Note: Descriptions are shown in the official language in which they were submitted.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
1
DESCRIPTION
IMPROVED METHODS FOR TRANSDUCING CELLS
BACKGROUND OF 'CHE INVENTION
The present application claims the priority of co-pending U.S. Provisional
Patent
Application Serial No. 601031,330, filed November 20, 1996, the entire
disclosure of which is
incorporated herein by reference without disclaimer. The government owns
rights in the present
invention pursuant to grant numbers R35-CA 42107 and CA-16672 from the
National Institutes
of Health.
1. Field of the Invention
The present invention relates generally to the fields of cellular and
molecular biology.
More particularly, it concerns compositions and methods for the transduction
of cells, as well as
compositions and methods for treating disease, including, but not limited to,
cancer.
2. Description of Related Art
Recent years have seen numerous advancements in the diagnosis and treatment of
genetically-based disease. This advance has been due in large part to the
revolution in molecular
biology, which has allowed the genes responsible for a number of diseases to
be cloned,
sequenced, and manipulated in vitro. Using these techniques, the structure-
function relationship
of the proteins encoded by a number of these genes has been elucidated,
allowing for the rational
design of drugs which ameliorate the disease state.
A number of genes associated with particular diseases have one or more
mutations which
leads to the disease phenotype. This knowledge has led to the advent of gene
therapy. In one
aspect of gene therapy, a defective copy of a particular gene is replaced in
vivo by the wild type
copy of the desired gene. In other aspects of gene therapy, (i) cells can be
engineered to express
antigens which target the host cells for immune attack, (ii) a heterologous
therapeutic gene can
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
2
be introduced into cells, or (iii) the recombinant host cells can be "tagged"
with specific genetic
markers to provide a method of tracking the fate of the "tagged" cells. Gene
therapy protocols
may also be designed to remedy diseases which are due to defects in multiple
genes. Thus, gene
therapy holds great promise for the future of curing a wide variety of
diseases.
However, the high expectations for genetic therapy have yet to be fully
realized (Marshall,
1995). A major obstacle to successful in vivo gene therapy is low transduction
efficiency, or the
efficiency of the insertion and expression of the selected transgene in host
cells (Knowles et al.,
1995; Grubb et al., 1994). Although transgene expression can be increased by
administration of a
high dose of vectors, the accompanying severe local inflammatory response may
limit the
effectiveness of increasing dosage. Also, the natural antiviral defense
mechanisms of cells, which
include production of interferons, can limit clinical effectiveness (Simon et
al., 1993; Yei et al.,
1994; Brody et al., 1994; Ginsberg et al., 1991 ). Therefore, the obstacles to
successful gene
therapy apparently are not fundamental in nature, but rather involve the need
to properly deliver
currently existing vectors {Marshall,1995). The ability to transduce cells in
vivo with viral vectors
containing one or more selected transgenes would represent an important
advancement in the field
of gene therapy.
Currently, cancer is one of the main targets in gene therapy trials. Once the
diagnosis of
cancer is established, the most urgent question is whether the disease is
localized, or has spread to
lymph nodes and distant organs. The most fearsome aspect of cancer is
metastasis, and this fear is
well justified. In nearly 50% of patients, surgical excision of primary
neoplasms is not curative
because metastasis has occurred by that time (Sugarbaker, 1977, 1979; Fidler
and Balch, 1987).
Metastases can be located in different organs and in different regions of the
same organ, making
complete eradication by surgery, radiation, drugs, or biotherapy difficult.
Moreover, the organ
microenvironment significantly influences the response of tumor cells to
therapy (Fidler, 1995),
as well as the efficiency of anticancer drugs, which must be delivered to
tumor foci in amounts
sufficient to destroy cells without leading to undesirable side effects
(Fidler and Poste, 1985)
Another major barrier to the treatment of metastases is the biological
heterogeneity of
cancer cells, and the rapid emergence of tumor cells with resistance to most
conventional anticancer
agents (Fidler and Poste, 1985). The design of more effective therapy for
metastatic disease
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
3
therefore requires a better insight into the molecular mechanisms that
regulate the pathobiology
of the process. One of the processes involved in the growth of both primary
and secondary
(metastatic) tumors is neovascularization, or creation of new blood vessels
which grow into the
tumor. This neovascularization is termed angiog;enesis (Folkman, 1986, 1989),
which provides
S the growing tumor with a blood supply and essential nutrients. Although
tumors 1-2 mm in
diameter can receive all nutrients by diffusion, further growth depends on the
development of an
adequate blood supply through angiogenesis. Inhit~ition of angiogenesis
provides a novel and more
general approach for treating metastases by manipulation of the host
microenvironment.
The induction of angiogenesis is mediated by several angiogenic molecules
released by
both tumor cells and the normal cells surrounding tJne tumor cells. The
prevascular stage of a tumor
is associated with local benign tumors, whereas the vascular stage is
associated with tumors capable
of metastasizing. Moreover, studies using light microscopy and
immunohistochemistry concluded
that the number and density of microvessels in different human cancers
directly correlate with their
potential to invade and produce metastasis (Weidnc~r et al., 1991, 1993). Not
all angiogenic tumors
produce metastasis, but the inhibition of angiogenesis prevents the growth of
tumor cells at both the
primary and secondary sites and thus can prevent the emergence of metastases.
Often, the metastases are too small to be detected (<5 mm in diameter), and
the primary
neoplasm is surgically resected with curative intent. Unfortunately, the
clinical reality is quite
different. The resection of some primary neoplas~ms can lead to the
accelerated growth of their
distant metastases (Tyzzer, 1913; Sugarbaker ei' al., 1977; Gorelik et al.,
1978, 1980, 1981;
Fisher et al., 1989). This accelerated growth is independent of specific
immune response (Prehn,
1991, 1993) and has been termed concomitant honor resistance. Over the last 80
years, many
different hypotheses for concomitant tumor resistance have emerged. These
include the
mechanical release of a large number of tumor cells during the surgical
resection procedure, the
sudden availability of "nutrients" for growth of metastases, the
immunosuppressive effects of
anesthesia and surgery that facilitate the escape of tumor cells from
surveillance mechanisms,
increased adhesive properties of platelets and blood coagulability, which aid
the survival of
circulating tumor emboli, and the production of a mitotic inhibitor by the
local tumor (Sugarbaker
et al., 1977; Gorelik,1983a,b; Prehn,1993).
CA 02275438 1999-06-09
WO 98/22605 PCT/~JS97/21475
4
However, recent studies have suggested a compelling explanation for this
phenomenon.
O'Reilly et al. (1994) reported that in mice bearing Lewis lung carcinoma
(3LL) subcutaneously
(s.c.), the primary or local tumor releases an angiogenesis-inhibiting
substance, named
angiostatin. Angiostatin is a 38-kDa fragment of plasminogen that selectively
inhibits
proliferation of endothelial cells. Angiostatin suppresses vascularization
and, hence, growth of
lung metastases. Several studies have produced results consistent with this
model. After
systemic administration, purified angiostatin can produce apoptosis in
metastases (Holmgren
et al., 1995) and sustain dormancy of several human tumors implanted
subcutaneously in nude
mice (O'Reilly et al. , 1996). However, although it is known that angiostatin
can be generated
in vitro from plasminogen by digestion with pancreatic elastase (O'Reilly,
1994), how it is
generated in vivo in tumors remains unclear. The ability to produce
angiostatin in tumors in vivo
would thus provide a significant advance in the art.
SUMMARY OF THE INVENTION
IS
The present invention seeks to overcome the limitations present in the prior
art by providing
compositions and methods for the efficient transduction of cells with nucleic
acid constructs
administered to host cells, for example using viral vectors. This is
accomplished through a
reduction of the endogenous expression and/or activity of /3-interferon in the
cells which are
targeted for transduction. Accordingly, the present invention provides
improved methods for the
treatment of genetically-based diseases by gene therapy, through the use of
the improved
transduction methods comprising reducing endogenous ~3-interferon expression
and/or activity.
Also provided are methods for transduction of cells for the in vitro
production of selected proteins
or peptides.
The instant invention further provides methods for treating diseases
associated with
neovascularization, including genetically based diseases such as ADA
deficiency, cystic fibrosis,
hemophilia and familial hypercholesterolemia, vascular proliferative diseases
such as infantile
hemangioma, arthritis, psoriasis and pulmonary hypertension, and various forms
of cancer. This
is achieved through the production in vivo of angiostatin, which inhibits the
formation of new blood
vessels.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
The present invention provides compositions comprising a cell in which the
endogenous
expression and/or activity of (3-interferon is inhibited. The cells of the
instant compositions may
be cells in which the levels of endogenous ~3-interi:eron are high, such as
macrophages.
5
The ~3-interferon inhibited cells provided in the present invention may
further comprise
an exogenous DNA segment. In certain aspects, the exogenous DNA segment may
comprise an
isolated gene encoding a selected protein or peptide. In other aspects, the
DNA segment may
comprise a ribozyme.
The exogenous DNA segments may be in operable relation to control sequences,
such as
promoters and enhancers, which direct the expression of a heterologous gene,
such as GM-CSF
or elastase. In other embodiments of the present invention, the gene may be in
operable relation
and in reverse orientation to a promoter, whereby said promoter directs the
production of an
1 S antisense transcript.
Thus the cells of the present invention are contemplated for use in the
formulation of an
anti-cancer therapeutic. The invention therefore provides for the use of the
instant cells in the
manufacture of a medicament for treating cancer.
The present invention also provides compositions for transducing a cell which
can be
characterized as including a ~i-interferon inhibitory factor which inhibits
the activity of (3-
interferon, and a heterologous DNA segment.
The (3-interferon inhibitory factors provided in the present invention may
comprise an
antibody which is immunologically reactive with ~i-interferon. Alternatively,
the ~i-interferon
inhibitory factors may comprise an isolated DNE1 sequence comprising a gene
which encodes
(3-interferon in operable relation and in reverse orientation to a promoter,
whereby said promoter
directs the production of an antisense transcript. In other aspects, the ~3-
interferon inhibitory
factor comprises an inhibitor of (3-interferon related protein kinase. In
still other embodiments,
the (3-interferon inhibitory factor comprises a ribo~zyme. In certain aspects
of the invention, the
(3-interferon inhibitory factor comprises a combination of two or more of an
antibody which is
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
6
immunologically reactive with (3-interferon, a gene which encodes (3-
interferon in operable
relation and in reverse orientation to a promoter, whereby said promoter
directs the production of
an antisense transcript, an inhibitor of (3-interferon related protein kinase
and a ribozyme.
S The transducing compositions of the instant invention may include DNA
segments which
comprise an isolated gene encoding a selected protein or peptide, for example
GM-CSF or
elastase. The DNA segments intended for use in expression will be in operable
relation to a
promoter that directs the expression of the selected protein or peptide. Thus
expression vectors
form another aspect of the present invention, particularly where the
expression vector is a viral
vector. In alternative embodiments, the expression vector may be an adenoviral
or retroviral
vector, preferably a replication defective adenoviral vector which is
contained within a viral
particle.
In other compositions, the DNA segment may be in operable relation and in
reverse
orientation to a promoter, whereby said promoter directs the expression of an
antisense
transcript.
In certain aspects of the present invention, the instant compositions are
contemplated for
use in rendering a cell susceptible to DNA uptake. In further embodiments, the
present
compositions are contemplated for use in sensitizing a cell to viral DNA
uptake. In still other
embodiments, the present compositions are contemplated for use in transducing
a cell with a
DNA segment. Thus, in preferred aspects, the present invention provides for
the use of the
instant compositions in the preparation of a cell transduction/cell infection
formulation. In
additional aspects, the invention provides for the use of the instant
compositions in the
preparation of a transducing formulation for providing a DNA segment to a
cell.
In further aspects of the invention, the compositions are contemplated for use
in
transducing a tumor cell with a tumor cell cytotoxic DNA segment. In certain
preferred
embodiments, the invention provides for the use of the instant compositions in
the preparation of
a medicament for treating cancer.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
7
The present invention also provides improved methods of transducing a cell,
comprising
contacting the cell with a transducing composition that may be characterized
as including a ~i-
interferon inhibitory factor which inhibits the activity of (3-interferon, and
a heterologous DNA
segment.
In the transducing methods provided herein, the (3-interferon inhibitory
factor may be
administered at a time effective for the transduction of said cell. The time
of administration may
be any reasonable time from before transduction to after transduction. In
certain aspects of the
present invention, the time of administration is from about 24 hours before
the time of
transduction to about 48 hours after transduction. In other embodiments, the
time of
administration may be variously from about 24 hours, about 18 hours, about 12
hours, about 6
hours or about 3 hours before the time of transduction to about 3 hours, about
6 hours, about 12
hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about
40 hours, about 44
hours or about 48 hours after transduction. In other aspects, the time of
administration may be
from about 24 hours, about 18 hours, about 12 hours, about 6 hours or about 3
hours before the
time of transduction up to and including the time of transduction.
Alternatively, the time of
administration may be from the time of transduction to about 3 hours, about 6
hours, about 10
hours, about 18 hours, about 24 hours, about 30 hours, about 36 hours, about
42 hours or about
48 hours after the time of transduction. It will be understood that the times
are approximate, and
therefore times which vary by up to one or two hours in either direction still
fall within the spirit
and scope of the invention.
In other methods of the present invention, the DNA segment may further
comprise an
isolated gene encoding a selected protein or peptide, such as GM-CSF,
elastase, IRF-2, ADA,
CFTR or ornithine transcarbamoylase. The DNA., segments intended for
expression will be in
operable relation to control sequences, such as promoters and enhancers.
In still other methods, the DNA segment may be in operable relation and in
reverse
orientation to a promoter, whereby said promoter directs the expression of an
antisense
transcript, such as (3-interferon antisense transcript.
CA 02275438 1999-06-09
WO 9$/22605 PCT/US97/21475
8
In certain methods provided in the instant disclosure, the DNA segment may be
further
defined as an expression vector, and in particular aspects a viral vector. In
other methods, the
vector may be an adenoviral vector, particularly a replication defective
adenoviral vector. In
certain embodiments, the adenoviral vector may be contained in an adenovirus.
In the transducing methods of the present invention, the target cell may be,
for example, a
macrophage, a tumor infiltrating lymphocyte, a tumor cell, an endothelial
cell, a peripheral blood
mononuclear cell or a stem cell. In further embodiments, the cell may be
located within an
animal, and in still further aspects, the animal may be a human subject.
In the improved transduction methods provided in the present invention, the ~3-
interferon
inhibitory factor may comprise an polyclonal or monoclonal antibody which is
immunologically
reactive with ~3-interferon. In other embodiments, the ~-interferon inhibitory
factor may
comprise an isolated DNA sequence comprising a gene, such as (3-interferon or
IRF-1, which is
in operable relation and in reverse orientation to a promoter, whereby said
promoter directs the
production of an antisense transcript. In still other methods, the (3-
interferon inhibitory factor
may comprise an inhibitor, such as a peptide or small chemical compound, of a
J3-interferon-
associated kinase. In further embodiments, the ~i-interferon inhibitory factor
may comprise a
ribozyme.
Thus the present invention provides improved methods for treating genetically-
based
diseases, which may comprise contacting a cell with a therapeutic transducing
composition that
may be characterized as including a (3-interferon inhibitory factor which
inhibits the activity of (3-
interferon, and a DNA segment comprising a therapeutic gene. Treatment is
achieved by
contacting the target cell with therapeutically effective amounts of the (3-
interferon inhibitory
factor which inhibits the activity of ~3-interferon, and a DNA segment
comprising a therapeutic
gene. Therapeutically effective amounts are those amounts which result in
improved rates of
transduction of the cell.
The present invention also provides a method of inhibiting a tumor in an
animal
comprising contacting the tumor with a therapeutically effective amount of a
GM-CSF protein or
peptide.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
9
The present invention also provides methods for producing angiostatin in vivo,
which
may be characterized as including the steps of first contacting a macrophage
with a transducing
composition comprising a (3-interferon inhibitory factor which inhibits the
expression or activity
of (3-interferon, and a DNA segment comprising a GM-CSF gene, and second
administering the
transduced cell to an animal, wherein the tramsduced macrophage is stimulated
by the transduced
GM-CSF gene to secrete macrophage metalloc;lastase, thereby producing
angiostatin from
plasminogen.
The present invention also provides alternaitive methods for producing
angiostatin in vivo,
which may be characterized as including the steps of first contacting a cell
other than a
macrophage with a transducing composition comprising a ~3-interferon
inhibitory factor which
inhibits the expression or activity of (3-interferon., and a DNA segment
comprising an elastase
gene, preferably macrophage derived metalloelastase, and second administering
the transduced
cell to an animal, wherein the tramsduced cell secretes elastase, thereby
producing angiostatin
from plasminogen.
Thus, methods of treating diseases associated with neovascularization are
provided which
may comprise administering a cell which has been engineered to produce
angiostatin in vivo to
an animal in need of inhibition of neovascularization.
The present invention also provides methods of inhibiting a tumor in an animal
which
may comprise contacting the tumor with a therapeutically effective amount of a
tumor inhibiting
composition comprising a DNA segment comprising at least a first DNA sequence
which
encodes a GM-CSF or an elastase protein or peptide. In certain methods, the
DNA segment may
be further defined as an expression vector, which may further be contained in
an adenovirus. In
alternative methods, the vector is contained in a host cell. Thus the present
invention provides
tumor inhibiting compositions which may be viruses or transduced cells. The
present invention
thus provides for the use of a composition compriising a GM-CSF or elastase
protein, peptide or
nucleic acid in the manufacture of a medicament f ~r treating cancer.
CA 02275438 1999-06-09
WO 98!22605 PCT/US97/21475
The present invention provides methods for ex vivo cancer therapy, wherein a
host cell is
removed from an animal, contacted with a tumor inhibiting composition, and
returned to the
animal. In certain methods, the host cell may be a tumor infiltrating
lymphocyte, a macrophage
or a tumor cell. The present invention also provides methods for in vivo
cancer therapy, wherein
5 the host cell is located within an animal, particularly a human subject. In
certain aspects, the
tumor inhibiting composition may further comprise a ~3-interferon inhibiting
factor. In other
embodiments of the present invention, the tumor inhibiting composition may be
formulated for
parenteral, intravenous, subcutaneous or oral administration.
10 The compositions that are intended for administration to an animal, such as
the
transducing compositions, the tumor inhibiting compositions and the viral and
cell therapeutic
compositions, may be dispersed in a pharmaceutically acceptable Garner.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to further
demonstrate certain aspects of the present invention. The invention may be
better understood by
reference to one or more of these drawings in combination with the detailed
description of
specific embodiments presented herein.
FIG. lA, FIG. 1B, FIG. 1C and FIG. 1D. Effect of anti-IFN-~i antibody on
transgene
expression. FIG. lA: Macrophages. FIG. 1B: NIH 3T3 cells. FIG.1C: Macrophages
plus anti-
IFN-j3. FIG. 1D: NIH 3T3 cells plus anti-IFN-~3. Cells were plated at the
density of 105 cells/38-
mm2 well. After 16 h (37°C), the cells were exposed for 1 h to
increasing concentrations
(PFU/cell) of AdSCMV-LacZ dispersed in 50 ml/well of serum-free Dulbecco's
modified essential
medium (DMEM)/F12 medium. DMEM with 10% fetal bovine serum (DMEM-10% FBS)
(open
circles) or DMEM-10% FBS containing 10 NU/ml of anti-IFN-~ antibody (filled
squares) or 0.25
mg/ml rat IgG (open triangles) was then added to a final volume of 200
ml/well. The cultures were
incubated at 37°C-5% C02 for an additional 48 h. (3-gal activity in the
cells was then determined as
described in Example 2. Dose-dependent enhancement of AdSCMV-LacZ infection of
macrophages (FIG. 1 C) but not NIH 3T3 cells (FIG. 1 D) was seen using anti-
IFN-(3. The cells
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
11
were infected with 30 PFU AdSCMV-LacZ/cell as described above in the absence
or presence of
different concentrations of anti-IFN-(3 antibody (fil.led squares) or control
rat IgG (open triangles).
*P<0.05 (Student's t test, two tailed).
FIG. 2. Fluorescence-activated cell sorting (FACS) analysis of ~3-gal
activity.
Macrophages were incubated for 1 h with 30 PFU/cell AdSCMV-LacZ in 50 ml of
serum-free
DMEM/F 12 solution. One milliliter of DMEM/F 12-10% FBS or the medium
containing 10
NU/ml of anti-IFN-(3 antibody or the medium containing 0.25 mg/ml of rat IgG
was then added.
The cells were cultured for 48 h under constant rocking. The ~i-gal activity
was then determined.
FIG. 3A and FIG. 3B. Effect of exogenous IFN-~i on transgene expression in NIH
3T3
cells. FIG. 3A: NIH 3T3 cells were incubated for 1 h with 30 PFU AdSCMV-
LacZ/cell.
Increasing concentrations of mIFN-(3 were then added to the cultures in medium
alone (open
circles) or in medium containing 10 NU/ml anti-IfN-(3 antibody (filled
squares) or control rat IgG
(open triangles). (3-gal activity was measured 48 h later as described above
with a reaction time of
10 min. FIG. 3B: Macrophages were plated at 5 x 104/ 38-mm2 well in a 96-well
plate. Sixteen
hours later, NIH 3T3 cells (5 x 104/ well) were seeded alone or onto the
macrophage monolayers,
and 2 to 4 h later, the cultures were infected with 3 x 106 PFU AdSCMV-
LacZ/well in 50 ml of
serum-free DMEM/F 12. One hour later, DMEM:/F 12-10% FBS (open squares) or the
medium
containing 10 NU/ml anti-IFN-/3 antibody (filled squares) was added to a final
volume of 200
ml/well. The (3-gal activity was measured 48 h later as described above with
the reaction time of 10
min for NIH 3T3 and NIH 3T3 + macrophages, and 60 min for macrophages cultured
alone.
*P<0.05 (Student's t test, two tailed).
FIG. 4. Production of elastase by macrophages treated with LPS and IFN-y. PEM
were
incubated in serum-free DMEM-F 12 alone or with LPS ( 100 ng/ml} and/or IFN-y
( 100 U/ml}.
The supernatants were collected at different times and assayed for
elastinolytic activity as
described in Example 4. The values are mean ~ S..D. of triplicate cultures.
- 30 FIG. SA and FIG. SB. Inhibition of elastase activity by LPS and IFN-y is
independent
of nitric oxide. FIG. SA: Nitrate content. FIG. SB: Elastase activity. PEM
were incubated in
MEM containing 5% FBS (FIG. SA) or serum-free DMEM-F 12 (FIG. SB) alone or
containing
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
12
LPS ( 100 ng/ml), and/or IFN-y ( 100 U/ml) with or without 1 mM NMA. Culture
supernatants
were collected after 48 h and assayed for nitrite content (FIG. SA) or
elastinolytic activity
(FIG. SB) as described in Examples 5 and 4, respectively. The values are mean
~ S.D. of
triplicate cultures.
FIG. 6A, FIG. 6B and FIG. 6C. Production of elastase by PEM treated with GM-
CSF,
M-CSF, or G-CSF. FIG. 6A: PEM treated with GM-CSF. FIG. 6B: PEM treated with M-
CSF.
FIG. 6C: PEM treated with G-CSF. PEM were incubated in serum-free DMEM-F 12
alone or
with different concentrations of recombinant GM-CSF (FIG. 6A), M-CSF (FIG.
6B), or G-CSF
(FIG. 6C). Culture supernatants were harvested after 48 h and assayed for
elastinolytic activity.
The values are mean ~ S.D. of triplicate cultures. *p<0.05 compared to control
macrophages.
**p<0.005 compared to control macrophages.
FIG. 7. GM-CSF enhances the stability of MME mRNA. PEM were incubated for 18 h
in medium alone or medium containing GM-CSF (1000 U/ml). Cells were either
collected at
this time point (time 0), or actinomycin D was added in the medium to 10 ~g/ml
and cells were
collected at the indicated times (h) after the addition of the inhibitor. RNA
was extracted and
separated on 1 % agarose, transferred onto a nylon membrane, and probed with
32P-labeled MME
and GAPDH cDNA probes. Data is calculated as the ratio of the area for the MME
transcript
and the GAPDH transcript. Curves were fitted with the polynomial curve-fit
program (order of
3) included in the Cricket graph computer software.
FIG. 8A, FIG. 8B, FIG. 8C and FIG. 8D. Macrophages expressed MME and generated
angiostatin in 3LL-met s.c. tumor. FIG. 8A: Macrophage content. FIG. 8B: MME
mRNA
expression. FIG. 8C: MME activity. FIG. 8D: Angiostatin activity. Cells from
subcutaneous
3 LL-met tumors was recultured and passaged successively in vitro. Macrophage
content
(FIG. 8A), MME mRNA expression (FIG. 8B), MME activity (FIG. 8C), and
angiostatin activity
(FIG. 8D) from each passage of the samples were analyzed.
FIG. 9A and FIG. 9B. 3LL tumor cells increased MME secretion and angiostatin
production by macrophages. FIG. 9A: Purif ed mouse peritoneal macrophages, 3LL-
nm, or
3LL-met cells were cultured in MEM-5% FBS separately or in combination for 24
hr. The
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
13
cultures were rinsed briefly and incubated in serum-free DMEM/F 12 medium for
72 hr in the
absence of human plasminogen. MME activity in the supernatants were
determined. FIG. 9B:
Purified mouse peritoneal macrophages, 3LL-nm, or 3LL-met cells were cultured
in MEM-5%
FBS separately or in combination for 24 hr. The; cultures were rinsed briefly
and incubated in
serum-free DMEM/F 12 medium for 72 hr in the presence of human plasminogen.
Angiostatin
activity in the supernatants was determined.
FIG. l0A and FIG. lOB. Conditioned medium of 3LL tumor cells increased MME
secretion and angiostatin production. FIG. 10A: Purified mouse peritoneal
macrophages were
incubated for 24 hr in MEM containing 5% FBS or conditioned media of 3LL-nm or
3LL-met.
The cells were rinsed and cultured for 72 hr in serum-free DMEM/F 12 in the
absence of human
plasminogen. MME activity in the supernatants were then determined. FIG. lOB:
Purified
mouse peritoneal macrophages were incubated for 24 hr in MEM containing 5% FBS
or
conditioned media of 3LL-nm or 3LL-met. The cells were rinsed and cultured for
72 hr in
serum-free DMEM/F 12 in the presence of human plasminogen. Angiostatin
activity in the
supernatants were then determined. Open box - medium cool; Hatched box -
conditioned
medium of 3LL-nm; Filled box - conditioned medium of 3LL-met.
FIG. 11A and FIG. 11B. Stimulation of MME secretion and angiostatin production
by
3LL cell-conditioned medium was blocked by GM-CSF antibody. FIG. 11A: MME
activity.
FIG. 11B: Angiostatin activity. The conditioned medium of 3LL cells were
incubated with 20
p,g/ml GM-CSF antibody or the same concentration of rat IgG for 45 min at
37°C and then used
to treat macrophages as described in the legend t~~ FIG. l0A and FIG. IOB. MME
(FIG. 1 lA)
and angiostatin (FIG. 11 B) activities in the supernatants were then
determined.
FIG. 12A and FIG. 12B. Induction of Macrophage-mediated Angiostatin Production
by
B 16-F 10 Cells Engineered to Constitutively Relf~ase GM-CSF. FIG. 12A.
Elastase activity.
FIG. 12B. Inhibition of BCE. M~~ = macrophages; P = wild-type B 16-F10;
H = B 16-F 10-GMCSF(high); M = B I 6-F 10-GMCSF(medium); C = B-I 6-F 10-
GMCSF(control).
FIG. 13A and FIG. 13B. Induction of Macrophage-mediated Angiostatin Production
by K1735M2 cells Engineered to constitutively Release GMCSF. FIG. 13A.
Elastase activity.
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
14
FIG. 13B. Inhibition of BCE. P = wild type K1735M2, N = K1735M2-Neo,
C = K1735M2-GMCSF(control); H = K1735M2-GMCSF(high); Mgr = macrophages.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
The present invention provides compositions and methods for the efficient
transduction of
cells with heterologous genes or cDNAs administered using viral vectors. This
is accomplished
through a reduction of the endogenous expression andlor activity of ~3-
interferon in the target cells.
Thus, the present invention provides improved methods for the treatment of
genetically-based
diseases by gene therapy, through the use of the improved transduction methods
disclosed herein.
The instant invention further provides methods for treating diseases
associated with
neovascularization, including, but not limited to, cancer. This is achieved
through the production
in vivo of angiostatin. In a particular embodiment of the present invention,
macrophages are
1 S transduced ex vivo with GM-CSF, thereby activating the macrophages to
produce macrophage
metalloelastase (MME). The administered macrophages home to primary and
metastatic tumor
sites, where the MME produced by the macrophages converts plasminogen to
angiostatin.
Gene therapy is an exciting development that has vast potential to treat a
number of
genetically-based diseases. The potential benefits of gene therapy have led to
an increasing
number of studies where a therapeutic gene is used to treat a variety of
diseases. However, the
high expectations for gene therapy have yet to be fully realized
(Marshall,1995).
The initial reports on gene therapy as a therapeutic approach for treating
disease used
retroviral vectors to mediate gene transfer (Anderson, 1984). This system has
been used to
deliver a copy of the correct adenosine deaminase (ADA) gene to humans with a
defective
version of the gene. However, the rates of transfer and expression of genes
using retroviral
vectors can vary dramatically from patient to patient (Marshall, 1995).
Another system which has been used widely is adenovirus. However, while
current
methods using adenoviral vectors allow for the transduction of a number of
different cell types
CA 02275438 1999-06-09
WO 98122605 PCT/US97/21475
in vitro, the results in vivo have been limited. The major obstacle to
successful in vivo gene therapy
is the low efficiency of the insertion and expression of the selected
transgene in host cells.
