Note: Descriptions are shown in the official language in which they were submitted.
CA 022S963S l999-0l-06
WO 98/S0536 PCT/US97/21299
HMGI PROTEINS IN TUMORS AND OBESITY
BACKGROUND OF THE INVENTION
This application is a continuation-in-part of United States patent
application serial no. 08/852,666, filed 7 May 1997, which application is a
continll~tion-in-part of United States patent application serial no. 08/679,529, filed
12 July 1996.
StPt~m~nt of Rights to IIl~w~Lio~ls
Made Under Federally-Sponsored Re3~ Cll and Development
Part of the work performed during development of this invention
25 utilized United States Government funds. The United States Government has
certain rights in this invention: NIH grant no. GM38731, HD30498, and
lK11CA01498.
3 o Field of the Invention
The present invention pertains to a method for treating obesity in a
m~mm~l which comprises reducing the biological activity of HMGI genes in the
3 5 m~mm~l . In another embo~limPnt, the invention pertains to a method for treating a
tumor in a patient by reducing the biological activity of normal HMGI genes which
comprises ~lmini.ctering to the patient a therape~ltic~lly effective amount of an
SUBS 1 l 1 u l ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/S0536 PCT/US97t21299
- 2 -
inhibitor compound active against normal HMGI-C or HMGI(Y) genes. In another
embodiment, the invention pertains to a method of producing a transgenic non-
human m~mm~l, the germ cells and somatic cells of which contain an inactivated
HMGI gene sequence introduced into the m~mm~l, or an ancestor of the m~mm~l,
5 at an embryonic stage. In another embodiment, the invention pertains to a method
for screening c~nr~ t~ compounds capable of inhibiting the biological activity of
norrnal HMGI proteins, or a fragment thereof, which comprises the steps of (a)
incubating a HMGI protein, or a fragment thereof, with a c~n~ te compound
under conditions which promote optimal interaction; and (b) m~ ring the binding
0 affinity of the c~n~ te compound to the HMGI protein, or a fragment thereof;
and (c) dele~ from the binding affinity which c~mli~l~te compounds inhibit
the biological activity of HMGI proteins, or a fragment thereof. In another
embodiment, the invention pertains to a method for sc,ce~ g c~nrlid~te compoundscapable of inhibiting the biological activity of normal HMGI genes which
5 comprises the steps of (a) transfecting into a cell a DNA construct which contains a
reporter gene under control of a normal HMGI protein-regulated promoter; (b)
mini~tering to the cell a c~n(~ t~ compound; (c) measuring the levels of reporter
gene expression; and (d) determining from the levels of reporter gene expressionwhich c~n~ tt~ cc.ll,~ounds inhibit the HMGI biological activity. In another
2 o embodiment, the invention pertains to a method for detecting normal HMGI
proteins as a diagnostic marker for a tumor using a probe that recognizes normalHMGI proteins, which comprises the steps of (a) cont~rting normal HMGI proteins
from a sample from a patient with a probe which binds to HMGI proteins; and (b)
analyzing for normal HMGI proteins by detecting levels of the probe bound to the25 normal HMGI pluteils, wherein the presence of normal HMGI proteins in the
sample is positive for a tumor. In another embodiment, the invention pertains to a
method for ~lPtecting antibodies to normal HMGI proteins using a probe that
recognizes antibodies to HMGI normal proteins, which comprises the steps of (a)
treating a sample from a patient with a probe which binds to antibodies to normal
30 HMGI pruLeills; and (b) analyzing for antibodies to HMGI proteins by detecting
levels of the probe bound to the antibodies to HMGI proteins, wh~.eill the presence
of antibodies to normal HMGI proteills in the sample is positive for a tumor. Inanother embodiment, the invention pertains to HMGI genes and proteins for use asa starting point to isolate duwns~ lll target genes regulated by the HMGI genes
3 5 and proteins.
SUB~i 1 l l U l ~ ; 1' (RULE 26)
CA 02259635 1999-01-06
wo 98/50536 PCT/USg7/21Z99
- 3 -
D~s~ ion of the Background
The disclosures referred to herein to illllstrat~ the background of
the invention and to provide ~ ition~l detail with respect to its practice are
incorporated herein by reference and, for convenience, are referenced in the
following text and respectively grouped in the appended bibliography.
HMGI Proteins in A.lil og~ s and Me~ r~-ynle Differenti~ti~n
Underst~nrling various genes and pathways underlying development
of mlllticell~ r org~ni~m~ provide insights into the molecular basis of the highly
regulated processes of cellular proliferation and difrclellliation. In turn, genetic
5 aberrations in control of cell growth lead to a variety of developmental
abnorm~ es and, most prominently, cancer (Aaronson, 1991). To pursue
itlentification of genes involved in these fi-~ m~nt~l biological processes, theviable pygmy mutation (MacArthur, 1944) was investi~t~(l because it gives rise to
mice of small stature due to a disruption in overall growth and development of the
20 mouse. An insertional tr~n~genir mutant facilitated cloning of the locus (Xiang et
al., 1990) and subsequently it was shown that expression of the HMGI-C gene was
abrogated in three pygmy alleles (unpublished results).
HMGI-C belongs to the HMG (high mobility group) family of
2 5 DNA-binding proteins which are abundant, heterogeneous, non-histone components
of chrolllalill (Cluscchrrll et al., 1994). HMG~roleills are divided into three
distinct familiPs, the HMG box-cnnt~ining HMGl/2, the active chromatin
associated HMG14/17 and the HMGI proteins (Grosschedl et al., 1994). At
present, the last family consists of two genes, HMGI(Y) (Johnson et al., 1988;
3 o Frie~im~nn et al., 1993) which produces two pl~teh~s via alternative splicing
(Johnson et al., 1989) and HMGI-C (Manfioletti et al., 1991; Patel et al., 1994).
A prnminpnt feature of HMGI proteins is the presence of DNA-binding ~lo~n~in~
which bind to the narrow minor groove of A-T rich DNA (Reeves and Nissen,
1990) and are therefore referred to as A-T hooks. Recently, valuable insights have
35 been gained into their mPrll~ni.~m and role in L~ seli~Lion (Thanos and ~ni~tic,
1992; Du et al., 1993). The HMGI proteins have no llal scliptional activity per se
SUB~ I l 1 U 1 k; ~ ; l (RULE 26)
..
CA 02259635 1999-01-06
WO 98/50536 PCT~US97/21299
-4-
(Wolffe, 1994), but through protein-protein and protein-DNA interactions olg~ni~e
the framework of the nucleoproteill-DNA llallseli~tional complex. This frameworkis ~n~inr~l by their ability to change the conforrnation of DNA and these proleil~s
are therefore termed archi~rctl~ral factors (Wolffe, 1994). In the well-studied case
5 of HMGI(Y) and the h~ rel.~il B promoter, HMGI(Y) stim~ tPs binding of NF-kB
and ATF-2 to applo~liate sequences and alters the DNA structure which allows thetwo factors to interact with each other and pre~ ably with the basal ll~sclil.tion
m~rhinPry (Thanos and Maniatis, 1992; Du et al., 1993).
0 A number of studies have revealed an association between increased
expression levels of HMGI proleh~s and transformation (Giancotti et al., 1987,
1989, 1993). For example, in ch~mir~lly, virally or spontaneously derived
tumors, appreciable expression of HMGI-C was found in contrast to no detectable
expression in normal tissues or untransformed cells (Giancotti et al., 1989). A
recent study has demonstrated a more direct role for HMGI-C in transformation
(Berlingieri et al., 1995). Cells infected with oncogenic retroviruses failed toexhibit various phenotypic markers of transformation if HMGI-C protein SyllllRSiS
was specifically inhibited.
DNA probes adjacent to HMGI-C were mapped to the distal portion
of mouse chromosome 10 in a region syntenic to the long arm of human
chromosomP 12 including and distal to band ql3 (Justice et al., 1990). This
genomic region is under intensive investigation because it is the location of
consistent rearrangements in a number of neoplasms, mainly of mesenchymal
origin (Schoenberg Fejzo et al., 1995). Lipomas, tumors mainly composed of
mature fat cells, are one of the most common m~senrl ymal neoplasms that occur in
hllm~n~ (Sreel~nt~i~h et al., 1991). Approxirnately 50~ of lipomas are
characterized by cytogenetic rearrangements and the predominant alteration is a
presumably b~l~need translocation involving 12ql4-15 with a large variety of
chromosomal pa~ s including 1,2,3,4,5,6,7,10,11,13,15,17,21, and X
(Sreel~nt~i~h et al., 1991; Fletcher et al., 1993). This variability in reciprocal
translocations along with duplications, inversions, and deletions of 12ql4-15 inthese tumors, strongly inrlir~Ps a primary role of a gene on chromosome 12 in
lipomas. Furtherrnore, this gene may play a key role in normal dirr~ ion of
primitive mPsenrllyme as not only lipomas, but also uterine leiomyomas (smooth
muscle tumors), lipoleiomyomas (smooth muscle and adipose components), and
SUB~ U l ~ ; l' (RULE 26)
. . . _ , . .
CA 02259635 1999-01-06
WO 98/50~36 PCT/US97/21299
- 5 -
pulmonary chondroid hamartomas (primitive mPsenrhyme, smooth muscle,
adipose, and mature cartilage components) are all clonal proliferations that arecharacterized by rearrangements of 12ql4-15 (Schoenberg Fejzo et al., 1995).
Interestingly, breakpoints in a lipoma, a pulmonary chondroid hamartoma and
5 uterine leiomyomata have been shown to map within a single YAC (Schoenberg
Fejzo et al., 1995).
HMGI Fl~t~illS in l~rnm~ n Growth and DevPlo~nPnt
0 The first step in the molecular definition of the pygmy mutation was
made possible by the isolation of a transgenic insertional mouse mutant at the
locus, pgTgN40ACha (Xiang et al., 1990). A 0.5kb ApaI-ApaI single copy
genomic sequence 2kb from the site of transgene insertion was identifiPd (Xiang et
al., 1990) and used to initiate a bi-directional chromosome walk on normal mousegenomic DNA. The analysis of seven overlapping clones spanning 91kb deline~te~l
a 56kb comrnon deletion between two informative ... "~ , pg and pgTgN4oAcha
(Figure 8a).
The common area of disruption was investigated further for
2 o candidate transcription units. The technique of exon amplification (Buckler et al.,
1991) was employed to identify putative exons and clones 803 and 5B, in the sameorientation, produced spliced products (Figure 8b). Their seq~lenre was
determined (Ausubel et al., 1988) and a comparison to DNA sequence ~t~b~cec
(GenBank and EMBL) revealed 100% homology to a previously identified gene,
HMGI-C (Manfioletti et al., 1991) (Figure 8c). The HMGI members have been
~signPd multiple functions (Manfioletti et al., 1991) and recently, have been
shown to play a critical role in regulation of gene ~ es~ion as archit~ctllral factors
by inducing DNA conformational changes in the formation of the three-
~1imPn~ional transcription complex (Thanos & ~ni~ti~, 199~; Du, W. et al.,
3 o 1993)-
Subsequently, the genomic structure of HMGI-C revealed that the
gene contains five exons and spans a region of approximately llOkb (Figure 8d).
Single copy sequences from the l90kb cloned pygmy locus, sull~ui~ding and
35 including the HMGI-C gene (Figure 8d), were used as probes on Southern blots
cont~inin~ DNA isolated from the two informative alleles (Xiang et al., 1990).
SUBSTITUTE S~k;~; l (RULE 26)
. .
CA 022~963~ 1999-01-06
WO 98/50536 PCT/[~S97/21299
- 6 -
The genomic area enromp~cinE HMGI-C is completely deleted in the l~dl~sgellic
insertional mutant pgTgN40ACha (A/A), whereas in the spontaneous mutant pg,
the 5 ' sequences and the first two exons are absent (Figure 8d).
Mi~ of Disrupted Hl~GI Proteins in ~llm~-l Tumors
Cancer arises from aberrations in the genetic m~çll~ni~m.c' that
control growth and dirr~,lG,l~iation and ongoing elucidation of these m,orh~ni~m~
continues to improve the underst~n~ling of ~ n development and its various
10 abnorm~litiPs. Increasingly, ~cc~m~ ting experimental evidence points towardstranscriptional deregulation as one of the pivotal events in neoplasia. Many of the
known transforming retroviral oncogenes, such as v-myc, v-fos and v-n~yb, are
homologs of m~mm~ n transcription factors which are normally involved in
proliferation and difrele.lliation control. Genes that encode for such transcription
lS factors are frequently affected by the som~tir~lly acquired genetic changes which
arise stoch~tir~lly over a lifetime of an o~ isll,. These alterations, which caneither activate expression of the relevant genes or disrupt them to create novelfusion pro~ins, affect llal~scriplion nelwulh~ and initiate cancer.
2 o One of the llalls~ tion factors whose disruption was shown to
result in tumorigenesis is HMGI-C, which has attracted considerable attention for
two reasons. First, a series of elegant experiments ~etnon.~trated that HMGI(Y) is
involved in transcriptional regulation and is required for virus induction of the
human i~ ,.r~loll-B gene expression. These obserations were incorporated into a
novel model in which activation of gene expression is initi~tecl by a higher order
transcription enhallcel complex. This functional nucleoprotein entity termed
enh~nreosome is formed when several distinct lldnscli~Lion factors assemble on
DNA in a stereospecific manner. Combinatorial m~ch~ni~m~ of the enhanceosome
formation enable the cell to achieve high specificity of gene activation in response
to multiple biological stimuli. As an esse~ti~l component of the e~h~nreosome,
HMGI(Y) promotes the assembly of this three-~imP~.~ional structure through both
protein-protein and protein-DNA interactions. The latter activity is mr~i~ted
through the HMGI DNA-binding domains.
The function of HMGI-C, the other known mtonnher of the HMGI
family, in growth and development control is better understood at the biological
SUB~ 1 l 1 U l ~; ~iH I1 ~;1 (RULE 26)
CA 022~963~ 1999-01-06
PCT/US97/21299
WO 98/50536
- 7 -
leveh In hllm~n.~, rearrangements of HMGI-C were linked to the pathogenesis of
several distinct types of solid tumors. Rearrange~.lk~ of the chromosomal band
12ql3-15, con~i.ctenfly found in a wide variety of benign mesenchymal neoplasms,disrupt HMGI-C and g~neldte novel chimeric transcripts. In the vast majority of
5 the analyzed tumors, these ll~nscli~ts consist of the HMGI-C DNA-binding
domains fused to ectopic sequences provided by the translocation partner.
In the mouse, HMGI-C inactivation produced a dramatic disruption
of both pre- and postnatal growth, reslllting in the pygmy phenotype. Pygmy mice0 exhibit signifirant growth retardation which is first appalel" in midgestation and
becomes even more pronounced after birth. Adult animals are proportionally builtand viable but exhibit a 60% weight reduction colll~a,ed to their wildtype
litterrnates. A detailed phenotypic analysis of the pygmy mouse revealed that the
weight reduction in most of the tissues is comm~n~urate with the overall decrease
5 in body weight. Most illlere~ gly, HMGI-C inactivation does not affect the
growth hormone-insuline-like growth factor endocr*ne pathway, suggesting that
HMGl-C functions in a previously unknown growth regulatory mPch~ni~m
The molecular basis of the pygmy mutation is not well understood.
20 High levels of the HMGI ~rolei"s are not required for cell growth per se and
elevated HMGI ~Ayles~ion appear to be associated with the biological state of the
cell more directly than with its high proliferation rate. Upon transformation with
oncogenic retroviruses, expression of HMGI-C and HMGI(Y) in epithelial cells is
dr;tm~tir~lly increased even though the proliferative capacity of the infected cells
2 5 remains lln~ffectecl . Furthermore, analysis of a llal~,ro.l~,ed cell line which
retained its dirrele..li~te~ phenotype revealed that levels of the HMGI expression
were signific~ntly lower than in cell lines which lost the* dirfelenLiaLion markers as
a result of transformation. Other studies demonstrated that HMGI-C is expressed
in less dirrtlel,liated mesenrllymal cells but is no longer present in their termin~lly
30 dirrcl~ rcl coullL~l~alL~. In combination, these results in-lic~t~ that the function
of the HMGI proteins may be to m~int~in the un~lifr~,~,..li~te~l cellular state.
The diverse set of m~senr~ymal neoplasms in which HMGI-C is
frequently disrupted by translocations of 12ql3-15 inrl~ es lipomas, uterine
35 leio"lyol"a, pulmonary hamartoma and pleomorphic adenom~c of salivary gland.
Another cytogenetic subgroup which can be ;~leltti~t~d in this set of tumors is
SUB~ 1 l 1 U 1~ (RULE 26)
.. . .. ..
CA 022~963~ 1999-01-06
wo 98/50536 PCT/US97/21299
.
- 8 -
charart~ri7P~ by rearrangements at 6p21-23. Intriguingly, HMGI(Y) has
previously been localized to this chromosomal area.
Tr~ oc~ion Br~kl~Q~ c U~lr~ of the HMGI-C Gene in Uterine
Lei~-llyu-llata
Uterine leiomyomata, also known as fibroids, are the most cornmon
pelvic tumors in women. Systematic histologic e~min~tion of hysterectomy
specimens has shown a prevalence as high as 77% for these tumors in women of
0 reproductive age. Although benign, uterine leiomyomata constitute a major health
problem as they are associated with abnormal uterine bleeding, pelvic pain, urinary
incollthle.lce, spontaneous abortion, premature delivery, and infertility.
Symptomatic fibroids are the leading indication for hysterectomy, accounting for27% of the estim~tPd 680,000 procedures performed annually in the United States.
Several different consistent chromosomal rearrange.ne.ll~ have been
~ Pntifier~ in uterine leiomyomata, and they suggest involvement of a critical gene
on chromosome 12 in the pathobiology. A translocation involving chromosomes
12 and 14, t(12; 14)(ql4-15;q23-24), le~rcse..l~ one of the most common
rearr~ngemPnts, although trisomy 12, inversions and duplications of 12ql4-ql5,
and translocations of 12ql4-ql5 with chromosomes other than 14 are not
uncommon. The breakpoint in 12ql4-ql5 in uterine leiomyomata is in an
intriguing chromosomal region because it is also the location of consistent
rearrangements in other benign solid tumors, including lipomas and pleomorphic
a(l~nnm~c of the salivary gland. Rearran~ell-e~ of 12ql3-15 have been reported
in pulmonary chondroid hamartoma, en~lom~trial polyps, epithelial breast tumors,hern~nEiopericytoma, and an aggressive angiomyxoma. These tumors have the
common proL,cllies of being mPsenrhyme-derived and benign. Therefore, it has
been hypothesized that a single gene involved in mPsenrl yme dirre~c~.liation and
3 o growth could be responsible for these multiple tumor types.
H.R. Asher et al. (1995) reported that HMGI-C, an architectural
factor that functions in l,al.scliplional regulation, is disrupted by rearrangement at
the 12ql4-15 chromosomal breakpoint in lipomas and suggests a role for HMGI-C
3 5 in adipogenesis and mPsenrllyme dirr~ liation.
SUB~ 1 l 1 U l ~; ~iH h'l~; l (RULE 26)
CA 022~963~ 1999-01-06
WO 9~/50536 PCT/US97/21299
g
X. Zhou et al., (1995) shows that the pygmy pheno~yl.e arises from
the inactivation of HMGI-C which function as architect~lral factors in the nuclear
scaffold and are critical in the assembly of stereospeci~lc transcriptional complexes.
A.C. Finlay et al. (1951) discloses an antibiotic obtained from
culture filtra~es of an Actinomycete, Streptomyces netropsis, isolated from a soil
sample and ac~ign~ the name Netropsin.
A. DiMarco et al. (1962) disclose the physicorh~ l properties of,
and the results obtained against some experimental tumors with, the antibiotic of
the netropsin group, distamycin A. Distamycin A is reported to exhibit a strong
irlhibition on ascites tumors [Ehrlich and sarcoma 180 (S180) ] and delays the
growth of solid tumors (Ehrlich ca,~;inc,lna, S180, Walker carcinoma, and
Oberling-Guerin-Guerin myeloma). Distamycin A is also reported to decrease the
mitotic index of the Ehrlich ascites tumor and induces mitotic damages of tumor
cells.
M.L. Kopka et al. (1985) discloses that X-ray analysis of the
complex of netropsin with the B-DNA ~odec~m~r of sequenre C-G-C-G-A-A-T-T-
~rC-G-C-G reveals that the antitllmnr antibiotic binds within the minor groove by
displacing the water molecules of the spine of hydration. Nello~sin amide NH is
reported to furnish hydrogen bonds to bridge DNA adenine N-3 and thymine 0-2
atoms occurring on ~ cent base pairs and opposite helix strands, exactly as withthe spine of hydration.
