Note: Descriptions are shown in the official language in which they were submitted.
CA 022~8011 1998-12-11
WO 97/48417 PCT/US97/11329
VACCINE TO PREVENI STREPTOCOCCAL
ENDOCA~DITIS
DESCRIPTION
BACKGROUND OF THE INVENTION
Field of the Invention
The invention is directed to vaccines and, more particularly, to a
vaccine for the prevention of endocarditis.
Background Description
Infective endocarditis is a serious endovascular infection causing
substantial morbidity and mortality despite medical and surgical advances
over the last several dec~des (11,18,38). In the United States, there are
30-40 cases per million a year (1,6,1 1). In Europe, the annual incidence of
disease ranges from 14-24 cases per million ( 19,25,41). Epidemiologic
surveys reveal that the incidence of endocarditis increases significantly with
age and that in developed countries with a growing population of elderly
people, endocarditis is a disease of increasing medical importance
(18,19,25,41) Native valve endocarditis occurs predominantly in patients
with predisposing heart lesions. High and moderate risk patients are those
with a history of infective endocarditis, prosthetic heart valves, surgical
systemic-pulmonary shunts, congenital cardiac malfunctions, rheumatic
valvular disease, mitral valve prolapse, and hyperthropic cardiomyopathy
(10). In patients with valve disease, daily low-grade bacteremia which
occurs during eating and tooth brushing affords the opportunity for
circulating bacteria to attach to the abnormal endocardium (21). Other
high-risk patient populations include those without preexisting valve lesions
CA 022~8011 1998-12-ll
W O97/48417 PCT~US97/11329
who have a history of recent exposure to invasive dental, upper respiratory,
gastrointestinal, and genitourinary diagnostic and surgical procedures
(22,3 1,37).
Prevention of endocarditis is vital because the disease is always fatal
if untreated. Current practice in the United States, ~ritain, and Europe
favors the use of antibiotic prophylaxis for patient at high rislc of endocarditis
undergoing health care techniques that can cause bacteremia (8,11,36). The
most cornmon pathogens associated with native valve endocarditis are the
viridans streptococci which account for over 60% of cases (9). Antibiotic
prophylaxis is targeted at these org~ni~m~. However, because only about
half of the patients with endocarditis have recognizable predisposing cardiac
conditions and since endocarditis associated with health care procedures
constitutes a rninority of cases, only a small fraction of endocarditis cases
may be preventable with prophylaxis (11,19,21).
Other preventive strategies are warranted and are being explored
There have been several reports on the effect of vaccination on susceptibility
to experimental endocardi.is. Tmm~lm7ation with killed whole cells of
Streptococcus sanguis, Streptococcus mu~ans, Streptococcus pneumoniae,
Pseudomonas aeruginosa, nutritionally variant streptococci, and Candida
albicans was protective against the development of endocarditis or early
septicemia in rabbits (2,4,12,30,32,40). In contrast, anti-whole cell antibody
did not protect rabbits from Staphylococcus aureus endocarditis (17).
Tmmllni7~tion with staphylococcal capsular polysaccharide/adhesin (PS/A)
prevented Staphylococcus epidermidis endocarditis in rabbits (39) and
immnni7~tion with fibronectin binding protein from Staphylococcus aureus
was protective in rats (34).
Vaccination studies in endocarditis models have provided insights
about how immlmoprophylaxis confers protection. Specific antibody
conferred immllnity by increasing bacterial clearance and by inhibiting
bacterial att~chment is a crucial early step in the pathogenesis of this disease (2,30,33,34,39)
CA 022~8011 1998-12-11
WO 97/48417 PCTIUS97tll329
FimA is an important virulence determinant in S. parasanguis
endocarditis and is implicated in promoting bacterial adherence to fibrin in
vegetations (7).
SVMMARY OF THE INVENTION
It is an object of this invention to provide a means to prevent
infections of heart valves (endocarditis) by the most common bacterial cause,
viridans streptococci (e.g., oral streptococcal bacteria). This invention
contemplates a composition of matter which takes the form of a protein
found on the surface of many streptococcal species present in the human
mouth. This protein, in purified forrn, can be ~dminictered as a vaccine and
confers protection against endocarditis Although modeled around one
species of streptococci, Streptotoccus pu,asu,.~is the material, called
FirnA, is found on many streptococci and enterococci bacteria. Protection in
animals has been demonstrated using a rodent model system, which reliably
mimics human endocarditis.
The S. parasanguis FimA protein was over produced and purified
using the Qiagen pQE3 0 plasmid expression system. Purified FirnA was
used to investigate its usefulness as a vaccine in a rat model of endocarditis.
The vaccination regimen was as follows. Nine-week old male
Sprague-Dawley rats were given an initial dose of 100 ,~g of purified FirnA
emulsified in Freund's Complete Adjuvant. The antigen preparation was
given in an area of the animal's flank in six intradermal injections. The same
site was used for a booster dose of 100 ~Lg of protein in Incomplete Freund's
Adjuvant three weeks later. Two weeks after vaccination, trauma to the
heart valves was ind~lced by catheterization in vac~in~ted and control
animals. Twenty-four hours after catheterization, the animals were
challenged with S. parasanguis FW213. A 107 inoculum of ore~ni~mc
grown to an OD660 = 0.6 in BHI broth was injected intravenously via tail
vein. Forty-eight hours following inoculation, animals were euth~ni7ed and
CA 022~8011 1998-12-11
W O 97/48417 PCT~US97/11329
endocarditis was determined by the presence of bacteria in vegetations
following necropsy. Catheterized rats immllni7.ed with FimA were protected
against challenge with S. parasanguis FW2 13 when compared to
unimmllni7ed control animals (p<0.00l). These results demonstrate that
FirnA can serve as a vaccinogen to protect against endocarditis.
Experiments were also conducted which demonstrate that FimA from
5. parasanguis is protective against heterologous infectious challenge. Rats
were vacrin~ted with FimA of S. parasanguis origin as described above, and
then challenged with fimA-expressing streptoccoci inclu~ling S. mitis, S.
0 salivarius, and S. mutans. A significant decline in FimA-vaccinated rats was
observed.
The principal advantages of this invention are that it would be
reasonably inexpensive, safe, reliable, and effective protection against
endocarditis. In short, this invention includes a primary protective vaccine
against endocarditis, a method for preventing endocarditis, and forrnulations
useful in protecting against endocarditis and methods for producing the
vaccine formulations.
The vaccine of this invention may also be used to prevent
streptococcal bacterernia, a clinical condition seen increasingly in immuno-
compromised patients. In this use, the FimA would be provided to an
immuno-compromised patient (e.g., a bone marrow transplant patient) by
intr~ sc~ r injection or other route prior to high dose chemotherapy or
radiation therapy, and would elicit opsonic antibodies to invading
streptococci in the patient's blood stream, thus enhancing clearance ofthese
infectants.
BRIEF DESCRIPI ION OF THE DRAWINGS
The foregoing and other objects, aspects and advantages will be
better understood from the following detailed description of the preferred
embodirnents of the invention with reference to the drawings, in which:
CA 022~8011 1998-12-11
WO 97/48417 PCT/US97/11329
Figure I is a schematic diagram showing the cloning ofJ~mA into the
pQE30 expression vector. fimA DNA from pVT781 was amplified by PCR.
Primers were designed to modify the ends of thefimA DNA for subcloning
as an Sp~ HindlII fragment at the multicloning site of the pQE30 vector.
This expression vector contained a phage T5 promoter and two lac operator
sequences. The ~. coli host ceil has multiple copies of the plasmid pREP4
which carries the lacI gene ensuring tight regulation of protein expression.
