Note: Descriptions are shown in the official language in which they were submitted.
WO 98/10078101520253035CA 02264955 1999-03-01CLONING OF FULL-LENGTH HUMAN PEX CDNABACKGRQUND OF THE INVENTIQN(a) Field of the InventionThe invention relates to the cloning of full-PEX CDNA isolated from tumorsuses of PEXlength human causingoncogenous hypophosphatemia osteomalacia,active site for the design of drugs to inhibit proteinactivity in cases of hyperphosphatemia or chronic renalfailure, uses of the PEX active site as a target forthefailure and uses in the diagnosis of hyperphosphatemiatreatment of hyperphosphatemia or chronic renalor chronic renal failure, use of PEX for the design ofdrugs to inhibit protein activity in cases of hyper-phosphatemia or chronic renal failure, use of PEX as atarget for the treatment of hyperphosphatemia, chronicrenal failure, hypophosphatemia or idiopathic hypercal-curia, and use of PEX in the diagnosis of hyperphos-phatemic states, chronic renal failure, hypophos-phatemic states or idiopathic hypercalcuria.(b) Description of Prior Artoncogenous hypophosphatemic osteomalacia (OHO)is a rare acquired disease characterized by severehypophosphatemia, inappropriate phosphaturia, reducedand defective bone mineralizationE., 1984,77:50l-512). This syndrome is associatedof histologically distinct,of theand results invitamin D levels,(Ryan, E.A. and Reiss, The American Journalof Medicine,with avariety usuallybenign, mesenchymal tumors. Resection tumorabnormalitiesIt has been postulated thata phosphaturic factor produced by these tumors promotesreverses the metaboliccure of the bone disease.the renal phosphate loss, which in turn results inosteomalacia. The putative phosphaturic factor may alsoPCT/CA97/00617W0 98/ 10078101520253035CA 02264955 1999-03-01PCT/CA97/0061 7inhibit the renal conversion of 25-hydroxyvitamin D3 to1,25-dihyâdroxyvitaminD3 levels and chronic phosphate depletion1,25-dihydroxy-vitamin D3. Depressedmay act synergistically to produce osteomalacia inthese patients. The nature of the phosphaturic sub-stance remains unknown and is distinct from parathyroidhormone and calcitonin, two polypeptide hormones knownto inhibit the tubular reabsorption of phosphorus.(HYP)disorder of phosphate homeostasis with biochemical andC.R.Dis.,xâlinked hypophosphatemia is an inherited(Scriver,Metab.a gene which spansphysical findings very similar to OHOH.S., 1992, J.By positional cloning,Xp22.1 inand Tenenhouse, Inher.15:6l0â624).the deletedmutatedHYP patients, or isidentifiedThisregionin nonâdeletion patients has beenCDNAexhibits homology to a family of endopeptidase genesand its partial sequence reported. geneinvolved either in activation or degradation of a num-ber of peptide hormones and has been named PEX(phosphate regulating gene with homologies to endopep-the X chromosome) (The1l:l30-136).It would be highly desirable to be provided withinhibitto be provided with a target for thetidases, on HYP Consortium,1995, Nature Genetics,a means to protein activity in cases ofhyperphosphatemia,treatment of hyperphosphatemia and to be provided witha diagnostic tool for hyperphosphatemia states.SUMMARY OF THE INVENTIONOne aim of the present invention is to employthe PEX active site of the design of drugs to inhibitprotein activity in cases of hyperphosphatemia.Anotheremploy the PEX active site as a target for the treat-aim of the present invention is toment of hyperphosphatemia or hypophosphatemic disordersWO 98/10078l015202530CA 02264955 1999-03-01PCT/CA97/0061 7.. 