R. Reeves et al. (1990) discloses the ~lom~in.~ of the ~ n
high mobility group (HMG)I chromosomal proteins nPcess~.~ and sufficient for
binding to the narrow minor groove of stretches of A T-rich DNA. The three
highly conserved regions within each of the known HMG-I proteins is reported to
3 o be closely related to the consensus seque~e T-P-K-R-P-R-C-R-P-K-K and that a
synthetic oligopeptide corresponding to this consensus "binding domain'l (BD)
sequ~rlce specifically binds to substrate DNA in a manner similar to the intact
HMG-I proteins. Molecular Corey-Pauling-Koltun model building and computer
~imul~tions employing energy minimi7~tion programs to predict structure are
3 5 reported to suggest that the conse.,~us BD peptide has a secondary structure similar
to the antitumor and antiviral drugs n~llup~ and distamycin, and to the dye
SUBS 1 l 1 U 1~ ; l (~ULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 10-
Hoechst 33258 and that in vitro these ligands, which also pl~felclltially bind to A
T-rich DNA, have been demonstrated to effectively compete with both the BD
peptide and the HMG-I proteins for DNA binding. The BD peptide is also
reported to contain novel structural features such as a Asx bend or "hook" at its
5 amino-terminal end and laterally projecting cationic Arg/Lys side chains or
"bristles" which may contribute to the binding plul)e.Lies of the HMGI proteins.The predicted BD peptide structure, referred to as the "A T-hook," represents a
DNA-binding motif capable of binding to the minor groove of stretches of A T
base pairs.
European patent EP727~87A1 (960821) (Bullerdiek et al.) discloses
the Multi-tumor Aberrant Growth (MAG) gene having the nucleotide sequence of
any one of the strands of any one of the members of the High Mobility Group
protein genes or LIM protein genes.
SUl~MARY OF THE INVENTION
The present invention pertains to a method for treating obesity in a
m~mm~l which co~ lises reducing the biological activity of HMGI genes in the
m~mm~l In this embo~im~ t~ at least 10% of the biological activity of HMGI
genes is reduced, and preferably at least 50% of the biological activity of HMGIgenes is reduced. In one embodiment, the biological activity of HMGI-C genes is
reduced, and in another embodiment, the biological activity of HMGI-(Y) genes isreduced. The m~,..,..~l is preferably leptin-deficient or leptin receptor-deficient.
The reduction in biological activity of HMGI genes may be achieved by inhibitingthe expression of HMGI genes, by ~dmini.ctering to the m~mm~l a the.i1l e~ir~llyeffective amount of an oligonucleotide which has a nucleotide sequence
3 o complr-Tnrr~t~ry to at least a portion of the mRNA of the HMGI gene, by inhibiting
the DNA-binding activity of HMGI genes, by a~mini.ctering to the m~mm~l a
the~ ir~lly effective amount of an inhibitor compound selected from the group
con~ tin~ of ntL,o~sil~, distamycin A, or Hoechst 33258 (bisben~imi-le), or by
inhibiting the protein-protein interactions of HMGI proteins. The m~mm~l may be
3 5 a human or a rodent. The biological activity of HMGI genes may also be
subst~nti~lly reduced by breeding the m~mm~l with an inactivated HMGI gene
SUB~ 1 l l U l ~ ; r (RULE 26)
CA 022~963~ 1999-01-06
~ WO 98/50536 PCT/US97/21299
- 11 -
sequence introduced into the m~mm~l, or an anceslor of the m~mm~l, at an
embr~vonic stage. The inactivated HMGI gene sequence may be an inactivated
HMGI-C gene sequence and may be the inactivated HMGI-C gene sequence set out
in Figure lO~
In another embo~imPnt, the present invention pertains to a method
for treating a tumor in a patient by reducing the biological activity of normal
HMGI genes which co,ll~,ises ~lmini~tPring to the patient a therapeutic~lly
effective amount of an inhibitor compound active against normal HMGI-C or
0 HMGI(Y) genes. In this embodiment, the biological activity of normal HMGI-C
genes may be reduced or the biological activity of normal HMGI-(Y) genes may be
recluce~ The reduction in biological activity of normal HMGI genes may be
achieved by inhibiting the expression of normal HMGI genes, by a~mini.ctering tothe patient a therapeutic~lly er~;Live amount of an oligonucleotide which has a
15 nucleotide sequence complenlpnt~y to at least a portion of the mRNA of the
normal HMGI gene, by inhibiting the DNA-binding activity of normal HMGI
genes, or by ~lm;.~ g to the patient a therapeutir~lly effective amount of an
inhibitor compound selecte(l from the group con.~i~ting of ll~kopsill, distamycin A,
or Hoechst 33258 (bisbe~?;~ P)~ In one embotlimP~t the tumor is mesenchyme-
2 o derived and benign and may be uterine leiomyomata, lipomas, pleomorphic
adenomas of the salivary gland, pulmon~ry chondroid hamartoma, enrlometrial
polyps, epithelial breast tumors, hPn ~ngiQpericytoma, or angiomyxoma, and is
preferably uterine leiomyomata, lipomas, or pleomorphic adenomas of the salivarygland. In another embodiment, the tumor is a m~lign~nt tumor of epithelial origin
25 and may be a carcinoma of the lung, colon, breast, prostate~ thyroid gland, or skin.
The reduction in biological activity of normal HMGI genes may be achieved by
inhibiting the protein-protein interactions of H M GI proteins.
In yet another embodirnent, the present invention pertains to a
3 o method of producing a transgenic non-human m~mm~l, the germ cells and somatic
cells of which contain an inactivated H M GI gene sequence introduced into the
m~mm~l, or an ancestor of the m~mm~l, at an embryonic stage. In this
embo-limPI~t, the inactivated HMGI gene sequence may be an inactivated H M GI-C
gene sequence and may be the inactivated HMGI-C gene sequence set out in Figure
3 5 lO. Preferably, the genome of the m~mm~l does not encode for both the
functionally active leptin gene and the functionally active HMGI genes.
SUB~ 111 U l ~ ; l (RULE 26)
CA 02259635 1999-01-06
W O 98/50536 PCT~US97/21299
In yet another embodiment, the present invention pertains to a
method for sele~n~l,g c~n~ te compounds capable of inhibiting the biological
activity of normal HMGI l)roteins, or a fragment thereof. The method colllprises5 the steps of (a) incubating a HMGI protein, or a fragment thereof, with a c~nt~ t~
compound under conditions which promote optimal interaction; and (b) measuring
the binding affinity of the c~nt~ te compound to the HMGI protein. or a fragmentthereof; and (c) determinin~ from the binding affinity which c~n~ te compounds
inhibit the biological activity of HMGI proteins, or a fragment thereof. The
0 can~ te compound may inhibit the biological activity of normal HMGI proteil,s,or a fragment thereof, in an amount of at least 10%. The binding affinity may bemeasured using a scintillation proximity assay or a fluorescence polarization assay.
In yet another embodiment, the present invention pertains to a
5 method for scl~enillg c~n~ te compounds capable of inhibiting the biological
activity of normal HMGI genes. The method comprises the steps of (a)
transfecting into a cell a DNA construct which contains a l~,polLel gene under
control of a normal HMGI protein-regulated promoter; (b) ~lmi-~is~ g to the cella c~n~ te compound; (c) measuring the levels of reporter gene expression; and
2 0 (d) ~letermining from the levels of reporter gene expression which c~n~ ate
compounds inhibit the HMGI biological activity. In this embodiment, the
c~nrli(l~te compound may inhibit the biological activity of normal HMGI genes inan amount of at least 10%.
In yet another embodiment, the present invention pertains to a
method for cletPcting normal HMGI ~loteh~s as a diagnostic marker for a tumor
using a probe that recognizes normal HMGI proleills. The method comprises
the steps of (a) cont~ting normal HMGI proteins from a sample from a patient
with a probe which binds to HMGl proteins; and (b) analyzing for normal
HMGI proteins by ~letecting levels of the probe bound to the normal HMGI
proteil,s, wherein the presence of normal HMGI ~roleills in the sample is
positive for a tumor. In this embodiment, normal HMGI-C proteins may be
detected or normal HMGI(Y) proteins may be detect~cl. In one embodiment,
the tumor is mPsPnrhyme-derived and benign and may be uterine leiomyomata,
lipomas, pleomorphic ~enom~s of the salivary gland, pulmo~ry chondroid
hamartoma, endometrial polyps, epithelial breast tumors, h~m~ngiopericytoma,
SUB~ 1 l l IJ 1~ ; l (RU~E 26)
CA 022~963~ 1999-01-06
PCT/US97nl299
~ WO 98/50536
- 13 -
or angiomyxoma. In another embo~imPnt, the tumor is a m~lign~nt tumor of
epithelial origin and may be a cdlchlo,na of the lung, colon, breast, prostate,
thyroid gland, or skin. The probe may be an antibody, the sample may be a
biopsy sample, a urine sample, a blood sample, a feces sample, or a saliva
s sample, and the method may be a histological assay, biochemir~l assay, flow
cytometry assay, Western blot assay, or solution assay. A positive and negative
control sample may be treated according to the method to assess the level of
normal HMGI l)lolehls in a tumor sample and a nontumor sample, respectively.
0 In yet another embodim~Pnt the present invention pertains to a
method for ~etecting antibodies to normal HMGI ~)lolt:ins using a probe that
recognizes antibodies to HMGI normal ~IOl~illS. The method complises the steps
of (a) treating a sample from a patient with a probe which binds to antibodies to
nor}nal HMGI proteins; and (b) analyzing for antibodies to HMGI pr~"eins by
rlPtectin~ levels of the probe bound to the antibodies to HMGI proteins, whereinthe presence of antibodies to normal HMGI pl'OteillS in the sample is positive for a
tumor. In this embo~limPnt7 antibodies to normal HMGI-C may be ~let~PctP~ or
antibodies to normal HMGI(Y) may be detectPd The probe may be normal
HMGI-C or HMGI(Y) proteins. In one emboflimPnt, the tumor is mPspnrllyme-
derived and benign and may be uterine leiomyomata, lipomas, pleomorphic
~ennm~ of the salivary gland, pulmonary chondroid hamartoma, en~lom~otrial
polyps, epithelial breast tumors, h~m~giopericytoma, or angiomyxoma. In
another embo-lim~nt, the tumor is a m~lign~nt tumor of epithelial origin and maybe a carcinoma of the lung, colon, breast, prostate, thyroid gland, or skin. The2 5 sample may be a biopsy sample, a urine sample, a blood sample, a feces sample, or
a saliva sample and the method may be a histological assay, bioc-hPmil~l assay,
flow cytometry assay, Western blot assay, or solution assay.
In yet another embodiment, the present invention pertains to HMGI
genes and proteins for use as a starting point to isolate d-)wl~llealll target genes
regulated by the HMGI genes and ~lolcills.
SUB~ l~l l U 1~; S~;~; 1 (RULE 26)
CA 02259635 1999-01-06
. W 0 98/50536 PCTrUS97/21299
- 14 -
B~U~EF D E S C~LrPrrIO N O F TEnE ~IGInRU3S
Figures l(A~ and l(B) illustrate the genomic structure of the human
5 HMGI-C gene.
Figures 2(A) through 2(F) illustrate FISH mapping of HMGI-C
lambda clones to lipoma tumor metaphase chromosomes from three lipomas
revealing rearrangement of HMGI-C in all three tumors.
Figure 3 illustrates RT-PCR amplification of HMGI-C chimeric
transcripts.
Figure 4 illustrates rearrang~mellLs of 12ql5 in human lipomas
which disrupt the HMGI-C gene and produce chimeric tlansc.i~
Figure 5 illustrates RT-PCR using primers located on either side of
the fusion site beLw~ell HMGI-C and novel sequences.
2 o Figures 6(A) and 6(B) illustrate novel sequences fused to the DNA
binding-domains of HMGI-C which encode tl~lls~ ional regulatory domains.
Figure 7 illustrates the structure and domain or~ni7~tion of HMGI-
C and the predicted fusion proteins.
Figures 8(A) through (D) illustrate the i-lentifir~tion and genomic
characterization of the HMGI-C gene at the pygmy locus in normal and mutant
alleles.
Figure 9 illustrates HMGI-C gene ~,iession of three alleles at the
mouse pygmy locus.
Figures lO(A) through(C) illustrate targeted disruption of the HMGI-
C gene.
SUB~ 1 l l U 1~ (RULE 26)
CA 02259635 1999-01-06
' W O 98/50536 PCTrUS97/21299
- 15 -
Figures 11(A) through (C) illustrate expression of HMGI-C in
development and growth.
Figure 12 illusLLdl~s a Northern blot demonstrating that expression
5 of the HMGI genes in obesity is dr~m~tis~lly increased. RNA isolated from the
adipose tissue of two month old mice was used for Northern blot analysis (wt,
wildtype; od, obese; db, di~beti~).
Figure 13 is a photograph illll~trating the phenotypic effects of
0 HMGI inactivation in obese ~"~ . Genotypes of the various progeny are shown
under the photographs. P~ hle~ y~ body weight of the leptin-deficient obese
mice (+/+ ob/ob) is reduced from 80 gram to 25 gram (normal weight) following
HMGI-C inactivation (pg/pg ob/ob).
Figure 14 is a bar graph illustrating that HMGI inhibition reverses
the hyperphagia of obese mice. Figure 14 also shows the effects of genotype on
food col~u~ ion. Daily food co.,sunl~tion is calculated as equal to Iweight of
food at 0 hours] minus [(weight of food at 24 hours) plus (food wasted)].
Figure 15 is a graph illustrating that irlhibition of HMGI supresses
tumorigenesis. Figure 15A shows that knockout mice developed tumors with a
frequency ten times lower than in the control animals. Figure 15B shows that
tumor multiplicity exhibited a 20-fold decrease following HMGI-C inhibition.
Solid squares refer to normal mice and solid triangles refer to mice without HMGI-
C.
DETAILED DESCRIPTION OF THE ~VENTION
Aberrations in the genetic mPcll~ni.cm~ that control growth and
proliferation have emerged as a primary event in carcinogenesis. The function ofHMGI-C and HMGI(Y), two embryonically expressed DNA-binding proteins, was
investig~t~d because their ~ sslon is highly associated with tumor development.
3 5 Disruptions of either HMGI-C or HMGI(Y) in humans result in a diverse array of
solid m~senrhymal tumors. Most prominent among these neoplasms are uterine
SUB~ 1 l 1 U 1~ ; l (RULE 26)
~ . . ~ . . .
CA 02259635 1999-01-06
PCT/US97/21299
WO 98/50536
- 16-
leiomyomata, the most common pelvic tumors in women and the in-lic~tiQn for
over 200,000 hysterectomies annually in the United States. In tumors of m~mm~ry
and thyroid glands as well as in prostate cancer, HMGI expression is highly
correlated with tumor progression and metastasis, suggesting that these proteins can
5 be used for as progression markers for a variety of tumor types.
Further proof for the pivotal role of HMGI proteins in both normal
and pathological growth was obtained in the mouse system. Homologous
recombination was used to inactivate murine HMGI-C gene. Demons~lalillg the
0 importance of the HMGI genes in growth regulation, HMGI-C knockout mice
exhibit ci~nifir~nt growth retardation (mutant mice are 60% smaller than their
wild-type litterm~trs) with the reduction in most tissues commensurate with the
overall decrease in the body weight. Even more importantly, these pygmy mice
are highly resistant to ch~mic~lly in~ red skin cancer. Specifically, the frequency
5 of tumor development in the knockout mice is 40% of that in the control anim~lc
and tumor multiplicity exhibits a 20-fold decrease. Independently, inhibition ofHMGI-C synthesis was shown to render thyroid epithelial cells intransigent to
retroviral ~lal~ro~ tin~. At the molecular level, HMGI proteins function in
transcriptional regulation by promoting coop~dtive binding of the transcription
20 factors to DNA. Deregulation of the do~ edll~ target genes can easily accountfor the important biological roles of the HMGI proteh~s as well as for the dramatic
consequences of their in~lol,liate expression.
Lipomas are one of the most common mesenchymal neoplasms in
25 hllm~n.c. They are characterized by consistent cytogenetic aberrations involving
chromosome 12 in bands ql4-15. Inl~ ingly, this region is also the site of
rearrangement for other m~senrllymally derived tumors. The present invention
demonstrates that HMGI-C, an arrhitrchlral factor that functions in transcriptional
regulation, has been disrupted by rearrangement at the 12ql4-15 chromosomal
30 breakpoint in lipomas. Chimeric transcripts were isolated from two lipomas inwhich HMGI-C DNA-binding domains (A-T hook motifs) are fused to either a
LIM or an acidic transactivation domain. These results identify the first gene
rearranged in a benign neoplastic process that does not proceed to a n~ n~nry
and suggest a role for HMGI-C in adipogenesis and lnesenrllyme dir~ ialion~
SUBSTITUTE ~ (RULE 26)
. .
CA 022~963~ l999-0l-06
W O 98t~0536 PCTrJS97121299
HMGI-C is an attractive c~n~ t~ gene to be implicated in lipoma
formation. This gene is required in lla~ro~ ation (Berlingieri et al., 1995) and is
a transcriptional regulatory factor as are many genes i(lP~tifiPd at translocation
breakpoints in a variety of tumors (Rabbitts, 1994). Secondly, disruption of
5 HMGI-C leads to mice of small stature which, most intriguingly, have
disproportionately less body fat than normal litterm~tes (Benson and Chada, 1994).
Finally, mouse HMGI-C maps to a region syntenic to human 12ql4-15 which is
the area most frequently rearranged in lipomas (Mandahl et al., 1988). Therefore,
the human homolog of the mouse HMGI-C gene was cloned and its possible role in
1 o lipomas investig~t~d .
Growth is one of the filn-1~m~nt~l aspects in the development of an
organism. Classical genetic studies have isolated four viable, spontaneous mousemllt~nt~ (Green, 1989) disrupted in growth, leading to dwarfism. Pygmy is unique5 among these ..-u~ because its phenotype cannot be explained by aberrations in
the growth hormone-insulin-like growth factor endocrine pathway (Lin, 1993; Li,
et al., 1990; Sinha et al., 1979; Nissley et al., 1980). The present invention shows
that the pygmy phenotype arises from the i-~c~iv~Lion of HMGI-C and are criticalin the assembly of stereospecific l~allsclilJlional complexes (Tjian & Maniatis,20 1994). In addition, HMGI-C and the other HMGI family m~mber, HMGI(Y)(
Johnson et al., 1988), were found to be e~les~ed predominantly during
embryogenesis. The HMGI family are known to be regulated by cell cycle
dependent phosphorylation which alters their DNA binding affinity (Reeves et al.,
1991). Overall, these results demonstrate the important role of HMGI proteins in25 m~mm~ n growth and development.
Among the most promin~-nt characteristics cu~ y exhibited by
cancer cells are karyotypic aberrations which disturb genes essential for the
regulation of filn(l~mPnt~l cellular processes. A wide array of solid mesenchymal
30 tumors is characterized by recurrent rearrangements of chromosomal bands 12ql3-
15 or 6p21-23. This study shows that HMGI expression is normally restricted to
undirÇclr~ ted, rapidly dividing cells but is activated in dir~L."i~ted adipocytes
following translocations of 12ql3-15 or 6p21-23 in human lipomas. The present
invention shows that the molecular ~a~lw~y of tumor development is dictated by
3 5 the precise nature of HMGI disruption and that HMGI mise~l,res~ion in a
dirr~lc.~ t~l cell is a pivotal event in benign tumorigenesis.
SUB~ 111 U 1~ l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/2l299
- 18-
Uterine leiomyomata are the most common pelvic tumors in women
and are the indication for more than 200,000 hysterectomies annually in the United
States. Rea.lallgel.lent of chromosome 12 in bands ql4-qlS is characteristic of
uterine leiomyomata and other benign mesenrhymal tumors, and a YAC spanning
chromosome 12 translocation breakpoints was i~nti~lP~l in a uterine leiomyoma,
pulmonary chondroid hamartoma, and lipoma. Recently, it was demonstrated that
HMGI-C, an architectural factor mapping within the YAC, is disrupted in lipomas,res~llting in novel fusion transcripts. This study concerns the loc~li7~tion of
0 translocation breakpoints in seven uterine leiomyomata 10 to > 100 kb upstream of
HMGI-C by use of fluorescence in situ hybridization. These findings suggest a
different pathobiologic ~ chAni!i... in uterine leiomyomata from that in lipomas.