The construct pVA2341 has the six histidine residue affinity tag 5' tofimA.
Fig~re 2 is a photograph of a protein analysis gel of purified
recomhin~nt FimA. Specifically, the photograph shows a Coomasie
blue-stained SDS-polyacrylamide gel. Lane 1 has a broad molecular weight
marker (Bio-Rad); Lane 2 has native FimA after metal chelate
chromatography (MCAC); Lane 3 has MCAC purified FimA after gel
filtration with FPLC.
Figure 3 is a graph showing the comparison of serum anti-FirnA titers
in imml~ni7~.d and non-immllni7ed rats. Rats were immllni7ed and boosted
once with FimA. Antibody levels were measured by EIA. Mean serum
anti-FimA titers standard deviation (SD) were plotted for each antibody
dilution tested. ~: Tmmllni7ed rats (n=6). ~: Non-imm~-ni7,ed rats (n-7).
Figures 4a-c are bar graphs showing the adherence properties of S.
pu~su~ is strains. Bacterial adherence to platelet-fibrin matrix and
adherence of S. pa~su/,~is FW2 13 incubated with adsorbed sera to
platelet-fibrin matrix were e~minçd. Bars show mean percent adherence to
platelet-fibrin matrices with standard deviations. Figure 4A shows the results
when S. parasanguis strains were incubated on platelet-fibrin coated
disposable Petri dishes (60 by 15 mm) for 30 min at 37~C. The adherence of
wild type FW213 was significantly different from the mean percent
adherence obtained withfimA mutant VT930 at a level of P<0.05. Figure
4B shows the results when S. parasanguis FW2 13 incubated in rabbit serum
adsorbed with S.parasanguis FW213 was exposed to a platelet-fibrin matrix.
The adherence of S. parasanguis FW213 preincubated with immlme sera was
CA 022~8011 1998-12-11
W O97/48417 PCTAUS97/11329
not significantly different from that found in preimmune sera (P=0.34).
Figure 4C shows the results when S. parasanguis FW213 incubated in rabbit
serum adsorbed with ~T930 was exposed to a platelet-fibrin matrix.
Incubation of S. parasanguis FW213 with anti-FimA sera adsorbed with
VT930 blocked adherence of S. parasanguis FW213 to the platelet-fibrin
matrix (0.34%) but no such blocking effect was observed by incubation with
adsorbed prPimm~lne sera (5.04%) (p~O.OOI).
Figure 5 are nucleotide sequences (SEQ. ID. Nos. 1-10) showing the
alignrnent of portions of the nucleotide sequences offimA (SEQ ID No. 1
and SEQ ID No. 6) and its homologs derived from the GCG program Pileup.
The primer pair in bold letters and identified with brackets 10 and 12
corresponds to nucleotides 151-173 and 868-893 offimA and represents
conserved regions in the lipoprotein receptor antigen (LraI) family. The
average size of the genes in this family is 930 bp in length. The primers are
S'GCTGGC~GATAAGATCGAGCTCCACAG 3' (SEQ ID No. 11), and
5' TTCATCATGCTGTAGTAGCTATCGCC 3' (SEQ ID NO. 12).
Figures 6a and 6b are photographs of gels showing the detection of
fimA homologs. Figure 6a shows a Southern blot of EcoR1-digested
genornic DNA from streptococcal strains usingfim,4 DNA as a probe.
Lanes: 1, fimA DNA;2,S. mutans ATCC 25175; 3, S. bovis ATCC43144,
4, S.oralis ATCC 10557; 5, S. salivarius ATCC 7073; 6, S. mitis ATCC
6249; 7, S. anginosus ATCC 27823; 8, E faecium ATCC 19434. Figure 6b
shows 0.8% gel electrophoresis of PC~ amplified genomic DNA from
various streptococcal strains. The primer pair corresponds to nucleotides of
fimA described in Figure 5. Lanes: 1, molecular size markers; 2, S.
parasanguis FW213; 3, S. mutans ATCC 25175; 4, S. bovis ATCC 43144;
5, S. oralis ATCC 10557; 6, S. salivarius ATCC 7073; 7, S. mitis ATCC
6249; 8, S. anginosus ATCC 27823; 9, E. faecium ATCCl9434. Sizes in
base pairs are given on the left of Figure 6b.
Figure 7 is a photograph of a gel showing the expression of
FimA-like proteins in clirlical isolates. Clinical isolates from bacteremic
CA 02258011 1998-12-11
W O 97/48417 PCT~US97/11329
patients were grown anaerobically in 50 ml of BHI broth for 48 hours at
37~C. Bacterial cells were disrupted using a MiniBeadTM beater. Protein
samples were separated by 10% TrisGlycine SDS PAGE and
electrotransferred to a nitrocellulose membrane and probed with polyclonal
anti-FirrLA. The bound antibodies were vis~l~li7ed by addition of anti-rabbit
IgG horseradish peroxidase conjugate, H2O2, and 4-chloronaphthol. Lanes:
1, broad molecular weight markers (BioRad); 2, S. mutans ATCC 25175
(this laboratory strain did not express FimA. Subsequent experiments
showed FimA to be expressed in multiple clinical isolates of S. mutans); 3, S.
pu,asu, ~lis FW2 l 3; 4, S. sanguis, V2426; 5, E. faecium V2424; 6, S.
saZivarius V247 I; 7, S. anginosus V2470; 8, E. faecalis V2437. The sizes
of protein markers are indicated on the left of the photograph in Figure 7.
The arrow corresponding to the 36 kDa size range indicates the reactive
proteins.
DETAILED DESCR~PTION OF THE PREFE:RRED
EMBODIMENTS OF THE INV~NTION
Present technology deals with endocarditis in one of two ways:
l. Patients at risk for endocarditis are given prophylactic
antibiotics prior to scheduled procedures that might result in
invasion of the bloodstream with oral streptococci (e.g.,
dental procedures).
2. Patients who contract endocarditis usually has sustained heart
valve damage. Depending on the nature of the damage, their
natural valves are surgically replaced with porcine or
2~ prosthetic valves
This invention provides a different approach and describes the first
and only primary protective vaccine against endocarditis.
Infective bacterial endocarditis cases in the United States alone
number between l 0 and 40 thousand per year. The majority of these
CA 022~8011 1998-12-ll
W O 97/48417 PCTrUS97/11329
infections are caused by viridans streptococci, including such species as S.
sanguis, S. parasanguis, S. mu~ans and others. Bacterial endocarditis is life
threatening and its treatment is expensive; 4 to 6 weeks of hospitalization are
required in order to complete effective intravenous antibiotic therapy
S protocols. Predisposing factors to streptococcal endocarditis include valve
damage, congenital heart defects, and rheumatic heart disease. Ninety
percent of all patients who contract infective endocarditis have one or more
predisposing factors. Based on identification of risk factors there would
likely be an annual steady state population of 75 to 100 thousand patients
who would require vaccination. This base would be significantly expanded if
the vaccine were ~mini~tered to the elderly population as well. There is
increasing concern among clinicians that infective endocarditis is appearing
more frequently in this patient population. Reasons for this include
calcification of heart valves and possible ~limini.~hed effectiveness of the
irnrnune system with age. There are approximately 31 rnillion individuals
over the age of 65 years in the United States population. Coverage of this
population with proven vaccines is actively increasin~ each year; e.g., flu
vaccination and pneumococcal vaccinations are widely recommended and
administered to this group. The segment of our population representing the
elderly is growing dramatically. The group comprising individuals over the
age of 65 years grew by 21% from 1980 to 1989. The rest ofthe population
grew by only 8% during the same period. Effective vaccines are likeiy to
enjoy broad usage in the elderly, a group which is growing strikingly as
medical advances lengthen life span.