Adenoviral vectors were used to treat mice with the rare recessive genetic
disorder ornithine
5 transcarbamoylase (OTC) deficiency. While tile adenoviral constructs were
successful in
delivering the normal OTC gene in vivo, normal e~;pression of OTC was observed
in only 4 of 17
instances (Stratford-Perricaudetet al., 1991 ). Therefore the defect was only
partially corrected in
most of the mice, and led to no phenotypic or physiological change.
10 Similarly, attempts have been made to treat cystic fibrosis in rats, mice
and humans by
using adenovirus to transfer the gene encodin;~ the correct version of the
cystic fibrosis
transmembrane regulator (CFTR) in vivo into the. affected columnar epithelial
cells lining the
airways of the lung (Rosenfeld et al., 1992; Grubb .et al., 1994; Knowles et
al., 1995). While gene
transfer using this technique was detected, in all cases the efficiency of
transfer and expression was
15 too low to be of physiological relevance.
Although transgene expression can be increased by administration of a high
dose of vectors,
the accompanying severe local inflammatory response limits the effectiveness
of increasing dosage.
Also, the natural antiviral defense mechanism of cells, which includes
production of interferons,
limits clinical effectiveness (Simon et al., 1993; 'i~ei et al., 1994; Brody
et al., 1994; Ginsberg
et al. , 1991 ). Therefore, the obstacles to successful gene therapy are
apparently not fundamental in
nature, but rather involve the need to properly delivE,r currently existing
vectors (Marshall,1995).
Efforts to decipher the mechanism of diminshed transduction efficiency have
focused on
the interferons, which are a family of multifunctional proteins with potent
antiviral activities (Sen
and Ransohoff,1993; Sen and Lengyel, 1992; Gutte;rman, 1994). Among the 3
types of interferons
(IFNs), a-interferon (IFN-a) and y-interferon (IFN-y} are mainly produced by
leukocytes, whereas
(3-interferon (IFN-(3) is produced by many cell types, including epithelial
cells, fibroblasts and
macrophages (Sen and Lengyel, 1992). Macrophages that express endogenous IFN-a
and -~i are
resistant to viral infection; however, this property can be compromised by
antibodies against IFN-~3
(Belardelli et al., 1987b).
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
16
In addition, treatment of cells with exogenous IFN-(3 or IFN-inducing agents
can suppress
replication of DNA and RNA viruses (Sen and Ransohoff,1993). Constitutive
expression of IFN-
~3 can protect monocytes/macrophages against viral infections (Belardelli et
al., 1987a;
Lallemand et al., 1996). Many tumors are infiltrated by macrophages that can
produce
S cytokines, including IFN-~3, subsequent to interaction with microorganisms
or their products
(Nathan, 1987). Whether the production of IFN-(3 by macrophages could protect
bystander
tumor cells from viral infection remains unclear.
In viewing the prior art, a significant question that remains unanswered is
whether the
reduction in endogenous ~i-interferon will allow the host cells to be
transduced and to express
significant levels of an introduced gene. Since the production of (3-
interferon in response to viral
infection is a natural response of a functional host cell, it is unclear if
this process can be
inhibited without having an adverse effect on other functions of the host
cell, including protein
production. It is entirely possible that blocking of ~3-interferon will result
in rapid cell death,
apoptosis or shut off of host cell synthetic machinery.
Another limitation present in the prior art is the lack of data concerning the
duration of
the (3-interferon inhibition necessary to protect cells against viral
infection. Since protection
against undesired viral infection would be compromised when ~i-interferon is
inhibited
indefinitely, the prolonged inhibition of ø-interferon is of limited clinical
significance.
The present invention discloses that the transduction efficiency of AdSCMV-
LacZ is
inversely correlated with expression of endogenous IFN-Vii. Moreover, the
presence of anti-IFN-
(3 antibody during the infection phase can increase transduction efficiency
and block the
inhibition of exogenous IFN-~i on cells which have low IFN-(3 expression. As
used herein,
transduction does not include viral replication, but does include expression
of non-viral genes by
the vector.
Further, the inventors' studies suggest that in vivo transduction of tumors
may be
inhibited by IFN-(3 produced by infiltrating macrophages. This "protection of
bystander cells"
from infecting viruses has particular relevance for gene therapy.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
17
Thus, a particular embodiment of the present invention concerns methods and
compositions for the efficient transduction of cells which express (3-
interferon, or which are
located in proximity to cells which express (3-interferon. This is
accomplished through the
reduction of (3-interferon expression, thus rendering cells amenable to
transduction.
Further particular embodiments of the present invention concern methods and
compositions for the efficient transduction of cells in vitro which express (3-
interferon, or which
are located in proximity to cells which express ~i..interferon. The cells thus
transduced can then
be used to produce heterologous proteins in vitro, or as compositions which
are administered to
an animal to produce a selected protein or peptide in vivo.
Additionally, certain aspects of the present invention concern methods and
compositions
for the efficient transduction of cells in vivo which express (3-interferon,
or which are located in
proximity to cells which express (3-interferon. Other aspects of the present
invention concern the
I S reduction of ~i-interferon expression in vivo for defined periods of time,
thereby providing an
improved procedure for transducing cells in vivo.
Further aspects of the present invention concern methods and compositions for
treating a
variety of diseases, including genetically based diseases such as ADA
deficiency, cystic fibrosis,
hemophilia and familial hypercholesterolemia, v;~scular proliferative diseases
such as infantile
hemangioma, arthritis, psoriasis and pulmonary hypertension. A particular
aspect of the present
invention concerns methods and compositions for the treatment of cancer.
Once a diagnosis of cancer is established., the urgent question is whether the
disease is
localized to the primary site or whether it already spread to the regional
lymph nodes and distant
organs. The spread of cancer from the primary site to secondary locations,
termed metastasis, is
responsible for the majority of cancer related deaths. Cancer metastasis
consists of multinte
complex, interacting, and interdependent steps, each of which is rate-
limiting, since a failure to
complete any of the steps prevents the tumor cell from producing a metastasis.
The tumor cells
that eventually give rise to metastases must survive a series of potentially
lethal interactions with
host homeostatic mechanisms. The balance of these interactions can vary among
different
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
18
patients with different neoplasms or even among different patients with the
same type of
neoplasm (Fidler, 1990, 1995).
The essential steps in the formation of a metastasis are similar in all tumors
(Poste and
Fidler, 1980; Fidler, 1990) and consist of the following. First, after
neoplastic transformation,
progressive proliferation of neoplastic cells is initially supported with
nutrients supplied from the
organ microenvironment by diffusion, and second, neovascularization or
angiogenesis must take
place for a tumor mass to exceed 1-2 mm in diameter. The synthesis and
secretion of different
angiogenic molecules and suppression of inhibitory molecules are responsible
for the
establishment of a capillary network from the surrounding host tissue. Third,
some tumor cells
can downregulate expression of cohesive molecules and have increased motility
and, thus, can
detach from the primary lesion. Invasion of the host stroma by some tumor
cells occurs by
several parallel mechanisms. Capillaries and thin-walled venules, like
lymphatic channels, offer
very little resistance to penetration by tumor cells and provide the most
common pathways for
tumor cell entry into the circulation. Fourth, detachment and embolization of
single tumor cells
or cell aggregates occurs next, the vast majority of circulating tumor cells
being rapidly
destroyed. Fifth, once the tumor cells have survived the circulation, they
must arrest in the
capillary beds of distant organs by adhering either to capillary endothelial
cells or to exposed
subendothelial basement membranes. Sixth, tumor cells (especially those in
aggregates) can
proliferate within the lumen of the blood vessel, but the majority extravasate
into the organ
parenchyma by mechanisms similar to those operative during invasion. Seventh,
tumor cells
bearing appropriate cell surface receptors can respond to paracrine growth
factors and hence
proliferate in the organ parenchyma. Eighth, the metastatic cells must evade
destruction by host
defenses that include specific and nonspecific immune responses. Ninth, to
exceed a mass of 1-2
mm in diameter, metastases must develop a vascular network. The metastases can
then give rise
to additional metastases, i. e. , the phenomenon of "metastasis of
metastases".
The term "cancer" embraces a collection of malignancies, with each cancer of
each organ
consisting of numerous subsets. Indeed, by the time of initial diagnosis,
cancers consist of
multiple subpopulations of cells with diverse genetic, biochemical,
immunological and biological
characteristics (Hart and Fidler, 1981 ). Biological heterogeneity is also
prominent within and
among metastases (Fidler, 1990). This heterogeneity, and the rapid emergence
of tumor cells
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
19
with resistance to conventional anticancer agents, is a major barrier to the
treatment of
metastases.
The design of a more effective therapy for metastatic disease therefore
requires a better
insight into the molecular mechanisms that regulate the pathobiology of the
process. One of the
obligate steps described above which is involved in the growth of both primary
and secondary
(metastatic) tumors is neovascularization, or creation of new blood vessels
which grow into the
tumor. This neovascularization is termed angio~;enesis (Folkman, 1986, 1989),
which provides
the growing tumor with a blood supply and essential nutrients.
Angiogenesis is mediated by multiple molecules that are released by both host
cells and
tumor cells. The host cells involved include endothelial cells, epithelial
cells, mesothelial cells
and leukocytes. Angiogenesis consists of sequential processes emanating from
microvascular
endothelial cells (Folkman, 1986). To generate capillary sprouts, endothelial
cells must
proliferate, migrate and penetrate host stroma, with the direction of
migration generally pointing
toward the source of angiogenic molecules.
There is a growing body of evidence 'that tumor growth is angiogenesis-
dependent
(O'Reilly et al., 1996). A number of angiogenesis inhibitors have been studied
as possible
anticancer agents. Recently, a substance termed angiostatin has been described
which suppresses
vascularization, and hence, growth of both primary and secondary (metastatic)
tumors (O'Reilly
et al., 1994). Studies have shown that after systemic administration, purified
angiostatin can
produce apoptosis in metastases (Holmgren et al. , 1995) and sustain dormancy
of several human
tumors implanted subcutaneously in nude mice (CfReilly et al., 1996).
Angiostatin is a 38 kDa fragment of plasminogen, and can be generated from
plasminogen in vitro by digestion with pancreatic elastase. However, how
angiostatin is
produced in vivo from circulating plasminogen has remained unanswered. As
described above,
purified angiostatin has been used to treat tumors in vivo, however, due to
the short circulating
_ 30 half life of angiostatin, the treatments must be given twice daily for
the duration of the regimen.
An additional limitation of the angiostatin treatments of the prior art is
that the administration of
angiostatin is systemic. Since a number of normal and critical cellular
functions (including, but
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
not limited to, wound healing) are dependent on angiogenesis, systemic, long-
term inhibition of
angiogenesis could be deleterious to the host organism.
Therefore, provided in the present invention are methods and compositions for
the in vivo
5 production of angiostatin which remove the proposed requirement of twice
daily administration.
Additionally, in certain embodiments, the production of angiostatin is
concentrated in the tumors
targeted for treatment, thus limiting the systemic effects of the inhibition
of angiogenesis.
In certain aspects of the present invention, angiostatin is produced by
elastase, preferably
10 macrophage metalloelastase (MME), which is induced in macrophages by
granulocyte-
macrophage colony stimulating factor (GM-CSF). The inventors' studies of two
tumor systems
in an art-accepted animal model, show that primary subcutaneous tumor cells
transduced with
therapeutically effective amounts of GM-CSF, recruit macrophages into the
tumor lesion and
stimulate MME expression in the infiltrating macrophages. The MME in turn
degrades
15 plasminogen to angiostatin that circulates into distant capillary beds
where it suppresses
angiogenesis and hence suppresses the growth of distant metastases.
I. Inhibition of (3-interferon
20 As described herein, numerous aspects of the present invention concern the
inhibition of
(3-interferon expression and/or the neutralization of the action of ~3-
interferon, either in cells
targeted for transduction or in bystander cells proximal to cells targeted for
transduction. The
inhibition can be in vitro or in vivo, depending on the particular aspect of
the invention practiced.
Further, the inhibition of (3-interferon expression can be transient or
sustained for discrete periods
of time.
There are a variety of methods for accomplishing the inhibition of (3-
interferon
expression, including, but not limited to, the use of anti-~i-interferon
antibodies, antisense
methodology, particularly with regards to ~i-interferon itself and interferon
regulatory factor-1,
ribozymes, inhibition of enzymes involved in the (3-interferon transduction
pathway, including
the protein kinases associated with the ~3-interferon receptor binding
proteins, overexpression of
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
21
interferon regulatory factor-2 and homologous recombination. Each of these
methods are
discussed in greater detail below.
A. Anti-(3-IFN antibodies
As discussed above, antibodies to (3-interferon can make cells less resistant
to viral
infection. In certain embodiments of the present invention, anti-(3-interferon
antibodies are
administered with the transducing construct to effect efficient transduction
of the target cells.
A number of different anti-~3-interferor.~ antibodies have been described and
are
commercially available. For example, a purified rabbit polyclonal anti-(3-
interferon antibody can
be purchased from Lee BioMolecular Research, Inc. (California), and a rat
monoclonal anti-~3-
interferon antibody can be purchased from Yamasa~. Shoyu Co., Inc. (Japan).
Additionally, polyclonal or monoclonal antibodies can be produced using
techniques well
known to those of skill in the art, as described below.
1. Antibody Production
In certain aspects of the present invention., the preparation of polyclonal or
monoclonal
antibodies, for example to ~i-interferon, is contemplated. Means for preparing
and characterizing
antibodies are well known in the art (See, e.g., Antibodies: A Laboratory
Manual, Cold Spring
Harbor Laboratory, 1988; incorporated herein by re;ference).
The methods for generating monoclonal antibodies (MAbs) generally begin along
the
same lines as those for preparing polyclanal antibodies. Briefly, a polyclonal
antibody is
prepared by immunizing an animal with an immunogenic composition in accordance
with the
present invention, either with or without prior i.mmunotolerizing, depending
on the antigen
composition and protocol being employed, and colJlecting antisera from that
immunized animal.
A wide range of animal species can be used for the production of antisera.
Typically the
animal used for production of anti-antisera is a rabbit, a mouse, a rat, a
hamster, a guinea pig or a
goat. Because of the relatively large blood volume of rabbits, a rabbit is a
preferred choice for
production of polyclonal antibodies.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
22
As is well known in the art, a given composition may vary in its
immunogenicity. It is
often necessary therefore to boost the host immune system, as may be achieved
by coupling a
peptide or polypeptide immunogen to a carrier. Exemplary and preferred
carriers are keyhole
limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as
ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as
carriers. Means
for conjugating a polypeptide to a carrier protein are well known in the art
and include
glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimide
and bis-
biazotized benzidine.
As is also well known in the art, the immunogenicity of a particular immunogen
composition can be enhanced by the use of non-specific stimulators of the
immune response,
known as adjuvants. Suitable adjuvants include all acceptable
immunostimulatory compounds,
such as cytokines, toxins or synthetic compositions.
IS
Adjuvants that may be used include IL-1, IL-2, IL-4, IL-7, IL-12, g-
interferon, GMCSP,
BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-
PE), lipid A, and monophosphoryl lipid A (MPL). RIBI, which contains three
components
extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall
skeleton (C WS) in a
2% squalene/Tween 80 emulsion. MHC antigens may even be used.
Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-
specific
stimulator of the immune response containing killed Mycobacterium
tuberculosis), incomplete
Freund's adjuvants and aluminum hydroxide adjuvant.
In addition to adjuvants, it may be desirable to coadminister biologic
response modifiers
(BRM), which have been shown to upregulate T cell immunity or downregulate
suppressor cell
activity. Such BRMs include, but are not limited to, Cimetidine (CIM; 1200
mgld)
(Smith/Kline, PA); or low-dose Cyclophosphamide (CYP; 300 mg/m2)
(Johnson/Mead, NJ) and
Cytokines such as g-interferon, IL-2, or IL-12 or genes encoding proteins
involved in immune
helper functions, such as B-7.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
23
The amount of immunogen composition used in the production of polyclonal
antibodies
varies upon the nature of the immunogen as well as the animal used for
immunization. A variety
of routes can be used to administer the immuno;;en (subcutaneous,
intramuscular, intradermal,
intravenous and intraperitoneal). The production of polyclonal antibodies may
be monitored by
sampling blood of the immunized animal at various points following
immunization.
A second, booster injection, may also be given. The process of boosting and
titering is
repeated until a suitable titer is achieved. When a desired level of
immunogenicity is obtained,
the immunized animal can be bled and the serurr~ isolated and stored, and/or
the animal can be
used to generate MAbs.
For production of rabbit polyclonal antibodies, the animal can be bled through
an ear vein
or alternatively by cardiac puncture. The removed blood is allowed to
coagulate and then
centrifuged to separate serum components from vcrhole cells and blood clots.
The serum may be
used as is for various applications or else the desired antibody fraction may
be purified by well-
known methods, such as affinity chromatography using another antibody, a
peptide bound to a
solid matrix, or by using, e.g., protein A or protein G chromatography.
MAbs may be readily prepared through use of well-known techniques, such as
those
exemplified in U.S. Patent 4,196,265, incorporated herein by reference.
Typically, this technique
involves immunizing a suitable animal with a selected immunogen composition,
e.g., a purified
or partially purified (3-interferon protein, polypeptide or peptide, or any ~i-
interferon composition,
if used after tolerization to common antigens. The immunizing composition is
administered in a
manner effective to stimulate antibody producing cells.
The methods for generating monoclonal antibodies (MAbs) generally begin along
the
same lines as those for preparing polyclonal antibodies. Rodents such as mice
and rats are
preferred animals, however, the use of rabbit, sheep frog cells is also
possible. The use of rats
may provide certain advantages (Goding, 1986, pp. 60-61 ), but mice are
preferred, with the
BALB/c mouse being most preferred as this is most routinely used and generally
gives a higher
percentage of stable fusions.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
24
The animals are injected with antigen, generally as described above. The
antigen may be
coupled to carrier molecules such as keyhole limpet hemocyanin if necessary.
The antigen
would typically be mixed with adjuvant, such as Freund's complete or
incomplete adjuvant.
Booster injections with the same antigen would occur at approximately two-week
intervals.
Following immunization, somatic cells with the potential for producing
antibodies,
specifically B lymphocytes (B cells), are selected for use in the MAb
generating protocol. These
cells may be obtained from biopsied spleens, tonsils or lymph nodes, or from a
peripheral blood
sample. Spleen cells and peripheral blood cells are preferred, the former
because they are a rich
source of antibody-producing cells that are in the dividing plasmablast stage,
and the latter
because peripheral blood is easily accessible.
Often, a panel of animals will have been immunized and the spleen of animal
with the
highest antibody titer will be removed and the spleen lymphocytes obtained by
homogenizing the
spleen with a syringe. Typically, a spleen from an immunized mouse contains
approximately S x
107 to 2 x 108 lymphocytes.
The antibody-producing B lymphocytes from the immunized animal are then
fused with cells of an immortal myeloma cell, generally one of the same
species as the animal
that was immunized. Myeloma cell lines suited for use in hybridoma-producing
fusion
procedures preferably are non-antibody-producing, have high fusion efficiency,
and enzyme
deficiencies that render then incapable of growing in certain selective media
which support the
growth of only the desired fused cells (hybridomas).
Any one of a number of myeloma cells may be used, as are known to those of
skill in the
art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984). cites). For example,
where the
immunized animal is a mouse, one may use P3-X63/AgB, X63-Ag8.653, NS1/l.Ag 4
1,
Sp210-Ag 14, FO, NSO/LJ, MPC-11, MPC 11-X45-GTG 1.7 and S 194/SXXO Bul; for
rats, one
may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2,
LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell
fusions.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
One preferred marine myeloma cell is the lVS-1 myeloma cell line (also termed
P3-NS-I-
Ag4-1 ), which is readily available from the NIGMS Human Genetic Mutant Cell
Repository by
requesting cell line repository number GM3573. Another mouse myeloma cell line
that may be
used is the 8-azaguanine-resistant mouse marine lnyeloma SP2/0 non-producer
cell line.
S
Methods for generating hybrids of antibody-producing spleen or lymph node
cells and
myeloma cells usually comprise mixing somatic cells with myeloma cells in a
2:1 proportion,
though the proportion may vary from about 20:1 to about 1:1, respectively, in
the presence of an
agent or agents (chemical or electrical) that promote the fusion of cell
membranes. Fusion
10 methods using Sendai virus have been described by Kohler and Milstein
(1975; 1976), and those
using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (
1977). The use of
electrically induced fusion methods is also appropriate (Goding pp. 71-74,
1986).
Fusion procedures usually produce viable hybrids at low frequencies, about 1 x
10'6 to
15 1 x 10-8. However, this does not pose a problem. as the viable, fused
hybrids are differentiated
from the parental, unfused cells (particularly the unfused myeloma cells that
would normally
continue to divide indef nitely) by culturing in a selective medium. The
selective medium is
generally one that contains an agent that blocks the de novo synthesis of
nucleotides in the tissue
culture media. Exemplary and preferred agents are aminopterin, methotrexate,
and azaserine.
20 Aminopterin and methotrexate block de novo synthesis of both purines and
pyrimidines, whereas
azaserine blocks only purine synthesis. Where aminopterin or methotrexate is
used, the media is
supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT
medium).
Where azaserine is used, the media is supplemented with hypoxanthine.
25 The preferred selection medium is HAT. Only cells capable of operating
nucleotide
salvage pathways are able to survive in HAT mef~.ium. The myeloma cells are
defective in key
enzymes of the salvage pathway, e.g., hypoxantlune phosphoribosyl transferase
(HPRT), and
they cannot survive. The B cells can operate this pathway, but they have a
limited life span in
culture and generally die within about two weeks. Therefore, the only cells
that can survive in
the selective media are those hybrids formed from myeloma and B cells.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
26
This culturing provides a population of hybridomas from which specific
hybridomas are
selected. Typically, selection of hybridomas is performed by culturing the
cells by single-clone
dilution in microtiter plates, followed by testing the individual clonal
supernatants (after about
two to three weeks) for the desired reactivity. The assay should be sensitive,
simple and rapid,
such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque
assays, dot
immunobinding assays, and the like.
The selected hybridomas would then be serially diluted and cloned into
individual
antibody-producing cell lines, which clones can then be propagated
indefinitely to provide
MAbs. The cell lines may be exploited for MAb production in two basic ways.
A sample of the hybridoma can be injected (often into the peritoneal cavity)
into a
histocompatible animal of the type that was used to provide the somatic and
myeloma cells for
the original fusion (e.g., a syngeneic mouse). Optionally, the animals are
primed with a
hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior
to injection. The
injected animal develops tumors secreting the specific monoclonal antibody
produced by the
fused cell hybrid. The body fluids of the animal, such as serum or ascites
fluid, can then be
tapped to provide MAbs in high concentration.
The individual cell lines could also be cultured in vitro, where the MAbs are
naturally
secreted into the culture medium from which they can be readily obtained in
high concentrations.
MAbs produced by either means may be further purified, if desired, using
filtration,
centrifugation and various chromatographic methods such as HPLC or affinity
chromatography.
Fragments of the monoclonal antibodies of the invention can be obtained from
the monoclonal
antibodies so produced by methods which include digestion with enzymes, such
as pepsin or
papain, andlor by cleavage of disulfide bonds by chemical reduction.
Alternatively, monoclonal
antibody fragments encompassed by the present invention can be synthesized
using an automated
peptide synthesizer.
It is also contemplated that a molecular cloning approach may be used to
generate
monoclonal antibodies. For this, combinatorial immunoglobulin phagemid
libraries are prepared
CA 02275438 1999-06-09
WO 98122605 PCT/LTS97/21475
27
from RNA isolated from the spleen of the immunized animal, and phagemids
expressing
appropriate antibodies are selected by panning using cells expressing the
antigen and control
cells e.g., normal-versus-tumor cells. The advantages of this approach over
conventional
hybridoma techniques are that approximately 104 times as many antibodies can
be produced and
screened in a single round, and that new spc:cificities are generated by H and
L chain
combination which further increases the chance of finding appropriate
antibodies.
For example, the gene encoding ~3-interferon (see below) can be subcloned into
a
baculoviral expression vector. The engineered baculoviral vector can then be
used to infect
insect cells, and then ~3-interferon can be purified from the insect cells an
appropriate time after
the induction of expression of the baculoviral vector. The purified (3-
interferon can then be used
to immunize animals with an appropriate adjuvant, following a standard
immunization protocol.
After approximately 4-12 weeks, the anti-(3-interfc;ron antibodies can be
purified from the sera of
immunized animals.
B. Antisense
In certain other embodiments of the present invention, antisense methodology
is used to
inhibit ~-interferon expression. In antisense constructs contemplated for use
in the present
invention, the gene encoding either (3-interferon or IRF-1 is subcloned into
an appropriate
expression vector, in operable relation to regulatory sequences as described
in Section V below.
In certain aspects of the invention, these antisensf: constructs are
administered to the target cells
(Section III below) prior to administration of the viral vectors comprising
heterologous genes
(Section II below). In other aspects of the instant invention, the antisense
constructs are
comprised within viral vectors themselves.
Antisense methodology takes advantage of the fact that nucleic acids tend to
pair with
"complementary" sequences. By complementary, it is meant that polynucleotides
are those
which are capable of base-pairing according to the standard Watson-Crick
complementarity
rules. That is, the larger purines will base pair with the smaller pyrimidines
to form
combinations of guanine paired with cytosine (~3:C) and adenine paired with
either thymine
(A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. Inclusion of
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
28
less common bases such as inosine, 5-methylcytosine, 6-methyladenine,
hypoxanthine and others
in hybridizing sequences does not interfere with pairing.
Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix
formation;
targeting RNA will lead to double-helix formation. Antisense polynucleotides,
when introduced
into a target cell, specifically bind to their target polynucleotide, for
example (3-interferon, and
interfere with transcription, RNA processing, transport, translation and/or
stability. Antisense
RNA constructs, or DNA encoding such antisense RNAs, may be employed to
inhibit (3-
interferon gene transcription or translation or both within the cells of the
present invention.
Antisense constructs may be designed to bind to the promoter and other control
regions,
exons, introns or even exon-intron boundaries of a (3-interferon gene. It is
contemplated that
effective antisense constructs will often include regions complementary to
intron/exon splice
junctions. Thus, antisense constructs with complementarity to regions within
50-200 bases of an
intron-exon splice junction of (3-interferon are contemplated for use
herewith. It has been
observed that some exon sequences can be included in the construct without
seriously affecting
the target selectivity thereof. The amount of exonic material included will
vary depending on the
particular exon and intron sequences used. One can readily test whether too
much exon DNA is
included simply by testing the constructs in vitro to determine whether the
expression of ~i-
interferon and/or other genes having complementary sequences is affected.
"Antisense" or "complementary" means polynucleotide sequences that are
substantially
complementary over their entire length and have very few base mismatches. For
example,
sequences of fifteen bases in length may be termed complementary when they
have
complementary nucleotides at thirteen or fourteen positions. Naturally,
sequences which are
completely complementary will be sequences which are entirely complementary
throughout their
entire length and have no base mismatches. Other sequences with lower degrees
of homology
also are contemplated. For example, an antisense construct which has limited
regions of high
homology, but also contains a non-homologous region (e.g., ribozyme) could be
designed.
These molecules, though having less than 50% homology, would bind to target
sequences under
appropriate conditions.
CA 02275438 1999-06-09
WO 98122605 PCT/US97/21475
29
It may be advantageous to combine portions of genomic DNA with cDNA or
synthetic
sequences to generate specific constructs. For example, where an intron is
desired in the ultimate
construct, a genomic clone will need to be used. 7.'he cDNA or a synthesized
polynucleotide may
provide more convenient restriction sites for the remaining portion of the
construct and,
therefore, would be used for the rest of the sequence.
Particularly contemplated for use in the present invention are amtisense
constructs
directed to (3-interferon and interferon regulatory factor-1 (IRF-1 ).
1. ~i-interferon
In particular aspects of the present invention, the antisense constructs are
directed to (3-
interferon itself. The cloning and sequencing of the human (Taniguchi et al.,
1980; GenBank
accession numbers J00218, K00616 and M1102'9) and mouse (Higashi et al., 1983;
GenBank
accession numbers X 14455 and X 14029) (3-interferon genes have been
described.
2. IRF-1
In other aspects of the present invention, p.-interferon expression is
inhibited by antisense
constructs to interferon regulatory factor-1. Interferon regulatory factor-1
(IRF-1) is a positive
control factor which binds efficiently to repeated hexamer motifs present in
the regulatory region
of interferon genes (Miyamoto et al., 1988). Theae motifs operate as virus-
inducible enhancers
(Fujita et al., 1987), and indeed transcription of the IRF-1 gene itself is
induced by viral
infection. This suggests that induction of IFN genes upon viral infection may
be due to increased
transcription of the IRF-1 gene. Expression of an IRF-1 antisense RNA in the
human fibroblast
cell line GM-637 results in strong inhibition of IFN-(3 gene expression (Reis
et al., 1992),
although this was not found in HeLa cells (Pine et al., 1990). This suggests
alternate pathways
for the induction of the (3-interferon gene.
The IRF-1 gene has been cloned from human (GenBank accession number X 14454)
and
mouse (GenBank accession numbers M21065, M2 5560 and J03160).
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
C. Ribozymes
Another method for inhibiting (3-interferon expression contemplated in the
present
invention is via ribozymes. Although proteins traditionally have been used for
catalysis of
nucleic acids, another class of macromolecules has emerged as useful in this
endeavor.
5 Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-
specific fashion.
Ribozymes have specific catalytic domains that possess endonuclease activity
(Kim and Cech,
1987; Gerlach et al., 1987; Forster and Symons, 1987). For example, a large
number of
ribozymes accelerate phosphoester transfer reactions with a high degree of
specificity, often
cleaving only one of several phosphoesters in an oligonucleotide substrate
(Cech et al., 1981;
10 Michel and Westhof, 1990; Reinhold-Hurek and Shub, 1992). This specificity
has been
attributed to the requirement that the substrate bind via specific base-
pairing interactions to the
internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.
