Note: Descriptions are shown in the official language in which they were submitted.
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97I23533
VEGF-B/RECEPTOR COMPLEX AND USES THEREOF
Background of the Invention
The present invention relates to a complex of Vascular
Endothelial Growth Factor-B (VEGF-B) and the Flt-1 receptor,
to methods of using such complexes to induce or antagonize
a VEGF-B-mediated cellular response, to assay kits for
identifying VEGF-B and/or VEGF-B analogs, and to isolated
binding partners, such as antibodies, which bind to VEGF-
B/Flt-1 complexes.
Vascular Endothelial Growth Factor (VEGF or VEGF-A;
sometimes also referred to as Vascular Permeability Factor
or VPF) is an angiogenic growth factor of the PDGF family.
It exerts its effect through two endothelial receptor
tyrosine kinases (RTKs), Flt-1 (also known as VEGFR-1)
[Shibuya et al., Oncogene, 5:519-524 (1990); de Vries et
al., Science, 255:989-991 (1992)] and Flk-1/KDR (also known
as VEGFR-2) [Matthews et al., Proc. Natl. Acad. Sci. USA,
88:9026-30 (1991); Terman et al., Biochem. Biopphys. Res.
Comm., 187:1579-86 (1992); Millauer et al., Ce11,72:835-46
(3993)]. These receptors appear to play a pivotal role in
regulation of endothelial cell growth and differentiation
and in maintenance of the functions of the mature
endothelium [Shalaby et al., Nature, 376:62-66 (1995); Fong
et al., Nature, 376:66-70 (1995)]. VEGF and its high
. affinity receptors Flt-1 and KDR/flk-1 are required for the
formation and maintenance of the vascular system as well as
for both physiological and pathological angiogenesis.
Placenta growth factor (P1GF) [Maglione et al., Proc.
Natl. Acad. Sci. USA, 88:9267-71 (1991)] is another ligand
for the Flt-1 RTK [Park et al., J. Biol. Chem., 269:25646-54
CA 02274675 1999-06-10
WO 98128621 PCTlUS97l23533
(1994)]. It is also a member of the PDGF family and is
structurally related to VEGF, but its biological function is
not presently well understood.
VEGF-B is a distinct growth factor for endothelial
cells described in Olofsson et al., "Vascular endothelial
growth factor B, a novel growth factor for endothelial
cells", Proc. Natl. Acad. Sci. USA, 93:2576-81 (1996). Like
VEGF and P1GF, it is a member of the PDGF family of growth
factors with which it shares substantial structural
similarities, including a pattern of conserved cysteine
residues which form disulfide bonds involved in homo- and
hetero-dimerization of the molecule. Nevertheless, VEGF-B
exhibits only approximately 40 to 45 percent sequence
similarity to VEGF and only approximately 30 percent
sequence similarity to P1GF. VEGF-B has been found to be
co-expressed with VEGF in various tissues and is
particularly abundant in heart and skeletal muscle tissue.
It promotes mitosis and proliferation of endothelial cells
and appears to have a role in endothelial tissue growth and
angiogenesis. VEGF-B may potentiate the mitogenic activity
of low concentrations of VEGF both in vitro and in vivo.
The present invention is based on the discovery that
VEGF-B is capable of binding to the extracellular domain of
Flt-1 receptor tyrosine kinase to form bioactive complexes
which mediate useful cell responses and/or antagonize
undesired biological activities.
References herein to the amino acid sequence of VEGF-B
refer to the sequence for human VEGF-Bles described in
Eriksson et al., published PCT Application No. WO 96/26736
(Genbank database accession no. U52819). References to the
amino acid or nucleotide sequences of Flt-1 refer to the
sequences described by Shibuya et al.) Oncogene) 5:519
(1990), (EMBL database accession no. X51602). Binding
affinity of VEGF-B and/or VEGF-B analogs for the Flt-1
receptor or analogs thereof is tested according to the
procedure described in Lee et al . , Proc. Natl . Acad. Sci . ,
- 2 -
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
93:1988 (1996). A useful method for assaying endothelial
cell proliferation is described in Olofsson et al., Proc.
Natl. Acad. Sci. USA, 93:2576-81 (1996) .
In accordance with one preferred aspect of the
. 5 invention, the invention relates to a method for identifying
a VEGF-B analog having substantially the same binding
affinity for a cell surface receptor as VEGF-B, the method
comprising the steps of:
(a) providing a sample containing a receptor protein
selected from the group consisting of:
(i) a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1,
or a VEGF-B-specific receptor analog thereof;
(ii) a polypeptide chain having binding affinity
for VEGF-B and sharing at least 30% amino
acid identity with residues 1-347 of Flt-1;
and
(iii) a polypeptide chain having binding affinity
for VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined
by nucleotides 1-1293 of Flt-1;
(b) contacting said sample of step (a) with a
candidate VEGF-B analog; and
(c) detecting specific binding between the candidate
VEGF-B analog and the receptor protein of step (a).
VEGF-B binding to a cell surface receptor is considered
to involve a VEGF-B dimer binding to the receptor which
causes dimerization of the receptor and autophosphorylation
of that receptor followed by intra-cellular signalling and,
~ in appropriate circumstances, a cellular response such as
angiogenesis.
The sample containing receptor protein could be, for
example, soluble Flt receptor produced naturally in the
- 3 -
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97/23533
conditioned medium of cells that normally express the
receptor. Tissue samples or tissue fluids shed naturally
from cells by proteolytic events also could be used as
receptor samples.
The VEGF-B analogs identified by this aspect of the
invention may be small molecules, for example proteins or
peptides or non-proteinaceous compounds such as DNA or RNA.
The analogs also could include VEGF-B or a derivative
(including, but not limited to, a fragement of a VEGF-B
monomer or dimer) tagged with a toxin or drug or radioactive
isotope which could target Flt-1 expressed and upregulated
on endothelial cells in tumors. Such molecules could be
useful to antagonize or inhibit unwanted VEGF-B induced
cellular responses such as tumor-induced angiogenesis or
psoriasis or retinopathies by techniques analogous to those
described in Kim et al., Nature, 362(6243):841-44 (1993) or
Aiello et al., New England Journal of Medicine,
331 (22) :1480-87 (1994) .
One procedure for isolating VEGF-B/Flt-1 complexes
involves using fusion proteins of the Flt-1 receptor and
immunoglobulin G (IgG) followed by Sepharose A binding.
Alternatives to the use of Sepharose A include using ion
exchange chromatography, gel filtration or affinity
chromatography. Conditioned medium containing receptor/IgG
fusion proteins could be allowed to interact with
conditioned medium either from cells either transfected with
DNA encoding the VEGF-B ligand or analog thereof, or from
cells which naturally express the ligand, or with a solution
containing a candidate ligand analog.
In accordance with another preferred aspect of the
invention, the invention relates to a method for identifying
a VEGF-B analog having substantially the same binding
affinity for a cell surface receptor as VEGF-B, the method
comprising the steps of:
- 4 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97J23533
(a) providing a sample containing cells that express
a surface receptor protein having binding affinity for
VEGF-B selected from the group consisting of:
(i} a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1,
or a VEGF-B-specific receptor analog thereof;
(ii) a polypeptide chain having binding affinity
for VEGF-B and sharing at least 30a amino
acid identity with residues 1-347 of Flt-1;
and
(iii) a polypeptide chain having binding affinity
for VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined
by nucleotides 1-1293 of Flt-1;
(b} contacting the cells with a candidate VEGF-B
analog, and
(c) detecting induction of a VEGF-B-mediated cellular
response. Examples of such detectable cellular responses
include endothelial cell proliferation, angiogenesis,
tyrosine phosphorylation of receptors, and cell migration.
The cells which express the cell surface receptor
protein may be cells which naturally express the receptor,
or they may be cells transfected with the receptor such that
the receptor is expressed. Conditioned medium from
culturing such cells can be passed over a Sepharose A column
or matrix to immobilize the receptor, or they can be
immobilized in cellulose disks or absorbed onto plastic, in
the form of an ELISA test. A second solution containing
conditioned medium from cells expressing the ligand is then
passed over such immobilized receptor. If desired, the
. ligand may be radioactively labelled in order to facilitate
measurement of the amount of bound ligand by radioassay
techniques. Such an assay can be used to screen for
conditions involving overexpression of the Flt-1 receptor,
i.e. through detection of increased bound radioactivity
- 5 -
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97/23533
compared to a control. This methodology can also be used to
screen for the presence of competing VEGF-B analogs, i . a .
through detection of decreased bound radioactivity compared
to a control indicative of competition between the
radioactively labelled VEGF-B ligand used in the test and a
non-radioactive putative analog.