Experiments have been conducted which demonstrate that FimA and
related proteins or protein fragments are useful vaccines against endocarditis.
In the experiments, the efficacy of FimA immllni~tion was evaluated in the
rat model of endocarditis, the effect of anti-FimA on the adherence of S.
parasanguis FW2 13 to platelet-fibrin matrix in vitro was investigated, the
presence offim,4 homologs among viridans streptococci was determined, and
the occurrence of FimA-like proteins among various streptococci and
CA 022~8011 1998-12-11
W O 97/48417 PCTAUS97/11329
enterococci was ~ss~ssed. The results showed that FimA immlmi7~tion
conferred antibody-mediated protection against S. parasanglis endocarditis
in rats. FimA from S. parasanguis was also demonstrated to confer
protection from endocarditis derived from other species inçl~lr}ing S. mitis, S.salivarius, and S. mutans. Southern hybridization, PCR amplification and
Western analyses indicated the occurrence of fimA homologs and the
expression of FimA-like proteins among viridans streptococci and
enterococci, and it is expected that theseJimA proteins, and fr~ments
thereof, can also provide protection against endocarditis.
In the practice of this invention, a patient would be provided with a
vaccine comprised of FimA, or fragments thereof, which is derived from
viridans streptococci and enterococci, to protect the patient from
endocarditis or bacteremia. The protein sequence for FimA, and its
corresponding DNA sequence are described in Fenno et al. Infec~. Immun.
57:3527-3553 (1989). The vaccine could be provided by parenteral (e.g.,
intravenous, intr~mllsc.llar, intradermal, subcutaneous), oral, sublingual,
transdermal and other routes of ~Amini.ctration well known in the art. The
preferred mode of delivery is parenteral. The FimA could be provided in
combination with carrier fluids (e.g., water based (saline, etc.) or oil based or
emulsions), stabilizing agents, preservatives (e.g., parabens, benzalkonium
chloride (BAK), etc.), and the like as appropriate to the delivery route. For
example, in an oral vaccine, the carrier may be a solid lactose based material.
The FimA protein of the vaccine should be provided in quantities
sufficient to confer protection by the patient's body raising antibodies to
FimA, and could be provided as a bolus dose with follow up boosters, or a
single bolus dose, or according to other dosing regimPns depending on the
patient and formulation of the vaccine.
~ The FimA protein or fragment thereof in the vaccine can be isolated
from a variety of streptococci or enteroccoci, or, as discussed in detail
below, be recombinantly produced in a bacterial, m~mm~ n or plant cell
host, or be m~nllf~c.tured by other means. In the methods below, it is shown
CA 022~8011 1998-12-ll
W O 97/48417 PCTrUS97/11329
that the gene for FimA can be isolated and transferred to a plasmid for
subsequent production in an E. coli host; however, it wlll be apparent to
those of skill in the art that the gene might be transferred and expressed in
and retrieved from a wide variety of different cell systems or from a living
animal or plant.
Recombinant production of FimA also rnight be accomplished so as
to render FimA or its subsequence peptides as fusion proteins. Fusion to
other proteins to increase the irnrnunogenicity of FimA and/or to increase its
stability would be desired outcomes of such fi~sion protein construction
Based on the results ofthe heterologous infectious challenge study,
the source of the FirnA protein should not limit the protein's effectiveness as
a vaccine against endocarditis or bacteremia derived from either viridans
streptococci and enterococci. However, a vaccine could take the forrn of a
mixture of FirnA proteins derived from a rnixture of viridans streptococci
and enterococci. In the case of fragments of the FimA protein being used as
the vaccine, enough of the protein should be present such that immllni7~tion
causes antibody-mediated protection.
MATERIALS AND MET~ODS
Bacterial strains, plasmids and media. Wild type S. parasanguis
FW213, its isogenicfimA insertion mutant, VT930 (does not express FimA
protein), and E. coli, VT786, a recombinant FimA producing strain, have
been described previously (13,14). The M15 E. coli host strain, pQE30
expression vector, and pREP4 repressor plasmid were from the Qiaexpress
system (Qiagen Inc. Chatsworth, CA). Streptococcal strains were grown
2~ anaerobically (10% CO2, 10% H2, 80% N2) at 37~C in brain heart infusion
(BHI) broth with 0.35% glucose. E. coli strains were grown in Luria Bertani
(LB) broth (Life Technologies, Inc., Gaithersburg, MD). Agar was added to
a final concentration of 1.5% to prepare solid medium. BH[, glucose, and
agar were obtained from Difco (Detroit, MI). Arnpicillin (100 ,llg/ml) and
CA 02258011 1998-12-11
W O97/48417 PCTrUS97/11329
kanamycin (25 ~g/ml to m~;nt~in pR~EP4 cont~ining strains or 100 ~glml to
m~in~in VT930) (Sigma Chemical Co., St. Louis, MO) were added for
bacterial and plasrnid selection. Bacterial cultures were stored at 70~ C in
BHI with 30% glycerol.
DNA methods. Plasmid DNA was isolated using the Qiagen~ plasrnid
purification protocol. Agarose gel electrophoresis protocols were those of
Sambrook et al. (28). Restriction endonucleases were purchased from
Bethesda Research Laboratories, Inc. (Gaithersburg, MD) and enzyrnatic
digestions were perforrned according to the m~nl-f~ctllrer's directions.
Preparation of Streptococcus chromosomal DNA was as described
previously (35).
Protein production and purification. Expression and purification of
recombinant FimA was perforrned using the Qiaexpress eAyl ession and the
Nickel-nitrilotriacetic acid (Ni-NTA) protein purification system. The
cloning strategy used to construct the ovele~ ression plasmid, pVA2341, is
shown in Fig.l. Plasrnid pVT78 1 was isolated from E. coli VT786 (26).
pVT78 1 was constructed by subcloningfimA as an NdeI-Bcll' fragment into a
pET3a expression vector.fimA DNA was amplified by polymerase chain
reaction (PCR). Oligonucleotides used to PCR amplifyfimA were
synthesized by Bio-Synthesis, IncorporatedlM (Lewisville, TX). The
oligonucleotide sequences corresponding tofimA nucleotides 1-17 and
916-930 were: 5' ACATGCATGCAAAAAAATCGCTTC 3' (SEQ ID No.
13) and 5' CCCAAGCTTACTGACTCAATCC 3' (SEQ ID No. 14). The
primers were designed so that the ends of thefimA DNA could be subcloned
as an SphI-Hin~II fragment into a pQE expression vector. The restriction
sites imbedded in these oligonucleotides are shown in bold font
(GCATGC=SphI, AAGCTT=HindIII). The multicloning region of pQE30
contains restriction endonuclease sites for BamHI, SphI, SacI, KpnI,
SmaI/XmaI, SalI, PstI and HindIII. Integration into pQ3~30 using SphI and
CA 022~80ll l998-l2-ll
W O 97/48417 PCTrUS97/11329
HindlII directional cloning resulted in a six histidine residue extension at theamino terminus offimA. The expression construct was transformed into the
M15 host strain carrying the plasmid pREP4 which carries the lacI gene.
Transformants were selected on LB agar plates Gont~ining ampicillin and
kanamycin and screened for correct insertion of thefimA gene by DNA
restriction endonuclease cleavage analysis.
