Note: Descriptions are shown in the official language in which they were submitted.
~ CA 022~3300 1998-10-29
r~ ! -- rA_~ ~ r~ r~ ! t~-''~'D
.~ . .'.t.~L~I'Li' N
Bioloqical Material, Free from Viral and
Molecular Pathoqens, and Preparation Method
The invention relates to a biological material that
is free from certain pathogens, in particular free from
viral pathogens, as well as to a method of depleting
viral and molecular pathogens in a biological material.
The production of therapeutical proteins and
preparations by extraction from human or animal tissues
or liquids, such as blood or plasma, as well as from
continuously growing transformed mammalian cells
frequently harbors the risk of a potential
contamination by pathogens, such as viruses, virus-like
particles or prions. Therefore, measures must be taken
that such possibly present pathogens are not
transmitted to man.
Human blood or plasma, respectively, may, e.g.,
contain viruses which cause diseases such as AIDS,
hepatitis B or hepatitis C. In case of plasma proteins
derived from plasma pools the risk of transmitting
infectious agents, such as virl1ses, is very low due to
the selection of blood or plasma donations and on the
preparation method. Suitable measures, such as
excluding blood donors who have an increased risk from
donating blood, as well as analyses of blood or plasma
donations which allow for detecting infectious
donations and for excluding them from further
CA 022~3300 1998-10-29
distribution, allow for the elimination of most of the
infectious donations, yet in most cases they do not
detect each and every one. Existing assaying systems
for the detection of infectious viruses in biological
materials do not always completely eliminate concerns
regarding a potential transmission of pathogens, since
with the broad range of infectious pathogens existing
it is impossible to assay the starting material for all
viruses or molecular pathogens which may be present in
a sample. Moreover, most assays do not detect the
virus, but antibodies developed against the virus, so
that during the period of time of the so-called
"diagnostic window", detection of a contamination
cannot take place. Besides, for some groups of viruses,
a reliable or sufficiently sensitive detection method
does not exist. Although newly developed assaying
methods, in particular nucleic acid amplification
methods, such as, e.g., PCR, are very sensitive and
specific, they are applicable only to pathogens whose
nucleic acid sequence is known. In those cases in which
the human pathogens are known, yet a sensitive
detection method does not exist, there still remains
the insecurity that a negative result is only obtained
because the virus content is too low, i.e. a virus
content lying below the sensitivity limit of the
assaying system.
Therefore, specific removal and/or inactivation
CA 022~3300 1998-10-29
methods for the depletion of viruses have been
developed for the preparation of pharmaceutical and
therapeutic products so that no infectious particles
are to be expected in the final product anymore.
Various inactivation methods are based on a
physico-chemical treatment by heat and/or chemicals. As
methods, particularly thermal treatment, pasteurizing,
treatment of the protein solution with ~-propiolactone
and W light, treatment with a combination of a solvent
and a detergent (so-called S/D methods) or exposure of
the protein solution upon addition of a photodynamic
substance are being used. With these methods, a virus
inactivation of up to 106 log steps has been achieved.
The efficiency of the inactivation method may, however,
vary with the type of virus. Although S/D-treated blood
products are considered safe relative to the
transmission of HCV, HBV or HIV, non-enveloped viruses,
such as HAV or parvovirus, are not inactivated by this
method (Prowse C. 1994. Vox Sang. 67:191-196).
The type of inactivation method may also have an
influence on the product, and thus a stabilisation has
often been necessary to minimize the protein loss.
Moreover, some inactivation methods must be followed by
purification steps so as to remove admixed chemicals.
Methods of depleting viruses comprise in particular
chromatographic methods, filtration of protein
solutions over a membrane filter or adsorption of
CA 022~3300 1998-10-29
viruses to a solid phase and subsequent removal of the
solid phase, as has been described in EP- 0 679 405.
However, it has been found that although the treatment
with a solid phase, such as, e.g. with Aerosil~, allows
for a removal of HIV of up to 4 log steps from an
immunoglobulin-containing solution, the loss of IgG may
amount up to 42~ (Gao et al., 1993, Vox Sang. 64:204-
209). At such high loss rates, such a method thus is
rather unsuitable for an application on a large
technical scale.
With ultrafiltration, virus depletion takes place
on account of an effect based on the size differences
of virus particles. Bechtel et al. (1988, Biomat., Art.
Cells, Art. Org. 16:123-128) showed that for viruses of
different sizes (EMC: 30-50 nm, Sindbis virus: 50-70
nm, and VSV: 80-100 nm) in all cases a virus depletion
of from 3.3 to 3.5 log steps is achieved and the
depletion by ultrafiltration thus is independent of the
virus size and is not sufficiently selective.
Conventional membrane filters have the disadvantage on
the basis of the exclusion size of approximately 0.1 ~m
to 0.2 ~m that most viruses can pass the filter freely.
The development of nanofilters having different nominal
exclusion sizes of from 15 to 75 nm or 70 to 160 kd
have made it possible to retain viruses up to a size of
28 nm (DiLeo et al. (1991). Nature 351:420-421, DiLeo
et al. (1992). Bio/Technology 10:182-188, Burnouf-
CA 022~3300 1998-10-29
Radosevich et al. (1994). Vox Sang. 67:132-138,
Hamamoto et al. (1989). Vox Sang 56:230-236).
The use of nanofilters for virus depletion allows
using a gentle method by which the final product is not
changed and by which also viruses of smaller size can
be removed from a biological material. Hoffer et al.
(1995, J. Chromatography B, 669:187-196) describe a
method of depleting viruses, based on the tangential
flow filtration for producing a factor IX-concentrate
by means of Viresolve~ membranes of an exclusion size
of 70 kD and they found a reduction factor of 3.5 log
steps for enveloped viruses and 7.2 log steps for non-
enveloped viruses. They note, however, that high-
molecular products are retained by these filters. Blood
factors of low molecular weight, such as factor IX or
factor XI, can freely pass nanofilters having an
exclusion size of between 15 and 35 nm (Burnouf-
Radosevich et al. (1994). Vox Sang. 67:132-138, Feldman
et al. (1995). Acta Haematol. 94:25-34). Products of
higher molecular weight, such as factor VIII (350 kD),
vWF (up to 2,000 kD) or immunoglobulins (IgG, 150 kD)
can only pass filters of larger exclusion size.
However, there is the risk that viruses of much smaller
diameters are not retained by the filter and get into
the filtrate. The application of nanofiltration for
producing virus-safe, therapeutically usable products
which are in particular free from small viruses, such
CA 022~3300 1998-10-29
as HAV or parvovirus, is thus restricted to products
containing proteins of small molecular size which can
also freely pass a nanofilter of small exclusion size.
Thus, only the use of nanofilters of a small exclusion
size of 15 nm ensures the depletion and removal of HAV
and parvovirus Bl9 from biological products. The
disadvantage is, however, that nanofiltration with
filters of this exclusion size is not applicable for
the production of products containing proteins of high
molecular weight, since the latter cannot pass the
filter and are retained just as the viruses are.
Another potential problem for nanofiltration is
that with various viruses the diameters described are
not always absolute. The generally indicated size for
HCV is 40-50 nm (Murphy et al. (1995). Archives of
Virology 10:424). Muchmore et al. ((1993).
International Symposium on Viral Hepatitis and Liver
Disease. Tokyo) found, however, that a HCV-containing
solution, filtered over a 35 nm nanofilter, leads to a
HCV infection in chimpanzees. The possible variability
of size of various viruses thus restricts the use of
nanofiltration for virus depletion and for the
preparation of a virus-safe product or harbours a risk
factor, respectively.