Ribozyme catalysis has primarily been observed as part of sequence-specific
15 cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cech et
al., 1981 ). For
example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as
endonucleases with
a sequence specificity greater than that of known ribonucleases and
approaching that of the DNA
restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of
gene expression
may be particularly suited to therapeutic applications (Scanlon et al., 1991;
Sarver et al., 1990;
20 Sioud et al. , 1992). Recently, it was reported that ribozymes elicited
genetic changes in some
cells lines to which they were applied; the altered genes included the
oncogenes H-ras, c-fos and
genes of HIV. Most of this work involved the modification of a target mRNA,
based on a
specific mutant codon that is cleaved by a specific ribozyme.
25 Several different ribozyme motifs have been described with RNA cleavage
activity
(Symons, 1992). Examples that are expected to function equivalently for the
down regulation of
(3-interferon include sequences from the Group I self splicing introns
including Tobacco
Ringspot Virus (Prody et al., 1986), Avocado Sunblotch Viroid (Palukaitis et
al., 1979 and
Symons, 1981 ), and Lucerne Transient Streak Virus (Forster and Symons, 1987).
Sequences
30 from these and related viruses are referred to as hammerhead ribozyme based
on a predicted
folded secondary structure.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
31
Other suitable ribozymes include sequencfa from RNase P with RNA cleavage
activity
(Yuan et al. , 1992, Yuan and Altman, 1994), haipin ribozyme structures
(Berzal-Herranz et al. ,
1992 and Chowrira et al., 1993) and Hepatitis Delta virus based ribozymes. The
general design
and optimization of ribozyme directed RNA cleavage activity has been discussed
in detail
(Haseloff and Gerlach, 1988, Symons, 1992, Chov~~rira et al., 1994, and
Thompson et al., 1995).
The other variable on ribozyme design is the selection of a cleavage site on a
given target
RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a
site by
complimentary base pair interactions. Two stretches of homology are required
for this targeting.
These stretches of homologous sequences flank the catalytic ribozyme structure
defined above.
Each stretch of homologous sequence can vary in length from 7 to 1 S
nucleotides. The only
requirement for defining the homologous sequences is that, on the target RNA,
they are separated
by a specific sequence which is the cleavage site. For hammerhead ribozyme,
the cleavage site
is a dinucleotide sequence on the target RNA is a uracil (U) followed by
either an adenine,
cytosine or uracil (A,C or U) (Perriman et al., 1992 and Thompson et al.,
1995). The frequency
of this dinucleotide occurring in any given RNA is statistically 3 out of 16.
Therefore, for a
given target messenger RNA of 1000 bases, 18'7 dinucleotide cleavage sites are
statistically
possible.
The large number of possible cleavage sites in (3-interferon coupled with the
growing
number of sequences with demonstrated catalytic RNA cleavage activity
indicates that a large
number of ribozymes that have the potential to downregulate (3-interferon are
available.
Designing and testing ribozymes for efficient cleavage of a target RNA is a
process well known
to those skilled in the art. Examples of scientific methods for designing and
testing ribozymes
are described by Chowrira et al. , ( 1994) and Lieber and Strauss ( 1995),
each incorporated by
reference. The identification of operative and preferred sequences for use in
(3-interferon-
targeted ribozymes is simply a matter of prepaJring and testing a given
sequence, and is a
routinely practiced "screening" method known to those of skill in the art.
D. Kinase Inhibitors
~i-interferon stimulates transcriptional activation in a variety of cells.
This activation is
stimulated by the binding of ~3-interferon to cognate receptors on the surface
of certain cell types.
CA 02275438 1999-06-09
WO 98/22605 PCT/CTS97/21475
32
Most of the elements of the interferon transduction pathway have been
identified and
sequentially ordered. The interferon receptor binding proteins do not contain
a functional
tyrosine kinase, but instead recruit Tyk2 and Jakl. These cytoplasmic tyrosine
kinases are
implicated in the phosphorylation of relevant cytoplasmic proteins, termed
signal transducers and
activators of transcription (STATs). These phosphorylated proteins then
migrate to the nucleus
to constitute a transcription factor which interacts with elements in the
promoter of (3-interferon
inducible genes.
In certain aspects of the present invention, inhibition of the tyrosine
kinases associated
with ~3-interferon transduction is accomplished by using small chemical
compounds, peptides or
peptidometic compounds which inhibit tyrosine kinase activity. Alternatively,
any of the
methods used herein to reduce gene expression, exemplified by, but not limited
to, antisense,
ribozymes and homologous recombination, are contemplated for use in the
present invention to
inhibit tyrosine kinase activity. In particular aspects of the present
invention, the inhibition of
I S the specific tyrosine kinases associated with ~i-interferon transduction
is localized to a tumor
being targeted for transduction.
The peptide compounds contemplated for use in the present invention may be
synthesized
using known methods for peptide synthesis (Atherton & Shepard, 1989). The
preferred method
for synthesis is standard solid phase methodology, such as that based on the
9-fluorenylmethyloxycarbonyl FMOC protecting group (Barlos et al., 1989), with
glycine -
functionalized o-chlorotrityl polystyrene resin. These methods are also
adaptable to placement
of linking units on the end of the compound to provide additional
functionalities, as desired.
A particular advantage to the solid phase method of synthesis is the
opportunity for
modification of these compounds using combinatorial synthesis techniques.
Combinatorial
synthesis techniques are defined as those techniques producing large
collections or libraries of
compounds by sequentially linking different building blocks. Libraries can be
constructed using
compounds free in solution, but preferably the compound is linked to a solid
support such as a
bead, solid particle or even displayed on the surface of a microorganism.
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
33
Several methods exist for combinatorial synthesis (Holmes et al., 1995;
Burbaum et al.,
1995; Martin et al., 1995; Freier et al., 1995; Pei et al., 1991; Bruce et
al., 1995; Ohlmeyer et al.,
1993); however, the preferred methods are split synthesis or parallel
synthesis. Split synthesis
may be used to produce small amounts of a relatively large number of
compounds, while parallel
synthesis will produce larger amounts of a relatively small number of
compounds. In general
terms, using split synthesis, compounds are synthesized on the surface of a
microparticle. At
each step, the particles are partitioned into several groups for the addition
of the next component.
The different groups are then recombined and partitioned to form new groups.
The process is
repeated until the compound is completed. Each particle holds several copies
of the same
compound allowing for facile separation and purification. Split synthesis can
only be conducted
using a solid support.
An alternative technique known as parallel synthesis may be conducted either
in solid
phase or solution. Using parallel synthesis, diflEerent compounds are
synthesized in separate
1 S receptacles, often using automation. Parallel synthesis may be conducted
in microtiter plate
where different reagents can be added to each well in a predefined manner to
produce a
combinatorial library. It is well understood that many modifications of this
technique exist and
can be adapted for use with the present invention.
E. Overexpression of IRF-2
Interferon regulatory factor-2 (IRF-2) is a. repressor of [3-interferon
expression (Harada
et al., 1989). IRF-2, an antagonistic repressor of IRF-1, represses the effect
of IRF-1. IRF-2
apparently acts by competing for the same cis-acting recognition sequences as
IRF-1. Whereas
the expression of IRF-1 induces (3-interferon, the concomitant expression of
IRF-2 represses this
activity (Harada et al., 1989, 1990).
The IRF-2 gene has been cloned from human (GenBank accession number X 15949)
and
mouse (GenBank accession number J03 i 68). In pertain aspects of the present
invention, IRF-2
is overexpressed in cells which are then transduced with a viral vector
containing a selected gene.
The IRF-2 gene can be subcloned into an expression vector, many examples of
which are known
to those of skill in the art, and subsequently introduced to the cells
targeted for transduction by
conventional DNA transfer means described herein.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
34
F. Homologous Recombination
Another approach for inhibiting (3-interferon involves the use of homologous
recombination, or "knock-out technology". Homologous recombination relies,
like antisense, on
S the tendency of nucleic acids to base pair with complementary sequences. In
this instance, the
base pairing serves to facilitate the interaction of two separate nucleic acid
molecules so that
strand breakage and repair can take place. In other words, the "homologous"
aspect of the
method relies on sequence homology to bring two complementary sequences into
close
proximity, while the "recombination" aspect provides for one complementary
sequence to
replace the other by virtue of the breaking of certain bonds and the formation
of others.
Put into practice, homologous recombination is used as follows. First, the
target gene is
selected within the host cell, in this case, (3-interferon. Sequences
homologous to the ~3-
interferon target gene are then included in a genetic construct, along with
some mutation that will
render the target gene inactive (stop codon, interruption, and the like). The
homologous
sequences flanking the inactivating mutation are said to "flank" the mutation.
Flanking, in this
context, simply means that target homologous sequences are located both
upstream (5') and
downstream (3') of the mutation. These sequences should correspond to some
sequences
upstream and downstream of the target gene. The construct is then introduced
into the cell, thus
permitting recombination between the cellular sequences and the construct.
As a practical matter, the genetic construct will normally act as far more
than a vehicle to
interrupt the gene. For example, it is important to be able to select for
recombinants and,
therefore, it is common to include within the construct a selectable marker
gene. This gene
permits selection of cells that have integrated the construct into their
genomic DNA by
conferring resistance to various biostatic and biocidal drugs. In addition, a
heterologous gene
that is to be expressed in the cell also may advantageously be included within
the construct. The
arrangement might be as follows:
...vector~5'-flanking sequence~heterologous gene~selectable marker
gene~flanking
sequence-3'~vector...
CA 02275438 1999-06-09
WO 98/22605 PCTIL1S97/21475
Thus, using this kind of construct, it is possible, in a single
recombinatorial event, to (i)
"knock out" an endogenous gene, (ii) provide a selectable marker for
identifying such an event
and (iii) introduce a heterologous gene for expression.
5 Another refinement of the homologous recombination approach involves the use
of a
"negative" selectable marker. This marker, unli)';e the selectable marker,
causes death of cells
which express the marker. Thus, it is used to identify undesirable
recombination events. When
seeking to select homologous recombinants using a selectable marker, it is
difficult in the initial
screening step to identify proper homologous recombinants from recombinants
generated from
10 random, non-sequence specific events. These recombinants also may contain
the selectable
marker gene and may express the heterologous protein of interest, but will, in
all likelihood, not
have the desired "knock out" phenotype. By attaching a negative selectable
marker to the
construct, but outside of the flanking regions, one can select against many
random recombination
events that will incorporate the negative selectable marker. Homologous
recombination should
15 not introduce the negative selectable marker, as it is outside of the
flanking sequences.
II. Transduction of cells
The present invention provides improved compositions and methods for the
transduction
20 of cells, particularly with viral vectors. In various aspects of the
present invention, target cells
(Section III below) can be transduced either in vitro, in vivo or ex vivo,
depending on the
particular application (Section VII, Subsection C below). As discussed in
Section I above, the
expression of (3-interferon can be inhibited, or the: activity of ~3-
interferon can be neutralized in
the target cells. In certain aspects of the invention, the inhibition of ~i-
interferon is effected for a
25 defined and limited period of time, thereby limiting the effect that
inhibition of ~3-interferon in
cells may have.
A. Time frame of (3-interferon inhibition
~3-interferon is constitutively expressed in some cells, and can be
transiently induced in
30 many types of cells. As discussed above, inhibition of (3-interferon
expression or activity can
lead to increased transduction efficiency. Studies conducted by the inventors
indicate that a
useful time frame for inhibition of (3-interferon e:Kpression and/or
neutralization of (3-interferon
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
36
activity, in order to increase the transduction efficiency, is while the cells
interact with the virus.
In particular aspects of the present invention, the period of inhibition of (3-
interferon expression
or activity is between about 24 hours before to between about 24 to 48 hours
after the
administration of the viral vector.
S
B. Transduction with Viral Vectors
In numerous aspects of the present invention, a heterologous gene is
introduced into a
host cell. For example, in the gene therapy aspects of the present invention,
a construct
comprising a therapeutic gene is delivered to cells in need of therapy.
Alternatively, in the
aspects of the present invention involving production of selected proteins in
vitro, an expression
construct is delivered to an appropriate host cell. The present invention
contemplates a variety of
methods for the delivery of transducing constructs to host cells, as discussed
in more detail
below.
In certain aspects of gene therapy, the stability of the transducing construct
is paramount
to the success of the therapy regimen. The stability of the constructs can be
effected in various
ways. In certain embodiments of the invention, the nucleic acid encoding a
selected gene may be
stably integrated into the genome of the cell. In yet further embodiments. the
nucleic ac;~i may
be stably maintained in the cell as a separate, episomal segment of DNA. Such
nucleic acid
segments or "episomes" encode sequences sufficient to permit maintenance and
replication
independent of or in synchronization with the host cell cycle. How the
expression construct is
delivered to a cell and where in the cell the nucleic acid remains is
dependent on the type of
expression construct employed.
1. Adenoviral Vectors
A particular method for delivery of the expression constructs involves the use
of an
adenovirus expression vector. Although adenovirus vectors are known to have a
low capacity for
integration into genomic DNA, this feature is counterbalanced by the high
efficiency of gene
transfer afforded by these vectors. "Adenovirus expression vector" is meant to
include those
constructs containing adenovirus sequences sufficient to (a) support packaging
of the construct
and (b) to ultimately express a tissue-specific transforming construct that
has been cloned
therein.
CA 02275438 1999-06-09
WO 98/Z2605 PCT/US97/21475
37
The expression vector comprises a genetically engineered form of adenovirus.
Knowledge of the genetic organization or adenovirus, a 36 kb, linear, double-
stranded DNA
virus, allows substitution of large pieces of adenoviral DNA with foreign
sequences up to 7 kb
(Grunhaus and Horwitz, 1992). In contrast to re;trovirus, the adenoviral
infection of host cells
does not result in chromosomal integration becau:;e adenoviral DNA can
replicate in an episomal
manner without, potential genotoxicity. Also, adenoviruses are structurally
stable, and no
genome rearrangement has been detected after extensive amplification.
Adenovirus is particularly suitable for use; as a gene transfer vector because
of its mid-
sized genome, ease of manipulation, high titer, wiide target-cell range and
high infectivity. Both
ends of the viral genome contain 100-200 base; pair inverted repeats (ITRs),
which are cis
elements necessary for viral DNA replication and packaging. The early (E) and
late (L) regions
of the genome contain different transcription units that are divided by the
onset of viral DNA
replication. The E 1 region (E 1 A and E I B) encodes proteins responsible for
the regulation of
transcription of the viral genome and a few cellular genes. The expression of
the E2 region (E2A
and E2B) results in the synthesis of the proteins for viral DNA replication.
These proteins are
involved in DNA replication, late gene expression and host cell shut-off
(Renan, 1990). The
products of the late genes, including the majority of the viral capsid
proteins, are expressed only
after significant processing of a single primary transcript issued by the
major late promoter
(MLP). The MLP, (located at 16.8 m.u.) is particularly efficient during the
late phase of
infection, and all the mRNA's issued from this promoter possess a 5'-
tripartite leader (TPL)
sequence which makes them preferred mRNA's for translation.
In a current system, recombinant adenovirus is generated from homologous
recombination between shuttle vector and provinls vector. Due to the possible
recombination
between two proviral vectors, wild-type adenovirus may be generated from this
process.
Therefore, it is critical to isolate a single clone of virus from an
individual plaque and examine
its genomic structure.
Generation and propagation of the current adenovirus vectors, which are
replication
deficient, depend on a unique helper cell line, designated 293, which was
transformed from
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
38
human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses
E I proteins
(E 1 A and E 1 B; Graham et al. , 1977). Since the E3 region is dispensable
from the adenovirus
genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help
of 293 cells, carry
foreign DNA in either the E 1, the D3 or both regions (Graham and Prevec, 1991
). In nature,
adenovirus can package approximately 105% of the wild-type genome (Ghosh-
Choudhury et al.,
1987), providing capacity for about 2 extra kb of DNA. Combined with the
approximately 5.5
kb of DNA that is replaceable in the E l and E3 regions, the maximum capacity
of the current
adenovirus vector is under 7.5 kb, or about 15% of the total length of the
vector. More than 80%
of the adenovirus viral genome remains in the vector backbone.
Helper cell lines may be derived from human cells such as human embryonic
kidney
cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal
or epithelial
cells. Alternatively, the helper cells may be derived from the cells of other
mammalian species
that are permissive for human adenovirus. Such cells include, e.g., Vero cells
or other monkey
embryonic mesenchymal or epithelial cells. As stated above, the preferred
helper cell line is 293.
Recently, Racher et al. ( 1995) disclosed improved methods for culturing 293
cells and
propagating adenovirus. In one format, natural cell aggregates are grown by
inoculating
individual cells into I liter siliconized spinner flasks (Techne, Cambridge,
UK) containing 100-
200 ml of medium. Following stirring at 40 rpm, the cell viability is
estimated with trypan blue.
In another format, Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1)
is employed as
follows. A cell inoculum, resuspended in 5 ml of medium, is added to the
carrier (50 ml) in a
250 ml Erlenmeyer flask and left stationary, with occasional agitation, for 1
to 4 h. The medium
is then replaced with 50 ml of fresh medium and shaking initiated. For virus
production, cells
are allowed to grow to about 80% confluence, after which time the medium is
replaced (to 25%
of the final volume) and adenovirus added at an MOI of 0.05. Cultures are left
stationary
overnight, following which the volume is increased to 100% and shaking
commenced for another
72 h.
Other than the requirement that the adenovirus vector be replication
defective, or at least
conditionally defective, the nature of the adenovirus vector is not believed
to be crucial to the
successful practice of the invention. The adenovirus may be of any of the 42
different known
CA 02275438 1999-06-09
WO 98/22605 PCT/US97I21475
39
serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred
starting material
in order to obtain the conditional replication-defective adenovirus vector for
use in the present
invention. This is because Adenovirus type 5 is a human adenovirus about which
a great deal of
biochemical and genetic information is known, and it has historically been
used for most
constructions employing adenovirus as a vector.
As stated above, the typical vector according to the present invention is
replication
defective and will not have an adenovirus E 1 region. Thus, it will be most
convenient to
introduce the transforming construct at the position from which the E 1-coding
sequences have
been removed. However, the position of insertion of the construct within the
adenovirus
sequences is not critical to the invention. The polynucleotide encoding the
gene of interest may
also be inserted in lieu of the deleted E3 region in E3 replacement vectors as
described by
Karlsson et al. ( 1986) or in the E4 region where ;~ helper cell line or
helper virus complements
the E4 defect.
Adenovirus growth and manipulation is known to those of skill in the art, and
exhibits
broad host range in vitro and in vivo. This group of viruses can be obtained
in high titers, e.g.,
109-1011 plaque-forming units per ml, and they are highly infective. The life
cycle of
adenovirus does not require integration into the host cell genome. The foreign
genes delivered
by adenovirus vectors are episomal and, therefore, have tow genotoxicity to
host cells. No side
effects have been reported in studies of vaccination with wild-type adenovirus
(Couch et al.,
1963 ; Top et al. , 1971 ), demonstrating their safety and therapeutic
potential as in vivo gene
transfer vectors.
Adenovirus vectors have been used in euli:aryotic gene expression (Levrero et
al. , 1991;
Gomez-Foix et al., 1992) and vaccine development (Grunhaus and Horwitz, 1992;
Graham and
Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus
could be used
for gene therapy (Stratford-Perricaudet and Perric;~udet, 1991; Stratford-
Perricaudet et al. , 1991;
Rich et al., 1993). Studies in administering recornbinant adenovirus to
different tissues include
trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., 1992), muscle
injection (Ragot
et al., 1993), peripheral intravenous injections (Herz and Gerard, 1993) and
stereotactic
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
inoculation into the brain (Le Gal La Salle et al. , 1993 ). Recombinant
adenovirus and adeno-
associated virus (see below) can both infect and transduce non-dividing human
primary cells.
2. AAV Vectors
5 Adeno-associated virus (AAV) is an attractive vector system for use in the
cell
transduction of the present invention as it has a high frequency of
integration and it can infect
nondividing cells, thus making it useful for delivery of genes into mammalian
cells, for example,
in tissue culture (Muzyczka, 1992) or in vivo. AAV has a broad host range for
infectivity
(Tratschin, et al., 1984; Laughlin, et al., 1986; Lebkowski, et al., 1988;
McLaughlin, et al.,
10 1988). Details concerning the generation and use of rAAV vectors are
described in U.S. Patent
No. 5,139,941 and U.S. Patent No. 4,797,368, each incorporated herein by
reference.
Studies demonstrating the use of AAV in gene delivery include LaFace et al. (
1988);
Zhou et al. (1993); Flotte et al. (1993); and Walsh et al. (1994). Recombinant
AAV vectors have
1 S been used successfully for in vitro and in vivo transduction of marker
genes (Kaplitt, et al., 1994;
Lebkowski, et al., 1988; Samulski, et al., 1989; Shelling and Smith, 1994;
Yoder, et al., 1994;
Zhou, et al., 1994; Hermonat and Muzyczka, 1984; Tratschin, et al., 1985;
McLaughlin, et al.,
1988) and genes involved in human diseases (Flotte, et al., 1992; Luo, et al.,
1994; Ohi, et al.,
1990; Walsh, et al., 1994; Wei, et al., 1994). Recently, an AAV vector has
been approved for
20 phase I human trials for the treatment of cystic fibrosis.
AAV is a dependent parvovirus in that it requires coinfection with another
virus (either
adenovirus or a member of the herpes virus family) to undergo a productive
infection in cultured
cells (Muzyczka, 1992). In the absence of coinfection with helper virus, the
wild type AAV
25 genome integrates through its ends into human chromosome 19 where it
resides in a latent state
as a provirus (Kotin et al., 1990; Samulski et al., 1991 ). rAAV, however, is
not restricted to
chromosome 19 for integration unless the AAV Rep protein is also expressed
(Shelling and
Smith, 1994). When a cell carrying an AAV provirus is superinfected with a
helper virus, the
AAV genome is "rescued" from the chromosome or from a recombinant plasmid, and
a normal
30 productive infection is established (Samulski, et al. , 1989; McLaughlin,
et al. , 1988; Kotin,
et al., 1990; Muzyczka, 1992).
CA 02275438 1999-06-09
WO 98!22605 PCT/US97/21475
41
Typically, recombinant AAV (rAAV) virus is made by cotransfecting a plasmid
containing the gene of interest flanked by the two AAV terminal repeats
(McLaughlin et al.,
1988; Samulski et al., 1989; each incorporated herein by reference) and an
expression plasmid
containing the wild type AAV coding sequences without the terminal repeats,
for example
pIM45 (McCarty et al., 1991; incorporated herein by reference). The cells are
also infected or
transfected with adenovirus or plasmids carrying the adenovirus genes required
for AAV helper
function. rAAV virus stocks made in such fashion are contaminated with
adenovirus which must
be physically separated from the rAAV particles (for example, by cesium
chloride density
centrifugation). Alternatively, adenovirus vectors containing the AAV coding
regions or cell
lines containing the AAV coding regions and some or all of the adenovirus
helper genes could be
used (Yang et al., 1994; Clark et al., 1995). Cell tines carrying the rAAV DNA
as an integrated
provirus can also be used (Flotte et al., 1995).
3. Retroviral Vectors
The retroviruses are a group of single-stranded RNA viruses characterized by
an ability to
convert their RNA to double-stranded DNA in inff;cted cells by a process of
reverse-transcription
(Coffin, 1990). The resulting DNA then stably integrates into cellular
chromosomes as a
provirus and directs synthesis of viral proteins. The integration results in
the retention of the
viral gene sequences in the recipient cell and its descendants. The retroviral
genome contains
three genes, gag, pol, and env that code for capsid proteins, polymerase
enzyme, and envelope
components, respectively. A sequence found upstream from the gag gene contains
a signal for
packaging of the genome into virions. Two long l;erminal repeat (LTR)
sequences are present at
the 5' and 3' ends of the viral genome. These contain strong promoter and
enhancer sequences
and are also required for integration in the host celil genome (Coffin, 1990).
In order to construct a retroviral vector, .a nucleic acid encoding a gene of
interest is
inserted into the viral genome in the place of certain viral sequences to
produce a virus that is
replication-defective. In order to produce virions, a packaging cell line
containing the gag, pol,
and env genes but without the LTR and packaging components is constructed
(Mann et al.,
1983). When a recombinant plasmid containing a cDNA, together with the
retroviral LTR and
packaging sequences is introduced into this cell line (by calcium phosphate
precipitation for
example), the packaging sequence allows the RN,A transcript of the recombinant
plasmid to be
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
42
packaged into viral particles, which are then secreted into the culture media
(Nicolas and
Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The media containing the
recombinant
retroviruses is then collected, optionally concentrated, and used for gene
transfer. Retroviral
vectors are able to infect a broad variety of cell types. However, integration
and stable
S expression require the division of host cells (Paskind et al., 1975).
Concern with the use of defective retrovirus vectors is the potential
appearance of wild-
type replication-competent virus in the packaging cells. This can result from
recombination
events in which the intact sequence from the recombinant virus inserts
upstream from the gag,
pol, env sequence integrated in the host cell genome. However, new packaging
cell lines are
now available that should greatly decrease the likelihood of recombination
(Markowitz et al.,
1988; Hersdorffer et al., 1990).
4. Other viral vectors
Other viral vectors may be employed as expression constructs in the present
invention.
Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal
and Sugden,
1986; Coupar et al., 1988), sindbis virus and herpesviruses may be employed.
They offer several
attractive features for various mammalian cells (Friedmann, 1989; Ridgeway,
1988; Baichwal
and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).
With the recent recognition of defective hepatitis B viruses, new insight was
gained into
the structure-function relationship of different viral sequences. In vitro
studies showed that the
virus could retain the ability for helper-dependent packaging and reverse
transcription despite the
deletion of up to 80% of its genome (Horwich et al. , 1990). This suggested
that large portions of
the genome could be replaced with foreign genetic material. Chang et al.
recently introduced the
chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus
genome in the place of
the polymerase, surface, and pre-surface coding sequences. It was
cotransfected with wild-type
virus into an avian hepatoma cell line. Culture media containing high titers
of the recombinant
virus were used to infect primary duckling hepatocytes. Stable CAT gene
expression was
detected for at least 24 days after transfection (Chang et al., 1991 ).
CA 02275438 1999-06-09
WO 98/22605 PCT/ITS97/21475
43
5. Modified Viruses
In still further embodiments of the present invention, the nucleic acids to be
delivered are
housed within an infective virus that has been engineered to express a
specific binding ligand.
The virus particle will thus bind specifically to the; cognate receptors of
the target cell and deliver
S the contents to the cell. A novel approach designed to allow specific
targeting of retrovirus
vectors was recently developed based on the chemical modification of a
retrovirus by the
chemical addition of lactose residues to the viral envelope. This modification
can permit the
specific infection of hepatocytes via sialoglycoprotein receptors.
Another approach to targeting of recombinant retroviruses was designed in
which
biotinylated antibodies against a retroviral envelope protein and against a
specific cell receptor
were used. The antibodies were coupled via the biotin components by using
streptavidin (Roux
et al., 1989). Using antibodies against major histocompatibility complex class
I and class II
antigens, they demonstrated the infection of a variety of human cells that
bore those surface
antigens with an ecotropic virus in vitro (Roux et .al., 1989).
C. Other types of DNA delivery to cells
In certain aspects of the present invention, certain nucleic acid constructs
need to be
administered to cells prior to transduction. In these aspects, delivery of the
constructs using viral
vectors may be inappropriate. Therefore, several :non-viral methods for the
transfer of expression
constructs into cells also are contemplated by the: present invention. In one
embodiment of the
present invention, the expression construct may consist only of naked
recombinant DNA or
plasmids. Transfer of the construct may be performed by any of the methods
mentioned which
physically or chemically permeabilize the cell membrane.
In certain embodiments of the present invention, the expression construct may
be
entrapped in a liposome. Liposomes are vesicular structures characterized by a
phospholipid
bilayer membrane and an inner aqueous medium. Multilamellar liposomes have
multiple lipid
layers separated by aqueous medium. They form spontaneously when phospholipids
are
suspended in an excess of aqueous solution. The lipid components undergo self
rearrangement
before the formation of closed structures and entrap water and dissolved
solutes between the lipid
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
44
bilayers (Ghosh and Bachhawat, 1991 ). Also contemplated is an expression
construct
complexed with Lipofectamine (Gibco BRL).
In certain embodiments of the invention, the liposome may be complexed with a
S hemagglutinating virus (HVJ). This has been shown to facilitate fusion with
the cell membrane
and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989). In
other
embodiments, the liposome may be complexed or employed in conjunction with
nuclear non-
histone chromosomal proteins (HMG-1) (Kato et al., 1991). In yet further
embodiments, the
liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
In other embodiments of the present invention, the expression construct is
introduced into
the cell via electroporation. Electroporation involves the exposure of a
suspension of cells and
DNA to a high-voltage electric discharge.
In other methods of DNA delivery contemplated in the present invention, the
expression
construct is introduced to the cells using calcium phosphate precipitation. In
another
embodiment, the expression construct is delivered into the cell using DEAE-
dextran followed by
polyethylene glycol.
Another embodiment of the invention for transferring a naked DNA expression
construct
into cells may involve particle bombardment. This method depends on the
ability to accelerate
DNA-coated microprojectiles to a high velocity allowing them to pierce cell
membranes and
enter cells without killing them (Klein et al. , 1987). Further embodiments of
the present
invention include the introduction of the expression construct by direct
microinjection or
sonication loading.
In still other aspects of the present invention, the expression construct is
introduced into
the cell using adenovirus assisted transfection. Increased transfection
efficiencies have been
reported in cell systems using adenovirus coupled systems (Kelleher and Vos,
1994; Cotten
et al., 1992; Curiel, 1994). Still further expression constructs that may be
employed to deliver
the construct to the target cells are receptor-mediated delivery vehicles.