3 ..such as chronic renal failure, or idiopathichypercalcuria, respectively.Another aim of the present invention is toemploy the PEX active site in the diagnosis of hyper-phosphatemic and hypophosphatemic disorders.The availability of full length PEX cDNA pro-vides us with an unprecedented opportunity to study thebiology of PEX and evaluate its role in conditions suchas OHO, HYP (aphatemic disorder) and in common pathologicalidiopathic hypercalcuria, hypophos-statescharacterized by impaired phosphate excretion includingthe withchronic renal failure.large and expanding population of patientsIn accordance with the present invention thereis provided a recombinant PEX protein generated fromcloned CDNA depicted in Figs. 1A to 1G.In accordance with the present invention thereis provided a polyclonal or monoclonal antibody raisedagainst the PEX active site which consists of at leastamino acid residue 579 to residue 749 illustrated in1A to 1G.In accordance with the present invention thereFigs.is provided a method for the design of drugs to be usedas competitive inhibitors or activators of PEX enzy-matic activity and/or its receptor in cases of hyper-phosphatemia (as in chronic renal failure) or hypophos-phatemia, which comprises the steps of:a) developing a radiolabeled or fluorescent-labeledmetalloendopeptidase substrate which reversibly orirreversibly binds PEX; andb) using PEX and the labeled ligand to screen anexpression library for an endogenous protein whichbinds PEX;SUBSTITUTE SHEET (RULE 26)W0 98/ 10078101520253035CA 02264955 1999-03-01PCT/CA97/00617or-using labeled PEX to examine its competitivebinding to a receptor;orrecombinant PEX toexpression library in order to clone its receptor.-using labeled screen anIn accordance with the present invention thereis provided a nmthod for the treatment of hyperphos-phatemia or of chronic renal failure which comprisesadministering to a patient an effective amount of apharmaceutical compound targeted to inhibit PEX activesite and/or its receptor.In accordance with the present invention thereis provided a method for the diagnosis of hyperphos-phatemic or hypophosphatemic conditions in patient,which comprises the steps of :a) preparing a solid support having bound theretoat least one of the anti-PEX antibody of the presentinvention, the recombinant PEX protein of the presentinvention, or the active site thereof;b) screening a biological sample of the patient onthe solid support; andc) detecting the presence of PEX protein or PEXantibody in the sample, thereby indicating the presenceof hyperphosphatemic or hypophosphatemic conditions.In accordance with the present invention thereis provided a transgenic mouse in which the wild typeand mutant PEX cDNA depicted in Figs. 1A to 1G has beeninserted into the murine genome to cause alterations inblood and urine phosphate and the murine counterpart ofHYP and OHO.study the biology of PEX protein in Vivo and its abil-Such a transgenic mouse may be used toity to reverse biochemical and physical abnormalitiesassociated with HYP in mice and patients in the form ofgene therapy.SUBSTITUTE SHEET (RULE 26)WO 98/10078l01520253035CA 02264955 1999-03-01PCT/CA97/0061 7In accordance with the present invention thereis provided a method for the treatment of cancer whichcomprises determining the role of PEX in tumor growthby assessing its activity and/or prenylation duringneoplastic transformation and using drug design tocreate novel anticancer treatments which interfere withPEX protein function.BRIEF DE§§RIPTION QF THE DRAWINQSFigs. lA-lG illustrate the nucleotide sequenceand predicted amino acid sequence of tumor PEX CDNA;Figs. 2A-2C illustrate the amino acid homologybetween PEX and human NEP cDNA with the sequence com-parison performed by LALIGN (a computer programdesigned to maximally align two different proteinand3 illustrates the hydropathy plot of PEXsequences);Fig.CDNA .DETAILED DESCRIPTION OF THE INVENTIONIn accordance with the present invention, PEXexpression in tumors associated with the syndrome (OHO)was examined.We have used the PCR technique to clone andcharacterize full-length human PEX cDNA from two tumorsassociated with OHO and have determined its normalWe show that full-length human PEX cDNA encodes a 749 amino acid proteinfetal and adult tissue distribution.