HMGI-C is the first gene i~lPntifie(l in chromosom~l rearrangements in uterine
leiomyomata and has important implications for an undersr~n(linl~ of benign
15 mesenchymal proliferation and differentiation.
Recently, molecular tlicsection of this chromosomal region has
su~ost~nti~tP~ this hypothesis. To identify a gene at the breakpoint on chromosome
12 in uterine leiomyomata, a high-density physical map of the t(12;14) breakpoint
20 region was constructed and i~lPntifi~tl a YAC, 981fll, that spans the translocation
breakpoints in a uterine leiomyomata, pulmonary chondroid ha"la"oma and a
lipoma. Further detailed characte,i~lion showed that the gene for HMGI-C, an
architPchlral factor that is a non-histone component of chromatin, maps within
981fll and is disrupted in lipomas. HMGI-C is rearranged in lipomas with
25 chromosome 12 translocations, resulting in novel chimeric trans~ that fuse the
DNA-binding A-T hook domains of HMGIC with potential transcriptional
activation ~lo~in.c.
Obesity
Ml~t~tionc of HMGI-C are re~ollsible for ovelg~ vlh of fat
lipomas, tumors composed of mature fat cells (Ashar et al., 1995; Schoenmakers et
al., 1995). Removal (inactivation, inhibition, etc.) of HMGI-C in normal mice
results in ~nim~l.c with a 20-fold reduction in the amount of fat tissue (Zhou et al.,
35 1995). Removal (inactivation, inhibition, etc.) of HMGI-C in leptin-deficientobese mice, which are a widely accepted model of human obesity, decreases the
SUB~ 1 l l U 1~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 19-
amount of fat tissue in these animals and le~Lon,s their normal weight (from 80
gram to 25 gram). Even a partial inactivation of HMGI-C, such as may be
produced by a drug, results in the decreased amount of fat and in a decreased
weight of obese animals. Moreover, food intake is also (1iminichetl as a result of
5 HMGI-C inhibition. This last study dem~ ales the use of HMGI-C inhibition to
regulate the amount of adipose tissue. Applicants also describe small molecule
inhibitors and ~ ice!~e oligonucleotides which can be used to inhibit the biological
activity of HMGI-C.
o Tumorigenesis
The first class of tumors treatable by the present invention includes
carcinomas, m~lign~nt tumors of epithelial origin, which are commonly referred to
as cancer, and include carcinomas of the lung, colon, breast, prostate, thyroid
5 gland and skin. A number of papers describe a correlation between tumor
development and the presence of HMGI proteins. Specifically, HMGI proteins are
absent in normal adult cells but are always found in m~lign~ns tumors
(carcinomas). This, however, is a correlative observation which does not teach
anything about treating those tumors. Applicants have discovered that HMGI-C
20 inhibition will be an effective method of treating tumors. Specifically, applicants
employed a chP~i~l skin carcinogenesis assay, a widely accepted model of
tumorigenesis, which is applicable not only to skin carcinomas but also to
carcinomas of lung, colon, breast, prostate and thyroid gland. Two sets of mice
were used, one with normal amounts of HMGI-C and one without any HMGI-C,
25 and to their skins certain chP~ lc known to induce cancers were applied. While
normal mice developed tumors as expected, mice without HMGI-C were resistant
to tumorigenPsi.c. The same types of inhibitors that were described for treating for
obesity can be used for treating cancer.
Berlingieri et al., 1995 demonstrates that inhibition of HMGI-C by
~nticenc~P. in vitro prevents cellular llan~rollllation. Transformation is a process
very different from tumorigenesis (carcinogenesis; tumor development; tumor
gro~vth, etc.). In studying transformation, one isolates cells, puts them in test
tubes, subjects them to various stimuli (I~hPmir~l~, viral infections, irradiation etc.)
and analyzes their ability to be transrolll,ed, i.e., exhibit characteristics dirrelent
from those of normal cells. In studying tumorigen~Psic, one takes anim~lc and
SUBST~TUTE ~H~ (RUT E 26)
*rB
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 20 -
studies their ability to develop tumors. Therefore, Berlingieri et al., 1995 does not
teach a method for SUylJ~cSSillg tumorigenesis.
The second class of tumors treatable by the present invention
includes benign tumors of mPsenrhymal origin7 as opposed to m~lign~nt tumors of
epithelial origin, including lipomas, uterine leiomyomas and other tumors (Ashar et
al., 1995; Schoe-nm~kPrs et al., 1995). These tumors are benign and therefore are
not cancers. However, one group in this class, uterine leiomyomas, present a
cignifir~nt health problem and complications associated with them (pain, infertility,
0 etc.) result in 200,000 operations to remove the uterus annually in the U.S.
Tumors of this second class are different from the first class (cancers) because in
the first class, tumors have increased amounts of normal HMGI-C while tumors of
the second class develop due to HMGI-C mutations.
As set out above, there are two classes of tumors which HMGI
genes are responsible for, and hence which are treatable by the present invention:
(1) benign mesel1chyll.al tumors, and (2) m~lign~nt epithelial tumors. Tumors oftype (2), m~lign~nt epithelial tumors, collsliluLe over 99% of all human tumors.There are two m~ch~ni~m~ by which HMGI genes can promote tumorigenesis:
2 o (a) HMGI genes can be disrupted by chromosomal translocations producing fusion
ploleins in which a major part of a normal HMGI protein is replaced by a
heterologous sequence derived from the translocation partner ("mutant HMGI
genes mrrh~ni.~rn"); and
(b) HMGI genes can simply be activated and appear in a cell where the genes
would not normally be present, without mutation ("normal HMGI genes
m~rh~ni.~m ")
Since HMGI proteins function in embryogenesis, the proteins should not normally
be present in an adult cell. Hence the presence of these proteins, even in theirnorrnal forrn, in the "wrongl' cell can result in tumor development.
Applicants have discovered that rnerh~nicm (a), the mutant HMGI
genes mPrh~ni~m, causes tumors of type (1), benign mesenrhymal tumors.
Applicants have also discovered that mPch~ni~m (b), the normal HMGI genes
m~rh~ni~m, causes tumors of type (2), m~lign~nt epithelial tumors, and that
3 5 inhibition of normal HMGI proleil~s will ~u~,ess the growth of tumors of type (2).
Applicants have further discovered that tumors of type (1), benign mPsenrhymal
SUBS 111 U 1~; S~EET (~ULE 26)
CA 02259635 1999-01-06
WO 98/50536 PCT/US97/21299
- 21 -
tumors, can be caused by ml~ch~ni~m (b), the normal HMGI genes m-och~ni~m, and
not only by rn~rl~ni~m (a), the mutant HMGI genes mech~ni.~m.
In general, a normal HMGI gene (protein) is a gene not disrupted by
5 any chromosomal aberration. The sequences of the human and mouse genes and
~ro~eills are well known and are published. Moreover, there exist variations of
these sequences, i~ e., conse~ i\re amino acid substitutions, changes of the
nucleotide sequence outside the open reading frame (the part that actually codes for
the protein), which preserve the normal molecular strucnlre and function of the
0 HMGI proteins. These variations also fall within the scope of the patent.
RESIJLTS
HMGI I'~ol~ s in Adi~oL_.,esis and Mf~ n.e Difft.~ lior~
Genomic Isolation and Characterization of the Human HMGI-C Gene
To obtain genomic clones of HMGI-C, DNA from yeast strains
harboring YACs, yWPR383 and yWPR384 were subcloned into the lambda PIXII
20 vector. Rec~llce there is extensive conservation (96%) between mouse and human
HMGI-C homologs (Patel et al., 1994), mouse HMGI-C cDNA fra~ tc
encompassing all five exons were used as probes on lambda libraries and five
clones were isolated (Figure lA). Restriction mapping of lambda clones followed
by Southern blot analysis allowed id~ontifi~tion of various restriction fr~gment~
2 5 cont~ining cross-hybridizing sequences. These fragments were subcloned and
nucleotide sequence analysis col,fi.--.rd published data (Patel et al., 1994). The
first three exons each contain a DNA binding domain encoding the A-T hook motif
that is characteristic of the HMGI family (Reeves and Nissen, l990) and exons 4
and 5 encode the acidic domain of the molecule (Manfioletti et al., 199l) (Figure
3 0 lB). Notably, a large intron (>25kb) between exons 3 and 4 ~e~ es the DNA
binding domains from the r~ in-~çr of the protein (Figure lB).
Fluorescence In Situ Hybridization of Lambda HMGI-C Exon Clones to Lipoma
Metaphase Chromosomes
SUB~ 111 U 1~ (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 22 -
Lambda clones from 5' and 3' ends of HMGI-C were used as probes
for FISH to tumor m~t~ph~e chromosomes. In lipoma ST90-375 cnnt~inin~ a
t(12;15)(ql5;q24) translocation, lambda clone H403 which contains the 5' end of
the gene gave a hybridization signal on the der(12), thus mapping l~ro~ al to the
5 breakpoint. In contrast, lambda clone H4002 which contains a portion of the 3'end of the HMGI-C gene, gave a hybridization signal on the der(15) and thereforemaps distal to the breakpoint (Figure 2). This result is con~i~t~nt with a disruption
of HMGI-C due to the t(12; 15) in this lipoma. Two other lipomas with
translocations in 12qlS were studied, similarly. In ST93-724 Cnnt~ining a
lo t(3;12)(q29;qlS), lambda clone H409 cont~ining the 5' end of HMGI-C hybridized
to the der(12), while the 3' end clone H4002 hybridized to the der(3) (Figure 2).
In ST91-198 with a t(12;13)(ql4-22;q21-32), the 5' clone H403 mapped on the
der(13) suggesting a position distal to the breakpoint. However, from the 3' end,
no hybridization to either derivative chromosome was noted in 20/20 metaphases
using lambda clone H4002 inrlir~ting that this portion of HMGI-C is deleted
(Figure 2). Therefore, in this tumor, the translocation appears to be proximal to
HMGI-C with the S ' end of the gene retained but the 3 ' end deleted. Regardless of
the chromosomal m~ch~ni~m which may include a complex rearr~ngmPnt in ST91-
198, HMGI-C is disrupted in three out of three lipomas analyzed.
~entific~tion of Chimeric Transcripts
The molecular structure of the HMGI-C transcripts in the lipomas
was next investigat~l Total mRNA was isolated (Chirgwin et al., 1979) from
primary cell cultures of ST90-375 t(12;15) and ST93-724 t(3;12) and 3' RACE
performed (Frohman et al., 1988). The resulting products were analyzed by
agarose gel electrophoresis and DNA fr~gmPntc of size 441 and 627 bp were
obtained from RNA samples isolated from ST90-375 and ST93-724, respectively
(Figure 3). These two DNA fr~ment~ were purified, subcloned and seqnenred
3 o In both cases, sequence analysis revealed an in frame fusion of novel seq~lPnres to
HMGI-C. These sequences differed between the two lipomas, and imm~ tely
followed exon 3 of HMGI-C (Figure 4).
The ~lesellce and specificity of chimeric transcripts in the two
lipomas were cnnfirmed further by an independent RT-PCR. cDNA was prepared
from lipoma RNA samples but primers from the novel sequences, instead of oligo-
SUBS 1 l 1 U 1~ (RULE 26)
.
CA 02259635 1999-01-06
~ ' WO 98/50536 PCT/US97/21299
- 23 -
dT, were used for the reverse ~ scli~tion reaction so that only RNA ll~nswi~Ls
spanning the translocation would result in a PCR amplification product (Figure 5).
Products of the predicted size were observed only when primers derived from the
novel sequences were used to reverse transcribe RNA isolated from the
corresponding cell lines. No products were seen in lipoma RNA from ST90-375 or
ST93-724 when primers 724 or 375 were used, lei~ye~Lively.
Finally, the chromosomal origin of the novel sequences was
~letertninP~i using DNA p,~a.~d from a monochromosomal rodent-human somatic
cell hybrid panel. Specific primers were deci~nP~l for the two novel sequPnre~c
obtained from the lipoma cDNAs. PCR pelÇol~llcd on genomic DNA from the
somatic cell hybrids demonstrated that the novel sequer~e fused to HMGI-C in
ST93-724, with a t(3;12), was located on chromosome 3 (Figure 6) and the novel
sequence from ST90-375, with a t(12;15), mapped to chromosome 15 (Figure 6).
Novel Sequences Encode for Transcriptional Regulatory Domains
A ~let~ilPd co~ uL~l analysis of the novel sequenres from the two
ampliffed fusion transcripts demonstrated that they encode putative ~-~nscliplional
regulatory cilm~inc Tncpection of the predicted protein sequPnre from ST93-724
revealed the presence of two t~n(1P-nly arrayed LIM dom~inc (Sanchez-Garcia and
Rabbitts, 1993) separated by the ch~raGteristic 8-10 amino acids (Figure 6A).
These domains are 50-60 amino acid residue motifs which are rich in cysteine andhicti~ine and were hrst i~Pntifie~l in three proteins, lin-11, Isl-1 and mec-3 (Way
and Chalfie, 1988; Freyd et al., 1990; Karlsson et al., 1990). The domain is
org~ni7P~l into two adjacent zinc fingers separated by a two residue linker
(Feuerstein et al., 1994) and members of the LIM family of proteins may contain
one or more LIM domains (Sanchez-Garcia et al., 1993). Many of the LIM-
cont~ining proteins are ll~ns.;li~lion factors (Sanr~Pz-Garcia et al., 1993) and their
3 0 activity is thought to be regulated by protein-protein interactions through the ability
of LIM dom~inc to dimerize (Feuerstein et al., 1994).
Cc,m~e~ analysis of the novel seqUpnre from ST90-375 did not
reveal any signifir~nt homology with known sequ~P~e~. Notably, the carboxy-
tPrrnin~l end of the predicted protein is highly acidic (pI 4.6) and rich in serine and
threonine residues. Such domains have been implicated in llal~scli~Jtional activation
SUB~ 111 u 1 k; ~ ; l (RULE 26)
CA 02259635 1999-01-06
WO 98/50536 PCT/US97/21299
- 24 -
and have been shown to stin~ te ha,~c,iplion from remote as well as proximal
positions (Mitchell and Tijan, 1989; Seipel et al., 1992).
Therefore, the ple~ d domain ol~an;~tion of the wildtype
5 HMGI-C and the fusion proLcills can be schPn ~tir~lly depicted as shown in Figure
7. In both fusion ~rotei"s, the C-termin~l domain of the wildtype HMGI-C, which
does not activate ll~ns.;li~lion (Thanos and Maniatis, 1992; X.Z. and K.C.,
unpublished data) is replaced by ~ictinrt, potential Lldllsclip~ion regulation
domains. These newly acquired functional domains in combination with the A-T
0 hooks of HMGI-C would give rise to unique ~Olcills that may contribute to the
pathobiology of lipomas.
HMGI Proteins in Malnm~ Growth and Development
Previous studies (King, J., 1955) had established that the pygmy
phenotype could be observed at birth. T~lefol~, RNA from wildtype mouse
embryos was isolated (Chirgwin, J. et al., 1979) and Northern blot analysis
revealed a l,~l~c,i~t of 4.1kb (Figure 9). As expected from the genomic analysis,
no d~tect~hle HMGI-C expression was observed in the spontaneous and transgenic
20 insertional mouse ~u~ . Additionally, a third allele exists at the pygmy locus
(Green, M.C., 1989), ln(10)17Rk, which carries an inversion of chromosome 10
and the distal breakpoint is within intron 3 of the HMGI-C gene (data not shown).
No HMGI-C expression was d~tected in homozygous embryonic In(10)17Rk RNA
(Figure 9). Q~l~ntit~tion by phosphorimager analysis revealed that heterozygous
mice expressed HMGI-C at approximately 50% wildtype levels. Therefore, the
wildtype allele in the h~lc.(lzygous mice does not il1(;,case its expression levels to
compensate for the loss of the deleted allele. This is consistent with the pygmymutation being semi-domin~rlt because there is a mild phenotypic effect on
heterozygous mice (80% the weight of wildtype mice) (Benson, K. & Chada, K.,
3 o 1994). Furth~rmore, HMGI(Y), the only other known m~tnher of the HMGI genefamily (Gro~sch~ll, R. et al., 1994), retained the same levels of e~ ssion in the
mutant and wildtype mice (Figure 9). Therefore, there is no compensation by
HMGI(Y) for the lack of HMGI-C expression in pygmy mice.
3 5 The mutant alleles described above arise from major disruptions of
genomic DNA which result in large deletio~ or a chromosomal inversion. To
SUB~ 111 U 1~ (RULE 26)
CA 022~963~ 1999-01-06
~ Wo 98/50~36 PCT/USg7/21299
- 25 -
exclude the possibility that a gene other than HMGI-C may be responsible for thepygmy phenotype, a mouse null mutant of HMGI-C was produced by targeted
disruption. Mouse embryonic stem (ES) cells were gc~ dlcd that had 3.0kb of the
HMGI-C gene, encomp~c.cing exons 1 and 2, replaced with a neomycin-resi~t~nre
gene (Figure lO(A)). Matings between mice hel~,ozygous for the mllt~tecl allele
produced mice homozygous for the disrupted allele (Figure lO(B)) at the expectedMendelian frequency of approximately 25% (13/51). Tmmlmnblot analysis
demonstrated an ~hsçnre of HMGI-C in protein extracts from homozygous
embryos (Figure lO(C)). Homozygous HMGI-C-/- mice revealed the classical
0 features of the pygmy phenotype which include reduced birthweight, craniofacial
defects (shortened head) and an adult body weight of approximately 40% (39.8 +/-2.9) of wildtype littermates (Benson, K. & Chada, K., 1994). Therefo-~, it can be
concluded that absence of HMGI-C expression in mice causes the pygmy
phenotype.
Previously, a restricted number of adult tissues were analysed
(Manfioletti, G. et al., 1991) and established that the endogenous eA~Jrcssion of
HMGI-C could not be detected. Hence, a more co~ ~he~ re panel of tissues
were e~r~mine~ to investigate the temporal and tissue specific eA~,tssion pattern of
HMGI-C. Within the sensitivity of Northern blot analysis, HMGI-C expression
was not ~et~cte~l in 18 adult tissues (data not shown). However, expression of
HMGI-C was observed during mouse embryogenesis (Figure ll(A)) as early as
10.5 days post coitum (dpc), but essentially disa~l~ea~d by 15.5dpc. ~2~Tn~rk~hly,
the other family member, HMGI(Y), showed a similar endogenous expression
pattern (Figure ll(A)) with expression readily observed in 10.5-16.5dpc mouse
embryos. The predomin~nt expression of HMGI-C and HMGI(Y) during
embryogenesis suggests this arcl-itec~ral factor family functions mainly in
m~mm~ n development.
The analysis of HMGI-C e~l,c~ion was further extended by its
loc~li7~tion in the normal developing mouse embryo. Expression was observed in
the majority of tissues and organs during embryogenesis as exemplified by the
11.5dpc mouse embryo (Figure ll(B)). Noticeably, HMGI-C eAl)lcssion was not
seen in the embryonic brain except in a small, localized region of the forebrain(Figure ll(B)). This ex~ression pattern coincides with previous studies which
demonstrated that most tissues in pygmy mice were 40-50 % smaller as compared to
SUB~ Lll u 1~; SH 1~:~; l (RULE 26)
*rB
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 26 -
wildtype tissues and the only tissue of normal size was found to be the brain
(Benson, K. & Chada, K., 1994).
To initiate studies on the eluci~tion of the role of HMG~-C in cell
5 growth, embryonic fibroblasts were cultured from homozygous and wildtype
embryos. Strikingly, the number of pg/pg embryonic fibroblasts was four-fold less
as conl~a~d to wildtype fibroblasts after four days in vitro (Figure 11(C)) and was
not due to cell death. This data, as well as similar studies in other systems (Ram,
T. et al., 1993; BPrlingi~ri, M.T. et al., 1995), is consistent with a role for HMGI-
lo C in cell proliferation and suggests that HMGI-C filn~tinn~ in a cell ~ulonol~ous
manner. Fu~ ."~ore, absence of HMGI-C eAp~sion in the pygmy mutant would
then lead to a decrease in cell proliferation and causes the reduced size of all the
tissues except for the brain.
5 Inhibition of HMGI-C Suppresses Tumorigenesis
Numerous studies, especjally those with HMGI-C inactivation of
LranSgelliC mice (Zhou et al., 1995), demonstrated that HMGI proteins play a
central role in both normal and aberrant growth regulation. Berlingieri et al.