These take advantage of
the selective uptake of macromolecules by receptor-mediated endocytosis that
will be occurring
CA 02275438 1999-06-09
WO 98/22605 PCT/US97121475
in the target cells. In other embodiments, the DN,4 delivery vehicle component
of a cell-specific
gene targeting vehicle may comprise a specific binding ligand in combination
with a liposome.
The nucleic acids to be delivered are housed within the liposome and the
specific binding ligand
is functionally incorporated into the iiposome membrane.
5
In still further embodiments, the DNA delivery vehicle component of the
targeted
delivery vehicles may be a liposome itself, which will preferably comprise one
or more lipids or
glycoproteins that direct cell-specific binding.
10 III. Cell Types
The present invention discloses improved methods for treatment of genetically-
based
diseases (Section IV below), through more efficient transduction of
therapeutic genes in target
cells. Therefore, all cell types which can be targeted by gene therapy are
contemplated for use in
15 the present invention. Additional aspects of the p~°esent invention
concern the in vitro production
of proteins (Section IX below). Different cell types may be required,
depending on the particular
protein being produced, the method of in vitro production, and the scale of
production.
Exemplary, but not limiting, cell types contemplated for use in the present
invention are
discussed in more detail below.
A. Tumor Infiltrating Lymphocytes
Tumor infiltrating lymphocytes are contemplated for use in the present
invention,
particularly in methods associated with the treatment of tumors. Tumor
infiltrating lymphocytes
(TIL) are lymphoid cells that infiltrate solid tumors. TILs are identified by
immunohistochemical detection of CD3 or CD4/CD8 in tumor sections. TIL can be
isolated
from neoplasms by enzymatic dissociation, and then cultured in vitro with
interleukin-2 (IL-2).
IL-2 stimulates the division of lymphoid cells, aJld, thus, the number of TILs
can be expanded
significantly (Topalian, 1995).
In some cases, TILs in tumors have been primed by tumor-associated antigens,
such as
breast and colon carcinomas (Vose and White, 1983), ovarian cancer (Ioannides
et al., 1991 ) and
melanoma (Topalian et al., 1989). In culture, TILs have been shown to mediate
specific
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
46
cytotoxicity against cancer cells (Topalian, 1995). The adoptive transfer of
TIL by intravenous
administration into mice (Topalian, 1995) or humans (Rosenberg, 1995) results
in T1L homing to
some cancer metastases.
TILs have also been transfected in vitro with TNF-oc genes. These genetically
modified
TILs also home to specific tumor sites (Rosenberg, 1995). In certain
particular aspects of the
present invention, TILs are transduced in vitro with a viral vector comprising
an elastase gene
and a GM-CSF gene, and administered to a cancer patient to produce angiostatin
at tumor sites.
B. Macrophages
One of the cell types contemplated for use in the present invention is
macrophages.
Macrophages are specialized white blood cells which are descendent from a
progenitor cell
called the granulocyte/macrophage progenitor cell. Macrophages are involved in
host defense by
eliminating invading microorganisms through phagocytosis. Foreign particle
recognition occurs
through the binding of antibodies which react with the surface of the particle
and are recognized
by the Fc receptors on the surface of macrophages. Macrophages also scavenge
senescent and
damaged host cells. Macrophages play an essential role in homeostasis by
participating in
wound healing, chronic inflammatory reactions, tissue remodeling, and host
defense against
neoplasms (Fidler, 1985, 1994). In addition, macrophages are known to
infiltrate certain types of
tumors.
During many of these processes, macrophages degrade extracellular matrix
proteins via
secretion of matrix metalloproteinases (MMPs) that include interstitial
collagenase, stromelysin,
type IV collagenases (MMP-2 and MMP-9), and elastase (Belaaouaj et al., 1995;
Shapiro et al.,
1993b; Xie et al., 1994). Although the MMPs share certain biochemical
properties, each has a
distinct substrate specificity (Matrisian, 1992). Which of these enzymes the
macrophage
produces depends on its level of differentiation and on tight regulation by
many physiologic,
pathologic, and pharmacological stimuli (Welgus et al., 1985; Busiek et al.,
1992; Lacraz et al.,
1992; Xie et al. , 1994).
The elastases can be divided into serine proteinases, which include pancreatic
elastase
(Shotton and Hartley, 1970) and neutrophil elastase (Ohlsson and Olsson,
1974), and the
CA 02275438 1999-06-09
WO 98!22605 PCT/US97/21475
47
metalloelastase (MME) secreted by macrophages (White et al., 1977). The
substrates for
elastase include type I V collagen, immunoglobul.in, some glycoproteins such
as a 1-proteinase
inhibitor, and elastin, but not gelatin (Banda et al., 1980, 1983; Banda and
Werb, 1981; Werb
and Gordon, 1975). The genes coding for both human and murine MME have
recently been
cloned and characterized (Shapiro et al., 1992, :1993a). MME is essential for
penetration of
basement membranes and tissue invasion by macrophages (Shipley et al., 1996a,
b), which can
occupy up to 60% of the tumor mass (Bucana et al. , 1992; Mantovani et al. ,
1992; Normann,
1985; Whitworth et al., 1990). Since angiostatin can be generated from
plasminogen by
pancreatic elastase in vitro, (O'Reilly et al. , 1994), the inventors reasoned
that tumor-infiltrating
macrophages could be induced to express MME, which in turn would generate
angiostatin
in vivo. This is shown to be the case in the instant disclosure (Examples 10
and 11 below).
C. Bone Marrow Macrophages
Particularly preferred for use in the present invention are bone marrow
macrophages.
1 S Bone marrow macrophages are collected from aspirates, and grown in
suspension cultures to
derive a large number of cells which can be transduced using the methods of
the instant
invention. These cells can then be administered. to a patient and home to
cancer metastases,
whereupon they can produce angiostatin.
D. Bone Marrow Celts
Another type of cells contemplated for use in the present invention are bone
marrow
cells. Bone marrow cells can be readily collected from patients and grown in
culture.
Transduction of these cells in vitro with viral and non-viral vectors has been
described, albeit at
low efficiencies (Deisseroth, 1993; Deisseroth et al., 1994; Hanania and
Deisseroth, 1994).
Using the methods disclosed herein, bone marrow cells can be efficiently
transduced with a
selected gene or genes, and the genetically modified cells can then be
injected directly into
tumors or into the circulation.
E. Tumor Cells
Another particular type of cells for use in the present invention are tumor
cells.
Replicating tumor cells or tumor cells that do not have invasive or metastatic
potential can be
used in the present invention. For example, and not limitation, tumor cells
transduced to produce
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
48
GM-CSF can be lethally X-irradiated, and reintroduced into a tumor. These
cells will not divide,
yet will remain metabolically active for several days. Noninvasive-
nonmetastatic tumor cells
will only grow at the local site. Cells transduced with the GM-CSF gene will
recruit and activate
macrophages to produce angiostatin.
F. Endothelial Cells
Also contemplated for use in the present invention are endothelial cells.
Endothelial cells
line all blood vessels and lymphatics. Endothelial cells are the key cellular
component of all
blood vessels, and are stimulated to produce new blood vessels in wound
healing, tissue repair
and regeneration and in neoplasms, i.e., the process of angiogenesis.
G. Epithelial Cells
Another particular type of cells for use in the present invention are
epithelial cells.
Epithelial cells are found throughout the body, including the skin, the
linings of the oral cavity,
the digestive tract, the urogenital system and the respiratory tract.
Epithelial cells can be readily
cultivated in culture, and serve as recipients for transduction.
H. Fibroblasts
Fibroblasts are the supporting structural cells of every organ in the body.
Skin fibrobiasts
can be readily cultivated in culture and can thus be transduced by the methods
of the present
invention with a variety of genes (Section VI below).
IV. Diseases
There are a number of diseases which are genetically-based, and therefore
amenable to
treatment by the improved methods and compositions for gene therapy disclosed
in the present
invention. These include, but are not limited to, cancer, angiogenesis related
diseases, viral
infections, including AIDS, and diseases caused by a missing or malfuctioning
gene, such as
ADA deficiency and cystic fibrosis.
CA 02275438 1999-06-09
WO 98122605 PCT/US97/21475
49
A. Cancer
Treatments for cancer are disclosed in the present invention. Since all
neoplasms require
an adequate blood supply for growth (angiogenesis), all neoplasms are amenable
to
antiangiogenic therapy, in particular, the GM-CSF stimulated elastase mediated
production of
angiostatin. This therapy can be directed against primary neoplasms and
disseminated cancer
metastases located in different body organs, e.~;., lung, liver, bone and
brain. Exemplary
neoplasms are prostate, breast, melanoma, colon, F~ancreas and lung.
In a particular embodiment of the present invention, bone marrow macrophages
are
isolated from aspirates, and grown in suspension cultures. A transducing
composition
comprising a gene encoding GM-CSF and a ~3-inte.rferon inhibitory factor is
then administered to
the macrophage culture. The transduced macrophages are then administered ex
vivo to a patient
in need of cancer therapy by any of the routes described herein, but
preferably intravenously or
intratumorally. The macrophages then naturally home to the sites of tumors,
both primary and
metastatic, whereupon the transduced GM-CSF gene induces the production of
MME. The
MME is secreted from the macrophages, and converts endogenous plasminogen to
angiostatin at
the tumor site, thus preventing tumor growth by blocking the formation of new
blood vessels.
In other aspects of the present invention, treatment of cancer using gene
therapy may be
combined with more conventional therapies, such ;~s chemotherapy (Section VIII
below).
B. Angiogenesis Related Diseases
Treatments for other angiogenesis related diseases are also contemplated in
the present
invention. Inhibition of excessive blood vessel formation is useful for
treatment of angiogenic
diseases, such as collateral blood vessels, vascular restenosis, ocular
neovascularization, infantile
hemangioma, diabetic retinopathy, arthritis, psoriasis, endometriosis,
duodenal ulcers (Folkman
and Shing, 1992; Folkman, 1995) and pulmonary hypertension (Tuder et al.,
1994).
C. Other Diseases Treated by Gene ~Cherapy
Since the methods described in the present invention can increase transduction
efficiency,
any disease which can be treated by gene therapy is contemplated for treatment
by the methods
of the present invention. Examples of these diseases are vascular
proliferative diseases
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
(Gunman, 1994; Chang et al., 1995), hemophilia (Kay et al., 1994; Fang et al.,
1995), a,l-
antitrypsin deficiency (Rosenfeld et al., 1991 ), ornithine transcarbamoylase
deficiency
(Stratford-Perricaudet et al., 1991), muscle degeneration diseases (Stratford-
Perricaudet et al.,
1992), cystic fibrosis (Rosenfeid et al., 1992; Knowles et al., 1995),
familial
5 hypercholesterolemia (reviewed by Crystal, 1995), ADA deficiency (Anderson,
1984), anemias
and chronic infections.
V. Promoters and Enhancers
10 In certain aspects of the present invention, vectors which are designed for
the expression
of a desired gene or genes are required. Thus, particular embodiments may
require a selected
nucleic acid segment, for example, antisense constructs (Section I, B), viral
constructs (Section
II, B) and heterologous genes to be expressed in host cells (Section VI) to be
operatively
positioned relative to control sequences, such as promoters and enhancers.
Below are a list of
15 viral promoters, cellular promoterslenhancers and inducible
promoters/enhancers that could be
used in combination with the present invention. Additionally any
promoter/enhancer
combination (as per the Eukaryotic Promoter Data Base, EPDB) could also be
used to drive
expression of exemplary structural genes encoding (3-interferon or (3-
interferon related proteins
such as IRF-1, elastase, GM-CSF, selectable marker proteins or a heterologous
protein of interest
20 (Section VI below).
TABLE 1
ENHANCER REFERENCES
Immunoglobulin Heavy ChainBanerji et al., 1983; Gilles et al.,
1983; Grosschedl
and Baltimore, 1985; Atchinson and
Perry, 1986,
1987; Imler et al., 1987; Weinberger
et al., 1984;
Kiledjian et al., 1988; Porton et al.;
1990
Immunoglobulin Light ChainQueen and Baltimore, 1983; Picard and
Schaffner,
1984
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
51
Table 1 (Continued)
ENHANCER REFERENCES
T-Cell Receptor Luria et al., 1987; Winoto and Baltimore,
1989;
Redondo et al. ; 1990
HLA DQ a and DQ (3 Sullivan and :Peterlin, 1987
(3-Interferon Goodbourn et al., 1986; Fujita et
al., 1987;
Goodbourn and Maniatis, 1988
Interleukin-2 Greene et al., 1989
Interleukin-2 Receptor Greene et al., 1989; Lin et al., 1990
MHC Class II 5 Koch et al., 1989
MHC Class II HLA-DRa Sherman et al., 1989
~i-Actin Kawamoto et al., 1988; Ng et al.;
1989
Muscle Creatine Kinase Jaynes et al., 1988; Horlick and Benfield,
1989;
Johnson et al., 1989a I
Prealbumin (Transthyretin)Costa et al., 1988
Elastase I Omitz et al., '1987
Metallothionein Karin et al., 1987; Culotta and Hamer,
1989
Collagenase Pinkert et al., 1987; Angel et al.,
1987
Albumin Gene Pinkert et al., 1987; Tronche et al.,
1989, 1990
oc-Fetoprotein Godbout et al'., 1988; Campere and
Tilghman, 1989
t-Globin Bodine and Ley, 1987; Perez-Stable
and Constantini,
1990
~i-Globin Trudel and Constantini, 1987
e-fos Cohen et al., 1987
c-HA-ras Triesman, 1986; Deschamps et al.,
~ 1985
' Insulin Edlund et al., 1985
Neural Cell Adhesion MoleculeHirsh et al., 1990
(NCAM)
al-Antitrypain Latimer et al., 1990
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
52
Table 1 (Continued)
ENHANCER REFERENCES
H2B (TH2B) Histone Hwang et al., 1990
Mouse or Type I Collagen Ripe et al., 1989
Glucose-Regulated ProteinsChang et al., 1989
(GRP94 and GRP78)
Rat Growth Hormone Larsen et al., 1986
Human Serum Amyloid A Edbrooke et al., 1989
(SAA)
Troponin I (TN I) Yutzey et al., 1989
Platelet-Derived Growth Pech et al., 1989
Factor
Duchenne Muscular DystrophyKlamut et al., 1990
SV40 Banerji et al., 1981; Moreau et al.,
1981; Sleigh and
Lockett, 1985; Firak and Subramanian,
1986; Herr
and Clarke, 1986; Imbra and Karin,
1986; Kadesch
and Berg, 1986; Wang and Calame, 1986;
Ondek
et al., 1987; Kuhl et al., 1987; Schaffner
et al., 1988
Polyoma Swartzendruber and Lehman, 1975; Vasseur
et al.,
1980; Katinka et al., 1980, 1981; Tyndell
et al.,
1981; Dandolo et al., 1983; de Villiers
et al., 1984;
Hen et al., 1986; Satake et al., 1988;
Campbell and
Villarreal, 1988
Retroviruses Kriegler and Botchan, 1982, 1983; Levinson
et al.,
1982; Kriegler et al., 1983, 1984a,
b, 1988; Bosze
et al., 1986; Miksicek et al., 1986;
Celander and
Haseltine, 1987; Thiesen et al., 1988;
Celander
et al., 1988; Choi et al., 1988; Reisman
and Rotter,
1989
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
53
Table 1 (Continued)
ENHANCER REFERENCES
Papilloma Virus Campo et al., 1983; Lusky et al., 1983;
Spandidos
I and Wilkie, 1983; Spalholz et al.,
1985; Lusky and
Botchan, 1986; Cripe et al., 1987;
Gloss et al., 1987;
Hirochika et ~xl., 1987; Stephens and
Hentschel,
1987; Glue et al., 1988
Hepatitis B Virus Bulla and Siddiqui, 1986; Jameel and
Siddiqui,
1986; Shaul zu~d Ben-Levy, 1987; Spandau
and Lee,
1988; Vannice and Levinson, 1988
Human Immunodef ciency Muesing et a!., 1987; Hauber and Cullan,
Virus 1988;
Jakobovits et al., 1988; Feng and Holland,
1988;
Takebe et al.. 1988; Rosen et al.,
~i 1988; Berkhout
et al., 1989; I,aspia et al., 1989;
Sharp and
Marciniak, 1 ~>89; Braddock et al.,
1989
Cytomegalovirus Weber et al., 1984; Boshart et al.,
1985; Foecking
and Hofstetter, 1986
Gibbon Ape Leukemia VirusHolbrook et crl., 1987; Quinn et al.,
1989
TABLE 2
Element Inducer References
MT II Phorbol Ester (TFA,) Palmiter et al., 1982;
Heavy metals Haslinger and Karin,
1985;
Searie et al., 1985;
Stuart
et al., 1985; Imagawa
et al.,
1987, Karin et al.,
1987;
Angel et al., 1987b;
McNeall et al., 1989
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
54
Table 2 (Continued)
Element Inducer References
MMTV (mouse mammary Glucocorticoids Huang et al., 1981;
tumor virus) Lee
et al. , 1981; Majors
and
Varmus, 1983; Chandler
et al., 1983; Lee
et al.,
1984; Ponta et al.,
1985;
Sakai et al., 1988
(3-Interferon poly(rI)x Tavernier et al.,
poly(rc) 1983
Adenovirus 5 E2 Ela Imperiale and
N evins, 1984
Collagenase Phorbol Ester (TPA) Angel et al., 1987a
Stromelysin Phorbol Ester (TPA) Angel et al., 1987b
SV40 Phorbol Ester (TPA) Angel et al., 1987b
Murine MX Gene Interferon, Newcastle
Disease Virus
GRP78 Gene A23187 Resendez et al., 1988
a,-2-Macroglobulin IL-6 Kunz et al., 1989
Vimentin Serum Rittling et al., 1989
MHC Class I Gene H-2KbInterferon Blanar et al., 1989
HSP70 Ela, SV40 Large T Taylor et al., 1989;
Antigen Taylor
and Kingston, 1990a,
b
Proliferin Phorbol Ester-TPA Mordacq and Linzer,
1989
Tumor Necrosis FactorFMA Hensel et al., 1989
Thyroid Stimulating Thyroid Hormone Chatterjee et al.,
Hormone a Gene 1989
VI. Genes
A number of different genes are contemplated for use in the present invention.
Among
these are genes useful in treating diseases such as cancer, other angiogenesis
related diseases, and
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
SS
additional diseases which can be treated by gene therapy (Section IV above).
Additionally,
marker genes used in the identification of recombinant cells are contemplated
for use, as are
genes encoding proteins to be produced by cells ir,! vitro.
A. GM-CSF
GM-CSF is a glycoprotein which stimulates the production of granulocytes and
macrophages from the common granulocyte/macrophage progenitor cells. Due to
the varying
degree of glycosylation, the molecular weight has been reported to be between
14.5 and 35 kDa.
The protein consists of a single polypeptide chain of 127 amino acids. GM-CSF
has been cloned
and sequenced from human (GenBank accession. number M 11220), gibbon, mouse
(GenBank
accession number X03019), cattle and sheep, as vvell as a partial sequence
from rat. The details
of the post receptor signal transduction pathway modulated by GM-CSF are
largely unknown.
While GM-CSF treatment leads to the phosphorylation of tyrosine residues on a
number of
different proteins, the GM-CSF receptor has no kinase domain or any known
signaling
sequences.
I n certain aspects of the present invention, the GM-C S F gene is introduced
into
macrophages to stimulate MME expression, and thereby the production of
angiostatin. In other
embodiments, the GM-CSF gene is used to direcvt the production of GM-CSF in
vitro, which is
then used for systemic administration to stimulate MME production in
macrophages which have
infiltrated tumors.
B. Elastase
The elastases can be divided into serine proteinases and metalloproteinases.
The serine
proteinases include pancreatic elastase (Shotton and Hartley, 1970) and
neutrophil elastase
(Ohlsson and Olsson, 1974), and the metalloprotE;inases include the
metalloelastase secreted by
macrophages (MME; White et al., 1977). Metalloproteinases are involved in such
functions as
tissue remodeling, wound repair and embryonic development.
The macrophage related metalloelastase (MME) from mouse and human (GenBank
accession number M82831 ) have been isolated and sequenced. In certain
embodiments of the
present invention, the MME gene is transduced, either alone or in combination
with the GM-CSF
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
56
gene, into cells which are then administered to a tumor, to effect the in vivo
production of
angiostatin.
C. (3-interferon
(3-interferon (IFN-Vii) is low molecular weight protein that is produced by
many cell types,
including epithelial cells, fibroblasts and macrophages (Sen and Lengyel,
1992). Cells that express
endogenous IFN-(3 are resistant to viral infection and replication. The (3-
interferon genes from
mouse (GenBank accession numbers X 14455, X 14029) and human (GenBank
accession numbers
J00218, K00616 and M 11029) have been isolated and sequenced.
In particular embodiments of the present invention, the gene for ~i-interferon
is used in an
antisense construct, which is administeredto target cells to reduce the
endogenous expression of (3-
interferon, thereby effecting increased transduction efficiency.
D. IRF-1 and IRF-2
Two genes which are involved in the regulation of (3-interferon are termed
interferon
regulatory factor-I (IRF-I) and interferon regulatory factor-2 (IRF-2). IRF-1
is a positive control
factor which binds to regulatory motifs present in the upstream region of
interferon genes
(Miyamoto et al., 1988). IRF-1 has been cloned from mouse (GenBank accession
numbers
M21065, M25560 and J03160) and human (GenBank accession number X 14454). IRF-2
is an
antagonistic repressor of ~3-interferon expression (Harada et al. , 1989). IRF-
2 has been cloned
from mouse (GenBank accession number J03168) and human (GenBank accession
number
X15949).
In certain aspects of the present invention, the gene for IRF-1 is comprised
within an
antisense construct and administered to a cell targeted for transduction,
thereby reducing the
endogenous expression of (3-interferon and effecting efficient transduction of
the target cell. In
other aspects, the gene for IRF-2 is subcloned into an expression vector which
is administered to
cells targeted for transduction, thereby reducing the endogenous expression of
(3-interferon and
effecting efficient transduction of the target cell.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
57
E. Heterologous Genes
The present invention discloses methods for the efficient transduction of
cells with a
selected heterologous gene. The heterologous genes can be used, for example,
in therapeutic
applications, or for the in vitro production of a desired protein. Below is a
list of selected cloned
structural genes that could be used in the present invention. The list is not
in any way meant to
be interpreted as limiting, only as exemplary of ohe types of structural genes
contemplated for
use in the present invention.
TABLE 3
Selected Cloned
Structural Genes
Gene Clone Type* Reference
activin porcine-cDNA Mason AJ, Nat, 318:659, 1985
adenosine deaminaseh-cDNA Wiginton DA, PNAS, 80:7481,
1983
angiotensinogen r-cDNA Ohkubo H, PNAS, 80:2196,
I 1983
r-gDNA Tanaka T, JBC, 259:8063,
1984
antithrombin III H-cDNA Bock SC, NAR 10:8113, 1982
h-cDNA and gDNA Prochownik EV, JBC, 258:8389,
1983
antitrypsin, alphah-cDNA Karachi K, PNAS, 78:6826,
I 1981
h-gDNA Leicht M, Nat, 297:655, 1982
RFLP Cox DW, AJHG, 36:1345, 1984
apolipoprotein h-cDNA, h-gDNA Shoulders CC, NAR, 10:4873,
A-I 1982
RFLP Karathanasis SK, Nat, 301:718,
1983
h-gDNA Kranthanasis SK, PNAS, 80:6147,
1983
apolipoprotein h-cDNA Sharpe CR, NAR, 12:3917,
A-II 1984
Chr Sakaguchi, AY, AJHB, 36:2075,
1984
h-cDNA Knott TJ, BBRC, 120:734,
1984
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
58
Table 3 (Continued)
Selected Cloned
Structural Genes
Gene Clone Type* Reference
apolipoprotein h-cDNA Knott TJ, NAR, 12:3909, 1984
C-I
apolipoprotein h-cDNA Jackson CL, PNAS, 81:2945,
C-II 1984
h-cDNA Mykelbost O, JBC, 249:4401,
1984
h-cDNA Fojo SS, PNAS, 81:6354, 1984
RFLP Humphries SE, C Gen, 26:389,
1984
apolipoprotein h-cDNA and gDNA Karanthanasis SK, Nat, 304:371,
C-III 1983
h-cDNA Sharpe CR, NAR, 12:3917,
1984
apolipoprotein h-cDNA Brewslow JL, JBC, 257:14639,
E 1982
atrial natriuretich-cDNA Oikawa S, Nat, 309:724, 1984
factor
h-cDNA Nakayama K, Nat, 310:699,
1984
h-cDNA Zivin RA, PNAS, 81:6325,
1984
h-gDNA Seidman CE, Sci, 226:1206,
1984
h-gDNA Nemer M, Nat, 312:654, 1984
h-gDNA Greenberg BI, Nat, 312:665,
1984
chorionic h-cDNA Fiddes JC, Nat, 281:351,
1981
gonadotropin,
alpha chain RFLP Boethby M, JBC, 256:5121,
1981
chorionic h-cDNA Fiddes JC, Nat, 286:684,
1980
gonadotropin,
beta chain h-gDNA Boorstein WR, Nat, 300:419,
1982
h-gDNA Talmadge K, Nat, 307:37,
1984
chymosin, pro (rennin)bovine-cDNA Harris TJR, NAR, 10:2177,
1982
complement, factorh-cDNA Woods DE, PNAS, 79:5661,
B 1982
h-cDNA and gDNA Duncan R, PNAS, 80:4464,
1983
complement C2 h-cDNA Bentley DR, PNAS, 81:1212,
1984
h-gDNA (C2, C4, Carroll MC, Nat, 307:237,
and 1984
B)
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
59
Table 3 (Continued)
Selected Cloned
Structural Genes
Gene Clone Type* Reference I
complement C3 m-cDNA Domdey H, PNAS, 79:7619,
h-gDNA 1983
Whitehead AS, PNAS, 79:5021,
1982 ~~
complement C4 h-cDNA and gDNA Carroll MC, PNAS, 80:264,
h-cDNA 1983
Whitehead AS, PNAS, 80:5387,
1983
complement C9 h-cDNA DiScipio RC, PNAS, 81:7298,
1984
corticotropin releasingsheep-cDNA Furutani Y, Nat, 301:537,
factor h-gDNA 1983
Shibahara S, EMBO J, 2:775,
1983
epidermal growth m-cDNA Gray A, Nat, 303:722, 1983
factor m-cDNA Scott J, Sci, 21:236, 1983
h-gDNA Brissenden JE, Nat, 310:781,
1984
epidermal growth h-cDNA and Chr Lan CR, Sci, 224:843, 1984
factor
receptor,oncogene
c-erb B
epoxide dehydrataser-cDNA ~Gonzlalez FJ, JBC, 256:4697,
1981
erythropoietin h-cDNA Lee-Huang S, PNAS, 81:2708,
1984
esterase inhibitor,h-cDNA 'Stanley KK, EMBO J, 3:1429,
Cl 1984
-
factor VIII h-cDNA and gDNA Gitschier J, Nat, 312:326,
h-cDNA 1984
'Toole JJ, Nat, 312:342,
1984
factor IX, Christmash-cDNA Kutachi K, PNAS, 79:6461,
factor h-cDNA 1982
RFLP Choo KH, Nat, 299:178, 1982
h-gDNA Camerino G, PNAS, 81:498,
1984
.Elnson DS, EMBO J, 3:1053,
1984
factor X h-cDNA :Leytus SP, PNAS, 81:3699,
1984
fibrinogen A alpha,h-cDNA ;Kant JA, PNAS, 80:3953,
1983
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
Table 3 (Continued)
Selected Cloned
Structural Genes
Gene Clone Type* Reference
B beta, gamma h-gDNA (gamma) Fornace AJ, Sci, 224:161,
1984
h-cDNA (alpha Imam AMA, NAR, I 1:7427,
1983
gamma) Fornace AJ, JBC, 259:12826,
1984
h-gDNA (gamma)
gastrin releasing h-cDNA Spindel ER, PNAS, 81:5699,
1984
peptide
glucagon, prepro hamster c-DNA Bell GI, Nat, 302:716, 1983
h-gDNA Bell GI, Nat, 304:368, 1983
growth hormone h-cDNA Martial JA, Sci, 205:602,
1979
h-gDNA DeNoto FM, NAR, 9:3719, 1981
GH-like gene Owerbach, D, Sci, 209:289,
1980
growth hormone, h-cDNA Gubler V, PNAS, 80:341 I,
RF, 1983
somatocrinin h-cDNA Mayo KE, Nat, 306:86:1983
hemopexin h-cDNA Stanley KK, EMBO J, 3:1429,
1984
inhibin porcine-cDNA Mason AJ, Nat, 318:659, 1985
insulin, prepro h-gDNA Ullrich a, Sci, 209:612,
1980
insulin-like growthh-cDNA Jansen M, Nat, 306:609, 1983
factor I h-cDNA Bell GI, Nat, 310:775, 1984
Chr Brissenden JE, Nat, 310:781,
1984
insulin-like growthh-cDNA Bell GI, Nat, 310:775, 1984
factor II h-gDNA Dull TJ, Nat, 310:777, 1984
Chr Brissenden JE, Nat, 310:781,
1984
interferon, alpha h-cDNA Maeda S, PNAS, 77:7010, 1980
(leukocyte), multipleh-cDNA (8 distinct)Goeddel DV, nat, 290:20,
1981
I h-gDNA Lawn RM, PNAS, 78:5435, 1981
h-gDNA Todokoro K, EMBO J, 3:1809,
1984
h-gDNA Torczynski RM, PNAS, 81:6451,
1984
CA 02275438 1999-06-09
WO 98/22605 PCT/(TS97/21475
61
Table 3 (Continued)
Selected Cloned
Structural Genes
Gene Clone Type* Reference
interferon, beta h-cDNA Taniguchi T, Gene, 10:1 l,
(fibroblast) h-gDNA 1980
h-gDNA (related) Lawn RM, NAR, 9:1045, 1981
h-gDNA (related) Sehgal P, PNAS, 80:3632,
1983
Sagar AD, Sci, 223:1312,
1984
interferon, gamma h-cDNA Gray PW, Nat, 295:503, 1982
(immune) h-gDNA Gray PW, Nat, 298:859, 1982
interleukin-1 m-cDNA Lomedico PT, Nat, 312:458,
1984
interleukin-2, h-cDNA Devos R, NAR, 11:4307, 1983
T-cell
growth factor h-cDNA Taniguchi T, Nat, 302:305,
h-gDNA 1983
Chr Hollbrook NJ, PNAS, 81:1634,
1984
Siegel LF, Sci, 223:175,
1984
interleukin-3 m-cDNA Fung MC, Nat, 307:233, 1984
kininogen, two bovine-cDNA Nawa H, PNAS, 80:90, 1983
forms bovine,-cDNA and Kitamura N, Nat, 305:545,
gDNA 1983
leuteinizing hormone,h-gDNA and Chr Talmadge K, Nat, 207:37,
beta subunit 1984
leuteinizing hormoneh-cDNA and gDNA Seeburg PH, Nat, 311:666,
1984
releasing hormone
lymphotoxin h-cDNA and gDNA Gray PW, Nat, 312:721, 1984
mast cell growth m-cDNA Yokoya T, PNAS, 81:1070,
factor 1984
nerve growth factor,m-cDNA Scott J, Nat, 302:538, 1983
beta subunit h-gDNA Ullrich A, Nat, 303:821,
Chr 1983
Franke C, Sci, 222:1248,
1983
oncogene, c-sis, h-gDNA Dalla-Favera R, Nat, 295:31,
PGDF 1981
chain A h-cDNA Clarke MF, Nat, 208:464,
1984
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
62
Table 3 (Continued)
Selected Cloned
Structural Genes
Gene Clone Type* Reference
pancreatic polypeptideh-cDNA Boel E, EMBO J, 3:909, 1984
and icosapeptide
parathyroid hormone,h-cDNA Hendy GN, PNAS, 78:7365,
1981
prepro h-gDNA Vasicek TJ, PNAS, 80:2127,
1983
plasminogen h-cDNA and gDNA Malinowski DP, Fed P, 42:1761,
1983
plasminogen activatorh-cDNA Edlund T, PNAS, 80:349, 1983
h-cDNA Pennica D, Nat, 301:214,
1983
h-gDNA Ny T, PNAS, 81:5355, 1984
prolactin h-cDNA Cook NE, JBC, 256:4007, 1981
r-gDNA Cooke NE, Nat, 297:603, 1982
proopiomelanocortinh-cDNA DeBold CR, Sci, 220:721,
1983
h-gDNA Cochet M, Nat, 297:335, 1982
protein C h-cDNA Foster D, PNAS, 81:4766,
1984
prothrombin bovine-cDNA MacGillivray RTA, PNAS, 77:5153,
1980
relaxin h-gDNA Hudson P, Nat, 301:628, 1983
h-cDNA (2 genes) Hudson P, EMBO J, 3:2333,
1984
Crawford, RJ, EMBO J, 3:2341,
1984
renin, prepro h-cDNA Imai T, PNAS, 80:7405, 1983
h-gDNA Hobart PM, PNAS 81:5026,
1984
h-gDNA Miyazaki H, PNAS, 81:5999,
1984
Chirgwin 3M, SCMG, 10:415,
1984
somatostatin h-cDNA Shen IP, PNAS, 79:4575, 1982
h-gDNA and Ri-IP Naylot SI, PNAS, 80:2686,
1983
tachykinin, prepro,bovine-cDNA Nawa H, Nat, 306:32, 1983
substances P & bovine-gDNA Nawa H, Nat, 312:729, 1984
K
CA 02275438 1999-06-09
WO 98/22605 PCTlUS97/21475
63
Table 3 (Continued)
Selected I~loned
Structural Genes
~
Gene Clone Type* Reference
urokinase h-cDNA Verde P, PNAS, 81:4727, 1984
vasoactive intestinalh-cDNA Itoh N, Nat, 304:547, 1983
peptide, prepro
vasopressin r-cDNA Schmale H, EMBO J, 2:763,
1983
Key to Table 3: *cDNA - complementary DNA; Chr - chromosome; gDNA - genomic
DNA;
RFLP - restriction fragment polymorphism; h - hu:man; m - mouse; r - rat
F. Oncogenes and Mutant Tumor Suppressors
In certain aspects of the present invention, antisense constructs to oncogenes
are used in
methods of treating cancer. In other aspects, transformation of target cells
is desired. Exemplary
transforming genes and constructs are listed below. These genes fall into
different functional
categories, such as those that perturb signal transduction, affect cell cycle,
alter nuclear
transcription, alter telomere structure or function, inhibit apoptosis, or
that exert pleiotropic
activities. It will be understood that the genes listed are only exemplary of
the types of
oncogenes, mutated tumor suppressors and other transforming genetic constructs
and elements
that may be used in this invention. Further transfbrming genes and constructs
will be known to
those of ordinary skill in the art.