Alternatively, the foregoing assay could be reversed by
immobilizing the VEGF-B ligand or candidate analog and
contacting the immobilized ligand with conditioned medium
from cells expressing the receptor.
In accordance with yet another aspect of the invention,
the invention relates to a kit for identifying VEGF-B or a
candidate VEGF-B analog in a sample, the kit comprising:
(a) a receptacle adapted to receive a sample and
containing a receptor protein selected from the group
consisting of:
(i) a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1,
or a VEGF-B-specific receptor analog thereof;
2o (ii) a polypeptide chain having binding affinity
for VEGF-B and sharing at least 30% amino
acid identity with residues I-347 of Flt-1;
and
(iii) a polypeptide chain having binding affinity
for VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined
by nucleotides 1-1293 of Flt-1;
and
(b) means for detecting interaction of VEGF-B or a
candidate VEGF-B analog with the receptor protein contained
in the receptacle, wherein the VEGF-B or candidate VEGF-B
analog comprises part of a sample received in the
receptacle. The detecting means may comprise, for example,
means for detecting specific binding interaction of VEGF-B
or a VEGF-B analog with the receptor protein or means for
detecting induction of a VEGF-B induced cellular response.
-s-
CA 02274675 1999-06-10
WO 98/28621 PCT/US97123533
A still further aspect of the invention relates to an
isolated ligand-receptor complex comprising two molecules,
one defining the ligand and comprising at least amino acids
1-115 of VEGF-B or a receptor-binding analog thereof, and
the second defining the receptor and being selected from the
group consisting of:
(i) a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1, or a
VEGF-B-specific receptor analog thereof;
(ii) a polypeptide chain having binding affinity for
VEGF-B and sharing at least 30o amino acid
identity with residues 1-347 of Flt-1;
(iii) a polypeptide chain having binding affinity for
VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined by
nucleotides 1-1293 of Flt-1.
Preferably the ligand is VEGF-B and the receptor is the
Flt-1 receptor which also has binding affinity for VEGF-A
and P1GF.
Isolation and purification of the ligands or complexes
could be effected by conventional procedures such as
immunoaffinity purification using monoclonal antibodies
according to techniques described in standard reference
works such as Harlow et al., Antibodies, a Laboratory
i~?anual, Cold Spring Harbor Laboratory Press (1988) and/or
Marshak et al., Strategies for Protein Purification and
Characterization, Cold Spring Harbor Laboratory Press
(1996). Suitable antibodies to the individual ligands or to
the complexes could be generated by conventional techniques.
A cell-free complex could be used either in vi vo or in
vitro to compete with VEGF-B binding to a cell surface
' receptor or to prevent dimerization of the cell-bound
receptor after ligand binding. Such a cell-free complex
would comprise at least one receptor molecule, for example
soluble FLT (sFLT), and a VEGF-B dimer molecule, VEGF-B
analog dimer molecule or mixed VEGF-B/VEGF-B analog dimer
- 7 _
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97/23533
molecule so that one molecule of the dimer can be bound to
the receptor molecule in the complex and the second molecule
of the dimer has a free binding site available to bind to a
cell surface receptor.
It is also an aspect of the present invention to
provide an isolated binding partner having specific binding
affinity for an epitope on a ligand-receptor complex
comprising VEGF-B protein or an analog thereof in specific
binding interaction with the ligand binding domain of a cell
surface receptor defined by:
(i) a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1, or a
VEGF-B-specific receptor analog thereof;
(ii) a polypeptide chain having binding affinity for
VEGF-B and sharing at least 30o amino acid
identity with residues 1-347 of Flt-1; or
(iii) a polypeptide chain having binding affinity for
VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined by
nucleotides 1-1293 of Flt-l;
wherein the binding partner has substantially no binding
affinity for uncomplexed VEGF-B or VEGF-B analog.
Preferably the binding partner also will have substantially
no binding affinity for any uncomplexed form of the cell
surface receptor protein or receptor analog thereof. The
binding partner may be an antibody which reacts with or
recognizes such growth factor/receptor complexes. Either
polyclonal or monoclonal antibodies may be used, but
monoclonal antibodies are preferred. Such antibodies can be
made by standard techniques, screening out those that bind
to either receptor or ligand individually.
An additional aspect of the invention relates to the
use of a VEGF-B analog obtained according to the methods
described above for
(i) antagonizing VEGF-B binding to a cell surface
receptor, or
_ g _
CA 02274675 1999-06-10
WO 98128621 , PCTlUS97I23533
(ii) antagonizing induction of a VEGF-B-mediated
cellular response.
A preferred VEGF-B analog comprises an antibody having
binding specificity for
(i) the ligand binding domain of a cell surface
receptor having binding affinity for VEGF-B, or
(ii) a receptor binding domain of VEGF-B or a receptor-
binding analog thereof.
The ligand binding domain of a cell surface receptor
ZO having binding affinity for VEGF-B desirably will exhibit at
least 30%, preferably at least 350, amino acid identity with
residues 1-347 of Flt-1 and especially preferably will
correspond thereto. The receptor binding domain of a VEGF-B
analog desirably will exhibit at least 500, preferably at
least 650, sequence identity with amino acid residues 1-115
of VEGF-B, and especially preferably will correspond
thereto.
Yet another aspect of the invention relates to the use
of a receptor protein selected from the group consisting of
(i) a polypeptide chain comprising an amino acid
sequence defined by residues 1-347 of Flt-1, or a
VEGF-B-specific receptor analog thereof;
(ii) a polypeptide chain having binding affinity for
VEGF-B and sharing at least 30o amino acid
identity with residues 1-347 of Flt-1; or
(iii) a polypeptide chain having binding affinity for
VEGF-B and encoded by a nucleic acid that
hybridizes under stringent conditions with a
nucleic acid comprising the sequence defined by
nucleotides 1-1293 of Flt-1;
in a method for antagonizing:
(a) VEGF-B binding to a cell surface receptor, or
' (b) induction of a VEGF-B-mediated cellular response.
The polypeptide chain competes with the cell surface
receptor for VEGF-B and ties up the available VEGF-B,
thereby preventing it from effectively interacting with the
cell surface receptor and inducing the VEGF-B mediated
_ g _
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
cellular response. A suitable peptide chain could be a
solubilized form of the receptor (sFLT) as described in
Kendall et al., Proc. Natl. Acad. Sci., 90:10705-709 (1993)-
Additionally, it is an aspect of the invention to
provide a method for antagonizing VEGF-B binding to a cell
surface receptor, the method comprising the step of
providing a protein having binding specificity for the amino
acid sequence defined by residues 1-347 of Flt-1 or a VEGF-B
receptor binding sequence variant thereof, wherein the
protein has at least 50%, and preferably at least 650, amino
acid sequence identity with residues 1-115 of VEGF-B, such
that the protein, when provided to a cell expressing the
cell surface receptor, is competent to interact specifically
with the receptor and thereby substantially inhibits VEGF-B
binding to the receptor. The protein may desirably be a
VEGF-B analog obtained according to one of the methods
described above.
In accordance with a further aspect of the invention,
pharmaceutical preparations are provided which comprise such
growth factor/receptor complexes.
In yet another aspect of the invention a method is
provided for treating a disease state characterized by
overexpression of an Flt-1 cell surface receptor, said
method comprising administering to a patient suffering from
said disease state an effective receptor-binding amount of
VEGF-B or a VEGF-B analog obtained according to one of the
methods described above.
Where the receptor protein comprises a polypeptide
chain other than residues 1-347 of Flt-1 but which
nevertheless exhibits a binding affinity for VEGF-B, it
should exhibit at least 300, desirably at least 35%,
preferably at least 65 0 , particularly preferably at least
90%, and especially preferably at least 95%, amino acid
identity with residues 1-347 of Flt-1. Useful VEGF-B
analogs should exhibit at least 50%, preferably at least
65a, particularly preferably at least 90a, and especially
preferably at least 950, sequence identity to VEGF-B.