20 (1995) studied the possible involvement of HMGI protein in Lf~,lsrollllation and
were able to show that in vitro retroviral transformation requires the presence of
HMGI-C protein. However? none of the previous reports addressed the role of the
HMGI protein family in tumor growth in the context of the whole organism.
Furthermore, previous studies failed to elucidate the possible role of the HMGI
2 5 proteins in tumorigenesis in vivo.
Generation of the HMGI-C knockout mice (Zhou et al., 1995)
provided a physiological model in which to study the effect of the HMGI proteinsin tumorigenesis in a defined and controlled manner. In order to determine
30 whether inhibition of the biological activity of HMGI proteins can be used tosuppress tumorigenesis, susceptibility of the knockout mice to tumor growth was
ex~mine~l by subjecting 2-month-old an~mals to a two-stage carcinogenesis protocol
ili7ing DMBA and TPA. Twenty HMGI-C knockout mice and 20 wildtype
controls were used in this experiment. The backs of the ~nim~ were shaved 48
3 5 hours before tumor initiation and mice were inhi~terl with a single topical
application of 200 nmol of 7, 12dimethylbenz[a]a~ acel.e dissolved in 200 ul of
SUB~ ; l (RULE 26)
CA 02259635 l999-0l-06
WO 98/50536 PCT/US97/21299
- 27 -
acetone. Starting one week later, animals were treated twice a week for the next18 weeks with topical applications of 6 nmo1 (4ug) of TPA dissolved in 200ul of
acetone. Forty-eight hours after the last application, the mice were sacrificed,whole dorsal skin was excised and tumors were counted.
A striking dir~l~nce between the rates of tumorigenesis of normal
and HMGI-C knockout mice was imm~di~t~ly a~al~llL. Transgenic mice without
HMGI protein are highly le~islall~ to ch~ornir~lly in-hlced skin cancer. Promin~ntly,
the knockout mice developed tumors with a frequency ten times lower than in the
0 control animals, see Figure 15A. Just as importantly, tumor multiplicity exhibited
a 20-fold decrease following HMGI-C inhibition, see Figure 15B.
These results conclusively demonstrated that inhibition of HMGI
biological activity in the context of the whole organism was able to suppress
15 tumorigenesis. Therefore, the above studies provide proof-of-principle evidence
that inhibition of HMGI biological activity can be used to su~ ss tumorigenesis
such as observed in cancer patients.
Mi~ of Disrupted HMGI P~lt~ s in ~llm~n Tumors
Isolation and Analysis of the Aberrant HMGI Transcripts
Rearrangements of HMGI-C in human tumors always preserve the
DNA-binding domains of the protein and the DNA-binding activity of the HMGI
25 archit~ct lral factors is es~enti~l for the enh~n-~er activation. Moreover, seql~enre
analysis demo~Ll~led that the DNA-binding domains are completely conserved
between human HMGI-C and HMGI(Y) (Figure not shown). Therefore, HMGI
expression was investigat~ in human tumors with karyotypic abnorm~lities
involving chromosomal band 6p21-23.
F.~t~hli~hm~nt of cell lines is frequently associated with ~ccl~m~ tion
of mutations in vitro. To exclude such artifacts, RNA was isolated directly fromfrozen tumor samples. Lipomas ST92-24269 t(4;6) and ST88-08203 t(6;11) were
karyotyped and total RNA was purified from frozen tissues by cesium chloride
3 5 centrif~lg~tion. Next, ~mplifi-~tion of the HMGI lr~nsc~ L~ was performed using
3' RACE protocol. Upon analysis of the resulting reactions by gel electrophoresis,
SUB~ l l 1 U l ~ (RULE 26)
. .
CA 02259635 1999-01-06
WO 98/50536 PCT/US97/21299
- 28 -
aberrant HMGI(Y) products were readily detect~le (Figure not shown). At the
same time, HMGI-C expression was not detected in these tumors (Figure not
shown).
The anomalous HMGI(Y) cDNAs were further characterized by
sequence analysis. In lipoma ST92-24269, the Ll~nsc~ enro~ed for the S' end of
HMGI(Y) followed by a novel seq~erlre (Figure not shown). Comparison of this
latter sequence to the Genbank d~t~ba~e revealed that it was derived from the
3'UTR of wild-type HMGI(Y). PCR analysis of the genomic DNA from tumor
ST92-24269 determined the llallscli~t was produced by an internal deletion of both
exonic and intronic sequences (unpublished data) which removed 922 bp from the
wild-type HMGI(Y) cDNA (Figure not shown).
Seq~l~nrin~ of the aberrant transcript in lipoma ST88-08203 revealed
a fully intact HMGI(Y) open reading frame . A ~let~ile~ molecular analysis
demo~ dt~d that this ~.allsclil)t was produced by the removal of 923 bp of the
wild-type sequence from exon 8 (Figure not shown). I~ Lingly, the
rearrangement was limited to the 3'UTR of the gene, leaving the coding seq~le~reintact. The~,fole, the aberrant tlanscliyt~ isolated from the lipomas with
rearrangements of 6p21 are produced by internal deletions within the HMGI(Y)
gene. The fin-lin~ in both tumors were confirmed by an independent RT-PCR in
which an HMGI(Y)-specific reverse primer rather than oligo-(dT) was used for
reverse transcription and subsequent PCR (Figure not shown).
2 5 In lipoma ST92-24269, the predicted HMGI(Y) fusion protein
consists of the first two DNA-binding dom~in~ of HMGI(Y) fused in frame to an
ul~inlellupted open reading frame (ORF) encoding for 108 amino acid residues. A
~~et~ (l e~min~tion of the ORF revealed an llmls~ ly high content of proline
(17%) which is indicative of a potential transcriptional regulatory domain (Figure
not shown). Therefore, the overall structure of this HMGI(Y) fusion protein is
rern~rk~bly similar to ploteins produced by disruptions at 12ql3-15 which
juxtaposed DNA-binding domains of HMGI-C to ~L~Liv~ lldllscli~lional regulatory
domains.
3 5 Translation of the HMGI(Y) aberrant transcript in the tumor ST88-
08203 predicted a normal protein. In contrast, in previously described lipomas
SUB~ I l 1 u l ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
wo 98/50536 PCTtUss7/212ss
- 29 -
chirneric HMGI-C Llal sc~ encoded for novel fusion proteins whose formation
was proposed to be ~Pcec.c~ry for lipoma development. To establish whether
differences in the overall domain o.g~ ion of the HMGI(Y) and HMGI-C
fusion pfoLeills found in lipomas are due to the distinct propcllies of these two
5 genes, an additional tumor with HMGI-C rearrangement, lipoma ST91-198
t(12;15), was analyzed. RNA was isolated from the primary cell culture and 3'
RACE used to amplify the HMGI-C chimeric transcript (unpublished data). The
molecular analysis of this cDNA revealed that it preserved the first three exons of
HMGI-C that encode for the HMGI DNA-binding domains. However, the
10 endogenous HMGI exons four and five were removed and replaced by a
heterologous sequence (Figure not shown). Notably, an in-frame stop codon
present in this sequence tennin~tPs translation of the chimeric tl~nscli~t afteradding only ten amino acid residues to the HMGI-C DNA-binding domains. The
sequence of the novel peptide did not contain any distinguishing features and
5 revealed no .~i~nificant homology with known proteins. Chromosomal
rearrangement in tumor ST91-198 therefore results in a Ll~ t~l protein that
consists mainly of the HMGI-C AT-hooks. Accc)l-lingly, a simple truncation of
either HMGI(~) or HMGI-C is sufficient to cause lipomas.
2 o Lipomas Can Bypass Expression of the Wild-type HMGI Allele
Expression of the wildtype HMGI proteins is highly associated with
transformation and can be det~ctP-~l in a wide variety of tumors. Moreover,
inhibition of HMGI-C synthesis was shown to render several distinct cell types
2 5 intransigent to retroviral transformation, suggesting that HMGI expression is
required for tumorige~si~. Appreciable levels of wild-type HMGI(Y) expression
that were found in tumor ST88-08203 (Figures not shown~ are in agreement with
this hypothesis. Su~ ish~gly, the non-,calr~,lged allele was not expressed in
lipoma ST92-24269 (Pigures not shown) where an HMGI(Y) fusion protein was
3 0 i~lentifi~(l.
In lipomas with rearrange.l,ellLs of 12ql3-15, chimeric transcripts
are produced by the juxtaposition of HMGI-C with the heterologous sequences and
therefore cannot be readily ~mplifi~d in the same PCR reaction with the wildtype35 cDNA. To assess the expression of the wild-type HMGI-C in these tumors, the
highly polymorphic microsatellite sequence located in the 5' UTR of HMGI-C was
SUB~ l l 1 U 1~ ; l (RULE 26)
CA 02259635 1999-01-06
~ ~ W O 98/50536 PCT~US97/21299
- 30 -
employed. Oligonucleotide primers complimPnt~ry to the sequences fl~n1-ing this
polypyrimidine tract were synth~si~Pd and used for RT-PCR (Figure not shown).
Again, expression from the non-rearranged allele was only observed in the tumor
with a llullcated HMGI-C. No expression of the wildtype allele but not in the
5 lipoma ST93-724, in which HMGI-C DNA-binding dom~in~ were fused to LIM
domains, motifs that function in transcriptional regulation (Figure not shown).
Dirre~ t~d Adipocytes Express HMGI-C in Lipomas but not in Normal Fat
0 During development, the ~ ression of the HMGI proteins is tightly
regulated. HMGI expression is found in the developing tissues and organs of the
mouse embryo but es~Pnti~lly ~ s~re~rs by the end of h~ uLe~ e development
and can no longer be found postnatally. To confirm that HMGI ~x~-cssion in
lipomas is not a consequence of the endogenous HMGI expression by the adult
adipose tissue, immllnocytoch~ try was pel~l.ned with an antibody raised
against HMGI-C. In full agl.,emellt with llu~llel'uus previous finrljngc which
demonstrated that HMGI ~loleins are not eA~r~ ssed by diffclc~ te~l cells or adult
tissues, HMGI-C expression could not be ~3etected in the adult adipose tissue
(Figure not shown). Futhermore, RT-PCR with primers specific for HMGI-C and
2 o HMGI(Y) col-f,~ d that HMGI genes are not expressed in normal fat
(unpublished data). However, the majority of difr ,~ tecl adipocytes in these
neoplasms stained positively for HMGI-C (Figure not shown). Overall, HMGI-C
expression was detected in 75% (22 out of 29) of tumors (unpublished data).
2 5 Tr~n~o~tinn Bre~kl~oint,s U~.~t~ of the HMGI-C Gene in Uterine
L~;o.~ o-l,ala
FISH analysis was performed on metaphase cells from uterine
leiomyomata with chromosome 12 rearrangements (Table not shown) by use of
clones from the 5' and 3' ends of HMGI-C (Figure not shown). In contrast to
lipomas, where translocation occurs in frame following exon 3, both 5' and 3'
clones hybridized only, on the rearranged chromosome not derived from
chromosome 12, in addition to the normal 12 homolog, indicating that the entire
sequence encoding HMGI-C maps distal to the translocation breakpoint. In two
uterine leiomyomata with typical t(12,14) translocations (ST90-194 and ST93-738),
breakpoints mapped within the same lambda clones approximately 10 kb u~ .
SUB~ l l I U 1~ (RULE 26)
,
CA 022~963~ 1999-01-06
PCT/US97/21299
WO 98/50536
of exon 1 of HMGI-C (Figures not shown). These breakpoints were verified by
Southern blot analysis, a 3.3 kb probe from lambda clone H528 detect~d
rearranged bands in both tumors (unpublished data). In ST92-224, a uterine
leiomyoma with a variant translocation involving chromosome 1, the breakpoint
mapped within this same region, int1i~ting that this site on chromosome 12
contains a critical region for l~_a~ gell-ent regardless of the chromosomal origin
of the translocated material. FISH analysis of ST94-114, another uterine
leiomyoma with a characteristic t(12;14) revealed a breakpoint approximately 100kb S' of HMGIC. In two other uterine leiomyomata (ST93-165 and ST89-171),
breakpoints occurred more than 100 kb u~sll~,alll of HMGI-C as the most 5'
lambda clone in the contig (H121) is translocated to the der(l4) chromosome in
these tumors. ST89-171 contains two normal chromosome 12 homologs in
addition to a der(l4)t(12;14); therefore, hybridization signals corresponding tothree copies of HMGI-C were det~cte~l (Figure not shown). Finally, another
uterine leiomyoma (ST93-220) with an atypical cytogenetic rearrangement in whichthe involved segment of chromosome 12 appeared to be proximal in band ql3 was
determined by FISH to have a deletion starting approximately 10 kb upstream of
HMGI-C and ext~n~ling up to about 100 kb 5' of exon 1 of HMGI-C (Figure not
shown).
DISCUSSION
HMGI Proteins in Adipo~.-csis and M~ r~ -e Diffe~ lialion
In this study, chimeric ll~nsc-;pts were i~ ti~led from two lipoma
which resulted from fusion of the 5' end of the HMGI-C gene to novel sequences
derived from different chromosomes. Three DNA binding domains corlt~ining the
A-T hook motifs of HMGI-C are linked in these transcripts to seq~lPr~es encodingpotential transcriptional regulatory domains. In the case of lipoma ST90-375, the
3 o novel domain is highly acidic and rich in serine and threonine residues resembling
the typical activation domains found in transcription factors. In lipoma ST93-724,
the novel protein contains two LIM domains, motifs that promote protein-protein
interactions.
SUB~ 1 l 1 U 1~; S~;~; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 32 -
HMGI-C, Chimeric Transcripts and Lipomas
The chromosomal region 12ql4-15 is hypoth~si7e(1 to contain an
important gene involved in lipomas because it is the most commonly rearranged
5 site (Mandahl et al., 1988). Our study establishes that HMGI-C is the gene
disrupted in lipomas with chromosome 12 rearran~nPntC. The large intron (greaterthan 25kb) between exons 3 and 4 (li.ctinr-tly sepalaLes the DNA-binding from the
acidic domains of HMGI-C. This provides a subst~nti~l target for translocations so
that the three A-T hook motifs remain intact and confer the DNA-binding
o specificity of HMGI-C to the fusion ploleins.
HMGI-C is a 109 amino acid residue protein (Patel et al., 1994) that
consists of three DNA-binding domains (A-T hooks) linked to the carboxy-terminalacidic domain which does not activate transcription (Thanos and Maniatis, 1992;
5 X.Z. and K.C., unpublished data). The two lipoma translocations result in a novel
protein con~ining A-T hooks of HMGI-C at the amino-terrnin--c fused to
transcriptional regulatory dom~in~ at the carboxy end. The other reported example
for an A-T hook cont~ining gene implicated in tumorigenesis is MLL (Tkachuk et
al., 1992; Gu et al., 1992). However, the presence of a putative second DNA-
20 binding domain (Ma et al., 1993) derived from the MLL gene and retained in thefusion protein obscures the exact contribution of the A-T hooks to tumor
pathogenesis (Rabbitts, 1994). In these lipomas, the only known HMGI-C
functional domains retained in the fusion proteins are the A-T hooks. These motifs
would therefore be responsible for DNA binding specificity of the fusion proteins.
25 Although it is possible that simple truncation of HMGI-C is sufficient to cause
lipomas, a number of studies have ~lete~ i"~ that both domains of fusion proteins
are n~ces~ry for transforming activity (de Thé et al., 1991; Kamps et al., 1991;Pendergast et al., 1991; May et al., 1993). Therefore, as proposed for other
fusion proteins, the heterologous sequen~e in the lipoma fusion proteills would alter
3 o the biological activity of wildtype HMGI-C and lead to deregulation of do~ ea
target genes.
The above model readily explains how the fusion protein produced
in lipoma ST90-375 may function. The novel sequence from chromosome 15
3 5 encodes for an acidic peptide rich in serine and threonine residues. These features
have been observed in a number of Llansclip~ional activation domains (Mitchell and
SUB~ I l l u ~ ~;~1 (RULE 26)
.
CA 022.,963., 1 999 - 0 1 - 06
PCT/~JS97121299
WO 98/50536
- 33 -
Tijan, 1989) inrl~rling the carboxy-terminal domains of homeobox proteins
(Hatano et al., 1991) and NF-kB (Schmitz and R~e~erle, 1991). So, the
acquisition of a transactivation domain by the DNA-binding ~om~in~ of HMGI-C,
which normally possesses a transcriptionally inactive acidic domain, can easily be
reconciled with aberrant regulation of the HMGI-C target genes. In the case of the
t(3;12) in ST93-724, the fusion protein must operate by a dirrclelll meçh~ni~m to
deregulate the HMGl-C target genes. The novel seql)~nre from chromosome 3
encodes for two t~n~lPn-ly arranged LIM motifs. The LIM domain is conserved
amongst highly diverged species and LIM proteins have been shown to have
important developmental funrtio~ which include pattPrning (Cohen et al., 1992),
cell fate decision (Freyd et al., 1990) and dirr~.c.,lialion (Way and Chalfie, 1988).
LIM domain proteins are capable of protein-protein interactions (Sadler et al.,
1992) through dimerization m.orli~ted by the LIM domains (Feuerstein et al.,
1994). Therefore, LIM-LIM interactions bciwccn the ST93-724 fusion product
and other nuclear prolcills could recruit potential L.dilsc.iL,Lional regulators to DNA
sequences with a specificity ~irt~t~d by the HMGI-C A-T hook motifs.
Deregulation of HMGI-C target genes would then contribute to lipoma
development. It is h~cle;,ling to note that the majority of nuclear ~lOlCillS capable
of interacting with LIM domains are known to function as transcription factors.
These include several LIM-homeodomain ~loteins (S~n~h~7-GarcIa et al., 1993 and
references within) as well as basic helix-loop-helix proteins shPan-1 (Gennan etal., 1992) and TAL1 (Valge-Archer et al., 1994). While ovclc~ ession of LIM
proleins has been implicated in T-cell lymphom~ (reviewed by Sanrh~z-Garcia and
Rabbits, 1993), this is the first example of a LIM domain occurring in a fusion
2 5 product.
A great heterogeneity in chromosomal palln(,LS translocated with
12ql4-15 is found in karyotypically abnormal lipomas in~ir~tin~ that a large
number of sequences in the genome can be fused to HMGI-C. The present data
demonstrate that novel sequences linked to HMGI-C in two lipomas encode for
distinct domains. This suggests that a number of ~ltern~tive domains can be placed
dow"~ of the HMGI-C A T hooks and contribute to the pathobiology of
lipomas. Il~ ingly, both novel sequences described in this study encode for
transcriptional regulatory domains. Therefore, the choice of novel sequences in
chimeric lla"sc,i~l~, in lipomas is p,csu~-,ably not arbitrary but does require the
presence of regulatory transcriptional dc~ in~ ~tt~rll~d to the HMGI-C A-T hooks.
SUB~ 111 U 1~ ; l (RULE 26)
~ . . .. . . .. . .
CA 022~963~ 1999-01-06
~ ' WO 98/50536 PCT/I~S97/21299
- 34 -
A similar situation has been observed in the llq23 acute lel-k~mi~ where the MLLgene is translocated with multiple chromosomal partners which mostly encode
different types of Llal~c.i~tional regulatory domains (Prasad et al., 1994). This
could be a general m~rh~ni~m for tumors where nonrandom rearrangenlellls of a
5 specific chromosomal region involve a variety of partners. Chimeric transcription
factors that promote tumorigenesis would be produced by juxtaposing DNA
binding domain(s) contributed by the collsi~L~lltly rearranged locus to distinct ~ypes
of transcriptional regulatory domains.
0 HMGI-C, Pygmy and Adipogenesis
The above studies demonstrate that an altered HMGI-C protein is
involved in the abnormal growth and development of fat cells reslllting in lipomas.
This leads to the possibility that HMGI-C may normally play a role in adipogenesis
5 and analysis of the pygmy mouse strongly sukst~nti~tPs this hypothesis. The mouse
mutant, pygmy, was found to be a null mutation of HMGI-C due to deletions
within the gene (unpublished results). The obvious phenotypic characteristics ofthe pygmy mouse are its small stature with most tissues reduced cornmP...c...at~with the overall decrease in weight of the mouse (40~ of wildtype). Il~ c~lhlgly,
20 one tissue disproportionately reduced in weight is body fat. The fat index, areliable in~lirator of total fat content relative to body weight (Rogers and Webb,
1980), is approximately eight times lower in pygmy than in their wild-type
itt~rm~tlos (Benson and Chada, 1994). The function of HMGI-C in adipogenesis
could be related to its role in cells undergoing dirrerelltialion. It is expressed in
25 less difr~rellLiated cells but no det~ct~hle levels are observed in their terminally
dirr~ ted coullL~,~a,Ls (Vartainen et al., 1988; Giancotti et al., 1987).