(Figs. 1A-lG) with extensive homology to the human neu-tral endopeptidase (Fig. 2) (NEP; EC 3-4.24.ll), sug-gesting that PEX is a nmtalloendopeptidase. The addi-tional sequences provided by our PEX cDNA clone include603 nucleotides of the 5' the first 3and the last 108 amino acids of the protein, comprisingnoncoding region,residues postulated to be critical for the formation ofSUBSTITUTE sneer (nuus 26)W0 98/ 10078101520253035CA 02264955 1999-03-01PCT/CA97/00617the active site of the protein and hence its enzymaticthe 276nucleotides of the 3' including theactivity, termination codon, as well asnoncoding region,we also show that PEX has acleavable signal sequence and a consensus sequence forpolyadenylation signal.prenylation of the protein at its carboxyl terminal.In summary, the cloning of the full-length humanPEX cDNA from tumors causing OHO is reported in thepresent invention. The availability of this cDNA opensnew and exciting avenues of investigation in a numberof clinical such asspecialties, endocrinology,nephrology, and oncology. The biology of PEX will beevaluated in conditions such as OHO, idiopathic hyper-calcuria, and HYP.Tumor TissuesTumor tissues were removed from two patientswith well-documented OHO. of theresulted in the complete reversal of the biochemicalResection tumorsand physical abnormalities associated with the syn-drome. Tumor tissue was frozen immediately in liquidnitrogen and stored at -70°C.PEX Expression in OHO-associated tumorsTo determine whether PEX is expressed in tumorsassociated with OHO, RNA was extracted from tumor tis-sue using Qiagen RNeasy Kitââ and reversed transcribed(BRL)transcriptase for 1 hour at 42°C in a final reactionusing oligodT primer and Superscript II reversevolume of 30 ul. The resulting cDNA was then amplifiedusing human PEX-specific primers, PEX 1( 5 ' GGAGGAATTGGTTGAGGGCG 3 ' ) and PEX 2(5' GTAGACCACCAAGGATCCAG 3'). Following amplificationthe PCR reaction was fractionated on a 1%PEX mRNA was(35 cycles)agarose gel stained with ethidium bromide.readily amplified from both samples demonstrating theW0 98ll0078l01520253035CA 02264955 1999-03-01PC T/CA97/0061 7expected 509 bp amplified fragment, as predicted fromthe published partial sequence.Cloning of full-length PEX cDNA from tumorsCloning of the 5'plished by anchored PCR.tially extracted from tumor tissue followed by the iso-lation of mRNA. 1.5 pg of mRNA was then reverse tran-CDNA 200 ng of a PEXantisense oligomer (PEX 2) and 200 units of SuperscriptII (BRL)final reaction volume of 30 pl.end of PEX CDNA was accom-Total cellular RNA was ini-scribed into using specificreverse transcriptase for 1 hour at 42°C in aThe resulting CDNA wassize fractionated on a 1% agarose gel and fragmentscorresponding to >600 bp were purified and resuspendedThe 3' end of the firsthomopolymer tailed with dGTP using l pl of Terminal(TdT) at 37°C for 30Following heat inacti-in H20. strand CDNA wasdeoxynucleotidyl transferaseminutes ix: a volume of 50 pl.vation of the enzyme, RNA template was removed by incu-bation with RNase H and the tailed cDNA was purified byphenol-chloroform extraction followed by ammonium ace-tate precipitation. The purified tailed CDNA was resus-pended in H20 and an aliquot was used for anchored PCRalong with 200 ng of an internal PEX specific antisense(PEX 3, 5' CGTGCCCAGAACTAGGGTGCCACC 3') and 200ng of oligodc as the sense primer. Forty cycles of PCRprimerwere performed using 0.5 ul of Taq polymerase (Promega)in a reaction volume of 50 pl. Cycling parameterswere: 1 minute of denaturation at 95°C, 2 minutes ofannealing at 55°C and 2 minutes of extension at 72°C.The PCR products were fractionated on a 1% agarose gelband of 700 bp wasinto pPCRIItransformation into HBl0l bacteria,theSequenase kit (US Biochem).and a isolated, purified, andligated vector (Invitrogen). Followingclones containingappropriate size insert were sequenced usingW0 98/10078l01520253035CA 02264955 1999-03-01PCT/CA97/0061 7To clone the 3' end of PEX CDNA,an amplified unidirectional cDNA library in pCDNA3 vec-an aliquot oftor (Invitrogen) generated from tumor mRNA was grownovernight in LB medium and plasmid DNA extracted. DNA(0.5 