Thus, there exists a demand for industrially
applicable methods for the safe separation of viruses
CA 022~3300 l998-l0-29
from protein solutions, so as to reduce the risk of
infection for patients who are treated with
pharmaceutical or therapeutical preparations of animal
or human origin or with preparations produced by a
genetical engineering method from cell cultures.
There also exists a demand for virus-safe
biological products which are free from pathogens, in
which it has already been ensured by the production
method that not any pathogen has been transmitted and
that the method is gentle enough to maintain the
biological acitivty of the products largely unaffected.
It is thus the object of the present invention to
provide a biological material which optionally contains
high-molecular pharmaceutically relevant proteins and
which is free from specific viral and molecular
pathogens, as well as a method of producing such a
biological material.
It is a further object to recover a biological
material which is safely virus-removed and free from
target viruses, a reduction factor of >107 being
attained - analogous to bacterial-proof filters.
According to the invention, this object is achieved
in that a biological material which is safely free from
specific pathogens is provided, which is obtained in
that at least one ligand or receptor contained in a
biological material reacts with a receptor or ligand of
a specific pathogen, whereby a ligand/receptor complex
CA 022~3300 1998-10-29
of the complexed pathogen forms. The ligand/receptor
complex subsequently is removed from the biological
material by a method which allows for the partial or
complete separation of the complexed pathogen.
The ligand or receptor which reacts with the
receptor or ligand of the pathogen may already be
present in the starting material. Preferably, the
biological material is, however, admixed with at least
one ligand or receptor which reacts with the receptor
or ligand of a specific pathogen. This makes it
possible to employ à well-targeted measure for an
optimal adjustment of the parameters, such as, e.g.,
the amount of ligands or receptors, the choice of the
ligand or receptor, or mixtures of various ligands or
receptors, or optionally also an addition of further
components which aid the formation of the complex.
Likewise, the time at which complexing is to take place
can be specifically determined. Thus, e.g., if several
operations or purification steps are effected prior to
the separation of the pathogen, the ligand or receptor
may be admixed just before the final step before the
separation, in particular before the penetration of the
biological material through a permeable filter. The
ligand or receptor thus preferably is admixed to the
biological material shortly before filtration.
The ligand or receptor admixed to the biological
material thus is a component capable of binding to a
CA 022~3300 1998-10-29
ligand or receptor and thus to a specific binding site
of the pathogen, which component is able to form a
complex with the pathogen, preferably a high-molecular
complex. In this ~ase, the ligand or receptor of the
pathogen may be an antigen, an epitope or an antigenic
determinant. According to the present invention, the
reactive ligand or receptor capable of binding which is
admixed to the biological material, preferably is a
specific antibody or a fragment of an antibody which is
still capable of binding to the ligand or receptor of
the pathogen.
Preferably, the biological material of the
invention is obtained in that an antibody is used as
the ligand or receptor which reacts with a ligand or
receptor of the pathogen, and that the ligand or
receptor of the pathogen is an antigen, whereby an
antibody/antigen complex forms as the ligand/receptor
complex. According to the present invention, the
complex subsequently is removed from the biological
material.
According to a particular aspect of the invention,
the biological material which is free from specific
pathogens is obtained in that the ligand/receptor
complex, preferably the antibody/antigen complex, is
separated from the biological material by penetration
of the solution through a permeable filter. Separation
of the complex from the solution may also be effected
CA 022~3300 1998-10-29
by sedimentation, preferably by density gradient
centrifugation.
According to the present invention, antibodies or
parts of an antibody which are still capable of binding
directed against at least one infectious agent are
admixed to the biological material which is suspected
of possibly containing an infectious pathogen. However,
also antibodies directed against several known
infectious viruses, such as, e.g., HAV, HBV, HCV, HDV,
HEV, HGV, HIV, CMV or parvovirus, or against molecular
pathogens, such as, e.g., prions, may be admixed. The
addition of the antibodies may be effected such that an
immunoglobulin-containing solution is added to a
protein-containing solution, the immunoglobulins
possibly also being added in excess (and thus in a
neutralising concentration) so that the risk of
potential pathogens still being present in the
biological material in free form can be excluded.
However, within the scope of the present invention it
has been found that also the addition of non-
neutralizing concentrations of antiserum allows for a
complete and full depletion of pathogens in a
biological material.
Thus, preferably, the ligand or receptor, in particular
an antibody, is admixed in a non-neutralizing
concentration, the concentration, however, being
sufficient to complex the pathogens present so that
- 10
CA 022~3300 1998-10-29
they can be removed completely from the biological
material by the separating step.
In some instances it may happen that aggregates of
various sizes may form, it also being possible that
small aggregates form which are still capable of freely
passing the filter or whose sedimentation density is
not sufficient to separate them from the biological
material.
According to a further aspect of the invention,
therefore, for improving the separation of the
ligand/receptor complex, the aggregation of the complex
is increased by adding further aggregating agents to
the biological material in addition to the
immunoglobulin-containing solutions, which further
aggregating agents either further agglutinate free
pathogens or increase the complexing of the
ligand/receptor complex. This may be effected by the
addition of agglutinins, such as lectins, one or more
complement-components, conglutinin, rheumatoid factor,
a non-toxic, water-soluble, synthetic polymer, in
particular polyethylene glycol, or albumin (at least
10~, preferably 20~) or other agglutinating agents
known from the pior art. The addition of the
aggregating agent is effected such that preferably
antigen/antibody complexes up to a size visible in the
light microscope form.
The biological material according to the invention
_
CA 022~3300 1998-10-29
is particularly characterised in that it is certainly
free from specific viral pathogens, both from the group
of lipid enveloped and of the non-enveloped viruses.
Among them are particularly viruses such as HAV, HBV,
HCV, HGV, HIV, HEV, HDV, CMV or parvovirus. Since the
specific antibody preferably used as the ligand or
receptor recognizes the corresponding antigens at the
surface of the respective virus and binds to the same,
each virus for which antibodies are available or
against which specific antibodies can be prepared or
are contained in an immunoglobulin solution or can be
isolated from the latter, can be complexed, and the
complex can be removed according to the invention from
the biological material. In this way it is possible to
complex known viruses and also viruses not as yet
identified, against which immunogobulin-containing
solutions are available, optionally to neutralize them
completely, and to separate the antibody/antigen
complex from the biological material and thus to
recover safely pathogen-free biological material.
Particular attention has been paid over the last
years also to the transmission of potentially
infectious molecular pathogens, such as, e.g., prions.
At present, only a few effective methods are available
for reducing the causative substances of Creutzfeldt-
Jakob Disease or BSE. Pocchiari et al. (1991, Horm.
Res. 35:161-166) have suggested a combination of
- 12 -
CA 022~3300 1998-10-29
ultrafiltration and 6 M urea for the depletion of so-
called "slow viruses". However, they do not give any
details as to by what extent the biological activity of
a thus-treated protein is adversely affected. By
treatment with high concentrations of the protein-
denaturing urea, it is, however, to be assumed that
proteins in a thus-treated solution are at least
partially denatured and thus inactivated.