Therefore, lack of HMGI-C expression, as found in the pygmy mouse, could affect
the differentiation of preadipocytes into mature adipocytes, cells capable of lipid
storage. This developmPnt~l abnormality would lead to a decrease in fat deposition
30 and the phenotype observed in the pygmy mouse. The role of HMGI-C in
adipogenesis and metabolic disorders such as obesity is thus of considerable
interest.
SUB~i 1 l 1 U l ~ (R~JLE 26)
. .
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 35 -
HMGI-C Inactivation Results in Reversion of the Obese Phenotype
The above observations suggested that HMGI genes play a pivotal
role in the growth and development of fat tissue and that they may be involved in
5 obesity as well. To address this latter question, expression of HMGI genes in fat
tissue obtained from normal and morbidly obese animals was determin~d
Signific~ntly, while HMGI-C expression was absent from fat tissue of nbrmal
mice, .~ignifir~nt expression was readily ~letect~ble in l~NA isolated from fat of
obese and diabetic mutant mice, two widely accepted models of obesity (Figure
0 12). A similar result was obtained with HMGI(Y) gene, whose expression in
obesity was dr~m~tic~lly elevated (Figure 12).
The above experiment demonstrated that expression of HMGI
proteins in obesity is increased 10 to 100 fold and that HMGI inactivation could be
5 used to regulate the amount of adipose tissue in vivo. Therefore, an attempt was
undertaken to regulate obesity by inhibiting the biological activity of the HMGIproteins. The term "HMGI genes" or "HMGI proteins", as used herein refers tO
both HMGI-C or HMGI(Y) genes or ~loLehls, rc;s~e~ ely.
2 o A classical mouse mutant called obese was selected for this
experiment. The obese phenotype has previously been well characterized and its
most prominent characteristic is a pathological weight gain due to an excessive
food intake (Green, 1989). Mice homozygous for the obese mutation acc~lm~ t~?
signifi~nt amounts of adipose tissue and reach the weight of 80 grams as opposedto 25 grams in normal animals. Recently, the gene responsible for the obese
phenotype has been cloned and was found to produce a hormone secreted by the fatcells (Zhang et al., 1994). Leptin, as this protein was called, is thought to beinvolved in the reg~llation of appetite, and its absence in the obese mutant leads to
overeating and obesity (Rink, 1994).
To revert the obese phenotype, HMGI-C gene was inactivated by
homologous recombination (Zhou et al., 1995) and the resulting mice were bred
with the obese mut~nt~. During the experiment, male and female mice were
m~int~in~ under altern~ting 12-h light and dark periods and provided water and
food ad libitum. Since both ob/ob and pg/pg animals are sterile (Green, 1989),
crosses were carried out in two stages. First, a pg/+Xobl+ intercross was
SUBSTITUTE S}~;~; l (RULE 26)
CA 022~963~ l999-0l-06
~ ' WO 98/50536 PCT/US97/21299
-36-
undertaken and the progeny from this cross were genotyped using Southern blotting
and PCR amplification. To screen for obese mutation, DNA was isolated from the
mouse tails by standard methods (Sambrook et al., 1989) and PCR amplified using
sense primer S'-CATTCTGAGTTTGTCCAAGATGC-3' and antisense primer 5'-
GGTCTGAGGCAGGGAGCAGC-3'. PCR conditions were as follows:
denaturation at 95~C for 2 mimltes and 30 cycles of amplification at 94~C for 30seconds, 58~C for 30 seconds and 72~C for 30 seconds, followed by a final
extension for 10 mim~tes at 72~C. The res~lting PCR products were digested with
DdeI and electrophoresed on 8% polyacrylamide gel. Under these conditions,
0 amplification of the wildtype allele yields 150 bp products which contains no DdeI
restriction sites. The ob mutation substitutes T for C in position 369,gen~"~atil.g a
novel DdeI site. Therefore, digestion of the PCR product from mutant allele
generates unique products of 106 and 44 bp. Genotyping of the HMGI-C knockout
mice was carried out as described previously (Zhou at al., 1995). The double
15 heterozygous ~nim~l~ (pg/+ ob/+) thus identified were intercrossed again and the
double homozygotes (ob/ob pg/pg) obtained from this second cross were further
analyzed.
Surprisingly, inactivation of HMGI-C produced a complete reversal
20 of obesity in the leptin-deficient mice (Figure 13). In the absence of HMGI-C,
pg/pg ob/ob mice did not develop an excess of adipose tissue and their body weight
stayed at the normal level of 25 grams as opposed to 80 grams in ~/+ ob/ob
anim~l~. A similarly dramatic effect was observed in mice which were
homozygous for ob mutation but heterozygous for HMGI-C inactivation (pg/+
2 s ob/ob). In these animals the amount of fat tissue was signific~ntly reduced and the
body weight decreased from 80 to 65 grams, even though these animals preserved
one of the two HMGI-C alleles intact and e~lessed 50% of the normal HMGI-C
levels. This result specifically proved that inhibition of HMGI biological activity
can be used to regulate growth and development of adipose tissue in m~mm~l~
3 o since less than a 100% HMGI inhibition results in a reduction in the amount of fat
tissue.
Just as importantly, this reduction in weight was accompani-~ by a
decreased food intake in the previously obese animals (Figure 14). Inhibition of35 HMGI-C biological activity resulted in a decrease of food intake from 7.25 grams
in +/+ ob/ob ~nim~ to 3.75 grams in pg/pg ob/ob mice (Figure 14). Therefore,
SUB~i 1 l 1 U 1~ ; l (RULE 26)
.,
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
the effects of HMGI inhibition are not limited to growth and dirr~"ellLiation ofadipose tissue but also result in an almost two-fold decrease in daily food intake.
It is important to consider the effects of HMGI inhibition in another
5 mouse mutant called "diabetes" (db). This model of human obesity and diabetes,characterized by excessive food intake, increased body weight and elevation of
blood sugar, results from an inactivating mutation in leptin receptor (Chen at al.,
1996). Therefore, our ability to prevent the detrimental effects of leptin deficiency
in obese mice via inactivation of HMGI genes in~lir~t~ that inhibition of HMGI
0 biological activity will be beneficial in various disturbances of leptin molecular
pathway, e.g., mutations of leptin receptor and/or leptin resi~t~nre. Signific~ntly,
resistance to normal or elevated levels of leptin may be an important factor in
human obesity (Tartaglia et al., 1995).
In combination, these results conclusively demonstrate the role of
HMGI genes in obesity and provide proof-of-principle evidence that inhibition ofthe HMGI biological activity can be used to control the growth and development of
adipose tissue such as occurs in obesity. Ir~hibition of the HMGI biological activity
can also be used to regulate the amount of carcass fat in farm anirnals if, for
2 o example, an animal lacking adipose tissue is desired.
The term "biological activity", as used herein, means the ability of
HMGI proteins to regulate and promote growth and development of adipose tissue
or the ability of the HMGI proteins to form transcriptional regulatory complexesand regulate transcription of other genes. Such inhibition is effected using theconventional means known in the art as described in greater detail in the following
non-limhing examples.
Relevance of HMGI Family in Tumors with Rearr~n~emPntc of 12ql3-15 or 6p21
Of major importance is the frequent observation of chromosomal
rearr~n~mPnt~ in bands 12ql3-15 in a large group of benign solid tumors. Most
~ro-,-i,u.,lly, these include uterine leiomyomata (Nilbert and Heim, 1990; Rein et
al., 1991), and pleomorphic adenomas of the salivary gland (Sandros et al., 1990;
3 5 Bullerdiek et al., 1993). Rearr~n~em~ntc of 12ql3-15 have also been reported in
pulmonary chondroid hamartomas (Dal Cin et al., 1993; Fletcher et al., 1995),
SUB~ 11 l U l ~; S~;~; 1 (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 38 -
endometrial polyps (Vanni et al., 1993), epithelial breast tumors (Rohen et al.,1993), hemangiopericytoma (Mandahl et al., 1993a), chondromatous tumors
(Mandahl et al., 1989, 1993b; Bridge et al., 1992; Hirabayashi et al., 1992),
diffuse astrocytomas (Jenkins et al., 1989), parosteal lipoma (Bridge et al., 1995),
5 and a giant-cell turnor of the bone (Noguera et al., 1989) Many of these tumortypes are of mesenchymal origin and it has therefore been hypoth~ci7~d that a
single gene associated with growth and mesenchyme may be responsible for these
multiple neoplasms (Schoenberg Fe3zo et al., 1995). Several lines of evidence
implicate HMGI-C as a strong c~n~ te for such a gene at 12ql4-15. First,
0 physical mapping studies have shown chromosomal breakpoints for three of thesebenign tumors (lipoma, pl~lmon~ry chondroid l~ a,lo~lla and uterine leiomyoma)
to map within a single YAC (Schoenberg Fejzo et al., 1995). This study assigns
HMGI-C to the translocation breakpoint in lipomas, and chromosomal breakpoints
in five analyzed uterine leiomyomata as well as a pl-lm~n~ry chondroid hamartoma5 have been found to reside within 10-lOOkb of exon 1 of HMGI-C (unpublished
results). Second, the role of HMGI-C in growth control is apparent because its
disruption in the pygmy mouse leads to aberrant growth and development. Also, ithas been shown in vitro that HMGI-C is required for transfo~nation (Berlingieri et
al., 1995). Finally, prelimin~ry studies reveal that e~pre~sion of HMGI-C during2 o mouse embryogenesis is restricted mainly to the m~senrhymal component of tissues
and organs (unpublished results). Taken together, these data in-lic~te that HMGI-C
is highly likely to be the gene disturbed by 12ql4-15 rearrangements in a numberof tumors of m~senrhymal origin.
2 5 Nonrandom involvement of 6p21-23 has also been observed in
lipomas (Sre~ nt~i~h et al., 1991), pulmonary chondroid hamartomas (Fletcher et
al., 1992, 1995) and uterine leiomyomata (Nilbert et al., 1990~ e~ gly,
HMGI(Y), the other member of the HMGI protein family with a similar structure
as HMGI-C that includes the three DNA-binding domains, has been localized to
3 o 6p21 (Frie(lm~nn et al., 1993) This raises an intriguing possibility that HMGI(Y),
a molecule closely related to, but distinct from HMGI-C, could also be associated
with benign tumors of m~senrhymal origin.
In s~ y, a disruption of the HMGI-C gene resulting in chimeric
~.~nsc,i~l~ is a characteristic feature of lipomas. As adipocytes play a key role in
lipid homrost~ and m~i"~ re of energy balance in vertebrates, an
SUBS 1 l l U 1~; S~ET (RULE 26~
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 39 -
underst~n~lin~ of HMGI-C function in adipogenesis may lead to insights into
obesity and other metabolic disorders. In addition, the obvious role of HMGI-C in
normal growth demonstrated by the phenotype of the pygmy mouse and its
loc~li7.~tiQn at or adjacent to the translocation breakpoints in lipoma, uterine5 leiomyoma and pulmonary chondroid hamartoma suggests its fim-l~mPn
involvement in a variety of benign tumors.
HMGI Proteins in M~mm~ n Growth and Development
0 The current study demonstrates that the absence of HMGI-C causes
growth retardation in pygmy mice. Although the precise molecular mrch~ni~m
remains to be elucidated, the function of HMGI prol~ills in cell proliferation could
be regulated during the cell cycle through alteration of their DNA binding ability
via phosphorylation by the cell cycle-dependent p34cdc2 kinase (Reeves, R. et al.,
1991). Inactivation of the HMGI-C gene would perturb the cell cycle in the
developing embryo and the resulting disruption of growth would produce the
pygmy phenotype. The identific~tion of the pygmy gene as HMGI-C provides
novel insights into the control of m~mm~ n growth and development and a
molecular clue.to investigate the biochemical nature of the African pygmy
phenotype (Sinha, Y. et al., 1979) and a mllltit~l~le of growth hormone-resistant
human dwarf syndromes (Benson, K. & Chada, K., 1994).
Mis~l..e~ion of Disrupted HMGI Proteins in ~lm~r~ Tumors
HMGI(Y) and HMGI-C, two homologous but distinct members of
the HMGI family of archh~cll~ral factors, have now been shown to be disrupted inidentical tumors. Rearrangements of HMGI-C, first reported in lipomas, were
later described in other mesenchymally derived neoplasms with translocations of
12ql3-15. Similar to HMGI-C, disruptions of HMGI(Y) will presumably be also
3 o responsible for uterine leiomyoma, pl~lmon~ry hamartoma, pleomorphic adenomas
of salivary gland and other mesPnrhymal tumors with recurrent aberrations at
6p21-23.
SUB~ 111 U 1~ (RULE 26)
.
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 40 -
Rearrangements within HMGI Genes are Required for I,ipoma Development
In combination with previous studies on HMGI(C) and HMGI-Y, it
is now possible to glean novel insight into the molecular m~C~l~ni~m of tumor
5 formation in lipomas and, by extrapolation, in related solid rnes~rlrhymal
neoplasms. HMGI-C does not behave as a classical transforming oncogene since
overexpression of full-length HMGI-C cDNA does not result in tumorigenesis; On
the other hand, in all twelve analyzed lipomas, chromosomal rearrangements have
produced disruptions in translocated HMGI alleles. While expression of an HMGI
0 gene is n~ces.s~ry for tumorigenesis, activation of an intact HMGI allele in amesenchymal cell will not be suf~ nt to produce a tumor. Therefore, disruptions
within HMGI genes and the aberrant structure of the res--lting cDNA are requiredfor lipoma development.
A variety of the HMGI chimeric transcripts can be found in lipomas.
The comparison of these aberrant cDNAs demol~Lr~tes that rearrangements can
range from a simple internal deletion to protein truncation to juxtaposition of
ll~ns~ lional regulatory dom~in~ to HMGI DNA-binding ~om~in~. An aberration
common to these twelve lipomas is a deletion of or within highly conserved and
Imllsu~lly large and 3'UTR of an HMGI gene. The best example is lipoma ST88-
08203, where the aberrant Lla~ t codes for the wild-type HMGI(Y) and the
deletion is limited to its 3' UTR. Since translocations of 12ql3-15 which disrupt
3'UTR of HMGI-C while preserving its ORF are also observed in leiomyoma and
pleiomorphic adenoma of salivary gland, 3'UTRs of HMGI genes may contain
z5 important regulatory sequenres that function in growth regulation and/or tumor
suppression.
Notably, the aberrant L~allsc~il)t~ isolated from lipomas with
rearrangements of 6p21-23 were generated by internal deletions within the
3 o translocated HMGI(Y) allele. This observation suggests that in lipomas and related
benign mPse~-~hymal tumors, HMGI genes may contain internal deletions and other
submicroscopic rearrangements un~etect~hle by cytogenetic techniques. It is likely
therefore that the contribution of the HMGI genes to tumorigenesis is more
significant than predicted by karyotypic analysis.
SUBSTITUTE SHEET (RULE 26)
CA 022~963~ l999-0l-06
WO 98/50536 PCT/US9712l299
- 41 -
Misexpression of HMGI genes in a Dir~.e,lLiated Cell Results in Tumorigenesis
To understand the biological function of the HMGI proteins, it is
important to analyze their expression profiles during both norrnal and pathological
5 growth. Promin~ntly, high levels of the HMGI expression are observed during
mouse embryonic development in midgestation but it ess~nti~lly dissal,peal~ closer
to the end of prt;gnallcy. Subsequently, no HMGI expression can be detected in
any of the adult tissues. Lipomas are composed of mature adipocytes which, like
other terminally dirrel~l.liated cells, normally do not express HMGI proteins.
0 However, transcriptionally active HMGI alleles are consistently found in solid mlosçnrhymal tumors with rearrang~lllellls of 12ql3-15 and 6p21-23.
Rearrangements of 12ql3-15 or 6p21-23 activate an HMGI allele normally silent inadult cells and the res..lting misexpression of the HMGI protein in the context of a
dirl~lcllliated mesenchymal cell is a crucial step in tumor development. A notable
5 feature of this mecll~ni~m stems from the observation that during mouse
embryonigenesis, HMGI-C is expressed in the mPsenrhymal component of the
developing organs and tissues (unpublished data). Tumorigenesis in this case
results from the temporally h,applu~r;ate ek~lcssion in an adult cell of a gene that
is normally expressed during prenatal development in an embryonic cell of the
2 o same lineage. This is remini~ce~t of observations in B-cell leuk~mi~c where
rearrangements of 8q24 chromosomal area activate c-myc expression in a precursorcell of B-lineage and result in neoplasia. Unlike the HMGI family members,
however, the endogenous expression of c-myc is not restricted to embryogenesis
and its hlapplop..ate expression takes place at the same time in the life of the2 5 organism when it is normally expressed. Even more different is a situation in some
of the T-cell acute Iymphoid leuk~mi~c where the cause of neoplasia is ectopic
expression in T-cell precursors of HOX11, normally expressed in the embryonic
liver.
3 o Distinct Molecular Pathways of Tumorigenesis Exist in Lipomas
The molecular analysis of the lipomas described above yields
valuable information about the ~AI)les~ion state of the non-le~ llged HMGI
alleles. Wildtype HMGI ~A~ ,s~ion, normally associated with tumorigenesis, was
3 5 readily detectable in lipomas ST88-08203 and ST91-198, where chromosomal
rearrangements produced an apparently normal HMGI(Y) and a truncated HMGI-C
SUB~ U 1~; SHEET (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 42 -
proteins, respectively. In contrast, the non-rearranged HMGI allele was not
expressed in tumors ST92-24269 and ST93-724, where the aberrant HMGI
transc~ were predicted to encode fusion prot~hls consisting of the HMGI DNA-
binding domains fused to putative transcriptional regulatory domains.
The above fintiing~ indicate that there are at least two distinct
molecular pathways by which tumorigenesis in lipomas can proceed.- When a
chromosomal rearrangement produces a disrupted HMGI protein with no intrinsic
transcriptional activity, tumor development is dependent upon subsequent activation
0 of the non-rearranged allele. However, the requirement for wildtype HMGI
expression can be circumvented when, as a result of a translocation, a
transcriptional regulatory domain is juxtaposed to the HMGI AT-hooks. The
unlikely alternative mech~ni~m, in which the non-leallailged allele is activated by
the fusion protein through a positive HMGI regulatory m~ch~ni~m, would postulate5 that such autoregulatory function is inhibited in the presence of ~la~sc~i~lional
regulatory domains. Therefore, we conclude that distinct rearrangements of a
single gene can activate alternative molecular palllways of tumor pathogenesis.
Molecular analysis of HMGI rearrangements in multiple tumor
20 samples can now be combined with the ~Ayr~sion studies of both disrupted and
non-rearranged alleles to produce a m~rh~ni~tir~lly coherent model of lipoma
development (Figure not shown). Tumor development is initi~ted when the
chromosomal rearrangement disrupt an HMGI allele and results in the HMGI
misexpression in a dirr~,~ellliated mesen-~.hymal cell. Deletion within 3' UTR is
25 probably the minim~l rearrangement nPcess~ry for tumor formation Subsequently,
one of the alternative tumorigenic pathways is selected based on the precise nature
of the HMGl disruption. In the simplest model, the requirement for HMGI
expression in tumorigenesis could be circumvented if HMGI DNA-binding domains
are juxtaposed with a transcriptional regulatory domain (Pigure not shown). The
30 reduced number of events involved in tumor form~tion would readily explain the
most frequently observed translocation in lipomas, t(3;12)(q29;qlS), since it fuses
DNA-binding domains of HMGI-C with LIM domains, motifs that are thought to
function in lldnscli~tional regulation.
SUB~ 1 l 1 U 1~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCTIUS97121299
- 43 -
The HMGI Proteins Play Dirr.,leilt Roles in Tumors of Epithelial and
M~senrllymal Origin
Benign tumors, unlike their m~lign~nt cou~ ,al L~, are
5 characterized by a limited number of highly specific genetic alterations involving
only a few chromosomal regions. It was proposed therefore that the molecular
analysis of these neoplasms would identify genes of major importance for growth
and proliferation. The above studies with HMGI(Y) and HMGI-C in lipomas
demonstrate that misexpression of HMGI proteins plays a significant role in the
10 development of a diverse array of human solid tumors. Clinically, a prominentfeature of these benign mesenchymal tumors is the extremely low rate at which
they convert to m~lign~nry. Indeed, uterine leiomyomas progress to become
leiomyosarcomas in less than 0.01% of the cases while conversion of lipoma to
lipo~a.collla is even less frequent. Therefore, mise~lcssion of HMGI proteins,
5 while acting to increase the growth rate of the mesenchymal cells, does not seem to
predispose the overproliferating cell to m~ n~nt transformation and may even play
a protective role.