Expression of recombinant FirnA was verified by preparation and
analysis of the protein from small scale cultures. A single colony of the
transformant was inoculated in 1.5 rnl of LB medium cont~ining IOO llg/ml
ampicillin and 25 llglml kanamycin and grown ovemight. 1.25 ml ofthe
saturated culture was added to 8.75 rnl of prewarmed LB medium with the
appropriate antibiotics. A 1 ml sample was taken prior to induction to serve
as the uninduced control. Expression was induced by adding isopropyl
,~-D-thiogalactopyranoside (IPTG) to a final concentration of 2 mM. A time
course of e,.plession was determined by taking I rnl samples at hourly
intervals. Cells were grown for up to 5 h. Cells were harvested by
centrifi~gation and cell pellets were stored at -20~C until all samples were
ready for processing. Cells were purified under denaturing conditions
according to the m~nuf~ct~lrer's instructions. Samples were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS PAGE) and
proteins were vt.cll~li7ed by Coomasie Blue stain.
For large scale expression of FimA, a 20 ml starter culture was first
grown overnight in LB broth cont~ining 100 llg/ml ampicillin and 25 llg/ml
kanamycin with 100 Ill of stock culture. One liter of LB broth with
antibiotics was inoculated 1 50 with the uninduced overnight culture and
these cells were grown at 37 ~C with vigorous shaking to an OD600 of 0.7.
The cells were induced with 2 mM IPTG and incubated for an additional 5 h.
Cells were harvested by centrifugation, suspended in 10 mM Tris-HCI (pH
8.0), and disrupted with the French~ Pressure Press (SLM Instruments Inc.,
Urbana, IL). The Iysate was centrifuged at 25,000 rpm in a Beckman SW28
rotor (Beckman Instruments, Inc., Palo Alto, CA) and the supernatant was
CA 022~80ll l998-l2-ll
W O 97/48417 PCT~US97/11329
loaded onto Ni-NTA column. The column was washed with 10 mM
Tris-HCl (pH 8.0) Cont~ininE 10 mM imidazole until the A280 had returned
to the baseline v.alue, and the protein was eluted with l O0 rnM
ethylenedi~minetetraacetic acid (EDTA) in Tris-HCl (pH 8.0). The protein
was further fractionated by gel filtration with Sepharyl~S-100 using fast
protein liquid chromatography (FPLC) (Pharmacia LKB, Piscataway, NJ).
The nucleotide sequence of the subcloned DNA in the construct
which expressed FimA was confirmed by DNA sequencing. Automated
sequencing reactions were perforrned by the Sanger-based dideoxy chain
telllfillaLion method (PRISM~M Ready Reaction DyeDeoxyTM Terminator
Cycle Sequencing Kit, Applied Biosystems Incorported, Foster City, CA)
according to the m~ntlf~cturer's directions.
Protein analysis. 15% SDS-PAGE (Bio-Rad Laboratories, Hercules, CA)
and Western imml~noblots (Promega Corp., Madison, WI) were performed
according to m~mlfActllrers' instructions. The gels were stained with
Coomassie Brilliant Blue (Sigma) and immersed in dest~ining solution (40%
methanol, 10% acetic acid, and 50% distilled water) until the background
was clear. Molecular weight standards (size range: 7,200-208,000) from
Bio-Rad were used. Protein concentrations were determined by the Lowry
method (23) using bovine serum albumin (BSA) as a standard.
Production of polyclonal antisera. Antisera directed against FimA were
prepared by subdermal injection of female New Zealand White rabbits at the
back ofthe neck with 0.5 mg FimA suspended in 0.5 ml phosphate buffered
saline (PBS) (pH 7.4) and emulsified in an equal volume of complete
Freund's adjuvant (CFA). A booster injection of 0.5 mg FimA in incomplete
Freund's adjuvant (IFA) was given three weeks later. Antisera were
collected and tested for antibody titer by enzyme immunoassay. All
prei".,.,.lne sera were negative by this method and immune sera had
anti-FimA titers of ~ 100,000. All sera were stored at 70~C until needed.
.
CA 022~8011 1998-12-ll
W O 97/48417 PCTAUS97/11329
Rabbit injections were carried out under the Virginia Commonwealth
University Institutional Animal Care and Use Committee (VCU IACUC)
authorization no. 9504-2137.
Enzyme immunoassay (EI~3. The procedure for immunodetection of
FimA was adapted from Sigma (Biochemicals and Organic Compounds for
Research and Diagnostic Reagents. 1995). EIA plates (Costar, Cambridge,
MA) were coated with l0 llg/ml FimA in carbonate-bicarbonate buffer (pH
9.5) and blocked with washing buffer. Serum from each animal was serially
diluted in PBS. The optimal dilutions for the secondary antibodies were
determined in titration assays. The peroxidase-conjugated goat anti-rabbit
antibody (Sigma) or peroxidase-conjugated mouse anti-rat antibody (Jackson
Irnrnunoresearch laboratories, Inc., West Grove, PA) was detected by
TMBlue substrate (TSI Center for Diagnostics Products, Milford, MA) and
color development was stopped with IN H2S04. Plates were read with a 700
MR microplate reader (Dynatech Laboratories, Inc., Chantilly, VA).
Antibody titers were expressed as the reciprocal of the highest serum dilution
with A,,50 of < 0.10 10 rnin after addition of substrate.
Immunization protocol. The immuni7~tion dose per Sprague-Dawley rat
contained 100 llg of FimA in CFA. The dose was given by intradermal
injection at 6 different sites in a shaved area of the rat's right flank. The same
area was used for a booster dose of l 00 llg of protein in IFA three weeks
~ater. In the first study, catheterization and bacterial challenge as described
below were performed six weeks after the initial immllni7~tion. In the
second study, nonimmuni7.ed and immlmi7ed rats were exsanguinated by
cardiac puncture two weeks after the booster dose to determine serum
antibody titers.
Rat model of endocarditis. The rat model of endocarditis employed in this
study was as described by Munro and Macrina (24). Approval for animal use
CA 022~8011 1998-12-11
WO 97/48417 PCT/US97/11329
was obtained from the VCU IACUC (protocol no. 9410-2082) prior to
initiation of experiments. Male ~prague-Dawley rats (Harlan, Tn~i~n~polis,
Ind.) were challenged with 1 X 107 bacteria 1-5 days after cardiac
catheterization. The significance of differences between the numbers of
S S~reptococcus infected vegetations obtained from imml-ni7ed and
non-imm~ni7ed rats was calculated by Fisher's exact test.
Platelet-fibrin adherence assay. Methods adapted from Scheld, e~ al (32)
and Munro and Macrina (24) were used. To prepare bacteria, an overnight
culture of streptococci in BHI was diluted 1:10 in fresh B~ and was grown
anaerobically to an optical density at 660 nm of ~ 0.6. Bacteria were washed
in PBS, sonicated, and diluted to yield 1 X 108 cells per ml. In some
experiments, these bacteria then were inr~lb~ted with either prei~.~.,."ne or
immune sera for 30 min at 37~C. Every ten minutes during the incubation
period, the cells were blended in a Vortex mixer for 30 sec to ensure that the
streptococci were single cells (not in chains). The sample was centrifuged
and washed with PBS. In other experiments, irnmune and prç;n~",llne sera
were adsorbed with 1 ml of an overrlight culture of S. parasang~is FW2 13
or VT930 (1 X 108 CFU) at 4~C for 24 h. To prepare the fibrin-platelet
matrices, I ml of human platelet-poor plasma (platelet count, ~ 50,000/mm3)
purchased from the Medical College of Virginia (MCV) Hospitals Blood
Bank was mixed with 0.4 ml of 0.2 M CaCl~ and 0.4 ml of bovine thrombin
(Baxter Diagnostics Inc., Deerfield, IL) at 100 NIH U/ml. To determine
adherence, 1 ml of bacteria was placed on the platelet-fibrin matrix and
incubated at 37~C for 30 min with gentle agitation. Non-adherent cells were
removed from the platelet-fibrin matrix and the surface was washed four
times with PBS. The matrix was dissolved by the addition of 0.5 ml of 2.5%
trypsin solution. The fluid was sonicated, serially diluted, and inoculated
onto B~ agar plates. The plates were incubated anaerobically at 37~C for
48 h. The percent adherence was calculated as: (number of colony forming
units recovered/number of cells introduced onto the platelet-fibrin plate) X
.. .