A number of proteins have been shown to inhibit apoptosis, or programmed cell
death.
Representative of this class are bcl-2 (distinct from bcl-1, cyclin D 1;
GenBank Accession No.
M14745, X06487) and family members including Bcl-xl, Mci-1, Bak, A1, A20, and
inhibitors of
interleukin-1 (3-converting enzyme and family members. Overexpression of this
oncogene was
first discovered in T cell lymphomas. It functions as an oncogene by binding
and inactivating
bax, a protein in the apoptotic pathway.
In addition to proteins which inhibit apoptosis, a large number of proteins
have been
reported which fail to promote apoptosis. Among these are p53, retinoblastoma
gene (Rb),
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
64
Wilm's tumor ( WT 1 ), bax alpha, interleukin-1 (3-converting enzyme and
family, MEN-1 gene
{chromosome 11 q 13 ), neurofibromatosi s, type 1 (NF 1 ), cdk inhibitor p 16,
p21, colorectal cancer
gene (DCC), familial adenomatosis polyposis gene (FAP), multiple tumor
suppressor gene
(MTS-1), BRCA1, BRCA2.
S
Preferred are p53 and the retinoblastoma gene. Most forms of cancer have
reports of p53
mutations. Inactivation of p53 results in a failure to promote apoptosis. With
this failure, cancer
cells progress in tumorigenesis rather than be destined for cell death. A
short list of cancers and
mutations found in p53 is: ovarian (GenBank Accession No. 553545, 562213,
S62216); liver
(GenBank Accession No. 562711, 562713, S62714, S6771 S, 572716); gastric
(GenBank
Accession No. 563157); colon (GenBank Accession No. S63610); bladder (GenBank
Accession
No. S85568, 585570, 585691 ); lung (GenBank Accession No. 541969, S41977);
glioma
(GenBank Accession No. S85807, 585712, S85713).
1 S There are a number of known oncogenes and mutant tumor suppressors which
act by
perturbing signal transduction. Representative members of this class are
tyrosine kinases, both
cytoplasmic and membrane-associated forms, such as the Src family, JaklStats,
Ros, Neu, Fms,
Ret, Abl and Met. Other members of this class are serine/threonine kinases,
such as Mos, Raf,
protein kinase C (PKC) and PIM-1. Another family of proteins which fall into
this class are the
growth factors and receptors, such as platelet derived growth factor (PDGF),
insulin-like growth
factor (IGF-1 ), insulin receptor substrate (IRS-1 and IRS-2), the Erb family,
epidermal growth
factor (EGF), growth hormone, hepatocyte growth factor (HGF) basic fibroblast
growth factor
(bFGF), as well as the corresponding growth factor receptors. Small GTPases or
G proteins also
belong to this class, and are represented by the ras family, rab family, and
Gs-alpha. Receptor-
type tyrosine phosphatase IA-2 is also a member of this class of proteins.
Exemplary of the members contemplated for use in the present invention are
Neu, also
known as Her2, also known as erbB-2 (GenBank accession numbers M11730, X03363,
U02326
and S57296). Discovered as an oncogene in breast cancer, found also in other
forms of cancer as
well. This seems to be a member of the receptor tyrosine kinase family. Also
preferred is
hepatocyte growth factor receptor (HGFr; GenBank accession number U11813),
also known as
scatter factor receptor. This can be an example of a receptor, either
endogenously present or
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
expressed from a recombinant adenovirus, that is used to stimulate
proliferation of a target cell
population. Other particular members are insulin-like growth factor 1 receptor
(GenBank
accession number X04434 and M24599), and G'TPase Gs alpha (GenBank accession
numbers
X56009, X04409). Gs alpha is associated with pituitary tumors that secrete
growth hormone, but
5 not other neuroendocrine or endocrine tumors.
Transforming genes have also been described which affect the cell cycle.
Proteins which
belong to this class are the cyclin-dependent protean kinases (cdk), classes A-
E; and members of
the cyclin family such as cyclin D. Exemplary for use in the present invention
is cyclin D1, also
10 known as PRAD, also known as bcl-1 (GenBar.~k accession numbers M64349 and
M73554).
This is associated as an oncogene primarily with parathyroid tumors.
A number of transforming genes have been described which assert their effect
through an
alteration of nuclear transcription. This class includes the Myc family
members including c-myc,
15 N-myc, and L-myc; the Rel family members including NF-KB; c-Myb, Ap-l, fos,
and jun,
insulinoma associated cDNA (IA-1), Erbb-1, and the PAX gene family. Exemplary
for use in the
present invention is c-myc (GenBank accession numbers J00120, K01980, M23541,
V00501,
X00364.
20 A protein which has recently been implicated in cellular transformation is
telomerase.
Telomerase is involved in the assembly and maintenance of telomeres, which are
at the end of
chromosomes. It is presently unknown how telomerase functions as in
transformation.
Some transforming genes have pleiotropic effects. Among these proteins are
viral
25 proteins such as SV40 and polyoma large T antigens, SV40 temperature
sensitive large T
antigen, adenovirus E 1 A and E 1 B proteins, and papillomavirus E6 and E7
proteins. Selected
from this class is SV40 large T antigen (TAG; Ger~Bank accession number
J02400).
G. Marker genes
30 In certain aspects of the present invention, specific cells are tagged with
specific genetic
markers to provide information about the fate of the tagged cells. Therefore,
the present
invention also provides recombinant candidate screening and selection methods
which are based
CA 02275438 1999-06-09
WO 98/22605 PCTlUS97/21475
66
upon whole cell assays and which, preferably, employ a reporter gene that
confers on its
recombinant hosts a readily detectable phenotype that emerges only under
conditions where a
general DNA promoter positioned upstream of the reporter gene is functional.
Generally,
reporter genes encode a polypeptide (marker protein) not otherwise produced by
the host cell
which is detectable by analysis of the cell culture, e.g., by fluorometric,
radioisotopic or
spectrophotometric analysis of the cell culture.
In other aspects of the present invention, a genetic marker is provided which
is detectable
by standard genetic analysis techniques, such as DNA amplification by PCRT""
or hybridization
using fluorometric, radioisotopic or spectrophotometric probes.
1. Screening
Exemplary enzymes include esterases, phosphatases, proteases (tissue
plasminogen
activator or urokinase) and other enzymes capable of being detected by their
activity, as will be
known to those skilled in the art. Contemplated for use in the present
invention is green
fluorescent protein (GFP) as a marker for transgene expression (Chalfie et
al., 1994). The use of
GFP does not need exogenously added substrates, only irradiation by near UV or
blue light, and
thus has significant potential for use in monitoring gene expression in living
cells.
Other particular examples are the enzyme chloramphenicol acetyltransferase
(CAT)
which may be employed with a radiolabelled substrate, firefly and bacterial
luciferase, and the
bacterial enzymes (3-galactosidase and (3-glucuronidase. Other marker genes
within this class are
well known to those of skill in the art, and are suitable fox use in the
present invention.
2. Selection
Another class of reporter genes which confer detectable characteristics on a
host cell are
those which encode polypeptides, generally enzymes, which render their
transformants resistant
against toxins. Examples of this class of reporter genes are the neo gene
(Colberre-Garapin
et al., 1981 ) which protects host cells against toxic levels of the
antibiotic 6418, the gene
conferring streptomycin resistance (IJ. S. Patent 4,430,434), the gene
conferring hygromycin B
resistance (Santerre et al., 1984; U. S. Patents 4,727,028, 4,960,704 and
4,559,302), a gene
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
67
encoding dihydrofolate reductase, which confers resistance to methotrexate
(Alt et al., 1978), the
enzyme HPRT, along with many others well kno~m in the art (Kaufman, 1990).
VII. Pharmaceutically Acceptable Compositia~ns and Routes of Administration
The present invention discloses numerous compositions, which in certain
aspects of the
invention, are administered to animals. For example, the instant invention
discloses nucleic
acids, both DNA, such as genes encoding (3-interferon or GM-CSF, and RNA, such
as anitsense
and ribozymes, proteins such as GM-CSF, peptides such as ~i-interferon-related
kinase inhibitors,
antibodies such as anti ~i-interferon polyclonal or monoclonal antibodies,
viruses such as
adenoviruses or retroviruses and chemicals such as ~3-interferon-related
kinase inhibitors and
chemotherapeutics for use in animals.
Where clinical applications are contemplated, it will be necessary to prepare
pharmaceutical compositions of the viruses and cells in a form appropriate for
the intended
application. Generally, this will entail preparing compositions that are
essentially free of
pyrogens, as well as other impurities that could be harmful to humans or
animals.
One will generally desire to employ appropriate salts and buffers to render
viruses or cells
suitable for introduction into a patient. Aqueous compositions of the present
invention comprise
an effective amount of viruses or cells, dissolved or dispersed in a
pharmaceutically acceptable
earner or aqueous medium, and preferably encapsulated. The phrase
"pharmaceutically or
pharmacologically acceptable" refer to molecular entities and compositions
that do not produce
adverse, allergic, or other untoward reactions when administered to an animal
or a human. As
used herein, "pharmaceutically acceptable carrier" includes any and all
solvents, dispersion
media, coatings, antibacterial and antifungal agent,, isotonic and absorption
delaying agents and
the like. The use of such media and agents for pharmaceutically active
substances is well know
in the art. Except insofar as any conventional media or agent is incompatible
with the vectors or
cells of the present invention, its use in therapeutic compositions is
contemplated.
Supplementary active ingredients, such as other anti-cancer agents, can also
be incorporated into
the compositions.
CA 02275438 1999-06-09
WO 98!22605 PCT/US97/21475
68
Solutions of the active ingredients as free base or pharmacologically
acceptable salts can
be prepared in water suitably mixed with surfactant, such as
hydroxypropylcellulose.
Dispersions also can be prepared in glycerol, liquid polyethylene glycols,
mixtures thereof and in
oils. Under ordinary conditions of storage and use, these preparations contain
a preservative to
prevent growth of microorganisms. Intravenous vehicles include fluid and
nutrient repienishers.
Preservatives include antimicrobial agents, anti-oxidants, chelating agents
and inert gases. The
pH and exact concentration of the various components in the pharmaceutical are
adjusted
according to well-known parameters.
An effective amount of the viruses or cells is determined based on the
intended goal. The
term "unit dose" refers to a physically discrete unit suitable for use in a
subject, each unit
containing a predetermined quantity of the therapeutic composition calculated
to produce the
desired response in association with its administration, i. e., the
appropriate route and treatment
regimen. The quantity to be administered, both according to number of
treatments and unit dose,
depends on the subj ect to be treated, the state of the subj ect, and the
protection desired. Precise
amounts of the therapeutic composition also depend on the judgment of the
practitioner and are
peculiar to each individual.
A. Parenteral Administration
The active compounds of the present invention will often be formulated for
parenteral
administration, e. g. , formulated for inj ection via the intravenous,
intramuscular, sub-cutaneous,
or even intraperitoneal routes. The preparation of an aqueous composition that
contains a second
agents) as active ingredients will be known to those of skill in the art in
light of the present
disclosure. Typically, such compositions can be prepared as injectables,
either as liquid
solutions or suspensions; solid forms suitable for using to prepare solutions
or suspensions upon
the addition of a liquid prior to injection can also be prepared; and the
preparations can also be
emulsified.
Solutions of the active compounds as free base or pharmacologically acceptable
salts can
be prepared in water suitably mixed with a surfactant, such as
hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and
mixtures thereof
CA 02275438 1999-06-09
WO 98/22605 PCT/US97121475
69
and in oils. Under ordinary conditions of storage and use, these preparations
contain a
preservative to prevent the growth of microorganisms.
The pharmaceutical forms suitable for inje;ctable use include sterile aqueous
solutions or
dispersions; formulations including sesame oil, peanut oiI or aqueous
propylene glycol; and
sterile powders for the extemporaneous preparation of sterile injectable
solutions or dispersions.
In all cases the form must be sterile and must be fluid to the extent that
easy syringability exists.
It must be stable under the conditions of manufacture and storage and must be
preserved against
the contaminating action of microorganisms, such as bacteria and fungi.
The active compounds may be formulated into a composition in a neutral or salt
form.
Pharmaceutically acceptable salts, include the acid addition salts (formed
with the free amino
groups of the protein) and which are formed with inorganic acids such as, for
example,
hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic,
tartaric, mandelic, and
the like. Salts formed with the free carboxyl groups can also be derived from
inorganic bases
such as, for example, sodium, potassium, ammonium, calcium, or fernc
hydroxides, and such
organic bases as isopropylamine, trimethylamine, histidine, procaine and the
like.
The carrier can also be a solvent or dispersion medium containing, for
example, water,
ethanol, polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol, and the
like), suitable mixtures thereof, and vegetable oils. The proper fluidity can
be maintained, for
example, by the use of a coating, such as lecithin, by the maintenance of the
required particle size
in the case of dispersion and by the use of surfactants. The prevention of the
action of
microorganisms can be brought about by various antibacterial ad antifungal
agents, for example,
parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
many cases, it will be
preferable to include isotonic agents, for example, sugars or sodium chloride.
Prolonged
absorption of the injectable compositions can be brought about by the use in
the compositions of
agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active
compounds in the
required amount in the appropriate solvent with various of the other
ingredients enumerated
above, as required, followed by filtered sterilization. Generally, dispersions
are prepared by
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
incorporating the various sterilized active ingredients into a sterile vehicle
which contains the
basic dispersion medium and the required other ingredients from those
enumerated above. In the
case of sterile powders for the preparation of sterile injectable solutions,
the particular methods
of preparation are vacuum-drying and freeze-drying techniques which yield a
powder of the
5 active ingredient plus any additional desired ingredient from a previously
sterile-filtered solution
thereof.
For parenteral administration in an aqueous solution, for example, the
solution should be
suitably buffered if necessary and the liquid diluent first rendered isotonic
with sufficient saline
10 or glucose. These particular aqueous solutions are especially suitable for
intravenous,
intramuscular, subcutaneous and intraperitoneal administration. In this
connection, sterile
aqueous media which can be employed will be known to those of skill in the art
in light of the
present disclosure. For example, one dosage could be dissolved in 1 ml of
isotonic NaCI
solution and either added to 1000 ml of hypodermoclysis fluid or injected at
the proposed site of
15 infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th
Edition, pages 1035-
1038 and 1570-1580). Some variation in dosage will necessarily occur depending
on the
condition of the subject being treated. The person responsible for
administration will, in any
event, determine the appropriate dose for the individual subject.
20 B. Other Routes of Administration
In addition to the compounds formulated for parenteral administration, such as
intravenous or intramuscular injection, other pharmaceutically acceptable
forms include, e.g.,
tablets or other solids for oral administration; time release capsules; and
any other form currently
used, including cremes, lotions, mouthwashes, inhalants and the like.
The expression vectors and delivery vehicles of the present invention may
include classic
pharmaceutical preparations. Administration of these compositions according to
the present
invention will be via any common route so long as the target tissue is
available via that route.
This includes oral, nasal, buccal, rectal, vaginal or topical. Alternatively,
administration may be
by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or
intravenous injection.
The injection can be general, regional, local or direct injection, for
example, of a tumor. Also
contemplated is injection of a resected tumor bed, and continuous perfusion
via catheter. Such
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
71
compositions would normally be administered as pharmaceutically acceptable
compositions,
described supra.
The vectors of the present invention are advantageously administered in the
form of
injectable compositions either as liquid solutions or suspensions; solid forms
suitable for solution
in, or suspension in, liquid prior to injection also rnay be prepared. These
preparations also may
be emulsified. A typical compositions for such purposes comprises a 50 mg or
up to about 100
mg of human serum albumin per milliliter of phosphate buffered saline. Other
pharmaceutically
acceptable carriers include aqueous solutions, non-toxic excipients, including
salts, preservatives,
buffers and the like. Examples of non-aqueous solvents are propylene glycol,
polyethylene
glycol, vegetable oil and injectable organic esters, such as theyloleate.
Aqueous carriers include
water, alcoholic/aqueous solutions, saline solution;>, parenteral vehicles
such as sodium chloride,
Ringer's dextrose, etc. Intravenous vehicle:. include fluid and nutrient
replenishers.
Preservatives include antimicrobial agents, anti-oxidants, chelating agents
and inert gases. The
pH and exact concentration of the various components in the pharmaceutical are
adjusted
according to well known parameters.
Additional formulations are suitable for oral administration. Oral
formulations include
such typical excipients as, for example, pharmaceutical grades of mannitol,
lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the
like. The
compositions take the form of solutions, suspensions, tablets, pills,
capsules, sustained release
formulations or powders. When the route is topical, the form may be a cream,
ointment, salve or
spray.
An effective amount of the therapeutic agent is determined based on the
intended goal.
The term "unit dose" refers to a physically discrete unit suitable for use in
a subject, each unit
containing a predetermined quantity of the therapeutic composition calculated
to produce the
desired response in association with its administration, i.e., the appropriate
route and treatment
regimen. The quantity to be administered, both according to number of
treatments and unit dose,
depends on the subject to be treated, the state of the subject and the
protection desired. Precise
amounts of the therapeutic composition also depend on the judgment of the
practitioner and are
peculiar to each individual.
incorporating the various
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
72
In certain cases, the therapeutic formulations of the invention could also be
prepared in
forms suitable for topical administration, such as in cremes and lotions.
These forms may be
used for treating skin-associated diseases, such as various sarcomas.
Upon formulation, solutions will be administered in a manner compatible with
the dosage
formulation and in such amount as is therapeutically effective. The
formulations are easily
administered in a variety of dosage forms, such as the type of injectable
solutions described
above, with even drug release capsules and the like being employable.
C. in vitro, ex vivo) in vivo administration
As used herein, the term in vitro administration refers to manipulations
performed on
cells removed from an animal, including, but not limited to, cells in culture.
The term ex vivo
administration refers to cells which have been manipulated in vitro, and are
subsequently
administered to a living animal. The term in vivo administration includes all
manipulations
performed on cells within an animal.
In certain aspects of the present invention, the compositions may be
administered either
in vitro, ex vivo, or in vivo. In certain in vitro embodiments, macrophage
suspension cultures are
incubated with an adenoviral vector of the instant invention for 24 to 48
hours. The transduced
cells can then be used for in vitro analysis, or alternatively for in vivo
administration. In an
additional in vitro embodiment, tumor cells are plated 24 hours prior to
transduction at 10-30%
confluence. The cells are then incubated with a selected vector for 1 to 3
hours, additional
medium is added, and the cells are cultured for an additional 24 to 48 hours.
The transduced
cells are harvested by trypsinization, and can then be used either for
analysis in vitro, or for
in vivo administration.
U.S. Patents 4,690,915 and 5,199,942, both incorporated herein by reference,
disclose
methods for ex vivo manipulation of blood mononuclear cells and bone marrow
cells for use in
therapeutic applications.
CA 02275438 1999-06-09
WO 98/22605 PG"T/US97/21475
73
In vivo administration of the compositions of the present invention are also
contemplated.
Examples include, but are not limited to, transduct.ion of bladder epithelium
by administration of
the transducing compositions of the present invention through intravesicle
catheterization into
the bladder (Bass et al., 1995), and transduction of liver cells by infusion
of appropriate
transducing compositions through the portal vein via a catheter (Bao et al.,
1996). Additional
examples include direct injection of tumors with the instant transducing
compositions, and either
intranasal or intratracheal (Dong et al., 1996) instillation of transducing
compositions to effect
transduction of lung cells.
D. Viruses as Therapeutic Compositions
The engineered viruses of the present invention may be administered directly
into
animals, or alternatively administered to cells which are subsequently
administered to animals.
The viruses can be combined with various of the /3-interferon inhibiting
formulations to produce
transducing formulations with greater transduction efficiencies.
E. Cells as Therapeutic Compositions
It is proposed that engineered cells of the present invention may be
introduced into
animals, including human subjects, with certain needs, such as animals,
including human
patients, with cancer. In an exemplary, but not limiting, cancer treatment
aspect, cells
(preferably macrophages) are engineered to contain the gene encoding GM-CSF.
These cells are
then administered to a cancer patient, home to both primary and metastatic
tumors, and produce
angiostatin. However, other engineered cells will also achieve advantages in
accordance with the
invention as described herein.
VIII. Combination Therapies
In certain aspects of the present invention, the anti-cancer compositions
described above
can be formulated in combination with other cancer therapies, for example, but
not limited to,
tumor suppressor genes or other chemotherapew:ic agents. In particular
embodiments of the
present invention, the transduction of macrophages with GM-CSF to promote the
production of
angiostatin is combined with conventional cancer i:reatments such as those
detailed below.
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
74
A. Tumor Suppressor Genes
A large number of proteins have been reported which promote apoptosis. Among
these
are p53, retinoblastoma gene (Rb), Wilm's tumor (WT1), bax alpha, interleukin-
lb-converting
enzyme and family, MEN-1 gene (chromosome 11q13), neurofibromatosis, type 1
(NF1), cdk
inhibitor p 16, colorectal cancer gene (DCC), familial adenomatosis polyposis
gene (FAP),
multiple tumor suppressor gene (MTS-1), BRCA1, BRCA2.
Preferred are p53 and the retinoblastoma gene. Most forms of cancer have
reports of p53
mutations. Inactivation of p53 results in a failure to promote apoptosis. With
this failure, cancer
cells progress in tumorigenesis rather than be destined for cell death.
Providing a wild type copy
of the p53 or retinoblastoma gene will promote apoptosis in cancer cells.
B. Chemotherapeutic Agents
Compositions of the present invention can have an effective amount of an
engineered
virus or cell for therapeutic administration in combination with an effective
amount of a
compound (second agent) that is a chemotherapeutic agent as exemplified below.
Such
compositions will generally be dissolved or dispersed in a pharmaceutically
acceptable carrier or
aqueous medium.
A wide variety of chemotherapeutic agents may be used in combination with the
therapeutic genes of the present invention. These can be, for example, agents
that directly cross-
link DNA, agents that intercalate into DNA, and agents that lead to
chromosomal and mitotic
aberrations by affecting nucleic acid synthesis.
Agents that directly cross-link nucleic acids, specifically DNA, are envisaged
and are
shown herein, to eventuate DNA damage leading to a synergistic antineoplastic
combination.
Agents such as cisplatin, and other DNA alkylating agents may be used.
Agents that damage DNA also include compounds that interfere with DNA
replication,
mitosis, and chromosomal segregation. Examples of these compounds include
adriamycin (also
known as doxorubicin), VP-16 (also known as etoposide), verapamil,
podophyllotoxin, and the
like. Widely used in clinical setting for the treatment of neoplasms these
compounds are
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
administered through bolus injections intravenously at doses ranging from 25-
75 mg/m2 at 21
day intervals for adriamycin, to 35-100 mg/m2 for etoposide intravenously or
orally.
1. Antibiotics
5 a. Doxorubicin
Doxorubicin hydrochloride, 5,12-Naphthacenedione, (8s-cis)-10-[(3-amino-2,3,6-
trideoxy-a-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-
(hydroxyacetyl)-
1-methoxy-hydrochloride (hydroxydaunorubicin hydrochloride, Adriamycin) is
used in a wide
antineoplastic spectrum. It binds to DNA and inhibits nucleic acid synthesis,
inhibits mitosis and
10 promotes chromosomal aberrations.
Administered alone, it is the drug of first clhoice for the treatment of
thyroid adenoma and
primary hepatocellular carcinoma. It is a comp~~nent of 31 first-choice
combinations for the
treatment of ovarian, endometrial and breast tumors, bronchogenic oat-cell
carcinoma, non-small
15 cell lung carcinoma, gastric adenocarcinoma, retinoblastoma, neuroblastoma,
mycosis fungoides,
pancreatic carcinoma, prostatic carcinoma, bladder carcinoma, myeloma, diffuse
histiocytic
lymphoma, Wilms' tumor, Hodgkin's disease, adrenal tumors, osteogenic sarcoma
soft tissue
sarcoma, Ewing's sarcoma, rhabdomyosarcoma and acute lymphocytic leukemia. It
is an
alternative drug for the treatment of islet cell, cervical, testicular and
adrenocortical cancers. It is
20 also an immunosuppressant.
Doxorubicin is absorbed poorly and must be administered intravenously. The
pharmacokinetics are multicompartmental. Distribution phases have half lives
of 12 minutes and
3.3 hr. The elimination half life is about 30 hr. F~ orty to 50% is secreted
into the bile. Most of
25 the remainder is metabolized in the liver, partly to an active metabolite
(doxorubicinol), but a
few percent is excreted into the urine. In the presence of liver impairment,
the dose should be
reduced.