According to a further aspect, the biological
material of the invention thus is also free from
molecular pathogens, in particular from prions, such as
the pathogens of BSE or Creutzfeldt-Jakob Disease. It
is possible to produce special antibodies against these
pathogens or to provide immunoglobulin-containing
solutions which particularly contain anti-~-amyloid
antibodies. By adding anti-~-amyloid-containing
immunoglobulin solutions to a biological material, thus
also potential molecular pathogens can be bound in a
complex, and the complex can be removed from the
biological material.
Since the separation of the ligand/receptor complex
and thus of the complexed pathogen is independent of
the physical-chemical properties of a virus, a virus-
safe, pathogen-free biological material is obtained
whose physical-chemical properties are not influenced
by the depletion method. It is known that in
conventional inactivation methods the addition of
CA 022~3300 1998-10-29
chemicals or the thermal treatment have an influence on
the products themselves, unless suitable measures, such
as, e.g., the addition of stabilizers, are taken. The
depletion of the pathogens by complexing with a ligand
or receptor and separation of the complex from a
biological material without physical-chemical treatment
thus offers the great advantage that the pathogens are
efficiently eliminated, while the product remains
unaffected in its native form. A thus obtained
biological material thus contains proteins whose
properties correspond to those of the native proteins
in the starting material prior to the depletion step
and whose activity remains unchanged. Furthermore, a
possible formation of denatured proteins which have to
be separated again from the protein solution in
additional complex purification steps, as is the case
with some virus inactivation methods, is also avoided.
Upon depletion of the pathogens from the biological
material, the pathogen-free material obtained may, of
course, be subjected to further purification steps so
as to remove accompanying proteins which may not be
desired in the final product. To this end, all the
methods known from the prior art, such as
chromatography, in particular ion exchange
chromatography or affinity chromatography, or gel
filtration may be carried out.
The separation of accompanying proteins form the
- 14 -
CA 022~3300 1998-10-29
biological material of the invention, such as the
separation of blood factors from a fraction destined
for the preparation of an immunoglobulin-containing
preparation, may also take place prior to virus
depletion. Preferably, however, depletion of the
pathogens from the biological material is effected
before the chromatographic separation of accompanying
proteins, since apart from the purification effect also
an additional depletion of the complexed pathogen as
well as of ligands or receptors originally admixed to
the biological material and possibly still present can
be attained by the chromatographic method.
The biological material obtained according to the
invention is particularly characterized in that it is
safely free from specific viral and molecular
pathogens, the pathogens having substantially
completely been removed from the biological material.
"Completely" in this connection means that by this
method a depletion of pathogens with a reduction factor
of at least 7 log steps is attained in the biological
material - analogous to bacteria-proof filters.
Preferably, the separation is effected with a capacity
~ of >7 log steps, preferably >9 log steps, and
particularly preferred >10 log steps. According to the
guidelines of the United States Pharmacopoeia (1995,
USP 23, NF 18: 1978-1980), the retention capacity of a
filter is described by the log reduction value (RF).
CA 022~3300 l998-l0-29
For instance, the retention capacity of an 0.2 ~m
sterile filter which can retain 107 microorganisms is
at least 7 log steps. In this case, this amount is seen
as the complete separation of the viruses by the
filter.
Since an antibody-containing hyper immunoglobulin
solution optionally is admixed in an excess to the
biological material so as to complex any free
infectious pathogens, the biological material of the
invention optionally also contains non-complexed
antibodies present in free form. Upon separation of the
antibody/antigen complex from the biological material
either by filtration or by sedimentation, the pathogen-
free biological material possibly also contains anti-
HAV, anti-HCV, anti-HBV or anti-parvovirus specific
antibodies.
Since by an excess of ligands or receptors which
are contained in the biological material or are admixed
thereto, respectively, and which bind to the pathogen
and complex therewith, free viruses are no longer
present in the biological material and the separation
of the complexed pathogen is effected either by
filtration or by sedimentation, neither pathogens
present in free form nor pathogens complexed with the
ligand/receptor get into the filtrate. The filtrate
thus obtained and containing biologically active
proteins thus, according to the present invention, is
- 16 -
CA 022~3300 1998-10-29
not only free from non-complexed and freely present
pathogens, but also free from pathogens present in a
complex with a ligand, such as an antibody.
A pathogen-free biological material obtainable
according to the present invention may be a plasma
fraction, an immunoglobulin-containing plasma fraction,
a plasma protein-containing fraction containing blood
factors, such as factor II, factor VII, factor VIII,
factor IX, factor X, factor XI, protein C, protein S,
vWF, a concentrate containing one of the blood factors
mentioned, a supernatant of a hybridoma cell line, a
cell culture supernatant from transformed or infected
mammalian cells or an extract from an animal or human
tissue.
According to a further aspect of the present
invention, there is provided a method of depleting
viral and molecular pathogens in a biological material
as well as a method of recovering biological material
which is safely free from viral and molecular
pathogens. The method is particularly characterized in
that at least one receptor or ligand contained in a
biological material (with a suspected presence of a
specific pathogen) reacts with a receptor or ligand of
a pathogen, whereby possibly a ligand/receptor complex
of a complexed pathogen forms. Preferably, a ligand or
receptor which reacts with the receptor or ligand of
the pathogen is admixed to the biological material. The
- 17 -
CA 022~3300 1998-10-29
ligand/receptor complex possibly formed subsequently is
removed from the biological material by a method which
allows for the partial or complete separation of the
complexed pathogen. By complexing a free pathogen with
a ligand in a complex, a complexed pathogen partical is
obtained which is enlarged, having a higher density or
a higher sedimentation coefficient than the free
pathogen.
Moreover, the complex has a higher aggregation than
the free pathogen, whereby, due to the increased
aggregation, the diameter of the complexed pathogen is
enlarged and its ability of passing through certain
membrane filters is changed.
The method of the invention for depleting pathogens and
recovering a pathogen-free biological material thus is
effected by complexing the pathogen with a
ligand/receptor so as to increase its density or
sedimentation properties as well as to enlarge its
diameter by increasing aggregation. Subsequently, the
complexed pathogen can be separated from the biological
material because its properties have thus been changed.
According to a preferred embodiment of the method,
separation of the ligand/receptor-pathogen-complex is
effected by penetration of a permeable filter, the
complex being selectively retained by the filter.
According to the invention, the exclusion size of the
- 18 -
CA 022~3300 1998-10-29
filter is chosen such that also high-molecular
proteins, such as, e.g., factor VIII, vWF or
immunoglobulins, can pass the filter freely, and also
if a highly concentrated protein solution is used,
clogging of the filter pores is not to be expected. The
exclusion size of the filter may, of course, not exceed
the highest-possible aggregation size of the
ligand/receptor complex, and, in particular, of the
antibody/antigen (pathogen) complex, since otherwise
also high-molecular, dense pathogen/antibody complexes
will pass the filter and thus get into the filtrate.
Thus, nanofilters are suitable for carrying out the
present invention. Particularly preferred are
nanofilters having a nominal exclusion size of between
35 and 100 nm. This exclusion size allows high-
molecular proteins to pass the filter freely; however,
they also retain free, non-complexed pathogens having a
diameter >100 nm as well as complexes of pathogens of
this size. Moreover, the use of filters of mean
exclusion size avoids possible clogging of the filters
by higher-molecular proteins and other components
possibly present in the biological material, by which
the flow-through capacities of the filters would be
lowered. Also when using the tagential flow filtration,
a slight pressure may possibly be required to pass the
liquid over the filter, whereby also the risk of the
filter being adversely affected by the applied pressure
- 19
, _
CA 022~3300 1998-10-29
and of cracks developing is reduced. Apart from a
depletion of pathogens that is efficient for the final
product and gentle, the use of nanofilters having an
exclusion size of 235 nm for carrying out the method of
the invention thus offers the advantage of lower costs
for the filters used than in case of nanofilters of
small exclusion size. This makes the method interesting
particularly for an application on a large technical
scale.