pg)sense oligomerwas subjected to PCR using(PEXl)sponding to SP6 RNA polymerase binding site sequencesin the pCDNA3 vector.amplification were performed in a 50 pl reaction volumea PEX-specificand an antisense oligomer corre-present Thirty five cycles ofwith each cycle consisting of LL min. denaturation at94°C,72°C.agarose gel andl min. annealing at 55°C and l min. extension atAmplified products were fractionated on a 1%a 1.2 kb fragment corresponding to the3' end of PEX CDNA was subcloned and sequenced.Figs. lA-lG show the nucleotide and. predictedamino acid sequence of the full-length PEX cDNA clonedfrom tumor tissue. In both tumors, there were threeamino acids that differ from the published partial PEXsequence, 353Dâ>A(GAc to GCC), 403R->w(AGG to TGG), and541Aâ>G(GcG to GGA). Full-length human PEX CDNA encodes749 amino acids and has extensive homology to the humanneutral endopeptidase (Fig. 2) (NEP; EC 3.4.24.ll),PEX is a metalloendopeptidase. Thesequences provided by our PEX CDNA clonesuggesting thatadditionalinclude 603 nucleotides of the 5âwell as the first 3 and the last 108 amino acids of theprotein. These additional amino acids comprise residuesthatnoncoding region, asmay be critical for the formation of the activesite of the protein and hence its enzymatic activity,such as 542E, 710H, and 593r733r746C. Our PEX clonealso identifies the termination codon, as well as 276nucleotides of the 3' noncoding region, including thepolyadenylation signal. Hydropathy plot and PSORTanalysis of the PEX protein identified a putativecleavable signal sequence composed of the first 49SUBSTITUTE SHEET (RULE 26)W0 98/10078101520253035CA 02264955 1999-03-01PCT/CA97/00617amino acids, implicating amino acid 50 at the beginningof the mature protein (Fig. 3). This contrasts with thehuman âNEP that doesPEX protein has also been shown to(CAAX box: CRLW) thatmay direct prenylation of the protein, a post-transla-sequence not have a cleavablesignal sequence.have ea carboxyl terminal motiftional modification that may be important in neoplasticprocesses, and could be targeted for pharmmxï¬ogicalmanipulation.Northern-blot analysisTotal RNA wasosteosarcoma cells by Trizo1TM and polyA+ RNA was iso-prepared from human Saos-2lated using standard procedures. Twenty micrograms ofPolyA+ RNA were fractionated on 1% denaturing agarosegel, transferred to nylon membrane and probed with 32P-labeled human PEX CDNA. The blot was washed in 0.1 XSSC at 55°C for 20 min.,graphy for 7 days.re-probed with an GAPDH cDNA probe.detectedand subjected to autoradio-To monitor loading, the membrane wasIn these cells, asingle weak transcript wasslightly faster than 285 RNA, consistent with the pre-dicted size from the cloned PEX CDNA ("3.l kb)more intense signal was observed of ~6.6 kb size.with mobilityand aTissue Distribution of PEX mRNARecent studies have not documented the presence of PEX mRNA in normal tissues except for fetal brain(The HYP Consortium, 1995,11:l30-136). Following the cloning of full-length PEX,and adult tissues and in a number of established humanand human leukocytes NatureGenetics,we examined PEX expression in normal fetalcell lines using RT-PCR. PEX was found to be expressedin fetal calvarium (bone) and. to a lesser degree infetal kidney and muscle while no expression was appar-PEX mRNA wasent in fetal liver. In adult tissues,identified in kidney, but not in liver, or endomyocar-SUBSTITUTE SHEET (RULE 26)W0 98l10078101520253035CA 02264955 1999-03-01PCT/CA97/00617_ lo _dium. Interestingly, weak expression was evident intissue from an atrial myxoma, a tumor of mesenchymalorigin and in renal cell carcinoma, an epithelialtumor. A number of established human cell lines werealso shown to express PEX, including the Saos-2osteosarcoma cells.In Vitro transcription and translationPlasmid pPEX was linearized at the XhoI site ofthe polylinker region and sense RNA strand was tran-scribed using T7 RNA polymerase. Translation reactionsin rabbit reticulocyte lysate were performed