Appropriate doses are, intravenous, adult, ~i0 to 75 mg/m2 at 21-day intervals
or 25 to 30
30 mg/m2 on each of 2 or 3 successive days repeated at 3- or 4-wk intervals or
20 mg/m2 once a
week. The lowest dose should be used in elderly patients, when there is prior
bone-marrow
CA 02275438 1999-06-09
WO 98/22605 PCT/ITS97/21475
76
depression caused by prior chemotherapy or neoplastic marrow invasion, or when
the drug is
combined with other myelopoietic suppressant drugs. The dose should be reduced
by SO% if the
serum bilirubin lies between 1.2 and 3 mg/dl and by 75% if above 3 mg/dl. The
lifetime total
dose should not exceed SSO mg/m2 in patients with normal heart function and
400 mg/m2 in
persons having received mediastinal irradiation. Alternatively, 30 mg/m2 on
each of 3
consecutive days, repeated every 4 wk. Exemplary doses may be 10 mg/m2, 20
mg/m2, 30
mg/m2, SO mg/m2, 100 mg/m2, 150 mg/m2, 175 mg/m2, 200 mg/m2, 225 mg/m2, 250
mg/m2,
275 mg/m2, 300 mg/m2, 350 mg/m2, 400 mg/m2, 425 mg/m2, 450 mg/m2, 475 mg/m2,
S00
mg/m2. Of course, all of these dosages are exemplary, and any dosage in-
between these points is
also expected to be of use in the invention.
In the present invention the inventors have employed E 1 A and LT as exemplary
genes for
therapy to synergistically enhance the antineoplastic effects of the
doxorubicin in the treatment
of cancers. Those of skill in the art will be able to use the invention as
exemplified potentiate the
effects of doxorubicin in a range of different neu-mediated cancers.
b. Daunorubicin
Daunorubicin hydrochloride, 5,12-Naphthacenedione, (8S-cis)-8-acetyl-10-[(3-
amino-
2,3,6-trideoxy-a-L-lyxo-hexanopyranosyl)oxy)-7,8,9,10-tetrahydro-6,8,11-
trihydroxy-10
methoxy-, hydrochloride; also termed cerubidine and available from Wyeth.
Daunorubicin
intercalates into DNA, blocks DAN-directed RNA polymerase and inhibits DNA
synthesis. It
can prevent cell division in doses that do not interfere with nucleic acid
synthesis.
In combination with other drugs it is included in the first-choice
chemotherapy of acute
myelocytic leukemia in adults {for induction of remission), acute lymphocytic
leukemia and the
acute phase of chronic myelocytic leukemia. Oral absorption is poor, and it
must be given
intravenously. The half life of distribution is 45 minutes and of elimination,
about I9 hr. The
half life of its active metabolite, daunorubicinol, is about 27 hr.
Daunorubicin is metabolized
mostly in the liver and also secreted into the bile (ca 40%). Dosage must be
reduced in liver or
renal insuff ciencies.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
77
Suitable doses are (base equivalent), intravenous adult, younger than 60 yr.
45
mg/m2/day (30 mg/m2 for patients older than 60 yr.) for 1, 2 or 3 days every 3
or 4 wk or 0.8
mg/kg/day for 3 to 6 days every 3 or 4 wk; no more than 550 mg/m2 should be
given in a
lifetime, except only 450 mg/m2 if there has been chest irradiation; children,
25 mg/m2 once a
week unless the age is less than 2 yr. or the body surface less than 0.5 m, in
which case the
weight-based adult schedule is used. It is available in injectable dosage
forms (base equivalent)
20 mg (as the base equivalent to 21.4 mg of the hydrochloride). Exemplary
doses may be 10
mg/m2, 20 mg/m2, 30 mg/m2, 50 mg/m2, 100 mg/rn2, 150 mg/m2, 175 mg/m2, 200
mg/m2, 225
mg/m2, 250 mg/m2, 275 mg/m2, 300 mg/m2, 350 mg/m2, 400 mg/m2, 425 mg/m2, 450
mg/m2,
475 mg/m2, S00 mg/m2. Of course, all of these: dosages are exemplary, and any
dosage in-
between these points is also expected to be of use in the invention.
c. Mitomycin
Mitomycin (also known as mutamycin and/or mitomycin-C) is an antibiotic
isolated from
1 S the broth of Streptomyces caespitosus which has been shown to have
antitumor activity. The
compound is heat stable, has a high melting point, and is freely soluble in
organic solvents.
Mitomycin selectively inhibits the synthesis of deoxyribonucleic acid (DNA).
The
guanine and cytosine content correlates with the degree of mitomycin-induced
cross-linking. At
high concentrations of the drug, cellular RNA and oprotein synthesis are also
suppressed.
In humans, mitomycin is rapidly cleared from the serum after intravenous
administration.
Time required to reduce the serum concentration by 50% after a 30 mg. bolus
injection is 17
minutes. After injection of 30 mg., 20 mg., or 10 mg. LV., the maximal serum
concentrations
were 2.4 mg./ml, 1.7 mg./ml, and 0.52 mg./ml, respectively. Clearance is
effected primarily by
metabolism in the liver, but metabolism occurs in other tissues as well. The
rate of clearance is
inversely proportional to the maximal serum concentration because, it is
thought, of saturation of
the degradative pathways.
Approximately 10% of a dose of mitomycin is excreted unchanged in the urine.
Since
metabolic pathways are saturated at relatively low doses, the percent of a
dose excreted in urine
CA 02275438 1999-06-09
WO 98/22605 PCT/US97121475
78
increases with increasing dose. In children, excretion of intravenously
administered mitomycin
is similar.
d. Actinomycin D
Actinomycin D (Dactinomycin) [50-76-0]; C62Hg6N12~16 (1255.43) is an
antineoplastic drug that inhibits DNA-dependent RNA polymerase. It is a
component of first-
choice combinatipns for treatment of choriocarcinoma, embryonal
rhabdomyosarcoma, testicular
tumor and Wilms' tumor. Tumors which fail to respond to systemic treatment
sometimes
respond to local perfusion. Dactinomycin potentiates radiotherapy. It is a
secondary (efferent)
immunosuppressive.
Actinomycin D is used in combination with primary surgery, radiotherapy, and
other
drugs, particularly vincristine and cyclophosphamide. Antineoplastic activity
has also been
noted in Ewing's tumor, Kaposi's sarcoma, and soft-tissue sarcomas.
Dactinomycin can be
effective in women with advanced cases of choriocarcinoma. It also produces
consistent
responses in combination with chlorambucil and in patientswithmetastatic
methotrexate
testicular carcinomas. A response may sometimesin patientswithHodgkin's
be observed
disease and non-Hodgkin's lymphomas. Dactinomycinalso usedto inhibit
has been
immunological responses, particularly the rej ection of renal transplants.
Half of the dose is excreted intact into the bile and 10% into the urine; the
half life is
about 36 hr. The drug does not pass the blood-brain barrier. Actinomycin D is
supplied as a
lyophilized powder (0/5 mg in each vial). The usual daily dose is 10 to 15
mg/kg; this is given
intravenously for 5 days; if no manifestations of toxicity are encountered,
additional courses may
be given at intervals of 3 to 4 weeks. Daily injections of 100 to 400 mg have
been given to
children for 10 to 14 days; in other regimens, 3 to 6 mg/kg, for a total of
125 mg/kg, and weekly
maintenance doses of 7.5 mg/kg have been used. Although it is safer to
administer the drug into
the tubing of an intravenous infusion, direct intravenous injections have been
given, with the
precaution of discarding the needle used to withdraw the drug from the vial in
order to avoid
subcutaneous reaction. Exemplary doses may be 100 mg/m2, 150 mg/m2, 175 mg/m2,
200
mg/m2, 225 mg/m2, 250 mg/m2, 275 mg/m2, 300 mg/m2, 350 mg/m2, 400 mg/m2, 425
mg/m2,
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
79
450 mg/m2, 475 mg/m2, 500 mg/m2. Of course,, all of these dosages are
exemplary, and any
dosage in-between these points is also expected to be of use in the invention.
e. Bleomycin
Bleomycin is a mixture of cytotoxic glycopeptide antibiotics isolated from a
strain of
Streptomyces verticillus. It is freely soluble in water.
Although the exact mechanism of action of bleomycin is unknown, available
evidence
would seem to indicate that the main mode of action is the inhibition of DNA
synthesis with
some evidence of lesser inhibition of RNA and protein synthesis.
In mice, high concentrations of bleomycin are found in the skin, lungs,
kidneys,
peritoneum, and lymphatics. Tumor cells of the skin and lungs have been found
to have high
concentrations of bleomycin in contrast to the low concentrations found in
hematopoietic tissue.
The low concentrations of bleomycin found in bone marrow may be related to
high levels of
bleomycin degradative enzymes found in that tissue.
In patients with a creatinine clearance o:f >35 ml per minute, the serum or
plasma
terminal elimination half life of bleomycin is aplnoximately 115 minutes. In
patients with a
creatinine clearance of <35 ml per minute, the plasma or serum terminal
elimination half life
increases exponentially as the creatinine clearance decreases. In humans, 60%
to 70% of an
administered dose is recovered in the urine as active bleomycin.
Bleomycin should be considered a palliative treatment. It has been shown to be
useful in
the management of the following neoplasms either as a single agent or in
proven combinations
with other approved chemotherapeutic agents in squamous cell carcinoma such as
head and neck
(including mouth, tongue, tonsil, nasopharynx, oropharynx, sinus, palate, lip,
buccal mucosa,
gingiva, epiglottis, larynx), skin, penis, cervix, and vulva. It has also been
used in the treatment
of lymphomas and testicular carcinoma.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
Because of the possibility of an anaphylactoid reaction, lymphoma patients
should be
treated with two units or less for the first two doses. If no acute reaction
occurs, then the regular
dosage schedule may be followed.
5 Improvement of Hodgkin's Disease and testicular tumors is prompt and noted
within 2
weeks. If no improvement is seen by this time, improvement is unlikely.
Squamous cell cancers
respond more slowly, sometimes requiring as long as 3 weeks before any
improvement is noted.
Bleomycin may be given by the intramuscular, intravenous, or subcutaneous
routes.
2. Miscellaneous Agents
a. Cisplatin
Cisplatin has been widely used to treat cancers such as metastatic testicular
or ovarian
carcinoma, advanced bladder cancer, head or neck cancer, cervical cancer, lung
cancer or other
1 S tumors. Cisplatin can be used alone or in combination with other agents,
with efficacious doses
used in clinical applications of 15-20 mg/m2 for 5 days every three weeks for
a total of three
courses. Exemplary doses may be 0.50 mg/m2, 1.0 mg/m2, 1.50 mg/m2, 1.75 mg/m2,
2.0
mg/m2; 3.0 mg/m2 , 4.0 mg/m2, 5.0 mg/m2 , 10 mg/m2. Of course, all of these
dosages are
exemplary, and any dosage in-between these points is also expected to be of
use in the invention.
Cisplatin is not absorbed orally and must therefore be delivered via injection
intravenously, subcutaneously, intratumorally or intraperitoneally.
In certain aspects of the current invention cisplatin may be used in
combination with E 1 A
or LT in the treatment of breast carcinoma. It is clear, however, that the
combination of cisplatin
and therapeutic genes could be used for the treatment of any other neu-
mediated cancer.
b. VP16
VP16 is also known as etoposide and is used primarily for treatment of
testicular tumors,
in combination with bleomycin and cisplatin, and in combination with cisplatin
for small-cell
carcinoma of the lung. It is also active against non-Hodgkin's lymphomas,
acute
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
81
nonlymphocytic leukemia, carcinoma of the breast, and Kaposi's sarcoma
associated with
acquired immunodeficiency syndrome (AIDS).
VP 16 is available as a solution (20 mg/ml) for intravenous administration and
as SO-mg,
liquid-filled capsules for oral use. For small-cell carcinoma of the lung, the
intravenous dose (in
combination therapy) is can be as much as 100 mg/m2 or as little as 2 mg/ m2,
routinely 35
mg/m2, daily for 4 days, to 50 mg/m2, daily for 5 days have also been used.
When given orally,
the dose should be doubled. Hence the doses for small cell lung carcinoma may
be as high as
200-250 mg/m2. The intravenous dose for testicular cancer (in combination
therapy) is 50 to
100 mg/m2 daily for 5 days, or 100 mg/m2 on alternate days, for three doses.
Cycles of therapy
are usually repeated every 3 to 4 weeks. The drug, should be administered
slowly during a 30- to
60-minute infusion in order to avoid hypotension and bronchospasm, which are
probably due to
the solvents used in the formulation.
1 S c. Tumor Necrosis Factor
Tumor Necrosis Factor [TNF; Cachectin) is a glycoprotein that kills some kinds
of cancer
cells, activates cytokine production, activates macrophages and endothelial
cells, promotes the
production of collagen and collagenases, is an inflammatory mediator and also
a mediator of
septic shock, and promotes catabolism, fever an~i sleep. Some infectious
agents cause tumor
regression through the stimulation of TNF production. TNF can be quite toxic
when used alone
in effective doses, so that the optimal regimens probably will use it in lower
doses in
combination with other drugs. Its immunosup~pressive actions are potentiated
by gamma-
interferon, so that the combination potentially is dangerous. A hybrid of TNF
and interferon-a
also has been found to possess anti-cancer activity,
3. Plant Alkaloids
a. Taxol
Taxol is an experimental antimitotic agent, isolated from the bark of the ash
tree, Taxus
brevifolia. It binds to tubulin (at a site distincl: from that used by the
vinca alkaloids) and
promotes the assembly of microtubules. Taxol is currently being evaluated
clinically; it has
activity against malignant melanoma and carcinoma of the ovary. Maximal doses
are 30 mg/m2
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
82
per day for S days or 210 to 250 mg/m2 given once every 3 weeks. Of course,
all of these
dosages are exemplary, and any dosage in-between these points is also expected
to be of use in
the invention.
b. Vincristine
Vincristine blocks mitosis and produces metaphase arrest. It seems likely that
most of
the biological activities of this drug can be explained by its ability to bind
specifically to tubulin
and to block the ability of protein to polymerize into microtubules. Through
disruption of the
microtubules of the mitotic apparatus, cell division is arrested in metaphase.
The inability to
segregate chromosomes correctly during mitosis presumably leads to cell death.
The relatively low toxicity of vincristine for normal marrow cells and
epithelial cells
make this agent unusual among anti-neoplastic drugs, and it is often included
in combination
with other myelosuppressive agents.
Unpredictable absorption has been reported after oral administration of
vinblastine or
vincristine. At the usual clinical doses the peak concentration of each drug
in plasma is
approximately 0.4 mM.
Vinblastine and vincristine bind to plasma proteins. They are extensively
concentrated in
platelets and to a lesser extent in leukocytes and erythrocytes.
Vincristine has a multiphasic pattern of clearance from the plasma; the
terminal half life
is about 24 hours. The drug is metabolized in the liver, but no biologically
active derivatives
have been identified. Doses should be reduced in patients with hepatic
dysfunction. At least a
50% reduction in dosage is indicated if the concentration of bilirubin in
plasma is greater than 3
mg/dl (about 50 mM).
Vincristine sulfate is available as a solution (1 mg/ml) for intravenous
injection.
Vincristine used together with corticosteroids is presently the treatment of
choice to induce
remissions in childhood leukemia; the optimal dosages for these drugs appear
to be vincristine,
intravenously, 2 mg/m2 of body-surface area, weekly, and prednisone, orally,
40 mg/m2, daily.
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
83
Adult patients with Hodgkin's disease or non-Hodgkin's lymphomas usually
receive vincristine
as a part of a complex protocol. When used in t:he MOPP regimen, the
recommended dose of
vincristine is 1.4 mg/m2. High doses of vincristine seem to be tolerated
better by children with
leukemia than by adults, who may experience sever neurological toxicity.
Administration of the
S drug more frequently than every 7 days or apt higher doses seems to increase
the toxic
manifestations without proportional improvement in the response rate.
Precautions should also
be used to avoid extravasation during intravenous administration of
vincristine. Vincristine (and
vinblastine) can be infused into the arterial blood supply of tumors in doses
several times larger
than those that can be administered intravenously with comparable toxicity.
Vincristine has been effective in Hodgkiri's disease and other lymphomas.
Although it
appears to be somewhat less beneficial than vinbl.astine when used alone in
Hodgkin's disease,
when used with mechlorethamine, prednisone, and procarbazine (the so-called
MOPP regimen),
it is the preferred treatment for the advanced stage; (III and IV) of this
disease. In non-Hodgkin's
lymphomas, vincristine is an important agent, particularly when used with
cyclophosphamide,
bleomycin, doxorubicin, and prednisone. Vin~~ristine is more useful than
vinblastine in
lymphocytic leukemia. Beneficial response have >=peen reported in patients
with a variety of other
neoplasms, particularly Wilms' tumor, neuroblastoma, brain tumors,
rhabdomyosarcoma, and
carcinomas of the breast, bladder, and the male and female reproductive
systems.
Doses of vincristine for use will be deaermined by the clinician according to
the
individual patients need. 0.01 to 0.03 mg/kg or 0.4~ to 1.4 mg/m2 can be
administered or 1.5 to 2
mg/m2 can also be administered. Alternatively 0.02 mg/m2, 0.05 mg/m2, 0.06
mg/m2, 0.07
mg/m2, 0.08 mg/m2, 0.1 mg/m2, O.I2 mg/m2, 0.14 mg/m2, 0.15 mg/m2, 0.2 mg/m2,
0.25
mg/m2 can be given as a constant intravenous infusion. Of course, all of these
dosages are
exemplary, and any dosage in-between these points is also expected to be of
use in the invention.
c. Vinblastine
When cells are incubated with vinblastine, dissolution of the microtubules
occurs.
Unpredictable absorption has been reported after oral administration of
vinblastine or vincristine.
At the usual clinical doses the peak concentration of each drug in plasma is
approximately 0.4
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
84
mM. Vinblastine and vincristine bind to plasma proteins. They are extensively
concentrated in
platelets and to a lesser extent in leukocytes and erythrocytes.
After intravenous injection, vinblastine has a multiphasic pattern of
clearance from the
plasma; after distribution, drug disappears from plasma with half lives of
approximately 1 and 20
hours.
Vinblastine is metabolized in the liver to biologically activate derivative
desacetylvinblastine. Approximately 15% of an administered dose is detected
intact in the urine,
and about 10% is recovered in the feces after biliary excretion. Doses should
be reduced in
patients with hepatic dysfunction. At least a 50% reduction in dosage is
indicated if the
concentration of bilirubin in plasma is greater than 3 mg/dl (about SO mM).
Vinblastine sulfate is available in preparations for injection. The drug is
given
intravenously; special precautions must be taken against subcutaneous
extravasation, since this
may cause painful irritation and ulceration. The drug should not be injected
into an extremity
with impaired circulation. After a single dose of 0.3 mg/kg of body weight,
myelosuppression
reaches its maximum in 7 to 10 days. If a moderate level of leukopenia
(approximately 3000
cells/mm3) is not attained, the weekly dose may be increased gradually by
increments of 0.05
mg/kg of body weight. In regimens designed to cure testicular cancer,
vinblastine is used in
doses of 0.3 mg/kg every 3 weeks irrespective of blood cell counts or
toxicity.
The most important clinical use of vinblastine is with bleomycin and cisplatin
in the
curative therapy of metastatic testicular tumors. Beneficial responses have
been reported in
various lymphomas, particularly Hodgkin's disease, where significant
improvement may be
noted in 50 to 90% of cases. The effectiveness of vinblastine in a high
proportion of lymphomas
is not diminished when the disease is refractory to alkylating agents. It is
also active in Kaposi's
sarcoma, neurobiastoma, and Letterer-Siwe disease (histiocytosis X), as well
as in carcinoma of
the breast and choriocarcinoma in women.
Doses of vinblastine for use will be determined by the clinician according to
the
individual patients need. 0.1 to 0.3 mg/kg can be administered or 1.5 to 2
mg/m2 can also be
CA 02275438 1999-06-09
WO 98/22605 PCT/CTS97/21475
administered. Alternatively, 0.1 mg/m2, 0.12 mg/m2, 0.14 mg/m2, 0.15 mg/m2,
0.2 mg/m2, 0.25
mg/m2, 0.5 mg/m2, 1.0 mg/m2, 1.2 mg/m2, 1.4 mg/m2, 1.5 mg/m2, 2.0 mg/m2, 2.5
mg/m2, 5.0
mg/m2, 6 mg/m2, 8 mg/m2, 9 mg/m2, 10 mg/m~Z, 20 mg/m2, can be given. Of
course, all of
these dosages are exemplary, and any dosage in-between these points is also
expected to be of
5 use in the invention.
4. Allrylating Agents
a. Carmustine
Carmustine (sterile carmustine) is one of the nitrosoureas used in the
treatment of certain
10 neoplastic diseases. It is 1,3 bis (2-chloroethyl;l-1-nitrosourea. It is
lyophilized pale yellow
flakes or congealed mass with a molecular weighl: of 214.06. It is highly
soluble in alcohol and
lipids, and poorly soluble in water. Carmustine is administered by intravenous
infusion after
reconstitution as recommended. Sterile carmustin~~ is commonly available in
100 mg single dose
vials of lyophilized material.
Although it is generally agreed that carmustine alkylates DNA and RNA, it is
not cross
resistant with other alkylators. As with other nitrosoureas, it may also
inhibit several key
enzymatic processes by carbamoylation of amino acids in proteins.
Carmustine is indicated as palliative therapy as a single agent or in
established
combination therapy with other approved chemotherapeutic agents in brain
tumors such as
glioblastoma, brainstem glioma, medullobladyoma, astrocytoma, ependymoma, and
metastatic
brain tumors. Also it has been used in combination with prednisone to treat
multiple myeloma.
Carmustine has proved useful, in the treatment of Hodgkin's Disease and in non-
Hodgkin's
lymphomas, as secondary therapy in combinatio n with other approved drugs in
patients who
relapse while being treated with primary therapy, or who fail to respond to
primary therapy.
The recommended dose of carmustine as a single agent in previously untreated
patients is
150 to 200 mg/m2 intravenously every 6 weeks. This may be given as a single
dose or divided
into daily injections such as 75 to 100 mg/m2 on l successive days. When
carmustine is used in
combination with other myelosuppressive drugs or in patients in whom bone
marrow reserve is
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
86
depleted, the doses should be adjusted accordingly. Doses subsequent to the
initial dose should
be adjusted according to the hematologic response of the patient to the
preceding dose. It is of
course understood that other doses may be used in the present invention for
example 10 mg/m2,
20 mg/m2, 30 mg/m2, 40 mg/m2, 50 mg/m2, 60 mg/m2, 70 mg/m2, 80 mg/m2, 90
mg/m2, or
100 mg/m2 . The skilled artisan is directed to, "Remington's Pharmaceutical
Sciences" ISth
Edition, chapter 61. Some variation in dosage will necessarily occur depending
on the condition
of the subject being treated. The person responsible for administration will,
in any event,
determine the appropriate dose for the individual subject:
b. MelphaIan
Melphalan also known as alkeran, L-phenylalanine mustard, phenylalanine
mustard, L-
PAM, or L-sarcolysin, is a phenylalanine derivative of nitrogen mustard.
Melphalan is a
bifunctional alkylating agent which is active against selective human
neoplastic diseases. It is
known chemically as 4-jbis(2-chloroethyl)amino]-L-phenylalanine.
Melphalan is the active L-isomer of the compound and was first synthesized in
1953 by
Bergel and Stock; the D-isomer, known as medphalan, is less active against
certain animal
tumors, and the dose needed to produce effects on chromosomes is larger than
that required with
the L-isomer. The racemic (DL-) form is known as merphalan or sarcolysin.
Melphalan is
insoluble in water and has a pKa 1 of ~2.1. Melphalan is available in tablet
form for oral
administration and has been used to treat multiple myeloma.
Available evidence suggests that about one third to one half of the patients
with multiple
myeloma show a favorable response to oral administration of the drug.
Melphalan has been used in the treatment of epithelial ovarian carcinoma. One
commonly employed regimen for the treatment of ovarian carcinoma has been to
administer
melphalan at a dose of 0.2 mg/kg daily for five days as a single course.
Courses are repeated
every four to five weeks depending upon hematologic tolerance (Smith and
Rutledge, 1975;
Young et al., 1978). Alternatively the dose of melphalan used could be as low
as 0.05 mg/kg/day
or as high as 3 mg/kg/day or any dose in between these doses or above these
doses. Some
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
87
variation in dosage will necessarily occur depending on the condition of the
subject being
treated. The person responsible for administration will, in any event,
determine the appropriate
dose for the individual subject.
c. Cyclophosphamide
Cyclophosphamide is 2H 1,3,2-Oxazapl:losphorin-2-amine, N,N bis (2-
chloroethyl)
tetrahydro-, 2-oxide, monohydrate; termed Cytox;an available from Mead
Johnson; and Neosar
available from Adria. Cyclophosphamide is pre~~ared by condensing 3-amino-1-
propanol with
N,N-bis(2-chlorethyl) phosphoramidic dichloride ~:(C1CH2CH2)2N--POC12] in
dioxane solution
under the catalytic influence of triethylamine. The condensation is double,
involving both the
hydroxyl and the amino groups, thus effecting the cyclization.
Unlike other (3-chloroethylamino alkylators, it does not cyclize readily to
the active
ethyleneimonium form until activated by hepatic enzymes. Thus, the substance
is stable in the
gastrointestinal tract, tolerated well and effective by the oral and parental
routes and does not
cause local vesication, necrosis, phlebitis or even pain.
Suitable doses for adults include, orally, 1 to 5 mg/kg/day (usually in
combination),
depending upon gastrointestinal tolerance; or 1 t~~ 2 mg/kg/day;
intravenously, initially 40 to
50 mg/kg in divided doses over a period of 2 to S clays or 10 to 15 mg/kg
every 7 to 10 days or 3
to 5 mg/kg twice a week or 1.5 to 3 mg/kg/day . E, dose 250 mg/kg/day may be
administered as
an antineoplastic. Because of gastrointestinal adverse effects, the
intravenous route is preferred
for loading. During maintenance, a leukocyte count of 3000 to 4000/mm3 usually
is desired.
The drug also sometimes is administered intramuscularly, by infiltration or
into body cavities. It
is available in dosage forms for injection of 100, 200 and 500 mg, and tablets
of 25 and 50 mg
the skilled artisan is referred to "Remington's Pharmaceutical Sciences" 15th
Edition, chapter 61,
incorporate herein as a reference, for details on doses for administration.
d. Chlorambucil
Chlorambucil (also known as leukeran) wa,s first synthesized by Everett et al.
( 1953). It
is a bifunctional alkylating agent of the nitrogen mustard type that has been
found active against
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
88
selected human neoplastic diseases. Chlorambucil is known chemically as 4-
[bis(2-
chlorethyl)amino) benzenebutanoic acid.
Chlorambucil is available in tablet form for oral administration. It is
rapidly and
completely absorbed from the gastrointestinal tract. After single oral doses
of 0.6-1.2 mg/kg,
peak plasma chlorambucil levels are reached within one hour and the terminal
half life of the
parent drug is estimated at 1.5 hours. 0.1 to 0.2 mg/kg/day or 3 to 6
mg/m2/day or alternatively
0.4 mg/kg may be used for antineoplastic treatment. Treatment regimes are well
know to those of
skill in the art and can be found in the "Physicians Desk Reference" and in
"Remingtons
Pharmaceutical Sciences" referenced herein.
Chlorambucil is indicated in the treatment of chronic lymphatic (lymphocytic)
leukemia,
malignant lymphomas including lymphosarcoma, giant follicular lymphoma and
Hodgkin's
disease. It is not curative in any of these disorders but may produce
clinically useful palliation.
e. Busulfan
Busulfan (also known as myleran) is a bifunctional alkyiating agent. Busulfan
is known
chemically as 1,4-butanediol dimethanesulfonate.
Busulfan is not a structural analog of the nitrogen mustards. Busulfan is
available in
tablet form for oral administration. Each scored tablet contains 2 mg busulfan
and the inactive
ingredients magnesium stearate and sodium chloride.
Busulfan is indicated for the palliative treatment of chronic myelogenous
(myeloid,
myelocytic, granulocytic) leukemia. Although not curative, busulfan reduces
the total
granulocyte mass, relieves symptoms of the disease, and improves the clinical
state of the
patient. Approximately 90% of adults with previously untreated chronic
myelogenous leukemia
will obtain hematologic remission with regression or stabilization of
organomegaly following the
use of busulfan. It has been shown to be superior to splenic irradiation with
respect to survival
times and maintenance of hemoglobin levels, and to be equivalent to
irradiation at controlling
splenomegaly.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
89
f. Lomustine
Lomustine is one of the nitrosoureas used in the treatment of certain
neoplastic diseases.
It is 1-(2-chloro-ethyl)-3-cyclohexyl-1 nitrosourea. It is a yellow powder
with the empirical
formula of C9H16C1N302 and a molecular weight of 233.71. Lomustine is soluble
in 10%
ethanol (0.05 mg per ml) and in absolute alcohol (70 mg per ml). Lomustine is
relatively
insoluble in water (<0.05 mg per ml). It is relatively unionized at a
physiological pH. Inactive
ingredients in lomustine capsules are: magnesium stearate and mannitol.
Although it is generally agreed that lomustine alkylates DNA and RNA, it is
not cross
resistant with other alkylators. As with other nitrosoureas, it may also
inhibit several key
enzymatic processes by carbamoylation of amino acids in proteins.
Lomustine may be given orally. Following oral administration of radioactive
lomustine
at doses ranging from 30 mg/m2 to 100 mg/m2, about half of the radioactivity
given was
excreted in the form of degradation products within 24 hours.
The serum half life of the metabolites ranl;es from 16 hours to 2 days. Tissue
levels are
comparable to plasma levels at 15 minutes after intravenous administration.
Lomustine has been shown to be useful as a single agent in addition to other
treatment
modalities, or in established combination therapy with other approved
chemotherapeutic agents
in both primary and metastatic brain tumors, in patients who have already
received appropriate
surgical and/or radiotherapeutic procedures. It has also proved effective in
secondary therapy
against Hodgkin's Disease in combination with other approved drugs in patients
who relapse
while being treated with primary therapy, or who fail to respond to primary
therapy.