It is, however, also possible to use filters having
an exclusion size of >100 nm for carrying out the
method, wherein, however, it must previously be ensured
that very large pathogen-ligand complexes or
antibody/antigen aggregates, respectively, are formed
or that, optionally, additional agglutinating agents
are utilized so that the ligand/receptor complex will
be sufficiently large so that it cannot pass the filter
freely. There, the conditions may, of course, also be
chosen such that antigen/antibody aggregates up to a
visible size will form which may even be retained by
conventional sterile filters. In principle, the smaller
the exclusion size of a filter, the more expensive its
production.
Within the scope of the present invention it could
be demonstrated that also filters of a nominal
exclusion size of from 0.04 ~m up to 3 ~m allow for a
complete separation of pathogens complexed according to
- 20 -
CA 022~3300 1998-10-29
the present invention, from a biological material. Thus
it has been shown that according to the present
invention, ligand/receptor complexes are formed which
reach a size in the visible range (e.g. in the light
mlcroscope ) .
According to a further embodiment, separation of
the ligand/receptor complex is effected by
sedimentation. Preferred is the sedimentation by
density-gradient centrifugation.
According to the method of the invention, the
ligand or receptor admixed to the biological material
is a component capable of binding to the ligand or
receptor and thus to a specific binding site of the
pathogen, which component is capable of forming a
complex with the pathogen, preferably a high-molecular
complex. The ligand or receptor of the pathogen may be
an antigen, an epitope or an antigenic determinant. The
reactive ligand or receptor which is capable of binding
and which is admixed to the biological material and
reacts with the ligand or receptor of the pathogen
preferably is an antibody or a antibody fragment which
is capable of binding. The antibody may be an antibody
of any sub-class, the sub-classes IgG and IgM, however,
being particularly preferred. As ligands or receptors,
however, all known components are considered which are
capable of binding to a receptor or ligand of a
pathogen and of forming a high-molecular complex with
- 21 -
CA 022~3300 1998-10-29
that pathogen.
By adding a receptor or ligand capable of binding
to a pathogen possibly present in a biological
material, a high-molecular complex is obtained from
pathogen and ligand/receptor, exchibiting a higher
aggregation.
According to one aspect of the method of the
invention, an immunoglobulin-containing solution
containing specific antibodies directed against
infectious human pathogens is admixed to a biological
material, preferably to a protein-containing solution,
whereby an antibody/antigen complex will form between
the pathogens possibly present in the biological
material and the antibodies.
According to a further aspect of the method of the
invention, aggregation of the ligand/receptor-pathogen-
complex is still further increased, whereby complexes
of higher density and larger diameters are formed. This
is effected according to the invention by adding
further agglutinating agents, in particular lectines,
such as, e.g., concanavalin A, ricin or phasin, or one
or several complement-components, conglutinin,
rheumatoid factor, or a synthetic polymer, such as,
e.g., polyethylene glykol or albumin. The aggregating
agent may be admixed with the biological material
either simultaneously with the ligand or receptor that
reacts with the pathogen, or after a predetermined span
- 22 -
CA 022~3300 1998-10-29
of time after addition thereof. It is, however,
preferred that the agglutinating agent is admixed with
a temporal delay after the addition of the
immunoglobulin-solution. By this it is ensured that the
agglutinins or conglutinins do not react with the
antibodies and do not aggregate or complex the latter,
but aggregate merely already formed pathogen/antibody
complexes to higher-molecular complexes. By this it is
also ensured that a higher complex density will be
attained by the further aggregation, whereby the
complex can be removed more efficiently from the
biological material. By the higher complexing of the
antigen/antibody-aggregates it is possible to use
membrane filters, even filters having a higher
exclusion size of preferably 235 nm, in the separating
procedure. On account of the higher density of the
aggregated particles, also an improved separation by
sedimentation is feasible, since all the complexed
pathogens can be encompassed.
By adding immunoglobulin-containing solutions or
ligands or receptors specifically reacting with the
pathogens it is also possible to deplete both viral and
molecular pathogens in a biological material,
irrespective of their physical-chemical properties.
This particularly applies to viruses or molecular
pathogens which so far could not be depleted or
inactivated by conventional methods. Thus, also small,
CA 022~3300 1998-10-29
non-lipid-enveloped viruses, such as parvovirus or HAV,
are encompassed by the method according to the
invention, which viruses so far could not be
efficiently removed or inactivated, neither by
physical-chemical inactivation methods, such as S/D
treatment, nor by nanofiltration, from highly
concentrated protein solutions or from solutions
containing high-molecular proteins (>150 kD).
Therefore, this method is applicable for the depletion
of all viral and molecular pathogens by which a
biological material can be contaminated, in particular
for the depletion of lipid-enveloped or non-lipid-
enveloped viruses, such as HAV, HBV, HCV, HIV, HEV,
HDV, HGV, CMV or parvorirus, but also for prions. The
method according to the invention is particularly
suited for the depletion of pathogens in a biological
material and for the recovery of biological material
which contains high-molecular proteins, e.g.
immunoglobulins or vWF.
Within the scope of the present invention thus also
a pathogen-free, virus-safe plasma protein-containing
composition is provided, in which the plasma proteins
comprise at least 80~ of the activity of the starting
material, the composition being obtained by the method
according to the invention.
According to a special aspect of the invention, an
antibody, obtained from a hyperimmunoglobulin solution
- 24 -
CA 022~3300 1998-10-29
or from a supernatant of a hybridoma cell line, is used
as a ligand when carrying out the method according to
the invention. The immunoglobulin-containing solution
may be obtained from plasma donations comprising a high
titer of antibodies directed against a specific
pathogen. These are particularly immunoglobulin
solutions from donors containing anti-HCV, anti-HAV,
anti-HBV, anti-HIV, anti-HEV, anti-HDV, anti-HGV, anti-
CMV or anti-parvovirus antibodies. The antibody-
containing solution may also be prepared by
biotechnological methods, such as the hybridoma
technique. In doing so, monoclonal antibodies directed
against an antigen of a particular pathogen are
secreted by a hybridoma cell line into the supernatant
of the culture medium from which the antibodies can
then be isolated in a high-titer solution.
Immunoglobulin-containing solutions recovered from
plasma donations may possibly also contain free viruses
against which the antibodies contained in the solution
are directed, as well as other pathogens. This applies
equally to monoclonal antibodies prepared via the
hybridoma technique, for which a possible contamination
with viral pathogens cannot be excluded. According to a
particular embodiment of the method according to the
invention, the hyperimmunoglobulin solution used for
carrying out the method optionally is subjected to a
virus inactivation and/or virus depletion method.
- 25 -
CA 022~3300 1998-10-29
If the antibody is present at a low titer in the
immunoglobulin-containing solution, the antibody
optionally can be enriched and subsequently utilized in
a highly concentrated solution as ligand or receptor.