The apparent inability of the HMGI-expressing benign m~senrhymal
20 tumors to undergo m~lign~nt conversion is in a stark contrast with the situation
seen in the tumors of epithelial origin. In these latter neoplasms, cellular
hyperproliferation provides starting population for clonal expansion which, in turn,
is followed by a stepwise progression to m~lign~nry. Even more intriguingly,
epithelial cells cannot be transformed by overe~plcssion of HMGI-C while
25 chromosomal rearrangements which could disrupt HMGI-C and HMGI(Y) are not
found in tumors of the epithelial origin. Finally, in epithelial tumors activation of
HMGI expression is associated with the advanced stages of carcinogenesis rather
than with early hyperplasia. The asynchrony between the expression patterns of
HMGI proteins in epithelial and mesenchymal cells as well as distinct phenotypes3 o of the relevant tumors indicate that in tissues of dirrt~llL embryonic lineage HMGI
plolei-ls l~lrOl~ imil~r functions.
One possible explanation for this ph~nt~m~rlon is provided by the
fact that HMGI proteins normally function in the developing mesenchyma. The
3s role of HMGI proteins in m~senrhymal tumorigenesis may therefore be closely
related to that during normal development, such as growth rate regulation. In the
SUB~ 111 U 1~ ; l (RULE 26)
CA 022~963~ l999-0l-06
W0 98150536 PCT/US97/21299
epithelial tumors, the HMGI architectllral factors, expressed outside of their normal
cellular milieu, may be recruited to take part in the transcriptional regulation of
genes that are involved speci~r~lly in the ~mal stages of tumor progression, such as
invasion and metastasis. Regardless of the molecular details, the ability of HMGI-
5 C and HMGI(Y) to execute distinct functions during tumorigenesis in diverse celltypes provides a powerful testim- ny to the biological potency of the HMGI
proteins and accounts for the dramatic con~equenre~ of their disn~ption.
Tr~n~'~c~tinn Breakpoints UIJ~lre~ll of the HMGI-C Gene in Uterine
1 o LL;~.Ilyol~aLa
Translocation breakpoints in uterine leiomyomata reported here are
in stark contrast to those observed in lipomas and other benign mesenchymal
tumors in which translocations are found within the coding region of HMGI-C.
Unlike the f1n~ingc in uterine leiomyomata rearrangements in lipomas consistently
result in disruption of HMGI-C, whereby DNA-binding A-T hook domains are
separated from the 3' region of the gene. Recallce HMGI-C has no transcriptionalactivation domain (unpublished data), the pathobiology of lipomas appears to result
from juxtaposition of direct or indirect activation ~lom~inc with the DNA-binding
A-T hook ~r)m~in.c, although an ~ltern~tive explanation of truncation of the protein
cannot be ruled out at present.
These studies of uterine leiomyomata suggest a completely different
molecular mlocll~ni.cm because the entire gene appears to be retained, suggesting
that both the 5' DNA-binding domain and the 3 ' domain of unknown function are
n~CeS,c~ry. The finding that chromosomal rearrangements were located 10 to > 100kb upstream of HMGI-C in seven uterine leiomyomata suggestc that breakpoints
might disrupt regulatory elem~ontc and alter the normal expression of HMGI-C,
analogous to Burkitt lymphoma, where translocations up to 100 kb upstream of
3 0 MYC result in aberrant e~ ession and neoplasia.
This "regulatory hypothesis" is supported by cytogenetic and FISH
results for the karyotypically variant uterine leiomyoma ST89-171. In this tumor,
three copies of HMGIC were present, suggesting a dosage meeh~ni.cm for altered
3s expression levels. Additionally, loss of the der(12) chromosome in ST89-171
SUBSTITUTE SHEET (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 45 -
provides further evidence that the der(14) chromosome, to which HMGI-C maps,
contains the critical sequence.
This observation of an i-ller~ ial deletion upstream of HMGI-C in
5 one uterine leiomyoma with a variant rearrangement of chromosome 12 is
important for the cytogenetic and molecular intel~retation of rearrangements in
uterine leiomyomata and other tumors. This finding implies that uterine
leiomyomata with unusual cytogenetic rearrangements of chromosome 12, and
possibly other mesenchymal neoplasms without microscopically ~etect~ble
0 chromosome 12 rearrangements, may have submicroscopic rearrangements of a
critical region upstream of HMGI-C. Characterization of HMGI-C expression in
uterine leiomyomata of all cytogenetic subgroups is now warranted for a more
complete underst~n~ing of the pathobiologic rmPch~ni~m.
Furthermore, this hlle.L,lcl~tion of a mPcll~ni.cm for dysregulation of
HMGI-C in uterine leiomyomata is s~lbst~nti~tPd by observation of a rearrangement
in a fibroid involving chromosomes 8 and 12 in which the 3' UTR of HMGI-C is
di~lup~ed. Such a rearrangement results similarly in retention of the entire coding
region of HMGI-C, a finding previously noted in variant translocations in Burkitt
2 o lymphoma. However, this translocation breakpoint mapping in uterine
leiomyomata and the deregulation model differ largely from that reported by others
in which intragenic breakpoints were found for some fibroids perhaps reflecting the
relatively limited number of tumors analyzed. Alternatively, although there are no
data to support the existence of alternative 5' exons of HMGI-C or other
uncharacteristic genes in the region, such possibilities, which might be affected by
chromosomal rearrangPment and contribute to tumor biology, cannot be excluded.
Regardless, a mPch~ni.~m of dysregulation not involving a filsion transcript must
be considered for tumors without intragenic rearrangements of HMGI-C because
irrefutable data implicate HMGI-C as the critical gene in benign mes~pnrhyma
3 o tuInors with rearr~n~mPnts of 12ql4-15 .
These fin-ling~ are con.~ tent with acc~m~ ting evidence for a
primary role of HMGI-C in normal growth and dirr~ tiation of a variety of
tissues. Besides expression of fusion tl~nscli~t~ in lipomas and other benign
3 5 mesenchymal tumors and in tnesen~ymal collll)ol~ellls of tissues in the developing
mouse embryo, expression of HMGI-C is found only in cells after they become
SUB~ U l ~; S~;~; 1 (RULE 26)
CA 02259635 l999-0l-06
PCT/US97/21299
WO 98/50536
- 46 -
transformed and has been found to be n~cess~ry, but not sufficient7 for
ru~ tiQn These studies indicate that HMGI-C also may be deregulated
through translocation in uterine leiomyomata without involvement of a fusion
transcript.
The present invention is further illustrated by the following examples
which are not intent~ed to limit the effective scope of the claims. All parts and
percentages in the examples and throughout the specification and claims are by
weight of the fimal composition unless otherwise sE~ecifiPd.
Examples
HMGI Proteins in A~ o~ and M~i..rl~yl.,e Differçn~i~tinn
The GenBank ~Cces~ion numbers for the novel sequences in the
chimeric transcripts from ST90-375 and ST93-724 are U28131 and U28132,
respectively.
Isolation of YACs at the Human Pygmy Locus
Initially, conserved fr~gmPnt~ were isolated from the cloned, mouse
pygmy locus (Xiang et al., 1990; K. Benson and K.C., unpublished observations)
and were used as probes on a normal, human lambda genomic library (Sambrook et
al., 1989). The cross-hybridizing clones were isolated and relevant homologous
2 5 fra~m~ntc were subcloned and sequenced. Specific oligonucleotide L~ e~s
(sequen~e 5 ' -AGGGGACAACAAATGCCCACAGG and 5 '-
CGTCACCAGGGACAGTTTCACTTGG) were synthP~i7ecl and used to screen a
human total genomic YAC library by the PCR-based method (Green and Olson,
1990). Four positive clones of Saccharomyces cerevisiae cnnt~ining YACs
3 o yWPR383, yWPR384, yWPR385 and yWPR386 were isolated.
Construction and Screening of Phage Libraries
High molecular weight DNA was isolated from yeast strains
harboring YACs yWPR383 and yWPR384 (Guthrie and Fink, 1991), and partially
digested with Sau3A. After partial fill-in of the Sau3A site, DNA was subcloned
SUB~ 111 U l ~ (RULE 26)
_
CA 022~963~ 1999-01-06
PCT/US97/21299
WO 98/50536
- 47 -
at the partially filled XhoI site of the predigested lambda FIXII vector (Stratagene,
La Jolla, CA) and packaged in vitro (GIGAPACK II p~cl~gin~ extract,
Stratagene). To select clones derived from the human YACs, 6000 plaques from
each library were probed with total human genomic DNA and hybridizing plaques
were spotted on plates inoculated with SRB(P2) cells in a gridded array. After
incubating the plates at 39~C for 12 hours, plaques were transferred onto
DURALON (Stratagene) membranes. These grids were used for identifying
lambda clones that cont~in~d human HMGI-C exons by probing with mouse
HMGI-C cDNA (unpublished results), using the same hybridization conditions as
0 detailed below for Southern analysis. Overlaps between contiguous clones and
colinearity with the genome were confirm~cl by a combination of clone to clone and
clone to genomic hybridizations along with restriction mapping.
Southern Blot Analysis
10-12 mg of human DNA was digested with the ~plopliate
restriction enzymes, products resolved on 0.8% agarose gels and transferred ontoDURALON (Stratagene) membranes. Blots were treated with prehybridization
solution (50% fonn~mi~lP, Sx SSC, 10x Denhardt's solution, 0.05M sodium
phosphate pH 6.8, 0.001M EDTA, 0.01 mg/ml denatured salmon sperm DNA,
and 0.2% SDS) for 2 hours at 42~C. Probes were added to the hybridization
solution (50% form~mi-le, 5x SSC, lx Denhardt's solution, 0.02M sodium
phosphate pH 6.8, 0.001M EDTA, 0.01 mg/ml dellalul~d salmon sperm DNA,
0.2% SDS and 10% dextran sulfate) and hybridization was performed for 16 hours
at 42~C. Membranes were washed with 2x SSC, 0.001M EDTA, 0.5% SDS,
0.05% NaPPi and 0.01M sodium phosphate pH 6.8, at 65~C for 3 x 1 hour
periods and exposed to X-ray film at -70~C with i~ sirying screens.
I~entifir~tiQn and Characterization of Chimeric Transcripts
First strand cDNA was synth~si7~d in a 20 ml reaction using an
anchored oligo-dT primer S'-GCAATACGACTCACTATAG(T)13 and Superscript
II RT reverse llallscliylase (BRL, Gaithersburg, MD) according to the
m~nllfactl~rer's protocol. Primers used in the first round of 3' RACE (Ausubel et
3 5 al., 1989) were an HMGI-C exon 1 sense primer 5'-
CTTCAGCCCAGGGACAACC and an ~ en~e adapter primer 5'-
SUBSi 1 l 1 U 1~ ; l (RULE 26)
CA 022~963~ 1999-01-06
PCT/US97/21299
WO 98/50536
- 48 -
GCAATACGACTCACTATAG. One ml of first-strand cDNA was combined with
25 pmole of sense primer in a 50 ml reaction mixture (60 mM Tris-SO4 (pH 9.1 at
25~C); 18 mM (NH4)2S04; 2 mM MgSO4; each dNTP at 200 mM; 2.5 U of Taq
DNA polymerase (BRL)), denatured for 2 minllt~~ at 94~C and subjected to 5
cycles of linear amplification (Rother, 1992) using the following conditions: 94~C,
30 seconds; 58~C, 20 seconds; 72~C1 1 minute 30 seconds. Ten pmole of
antisense primer were then added and 25 cycles of exponential amplification wereperformed (94~C, 30 seconds; 56~C, 30 seconds; 72~C, 1 minute 30 seconds).
One ml of the PCR reaction was reamplified for 20 cycles with a nested HMGI-C
o sense primer spanning exon 1 and 2, 5'-GGAAGCAGCAGCAAGAACC as
described above. Five ml of each reaction were analyzed on a 1.5% agarose gel.
Reverse l.anscIi~tion for the detection of chimeric transcripts using novel
sequence-specific primers was p~Iro.I.led as above except primers 375 (5'-
CTTCTTTCTCTGCCGCATCG) for ST90-375 and 724 (5'-
GTGAGGATGATAGGCCTTCC) for ST93-724 were used. Subsequent PCR
conditions were an initial denaturation at 94~C for 2 ~ ules; 30 cycles at 94~C,30 seconds; 58~C, 30 seconds; 72~C, 1 minute, followed by a final extension for
10 mimltPs at 72~C.
2 o Chimeric transcripts amplified by 3 '-RACE and Rl'-PCR were
isolated from the gel, blunt-end cloned by standard methods (Sambrook et al.,
1989) into the pCR-Script vector (Stratagene) and sequenced using the Sequenase
kit Version 2.0 (USB, Cleveland, OH).
2 5 Chromosomal T .oc~1i7~tion of Novel Seql~Pn~es
The NIGMS monochromosomal somatic cell hybrid mapping panel
#2 was obtained from the Coriell Cell Repositories (Coriell ~n~tin-te for Medical
Research, Cam~en, NJ). Primers used were derived from the novel sequences of
the chimeric ~Idnscli~ts and 500 ng of genomic DNA from each somatic cell line
was used as a template for PCR amplification. For the novel sequence derived
from the chimeric transcript obtained from lipoma ST90-375, the primers were 5'- CAGAAGCAGACCAGCAAACC and 5~ lcTcTGccGcATcG and
from lipoma ST93-724, the primers were S'-CTCTGGAGCAGTGCAATGTG and
3 5 S'-GTGAGGATGATAGGCCTTCC. PCR con~itiol-~ for the ST93-724 novel
sequence primers were 26 cycles of 94~C, 15 seconds; 64~C, 30 seconds; 72~C, 1
SUB~ 111 U 1 k~ 1 (RULE 26)
*rB
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 49 -
minute. For ST90-375, the same conditions were used except that the ~nnP~ling
temperature was 62.5~C. PCR products were analyzed on a 7% acrylamide gel.
Tumor C~ell Lines and Chromosome Preparations
Lipoma specimens were obtained from patients at the time of
surgery. Tumor culture, metaphase chromosom~- harvesting, slide preparation, andtrypsin-Giemsa banding were performed as described previously (Fletcher et al.,
1991). Met~ph~es with rearrangements of chromosome 12 in band ql5 were
0 identified and corresponding cell pellets stored in fixative at -20~C were used to
prepare slides for FISH. These slides were stored at room temperature for at least
10 days prior to hybridization.
Lambda clones shown in Figure 1 were mapped to lipoma tumor
metaphase chromosomes from ST90-375 [46,XX,t(12;15)(ql5;q24)], ST91-198
[46,XX,t(12;13)(qlS;q21-32)], and ST93-724 [46,XX,t(3;12)(q29;qlS)]
Karyotypes for lipomas ST90-375 and ST91-198 have been reported previously
(Fletcher et al., 1993).
2 o FISH with Lambda Clones
Slides for FISH were prepared as leco"~",~n-le~l in the Hybridization
Kit (Oncor, Gaithersburg, MD) except for denaturation at 68~C for 30 seconds.
Lambda probes were labeled with digoxigenin-11-dUTP (Boehringer Mannheim,
2 5 ~nrii~n~rolis, IN) using 1 mg of the appropriate lambda DNA using dNTPs
obtained from Boehringer Mannheim and the DNase l/DNA polymerase I mix
from the BioNick Labeling System (BRL). Labeling reactions were performed at
16~C for 2 hours. 500 ng of digoxigenin-labeled lambda probe was lyophili7Pd
with S mg of Cot-l DNA (BRL) and resllspen~d in 20 ml deionized water. 2 ml
3 o of resuspended probe was added to 9 ml Hybrisol VI (Oncor). The lambda probe
was denatured, hybridized to slides, and washed according to standard protocols
(Oncor). Digoxigenin-labeled lambda clones were detecte(l using the fluorescein-labeled antidigoxigenin antibody (Oncor) according to the m~mlfactllrer~ s
recomm~n~l~tions. Metaphase chromosomes were counterstained with 4,6-
3 5 di~mitiinQ-2-phenylindole-dihydrochloride (DAPI) according to the protocolsupplied by Oncor. Hybridization was observed using a Zeiss Axioskop
SUB~ 1 l 1 U 1~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US9~/21299
- 50 -
microscope and images captured with the (:~ytoVision ~m~ging System (Applied
Tm~ging),
Fig~res l(A) and l(B) illustrate the genomic structure of the human
HMGI-C gene. Figure 1(A): 403, H409, H5003, H1001 and H4002 are genomic
lambda FIXII clones (see Materials and Methods) that contain the five exons (El -
E5) of the human HMGI-C gene. Figure l(B): Exons are denoted by boxes and
introns by a line. Overlapping lambda clones were not obtained within intron 3
and this region is denoted with a dashed line. Sequences encoding potential
0 functional domains, AUG and UAG codons are shown in the exons. The A-T
hook motifs of the DNA-binding domains are shown as stippled areas and the solidregion (in E5) encodes for the acidic domain of unknown function. The Figure is
not drawn to scale because of the large 5' and 3' UTRs.
Figures 2(A) through 2(F) illustrate FISH mapping of HMGI-C
lambda clones to lipoma tumor metaphase chromosomes from three lipomas
revealing rearrangement of HMGI-C in all three tumors. The normal chromosome
12 homologs provide internal positive hybridization controls and are marked by
yellow arrows in each metaphase, while derivative chromosomes are marked by
red arrows. Lambda clones H403 and H409 from the 5' end of HMGI-C were
used as FISH probes to lipoma met~rh~c~ chromosomes from Figure 2(A) ST90-
375 and Figure 2(C) ST93-724, respectively. Note hybridization on the normal
chromosome 12 and the der(12), demonstrating that these clones map pro~cimal to
the breakpoint in both lipomas. In contrast, when H403 was hybridized to lipoma
metaphase chromosomes from Figure 2(E) ST91-198, hybridization was observed
on the der(13) showing a map position distal to the breakpoint in this tumor.
H4002 from the 3 ' end of HMGI-C was used as a FISH probe to lipoma metaphase
chromosomes from Figure 2(B) ST90-375 and Figure 2(D) ST93-724; note
hybridization on the normal chromosome 12 and the der(15) or der(3),
respectively, i~ ting that these clones map distal to the breakpoint in both
lipomas. However, FISH with H4002 from the 3' end of HMGI-C on Figure 2(F)
ST91-198 revealed hybridization on the normal chromosome 12 only, suggesting
this clone is deleted from either der (12) or der(15) in this tumor. Met~rh~ce
spreads were counterstained with DAPI. Lipoma karyotypes are: ST90-375,
t(12;15)(ql5;q24); ST93-724, t(3;12)(q29;ql5); ST91-198, t(12;13)(ql5;q21-32).
S~JBSTITUTE ~ (RULE 26)
CA 0225963~ l999-0l-06
W O 98/50536 PCT/US97/21299
.
- 51 -
Figure 3 illustrates RT-PCR amplifi~tion of HMGI-C chimeric
llallscripl~. 3' R~CE on RNA from lipomas ST90-375 (375) and ST93-724 (724)
yield 441 bp and 672 bp products. Reverse llailsc~i~Lion was ~e,ro~ ed with an
oligo-dT prirner linked to an adapter sequence and was followed by a nested PCR
with sense primers from exon 1 and sp~nnin~ exons 1 and 2. DLD-1 is a
colorectal adenocarcinoma cell line that expresses wild-type HMGI-C (data not
shown) but under these conditions, the predicted 3.1 kb wild-type message was not
amplified. Products were analyzed on a 1.5% agarose gel. M are molecular
weight markers in kilobases.
Figure 4 illustrates rearrang~ ellL~ of 12ql5 in human lipomas
which disrupt the HMGI-C gene and produce chimeric transcripts. HMGI-C
denotes the nucleotide and amino acid sequence of the wildtype gene and the openbox sequence corresponds to the end of HMGI-C exon 3. t(3;12) and t(12;15)
refer to the nucleotide and predicted amino acid sequences of the chimeric
transcripts from the cloned cDNA products obtained by 3' RACE on RNA isolated
from prirnary cell cultures of ST93-724, t(3;12), and ST90-375, t(l2;15),
respectively. Chr. 3 and Chr. 15 refer to the novel sequences derived from
chromosome 3 or 15 in t(3;12) and t(12;15) lipomas, r~spe~ ely. Only the
sequences immPrli~tely adjacent to the fusion sites are shown.