- 10 -
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
Brief Description of the Drawings
The invention will be described in further detail
hereinafter with reference to illustrative experiments, the
results of which are illustrated in the accompanying
drawings in which:
Figure 1 is an anti-PTyr probed Western blot of Flt-1
immunoprecipitates from Flt-1 expressing NIH3T3 cells
stimulated with conditioned media from 293 EBNA cells
transfected respectively with expression vectors for human
VEGF and VEGF-B;
Figures 2(a? and (b) are respectively long and short
exposures of SDS-PAGE electrophoresis gels showing binding
of 35S-methionine-labelled murine VEGF-Blab to Flt-1-IgFc
fusion protein;
Figure 3 is an SDS-PAGE analysis of the binding of
VEGFiss, VEGF-B16-" VEGF-Blas and VEGF-C to soluble VEGFR-1,
VEGFR-2 and VEGFR-3;
Figure 4 is a graph of the displacement of [lasl] _hVEGFI6s
from VEGFR-1/Flt-1 by mVEGF-Bleb using NIH3T3 Flt-1 cells;
Figure 5 is a graph of competition on NIH-VEGFR-1/Flt-1
by mVEGFlsa ;
Figure 6 shows displacement of VEGF-B16., and VEGF-Blas
from soluble VEGFR-1 by excess VEGFlss
Figure 7 is an SDS-PAGE analysis showing proteolytic
processing of VEGF-Blas
Figure 8 is an SDS PAGE analysis showing plasmin
digestion of VEGF-Bles
Figure 9 is a schematic diagram showing mutations of
VEGF-B16, used for mutational analysis and binding of receptor
binding epitope mutants to soluble VEGFR-1;
Figures l0a through lOc show an SDS-PAGE analysis of
cysteine mutations of VEGF-B;
Figure 1.1 shows an SDS-PAGE analysis of VEGF-B16~ mutants
labelled in the presence of 10 ~g/ml heparin;
Figure 12 shows a Northern Blot analysis of RNA from
bovine microvascular endothelial (BME) cells incubated in
the presence of 50 ng/ml hVEGF-Bles% and
- 11 -
CA 02274675 1999-06-10
WO 98/28621 PCT/ITS97/23533
Figures 13a and 13b show a zymographic and reverse
zymographic analysis of cell extracts prepared from BME
cells incubated in the presence of hVEGF-Bles-
General Methods
Cell culture and materials:
Sf-9 cells were maintained in Sf-900 II SFM (Gibco BRL,
Life Technologies) supplemented with O.lo pluronic f-68 for
suspension growth.
High Five cells (Invitrogen) were maintained in Ex-cell
400 media (JHR Bioscience UK).
293-EBNA, COS-7, 293-T and NIH3T3-Flt-1 cells [Sawano
et al., Cell Growth & Differentiation 7, 213-21 (1996)] were
grown in Dulbecco's minimum essential medium (DMEM)
supplemented with 10% fetal calf serum (FCS). NIH3T3 Flt-1
were kept under continuous selection using 200 ~.g/ml
neomycin.
Bovine adrenal cortex-derived microvascular endothelial
(BME) cells were grown in MEM, alpha modification (Gibco AG,
Basel, Switzerland) supplemented with 15e donor calf serum
on 1.5o gelatin coated tissue culture flasks.
PAE-KDR cells [Waltenberger et al., J. Biol. Chem.,
269:26988-95 (1994)] were cultured in Ham's F12 media with
loo FCS.
Construction of receptor Ig-fusions and Expression Vectors:
a) pIg-VEGFR-1.
The expression plasmid pIg-VEGFR-1 coding for the first
five Ig-like domains of VEGFR-1 fused to human IgG1 Fc was
constructed by legating a HindIII fragment (coding for the
amino acids 1-549 of VEGFR-1) from pLTR Fltl into pIgplus
vector (Ingenius). Prior to the cloning the pIgplus vector
was digested with XhoI and XbaI, blunted and relegated in
order to correct the reading frame for the fusion protein
production.
- 12 -
CA 02274675 1999-06-10
WO 98128621 PCTIUS97/Z3533
b) spIg-VEGFR-2.
For the spIg-VEGFR-2 construct , cDNA encoding the first
four Ig-like domains of VEGFR-2 was amplified by polymerase
chain reaction (PCR) using human fetal lung cDNA library
(Clontech) as a template. The primers
5'-atggtacccccaggctcagcatacaaaaagac-3' (SEQ ID NO. 1)
and
5'- gcgtctagagggtgggacatacacaaccag-3' (SEQ ID NO. 2)
were used, and the amplified fragment was cleaved with Kpn-1
and Xba-1 and cloned into corresponding sites of signal pIg
vector ( Ingenius ) .
c ) mVEGF-B186 pFASTBACl .
mVEGF-Blg6 cDNA [Olofsson et al., J. Biol. Chem.
271:19310-19317 (1996)] was cleaved by EcoRI and subcloned
into pFASTBACl (Gibco BRL Life Technologies). A (His)6 tag
(and an enterokinase site} was introduced at the N-terminus
devoid of signal sequence, using PCR with mVEGF-Blas pSG5 as
a template, and the primers
5'-atcgagatcttcatcaccatcaccatcacggagatgacgatgacaaacctgtgtc
ccagttt-3' (SEQ ID NO. 3) and
5'-caagggcggggcttagagatctagct-3' (SEQ ID NO. 4)
(both containing Bgl II sites) were used. The amplified
fragment was cleaved with Bgl II and cloned into the Bam HI
site in frame with the signal sequence of GP-67, of
pAcGP67A, (Pharmingen, U.S.A.).
d) hVEGF-Bleb pPIC-9.
hVEGF-Bles was amplified by PCR using the forward primer
5'-ggaattccccgcccaggcccctgtc-3' (SEQ ID NO. 5)
and the reverse primer
5'-ggaattcaatgatgatgatgatgatgagccccgcccttggc-3' (SEQ ID NO.
6) .
The amplified product containing a C-terminal (His)6 tag was
cloned into the EcoRI site of pPIC-9 (Invitrogen) in frame
with the alpha mating factor signal sequence.
- 13 -
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97/23533
The authenticity of all sequences was verified by
sequencing.
Protein Expression and Purification:
For baculoviral production using Sf9 and High Five
cells, mVEGF-B recombinant plaques were purified and
amplified [Summers et al., Tex. Agric. Exp. Stn. Bul.I.
1555:1-57 (1988)], and the corresponding expressed proteins
as well as the Pichia pastoris (strain GS115) expressed
hVEGF-Blas were purified using Ni-NTA Superflow resin
(Qiagen) .
For quantitative immunoblots, media from infected
insect cells were run together with 1-30 ng purified
m(His)6VEGF-Bleb as a standard on a reducing 12o SDS-PAGE and
blotted with the affinity purified antibody against
m (His) 6VEGF-Blas.
Transfection, immunoprecipitation and soluble receptor
binding:
293-T cells or COS-7 cells were transfected with
hVEGFlsspSG5 , mVEGF-Bl6~pSG5 , mVEGF-BkEXi-sPSGS , mVEGF-Blg6pSG5 ,
VEGFR-1 pIg and VEGFR-2 pIg using calcium phosphate
precipitation. VEGFR-3 EC-Ig pREP7 (obtained from Dr. Katri
Pajusola) and hVEGF-CONIC (His)6 pREP7 [Joukov et al., EMBO
J. 16:3898-911 (1997)] were similarly expressed in 293-EBNA
cells. The cells expressing the growth factors were
metabolically labelled 48 hours post transfection with 100
~.Ci/ml Promix TM L-35 S (Amersham) for 5-6 hours (unless
otherwise stated), and the media were collected. Heparin (10
or 50 ~Cg/ml) was added to the labeling medium when
indicated. The metabolically labelled media (except from the
VEGF transfection) was immuna-depleted of endogenous
expressed VEGF and heterodimers for 2 hours with 2~.g/ml VEGF
antibody MAB 293 (R&D Systems). For the soluble receptors
the media was replaced 48 hours post transfection by DMEM
containing 0.1% BSA and incubated for additional 12 hours.
- 14 -
CA 02274675 1999-06-10
WO 98/28621 PCT/LTS97123533
The receptor-Ig fusions (in some cases the amounts were
quantified on 10% SDS-PAGE stained with Colloidal Comassie
(Novex, San Diego)) and the same volume of media from mock
transfected cells were absorbed to protein-A-Sepharose. The
metabolically labelled growth factors were incubated with
the receptor Ig fusions for 3 hours at + 4°C and washed with
ice-cold binding buffer (PBS 0.5o BSA, 0.020 Tween 20 and
1mM PMSF) three times and twice with PBS containing 1mM
PMSF.
Antibody Production:
Rabbits were immunized with purified m(His)6VEGF-B186
according to standard procedures and the resulting antiserum
was collected. Antiserum to mVEGF-B N-terminal peptide was
produced as described in [Olofsson et al . , J. Bio1 . Chem.
271:19310-19317 (1996)]. The antisera were affinity
purified against m (His) 6VEGF-B186 covalently bound to
CNBr-activated Sepharose CL-4B (Pharmacia).