According to a particular aspect, an anti-~-amyloid
antibody is used as antibody for carrying out the
method according to the invention. Anti-~-amyloid
antibodies preferably recognize structures at the
surface of prions, are able to bind thereto and form a
prion/antibody complex. According to the present
invention, antibodies can specifically be prepared
against prions, in particular against the pathogens of
the Creutzfeldt-Jakob disease, or anti-~-amyloid-
containing immunoglobulin solutions can be provided and
admixed to a biological material which possibly
contains prions. By the attachment of anti-~-amyloid
antibodies to the prions, the low-molecular prions are
aggregated to a high-molecular complex which
subsequently can selectively be separated from the
biological material by filtration or sedimentation.
According to a further particular aspect of the
invention, antibodies directed against HAV, HBV, HCV,
HIV, HGV, HEV or parvovirus are utilized as ligands or
receptors. To carry out the method, an immunoglobulin-
containing solution containing antibodies directed
against a specific virus can be added to the biological
material. Yet, it is also possible to admix a mixture
- 26 -
CA 022~3300 1998-10-29
of antibodies or other ligands which are directed
against different pathogens with which the biological
material may possibly be contaminated. Upon addition of
at least one immunoglobulin-containing solution
directed against a specific pathogen, or of a mixture
of antibody-containing solutions directed against
various pathogens, the mixture of biological material
and immunoglobulin solution is incubated for a period
of time which allows complex formation between the
antigen of the pathogen and the antibody, and the
complex formed subsequently is separated from the
biological material as described above.
The method according to the invention can be used
for depleting viral and/or molecular pathogens in a
biological material. The biological material may be a
plasma fraction, an immunoglobulin-containing plasma
fraction, a plasma protein-containing fraction
containing blood factors, such as, e.g., factor II,
factor VII, factor VIII, factor IX, factor X, factor
XI, protein C, protein S, vWF, a concentrate containing
one of the said blood factors, a supernatant of a
hybridoma cell line, a cell culture supernatant from
transformed or infected mammalian cells, or an extract
of an animal or human tissue. The parameters for
carrying out the method are each adapted to the type
and nature of the biological material and of the
contaminating pathogens possibly present. Thus, the
CA 022~3300 1998-10-29
formation of the ligand/receptor complex for
aggregating the pathogen is carried out under
conditions which allow for optimal complexing, in
particular for the binding between receptor and ligand
or between antibody and antigen of the pathogen,
respectively. The optimal parameters, such as pH,
temperature, duration of invubation for carrying out
the method according to the invention, depending on the
type of pathogen, the specificity of the ligand or
receptor (antibody) admixed, and on the nature of the
biological material (purity of the solution, protein
concentration in the solution) can be determined by any
skilled artisan on the basis of his/her general
knowledge. If the ligand/receptor complex is removed
from the biological material by a filtration step, a
filter will be used which has an exclusion size which
allows for the biological material to freely pass the
permeable filter and for the ligand/receptor complex to
be selectively retained by the filter.
To ensure that any free pathogens present in the
biological material have been complexed by antibodies,
both the filtrate and the concentrate will be assayed
for the presence of viruses or for an excess of
specific antibodies. The depletion rate of the
pathogens from the biological material may be
determined by virus titer determination methods or via
the determination of the gene copy number or genomic
CA 022~3300 1998-10-29
equivalents, respectively, of specific viruses, e.g. by
quantitative PCR, as described by Dorner et al. (1994.
25. Hamophilie-Symposion, Ed. Scharrer & Schramm, pp.
29-44), in the filtrate and in the concentrate.
According to a further aspect of the present
invention, the biological material obtained by the
method according to the invention is assayed for the
presence (of an excess) of the ligand/receptor used, in
particular of a specific antibody. Since, when admixing
an excess of an antibody directed against a specific
pathogen, non-bound and non-complexed antibodies have a
density and a molecular size which is below that of the
complexed antibody, the presence of free antibodies in
the biological material is also a criterion that the
concentration of antibodies in the solution has been
sufficient for complexing the free pathogen. The
presence of an excess of utilized ligands or receptors
is determined in that a known amount of a viral or
molecular pathogen which has specific ligands or
receptors for the antibody is admixed to a sample of
the biological material prior to and following the
pathogen depletion, the thus recovered biological
material containing the antibody/pathogen complex is
again filtered over a permeable filter, and the
residual amount of pathogen present in the filtrate is
determined. In this way it can be determined whether or
not the immunoglobulin solution used for the depletion
- 29 -
CA 022~3300 1998-10-29
has an antibody content sufficient for complexing the
pathogens, and whether or not non-complexed antibodies
are present in the filtrate and, thus, in the final
product.
The method of the invention for depleting viral and
molecular pathogens and for recovering pathogen-free
biological material can be combined with any known
virus inactivation method, such as, e.g. heat
treatment, pasteurizing or the S/D method. Preferably,
the inactivation methods are applied before carrying
out the method according to the invention, since in
this manner viruses not encompassed by the inactivation
method can be depleted by the method according to the
invention.
According to a further aspect, the invention
provides a virus-inactivated immunoglobulin solution
containing specific antibodies against viral or
molecular pathogens as a ligand for complexing viral or
molecular pathogens in the method according to the
invention.
The method according to the invention for depleting
viral and/or molecular pathogens may, in particular, be
used for recovering and preparing a biological material
which is free from specific pathogens present both in
free, non-complexed form and in bound, complexed and
aggregated form.
The invention will now be explained in more detail
- 30 -
CA 022~3300 l998-l0-29
by way of the following Examples to which, however, it
is not restricted.
Example 1: (At Present Considered by Applicant to
be the Best Mode of Carrying out the
Invention)
Depletion of HAV by HAV-Specific Antibodies and
Sub~equent Nanofiltration
98 ml of a 2~ human serum albumin solution which
was free from antibodies, and a 2~ human immunoglobulin
solution containing Hepatitis A virus (HAV)-specific
antibodies were spiked with high-titer HAV. The virus
titer was determined from aliquots of both solutions.
The solutions were then subjected to a 4-hour
tangential flow filtration with an initial pressure of
0.8 bar. An 0.001 m2/35 nm filter (Planova 35N, Asahi)
was used. HAV titration was effected as in Barrett et
al. (J. Med. Virol. (1996), Vol. 49: 1-6).
Upon serial ~ log dilution in cell culture medium,
the virus titer was determined. 100 ~l of each serial
dilution were each put into 8 wells of a microtiter
plate containing 1 x 104 FRhK-4 cells per well.
Subsequently the plates were incubated for 14 days at
37~C. After seven days, the medium was changed. After
this incubation period, the cytopathic effect (cpe) was
microscopically determined. The TCIDso was determined
on the basis of the number of wells of the microtiter
plate which exhibited a positive CPE. The efficiency of
CA 022~3300 1998-10-29
the process of virus depletion was expressed as
reduction factor (R.F.) which was calculated according
to the formula recommended by the E.C. Committee for
Proproetary Medicine (Commission of the European
Communities (1991): Ad hoc Working Party on
Biotechnology / Pharmacology - Note for Guidance
(Validation of Virus Removal and Inactivation
Procedures) III/8115/89-EN):
Sample volume before treatment x
virus titer before treatment
R.F. =
Sample volume after treatment x
virus titer after treatment
As had to be expected on the basis of the virus ize
(diameter, 25-30 nm), in the absence of a HAV-specific
antibody HAV was not retained by filtration over the 35
nm membrane. However, from the sample which contained
immunoglobulin with HAV-specific antibodies, a complete
virus removal could be achieved by filtration through
the 35 nm membrane (R.F.> 5.2), with no virus being
detectable in the filtrate, and the virus was retained
up to 100~ in the concentrate (Table 1).