CA 022~8011 1998-12-11
W O97/48417 PCT~US97/11329
16
100. Statistical analysis was calculated by Student's ~ test.
Southern hybridization. Three llg of chromosomal DNA digested with
EcoRI were electrophoresed in a 0.8% Tris-borate (TBE) agarose gel on a
model H5 horizontal gel apparatus (Life Technologies, Inc.) at 1 5V for 24h.
The gel was depurinated in 0.25 M HC1 for 15 mim,te.c, denatured in a
solution cont~ining 0.05 M NaOH and 1.5 M NaCl for 30 min, and
neutralized in a solution cont~inin~ 2.5 M NaOH and 1.0 M CH3CO0N~I4
for 1 h. DNA fr~m~nts were transferred to 0.45 llm pore size rlitrocellulose
membrane (Micron Separations Incorporated, Westboro, MA) by capillary
action (35). The DNA was immobilized on the membrane by ultraviolet
irradiation in a model 2400 W StratalinkerlM (Stratagene, La Jolla, CA).
Random-primed radioactive labeling of fi~ll lengthfimA probe was generated
by using Prime-a-Gene~ (Promega Corp.). The nitrocellulose membrane was
incubated for 1 h at 42~ C in a prehybridization buffer consisting of 5X
SSPE (0.75M NaCl, S mM EDTA, 0.05 MM NaH2PO4), 5X Denhardt's
reagent, 100 ,ug/ml salmon sperm DNA and 25% formamide. Hybridization
with the randomly labeled probe was carried out at 42~ C for 18 h in a
so}ution of SX SSPE, IX Denhardt's reagent, 100 ~ ml salmon sperm DNA,
and 25-% formamide. A~er hybridization, the membrane was washed twice
(15 min each) in 2X SSPE with 0.1% SDS and then washed twice (15 min
each) in 0. lX SSPE with 0.1% SDS at room temperature to remove
unbound probe. Prehybridization, hybridization and washing steps were
performed in a Savant Gene RollerlM hybridization oven (Savant
Instruments, Inc., Holbrook, NY). The membrane was exposed to
ReflectionTM autoradiography film (Du Pont-NENG~ Research Products,
Wilmington, DE).
PCR amplification to demonstratefim~ homologs. Oligonucleotides
were designed to amplifyfimA homologs from Streptococcus spp The
synthetic oligonucleotides 5' GCTGGGGATAAGATCGAGCTCCACAG 3'
CA 022~8011 1998-12-11
Wo 97/48417 PCT/US97/11329
(SEQ ID No. I I) (nucleotides 151 to 173 in Figure 5) and
S' TTCATCATGCTGTAGTAGCTATCGCC 3' (SEQ ID No. 12)
(complementary to nucleotides 868 to 893) derived fromfimA related
se~uences found in well-conserved regions of the lipoprotein receptor
~ 5 antigen I (LraI) family of genes were used as primers to amplify by PCR
DNA fr~em~nt~ from genomic DNA of streptococcal strains used in the
Southern blot. Nucleotide coordinates corresponded to the 930 bp native
fimA gene. GenAmp~ PCR core reagents (Perkin Elmer Corp., Norwalk,
CT) were used and reactions were carried out for 28 cycles (94~C for 30
I0 sec, 55~C for 20 sec, and 72~C for 45 sec) with an automated thermal
cycler, GeneAmp PCR System 9600 (Perkin Elmer Corp.). The reaction
products were analyzed by 0.8% agarose gel electrophoresis.
Preparation of cell Lysates for protein analysis. Clinical strains of
streptococci from patients who had positive blood cultures were obtained
from the diagnostic rnicrobiology laboratory, MCV Hospitals (Virginia
Commonwealth University). Bacteria were grown anaerobically for 48 hrs at
37~C in 50 ml of BHI broth. The cells were harvested by centrifi~gation at
4000 X g for 10 min at 4~C. The cell pellets were suspended in BHI to a
final volume of 1 ml, and transferred to microcentrifuge tubes Cont~ining
one-half volume of 0.1 mm zirconium beads (Biospec Products, Bartlesville,
OK). The cells were disrupted in a Mini-Bead Beater homogenizer (Biospec
Products) for 2 min,ltçs. Beads and cellular debris were removed by
centrifugation at 12,000 X g for S minutes to obtain a clear Iysate. The
Iysates were kept at 4 ~C until protein analyses were performed.
RI~SULTS
Overe~pression and purification of FimA. It has been demonstrated that a
fimA insertion mutant, VT930, had significantly reduced virulence in the rat
endocarditis model compared to wild-type S. paras~nguis FW2 13 . It was
. . . .
CA 022~8011 1998-12-11
W O97148417 PCTrUS97/11329
18
deduced from in vltro experimental data that virulence was associated with
adherence of FimA to fibrin. Recombinant FimA was made using the
QiaexpressrM System for further in vivo and in vitro studies. The cloning of
fimA into a pQE expression vector was done as described in Materials and
Methods (Fig. l). Oligonucleotide primers were synthesized to amplifyfimA
by PCR. The DNA product was subcloned into a pQE30 vector. The
expression vector contained a phage T5 promoter and two lac operator
sequences thereby increasing the probability of lac repressor binding and
ensuring effective repression of the T5 promoter. This plasmid had a
~0 synthetic ri~osomal binding site for more efficient translation and two
transcriptional terminators, to from phage lambda and tj from the rrnB operon
of E. coli, which prevented read-through transcription thus stabilizing the
expression construct. The six consecutive histidine residue tag and the start
codon (ATG) were upstream of the polylinker sequence. The E. coli M15
host expression strain carried the pREP4 plasmid. The nucleotide sequence
of the subcloned DNA in the construct was analyzed and confirrned. The 6X
histidine residue served as a convenient affinity tag for purification of FimA
from crude E. coli Iysates under native conditions. The Ni-NTA resin metal
chelate adsorbent allowed for separation of most cont~min~ting proteins.
Other cont~min~nts were subsequently removed by gel filtration. The
recombinant strain, VA2341, expressed 0.5 mg/liter of FimA.
As illustrated in Figure 2, FimA with the 6X histidine tag migrated
more slowly and appeared larger than its expected size of 36kDa on
SDS-PAGE gel. Presumed lower molecular weight degradation products
were apparent. Based on molecular size analysis, native FimA appeared in
monomeric and dimeric forms (see arrows to right of Fig. 2).
Susceptibility of nonimmunized and immunized rats to endocarditis.
The effect of FimA imml~i7~tion in rats' susceptibility to endocarditis was
investigated. Vaccin~ted and non-vaccinated rats were inoculated with S.
parasanguis FW2 13 twenty-four hours after catheteri_ation. Forty-eight
CA 022F78011 1998-12-11
WO 97/484l7 PCT/US97tll329
19
hours post-challenge, the animals were sacrificed and their hearts resected.