Example 1
Procedure:
Cultures of NIH3T3 cells expressing human Flt-1
receptor protein were first starved in 0.5a fetal calf serum
(FCS) in DMEM for 24 hours. The cells were then stimulated
for 5 minutes at 37°C in conditioned medium from cultures of
293 EBNA cells which had been transfected respectively with
pREP7-hVEGF-A or pREP7-hVEGF-B16.,. Conditioned medium from
293 EBNA cells transfected with pREP7 alone was used as a
negative control (Mock). All conditioned media contained 1
~g/ml heparin. After stimulation, the cells were rinsed in
ice-cold PBS containing 0.1 mM sodium orthovanadate and
lysed in RIPA buffer containing 2 mM sodium orthovanadate,
1 mg/ml aprotinin and 1 mM PMSF. The lysates were
sonicated, clarified by centrifugation and incubated on ice
for 2 hours with the anti-flt-1 antibody, SC316 (Santa
Cruz). The resulting immune complexes were collected by
- 15 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97J23533
precipitation with protein A-sepharose beads.
Immunoprecipitates were washed three times with the lysis
buffer, separated by electrophoresis on 6% SDS PAGE and
transferred to a nitrocellulose filter. The filter was
probed with horse-radish peroxide (HRP)-conjugated anti
phosphotyrosine antibody RC20H (Transduction Labs) and
immunoreactivity detected by ECL (Amersham). The anti
phosphotyrosine antibody recognized phosphorylated tyrosine
on Flt-1 and enabled observation of autophosphorylation of
the Flt-1 receptor.
Results:
As can be seen from the accompanying Figure 1, which is
an anti-PTyr probed Western blot of Flt-1 immunoprecipitated
from Flt-1 expressing NIH3T3 cells stimulated with
heparin-supplemented conditioned medium from VEGF vector,
empty vector or human VEGF-B16., pREP7 vector-transfected 293
EBNA cells, somewhat weak but nevertheless positive tyrosine
phosphorylated bands are observed for both VEGF-A and VEGF-B
which indicate that both of these ligands cause
autophosphorylation of Flt-1. In contrast, the mock (-)
lane in the center of the Figure is devoid of
autophosphorylation.
This data shows that human VEGF-B binds with and
induces autophosphorylation of the Flt-1 receptor. This
indicates that Flt-1 also is a receptor for human VEGF-Bls~.
Example 2
Procedure:
Receptor IgG fusion proteins:
cDNA encoding the first three immunoglobulin (Ig) loops
of Flt-1 was spliced to the Fc region of a human IgG heavy
chain and cloned in to the vector pREP7 (Invitrogen) to
yield the plasmid pREP7 Flt-1-IgFc. pREP7 KDR-IgFc was
constructed in a similar fashion. The Flt-1-Ig Fc and KDR-
Ig Fc cDNAs used in this experiment were RT-PCR products
- 16 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97123533
from a plasmid construct called pBJFItKT3. The resulting
plasmids were used to transfect 293 EBNA cells by the
calcium phosphate method, and the resulting conditioned
medium was harvested 48 hours post-transfection.
Receptor IgG precipitation of 35S-labeled mVEGF-B186:
Plasmid pSJS (Stratagene) encoding for murine VEGF-Bles
(pSJ5 VEGF-B186} was transfected into COS cells by
electroporation, and the cells were labeled for 10 hours
with 35S-methionine and 35S-cysteine. 35S-labeled hVEGF-A16S
was used as a positive control for receptor binding and was
produced in 293 EBNA cells transfected with pREP7 VEGF-A and
labeled as described above. About 1 ml of conditioned
medium containing Flt-1-IgFc or KDR-IgFc was incubated with
40 ~.l of a 50% slurry of protein-A sepharose for 1 hour at
4°C under continuous agitation. Conditioned medium from
mock-transfected cells was used as a negative control. The
protein-A sepharose beads were collected by centrifugation,
and incubated with 1 ml of conditioned medium containing
35S-labeled mVEGF-B186 or VEGF (-A) in binding buffer (PBS,
0.5 o BSA, 0. 02% Tween 20, 1 ~g/ml heparin) for 3 hours at
room temperature with gentle agitation. The protein-A
sepharose beads were collected by centrifugation, washed
twice in ice-cold binding buffer and once in 20 mM tris pH
7.5, boiled in SDS sample buffer and electrophoresed on l00
PAGE.
Results:
The results are shown in Figures 2(a) and (b), which
are long and short exposures of the SDS-PAGE gels. In the
Figures, lane 1 shows immunoprecipitated murine VEGF-Bleb:
lane 2 shows Flt-1-Ig, mVEGF-Bles% lane 3 shows Flt-1-Ig,
mock; lane 4 shows mock, mVEGF-B186; lane 5 shows KDR-Ig,
mVEGF-Bleb: lane 6 shows KDR-Ig, mock. To determine whether
VEGF-Bles is a ligand for Flt-1, plasmid containing cDNA for
this factor, as well as plasmid encoding VEGF(-A), or the
- 17 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
expression vector alone were transfected into mammalian
cells, and the proteins were labeled with 3sS amino acids.
Conditioned medium from these cells were precipitated with
Flt-1-IgFc or KDR-IgFc bound to protein-A sepharose beads.
A 32 kDa band [identified by the upper arrow in Fig. 2 (a) ]
was precipitated from the VEGF-B186 conditioned medium with
Flt-1-IgFc. This band, which co-migrates with
immunoprecipitated VEGF-Bles. was absent in the Flt-1-IgFc
precipitation of mock transfected cells, or precipitation of
VEGF-Bls6 bY protein-A sepharose alone. Little precipitation
of this 32 kDa band was also found with KDR-IgFc.
The data clearly show the formation of complexes
between the murine VEGF-Blab and the human Flt-1 receptor.
As can also be seen from the Figs . 2 (a) and (b) , both
Flt-1-IgFc and KDR-IgFc additionally precipitated lower
molecular weight species, but these three bands also were
found in conditioned medium of mock transfected cells, and
are considered to represent endogenous factors produced by
COS cells, possibly VEGF(-A). Of these, the band indicated
by the arrow in brackets may also partially represent VEGF-B
related material.
Example 3
Test of VEGF-B binding to VEGFR-1, -2 and/or -3:
To determine whether VEGF-B is a ligand for VEGFR-1 -2
or -3, 293T cells were transfected with expression plasmids
for VEGFlss, mVEGF-B16." mVEGF-Blas or VEGF-C, and the proteins
were metabolically labelled, in the presence of 50 ~,g/ml
heparin for VEGFlss and VEGF-B167, and the media was collected.
Conditioned media from all except the VEGF transfection
were precleared of endogenous VEGF and VEGF/VEGF-B
heterodimers and then the respective proteins were either
immunoprecipitated with specific antibodies or bound to
soluble receptor Ig fusion proteins containing the first
five Ig-like domains of Flt-1 bound to protein A-Sepharose
(PAS). The precipitated ligands were analyzed by SDS-PAGE
- 18 -
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97I23533
under reducing conditions. Approximately 50 ng of soluble
receptor was used for each ligand precipitation. As shown
in Fig. 3, both VEGF-B splice isoforms specifically bound to
VEGFR-1 but not to VEGFR-2 or -3. Functionality of the
VEGFR-2 and VEGFR-3 receptors was confirmed by the binding
tests with VEGF and VEGF-C, respectively. This test shows
that VEGF-B binds specifically to VEGFR-1/Flt-1, making it
the third ligand identified for VEGFR-1, after VEGF and
P1GF.
Two bands of 32 kD and 16 kD were precipitated from the
mVEGF-Blas conditioned medium with the specific antibody and
by VEGFR-1. The 32 kD band corresponds to the glycosylated,
secreted form of mVEGF-BlB6 [Olofsson et al . , J. Biol. Chem.
271:19310-19317 (1996)]. The 16 kD form is apparently a
product of proteolytic processing described in further
detail hereinafter.
Example 4
Further Examination of VEGF-B/VEGFR-1 Binding:
The ability of VEGF-B to bind VEGFR-1 expressed on cell
surface was examined using NIH3T3-Fltl cells. Consistent
with the data obtained with soluble receptors, conditioned
media from mVEGF-B186-infected, but not mock infected High
Five cells, competed for lasl-VEGF binding to NIH3T3-Fltl as
seen in Fig. 4. Half maximum inhibitory concentration for
mVEGF-B186 was estimated using quantitative immunoblots to 3
ng/ml compared to recombinant mVEGFls4 which competed for
iodinated hVEGFlss at a half maximum inhibitory concentration
at 1.5 ng/ml (Figs. 4 and 5). This effect was specific to
VEGFR-1 as no competition was observed with PAE-KDR cells.