- 32 -
CA 022~3300 1998-10-29
Table 1: Influence of Specific Antibodies on the
Depletion of Hepatitis A Virus by 35 nm
Nanofiltration
Human Immunoglobulin
Serum Albumin
Virus-stock titer 107-9 107-9
Virus titer in Product 1o6.3 105.3
Virus titer in concentrate 105-7 105-9
Virus titer in filtrat 105.7 c10~
Reduction factor 0.6 ~5.2
Example 2:
Depletion of Parvoviruses by Anti-Parvovirus-
Specific Antibodies and Subsequent Nanofiltration
It was tested whether or not a rabbit antiserum
against the parvovirus "minute mouse virus" (MMV, ATCC
VR1346) is capable of retaining the virus at filtration
over a 35 nm membrane, by forming a complex with this
vlrus .
The rabbit antiserum was obtained by immunising the
animals with concentrated, formalin-inactivated MMV
preparations and complete Freund adjuvant and a
subsequent booster with incomplete Freund adjuvant
carried out 4 weeks after primary immunisation. Blood
was obtained for the preparation of the serum 4 weeks
after the secondary immunisation.
CA 022~3300 1998-10-29
98 ml of a 2~ human immunoglobulin solution were
spiked with 2 ml of an MMV suspension. Upon addition of
0, 0.005, 0.05, 0.5, 5.0 ml of the anti-MMV serum, each
mixture was subjected to filtration under conditions as
described in Example 1.
Samples of virus-spiked starting material,
concentrate (diluted to original volume) and filtrate
were titrated according to the standard TCIDso test, as
described in Example 1, except that A9 cells (ATCC
CRL6319) were used for virus propagation and an
incubation period of 7 days was chosen.
As was to be expected on account of the virus size
(diameter 18-24 nm), MMV without addition of antiserum
was not retained by the 35 nm filter membrane, but was
found again at 100~ in the filtrate (R.F., -0.1). Upon
addition of 5 ml of MMV-specific antiserum, the virus
infectiousness could be completely neutralized so that
the virus could be detected neither in the filtrate nor
in the concentrate. Yet, also upon addition of non-
neutralizing concentrations of the antiserum (0.5 ml),
a complete removal of the virus could be attained by
filtration (R.F. >6.9), no virus being detectable in
the filtrate. Still lower concentrations of the MMV-
specific antiserum (0.05 ml) likewise caused MMV to be
largely removed by filtration (R.F., 4.4) (Table 2).
CA 022~3300 1998-10-29
Table 2: Influence of Specific Antibodies on the
Depletion of Parvovirus by 35 nm
Nanofiltration
IqG 98 ml98 ml 98 ml 98 ml 98 ml
MMV 2 ml 2 ml 2 ml 2 ml 2 ml
Anti-MMV serum
from rabbit 0 ml0.005ml 0.05ml 0.5ml 5 ml
Virus stock titer 108-2 107-6 107.6 1o8.1 107.5
Virus titer
in product 106-~ 105-9 105.3 107-~ 105.5
Virus titer
in concentrate 106-4 105.8 104.6103-8 <lOo-
Virus titer
in filtrate 106-1 104.6 10~ 9 c10~ 1 c10~
Reduction factor -0.1 1.3 4.4>6.9 ~5.4
Example 3:
Depletion of HCV by Anti-HCV-Antibodies and
Subsequent Nanofiltration
The possibility to prevent virus passage of
hepatitis C virus (HCV) through a 35 nm filter membrane
by adding a HCV-specific antibody to the virus
suspension was tested. A plasma free from anti-HCV
antibody which was highly contaminated with HCV was
used as the starting material for the high-titer virus
stock. About 250 ml plasma were clarified in a Beckmann
- 35 -
CA 022~3300 1998-10-29
centrifuge (Rotor JA10) for 20 min at 10,000 rpm. The
supernatant was subjected to 2.5 hours of ultra-
centrifugation at 55,000 rpm in a Ti 70 rotor. After
the pellet had been resuspended in PBS and pooled
(about 10 ml), the HCV genomic copy number was
determined in a quantitative PCR analysis, as described
by Dorner et al. ((1994), 25. Hamophilie-Symposium, Ed.
Scharrer & Schramm, pp. 29-44).
95 ml of a 2~ human immunoglobulin solution were
spiked with 2.5 ml of the concentrated virus stock.
5 ml of a 10~ human immunoglobulin solution containing
antibodies against HCV, yet no HCV genome equivalents
(which had been ensured by quantitative PCR), or 5 ml
of PBS, as control, were admixed. Both samples were
subjected to a tangential flow filtration under
conditions as described in Example 1. In samples of the
HCV-spiked starting material, the filtrate and the
concentrate which was diluted to the original volume,
the HCV gene copy number was determined, as described
above. It could be demonstrated that upon addition of
anti-HCV-specific immunoglobulin, by filtration over a
35 nm membrane, complete removal of virus from the
filtrate was attained (R.F., >3.0), while in the
control mixture no substantial depletion of HCV could
be attained (R.F.: 1.4) (Table 3).
- 36 -
.
CA 022~3300 1998-10-29
Table 3: Influence of a Specific Antibody on the
Depletion of Hepatitis C Virus by 35 nm
Nanofiltration
IgG 95 ml 95 ml
HCV 2.5 ml 2.5 ml
Anti-HCV IqG O 5 ml
Virus stock titer
(qenomic copies/ml) 107 107
Virus titer in product
(qenomic coPies/ml) 105.7 105.7
Virus titer in concentrate
(qenomic copies/ml) 105.3 105.7
Virus titer in filtrate
(genomic copies/ml) 104.3 <1o2.7
Reduction factor 1.4 >3.0
Example 4:
Depletion of HAV by Immunoglobulin Solutions Having
Different Anti-HAV-Antibody Titers
A series of different immunoglobulin-containing
solutions (lots) having HAV antibody titers of from 1.5
units/ml to 11 units/ml, and, as control, a HSA
solution containing no HAV-specific antibodies, were
spiked with high-titer HAV. Subsequently, the solutions
were subjected to a tangential flow filtration, as
described in Example 1, at a total volume of 250 ml,
CA 022~3300 1998-10-29
and the virus titers of concentrate and filtrate were
determined. The results of the HAV depletion are
illustrated in Table 4.
Table 4: Depletion of Hepatitis-A Virus (HAV) by
35 N-Nanofiltration
Lot P061960A1 P061960Al P065960A1 Human Serum
Albumin
HAV-specific 1.5 1.5 11 negative
antibody titer
(U/ml)
Virus titer Virus titer Virus titer Virus titer
(TCID50/ml ) (TCID50/ml ) (TCIDSO/ml ) (TCID50/ml )
Virus-Stock lo8.3 107.6 107.6 1o8.0
(VS)
Virus-Stock lo5.8 1o6.1 1o6.4 1o6.7
diluted 1:40
in product
Concentrate 105.6 1o6.0 1o6.3 105.7
Filtrate ~10~'1 ~loO-l C100-1 105.4
Reduction ~5.7 76.0 76.3 1.3
factor*
* The reduction factor was determined according to the
CPMP guidelines (CPMP/BWP/268/95).
- 38 -
CA 022~3300 1998-10-29
Also in immunoglobulin solutions of lower HAV
antibody titers a reduction factor of >6 log steps is
possible. With a solution that has an approximately 10-
fold higher antibody titer, no improvement of the virus
depletion can be attained. Hence follows that
irrespective of the specific antibody titer, at least
within the tested range a reproducible depletion of HAV
is possible.