Correct catheter placement and the presence and absence of vegetations
were ~csessed visually. Only those animals with proper catheter placement
were included in our analyses. Development of endocarditis was determined
by recovery of streptococci from cultured vegetations. Twenty-one out of
33 nonimmllni7ed rats (61%) developed S. pcuc(sa~ is endocarditis
compared with 2 of 34 rats (6.1%) imrnnni7ed with FimA (p<0.001) (Table
1). Thus, vaccination with FimA conferred protective irnmunity against
endocarditis in this model.
Table 1. Protective Effect of Tmmllni7~tion with FirnA in Rats Challenged
with S. parasanguis FW123.
Rats No. infected/total % infected
Nonimmnni7ed 21/33 61.8
Tmmllni7ed 2/34 6.1
The rat model is considered predictive of human endocarditis
infection because rat cardiovascular anatomy is very sirnilar to that of the
human, and the course and outcome of infection are clinically sirnilar.
Infected vegetations from rats and humans are visually in~lictinf~li5h~ble
microscopically .
Heterologous ch~llenge. FimA from S. parasanguis was tested to
determine protection against heterologous infectious challenge. Rats were
v~c~.in~ted as described above with fimA of S. parasanguis origin, (S.
parasanguis FW213) and then challenged with ~lirrerent fimA expressing
streptococci five days post catheterization. Three species of streptococci
2~ were tried in these experiments and the results are shown in Table 2
CA 022~8011 1998-12-ll
W O97/48417 PCT~US97/11329
Table 2. Protective ef~ect of immunization with FimA from one organism
against other FimA expressing org~ m.c
Organism # rats # rats p value~
infected/total infected/total
(%) (%) FimA-
unvaccinated v~c~in~ted
S. mifis 5/7 (71%) 4121 (26%) 0.01g6
S. salivarius 5/8 (63%) 2124 (8%) 0.048
S. mutans 10/15 (66%) 7123 (21%) 0.0077
a p values were calculated using the Fisher's Exact Probability test.
All isolates tested were of clinical origin from blood cultures. The S.
mutans data represents pooled data from infections using three clinical
isolates of this species, all with identical genotypic HaeIII-DNA restriction
fragment patterns. All of the p values were highly significant indicating
protection conferred by the FimA vaccine. Thus, these data indicate FimA is
a virulence factor in these other strains as has been demonstrated in S.
parasanguis.
While the data do not suggest the requirement, the vaccine may
include several different FimA proteins from several different sources.
Evaluation of anti-FimA titers in rats. Humoral immunity is an important
defense mech~nicm in many diseases. To establish that the induction of
antibodies correlated with the protection observed with imml~ni7~tion ~,vith
FimA, anti-FimA levels were compared with imml~ni7ed and non-immnni7ed
animals. As illustrated in Figure 3, immnni~ed rats developed anti-FimA
titers ranging from 1:10,000 to 1:100,000 whereas no anti-FimA antibodies
were detected in control rats. 6 out of 7 imm~lni7ed animals had high
antibody levels. One immllni7ed animal, and 7 out of 7 non-immnni7ed
animal had no demonstrable levels of anti-FirnA.
Thus, the FimA used in the vaccine should be of a sufficient quantity,
and of a sufficient size in the case of a FimA fragment, to allow a patient's
CA 022~8011 1998-12-11
WO 97148417 PCT~US97/11329
body to raise antibodies against the FimA in an immune response. Figure 3
shows that the antibody titers raised in an effective vaccine could be
1: 1 0,000 to 1: 1 00,000.
Bacterial adherence in vitro. A crucial step in the development of
endocarditis is the initial colonization by bacteria of endothelial lesions withsterile vegetations. Previous experiments showed that wild type S.
parasanguis FW213 bound significantly better (2.1% of added cells) to fibrin
monolayers than afimA insertion mutant (0.12% of added cells) (7). To
more closely .cim~ te vegetations in vivo, we perforrned adherence
GAye~il,,ents on platelet-fibrin matrices.
Platelet-fibrin matrices were prepared and the percent adherence of
streptococci was determined. The results of adherence and immllne blockade
assays from three replicate experiments, each of which were perforrned in
triplicate, are illustrated in Figure 4a-c.
The ability of wild type S. parasang~is FW213 to adhere to
platelet-fibrin matrices in vitro was tested and compared with that of its
isogenic fimA insertion mutant, VT930 (Fig. 4A). VT930 adhered less
readily (0.74% of added cells) than did the wild type strain (7.44% of added
cells) (pC0.05).
Since FimA is a fibrin-binding ~rlhe.~in, it was tested whether
anti-FirnA antibodies would interfere with colonization of vegetations. As
shown in Figure 4B, prior adsorption of immune sera with S. parasanguis
FW2 13 did not affect the ability of S. parasanguis FW2 13 to adhere to
platelet-fibrin matrix (4.9%of added cells) (Fig. 4B). In contrast, incubation
of S. parasanguis FW2 13 with anti-FimA sera adsorbed with VT93 0 blocked
adherence of S. parasanguis FW213 to the platelet-fibrin matrix (0.34% of
added cells) but no such blocking effect was observed by incubation with
adsorbed pr~ "~lne sera (5.04%) (p<0.001) (Fig.4C).
These results suggest that a protective mec.h~nicm of FimA
immllni7~tion is inhibition of viridans streptococci and enterococci
CA 02258011 1998-12-ll
W O 97/48417 PCTAUS97/11329
att~chment to platelet-fibrin thrombin.
.fimA homologs among viridans streptococci and enterococci. fimA is
one of five known genes which encode proteins belonging to the LraI family
of adhesins (20). The presence of fim,4 homologs among viridans
S streptococci and enterococci which comrnonly cause native valve
endocarditis were deterrnined to explore the feasibility of u~ili7ir)~ FimA as abroadly protective vaccine against streptococcal endocarditis. Southern blot
analysis of streptococcal genomic DNA digested with EcoRI and probed
with full lengthfimA DNA showed the presence of reactive fr~m~nts in six
of seven streptococci tested (Fig. 6A). Hybridizing fragments which
co-migrated withfimA were found with S. mutans ATCC 25175, S. oralis
~TCC 10557, and S. salivarius ATCC 7073. Less well-hybridizing
fragments of differing molecular weights were observed with S. salivarius,
and S. anginosus ATCC 27823. The probe did not react with S. bovis
ATCC 43144 norE faecium ATCC 19434.
As shown in Figure 6B, PCR reactions amplified 800 bp DNA
fragments from S. mutans, S. oralis, 5. salivarius and S. anginosus which
co-migrated with the amplified fragment from S. parasanguis FW213.
Larger DNA fragments were amplified from S. salivarius and E. faecium.
Taken together, results from the Southem blot and PCR analysis show that
fim,4 homologs are present in a variety of viridans streptococci and
enterococci studied.
The results above indicate the presence of closely related genes in
streptococci and enterococci. This can be seen from the finding that
identically sized DNA fragments were amplified in S. mz lans ATCC 25175,
5. oralis ATCC 10557, and S. salivarius ATCC 7073 using oligonucleotide
primers from thefimA sequence of S. parasanguis. The fainter components
observed with E. faecium ATCC 19434, S. salivanusATCC 7073, and S.
anginosus ATCC 27823 suggest theirfimA like genes exhibit reduced
sequence homology to fim,4.
CA 022~8011 1998-12-11
wo 97/48417 PCT/US97/11329
As explained above, in vivo testing with FimA from S. parasanguis
demonstrated protection was conferred to different species of streptococci.
Expression offimq homologs among viridans streptococci and
enterococci. FimA is a protein found on the cell surface of streptococci and
S enterococci and belongs to the lipoprotein receptor adhesin family (5,16,29).