Thus it is apparent that although VEGF-B186, like VEGFl2l~
lacks the C-terminal basic residues found in VEGFlss, it
nevertheless binds to VEGFR-1 on NIH3T3-Fltl cells. VEGF-B
also was found to bind equally well to the VEGFR-1 Ig-fusion
containing the three N-terminal Ig-like domains of VEGFR-1
(residues 1-347) as well as to the VEGFR-1 Ig-fusion
containing five of the Ig-like domains.
- 19 -
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
Due to aggregation and protein stability problems,
purified His-tagged VEGF-B (human and mouse (His)6VEGF-Blg6.
also C-terminal deletion mutants covering exons 1-5 of mouse
and human (His)6VEGF-B) competed only at high concentrations
with iodinated VEGF for VEGFR-1 binding.
Example 5
VEGF Competition Studies:
mVEGF-B16., and mVEGF-Blgs expressed in transfected 293-T
cells were labelled and precleared as described in the
binding test, with the only difference being that 10 /Cg/ml
heparin was used for mVEGF-Bz6., in the labelling media. 2 ~.g
of recombinant hVEGFISS was added as a cold competitor to the
binding reaction when indicated. Equal volumes of
metabolically labelled factors were bound to soluble VEGFR-1
or immunoprecipitated with affinity purified N-terminal
peptide VEGF-B antibody for 2 hours and washed twice with
ice-cold lOmM Tris-HCl pH 8.0, 1% TritonX-100, 25 mM EDTA,
1mM PMSF and twice with PBS containing 1mM PMSF. The
precipitates were analyzed by 15% SDS-PAGE. As shown in
Fig. 6, the binding of these two forms as well as that of
mVEGF-B16, to VEGFR-1 was abolished by excess rhVEGF, thereby
indicating that binding of VEGF-B to VEGFR-Z can be competed
by excess VEGF. This test result confirms the specificity
of the interaction and suggests that the interaction sites
for VEGF and VEGF-B on the receptor must be overlapping,
partially overlapping or at least in close proximity.
Example 6
Competition for Binding to Cell Surface Receptors:
For the competition assays, High five cells were
infected with the recombinant virus for native mVEGF-Bles
(mVEGF-Bles PFASTBAC1) and with a mock virus, and the media
were harvested 48 hours post infection and immediately used
or frozen at -70°C.
- 20 -
CA 02274675 1999-06-10
WO 98128621 , PCTIUS97123533
Recombinant mVEGFls4 (obtained from Dr. Herbert Weich)
or hVEGFlss (R&D systems or Peprotech) were labelled with Izsl
using the Iodo-Gen reagent (Pierce) and purified by gel
filtration on PD-10 columns (Pharmacia). The specific
activities were 2.2x10s cpm/ng and l.OxlOs cpm/ng for mVEGF
and hVEGF, respectively. For binding analysis PAE-KDR and
NIH3T3-Fltl cells were seeded in 24 well plates coated with
0.2% gelatin, grown to confluence, washed twice with
ice-cold binding buffer (Ham's F12, 0.5mg/ml BSA, 10 mM
Hepes pH 7.4 for PAE-KDR and DMEM, 0.5 mg/ml BSA, 10 mM
Hepes pH 7.4 for NIH3T3 Fltl) and incubated in triplicate
with 0.5 ng/ml [lzsll-VEGF in binding buffer containing
increasing amounts of unlabelled VEGF or media from VEGF-B
or mock infected insect cells. After incubation for 2 hours
at + 4°C, the cells were washed three times with ice-cold
binding buffer and twice with PBS containing 0.5 mg/ml BSA
and lysed in 0.5 M NaOH. The solubilized radioactivity was
measured using a gamma counter. Fig. 4 shows displacement
of [lzsl] _hVEGFlss from VEGFR-1/Fltl by mVEGF-Blas using NIH 3T3
Flt-1 cells. Fig. 5 shows competition on NIH-VEGFR-1/Flt-1
by mVEGFls9
In an analagous test, mVEGF-Bles was found not to compete
with (lasI] -VEGF for VEGFR-2 on PAE-KDR cells .
Competition analysis using purified recombinant
(His)sVEGF-B186 indicated that only a minor portion of the
protein is biologically active, since the native (own signal
sequence) unpurified VEGF-Bzes competed far more efficiently
with iodinated VEGF for VEGFR-1 binding.
Examt~le 7
Proteolytic Processing of VEGF-Blgs
mVEGF-B186 expressed in COS cells is modified by 0-linked
glycosylation, which increases the apparent molecular weight
from 25 kDa of the intracellular form to 32 kDa in the
secreted form. As noted above, when mVEGFBIg6 was expressed
in 293-T cells, a faster form migrating as a 15 kDa band
- 21 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
appeared in addition to the 32 kDa form. This band was also
observed in conditioned media from CAS cells when the cells
were labeled for a longer period. The following test was
carried out to compare the migration of dimers formed by
mVEGF-Bles to mVEGF-B~6~ and a C-terminal truncated form
mVEGF-BkExl-s expressed in 293-T cells and their ability to
bind the sVEGFR-1. The mVEGF-B exon 1-5 mutant containing
a C-terminal Kemptide motif [Mohanraj et al., Protein
Expression & Purification, 8:175-82 (1996) ] (mVEGF-BkExl-5
pSGS, was produced by polymerase chain reaction (PCR).
VEGF-BkExl-5 ~ ~GF-Bls~ and VEGF-B186 were expressed in
293-T cells. The cells were metabolically labelled. Mock
transfected and VEGF-B16., transfected cells were labelled in
the presence of 10 ~.g/ml heparin. The collected media were
precleared of VEGF and heterodimers, and were
immunoprecipitated with an affinity purified N-terminal
VEGF-B peptide antibody or bound to VEGFR-1. The bound
ligands were analyzed by SDS-PAGE under non-reducing
conditions. The results are shown in Fig. 7.
It can be seen that mVEGF-B186 migrates as three
different dimeric polypeptides the shortest being 34 kDa, an
intermediate form of 48 kDa and the full length form of
60kDa. The 34 kDa band migrates slightly slower than
mVEGF-BkExl-5i indicating that the putative cleavage site is
more C-terminal, presumably in the beginning of the
translated exon 6A [Olofsson et al., J. Biol. Chem.
271:19310-19317 (1996)].
The test clearly shows that the longer VEGF-B186 isoform
undergoes proteolytic processing which results in a shorter
form containing the receptor binding epitopes for VEGFR-1.
The functional aspects of this proteolytic processing of
VEGF-B186 are not fully understood. Since the VEGF-Bees
isoform is readily secreted from cells, the proteolytic
processing does not appear to be a way of regulating the
release or availability of the protein.
- 22 -
CA 02274675 1999-06-10
WO 98/28621 PCT/CTS97/23533
As can be seen from Fig. 7, the relative intensity of
the VEGF-B signal compared between the immunoprecipitated
forms and the receptor-bound forms shows that the strength
of the signal seems to correlate with the level of processed
subunits in the dimers, thereby indicating that processing
leads to an increased affinity for the receptor. The 48 kDa
band is believed to consist of a dimer between a processed
(16 kDa) and a full length (32 kDa) monomer. The 34 kDa
band consists of a dimer between two processed monomers of
16 kDa each. It is significant that both these dimers which
comprise the 16 kDa analog produced by processing of VEGF-B,
bind better to the VEGFR-1 receptor than the ~60 kDa dimer
which is made up of two full length 32 kDa monomers.
Example 8
Plasmin Cleavage:
The following test was run to determine whether a full
length form of VEGF-Blas expressed in COS cells could be
cleaved by the addition of plasmin, and if this affects the
VEGFR-1 binding. This could be a physiological mechanism at
the site of basement membrane degradation in the
angiogenesis process.
COS-7 cells were transfected with rnVEGF-Bles
metabolically labelled for 75 minutes, and the collected
media was precleared of VEGF and heterodimers. The media was
then incubated at 37°C with 0.1 U/ml plasmin (Boehringer
Mannheim) for the time periods of 0, 5, 15, 30 and 60
minutes. The reaction was stopped by addition of 1 mM PMSF
and 0.1 casein units of aprotinin. The media were
immunoprecipitated by the affinity purified N-peptide VEGF-B
antibody and also bound to VEGFR-1 Ig. The precipitated
proteins were analyzed by SDS-PAGE under reducing
conditions. The results are shown in Fig. 8.