The recommended dose of lomustine in adults and children as a single agent in
previously untreated patients is 130 mg/m2 as a single oral dose every 6
weeks. In individuals
with compromised bone marrow function, the dose should be reduced to 100 mg/m2
every 6
weeks. When lomustine is used in combination with other myelosuppressive
drugs, the doses
should be adjusted accordingly. It is understood that other doses may be used
for example, 20
CA 02275438 1999-06-09
WO 98!22605 PCT/LTS97/21475
mg/m2 30 mg/m2, 40 mg/m2, 50 mg/m2, 60 mg/m2, 70 mg/m2, 80 mg/m2, 90 mg/m2,
100
mg/m2, 120 mg/m2 or any doses between these ranges as determined by the
clinician to be
necessary for the individual being treated.
5 IX Use of Transduced Cells in Bioreactors
The abili"y to produce biologically active polypeptides is increasingly
important to the
pharmaceutical industry. The present invention discloses compositions and
methods for the
efficient transduction of cells, allowing for the production of proteins in
vitro from previously
10 refractory cell types.
Over the last decade, advances in biotechnology have led to the production of
important
proteins and factors from bacteria, yeast, insect cells and from mammalian
cell culture.
Mammalian cultures have advantages over cultures derived from the less
advanced lifeforms in
15 their ability to post-translationally process complex protein structures
such as disulfide-
dependent folding and glycosylation. Indeed, mammalian cell culture is now the
preferred
source of a number of important proteins for use in human and animal medicine,
especially those
which are relatively large, complex or glycosylated.
20 Development of mammalian cell culture for production of pharmaceuticals has
been
greatly aided by the development in molecular biology of techniques for design
and construction
of vector systems highly efficient in mammalian cell cultures, a battery of
useful selection
markers, gene amplification schemes and a more comprehensive understanding of
the
biochemical and cellular mechanisms involved in procuring the final
biologically-active
25 molecule from the introduced vector.
However, the traditional selection of cell types for expressing heterologous
proteins has
generally been limited to the more "common" cell types such as CHO cells, BHK
cells, C 127
cells and myeloma cells. In many cases, these cell types were selected because
there was a great
30 deal of preexisting literature on the cell type or the cell was simply
being carried in the
laboratory at the time the effort was made to express a peptide product.
Frequently, factors
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
91
which affect the downstream (e.g., beyond the T-75 flask) side of
manufacturing scale-up were
not considered before selecting the cell line as the :host for the expression
system.
Aspects of the present invention take advantage of the biochemical and
cellular capacities
of mammalian cells as well as of recently available bioreactor technology.
Growing cells
according to the present invention in a bioreactor ~~llows for large scale
production and secretion
of complex, fully biologically-active polypepti~des into the growth media. In
particular
embodiments, by designing a defined media with low contents of complex
proteins and using a
scheme of timed-stimulation of the secretion into the media for increased
titer, the purification
strategy can be greatly simplified, thus lowering production cost.
1. Anchorage-dependent ver~;us non-anchorage-dependent cultures.
Animal and human cells can be propagated in vitro in two modes: as non-
anchorage
dependent cells growing freely in suspension throughout the bulk of the
culture; or as anchorage
dependent cells requiring attachment to a solid suhstrate for their
propagation (i. e., a monolayer
type of cell growth).
Non-anchorage dependent or suspension cultures from continuous established
cell lines
are the most widely used means of large scale production of cells and cell
products. Large scale
suspension culture based on microbial (bacterial and yeast} fermentation
technology has clear
advantages for the manufacturing of mammalian cell products. The processes are
relatively
straightforward to operate and scale up. Homogeneous conditions can be
provided in the reactor
which allows for precise monitoring and control of temperature, dissolved
oxygen, and pH, and
ensure that representative samples of the culture can be taken.
However, suspension cultured cells cannot always be used in the production of
biologicals. Suspension cultures are still considered to have tumorigenic
potential and thus their
use as substrates for production put limits on the use of the resulting
products in human and
veterinary applications (Petricciani, 1985; Larsson and Litwin, 1987). Viruses
propagated in
suspension cultures as opposed to anchorage-dependent cultures can sometimes
cause rapid
changes in viral markers, leading to reduced immunogenicity (Bahnemann, 1980).
Finally,
sometimes even recombinant cell lines can secrete considerably higher amounts
of products
CA 02275438 1999-06-09
WO 98/22605 PCT/iJS97/21475
92
when propagated as anchorage-dependent cultures as compared with the same cell
line in
suspension (Nilsson and Mosbach, 1987). For these reasons, different types of
anchorage-
dependent cells are used extensively in the production of different biological
products.
The current invention includes cells which are anchorage-dependent of nature.
Anchorage-dependent cells, when grown in suspension, will attach to each other
and grow in
clumps, eventually suffocating cells in the inner core of each clump as they
reach a size that
leaves the core cells unsustainable by the culture conditions. Therefore, an
efficient means of
large-scale culture of anchorage-dependent cells is also provided in order to
effectively take
advantage of the cells' capacity to secrete heterologous proteins.
2. Reactors and processes for suspension.
Large scale suspension culture of mammalian cultures in stirred tanks is
contemplated.
The instrumentation and controls for bioreactors have been adapted, along with
the design of the
fermentors, from related microbial applications. However, acknowledging the
increased demand
for contamination control in the slower growing mammalian cultures, improved
aseptic designs
have been implemented, improving dependability of these reactors.
Instrumentation and controls
include agitation, temperature, dissolved oxygen, and pH controls. More
advanced probes and
autoanalyzers for on-line and off line measurements of turbidity (a function
of particles present),
capacitance (a function of viable cells present), glucose/lactate,
carbonate/bicarbonate and carbon
dioxide are also available. Maximum cell densities obtainable in suspension
cultures are
relatively low at about 2-4 ' 106 cells/ml of medium (which is less than 1 mg
dry cell weight per
ml), well below the numbers achieved in microbial fermentation.
Two suspension culture reactor designs are most widely used in the industry
due to their
simplicity and robustness of operation - the stirred reactor and the airlift
reactor. The stirred
reactor design has successfully been used on a scale of 8000 liter capacity
for the production of
interferon (Phillips et al., 1985; Mizrahi, 1983). Cells are grown in a
stainless steel tank with a
height-to-diameter ratio of 1:1 to 3:1. The culture is usually mixed with one
or more agitators,
based on bladed disks or marine propeller patterns. Agitator systems offering
less shear forces
than blades have been described. Agitation may be driven either directly or
indirectly by
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/Z1475
93
magnetically coupled drives. Indirect drives reduce the risk of microbial
contamination through
seals on stirrer shafts.
The airlift reactor, also initially described for microbial fermentation and
later adapted for
mammalian culture, relies on a gas stream to both mix and oxygenate the
culture. The gas
stream enters a riser section of the reactor and drives circulation. Gas
disengages at the culture
surface, causing denser liquid free of gas bubbles to travel downward in the
downcomer section
of the reactor. The main advantage of this dc;sign is the simplicity and lack
of need for
mechanical mixing. Typically, the height-to-diameter ratio is 10:1. The
airlift reactor scales up
relatively readily, has good mass transfer of gasses and generates relatively
low shear forces.
Most large-scale suspension cultures are operated as batch or fed-batch
processes because
they are the most straightforward to operate and scale up. However, continuous
processes based
on chemostat or perfusion principles are available.
A batch process is a closed system in which a typical growth profile is seen.
A lag phase
is followed by exponential, stationary and decline phases. In such a system,
the environment is
continuously changing as nutrients are deplete~3 and metabolites accumulate.
This makes
analysis of factors influencing cell growth and productivity, and hence
optimization of the
process, a complex task. Productivity of a batch Inocess may be increased by
controlled feeding
of key nutrients to prolong the growth cycle. Such a fed-batch process is
still a closed system
because cells, products and waste products are not removed.
In what is still a closed system, perfusion of fresh medium through the
culture can be
achieved by retaining the cells with a fine mesh spin filter and spinning to
prevent clogging.
Spin filter cultures can produce cell densities of approximately 5 x 10~
cells/ml. A true open
system and the most basic perfusion process is the chemostat in which there is
an inflow of
medium and an outflow of cells and products. Culture medium is fed to the
reactor at a
predetermined and constant rate which maintains the dilution rate of the
culture at a value less
than the maximum specific growth rate of the cells (to prevent washout of the
cell mass from the
reactor). Culture fluid containing cells, cell products and byproducts is
removed at the same rate.
These perfused systems are not in commercial use for production from mammalian
cell culture.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
94
3. Non-perfused attachment systems.
Traditionally, anchorage-dependent cell cultures are propagated on the bottom
of small
glass or plastic vessels. The restricted surface-to-volume ratio offered by
classical and traditional
techniques, suitable for the laboratory scale, has created a bottleneck in the
production of cells
and cell products on a large scale. To provide systems that offer large
accessible surfaces for cell
growth in small culture volume, a number of techniques have been proposed: the
roller bottle
system, the stack plates propagator, the spiral film bottles, the hollow fiber
system, the packed
bed, the plate exchanger system, and the membrane tubing reel. Since these
systems are non-
homogeneous in their nature, and are sometimes based on multiple processes,
they can
sometimes have limited potential for scale-up, difficulties in taking cell
samples, limited
potential for measuring and controlling the system and difficulty in
maintaining homogeneous
environmental conditions throughout the culture.
1 S A commonly used process of these systems is the roller bottle. Being
little more than a
large, differently shaped T-flask, simplicity of the system makes it very
dependable and, hence,
attractive. Fully automated robots are available that can handle thousands of
roller bottles per
day, thus eliminating the risk of contamination and inconsistency associated
with the otherwise
required intense human handling. With frequent media changes, roller bottle
cultures can
achieve cell densities of close to 0.5 x 106 cells/cm2 (corresponding to 109
cells/bottle or 107
cells/ml of culture media).
4. Cultures on microcarriers
van Wezel (1967) developed the concept of the microcarrier culturing systems.
In this
system, cells are propagated on the surface of small solid particles suspended
in the growth
medium by slow agitation. Cells attach to the microcarriers and grow gradually
to confluency of
the microcarrier surface. In fact, this large scale culture system upgrades
the attachment
dependent culture from a single disc process to a unit process in which both
monolayer and
suspension culture have been brought together. Thus, combining the necessary
surface for the
cells to grow with the advantages of the homogeneous suspension culture
increases production.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
The advantages of microcarrier cultures over most other anchorage-dependent,
large-
scale cultivation methods are several fold. First, microcarrier cultures offer
a high surface-to-
volume ratio (variable by changing the Garner concentration) which leads to
high cell density
yields and a potential for obtaining highly concentrated cell products. Cell
yields are up to 1-2 x
5 10~ cells/ml when cultures are propagated in a ~perfused reactor mode.
Second, cells can be
propagated in one unit process vessels instead of using many small low-
productivity vessels (i. e.)
flasks or dishes). This results in far better utilization and a considerable
saving of culture
medium. Moreover, propagation in a single reactor leads to reduction in need
for facility space
and in the number of handling steps required per cell, thus reducing labor
cost and risk of
10 contamination.
Third, the well-mixed and homogeneous microcarrier suspension culture makes it
possible to monitor and control environmental conditions (e.g., pH, p02, and
concentration of
medium components), thus leading to more reproducible cell propagation and
product recovery.
1 S Fourth, it is possible to take a representative s~unple for microscopic
observation, chemical
testing, or enumeration. Fifth, since microcarriers settle out of suspension
easily, use of a fed-
batch process or harvesting of cells can be done relatively easily. Sixth, the
mode of the
anchorage-dependent culture propagation on the microcarners makes it possible
to use this
system for other cellular manipulations, such as cell transfer without the use
of proteolytic
20 enzymes, cocultivation of cells, transplantation unto animals, and
perfusion of the culture using
decanters, columns, fluidized beds, or hollow fibers for microcarrier
retainment. Seventh,
microcarner cultures are relatively easily scaled up using conventional
equipment used for
cultivation of microbial and animal cells in suspension.
25 5. Microencapsulation of mammalian cells
One method which has shown to be particularly useful for culturing mammalian
cells is
microencapsulation. The mammalian cells are retained inside a semipermeable
hydrogel
membrane. A porous membrane is formed around the cells permitting the exchange
of nutrients,
gases, and metabolic products with the bulk medium surrounding the capsule.
Several methods
30 have been developed that are gentle, rapid and non-toxic and where the
resulting membrane is
sufficiently porous and strong to sustain the growing cell mass throughout the
term of the
culture. These methods are all based on soluble alginate gelled by droplet
contact with a
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
96
calcium-containing solution. Lim ( 1982) describes cells concentrated in an
approximately 1
solution of sodium alginate which are forced through a small orifice, forming
droplets, and
breaking free into an approximately 1 % calcium chloride solution. The
droplets are then cast in
a layer of polyamino acid that ionically bonds to the surface alginate.
Finally the alginate is
reliquefied by treating the droplet in a chelating agent to remove the calcium
ions. Other
methods use cells in a calcium solution to be dropped into a alginate
solution, thus creating a
hollow alginate sphere. A similar approach involves cells in a chitosan
solution dropped into
alginate, also creating hollow spheres.
Microencapsulated cells are easily propagated in stirred tank reactors and,
with beads
sizes in the range of 150-1500 mm in diameter, are easily retained in a
perfused reactor using a
fine-meshed screen. The ratio of capsule volume to total media volume can kept
from as dense as
1:2 to 1:10. With intracapsular cell densities of up to 108, the effective
cell density in the culture
is 1-S x 10~.
The advantages of microencapsulation over other processes include the
protection from
the deleterious effects of shear stresses which occur from sparging and
agitation, the ability to
easily retain beads for the purpose of using perfused systems, scale up is
relatively
straightforward and the ability to use the beads for implantation.
6. Perfused attachment systems
Perfusion refers to continuous flow at a steady rate, through or over a
population of cells
(of a physiological nutrient solution). It implies the retention of the cells
within the culture unit
as opposed to continuous-flow culture which washes the cells out with the
withdrawn media
(e.g.) chemostat). The idea of perfusion has been known since the beginning of
the century, and
has been applied to keep small pieces of tissue viable for extended
microscopic observation. The
technique was initiated to mimic the cells milieu in vivo where cells are
continuously supplied
with blood, lymph, or other body fluids. Without perfusion, cells in culture
go through
alternating phases of being fed and starved, thus limiting full expression of
their growth and
metabolic potential. The current use of perfused culture is to grow cells at
high densities (i. e.,
0.1-5 x 108 cells/ml). In order to increase densities beyond 2-4 ' 106
cells/ml (or 2 x 1 OS
CA 02275438 1999-06-09
WO 98/22605 PCT/US97121475
97
cells/cm2), the medium has to be constantly replaced with a fresh supply in
order to make up for
nutritional deficiencies and to remove toxic products. Perfusion allows for a
far better control of
the culture environment (pH, p02, nutrient levels, ntc. ) and is a means of
significantly increasing
the utilization of the surface area within a culture for cell attachment.
Microcarrier and microencapsulated cultures are readily adapted to perfused
reactors but,
as noted above, these culture methods lack the capacity to meet the demand for
cell densities
above 10g cells/ml. Such densities will provide ;for the advantage of high
product titer in the
medium (facilitating downstream processing), a smaller culture system
(lowering facility needs),
and a better medium utilization (yielding savings in serum and other expensive
additives).
Supporting cells at high density requires efficient perfusion techniques to
prevent the
development of non-homogeneity.
The cells of the present invention may, irre:~pective of the culture method
chosen, be used
in protein production and as cells for in vitro ~;ellular assays and screens
as part of drug
development protocols.
7. Protein Purification
Certain aspects of the present invention concern the purification, and in
particular
embodiments, the substantial purification, of an encoded protein or peptide.
The term "purified
protein or peptide " as used herein, is intended to refer to a composition,
isolatable from other
components, wherein the protein or peptide is purified to any degree relative
to its naturally-
obtainable state. A purified protein or peptide therefore also refers to a
protein or peptide, free
from the environment in which it may naturally occur.
Generally, "purified" will refer to a protein or peptide composition that has
been
subjected to fractionation to remove various other components, and which
composition
substantially retains its expressed biological activil:y. Where the term
"substantially purified" is
used, this designation will refer to a composition in which the protein or
peptide forms the major
component of the composition, such as constituting about 50% or more of the
proteins in the
composition.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
98
Various methods for quantifying the degree of purification of the protein or
peptide will
be known to those of skill in the art in light of the present disclosure.
These include, for
example, determining the specific activity of an active fraction, or assessing
the number of
polypeptides within a fraction by SDS/PAGE analysis. A preferred method for
assessing the
purity of a fraction is to calculate the specific activity of the fraction, to
compare it to the specific
activity of the initial extract, and to thus calculate the degree of purity,
herein assessed by a "-
fold purification number". The actual units used to represent the amount of
activity will, of
course, be dependent upon the particular assay technique chosen to follow the
purification and
whether or not the expressed protein or peptide exhibits a detectable
activity.
Various techniques suitable for use in protein purification will be well known
to those of
skill in the art. These include, for example, precipitation with ammonium
sulphate, PEG,
antibodies and the like or by heat denaturation, followed by centrifugation;
chromatography steps
such as ion exchange, gel filtration, reverse phase, hydroxylapatite and
affinity chromatography;
isoelectric focusing; gel electrophoresis; and combinations of such and other
techniques. As is
generally known in the art, it is believed that the order of conducting the
various purification
steps may be changed, or that certain steps may be omitted, and still result
in a suitable method
for the preparation of a substantially purified protein or peptide.
There is no general requirement that the protein or peptide always be provided
in their
most purified state. Indeed, it is contemplated that less substantially
purified products will have
utility in certain embodiments. Partial purification may be accomplished by
using fewer
purification steps in combination, or by utilizing different forms of the same
general purification
scheme. For example, it is appreciated that a cation-exchange column
chromatography
performed utilizing an HPLC apparatus will generally result in a greater -fold
purification than
the same technique utilizing a low pressure chromatography system. Methods
exhibiting a lower
degree of relative purification may have advantages in total recovery of
protein product, or in
maintaining the activity of an expressed protein.
It is known that the migration of a polypeptide can vary, sometimes
significantly, with
different conditions of SDS/PAGE (Capaldi et al., 1977). It will therefore be
appreciated that
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97121475
99
under differing electrophoresis conditions, the apparent molecular weights of
purified or partially
purified expression products may vary.
High Performance Liquid Chromatography (HPLC) is characterized by a very rapid
separation with extraordinary resolution of peaks. This is achieved by the use
of very fine
particles and high pressure to maintain and adequ~~te flow rate. Separation
can be accomplished
in a matter of minutes, or a most an hour. Moreover, only a very small volume
of the sample is
needed because the particles are so small and clo~;e-packed that the void
volume is a very small
fraction of the bed volume. Also, the concentration of the sample need not be
very great because
the bands are so narrow that there is very little dilution of the sample.
Gel chromatography, or molecular sieve chromatography, is a special type of
partition
chromatography that is based on molecular size. The theory behind gel
chromatography is that
the column, which is prepared with tiny particles of an inert substance that
contain small pores,
I S separates larger molecules from smaller molecules as they pass through or
around the pores,
depending on their size. As long as the material of which the particles are
made does not adsorb
the molecules, the sole factor determining rate of flow is the size. Hence,
molecules are eluted
from the column in decreasing size, so long as the shape is relatively
constant. Gel
chromatography is unsurpassed for separating molecules of different size
because separation is
independent of all other factors such as pH, ionic strength, temperature, etc.
There also is
virtually no adsorption, less zone spreading and the elution volume is related
in a simple matter
to molecular weight.
Affinity Chromatography is a chromatographic procedure that relies on the
specific
affinity between a substance to be isolated and a molecule that it can
specifically bind to. This is
a receptor-ligand type interaction. The column material is synthesized by
covalently coupling
one of the binding partners to an insoluble matrix. The column material is
then able to
specifically adsorb the substance fiom the solution. Elution occurs by
changing the conditions to
those in which binding will not occur (alter pH, ionic strength, temperature,
etc. ).
A particular type of affinity chromatography useful in the purification of
carbohydrate
containing compounds is lectin affinity chromatography. Lectins are a class of
substances that
CA 02275438 1999-06-09
WO 98/22b05 PCT/US97/21475
100
bind to a variety of polysaccharides and glycoproteins. Lectins are usually
coupled to agarose by
cyanogen bromide. Conconavaiin A coupled to Sepharose was the first material
of this sort to be
used and has been widely used in the isolation of polysaccharides and
glycoproteins other lectins
that have been include lentil lectin, wheat germ agglutinin which has been
useful in the
purification of N-acetyl glucosaminyl residues and Helix pomatia lectin.
Lectins themselves are
purified using affinity chromatography with carbohydrate ligands. Lactose has
been used to
purify lectins from castor bean and peanuts; maltose has been useful in
extracting lectins from
lentils and jack bean; N-acetyl-D galactosamine is used for purifying lectins
from soybean; N-
acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been
used in
obtaining lectins from clams and L-fucose will bind to lectins from lotus.
The matrix should be a substance that itself does not adsorb molecules to any
significant
extent and that has a broad range of chemical, physical and thermal stability.
The ligand should
be coupled in such a way as to not affect its binding properties. The ligand
should also provide
relatively tight binding. And it should be possible to elute the substance
without destroying the
sample or the ligand. One of the most common forms of affinity chromatography
is
immunoaffinity chromatography.
X. Kits
All the essential materials and reagents required for the various aspects of
the present
invention may be assembled together in a kit. When the components of the kit
are provided in
one or more liquid solutions, the liquid solution preferably is an aqueous
solution, with a sterile
aqueous solution being particularly preferred.
For in vivo use, the instant compositions may be formulated into a single or
separate
pharmaceutically acceptable syringeable composition. In this case, the
container means may
itself be an inhalant, syringe, pipette, eye dropper, or other such like
apparatus, from which the
formulation may be applied to an infected area of the body, such as the lungs,
injected into an
animal, or even applied to and mixed with the other components of the kit.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
101
The components of the kit may also be provided in dried or lyophilized forms.
When
reagents or components are provided as a dried farm, reconstitution generally
is by the addition
of a suitable solvent. It is envisioned that the solvent also may be provided
in another container
means. The kits of the invention may also include an instruction sheet
defining administration of
the gene therapy and/or the chemotherapeutic drug.
The kits of the present invention also will typically include a means for
containing the
vials in close confinement for commercial sale such as, e.g., injection or
blow-molded plastic
containers into which the desired vials are retained. Irrespective of the
number or type of
containers, the kits of the invention also may corr~prise, or be packaged
with, an instrument for
assisting with the injection/administration or placement of the ultimate
complex composition
within the body of an animal. Such an instrument: may be an inhalant, syringe,
pipette, forceps,
measured spoon, eye dropper or any such medically approved delivery vehicle.
Additionally,
instructions for use of the kit components is typical'.ly included.
The following examples are included to demonstrate preferred embodiments of
the
invention. It should be appreciated by those of skill in the art that the
techniques disclosed in the
examples which follow represent techniques discovered by the inventor to
function well in the
practice of the invention, and thus can be considered to constitute preferred
modes for its
practice. However, those of skill in the art shouldl, in light of the present
disclosure, appreciate
that many changes can be made in the specific embodiments which are disclosed
and still obtain
a like or similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
Adenoviral vectors induce expression of IFN-Q
Specific pathogen-free female C57BL/6 mice were purchased from Jackson
Laboratory,
Bar Harbor, Maine. The mice were used when 8-12 weeks of age according to
institutional
guidelines. Animals were maintained in facilitie~~ approved by the American
Association for
Accreditation of Laboratory Animal Care and in accordance with current
regulations and standards
of the United States Department of Agriculture, Department of Health and Human
Services, and
National Institutes of Health.
CA 02275438 1999-06-09
WO 98/22605 PCT/ITS97/21475
102
Macrophages were collected by peritoneal lavage from mice given an i.p.
injection of 1.5
ml of thioglycollate broth (Baltimore Biological Laboratories, Cockeysville,
Maryland) 4 days
before harvest (Zhang et al., 1994a). The macrophages were washed with Ca2+-
and Mg2+-free
phosphate buffered saline and resuspended in serum-free minimum essential
medium (MEM), and
1 x 1 OS cells in 0.2 ml MEM were plated into 38-mm2 wells of 96-well flat-
bottomed Microtest III
plates (Falcon Plastics, Oxford, California). After 90 min, the wells were
washed with HBSS to
remove nonadherent cells. The resultant macrophage monolayer was >98% pure
according to
morphologic and phagocytic criteria.
The plasmids pxCMV and pJMl7, AdSCMV-LacZ (a recombinant adenovirus encoding
the E. toll LacZ gene) and the human transformed primary embryonic kidney 293
cell line were
obtained from Dr. W. Zhang (M. D. Anderson Cancer Center) (Chu et al., 1992).
The full coding
region of human IFN-(3 cDNA was subcloned into a pxCMV plasmid to generate the
shuttle vector
pEC-HuIFN-(3. AdSCMV-HuIFN-~i was obtained by homologous recombination of pEC-
HuIFN-~3
and plasmid pJMl7 in line 293 cells using liposome-mediated transfection with
lipofectin. The
vectors were propagated in 293 cells. The viruses released from the infected
293 cells by 3 cycles
of freezing-thawing were used without further purification to avoid endotoxin
contamination.
However, similar results were also obtained using the vectors purified by
double CsCI banding.
The virus titers were measured in 293 cells using a plaque assay (Graham and
Prevec, 1991 ).
Mouse peritoneal macrophages (bong et al., 1993a) or NIH 3T3 cells were
incubated
with AdSCMV-LacZ, a recombinant adenovirus carrying an Escherichia toll (3-
galactosidase (~3-
gal) gene under the control of a cytomegalovirus promoter (Zhang et al.,
1994b). Total cellular
RNA was extracted and expression of mIFN-~3 was analyzed in control and virus-
infected
macrophages by reverse transcriptase-polymerase chain reaction (RT-PCRTM).
Primers for (3-
actin were added into the same reaction vial to evaluate sample loading.
Total cellular RNA was extracted from control or infected cells. The RNA was
treated for
30 min at 37°C with 1 U/mg RQ 1 RNase-free DNase (Promega, Madison,
Wisconsin), and 1 mg of
the treated RNA was reverse-transcribed for 1 S min at 42°C using an
AMV reverse transcriptase
system (Promega) in a final volume of 20 ml. Resulting cDNA (5 ml/reaction)
was amplified with
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
103
2.5 U of Taq polymerase in a 50 ml reaction volume containing 10 mM Tris-HC1,
pH 9.0 at 25°C,
1.5 mM MgCl2, 50 mM KCI, 0.1 % Triton X-100, 200 mM concentrations of each of
the dNTPs,
and 200 nM each of primers 1 to 4.
Primer 1 (CCAAGAAAGGACGAACATT; SEQ ID NO:1) and primer 2
(ATCTCTGCTCGGACCACCA; SEQ ID N0:2) define a 411-by fragment of mIFN-Vii.
Primer 3
(GTGGGCCGCTCTAGGCACCA; SEQ ID N0:3) and primer 4
(CGGTTGGCCTTAGGGGTCAGGCTGG;SEQ ID N0:4) define a 245-by fragment of mouse ~i-
actin (Stratagene, La Jolla, California). Amplification was carried out on a
Perkin-Elmer-Cetus
thermal cycler for 25 cycles { 1 cycle = 94°C, 45 s; 60°C, 45 s;
and 72°C, 1 min). Thirty-microliter
aliquots of each resulting mixture were separated on 1.5% agarose gel and
viewed under ultraviolet
(UV) light (for (3-actin). The separated DNA was then transferred onto
GeneScreen nylon
membrane (NEN Research Products, Boston, MA) in 0.4 M NaOH and hybridized with
32P-labeled
mIFN-(3 cDNA fragment (Sen and Ransohoff,1993}.
Control mouse peritoneal macrophages constitutively expressed very low levels
of IFN-~
mRNA. A significant elevation of IFN-(3 mRNA was found in macrophages
incubated for 8 h
with 30 PFU/cell of AdSCMV-LacZ. The increased expression of mouse IFN-~i
(mIFN-(3) was
also observed in macrophages infected with AdSCMV-mIFN HuIFN-j3, a replication-
deficient
adenoviral vector encoding human IFN-(3 gene, ruling out the possibility that
the elevated
expression of IFN-(3 gene was caused by a toxic effect of the LacZ gene.
IFN-~3 activity was determined in macrophages and NIH 3T3 cells. Macrophages
or
NIH 3T3 cells were incubated in medium or medium containing 30 PFU/cell AdSCMV-
LacZ.
Culture supernatants were collected and irradiated on ice under a UV light for
30 min to inactivate
the virus. To evaluate IFN-(3 activity, macrophages were plated into 96-well
plates at a density of
105 cell/38-mm2 well and incubated with the samyles or increasing
concentrations of IFN-~i (Lee
BioMolecular, San Diego, California) in the presence of 1 mg/ml LPS (E coli,
O111:B4, Sigma, St.
Louis, Missouri) for 24 h. N02 in the culture supc;matants was measured as
described previously
{bong et al., 1994b). A rat monoclonal antibody against mIFN-(3 (Yamasa Shoru
Co., Tokyo,
Japan) was added to the assay to confirm that the IFN activity detected was
IFN-~3.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
104
IFN-(3 activity was not detected in culture supernatants of control
macrophages, whereas
in macrophages infected with 30 PFU/cell of AdSCMV-LacZ for 2, 24, and 48 h,
the
supernatants contained 24 ~ 5, 112 t 20, and 67 ~ 20 U/106 macrophages,
respectively. The
production of IFN-(3 by the macrophages was transient and ceased after removal
of AdSCMV-
S LacZ. In contrast, neither control nor AdSCMV-LacZ-infected NIH 3T3 cells
expressed IFN-~3
on the mRNA (RT-PCRTM analysis) or protein (activity) level.