Figure 5 illustrates RT-PCR using primers located on either side of
the fusion site between HMGI-C and novel sequences. RNA refers to the lipoma
source of total RNA. Primer 375 is an oli~onucleotide that is complementary to
the novel sequence from the chimeric kailscli~t of lipoma ST90-375 and is located
8 nucleotides dowll~ a,ll of the fusion point. Primer 724 is a comple~nent~ry
oligonucleotide to the novel sequence from the chimeric transcript of lipoma ST93-
724 and is located 425 nucleotides downstream of the fusion point. Total RNA
from both lipoma primary cell cultures was reverse transcribed using either 375 or
3 o 724 primers and PCR amplified using HMGI-C sense primer (which spans exons 1
and 2) and the ~nti~Prl.~e primer used for reverse lldns~ lion. Expected productsizes are: 180 bp from ST90-375 cDNA with 375 primer and 597 bp from ST93-
724 cDNA with 724 primer.
Figures 6(A) and 6(B) illustrate novel sequences fused to the DNA
binding-domains of HMGI-C which encode transcriptional regulatory domains.
SUBS 111 U ~ (RULE 26)
*rB
CA 022~963~ l999-0l-06
WO 98/50536 PCTAUS97/21299
- 52 -
Figure 6(A) illustrates a comparison of the novel chromosome 3 sequence from
ST93-724 with the LIM domain-cont~ining proteins, zyxin (Sadler et al., 1992),
apterous (ap) (Cohen et al., 1992), Lh2 (Xu et al., 1993), Linll (Freyd et al.,
1990), ~BTN-l (McGuire et al., 1989). Amino acids that con~ti~lt~ the LIM
domain consensus are highlightPd. The amino acid spacing between the consensus
residues is iTl~lir~ted by an x. In addition to the totally conserved cysteine,
hi~titlin~ and aspartic acid residues (Sadler et al., 1992), LIM domains are
characterized by the presence of an aromatic residue adjacent to the first hicti~int~
and a leucine located C-termin~l to the central HxxCxxCxxC cluster. The
lo positions of these conserved residues are inrlir~t~d by arrows. Each LIM domain is
designated 1, 2 or 3 depending on its position relative to the N-terminus. The
uni~lle~ d sequence of the two LIM domains in the various proteins are shown
and gaps were introduced to permit ~lignmPnt of the two LIM domains.
Figure 6(B) illustrates the potential transactivation acidic domain encoded by the
sequence derived from chromosome l5 in ST90-375. Acidic residues are
underlined and the amino acids, serine and threonine, are in bold type.
Figure 7 illustrates the structure and domain o~ ni7~tion of HMGI-
C and the predicted fusion proteins. The vertical dashed line shows the location of
junction sites in the chimeric products. DNA binding domains of HMGI-C (AT)
are preserved in the fusion proteins but the C-t~rmin~l domain (stippled) is replaced
by potential transcriptional regulatory ~lom~in~. LIM, LIM domain; (--), acidic
domain; S,T, serine-threonine rich domain.
2 5 HMGI Proteins in Ma~ n Growth and Development
Figures 8(A) through (D) illustrate the i~lentifit~ion and genomic
chara~Le~ tion of the HMGI-C gene at the pygmy locus in normal and mutant
alleles. Figure 8(A): Delineation of the overlapping deleted genomic regions at
3 o the pygmy locus in the spontaneous and transgenic insertional mouse mut~ntc. The
open box above clone 3 positions the 0.5kb ApaI-ApaI fragment and the filled
boxes ,e~rese,ll single copy sequences used as probes to analyze genomic DNA
isolated from mice of varying genotypes (Xiang, X. et al., 1990). Solid and
dashed lines represent presence or absence of genomic seque~lres, respectively, in
35 the transgenic insertional mouse mutant pgTgN40ACha (A) and the spontaneous
mutant pygmy (pg). Figure 8(B): Exon amplification from lambda clones 803 and
SUB~ 1 U 1~ ;l (RULE26)
CA 022~963~ l999-0l-06
W O 98/50536 PCT/US97/21299
5B. The primary PCR exon amplification products in both sense (+) and antisense
(-) orientations from the lambda clones shown in Figure 8(A) were analyzed on a
5% polyacrylamide gel (Buckler, A. et al., 1991). The 379bp PCR product
observed in the control pSPLl lane results from splicing between the HIV tat andb-globin vector sequences (Buckler, A. et al., 1991). Figure 8(C): Sequence of
exons amplified from clone 803 and comparison to the HMGI-C gene. Figure
8(D): A series of overlapping phage clones ext~ ing approximately 190kb at the
pygmy locus. The discontinuous region represents an unclonable 1 lkb fragment asest~ t~d from Southern blots of cleaved genomic DNA probed with single copy
0 sequences from the end of the clonable region. The position and number of the
HMGI-C exons (not drawn to scale) are shown above the wildtype locus. Single
copy sequences were isolated at the in-lic~t~d positions and are represented by filled
boxes below the wildtype locus. Thick bars and blank regions represent the
genomic sequences that are present or deleted in the two alleles.
Methods. The 0.5kb ApaI-ApaI fragment (Xiang, X. et al., 1990)
was used as a probe to isolate clones 3 and 4 from an EMBL3 mouse genomic
library (a kind gift of Dr. E. Lacy) and a YAC (902C0711) from a mouse YAC
library (Lehrach, H. et al., 1990). YAC 902CO711 was further subcloned into
2 o lambda FIX II (Ausubel, F. et al., 1988) and 86 clones that hybridized to
radioactively-labeled mouse genomic DNA were picked and tldn~ ,d to new
plates in a gridded array (Ausubel, F. et al., 1988). Lambda clones 802, 906, SB,
803 and 308 were isolated after the walk was initi~tP(l with the 0.5kb ApaI-ApaIfragment and accomplished by repeated hybridization to filters of the array.
2 5 Overlaps between the contig clones and colinearity with the genome were
confirmlo~l by a combination of clone to clone and clone to genomic hybridizations
along with restriction mapping. Exon amplification was performed (Exon
Trapping System, Gibco BRL) after the genomic inserts from the lambda clones
were removed by cleavage wi~ SalI, partially filled-in (Ausubel, F. et al., 1988)
3 o and subcloned into a partially filled-in BamH1 cleaved pSPL1 plasmid (Buckler, A.
et al., 1991). The DNA was electroporated into COS-7 cells at 180V and 960mF
in a Bio-Rad Gene Pulser. Cytoplasmic RNA was isolated after 2-3 days and RT-
PCR performed using primers supplied by the m~nllf~rblrer~ The secondary PCR
amplification products (Buckler, A. et al" 1991) from clones 803 and 5B were
subcloned into the plasmid vector, pAMP10 (Exon Trapping System, Gibco BRL)
and sequenced using the Sequenase Version 2.0 sequencing kit (USB) (Ausubel, F.
SUBSTITUTE S~;~; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 54 -
et al., 1988). A 344bp fragment corresponding to the complete open reading frameof the HMGI-C gene (Mar~loletti, G. et al., 1991) was amplified from 12.5dpc
mouse embryos (see text) using reverse transcription (RT) and PCR. Lambda
clones cont~ining the HMGI-C exons were then isolated by hybridization of the
344bp radioactively-labeled fragment to the gridded array o~ lambda clones and
subsequently conn~cted through chromosome walking. The RT-PCR conditions for
isolation of the 344bp fragment consisted of first strand cDNA synthesis with
primer 1 (5'-ATGAATTCCTAATCCTCCTCTGC-3'), followed by PCR
amplification with primers 1 and 2 (5'-ATGGATCCATGAGCGCACGCGGT-3').
0 PCR conditions were 94~C, 0.5 minute; 55~C, 0.5 minute; 72~C, 1 minute; for 30
cycles. The amplified product was confirmed by sequencing analysis (Ausubel, F.
et al., 1988).
Figure 9 illustrates HMGI-C gene expression of three alleles at the
mouse pygmy locus. The wildtype allele is r~l r~s~llted by +, the transgenic allele
pgTgN40ACha by A, the spontaneous mutant allele by pg and an allele at the
pygmy locus which involves a paracentric inversion on chromosome 10
(In(10)17Rk) by Rk.
2 o Methods. The genotypes were established for mice in line A and the
spontaneous mutant pg as previously described (Xiang, X. et al., 1990), while
mice cont~ining the In(10)17Rk inversion were ~let~cted by a PCR-based RFLP
(unpublished results). RNA was isolated from 12.5dpc embryos and equal amounts
(5mg) were analyzed by Northern blot hybridization (Ausubel, F. et al., 1988).
The probes were a 138bp nucleotide cDNA fragment encompassing exons 2 and 3
of the HMGI-C gene and a 340bp cDNA fragment cont~ining the complete coding
sequence of the HMGI(Y) gene (Johnson, K. et al, 1988). The blot was
subsequently hybridized to an oligonucleotide complementary to murine 28S
ribosomal RNA (Barbu, V. & Dautry, F., 1989) to ensure equal amounts of RNA
3 o were present in each lane and the results are shown in the lower panel.
Figures lO(A) through(C) illustrate targeted disruption of the HMGI-
C gene. Figure lO(A): Targeting strategy. Endogenous HMGI-C gene (top),
targeting vector (middle) and predicted mutant gene (bottom). The targeting vector
was created by replacing the 3kb DNA fragment cont~inin~ exonl (E1) and exon2
(E2) with a PGK-neo cassette. The vector also includes a MCl-tk cassette at the 5'
SUBSTITUTE ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
~ WO 98/50536 PCT/US97/21299
- 55 -
end of the long homologous segment. B-, BamHI; Probe, a 4kb HincII fragment
used to identify the disrupted allele. Figure lO(B): Southern blot analysis of mice
from a heterozygous cross. DNA from tails of the mice was digested with BamHI
and hybridized to the external probe (see Figure lO(A~). The positions of the
5 bands corresponding to the wildtype allele (10.5kb) and the mutant allele (9.3kb)
are inrlir~teA Figure lO(C): Western blot analysis of wildtype (+/+),
heterozygous (+/-) and homozygous (-/-) 12.5dpc embryos with anti-GST-H~iIGI-
C rabbit IgG.
o Methods. Genomic clones of the mouse H M GI-C gene were
isolated from the mouse pygmy locus as described in Figure 8 legend. Lil~a~i~ed
vector (lOmg) was electroporated into AB1 ES cells at 280V, SOOmF, and
homologous recombination events enriched for by selection with G418 (350mg/ml)
and 2rnM gangcyclovir (Syntex) on SNL76/7 feeder cells. Six targeted clones
were obtained and three were injected into C57BL/6J blastocysts to generate
chim~er~c. Chimaeric males were mated to C57BL/6J females, and heterozygous
offspring h~lel~;rossed to produce subsequent generations. Southern blot analysis of
the progeny from heterozygous crosses was pe.ro.llled as described (Ausubel, F. et
al., 1988) Proteins were extracted from 12.5 dpc mouse embryos from a
heterozygous cross with Iysis buffer cont~ining 50mM Tris-HCI (pH 7.5), 10~
glycerol, 5mM m~gn~sium acetate, 0.2mM EDTA, l.OmM PMSF, and 1% SDS.
lOmg of each sample was separated by 15% SDS-PAGE, transferred to a nylon
membrane (Duralon, Stratagene) and HMGI-C was ~i~tected using rabbit IgG anti-
mouse GST-HMGI-C, HRP-conjugated goat anti-rabbit IgG and ECL substrate
2 5 (Amersham).
Figures l l(A) through (C) illustrate ~lession of HMGI-C in
development and growth. Figure ll(A): Temporal expression pattern of HMGI-C
and HMGI(Y) ~etermin~ by Northern blot analysis of RNA (5mg) isolated from
3 0 the head (H) and body (B) of mouse embryos whose ages in days post coitum are
inAir~tPA at the top of the panel. No expression of HMGI-C was ~etected in
placenta at any of these stages (data not shown). The probes are described in the
legend of Figure 9. Figure ll(B): Spatial localization of HMGI-C tldllscli~Jt~ in
11.5dpc mouse embryos. Photomicrographs of 8 mm, a~ ent7 para~ggit~l
sections through 11.5dpc mouse embryos hybridized with the ~ntice~e (A) or
sense (B) strand of exon 2 and 3 of HMGI-C or stained histoch~mi~lly with
SUB~ 111 U 1~; S~;~; l (RULE 26)
CA 02259635 1999-01-06
W O 98/50536 PCT/US97/21299
- 56 -
h~em~toxylin and eosin (C). G, gut m~senr~lyme; H, heart; L, liver; Lb, limb
bud; M, mandible; N, median nasal process; NE, neural epith~ m; O, otocyst.
Magnification: 25X. Figure ll(C): Growth of wildtype and pygmy embryonic
fibroblasts. Fibroblasts derived from 13.5dpc embryos were seeded at a
concentration of 1.7 x 103 cells per cm2 in DMEM cont~ining 10% fetal bovine
serum. Cell number (ordinate) was determined on day 4. Small bars le~lcsell~
standard deviations of triplicate experiments. P < 0.001. The genotypes of
embryos were determined as previously described (Xiang, X. et al, 1990)
0 Methods. For in si~u hybridization, CBA/J embryos (11.5dpc) werefixed in 4% paraformaldehyde, dehydrated and embedded in paraffin. Paraffin
sections were depar~ffini7~d and hybridized with sense and ~nti~e~e riboprobes
corresponding to exons 2 and 3 of HMGI-C as previously described (Duncan, M.
et al., 1992). Sections were stained with h~ toxylin and eosin according to
standard procedures.
Translocation Bre~krQ;nt~ Upstream of the HMGI-C Gene in Uterine
Lei~ yulllala
2 o Fluorescenre In Situ Hybridization (FISH)
Slides for FISH were ~r-,~al~d as recommPn~1e~1 in the Hybridization
Kit (Oncor, Gaithersburg, MD), except for denaturation at 68~C for 30 seconds.
HMGI-C clones were in the lambda FIXII vector (Stratagene, La Jolla, CA). They
2s were labeled with digoxigenin-1-dUTP (Boehringer ~q~nnht~im, In(li~n~rolis, IN)
with 1 ~4g of the a~ro~liate lambda DNA, dNTPs from Boehringer Mannheim,
and the DNasel/DNA polymerase mix from the BioNick Labeling System (BRL,
Gaithersburg, MD). Labeling reactions were ~elrollned at 16~C for 2 hours. Five
hundred nanograms of digoxigenin-labeled probe were lyophilized with 5 ~g of
Cot-1 DNA (BRL) and resuspended in 20 ~4l of deionized water. Two microliters
of resuspended probe were added to 9 ~l Hybrisol VI (Oncor). The probe was
denatured, hybridized to slides, and washed according to standard protocols
(Oncor). Digoxigenin-labeled lambda-clones were ~letected with fluorescein-
labeled antidigoxigenin antibody (Oncor) according to the m~mlfactllrer' s
s recomm~n~i~tinns~ and m~t~rh~ chromosomes were coulltu.~l~ined with 4,6-
mil1ino-2-phenylindole-dihydrochloride (DAPI). Hybridization was observed
SUBSTITUTE ~ (RULE 26)
CA 022~963~ 1999-01-06
PCT/US97/21299
WO 98/50S36
- 57 -
with a Zeiss Axioskop microscope, and images were captured with the CytoVision
Tm~ging System (Applied Im~ging, Pittsburgh, PA)
Inhibition of HMGI Biological Activity Using ~nti~çn~P Oligonucleotides.
~nti.cen~e oligonucleotides, in particular antisense oligonucleotides
to the HMGI genes, can be used to inhibit HMGI biological activity. 'Such
antisense oligonucleotides have a nucleotide seqllPn~e complement~ry to at least a
portion of the mRNA transcript of the human HMGI genes and are hybridizable to
0 the mRNA transcript. Preferably, the oligonucleotide is at least a 15-mer. More
preferably, the oligonucleotide is a 15- to 21-mer. While oligonucleotides having
a sequence complem~nt~ry to any region of the human HMGI genes can be used,
oligonucleotides complementary to a portion of the mRNA transcripts (i) including
the translation initiation codon, and/or (ii) beginning with the second codon from
the 5 ' end of the ll~nscli~ts, are particularly l)~ef~ ;d.
The following 15- through 21-mer oligonucleotides are
complem~nt~ry to the human HMGI-C rnRNA transcript beginr~ing with the
translation initiation codon:
5'-GCC CTC ACC GCG TGC GCT CAT-3'
5'-CC CTC ACC GCG TGC GCT CAT-3'
5'-C CTC ACC GCG TGC GCT CAT-3'
5'- CTC ACC GCG TGC GCT CAT-3'
2 5 5'-TC ACC GCG TGC GCT CAT-3'
5 '-C ACC GCG TGC GCT CAT-3 '
5'- ACC GCG TGC GCT CAT-3'
Similarly, the following 15- through 21-mer oligonucleotides are
3 o complern~nt~ry to the human HMGI(Y) mRNA l~ sclil)l beginning with the
translation initiation codon:
SUBS 1 l l U 1~; SHEET (RULE 26)
CA 022~963~ 1999-01-06
WO 98/~0536 PCT/I~S97/21299
- 58 -
5'-CTT CGA GCT CGA CTC ACT CAT-3 '
5'-TT CGA GCT CGA CTC ACT CAT-3'
5'-T CGA GCT CGA CTC ACT CAT-3'
5'- CGA GCT CGA CTC ACT CAT-3'
5'-GA GCT CGA CTC ACT CAT-3 '
5'-A GCT CGA CTC ACT CAT-3'
5'- GCT CGA CTC ACT CAT-3'
Such oligonucleotides are most advantageously pre~cd by using
0 any of the commercially available, automated nucleic acid synthesizers such as the
Applied Biosystems 380B DNA Synth~si7Pr~ Since the complete nucleotide
sequences of DNAs complelnPnt~ry to HMGI transcripts are known, antisense
oligonucleotides hybridizable with any portion of the rnRNA ll~nscri~t may be
prepared by the oligonucleotide synthesis methods known to those skilled in the art.
For in vivo use, the ~nticence oligonucleotides may be combined
with a conventional ph~rm~rel-tir~l carrier, such as ~ictill~d water, physiological
saline, aqueous solution of dextrose and the like. In addition to a~lminictration with
conventional carriers, the ~nti.c.on.ce oligonucleotides may be ~(lminictered by a
2 o variety of specialized oligonucleotide delivery tçchni~ es. For example,
oligonucleotides can be encapsulated in nnil~m~llar liposomes or in reco~ ed
Sendai virus envelopes.
For in vivo use, the antisense oligonucleotides may be a~minictçred
2 5 intravenously in a therape~lfic~lly effective amount suf~lcient to result inextracellular concentrations of 10 to 100 mg/ml. The precise dosage amount and
the duration of ~minictration of the ~nticçncP oligonucleotide for the purposes of
the present invention will depend upon exigencies of the m~-liral situation and the
judgment of the physician carrying out the tre~nPnt in accordance with the
30 conventional practice among mr~ir~l or veterinary professionals. The effective
amount of the ~nticçnce oligonucleotide will depend upon such factors as the age,
weight and condition of the subject as well as the frequency of ~lminictration and
the manner in which the subject responds to tre~tmP-nt Greater or lesser amountsof oligonucleotide may be ~lmi~ d, as required.
SUB~ .; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98150536 PCT/US97/21299
59
In regulating the amount of carcass fat in farrn ~nim~c, the effective
amount of the ~nticence oligonucleotide will depend upon such factors as the ageand weight of the animal and degree of reduction of the carcass fat desired and can
be detP-minPd in accordance with conventional methods.
Inhibition of HMGI biological activity using small molecules.
As archit~ct~lral components of the enh~nreosome, a higher order
transcription enhancer complex that forms when several distinct transcription
factors assemble on DNA in a stereospecific manner, HMGI proteins function to
regulate the expression of dowl~LIealll target genes. Disruption of the
enhanceosome assembly, by interfering either with protein-DNA or protein-proteininteractions of HMGI proleills results in loss of transcriptional regulation. Small
molecule drugs which hlLelr~lc with the function of HMGI proteins as architectural
factors can therefore be used to regulate growth and development of adipose tissue.