Concominant with the reduced amounts of the full length
form is the appearance a 15 kDa fragment followed by a
secondary fragment of 12 kDa. Thus plasmin cleavage does
- 23 -
CA 02274675 1999-06-10
WO 98/28621 PCTlUS97I23533
occur, but evidently does not give rise to the same fragment
as the endogenous proteolytic processing of VEGF-Bles
described above. Nevertheless, this N-teminal fragment is
fully capable of interacting with sVEGFR-1, suggesting that
VEGF-B is similar to VEGF, in that the recepetor binding
epitopes are contained in the N-terminal fragment which is
resistent to proteases such as plasmin.
Example 9
Mutational Analysis of Receptor Epitopes:
Crystal structure determination and mapping of the
VEGFR-2 epitope for VEGF has pointed to a number of hot spot
amino acid residues, with the most important residues for
the ligand-receptor interaction being Ile-46, Ile-83,
Glu-64, Phe-17, Gln-79, Pro-85, Ile-43 and Lys-84 [Mullet et
al., Proc. Nail. Acad. Sci. USA 94:7192-7 (1997)]. The
extent to which these residues are involved in VEGFR-1
binding is less clear. By charged amino acid to alanine
scan mutagenesis [Keyt et al., J. Biol. Chem., 271:5638-5646
(1996)] the VEGFR-1 binding epitope in VEGF was proposed to
involve a stretch of acidic residues (Asp-63, Glu-64 and
Glu-67). These amino acid residues are conserved in VEGF-B
(Asp-63, Asp-64 and Glu-67) and to a lesser extent in P1GF.
In order to analyze whether the acidic amino acid
residues which are conserved between VEGF and VEGF-B and
which have been implicated in VEGF/VEGFR-1 binding, are also
are the major determinants for VEGF-B/VEGFR-1 binding, Asp63
Asp64 and G1u67 were mutated into alanines. The mutation
scheme is illustrated in Fig. 9, which is a schematic
illustration of the wildtype VEGF-B forms and the different
mutants.
The putative receptor epitope mutants of VEGF-B16, were
expressed in transfected 293-T cells and metabolically
labelled in the presence of 50 ~,g/ml heparin. In order to
study the VEGF-B homodimers, endogenous VEGF and VEGF
heterodimers formed by VEGF and overexpressed VEGF-B were
- 24 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
immunodepleted with VEGF antibodies (MAB 293 from R&D
Systems). The VEGF-B mutants were either immunoprecipitated
with affinity purified N-terminal peptide antibody or bound
to soluble VEGFR-1 Ig. The precipitates were analyzed by
SDS-PAGE under reducing conditions. From the results it is
apparent that neither mutation of two first acidic residues
nor the mutation of all three acidic amino acid residues
abolished VEGF-B binding to VEGFR-1. Thus, this data based
upon either mutation of all three charged amino acids to
alanines or on mutation of only the first two charged amino
acid residues into alanines, indicates that the conserved
acidic residues are not the major contributors to the
binding of VEGF-B to VEGFR-1.
Example 10
Mutational Analysis of Conserved Cysteines in VEGF-Bls~:
To examine the contribution of the conserved cysteines
to dimer formation of VEGF-B and test the structural
prediction based upon the anti-parallel covalent VEGF dimer
model, cysteine-51 (Cys 2) and cysteine-60 (Cys 4) were
mutated to serine residues. The cysteine to serine mutants
in mVEGF-B16., pSGS were generated by M13-based in vitro single
stranded mutagenesis employing the helper phage M13K07
[Viera et al., Methods Enzymol., 153:3-11 (1987)] and the
dut- ung- E.coli strain RZ1032 [Kunkel et al., Methods
Enzymol. 154:367-382 (1987)]. Mutations were carried out
both as single mutants (C2S and C4S) and as a double mutant
(C2S,C4S). The mutation scheme is illustrated in Fig. 9.
The mutants and wildtype VEGF-816., were expressed alone
or in different combinations as co-transfections and
metabolically labelled in 293-T cells, and the media were
precleared from VEGF and heterodimers. The results are
shown in Figs. l0a-c. The media were either
immunoprecipitated with the affinity purified N-terminal
VEGF-B antibody and analyzed under both non-reducing
conditions (Fig. l0a) and reducing conditions (Fig, lOb) or
- 25 -
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
bound to soluble VEGFR-1 Ig (Fig. lOc). As can be seen from
Fig. 10b, all the mutants were expressed in approximately
same amounts.
It was found that VEGF-Bleb is cleaved, most likely
C-terminal of the region identical in the two splice
variants, which is encoded by exons 1-5 and contains the
cysteine knot as well as the receptor binding epitopes.
Wildtype VEGF-B16., migrated under non-reducing conditions as
two bands 42 kDa and 46 kDa, however only the 46 kDa form
was capable of binding to the VEGFR-1 (compare Figs. 2A and
3C) . The 42 kD band is believed to correspond to dimers
joined together by aberrant disulfide bridges, since these
doublet bands are not seen with VEGF-B186 or VEGF-BkExl-s ~ which
lack the additional eight cysteines found in the C-terminal
part of VEGF-B16~. The single mutant C4S gave rise to
monomers. Also some dimers migrating as a 42kDa band were
observed which were unable to bind to VEGFR-1. Surprisingly
the C2S mutant, although partly produced as monomers, could
still form dimers capable of receptor binding. Co-
transfection of the single mutants (C2S+C4S) led to
increased amounts of the 46kDa band regaining receptor
binding, indicating that the dimerization impairment can be
complemented by establishing a disulfide link between the
non-mutated cysteins similar to VEGF [Potgens et al., J.
Biol. Chem., 269:32879-85 (1994)]. Co-transfection of a
single mutant with the double mutant failed to complement.
Some of the VEGF-B16~ mutants were expressed as above,
and cells were labelled in the presence of 10 ~.g/ml heparin.
The collected media were incubated with VEGFR-1 Ig, and the
bound ligands were subjected to SDS-PAGE under non-reducing
conditions. The results are shown in Fig. 11. It can be
seen that the C4S mutant and the double mutant C2SC4S showed
residual receptor binding which is explainable by the
interactions of the soluble receptor to the monomers.
- 26 -
CA 02274675 1999-06-10
WO 98128621 , PCTlUS97/23533
Thus, the mutational analysis of conserved cysteines
which contribute to the formation of VEGF-B dimers indicates
a structural conservation with VEGF and PDGF.
Example 11
Biological Response to VEGF-B:
RT-PCR analysis using specific primers based on the
bovine VEGFR-1 sequence shows that VEGFR-1 mRNA is expressed
by bovine adrenal cortex-derived microvascular endothelial
(BME) and bovine aortic endothelial (BAE) cells. To
determine the biological response of VEGF-B on endothelial
cells, replicate filters containing 5 ~g/lane of total
cellular RNA prepared from confluent monolayers of BME cells
incubated in the presence of 50 ng/ml hVEGF-B186 were
hybridized with [3zP] -labelled cRNA probes . BME cells [Furie
et al., J. Cell Biol., 98:1033-41 (1984)] were grown in MEM
alpha modification (Gibco AG, Basel, Switzerland)
supplemented with 15% donor calf serum on 1.5% gelatin
coated tissue culture flasks. The cytokine was added to
confluent monolayers of BME cells to which fresh complete
medium had been added 24 hours previously. Total cellular
RNA was prepared after time periods of 0, l, 3, 9, 24 and 48
hours using Trizol reagent (Life Technologies AG, Basel,
Switzerland). Northern blots, UV-cross linking and
methylene blue staining of filters, in vitro transcription,
hybridization and post hybridization washes were carried out
as described in [Pepper et al., J. Cell Biol., 111:743-55
(1990)]. The 32P-labelled cRNA probes were prepared from
bovine u-PA [Kratzschmar et al., Gene, 125:177-83 (1993)],
human t-PA [Fisher et al., J. Biol. Chem., 260:11223-30
(1985)] and bovine PAI-1 [Pepper et al., J. Cell Biol.,
111:743-55 (1990)] cDNAs as described in [Pepper et al., J.
Cell Biol., 111:743-55 (1990); Pepper et al., J. Cell Biol.,
122:673-84 (1993)]. The results are shown in Fig. 12. RNA
integrity and uniformity of loading were determined by
staining the filters with methylene blue after transfer and
- 27 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
cross-linking (lower panel of the figure); 28S and 18S
ribosomal RNAs are shown.