accordingto the manufacturer's (Promega) procedure either in theabsence or presence of canine pancreas microsomal mem-branes. Samples were processed for SDS-polyacrylamide(PAGE)and autoradiography were performed.PEX CRNA was translated into agel electrophoretic analysis of the peptides,In the absence ofmicrosomal membranes,addition of microsomal"82kD protein. Following themembranes, two translated products of higher molecularweight were apparent, consistent with N-glycosylationof PEX (nine potential sites).The present invention will be more readily un-derstood by referring to the following examples whichare given to illustrate the invention rather than tolimit its scope. 'EXAMPLE IUses of recombinant PEX proteinRecombinant PEX protein will be generated fromthe cloned CDNA and an assay will be developed to clonethe PEX substrate and/or PEX receptorâ which may alsohave important biological functions. For this assay, asoluble form of PEX protein will be used to bind afluorescent substrate and conditioned media from COScells transfected with various CDNA expression librar-ies will be used to compete with the substrate for theW0 98/ 10078l0l520253035CA 02264955 1999-03-01PCT/CA97l00617_ ll _PEX protein. Step-wise analysis will lead to identifi-cation of the CDNA encoding the physiological substrateof PEX.recombinant PEX interacts with a specific receptor andother studies will determine if radiolabeledif so, the receptor will be cloned by expressioncloning.EXAMPLE IIUses of specific antiâPEx antibodySpecific PEX antibodies will be generated fordeveloping assays that will measure circulating levelsof thischronic renal failure.peptide in various clinical states such asEXAMPLE IIICompetitive inhibitors or activators ofPEX enzymatic activityOther studies will concentrate on the role ofPEX inimpaired phosphatepathological states characterized bywithdevelop hyper-commonexcretion, as in patientschronic renal failure. These patientsphosphatemia that causes a number of complications suchas ectopic calcifications, secondary hyperparathyroidâism and inevitable metabolic bone disease leading toThetherapeutic value of pharmacological manipulation ofPEXcompetitive inhibitors or activators of its enzymaticincreased morbidity and mortality. potentialin this condition will be examined by designingactivity and/or its receptor, and studying their ef-fects, first in animal models of chronic renal failure,and eventually in patients.EXAMPLE IVGene transfer using PEX cDNAIn animal studies, we will use the technique ofgene transfer to introduce normal and mutated PEX cDNAin normal mice and in mice with the murine counterpartof HYP to study the biology of the protein and itsW0 98/1007810152025CA 02264955 1999-03-01PCT/CA97/0061 7ability to reverse the biochemicalâand physical abnor-malities associated. with the latter disorder. Poten-tially,peutic purposes to patients with HYP as well as otherthese experiments can be extended for thera-disorders of phosphate homeostasis.EXAMPLE VRole of PEX in tumorswilldefining the role of PEX in tumor growth by assessingFinally, studies also be directed inits activity and/or prenylation during neoplastictransformation. Prenylation is necessary for associa-tion with the plasma membrane and cell transformation.The critical role of prenylation can be exploited bythe use of rational drug design to create novel anti-cancer treatments that interfere with PEX protein func-tion.While the invention has been described in con-it will beunderstood that it is capable of further modificationsnection with specific embodiments thereof,and this application is intended to cover any varia-or adaptations of the invention following,the theincluding such departures from the present disclosuretions, uses,in general, principles of invention andas come within known or customary practice within theart to which the invention pertains and as may beapplied to the essential features hereinbefore setforth, and as follows in the scope of the appendedclaims.