One method for inhibiting HMGI biological activity can inhibit
HMGI DNA-binding function by small molecule drugs which have the same DNA-
binding specificity as HMGI proteins. Examples of such small molecules include
2 o netropsin, distamycin A and Hoechst 33258 (bisben7imi~lP), which are
cornmercially available, for example, from Sigma. These molecules have been
shown to compete with the HMGI proteins for binding to AT-rich DNA (Reeves
and Nissen, 1990) suggesting that they possess a structure sirnilar to the HMGI
DNA-binding domains and will be able to inhibit HMGI biological function.
The aforementioned small molecules can be ~lTnini~tered orally,
subcutaneously or intravenously to an Ol~;~lllSnl in which regulation of an amount
of adipose tissue is needed in an amount sufflcient to result in inhibition in whole
or in part of the biological activity of HMGI proteins. The precise dosage amount
and the duration of ~-lmini.ctration of the HMGI inhibitor for the purposes of the
present invention will depend upon exigencies of the medical situation and the
judgment of the physician carrying out the tre~t-n~nt in accordance with the
conventional practice among rnPdic~l or v~elh~al~ professionals. The effective
amount of the inhibitor will depend upon such factors as the age, weight and
condition of the subject as well as the frequency of a~minictration and the manner
SUB~i 11 l LJ ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97t21299
- 60 -
in which the subject responds to tre~tm~nt. Greater or lesser amounts of the
inhibitor may be admini~tered, as required.
Assays For Isolation of Small Molecules Which Inhibit Biological Activity of
5 HMGI Proteins
Additional small molecule drugs which bind to HMGI pr~teins
directly may be obtained by methods known to those skilled in the art. For
example, HMGI protein or their fragments may be immobilized on scinti1l~ting
0 plates and a library of various radiolabeled compounds can be screened against the
plate using high-throughput screening equipment available cornmercially from, for
example, Hewlett-Packard. Binding of a compound to an immobilized HMGI
protein or its fragment will result in increased scintill~tiQn counts. Specific areas
of HMGI plut~ins which present attractive targets are, for example~ HMGI DNA-
5 binding domains with a cnn.~e~.c~ls sequence TPKRPRGRPKK (Reeves and Nissen,1990) or the sequence PRGRPKGSKNK, implicated in protein-protein interactions
involving HMGI ~rolchls (Leger et al., 1995).
Altern~tively, a cell-based assay can be used to isolate small
20 molecules which bind to HMGI proteins or their fr~gJnPnt~. In this assay, a DNA
construct cont~ining a reporter gene such as luciferase gene under control of a
HMGI-regulated promoter such as human interferon-l~ promoter (Thanos and
Maniatis, 1992) is transfected into a cell line which expresses proteins required for
induction of human int~relon-l~ gene, i.e., NF-kb, ATF-2 and an HMGI genes. A
25 library of various compounds is then screened using this cell-based assay andmolecules that inhibit HMGI biological activity are isolated based on their ability to
decrease the e~rcssion of the reporter gene.
Throughout this application, various publications have been
3 o rcrerel1ced. The disclosures in these publications are incorporated herein by
~eferellce in order to more fully describe the state of the art.
Refe. ~llces
Aaronson, S. A. (1991), Science 254, 1146-1152.
SUBS l l l U ~ ; l' (RULE 26)
CA 02259635 1999-01-06
W O 98/50536 PCT/US97/21299
- 61 -
Asher, H. R., Fejzo M. S., Tk~h~nko, A., Zhou, X., Fletcher, J.
A., Weremowicz, S., Morton, C. C., and Chada, K., Cell 82 57-65 (1995)
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,
5 Seidman, J. G., Smith, J. A., and Struhl, K. (1989), Current Protocols in
Molecular Biology (New York: Greene Publishing Associates and Wiley
Interscience) .
Barbu, V. &Dautry, F. NucleicAcidsRes. 17, 7115 (1989).
Benson, K. and Chada, K. (1994), Genet. Res. 64, 27-33.
Berlingieri, M. T., Manfioletti, G., Santoro, M., Bandiera, A.,
Visconti, R., Giancotti, V., and Fusco, A. (1995), Mol. Cell. Biol. 15, 1545-
1553.
Bridge, J. A., Persons, D. L., Neff, J. R., and Bhatia, P. (1992),
Cancer Detect. Prev. 16, 215-219.
Bridge, J. A., DeBoer, J., Walker, C. W., and Neff, J. R. (1995),
Genes Chrom. Cancer 12, 70-72.
Buckler, A. et al. Proc. natn. Acad. Sci. U.S.A. 88, 4005-4009
(1991).
Bullerdiek, J., Wobst, G., Meyer-Bolte, K., Chilla, R., Haubrich,
J., Thode, B., and Barnitzke, S. (1993), Cancer Genet. Cytogenet. 65, 27-31.
Chen, H., Charlat, O., Tartaglia, L.A., Woolf, E.A., Weng, X.,
30 Ellis, S.J., Lakey, N.D., Culpepper, J., Moore, K.J., Bleil~lL, R.E., Duyk,
G.M., Tepper, R.I., and Molgell~L~ill, J.P. (1996). Cell 84, 491-495.
Chirgwin, J., Przybyla, A., MacDonald, R., and Rutter, W. J.
(1979), Biorh~ try 18, 5294-5299.
SUBSTITUTE ~ (RULE 26)
~ .
CA 022~963~ 1999-01-06
~ WO 98/50536 PCTrUS97/21299
- 62 -
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D., and Cohen, S.
M. (1992), Genes Dev. 6, 715-729.
Dal Cin, P., Kools, P., De Jonge, I., Moerrnan, P., Van de Ven,
W., and Van den Berghe, H. (1993), Genes Chrom. Cancer 8, 131-133.
de Thé, H., Lavau, C., Marchio, A., Chomienne, C., Degos, L.,
and Dejean, A. (1991), Cell 66, 675-684.
0 DiMarco, A., Gaetani, M., Orezzi, P., Scotti, T., and Arcamone,
F. (1962), Cancer Chemo. Reports 18,15-19.
Du, W., Thanos, D., and Maniatis, T. (1993), Cell 74, 887-898.
Duncan, M., DiCicco-Bloom, E.M., Xiang, X., Benezra, R. &
Chada, K. Dev. Biol. 154, 1-10 (1992).
Feuerstein, R., Wang, X., Song, D., Cooke, N. C., and Liebhaber,
S. A. (1994), Proc. Natl. Acad. Sci. USA 91, 10655-10659.
Finlay, A.C., Hochstein F.A., Sobin, B.A., and Murphy, F.X.
(1951), J. Amer. Chem. Soc. 73, 341-343.
Fletcher, J. A., Kozakewich, H. P., Hoffer, F. A., Lage, J. M.,
Weidner, N., Tepper, R., Pinkus, G. S., Morton, C. C., and Corson, J. M.
(1991), N. Engl. J. Med. 324, 436-443.
Fletcher, J. A., Pinkus, G. S., Donovan, K., Naeem, T.,
Sugarbaker, D. J., Mentzer, S., Pinkus, J. L., and Longtine, J. (1992), Cancer
Res. 52, 6224-6228.
Fletcher, J. A., Kozakewich, H. P., Schoenberg, M. L., and
Morton, C. C. (1993), Genes, Chrom. Cancer 6, 24-29.
3 5 Fletcher, J. A., Longtine, J., Wallace, K., Mentzer, S. J., and
Sugarbaker, D. J. (1995), Genes Chrom. Cancer 12, 210-223.
SUBSTITUTE ~ (RULE 26)
CA 022~963~ l999-0l-06
W098/50536 PCTrUS97/21299
- 63 -
Freyd, G., Kim, S. K., and Horvitz, H. R. (1990), Nature 344,
876-879.
Frie~lm~nn, M., Holth, L. T., Zoghbi, H. Y., and Reeves, R.
(1993), Nucleic Acids Res. 21, 4259-4267.
Frohman, M. A., Dush, M. K., and Martin, G. R. (1988), Proc.
Natl. Acad. Sci. USA 85, 8998-9002.
German, M. S., Wang, J., Chadwick, R. B., and Rutter, W. J.
(1992), Genes Dev. 6, 2165-2176.
Giancotti, V., Pani, B., Andrea, P. D., Berlingieri, M. T., Di
5 Fiore, P. P., Fusco, A., Vecchio, G., Philp, R., Crane-Robinson, C., Nicolas, R.
H., Wright C. A., and Goodwin, G. H. (1987), EMBO J. 6, 1981-1987.
Giancotti, V., Buratti, E., Perissin, L., Zorzet, S., R~lm~in, A.,
Portella, G., Fusco, A., and Goodwin, G. H. (1989), Exp. Cell Res. 184, 538-
545.
Giancotti, V., Bandiera, A., Ciani, L., Santoro, D., Crane-
Robinson, C., Goodwin, G. H., Boiocchi, M., Dolcetti, R., and Casetta, B.
(1993), Eur. J. Biochem. 213, 825-832.
Green, E. D. and Olson, M. V. (1990), Proc. Natl. Acad. Sci. USA
87, 1213-1217.
Green, M.C. in Genetic Variants and Strains of the Laboratory M
3 o ouse (eds. Lyon, M. & Searle, A.) 12-403 (Oxford University Press, Oxford,
1989).
Grossch~cll, R., Giese, K. and Pagel, J. (1994), Trends Gen. 10,
94-100.
SUB~ 111 U l ~ ; l (RULE 26)
CA 022~963~ l999-0l-06
WO 98/50536 PCT/US97/21299
- 64 -
Gu, Y., Nakamura, T., Alder, H., Prasad, R., C~n~ni, O.,
Cirnino, G., Croce, C. M., and Can~ni, E. (1992), Cell 71, 701-708.
Guthrie, C. and Fink, G. R. (1991), Meth. Enzymol. 194, 218-219.
Hatano, M., Roberts, C. W. M., Minden, M., Crist, W. M., and
Korsmeyer, S. J. (1991), Science 253, 79-82.
Hirabayashi, Y., Yoshida, M. A., Ikeuchi, T., Ishida, T., Kojima,
T., Higaki, S., M~hin~mi, R., and Tonomura, A. (1992), Cancer Genet.
Cytogenet. 60, 35-40.
Jenkins, R. B., Kimmell, D. W., Moertel, C. A., Schultz, C. A.,
Menezes, R. M., Scheihauer, B., Kelly, P. J., and Dewald, G. W. (1989),
Cytogenet. Cell Genet. 51, 1019.
Johnson. K. R., Lehen, D. A., Elton, T., Barr, P., and Reeves, R.
(1988), J. Biol. Chem. 263, 18338-18342.
Johnson, K. R., Lehen, D. A., and Reeves, R. (1989), Mol. Cell.
Biol. 9, 2114-2123.
Justice, M. J., Siracusa, L. D., Gilbert, D. J., Heisterk~mr~, N.,
Groffen, J., Chada, K., Silan, C., Copeland, N. and Jenkins, N. A. (1990),
2 5 Genetics 125, 855-866.
Kamps, M. P., Look, A. T., and Baltirnore, D. (1991), Genes Dev
5,358-368.
Karlsson, O., Thor, S., Norbert, T., Ohlsson, H., and Edlund, T
(1990), Nature 344, 879-882.
King, J. Genetics 53, 487-497 (1955).
SUBSTITUTE SHEET (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 65 -
Kopka, Mary L., Yoon, Chun, Goodsell, David, Pjura, Philip, and
Dickerson, Richard E., (1985), Proc. Natl. Acad. Sci. USA, Vol. 82, pp. 1376-
1380.
Leger, H., Sock, E., Renner, K., Grummt, F., and Wegner, M.
(1995). Mol. Cell. Biol. 15, p. 3738-3747.
Lehrach, H. et al. in Genome Analysis Volume 1: Genetic and
Physical Mapping (eds Davies, K. & Til~hm~n, S.) 39-81 (Cold Spring Harbor
Laboratory Press, New York, 1990).
Li, S. et al. Nature 347, 528-533 (1990).
Lin, S-C. et al. Nature 364, 208-213 (1993).
Ma, Q., Alder, H., Nelson, K. K., Chatterjee, D., Gu, Y.,
Nakarnura, T., Can~ni, E., Croce, C. M., Siracusa, L. D., and Buchberg, A. M.
(1993), Proc. Natl. Acad. Sci. USA 90, 6350-6354.
MacArthur. J. (1944), Amer. Nat. 78, 142-157.
M~n~ hl~ N., Heim, S., ~rh~den, K., Rydholm, A., Willen, H.,
and Mitelman, F. (1988), Hum. Genet. 79, 203-208.
l~anrl~hl~ N., Heim, S., Arheden, K., Rydholm, A., Willen, H.,
and Mitelman, F. (1989), Cancer 65, 242-248.
Mandahl, N., Orndal, C., Heim, S., Willen, H., Rydholm, A.,
Bauer, H. C. F., and Mitelm~n, F. (1993a), Cancer 71, 3009-3013.
Mandahl, N., Willen, H., Rydholm, A., and Mitelman, F.
(1993b), Genes Chrom. Cancer 6, 121-123.
Manfioletti, G., Giancotti, V., Bandiera, A., Buratti, E., Sautiere,
P., Cary, P., Crane-Robinson, C., Coles, B., and Goodwin, G. H. (1991),
Nucleic Acids Res. 19, 6793-6797.
SUBSTITUTE ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
WO 98/50536 PCT/US97/21299
- 66 -
May, W. A., Gishizky, M. I., TPSSnjrL, S. L., Lunsford, L. B.,
Lewis, B. C., Delattre, O., 71lcm~n, J., Thomas, G., and Denny, T. D. (1993),
Proc. Natl. Acad. Sci. USA 90, 5752-5756.
McGuire, E. A., Hockett, R. D., Pollock, K. M., Bartholdi, M. F.,
O'Brien, S. J., and Korsmeyer, S. J. (1989), Mol. Cell. Biol. 9, 2124-2132.
Mitrh~ll, P. J., and Tijan, R. (1989), Science 245, 371-378.
Nilbert, M., and Heim, S. (1990), Genes Chrom. Cancer 2, 3-13.
Nissley, S., Kn~7~1~, R. & Wolff, G. Horm. Metab. Res. 12, 158-
164 (1980).
Noguera, R., Llombart-Bosch, A., Lopez-Gines, C., Carda, C.,
and Fern~n-lez, C. (1989), Virchows Arch. A. Pathol. Anat. Histopathol. 415,
377-382.
Patel, U. A., Bandeira, A., Manfioletti, G., Giancotti, V., Chau,
K-Y., and Crane-Robinson, C. (1994), Biochem. Biophys. Res. comIn. 201, 63-
70.
Pendergast, A. M., Muller, A. J., Havlik, M. H., Maru, V., and
Witte, O. N. (1991), Cell 66, 161-171.
Prasad, R., Leshkowitz, D., Gu, Y., Alder, H., Nakamura, T.,
Saito, H., Huebner, K., Berger, R., Croce, C. M., and Can~ni, E. (1994), Proc.
Natl. Acad. Sci. USA 91, 8107-8111.
Rabbitts, T. H. (1994), Nature 372, 143-149.
Ram, T., Reeves, R. & Hosick, H.L. Cancer Res. 53, 2655-2660
(1993)-
SUB~ l U ~ ;l (RULE 26)
*rs
. ~
CA 02259635 1999-01-06
PCT/US97/21299
WO 98/50536
- 67 -
Reeves, R., and Nissen, M. S. (1990), J. Biol. Chem. 265, 8573-
8582.
Reeves, R., T ~ng~n, T.A. & Nissen, M.S. Proc. natn. Acad. Sci.
U.S.A. 88, 4005-4009 (1991).
Rein, M. S., Fri~lm~n, A. J., Barbieri, R. L., Pavelka, K.,
Fletcher, J. A., and Morton C. C. (1991), Obstet. Gynecol. 77, 923-926.
0 Rink T.J. (1994), In search of a satiety factor. Nature 372 p. 406-
407.
Rogers, P., and Webb, G. P. (1980), British J. Nutrition 43, 83-86.
Rohen, C., Bonk, U., Staats, B., Rarnit7ke, S., and Bullerdiek, J.
(1993), Cancer Genet. Cytogenet. 69: 68-71.
Rother, R. P. (1992), Biotechniques 13, 524.
Sadler, I., Crawford, A. W., Michelsen, J. W., and Beckerle, M.
C. (1992), J. Cell Biol. 119, 1573-1587.
Saitoh, Y. & ~ ~ernmli, U.K. Cell 76, 609-622 (1994).
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular
cloning: A Laboratory Manual, 2nd edition (Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press).
SfinrhP7-Garcia, I., Osada, H., Forster, A., and Rabbitts, T. H.
3 o (1993), EMBO J. 12, 4243-4250.
.S~nrhr7-Garcia, I., and Rabbitts, T. H. (1993), Sem. Cancer Biol.
4, 349-358.
Sandros, J., Stenman, G., and Mark, J. (1990), Cancer Genet.
Cytogenet. 44, 153-167.
SUBS l 11 U ~ (RULE 26)
CA 022~963~ l999-0l-06
W 098/50536 PCT/US97/21299
- 68 -
Schmit7., M. L., and Baeuerle, P. A. (1991), EMBO J. 10, 3805-
3817.
Schoenberg Fejzo, M., Yoon, S-J, Montogomery, K., Rein, M. S.,
Weremowicz, S., Krauter, K. S., Dor nan, T. E., Fletcher, J. A., Mao, J., Moir,
D. T., Kucherlapati, R. S. and Morton, C. C. (1995), Genomics 26, 265-271.
Seipel, K., Georgiev, O., and Sch~ffn~r, W. (1992), EMBO J. l1,
104961-4968.
Sinha, Y., Wolff, G., Baxter, S. & Domon, O. Proc. Soc. Expt.
Biol. Med. 162, 221-223 (1979).
Sre~ nt~i~h, C., Leong, S. P. L., Karakousis, C. P., McGee, D.
L., Rappaport, W. D., Villar, H. V., Neal, D., Fleming, S., Wankel, A.,
Herrington, P. N., Carmona, R., and Sandberg, A. (l99l), Cancer Res. 51, 422-
433.
Tartaglia, L.A., Dembski, M., Weng, X., Culpepper, J., Devos,
R., Richards, G.J., Camp~leld, L.A., Clark, F.T., Deeds, J., Muir, C., Sanker,
S., Moriarty, A., Moore, K.J., Smutko, J., Mays, G.G., Woolf, E.A., Monroe,
C.A., and Tepper, R.I. (1995). Cell 83, p.1263-1271.
Thanos, D., and Maniatis, T. (1992), Cell 71, 777-789.
Tjian, R. & Maniatis, T. Cell 77, 5-8 (1994).
Tk~rh~k, D. C., Kohler, S., and Cleary, M. L. (1992), Cell 71,
30691-700.
Valge-Archer, V E., Osada, H., Warren, A. J., Forster, A., Li, J.,
Baer, R., and Rabbitts, T. H. (1994), Proc. Natl. Acad. Sci. USA 91, 8617-
86212.
SUB~ 1 l 1 U l ~ ; l (RULE 26)
CA 022~963~ 1999-01-06
W098/50536 PCT/US97/21299
- 69 -
Vanni, R., Dal Cin, P., Marras, S., Moerrnan, P., Andria, M.,
Valdes, E., Deprest, J., and Van den Berghe, H. (1993), Cancer Genet.
Cytogenet. 68, 32-33.
Vartainen, E., Palvimo, J., Mahonen, A., Linnala-K~nkln-nP~, A.,
and Maenpaa P. H. (1988), FEBS Lett. 228, 45-48.
Way, J. C., and Chalfie, M. (1988), Cell 54, 5-16.
0 Wolffe, A. (1994), Science 264, 1100-1101.
Xiang, X., Benson K. F., and Chada, K. (1990), Science 247, 967-
969.
Xu, Y., Ral-l~cs~re, M., Fisher, P., Rathbun, G., Oltz, E. M., Yancopoulos, G.
F. W. (1993), Proc. Natl. Acad. Sci. USA 90, 227-231.
Zhang, Y., Proenco, R., Maffel, M., Barone, M., Leopold, L., and
FriP~lm~n, J.M. (1994) Position~l cloning of the mouse obese gene and its human
homologue. Nature 372, p.425-431.
Zhou, X., Benson, K. F., Ashar, H. R., and Chada, K., Nature 376
771-774 (1995).
While the invention has been particularly described in terms of
specific embodimPnt.c, those skilled in the art will understand in view of the present
disclosure that numerous variations and mo~lifirations upon the invention are now
enabled, which variations and mo~lifir-~tinns are not to be regarded as a departure
from the spirit and scope of the invention. Accordingly, the invention is to be
3 o broadly construed and limited only by the scope and spirit of the following claims.
SUB~ 1 l l U 1~ ; r (RULE 26)