Several species of viridans streptococci and enterococci that cause
endocarditis are known to have genes that encode for these proteins.
According to Mandell et al. (Principles and Practice of Infectious Diseases 4th
edition, Churchill Livingstone, NY, 1995, P.753) streptococci account for
60-80% of the cases of endocarditis. The viridans streptococci alone
account for 30-40% of all cases.
Polyclonal antisera raised against FirnA from S. parasanguis were
used to evaluate whether a related antigen is present in other streptococci
and enterococci. Blood isolates from clinical patients were screened by
immunoblot (Western blot) using polyclonal antisera. Table 3 shows that
FimA is broadly expressed among bacteria which most frequently cause
endocarditis.
TABLE 3
Reactivity of Streptococcal and Enterococcal Blood Isolates to
Polyclonal Anti-FimA.
Organism FimA-Positive FimA-Negative Total
E~. faecalis 10 6 16
E. faecium 2 o o
S. anginosus 1 o o
S. salivarius 4 o 4
S. sanguis 9 G g
S. mutans 10 0 10
S. mitis 1 0
CA 022~8011 1998-12-ll
W O 97/48417 PCTrUS97/11329
24
Nutritionally 4 o 4
deficient
streptococci (S.
defectivus)
In the case of S. mitis and S. defectivus collectively, multiple isolates from
the blood of patients with endocarditis wee evaluated and found uniforrnly to
express a FimA-like antigen. The S. mutans data seen in Table 3 were
obtained .from endocarditis isolates of ten species. In contrast, only 1 of 4
dental plaque isolates of S. mutans were found to express FimA protein.
In addition to the data shown in Table 3 which demonstrate FimA-
like proteins are commonly expressed by clinical strains of streptococci and
enterococci from patients with bacteremia, Figure 7 shows that FimA
antiserum detected proteins which co-rnigrated with FimA, further indicating
their sirnilarity.
Taken together the results shown in Table 3 and Figures 6A, 6B, and
7 provide molecular and imml~nological proof of concepts that are seminal to
the use of FirnA as a vaccinogen. First, thefimA gene and its encoded
protein are e~ olutionarily conserved in gram positive bacteria, especially in
organisms frequently associted with endocarditis etiology. Second, these
proteins are naturally expressed and by direct evidence and by inference play
a role in the org~ni~m~ ability to incite endocarditis. Third, a paradigm Fi~
from S. parasanguis can be used to provide irnrnunity against endocarditis in
animals challenged with fimA producing organism other than S. par~sanguis
(e.g., S. mitis, S. mulans, 5. salivarus). Thus, for purposes of this invention,FimA shall mean FimA and FimA like proteins, and fragments or fusion
proteins thereof, which are derived from any species known to express these
proteins.
The propensity of viridans streptococci to czuse endocarditis is likely
due to their adherence abilities. Several FimA like cell-surface proteins of
oral streptococci and enterococci belonging to the LraI family of adhesins
have been identified (5,16,29). In addition to FimA from S. parasanguis,
CA 022~8011 1998-12-11
Wo 97/48417 PCT/USg7/11329
these include EfaA from E;nterococcusfaecalis (3,5), PsaA from
S~reptococcus pneumoniae (29), ScaA from Streptococcus gordonii
(3,5,29), and SsaB from Strep~ococcussangz~is (15). Ofthese, EfaA and
FimA have been implicated in endocarditis pathogenesis (3,~,16,29). As
discussed above, the Qiaexpress System can be used for expression and
purification of recombinant FimA in E. coli. As illustrated in Figure 2, a
relatively pure preparation of native FimA was eluted from the Ni-NTA
column and other nonspecific cont~min~n~ were effectively removed by gel
filtration. FirnA monomers and dimers were evident in the
Coomassie-stained SDS PAGE gel. Polymeric forms of FimA may also be
produced other over~A~l ession and renaturation protocol (26)
The rationale for the use of the FimA adhesin as a vaccine is that
antibody formed against it may interfere with bacterial adherence and thereby
reduce virulence. Once the vegetation is colonized and bacteria are overlaid
with fibrin and platelets, the pathogens are less likely to be opsonized and
phagocytosed. The data presented above shows that immllni7.ed animals
were less susceptible to subsequent challenge with S. parasanguis FW213
than the nonimmlmi7ed group. Six out of 7 (86%) imm~lni7.ed rats
developed high anti-FirnA titers; in contrast, all control animals showed no
demonstrable antibody to FimA (Fig. 3). In addition, the FirnA from S.
parasanguis was protective against heterologous infectious challenge.
The vaccine of this invention may also be used to prevent
streptococcal bacteremia, a clinical condition seen increasingly in immuno-
compromised patients. In this use, the FirnA would be provided to an
irnmuno-compromised patient (e.g., a bone marrow transplant patient) by
intr~mtlscul~r injection or other route prior to high dose chemotherapy or
radiation therapy, and would elicit opsonic antibodies to invading
streptococci in the patient's blood stream, thus enhancing clearance of these
infectants.
While the invention has been described in terrns of its preferred
embodiments, those skilled in the art will recognize that the invention can
-
CA 02258011 1998-12-ll
WO97/48417 PCTrUS97tll329
26
be practiced with modification within the spirit and scope of the appended
clairns.
LITERATURE CïTED
1. Anonymous. 1995. The World .Alm~n~c and Books of Facts 1995. St.
Martin's Press, Mahwah, NJ
2. Adler, S., D. Selinger, and W. Reed. 1981. Effect of immuni7~tion
on the genesis of pneumococcal endocarditis in rabbits. Infection and
Tm m-lnity 34:55-61.
3. Andersen, R., N. Gan~shkl-m~r, and P. Kolenbrander. 1993.
Cloning of the Streptococcus gordonii pPK488 gene, encoding an adhesin
which m~ t~s coaggregation with Ac~momyces naeslund~i PK606.
Infection and Tmmnnity 61:981-987.
4. Archer, G. and J. Johnston. 1979. Effect of type-specific active
imml-ni7~tion on the development and progression of experimental
Pseudomonas aerugmosa endocarditis. Infection and Irnmunity
24: 167-173.
5. Baddour, L.. 1988. Twelve-year review of recurrent native-valve
infective endocarditis: a disease of the modem antibiotic era. Reviews of
Infectious Diseases 10: 1163-1170.
6. Bayer, A.. 1993. Infective endocarditis. Clinical Infectious Diseases
17:313-322.
7. Burnette-Curley, D., V. Wells, H. Viscount, C. Munro, J. Fenno,
P. Fives-Taylor, and F. Macrina. 1995. FirnA, a major virulence factor
associated with S parasanguis endocarditis. Infection and Irnmunity
63 :4669-4674.
8. Dujani, A., A. Bisno, K. Chung, D. Duruck, M. Freed, M.
Gerber, A. Karchmer, H. Millard, S. Rahimtoola, S. Shulman, C.
W~t~n~k~-n~korn, and K. Taubert. 1990. Prevention of Bacterial
Endocarditis. Recormnendations by the Arnerican Heart Association.
Joumal of the Arnerican Medical Association 264:2919-2922.
CA 02258011 1998-12-ll
W O97/48417 PCT~US97/11329
27
9. Davies, M.. 1992. The pathology of cardiac valves, p. 867-878. In J.
McGee, P. Isaacson, and N. Wright (eds.), Oxford Textbook of
Pathology. Oxford University Press, Oxford.
10. Delaye, J., J. Etienne, G. Feruglio, J. Fraile, M. Glauser, L.
Gruer, W. Hagler, H. Krayenbuehl, R. Kremer, K Meeter, and C.