Example 5:
Virus Depletion Capacity of a HAV-Antibody-
Cont~; n; n~ Solution
To test the depletion capacity of the antibody-
containing solution, the filtrate obtained according to
Example 4 was re-spiked with HAV, and the virus
depletion capacity of the anbitody still present in the
filtrate or the reduction factor, respectively, was
determined.
In Table 5, the results of the HAV depletion in a
re-spiked filtrate from low- and high-titer
immunoglobulin solutions are summarized.
- 39 -
CA 022~3300 l998-l0-29
Table 5: Depletion of Hepatitis-A Virus (HAV) by
35 N-Nanofiltration after Re-Spiking with HAV
Lot P061960Al P061960Al P065960Al
HAV-specific 1.5 1.5 11
antibody titer (U/ml)
Virus titer Virus titer Virus titer
(TCID50/ml) (TCID50/ml) (TCID50/ml)
Virus-Stock (VS) lo8.0 107.6 107.6
VS diluted 1:40 105.2 105.4 105.4
in combined filtrate
Concentrate 105.6 105.6 105-~
Filtrate ~ 10~-1 ~10~-1 ~ 10~-
Reduction factor* ~ 5.1 > 5.3 >5.3
* The reduction factor was determined according to the
CPMP guidelines (CPMP/BWP/268/95).
It is shown that also in an immunoglobulin-
containing starting material of low antibody titer (1.5
U/ml) sufficient antibody is still present to enable
once more a depletion of more than 5 log steps.
Compared thereto, the virus depletion capacity of a
high-titer antibody solution is only slightly
increased.
Summing up the depletion rates from the 1st and 2nd
virus spiking, a virus depletion with a total reduction
factor of at least 11 log steps can be attained.
Example 6:
Depletion of Parvovirus by Means of Anti-
ParvoviruR-Antibody-Containing Immunoglobulin Solution
- 40 -
CA 022~3300 1998-10-29
A series of immunoglobulin preparations (lots) was
tested for parvovirus-B19-specific antibodies. In the
different lots, an antibody titer of from 1:400 to
1:800 was found by means of ELISA.
Two different lots having a slight B19-specific
antibody titer of 1:400 were spiked with a high-titer
virus stock of parvovirus B19, and the titers of both
solutions were determined by means of quantitative PCR.
The determination by means of quantitative PCR was
effected according to the method described in EP-0 714
988 by means of the parvovirus-specific primer pair:
Parvo + 1353/FAM: 5' GGGGCAGCATGTGTTAAAGTGG 3'
bp 1353-1374*
Parvo - 1529 : 5' CCTGCTACATCATTAAATGGAAAG 3'
bp 1529-1506*
* Numbering according to the master sequence PARPVBAU
(EMBL data bank)
Plasmid pParvo-wt, containing the parvovirus-
specific sequences of nt 1127-1550 (according to the
numbering of Shade et al. (1986), J. Virol. 58:921) was
used as verifier. Plasmid pParvo-15 and plasmid
pParvo+21 were used as internal standards. pParvo-15
was produced by deletion of a 35 bp fragment between nt
1455-1489 and insertion of a ds oligonucleotide
generated from the primers 5' GTT CCA GTA TAT GGC ATG
GTT 3' and 5' ACC CAT GCC ATA TAC TGG AAC 3'. pParvo+21
was obtained by duplication of the bp 1468-1487 between
- 41 -
.
CA 022~3300 1998-10-29
nt 1453 and 1454. After amplification with the
parvovirus-specific primers, the PCR products had a
respective length of 177 bp (wt), 162 bp (-15) or 198
bp (+21).
Each one of the mixtures was subjected to
filtration under conditions as described in Example 1.
In samples of the virus-spiked starting material, the
concentrate (diluted to the original volume), and the
filtrate, the titers were determined by means of a
quantitative nucleic acid amplification method (PCR).
The results of the titer determinations are summarized
in Table 6. An excellent depletion of about 6 log steps
was attained.
Table 6: Depletion of B19 Parvovirus by 35 N-
Nanofiltration
LotP061960Al P065960Al
Bl9-specific 1:400 1:400
titer (genomic copies/ml) titer (genomic copies/ml)
Virus-Stock (VS) loll.6 loll.0
VS diluted lo8.8 1o8.6
1:40 in product
Concentrate lo8.9 1o8.5
Filtrate ~ 10 ~ 10
Reduction factor* ~6.1 ~5.9
* The reduction factor was determined according to the
CPMP guidelines (CPMP/BWP/268/95).
- 42 -
,, .
CA 022~3300 1998-10-29
Example 7:
Virus Depletion Capacity of the Anti-Parvovirus
B19-Antibody-Containing Solution
To test the depletion capacity of the antibody-
containing solution, the filtrate obtained according to
Example 6 was re-spiked with parvovirus, and the virus
depletion capacity of the antibodies still present in
the filtrate or the reduction factor, respectively, was
determined.
In Table 7, the results of the parvovirus depletion
in a re-spiked filtrate from an immunoglobulin-
containing solution having a 1:400 antibody titer are
summar1zed.
- 43 -
CA 022~3300 l998-l0-29
Table 7: Depletion of Bl9-Parvovirus by 35 N Nano-
filtration and Re-Spiking with Parvovirus
Lot P061960Al P065960Al
Bl9-specific 1:400 1:400
antibOdy titer (u/ml) titer (genomic copies/ml) titer (genomic copies/ml)
VS diluted 1:40 1o8.2 10
in combined product
Concentrate lolo lolO.l
Filtrate 103.2 10
Reduction factor 5.0 5.0
* The reduction factor was determined according to the
CPMP guidelines (CPMP/BWP/268/95).
It has been shown that in the filtrate sufficient
antibodies were still present to attain a further
depletion by 5 log steps. Summing up the depletion rate
and the reduction factor after the 1st and 2nd spiking,
a reduction factor of at least 11 log steps is attained
by the method according to the invention, which
corresponds to a complete removal of pathogens from the
biological material.
Hence follows that the system is suitable for
industrial application and ensures that protein-
containing solutions free from infectious pathogens can
- 44 -
CA 022~3300 1998-10-29
be obtained.
Example 8:
Depletion of Parvovirus with Filters of Different
Exclusion Sizes
In Example 1 it could be demonstrated that already
by adding a non-neutralizing concentration of antiserum
and subsequent nanofiltration over a 35 nm membrane, a
complete removal of pathogens is achieved. To test
whether filters having a higher exclusion size are also
suitable for the depletion of antigen-antibody
complexes, a series of deep bed filters having a
nominal exclusion size of between 0.04 ~m and 3 ~m were
tested for their ability of retaining parvovirus MMV,
"minute mouse virus". 196 ml of a 2~ IgG solution were
spiked with 4 ml of a MM virus titer preparation and
subsequently admixed with 1 ml of rabbit-anti-MMV
serum. A spiked gammaglobulin solution without specific
anti-MMV serum was used as control. The mixtures were
filtered via different deep bed filters having nominal
exclusion sizes of 3 ~m, 0.5 ~m, 0.3 ~m and 0.04 ~m
with a flow rate of 50 ml/min until the end. The virus
titers were determined both in the starting material
and in the filtrate. The results are summarized in
Table 8.