The Northern blot analysis showed that VEGF-BIBS (50
ng/ml) increased steady state levels of urokinase type
plasminogen activator (u-PA) and plasminogen activator
inhibitor 1 (PAI-1) mRNAs in BME cells. That is, the test
showed that endothelial cells responded to VEGF-B by
inducing PAI-1 mRNA and u-PA mRNA. Thus, binding of VEGF-B
to its receptor on endothelial cells stimulates the activity
of u-PA as well as of PAI-1, which are important modulators
of extracellular matrix degradation and cell adhesion and
migration.
Example 12
Zymography and Reverse Zymography:
Cell extracts prepared from BME cells incubated in the
presence of hVEGF-B186 at concentrations of 0, 1, 3, 10, 30
and 100 ng/ml, VEGF at a concentration of 30 ng/ml, or
recombinant human bFGF (155 amino acid form obtained from
Dr. P. Sarmientos) at a concentration of 30 ng/ml, were
subjected to zymography and reverse zymography as follows.
Confluent monolayers of BME cells in 35 mm gelatin coated
tissue culture dishes were washed twice with serum free
medium and the cytokines were added in serum free medium
containing trasylol (200 KIU/ml). After 15 hours incubation
time, cell extracts were prepared and analysed by zymography
and reverse zymography as described in Vassalli et al., J.
Exp. Med., 159:1653-68 (1984) and in Pepper et al., J. Cell
Biol., 111:743-55 (1990). The results are shown in Figs.
13a-b and indicate that recombinant hVEGF-B186 increases u-PA
and PAI-1 activity in BME cells. The Fig. 13a shows a
zymographic analysis and Fig. i3b shows a reverse zymography
analysis of cell extracts from BME cells. It can be seen
that VEGF-B186 induces a dose-dependent increase in u-PA and
PAI-1 activity in the BME cells. The apparent lack of
induction of PAI-1 activity by VEGF used as a control,
- 28 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97123533
reflects rapid sequestration of PAI-1 into a complex with
VEGF-induced tPA. This complex is observed by zymography of
the culture supernatant of VEGF-treated cells. In contrast
to VEGF [Pepper et al., Biophys. Res. Commun., 189:824-31
(1992)], VEGF-Bls6 did not increase t-PA activity. The test
showed that endothelial cells responded to VEGF-B by
increasing synthesis of u-PA and PAI-1 and the resultant
protein activities. However, the kinetics of PAI-1
induction were more rapid (within 1 hour) and transient
(maximal effect observed at 3 hours) than those of u-PA
(induced after 9 hours and sustained for up to 48 hours).
This is in agreement with what has been observed for bFGF
and VEGF [Pepper et al., J. Cell Biol., 111:743-55 (1990);
Pepper et al., Biochem. Biophys. Res. Commun., 181, 902-906
{1991); Mandriota et al., J. Biol. Chem., 270:9709-16
(1995) ] .
Examples 11 and 12 show that recombinant hVEGF-Blas
increases steady-state levels of u-PA and PAI-1 mRNAs in BME
cells. In similar testing, VEGF-Blas also induced PAI-1 but
not u-PA mRNA in BAE cells.
Usefulness
The formation of complexes between Flt-2 tyrosine
kinase receptors and VEGF-B and/or VEGF-B analogs may be
used as a treatment for disease states characterized by
overexpression of the Flt-1 receptor by administering to a
patient suffering from such a disease state an effective
Flt-1 receptor binding or receptor antagonizing amount of
VEGF-B or a VEGF-B analog. An example of such a disease
state characterized by overexpression of the Flt-1 receptor
is hemangioendothelioma. The Flt-1 receptor also is
overexpressed in various tumors [Warren et al., J. Clin.
Invest., 95(4):1789-97 (1995); Hatva et al., Amer. J.
Pathology, 146 (2) :368-78 (1995) ] . The formation of
complexes between VEGFR-1 and VEGF-B or a VEGF-B analog may
also be useful in treating states characterized by
- 29 -
CA 02274675 1999-06-10
WO 98/28621 PCT/L1S97/23533
underexpression on a Flt-1 receptor. Such states may
include normal adult endothelium or states which require
increased blood vessel formation. The amount to be
administered in a given case will depend on the
characteristics of the patient and the nature of the disease
state and can be determined by a person skilled in the art
by routine experimentation.
The VEGF-B or VEGF-B analog may suitably be
administered intravenously or by means of a targeted
delivery system analogous to the systems heretofore used for
targeted delivery of VEGF or FGF. Examples of such systems
include use of DNA in the form of a plasmid [Isner et al.,
Lancet, 348:370 (1996)] or use of a recombinant adenovirus
[Giordano et al., Nature Medicine, 2:534-39 (1996)]. VEGF-B
could also be provided in protein form by techniques
analogous to those described for VEGF [Bauters et al., The
American Physiological Society, pp H1263-271 (1994); Asahara
et al., Circulation, 91:2793 (1995)] or through use of a
defective herpes virus [Mesri et al., Circulation Research,
76:161 (1995)]. Small molecule VEGF-B analogues could be
administered orally. Other standard delivery modes, such as
sub-cutaneous or intra-peritoneal injection, could also be
used.
VEGF-B protein/Flt-1 receptor complexes also can be
used to produce antibodies. The antibodies may be either
polyclonal antibodies or monoclonal antibodies. In general,
conventional antibody production techniques may be used to
produce antibodies to VEGF-B/Flt-1 complexes. For example,
specific monoclonal antibodies may be produced via
immunization of fusion proteins obtained by recombinant DNA
expression. Both chimeric and humanized antibodies and
antibody fragments to the VEGF-B/Receptor complex are
expressly contemplated to be within the scope of the
invention. Labelled monoclonal antibodies, in particular,
should be useful in screening for medical conditions
characterized by overexpression or underexpression of the
- 30 -
WO 98/28621 PCT/US97123533
reflec
CA 02274675 1999-06-10
WO 98/28621 PCTIUS97I23533
Flt-1 receptor. Examples of such conditions include
endothelial cell tumors of blood and lymphatic vessels, for
example, hemangioendothelioma.
In one preferred embodiment of a diagnostic/prognostic
means according to the invention, either the antibody, the
growth factor or the receptor is labelled, and one of the
three is substrate-bound, such that the antibody-complex
interaction can be established by determining the amount of
label attached to the substrate following binding between
the antibody and the growth factor/receptor complex. In a
particularly preferred embodiment of the invention, the
diagnostic/prognostic means may be provided as a
conventional ELISA kit.
The foregoing description and examples have been set
forth merely to illustrate the invention and are not
intended to be limiting. Since modifications of the
described embodiments incorporating the spirit and substance
of the invention may occur to persons skilled in the art,
the invention should be construed broadly to include all
variations falling within the scope of the appended claims
and equivalents thereof.
- 31 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
The following references provide technical background
information and are hereby incorporated herein by reference:
References
- Ferrara, N. & Davis-Smyth, T. (1997) Endocrine Reviews 18,
4-25.
- Risau, W. (1997) Nature 386, 671-4.
- Folkman, J. (1995) Nature Medicine l, 27-31.
- Barleon, B., Sozzani, S., Zhou, D., Weich, H. A.,
Mantovani, A. & Marme, D. (1996) Blood 87, 3336-43.
- Clauss, M. , Weich, H. , Breier, G. , Knies, U. , Rockl, W. ,
Waltenberger, J. & Risau, W. (1996) J. Biol. Chera. 271,
17629-34.
- Fong, G. H., Rossant, J., Gertsenstein, M. & Breitman, M.
L. (1995) Nature 376, 66-70.
- Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein,
M., Wu, X. F., Breitman, M. L. & Schuh, A. C. (1995) Nature
376, 62-66.
- Shalaby, F., Ho, J., Stanford, W. L., Fischer, K. D.,
Schuh, A. C., Schwartz, L., Bernstein, A. & Rossant, J.
(1997) Cell 89, 981-90.
- Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S.,
Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A.,
Harpal, K., Ebenhardt, C., Declercq, C., Pawling, J., Moons,
L., Collen, D., Risau, W. & Nagy, A. (1996) Nature 380,
435-439.
- Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L.,
O'Shea, K. S., Powell-Braxton, L., Hilan, K. J. & Moore, M.
W. (1996) Nature 380, 438-442.
- Pepper, M. S., Ferrara, N., Orci, L. & Montesano, R.
(1991) Biochern. Biophys. Res. Commun. 181, 902-906.
- Chapman, H. A. (1997) Curr. Opin. Cel1 Biol. 9, 714-724.
- Bacharach, E., Itin, A. & Keshet, E. (1992) Proc. Natl.
Acad. Sci. USA 89, 10686-10690.
- Maglione, D., Guerriero, V., Viglietto, G., Delli-Bovi, P.