Oakley. 1985. Prophy.laxis of infective endocarditis for dental
procedures. European Heart Joumal 6:826-828.
11. Durack, D. . 1995. Prevention of infective endocarditis. The New
F.nf~l~n-l Journal of Medicine 332:38-44.
12. Durack, D., B. G~ n~, and R. P~ dcrf. 1978. Effect of
immllni7~rion on susceptibility to experirnental Streptoccus mutans and
Streptococcus sanguis endocarditis. Infection and Tmmlmity 22:52-56.
13. Fenno, J., J. LeBlanc, and P. Fives-Taylor. 1989. Nucleotide
sequence analysis of a type I fimbrial gene of Streptococcus sanguis
FW213. Infection and Tmml-nity 57:3527-3533.
14. Fenno, J., A. Shaikh, G. Spatafora, and P. Fives-Taylor. 1995.
ThefimA locus of Streptococcus parasanguis encodes an ATP-binding
membrane transport system. Molecular Microbiology 15:849-863.
15. G~ne~hk-~m~r, N., P. ~nn~m, P. Kolen~rander, and B.
McBride. 1991. Nucleotide sequence of a gene codin~ for a
saliva-binding protein (SsaB) from Streptococcus sanguis 12 and a possible
role of the protein in coaggregation with Actinomyces. Infection and
unily 59:1093-1099.
16. Ganeshkumar, N., M. Song, and B. McBride. 1988. Cloning of
Streptococcus sangu~s adhesin which mediates binding to saliva-coated
hydroxyapatite. Infection and ~mmllnity 56:11S0-1157.
17. Greenl~erg, D., J. Ward, and A. Bayer. 1987. Influence of
Staphylococcus aureus antibody on experimental endocarditis in rabbits.
Infection and Immunity 55:3030-3034.
18. Griffin, M., W. Wilson, W. Edwards, W. O'Fallon, and L.
Kurland. 1995. Infective endocarditis. European Heart Journal
CA 02258011 1998-12-ll
W O 97/48417 PCTrUS97/11329
28
16:394-401.
19. Hogevik, H., L. Olaison, R. Andersson, J. Lindberg, and K.
Alestig. 1995. Epidemiologic aspects of infective endocarditis in an urban
population. A 5-year prospective study. Medicine 74:324-339.
20. Jenkinson, H.. 1994. Cell surface protein receptors in oral
streptococci . FEMS Microbiology Letters 121: 133-140.
21. Kaye, D. and E. ~brutyn. 1991. Prevention of Bacterial
Endocarditis:1991. Annals of Tntt~m~l Medicine 1 14:803-804
22. Korzeniowski, O. and D. Kaye. 1992. Endocarditis, p. 548-557. In
S. Gorbach, J. Bartlen, and N. Blacklow (eds.), Infectious Diseases. W.
B. Saunders Company, Philadelphia.
23. Lowry, O., N. ~osebrough, A. Farr, and R. Randall. 1951.
Protein measurement with the folin ph~nol reagent. J. Biol. Chem
193 :265-275.
24. Munro, C. and F. Macrina. 1993. Sucrose-derived
exopolysaccharides of Slreptococcus mutans V403 contribute to infectivity
in endocarditis. Molecular Microbiology 8:133-142.
25. Nissen, H., P. Nielsen, M. Frederiksen, C. Helleberg, and J.
Nielsen. 1992. Native valve infective endocarditis in the general
population: a 10-year survey of the clinical picture during the 1980s.
European Heart Joumal 13:872-877.
26. Oligino, L. and P. Fives-Taylor. 1993. Overexpression and
purification of a fimbria-associated adhesin of Streptococcus parasanguis.
Infection and ~mmllnity 61:1016-1022.
27. Ray, C. and K. Ryan. 1990. Intravascular infections, bacteremia,
and endotoxemia, p. 873-885. In J. Sherris (ed.), Medical Microbiology.
Elsevier Science Publishing Co., Inc., New York.
28. Sarnbrook, J., E. Fritsch, and T. l\l~ni~ti~. 1989. Molecular
cloning: a laboratory manual. Cold Spring Harbor Press, New York.
29. Sampson, J., S. O'Connor, A. Stinson, J. Tharpe, and H. Russeil.
lg94. Cloning and nucleotide sequence analysis of psaA, the
CA 02258011 1998-12-11
wo 97/484l7 PCT5US97/11329
29
Streptococcus pnellmoniae gene encoding a 37-kilodalton protein
homologous to previously reported Streptococcus sp adhesins. Infection
and Tmm~m-ty 62:319-324.
30. Scheld, W., R. Calderone, J. Brodeur, and M. Sande. 1983.
Influence of preformed antibody on the pathogenesis of experimental
Candida albicans endocarditis. Infection and ~mml-nity 40:950 955
31. Scheld, W. and M. Sande. 1990. Endocarditis and intravascular
infections, p. 670-706. In G. Mandell, R. Douglas~ and J. Bennett (eds.),
Principles and practice of infectious ~ii.ce~ces. Churchill Livingstone, New
York.
32. Scheld, W., J. Thomas, and M. Sande. 1979. Influence of
preformed antibody on experimental Streptococcus sanguis endocarditis.
Infection and Immllnity 25:781-785.
33. Scheld, W., J. Valone, and M. Sande. 1978. Bacterial adherence in
the pathogenesis of endocarditis. Joumal of Clinical Investigations
61: 1394-1404.
34. Srh~nnin~, T., A. Heimdahl, K. Coster, and J. Flock. 1993.
Immllni7~tion with fibronectin binding protein from Staphylococcus aureus
protects against expe~ elltal endocarditis in rats. Microbial pathogenesis
15 :227-236.
35. Schroeder, V., S. Michalek, and F. Macrina. 1989. Biochemical
characterization and evaluation of virulence of a
fructosyltransferase-deficient mutant of Streptococcus mutans V403.
Infection and ~mmllnity 57:3560-3569.
36. Simmonc, N., A. Ball, R. Cawson, S. Eykyn, W. Littler, D.
McGowan, C. Oakley, and D. Shanson. 1992. Antibiotic prophylaxis
and infective endocarditis. The Lancet 339:1292-1293.
37. Snelson, C., B. Cline, and C. Luby. 1993. Infective endocarditis: a
challenging diagnosis. Dimensions of Critical Care Nursing 12:4-20.
38. Steckelberg, J., L. Melton, D. Ilstrup, M. Rouse, and W. Wilson.
1990. Influence of referral bias on the apparent clinical spectrum of
CA 02258011 1998-12-ll
W O 97/48417 PCT~US97/11329
infective endocarditis. The American Joumal of Medicine 88:582-588.
39. Takeda, S., G. Pier, Y. Kojima, M. Tojo, E. Muller, T. Tosteson,
and D. Coldman. 1991. Protection against endocarditis due to
Staphylococcus epidermidis by imrnunization with capsular
polysaccharideladhesin. Circulation 84:2539-2546.
40. van de Rijn., I.. 1985. Role of culture conditions and immuni7ation
in experimental nutritionally variant streptococcal Endocarditis. Infection
and Tmmllnity 50:641-646.
41. van der Meer, J., J. Thompson, H. Valkenburg, and M. Michel.
1992. Epidemiology of bacterial endocarditis in the Netherlands. I.
Patient characteristics. Arch Intem Med 152: 1863-1868.
42. Yother, J. and J. White. 1994. Novel surface att~chment
mech~ni~m of the Streptococcus pneumoniae protein PspA. Joumal of
Bacteriology 176:2976-2985.