Table 8: Depletion of Parvovirus MMV by Conventional Deep Bed Filtration of Gammaglobulin
Nominal Filter Exclusion Size
D
3,u 3J~ O . 5~J 0. 5JJ O . 3~0 . 3~0 . 04,UO . 04~1 ~
Rabbit anti-MMV - + - + - + - +
Serum
Virus Stock Titer lo8.7 1o8. 3 1o8 . 7 1o8 . o 1o8 . 3 1o8 . 7 1o8 . 3 1o8. 1
Virus titer in product 10 105~5 1o7.6 105~4 107~ 105~3 107~~ 5 2
Virus titer in filtrate 106' 3 C 10 ~ 105 . 7 ~10~ ~ 1 105 . 3 10 ~ 103 . 7 10~ ~
Reduction factor 0.8 > 5.4 1.9 >5.3 1.7 ~5.2 3.3 ~5.1
CA 022~3300 1998-10-29
It was shown that with the method according to the
invention, even with filters having an exclusion size
of 3 ~m a depletion by more than 5 log steps is
possible, while without an addition of ligand which
complexes the pathogens only with a filter of about
0.4 ~m a significant reduction factor was attained.
Example 9:
Effect of Rheumatoid Factor on the Depletion of
Poliovirus
To enable assaying the influence of the addition of
agglutinins, which increase the size of the complex, on
the efficiency of depletion, rheumatoid factor was
admixed to the spiked immunoglobulin solution as
agglutinin or conglutinin. 85 ml of a 2~ immunoglobulin
solution were spiked with 5 ml of a high-titer
poliovirus type 1-containing preparation. 10 ml of a
preparation containing human rheumatoid factor with a
titer of 800 U/ml were added to the mixture. 10 ml of
buffer were added instead of the rheumatoid factor, as
control. Both mixtures were filtered over a 35 N
membrane, as described in Example 1, and the virus
titers of the concentrate and of the filtrate were
determined. The virus titer determination was effected
by a TCIDso determination on VERO cells.
The results of the determination as well as the
reduction factor found with and without the addition of
rheumatoid factor are illustrated in Table 9.
- 47 -
-
CA 022~3300 1998-10-29
Table 9: Effect of Rheumatoid Factor on the Depletion
of Poliovirus from an Immunoglobulin Solution
and Nanofiltration
IqG volume (ml) 85 85
Rheumatoid Factor (ml) - 10
Buffer (ml) 10
Poliovirus (ml) 5 5
Virus stock titer 1olO.l 1olO.4
Virus stock titer in product 108-3 1o8.2
Virus titer in concentrate 109-~ 109-3
Virus titer in filtrate 105.2 <10~.6
Reduction factor 3.1 >7.6
The results demonstrate that rheumatoid factor in
combination with the specific anti-poliovirus
antibodies complex the virus in a manner that it can be
effectively retained by nanofiltration over a 35 N
filter. If no further agglutinating agent (rheumatoid
factor) is admixed, a virus depletion with a reduction
factor of 3.1 log steps is attained, which can be
increased in the presence of the rheumatoid factor to a
reduction factor of >7.6. Thus, an effective and
substantially complete separation of small, non-
enveloped viruses from a protein solution has been
possible for the first time.
Example 10:
Effect of Agglutinins or Conglutinins, Respective-
- 48 -
CA 022~3300 1998-10-29
ly, on the Depletion of Poliovirus by mean~ of
Conventional Deep Bed Filtration
The ability of rheumatoid factor to influence the
depletion of high-titer poliovirus when using
conventional deep bed filters was determined. In doing
so, a filter type was used which had proven to be
ineffective in the depletion of poliovirus, even in the
presence of poliovirus-specific antibodies. For this,
85 ml of a 2~ gammaglobulin solution were spiked with 5
ml of a high-titer poliovirus stock solution, and 10 ml
of a solution of rheumatoid factor having a titer of
800 units/ml were admixed. As control, 10 ml of buffer
were admixed instead of rheumatoid factor. Both
mixtures were filtered through a Seitz BKS-P deep bed
filter at a flow rate of 50 ml/min. The virus titer of
the starting material was determined before and after
filtration. The results are summarized in Table 10. It
has been shown that merely by the addition of a further
aggregating agent, such as rheumatoid factor,
poliovirus could be efficiently depleted by using a
conventional deep bed filter. This method results in a
depletion with a reduction factor of >7.7 log steps,
while without the addition of rheumatoid factor, merely
a reduction of approximately 1.1 log steps was
achieved. This clearly demonstrates that by the method
of the invention, when admixing lectins or lectin-like
proteins, such as conglutinins, even when using
- 49 -
CA 022~3300 1998-10-29
conventional deep bed filters, a substantially complete
separation of the pathogens is achieved.
Table 10: Effect of Rheumatoid Factor on the Depletion
of Poliovirus from a Gammaglobulin Solution
by Conventional Deep Bed Filtration
IqG volume (ml) 8S 85
Rheumatoid Factor - 10
Buffer (ml) 10
Polio virus (ml) 5 5
Virus stock titer lolO.6 1olO.5
Virus titer in product lo8.0 1o8.3
Virus titer in filtrate lo6.9 <10~.6
Reduction factor 1.1 >7.7
Example 11:
Determination of the Activity of Factor VIII and
vWF Before and After Virus Depletion
The activity of two plasma factors was determined
before and after virus depletion with the method
according to the invention. For this, 100 ml of a
factor VIII/vWF-complex-containing solution were
filtered through a Cuomo ZA 90 deep bed filter with a
flow rate of 50 ml/min. In samples of the starting
material and of the filtrate, the factor VIII activity
and the vWF antigen content were determined, and a vWF
multimer analysis was carried out. In a parallel
- 50 -
CA 022~3300 l998-l0-29
experiment, the same material was spiked with mouse
minute virus (MMV), and specific anti-MMV-antiserum was
admixed prior to filtration. The virus titer was
determined before and after filtration in the starting
material and in the filtrate. The results are
summarized in Table 11 and demonstrate that under these
conditions a depletion by >6.5 log steps is achieved.
The factor VIII activity and the vWF antigen content,
respectively, remain substantially unaffected by the
method. Likewise it could be demonstrated that the vWF
multimer pattern remains substantially unchanged (data
not indicated).
Table 11: Determination of the Factor VIII and vWF
Activities before and after Filtration
FVIII-Activity vWF-Antigen log 10 MMV-Titer
(I.U./ml) ~(~g/ml) (TCID50/ml)
'Starti~g ma~rial 3.3 173.5 6.6
Filtrate 2.8 143.2< 0.1
Example 12:
Determination of the Activity of Blood Factors from
a Cryo-Supernatant after Filtration
A cryo-supernatant of human plasma was spiked with
a high-titer poliovirus preperation and subjected to
deep bed filtration with a flow rate of 50 ml/min. The
activities of factor VII, factor IX, antithrombin III
(ATIII) and C1-esterase inhibitor were determined
CA 022~3300 1998-10-29
before and after filtration. The results are summarized
in Table 12 and demonstrate that with the described
method a virus depletion of >7 log steps is achieved
and the activity of the blood factors is not adversely
affected.
Table 12: Determination of the Activities of
Factor VII, Factor IX, ATIII and C1-Esterase
Inhibitor, before and after Filtration
Activ-ty (IU/ml)
Virus titer
(TCID 0/ml) FVII FIX AT-III C1-Inhibitor
Before
Filtration 107.5 0.83 0.75 0.92 0.76
After
Filtration <10~-7 0.80 ,0.76 0.95 0.76