& Persico, M. G. (1991) Proc. Natl. Acad. Sci. USA 88,
9267-9271.
- Olofsson, B., Pajusola, K., Kaipainen, A., Von Euler, G.,
Joukov, V., Saksela, O., Orpana, A., Pettersson, R. F.,
Alitalo, K. & Eriksson, U. (1996) Proc. Natl. Acad. Sci. USA
93, 2576-2581.
- 32 -
CA 02274675 1999-06-10
WO 98/28621 PCT/ITS97I23533
- Grimmand, S., Lagercrantz, J., Drinkwater, C., Silins, G.,
Townson, S., Pollock, P., Gotley, D., Carson, E., Rakar, S.,
Nordenskjold, M., Ward, L., Hayward, N. & Weber, G. (1996)
Genome Res. 6, 124-131.
- Joukov, V., Pajusola, K., Kaipainen, A., Chilov, D.,
Lahtinen, I., Kukk, E., Saksela, O., Kalkkinen, N. &
Alitalo, K. (1996) EMBO J. 15, 290-298.
- Lee, J. , Gray, A. , Yuan, J. , Louth, S. -M. , Avraham, H. &
Wood, W. (1996) Proc. Natl. Acad. Sci. USA 93, 1988-1992.
- Orlandini, M., Marconcini, L., Ferruzzi, R. & Oliviero, S.
(1996) Proc. Natl. Acad. Sci. USA 93, 11675-11680.
- Yamada, Y., Nezu, J., Shimane, M. & Hirata, Y. (1997)
Genomics 42, 483-8.
- Park, J. E., Chen, H. H., Winer, J., Houck, K. A. &
Ferrara, N. (1994) J. Bioi. Chem. 269, 25646-25654.
- Olofsson, B., Pajusola, K., von Euler, G., Chilov, D.,
Alitalo, K. & Eriksson, U. (3996) J. Biol. Chem. 271,
19310-19317.
- Keyt, B. A., Nguyen, H. V., Berleau, L. T., Duarte, C. M.,
Park, J., Chen, H. & Ferrara, N. (1996) J. Biol. Chem. 271,
5638-5646.
- Potgens, A. J., Lubsen) N. H., van Altena, M. C.,
Vermeulen, R., Bakker, A., Schoenmakers, J. G., Ruiter, D.
J. & de Waal, R. M. (1994) J. Biol. Chem. 269, 32879-85.
- Muller, Y. A., Li, B., Christinger, H. W., Wells, J. A.,
Cunningham, B. C. & de Vos, A. M. (1997) Proc. Natl. Acad.
Sci. USA 94, 7192-7.
- Sawano, A., Takahashi, T., Yamaguchi, S., Aonuma, M. &
Shibuya, M. (1996) Cell Growth & Differentiation 7, 213-21.
- Furie, M. B., Cramer, E. B., Naprstek, B. L. &
Silverstein, S. C. (1984) J. Cell Biol. 98, 1033-41.
- Mohanraj, D., Wahlsten, J. L. & Ramakrishnan, S. (1996)
Protein Expression & Purification 8, 175-82.
- Viera, J. & Messing, J. (1987) Production of
single-stranded plasmid DNA. Methods Enzymol. 153, 3-11.
- Kunkel, T.A., Roberts, J.D. & Zakour, R.A. (1987) Rapid
and efficient site-specific mutagenesis without phenotype
selection. Methods Enzymol. 154, 367-382.
- Summers, M.D. & Smith, G.E. (1988) A manual of methods for
baculovirus vectors and insect cell culture procedures. Tex.
Agric. Exp. Stn. Bull. 1555, 1-57.
- 33 -
CA 02274675 1999-06-10
WO 98128621 PCT/US97/23533
- Joukov, V., Sorsa, T., Kumar, V., Jeltsch, M.,
Claesson-Welsh, L., Cao, Y., Saksela, O., Kalkkinen, N. &
Alitalo, K. (1997) EMBO J. 16, 3898-911.
- Vassalli, J. D., Dayer, J. M., Wohlwend, A. & Belin, D.
(1984) J. Exp. Med. 159, 1653-68.
- Pepper, M. S., Belin, D., Montesano, R., Orci, L. &
Vassalli, J. D. (1990) J. Cell Biol. 111, 743-55.
- Kratzschmar, J. , Haendler, B. , Kojima, S. , Rifkin, D. B.
& Schleuning, W. D. (1993) Gene 125, 177-83.
- Fisher, R., Waller, E. K., Grossi, G., Thompson, D.,
Tizard, R. & Schleuning, W. D. (1985) J. Biol. Chem. 260,
11223-30.
- Pepper, M. S., Vassalli, J. D., Orci, L. & Montesano, R.
(1993) Exp. CeI1 Res. 204, 356-363.
- Mandriota, S. J., Seghezzi, G., Vassalli, J.-D., Ferrara,
N., Wasi, S., Mazzieri, R., Mignatti, P. & Pepper, M. S.
(1995) J. Biol. Chern. 270, 9709-9716.
- Davis-Smyth, T., Chen, H., Park, J., Presta, L. G. &
Ferrara, N. (1996) EMBO J. 15, 4919-27.
- Barleon, B., Totzke, F., Herzog, C., Blanke, S., Kremmer,
E., Siemeister, G., Marme, D. & Martiny-Baron, G. (1997) J.
Biol. Chem. 272, 10382-8.
- Wiesmann, C., Fuh, G., Christinger, H. W., Eigenbrot, C.,
Wells, J. A. & de Vos, A. M. (1997) Cell 91, 695-704.
- Plouet, J., Moro, F., Bertagnolli, S., Coldeboeuf, N.,
Mazarguil, H., Clamens, S. & Bayard, F. (1997) J. Biol.
Chem. 272, 13390-13396.
- Park, J.E., Keller, G.A. & Ferrara, N. (1993) Mol. Biol.
Cel1 4, 1317-1326.
- Takahashi, T. & Shibuya, M. (1997) Oncogene 14, 2079-2089.
- Seetharam, L., Gotoh, N., Maru, Y., Neufeld, G.,
Yamaguchi, S. & Shibuya, M. (1995) Oncogene 10, 135-147.
- DiSalvo, J., Bayne, M. L., Conn, G., Kwok, P. W., Trivedi,
P. G., Soderman, D. D., Palisi, P. M., Sullivan, K. A. &
Thomas, K. A. (1995) J. Biol. Chem. 270, 7717-7723.
- Cao, Y., Chen, H., Zhou, L., Chiang, M.-K., Anand-Apte,
B. , Weatherbee, J. A. ( Wang, Y. , Fang, F. , Flanagan, J. G.
& Tsang, M. L.-S. (1996) J. Biol. Chem. 271, 3154-3162.
- Stefansson, S. & Lawrence, D. A. (1996) Nature 383,
441-443.
- 34 -
CA 02274675 1999-06-10
WO 98!28621 PCT/US97/23533
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: KORPELAINEN, Eija
OLOFSSON, Birgitta
GUNJI, Yuji
ERIKSSON, Ulf
ALITALO, Kari
(ii) TITLE OF INVENTION: VEGF-B/RECEPTOR COMPLEX AND USES THEREOF
(iii) NUMBER OF SEQUENCES: 6
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Evenson, McKeown, Edwards & Lenahan PLLC
(B) STREET: 1200 G Street, N.W., Suite 700
(C) CITY: Washington
(D) STATE: DC
(E) COUNTRY: USA
{F) ZIP: 20005
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: WO
(B) FILING DATE: 19-DEC-1997
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/033,697
(B) FILING DATE: 20-DEC-1996
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: EVANS, Joseph D.
(B) REGISTRATION NUMBER: 26,269
(C) REFERENCE/DOCKET NUMBER: 1064/43148PC
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 628-8800
{B) TELEFAX: (202) 628-8844
- 35 -
CA 02274675 1999-06-10
WO 98!28621 PCT/US97123533
(2} INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B} TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
ATGGTACCCC CAGGCTCAGC ATACAAAAAG AC 32
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
GCGTCTAGAG GGTGGGACAT ACACAACCAG 30
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 62 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
ATCGAGATCT TCATCACCAT CACCATCACG GAGATGACGA TGACAAACCT GTGTCCCAGT 60
TT 62
- 36 -
CA 02274675 1999-06-10
WO 98/28621 PCT/US97/23533
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
CAAGGGCGGG GCTTAGAGAT CTAGCT 26
(2} INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
{C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
GGAATTCCCC GCCCAGGCCC CTGTC 25
(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
GGAATTCAAT GATGATGATG ATGATGAGCC CCGCCCTTGG C 41
- 37 -