EXAMPLE 2
Neutralization of Endogenous IFN-j3 Increases Expression of a Trans~'
In the next set of studies, macrophages and NIH 3T3 cells were incubated with
increasing
concentrations of AdSCMV-LacZ, and (3-gal activity was determined 48 h later.
The cultures in
96-well plates were rinsed twice with PBS and lysed with 80 ml/well of lysis
buffer (23 mM
NaH2P04, 77 mM Na2HP04, 0.1 mM MnCl2, 2 mM MgS04, 40 mM (3-mercaptoethanol,
0.1
Triton X-100, pH 7.3) at 37°C for 20 min. Twenty microliters of O-
nitrophenyl-(3-D-
galactopyranoside (ONPG) in warmed (37°C) substrate buffer (lysis
buffer without Triton X-100)
at 4 mg/ml was added to each well and allowed to react for 10 min (for NIH 3T3
cells) or 60 min
(for macrophages). The reaction was stopped by the addition of 50 ml/well of 1
M Na2C03. The
plates were read at 450 nm in a microplate reader (Dynach 5000). The (3-gal
activity was calculated
as U = (380 x A450)/10 or 60 (min) (MacGregoret al., 1991).
A rat monoclonal antibody against mIFN-~i or an equivalent amount (0.25 mg/ml)
of rat
IgG was added during the infection period at 10 neutralizing units (NU)/ml,
which was sufficient to
neutralize 100 IU/ml of IFN-~3 activity. At all concentrations of the vector,
the anti-IFN-(3
antibody, but not the control, nonspecific IgG, increased LacZ gene expression
threefold (FIG. 1 A).
The effect of the anti-IFN-(3 antibody was dose dependent, beginning at 1
NU/ml and reaching a
plateau at 20 NU/ml (FIG. 1B). (3-gal activity was significantly increased in
AdSCMV-LacZ-
infected NIH 3T3 cells (FIG. 1 C) and was not altered by the presence of the
anti-IFN-(3 antibody.
Even in the presence of the optimal concentration (20 NU/ml) of anti-IFN-~3
antibody, (3-gal
activity was higher in the NIH 3T3 cells than in macrophages. Whether this
difference was due to
fewer adenovirus receptors on macrophages (Chu et al., 1992) or to inhibition
in macrophages of
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
105
viral infection by generation of IFN-a (Gessani et al., 1987) or nitric oxide
(NO) (Croen, 1993;
Karupiah et al., 1993; Melkova and Esteban, 1995) is unclear.
Next, the inventors determined whether the continuous presence of the antibody
was
required to maintain enhanced expression of the transgene. Macrophages were
infected with
AdSCMV-LacZ in the presence of anti-IFN-/3 antiibody. Two days later, the
macrophages were
incubated in medium alone or medium containing 10 NU/mI of anti-IFN-(3
antibody. Macrophages
infected in the presence of the antibody expressed higher levels of (3-gal
activity than control
macrophages. The (3-gal activity was maintained for up to 7 days in these
macrophages regardless
of whether they were subsequently cultured with or without anti-IFN-(3
antibody. Moreover, the
addition of fresh antibody after the initial infection F~eriod did not further
increase ~i-gal activity.
After their infection with AdSCMV-LacZ, analysis of ~i-gal activity in single
cells was
performed by flow cytometry (Fluorescence-Activated Cell Sorting; FACS).
Macrophages were
cultured for 48 h with constant rocking. After a wash, the (3-gal activity was
determined using a
FluoReporter LacZ Flow Cytometry kit (Molecular Probes, Inc., Eugene, Oregon)
following
manufacturer's instructions. The analysis of (3-gal activity revealed two
overlapping populations of
macrophages. The majority (75%) of macrophages infected in the absence of the
antibody were
weakly fluorescent, with a mean relative fluorescence intensity (RFI) of 3.2;
25% exhibited
stronger (RFI=22) ~i-gal activity. Similar results were obtained with
macrophages infected in the
presence of nonspecific rat IgG. The fluorescence intensity of macrophages
infected with
AdSCMV-LacZ in the presence of the anti-IFN-~i antibody was significantly
higher, with 75% of
the cells having an RFI of 15 and 25% having an RF~ I of 95 (FIG. 2).
EXAMPLE 3
Suppression of Transduction by Exogenous IFN-Q
Infection of NIH 3T3 cells with AdSCM'~-LacZ did not generate expression of
IFN-(3
(Example 1 ). The inventors therefore analyzed whether the addition of
exogenous IFN-(3
suppressed transduction efficiency. Indeed, the addition of 1 to 1000 U/ml
mIFN-(3 to NIH 3T3
cells during infection with AdSCMV-LacZ produced a significant dose-dependent
reduction in
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
106
expression of ~3-gal activity (FIG. 3A). This inhibition was blocked by anti-
IFN-~3 antibody but not
by IgG (FIG. 3A).
Because macrophages respond to infection of AdSCMV-LacZ by producing IFN-(3,
the
S inventors next investigated whether macrophages (which are relatively
resistant to infection) could
affect AdSCMV-LacZ-mediated transduction of NIH 3T3 cells. NIH 3T3 cells were
plated alone
or onto monolayers of macrophages (1:1 ratio) and infected with the vector in
the presence of rat
IgG (control) or anti-IFN-(3 antibody. (3-gal activity in control cocultures
(incubated in medium or
with rat IgG) was ~50% lower than that in NIH 3T3 cells cultured alone (FIG.
3B). Infection of the
cocultures in the presence of anti-IFN-(3 antibody partially prevented this
inhibition (P<0.05)
(FIG. 3B).
EXAMPLE 4
Production of Metalloelastase by Murine PEM
Specific pathogen-free female C57BL/6 mice were purchased from the Jackson
Laboratory (Bar Harbor, ME). The mice were used when 8 to 12 weeks of age
according to
institutional guidelines. Animals were maintained in facilities approved by
the American
Association for Accreditation of Laboratory Animal Care and in accordance with
current
regulations and standards of the U.S. Department of Agriculture, Department of
Health and
Human Sciences, and National Institutes of Health.
PEM were collected by peritoneal lavage with HBSS from mice given an
imraperitoneal
injection of 1.5 ml of thioglycollate broth (Baltimore Biological
Laboratories, Cockeysville,
MD) 4 days previously (Saiki and Fidler, 1985). The PEMs were pelleted and
resuspended in
Eagle's MEM without serum, and 3 x 105 cells in 0.5 ml MEM were plated in 48-
well cell
culture clusters (Costar Co., Cambridge, MA). After 2 h, the wells were washed
with EMEM to
remove nonadherent cells. The resultant macrophage monolayer was >98% pure
according to
morphologic and phagocytic criteria. These cultures were then immediately
treated as described
below.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
107
Murine PEM were plated for 2 h in serum-:free medium and then all nonadherent
cells
were removed. Serum-free DMEM-F 12 medium was added to the cultures. Forty-
eight hours
later, the culture supernatants were collected and treated for 20 rnin with
the metal ion chelators
EDTA (2 mM), EGTA (2 mM), or 1, I 0-phenanthraline ( 1 mM), which are potent
inhibitors of
MMPs (Barrett, I 977; Knight, 1977); with the serine protease inhibitors PMSF
( 10 mM),
aprotinin ( 100 ~,g/ml), or trypsin inhibitor ( I 00 pg/ml) (Banda et al.,
1987); or with the
cysteinyl-proteinase inhibitor leupeptin ( 100 ~g/ml ) (Barrett, 1994).
Aliquots of control and
treated supernatants were collected and spun at 3,000 x g at 4°C for 30
min to remove cell
debris, and then added to 3H-labeled elastin. The elastase activity was
determined 18 h later.
Elastase activity was assayed by a method described previously (Banda et al.,
1987).
Briefly, bovine ligament elastin was radiolabeled with [3HJsodium borohydride
(ICN) as
described previously. Aliquots (0.1 ml) of serum-free conditioned medium were
added to 200
pg of insoluble 3H-labeled elastin in 0.1 M of Tris-FICI (pH 8.0), 5 mM CaCl2
and 166.6 ~.g/ml
sodium dodecyl sulfate in a total volume of 0.3 ml. The reaction was carried
out at 37°C for 18 h
with constant shaking and terminated by centrifugation in a microcentrifuge at
10,000 x g for 3
min. Radioactivity in aliquots ( I 00 pl) of supernata~its (containing
degraded 3H-labeled elastin)
was then measured in a liquid scintillation counter (;Beckman). A unit of
elastinolytic activity
was defined as the amount of enzyme degrading 1 ~g of 3H-labeled elastin/h
(Banda et al.,
1987).
As shown in Table 4, control PEM produced 22.2 ~ 1.0 U of elastase
activity/106 cells.
The metal ion chelators (EDTA, EGTA, and 1,10-phf;nanthraline) significantly
inhibited elastase
activity (p<0.001 ), whereas the serine proteinase inhibitors (PMSF,
aprotinin, and trypsin
inhibitor) and cysteinyl-proteinase inhibitor (leupeptin) did not. These data
confirm that murine
PEM produce elastase (Werb and Gordon, 1975; 'White et al., 1977) which is
classified as
metalloproteinase (Shapiro, 1994; Senior et al., 1989; Banda and Werb, 1981 ).
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
108
TABLE 4
Production of Metalloelastase by Murine PEM
Protease inhibitors Concentration Elastas 6 activity percent inhibitionb
(U/IO cells)
Medium control 22.2 ~ 1.0
EDTA 2 mM 0.7 t 0.1 96.8
EGTA 2 mM 1.4 ~ 0.2 93.7
1,10-Phenanthraline1 mM 1.3 ~ 0.1 93.9
PMSF 10 mM 24.6 ~ 2.3 0.0
Aprotinin 100 mg/ml 23.1 ~ 1.9 0.0
Trypsin inhibitor100 mg/ml 19.8 ~ 2.1 10.8
Leupeptin 100 mg/ml 22.7 ~ 2.6 0.0
aPEM culture supernatant was incubated 20 min with different concentrations of
the indicated
protease inhibitors prior to the addition of radiolabeled elastin substrate.
bPercent inhibition of elastase activity in comparison to control
supernatants.
p<0.001.
EXAMPLE 5
Treatment of PEM with IFN-y and LPS Suppresses Elastase Production
The inventors determined whether LPS and IFN-y, which activate PEM to become
tumoricidal (Saiki and Fidler, 1985), would also regulate the production of
elastase. PEM were
incubated in serum-free DMEM-F 12 medium (control) or medium containing LPS (
100 ng/ml),
IFN-y ( 100 U/ml), or LPS ( 100 ng/ml) plus IFN-y ( 100 U/ml). At different
times, elastinolytic
activity in the culture supernatants was determined by the degradation of 3H-
labeled elastin
(FIG. 4). The production of elastase by control PEM was cumulative, reaching a
peak by 48 h.
A significant reduction in elastase activity (p<0.001 ) was found in PEM
treated with LPS, IFN-y,
or LPS plus IFN-y. These results indicate that tumoricidal activation of
macrophages by LPS
plus IFN-y (Saiki and Fidler, 1985) does not correlate with enhanced elastase
activity (FIG. 4).
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
109
Since the treatment of macrophages with LPS plus IFN-y induces the production
of nitric
oxide (Stuehr and Nathan, 1989), superoxide, and hydrogen peroxide (Nathan,
1982), which can
interfere with cellular signaling pathways (Schreck et al., 1991; Moncade et
al., 1991 ) and
protein synthesis (Schreck et al., 1991 ), the inventors examined whether the
inhibition of elastase
in macrophages treated with LPS and IFN-y was associated with production of
these free
radicals. PEM were incubated with LPS ( 100 ng/rr~l), IFN-y ( 100 U/ml), or
LPS ( 100 ng/ml)
plus IFN-y ( 100 U/ml) in the absence or presence of 1 mM of the specific
inducible nitric oxide
inhibitor N-methyl arginine (NMA) (Stuehr and Griffith, 1992; Hibbs et al.,
1987).
IO Nitrite concentration in culture supernatants was determined by a
micropiate assay as
described by Ding et al. (1988). Briefly, 50-p.l samples harvested from PEM-
conditioned
medium were treated with an equal volume of Gniess reagent ( 1 % sulfanilamide
- 0.1
naphthylethylene diamine dihydrochloride - 2.5% H,P04) at room temperature for
10 min. The
absorbance at 540 nm was monitored with a mic~roplate reader. Nitrite
concentration was
determined by using sodium nitrite as a standard.
NMA significantly inhibited production of NO measured as the level of nitrites
(Senior
et al., 1991 ) in the culture supernatants (FIG. SA) but did not prevent the
inhibition of elastase
activity (FIG. SB). Similarly, treatment of PEM vvith optimal concentrations
of the oxygen
radical scavengers superoxide dismutase or catalase (Blake et al., 1987;
Cheeseman and Slater,
1993) did not abrogate the inhibition of elastase acti~rity subsequent to
treatment with LPS plus
IFN-y (Table 5). Collectively, these data demonstratf; that LPS and IFN-y
inhibit the production
of elastase in PEM by a mechanism that is independent of nitric oxide,
superoxide, and hydrogen
peroxide.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
110
TABLE 5
Inhibition of Elastase Activity by LPS and IFN-'y is Independent of
Superoxide and Hydrogen Peroxide
Elastase activity (U/106 cells)
Superoxide dismutase (U/ml) Catalase (U/ml)
Treatments Medium 100 300 100 1000
None 18.211.8 16.411.9 15.81.6 19.52.1 14.02.1
LPS 3.0~0.3b 2.9t0.7b 1.8~0.8b 1.9f0.2b 1.8~O.Sb
IFN-g 1.8~0.3b 1.9~0.4b 2.1~O.Sb 1.8~0.4b 1.7~O.Sb
LPS+IFN-g 2.2tO.Sb 2.5t0.3b 1.9t0.6b 2.1 ~O.Sb 2.0~0.4b
aPEM were incubated in serum-free DMEM-F 12 alone or medium containing LPS (
100
ng/nl) or IFN-y ( 100 U/ml) with or without indicated concentrations of
superoxide
dismutase or catalase. The culture supernatants were collected after 48 h and
assayed for
elastinolytic activity as described in Materials and Methods. Values are mean
~ SD of
triplicate cultures. This is a representative study of 2.
p<0.001.
EXAMPLE 6
Regulation of Elastase Activity in PEM by Cytokines
The inventors determined whether the expression of elastase by macrophages can
be
regulated by cytokines. To do so, the inventors incubated PEM with serum-free
medium
(control) or medium containing different concentrations of cytokines for 48 h.
Culture
supernatants were harvested at 3,000 x g at 4°C for 30 min to remove
cell debris, and tested for
elastinolytic activity. Treatment of marine PEM with 100 U/ml of recombinant
mouse IFN-y
significantly inhibited the elastase activity (98% inhibition, p<0,001). In
contrast, treatment of
PEM with different concentrations of IFN-13, IL-la, IL-113, IL-2, IL-4, IL-6,
IL-8, IL-10, TNF-a,
TGF-a, TGF-13, bFGF, and marine 3E (MCF-1) did not alter the production of
elastase nor the
viability of the macrophages.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
111
The inventors next examined the effect of th~~ above cytokines on production
of elastase
by resident peritoneal macrophages. The resident macrophages secreted lower
levels of elastase
as compared to thioglycollate-elicited macrophages x;2.65 ~ 0.32 vs. 19.58 ~
1.23 U/ I 06 cells/48
h). Elastase activity was decreased in the resident macrophages by incubation
with LPS and
IFN-y. Unlike the inflammatory macrophages, the M-CSF and GM-CSF did not
affect secretion
of elastase by resident peritoneal macrophages.
Since colony-stimulating factors (CSF) have been shown to enhance the
proliferation of
macrophages and modulate their function (Brach and Herrman, 1991; Crosier and
Clark, 1992;
Metcalf, 1990; Chen et al., 1988; Sampson-Johannes and Cerlino, 1988), the
inventors examined
whether treatment of PEM with G-CSF, M-CSF, or GM-CSF altered the production
of elastase.
PEM were incubated in medium (control) or medium containing different
concentrations of the
CSFs for 48 h, and then the culture supernatants were collected at 3,000 x g
at 4°C for 30 min to
remove cell debris and assayed for elastinolytic activity. Treatment of PEM
with GM-CSF
enhanced elastase production in a dose-dependent manner (FIG. 6A), whereas
treatment of PEM
with M-CSF inhibited it (FIG. 6B). G-CSF treatment did not affect elastase
production
(FIG. 6C).
In the next set of studies, the inventors examined whether the treatment of
PEM with
GM-CSF could abrogate (or reverse) the inhibition of elastase activity
produced by LPS and
IFN-y. As shown in Table 6, treatment of PEM with GM-CSF (10-1000 U/ml)
increased the
production of elastase from 11.3 U/ml to 32.9 U/ml hut did not prevent the
inhibition of elastase
activity in macrophages incubated with LPS and IFN-y.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97t21475
112
TABLE 6
Elastase Activity in PEM Incubated With GM-CSF in the Presence of LPS and IFN
y
Elastase activity (U/106 cells)
0 U/m! 10 U/ml 100 U/ml 1000 U/ml
Treatment9 GM-CSF GM-CSF GM-CSF GM-CSF
Medium 11.3 ~ 0.9 14.91 1.7 21.1 ~ 1.8 32.9 ~ 2.3
LPS 2.0 ~ 0.4b 2.4 ~ 0.4b 4.3 t 0.7b 6.9 t 0.9b
IFN-y 3.8~0.3b 5.7~0.9b 10.40.8 14.9 1.3
LPS+IFN-y 2.2t0.3b 2.4t0.5b 2.8~0.9b 5.0~0.7b
aPEM were incubated in serum-free DMEM-F 12 alone or medium containing LPS (
100
ng/ml) or IFN-y ( 100 U/ml) with different concentrations of recombinant GM-
CSF. The
culture supernatants were collected after 48 h and assayed for elastinolytic
activity as
described in Materials and Methods. Values are the mean of elastase activity
(U/106
cells) ~ S.D. of triplicate cultures. This is a representative study of 3.
p<0.001.
Elastolytic activity was also determined by K-elastin zymography (Senior et
al., 1991 ).
Briefly, aliquots of conditioned medium from control and test PEM were
subjected to substrate
gel electrophoresis. PEM were incubated in DMEM-F 12 alone or with LPS ( 100
ng/ml), IFN-y
(100 U/ml), GM-CSF (1000 U/ml), M-CSF (10 ng/ml), or G-CSF (1000 U/ml). The
supernatants were collected after 48 h, concentrated, and analyzed by elastin
zymography. The
samples were applied without reduction to a 12% SDS-polyacrylamide gel
impregnated with 1
mg/ml K-elastin (ETNA-elastin, Elastin Products, Owensville, MO). Following
electrophoresis,
the gels were washed twice for 15 min each time in washing buffer (50 mM Tris,
pH 7.5, 5 mM
CaCl2, 1 ~,M ZnCl2, 2.5% Triton X-100), and then incubated at 37°C for
48 h with shaking in the
buffer that also contained 1 % Triton X-100. The gels were stained with a
solution of 0.1
Coomassie brilliant blue R-250. Elastolytic activity was indicated by the
appearance of a clear
zone of lysis in a blue background. Molecular weight of the elastolytic bands
were estimated by
using prestained molecular weight markers (BioRad).
CA 02275438 1999-06-09
WO 98/22605 PCT/US97121475
113
Macrophages secrete 22-kDa active MME. The high molecular weight forms may
represent differentially cleaved fragments of the 5_S-kDa proenzyme (Sampson-
Johannes and
Cerlino, 1988). As revealed by zymogram, the changes in the elastolytic
activity of macrophages
treated with LPS, IFN-y, GM-CSF, or G-CSF resulted from alteration in the
level of
metalloelastase protein.
EXAMPLE. 7
Northern Blot Anahrsis
The inventors determined whether treatment: of PEM with various cytokines or
LPS
regulated the expression of MME mRNA. PEM were incubated in medium alone or
medium
containing LPS ( 100 ng/ml), IFN-y { 100 U/ml), GM-(~SF ( 1000 U/ml), M-CSF (
10 ng/ml), or G-
CSF ( 1000 U/ml), at which point mRNA was isolated and analyzed for MME-
specific mRNA
transcripts on northern blots. Using the Fast Track mRNA isolation kit
(Invitrogen, San Diego,
CA), polyadenylated mRNA was extracted from 5 x l0' PEM that had been cultured
in medium
alone or with different agents. mRNA (2.5 pg mRNA/lane) was electrophoresed on
1
denaturing formaldehyde/agarose gel, electrotransferred at 0.6 A to a
GeneScreen nylon
membrane (DuPont Co., Boston, MA), and UV cross-linked with 120,000 p,J/cm2
using a UV
Stratalinker 1800 (Stratagene, La Jolla, CA). Hybridi.zations were performed
with 1.7-kb cDNA
fragment corresponding to marine macrophage elastase (MME; Shapiro et al.)
1992), human
TIMP-1 cDNA that detects a mouse 0.9 kb transcript (Campbell et al., 1987),
and 1.3-kb gene
fragment corresponding to rat GAPDH cDNA (F~rt et al., 1985) as described
previously
(Radinsky et al., 1987). Nylon filters were washed three times at 55-
60°C with 30 mM NaCI, 3
mM sodium citrate (pH 7.2), and 0.1 % sodium dodecyl sulphate (w/v).
The cDNA probes used in this analysis were a 1.3-kb PstI cDNA fragment
corresponding
to rat GAPDH (Fort et al., 1985), a 1.7-kb BamH:f cDNA fragment of marine
macrophage
elastase (MME) (obtained from Dr. S. D. Shapiro, Sn. Louis, MO) (Shapiro et
al., 1992), and a
0.63-kb EcoRI-KpnI gene fragment corresponding o~o metalloproteinase inhibitor-
1 (TIMP-1 )
(obtained from Dr. W. Stetler-Stevenson, NIH, NCI, l3ethesda, MD). Each cDNA
fragment was
purified by agarose gel electrophoresis, recovered using GeneClean (Bio 101,
Inc., La Jolla, CA),
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
114
and radiolabeled by the random primer technique using [a-32P]-dNTP (Feinberg
and Vogelstein,
1983).
Control PEM expressed a specific mRNA transcript for MME. Treatment of PEM
with
LPS or IFN-y inhibited steady-state expression of MME mRNA by 70% and 80%,
respectively.
Treatment of PEM with GM-CSF increased expression of MME mRNA (40%), whereas M-
CSF
decreased it by 70% and G-CSF had little to no effect.
Since elastase activity is dependent on the balance between production of
elastase and
TIMP-1 (Campbell et al., 1987; Shapiro et al., 1992; Welgus et al., 1992;
Docherty et al., 1985),
the inventors examined the steady-state expression of TIMP-1 mRNA in PEM.
Normal
(untreated) PEM did not express TIMP-l, whereas PEM treated with LPS and M-CSF
demonstrated a 6.1- and S.1-fold increase in TIMP-1-specific mRNA transcripts,
respectively.
Treatment of PEM with IFN-y, GM-CSF, or G-CSF slightly increased the steady-
state level of
TIMP-1 mRNA. Collectively, these data show that the expression of TIMP-1 by
macrophages is
differentially regulated by different CSFs and suggest a potential mechanism
by which treatment
of PEM with M-CSF would inhibit elastase activity.
EXAMPLE 8
Upregulation of MME Expression
The inventors determined whether the upregulation of steady-state mRNA was due
to
increased transcription or enhanced stability of the message (Sessa et al.,
1992; Weisz et al.,
1994; Vodvotz et al., 1993). The inventors carried out nuclear run-on assay
using nuclei isolated
from inflammatory macrophages. PEM (5 x 10') were cultured 4 h in medium
(control) or
medium containing GM-CSF (1000 U/ml), and were then harvested. Cells were then
lysed,
nuclei were isolated and incubated with a transcription buffer containing a
32P-labeled UTP to
label nascent RNA molecules as previously described (Sessa et al., 1992; Weisz
et al., 1994)
with modifications. After in vitro transcription, nuclear RNA was isolated
using TRI reagent
(Molecular Research, Inc., Cincinnati, OH), and hybridized to immobilized DNA
probes.
Following hybridization, filters were washed and autoradiographed.
CA 02275438 1999-06-09
WO 98/22605 PCT/L1S97/21475
115
32P-labeled RNA was normalized to the lowest sample to achieve 5 x 105 cpm/ml
of
hybridization buffer consisting of 10 mM Tris, pH 7.4, 10 mM EDTA, 0.2% SDS,
300 mM
NaCI, 0.1 % sodium pyrophosphate, 1 x Denhardt's solution, and 100 p,g/ml
salmon sperm DNA.
For hybridization, 10 ~g of a marine MME cDNA- containing plasmid and a 10 ~g
of a rat
S GAPDH cDNA containing plasmid were denatured and dot blotted on GeneScreen
membrane
(DuPont, Boston, MA). After 72 h hybridization, the filters were washed in 2x
SSC at 65°C, and
then in 2x SSC containing 0.1% SDS at 65°C. Air-dried filters were
exposed to X-ray film. The
relative transcriptional rate was determined as a ratio of the average area of
MME-specific signal
and GAPDH-specific signal using a personal densitometer {Molecular Dynamics,
Sunnyvale,
CA).
Expression of the MME gene was quantified by densitometry of autoradiograms
using
Image Quant software program (Molecular Dynamics, Sunnyvale, CA). The value
for each
sample was calculated as the ratio of the average areas of MME-specific mRNA
transcripts to the
1.3-kb GAPDH mRNA transcript in the linear range of the film. The rate of in
vitro transcription
determined by densitometric analysis of autoradiograms demonstrated that GM-
CSF induced the
transcription of the MME gene (30%) as compared to the control.
To determine whether GM-CSF affected the stability of MME mRNA transcripts,
PEM
were incubated for 18 h in medium alone or medium containing 1000 U/ml GM-CSF.
The cells
were washed and de novo synthesis of RNA was inhibited by 10 pg/ml actinomycin-
D (Docherty
et al., 198S). RNA was extracted at different time points and separated on 1 %
agarose,
transferred onto a nylon membrane, and probed with 32P-labeled MME and GAPDH
cDNA
probes. As shown in FIG. 7, treatment of macrophages with GM-CSF resulted in
stabilization of
2S MME mRNA as compared to the medium control.
EXAMPLE; 9
Resection of Local Subcutaneous Tumors and Outgrowth of Lung Metastases
The inventors determined whether the excision of a local ("primary")
subcutaneous 3LL
carcinoma would enhance the growth of spontaneovus lung metastases. CS7BL/6
mice (8-12
weeks old) were implanted s.c. with cells from 3LL-met (metastatic) or 3LL-nm
(nonmetastatic)
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
116
variants. The nonmetastatic variant 3LL-run was isolated from a 3LL tumor
originally obtained
from the National Cancer Institute Tumor Bank (NCI-Frederick Cancer Research
Facility,
Frederick, MD) (Talmadge and Fidler, 1982). The metastatic variant 3LL-met was
obtained
from Dr. M. O'Reilly (Harvard Medical School, Boston, MA) (O'Reilly et al.,
1994). Both
tumor cell lines were maintained in tissue culture in Eagle's minimal
essential medium (MEM)
supplemented with 10% fetal bovine serum (FBS), sodium pyruvate, nonessential
amino acids,
L-glutamine, and a twofold vitamin solution. Adherent cultures were maintained
on plastic and
were incubated in 5% C02-95% air at 37°C. The cultures were free of
Mycoplasma and
pathogenic mouse viruses.
Subcutaneous tumors (8-12 mm in diameter) were resected aseptically. All
necrotic
zones were removed and the viable tissue was minced and dissociated with
collagenase (Type I,
200 Ulml) and DNase (270 U/ml) (Sigma Chemical Co., St. Louis, MO) as
described previously
(Dong et al. , 1994a). Cells were suspended in MEM containing 10% FB S and
plated at 5-10 x
106 viable cells/T150 flask. After a 3-hr adherence, the cultures were rinsed
and given fresh
medium. Forty-eight hours later, the adherent tumor cells were harvested by
brief trypsinization,
washed in MEM-10% FBS, and resuspended in Hanks' balanced salt solution
(HBSS). Aliquots
of 106 cells in 0.1 ml of HBSS were injected into the dorsal subcutis in the
proximal midline.
When tumors were 12-15 mm in diameter, the mice were anesthetized with
methoxyflurane. The
tumors in one group of mice were surgically excised, and the area closed with
metal wound clips.
The other group underwent a sham surgical procedure, which left the s.c.
tumors intact. The
mice were monitored daily and killed 10-14 days after surgery. The lungs were
weighed and
fixed in Bouin's solution. The tumor nodules were counted under a dissecting
microscope.
Although the two variant 3LL carcinoma cell lines had similar growth patterns
in culture,
the 3LL-met produced rapidly growing tumors, and the 3LL-nm cells produced
slow-growing
tumors in the dorsal subcutis of syngeneic mice. Specifically, the s.c. tumors
reached 12-15 mm
in diameter on days 14 and 28 for the 3LL-met and 3LL-nm cells, respectively.
The 3LL-run
tumors did not produce visible lung metastases regardless of whether the local
s.c. tumor was
resected or not (even after 60 days). In contrast, on day 28 of the study, the
3LL-met s.c. tumors
produced a median of 10 lung metastases in mice with progressively growing
s.c. tumors. In
mice with resected s.c. tumor, the median number of visible lung metastases
was 61 (P>0.05),
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
117
and the size of the lung metastases was significantly enhanced (P<0.01 )
(Table 7). These results
show that the surgical resection of a metastatic variant of the 3LL tumor
significantly enhances
the size of spontaneous lung metastases.
TABLE T
Enhanced Growth of Spontaneous 3LL Lung Metastases in Mice Subsequent to
Resection of the Primary Subcutaneous Tumor
Lung Metastases Lung Weight
Cell Lines Treatment Median Range (mg)
3LL-nm Sham surgery 0 - 200 ~ 16
Resected 0 - 205 ~ 18
3LL-met Sham surgery I 0 0-90 251 ~ 14
Resected 61 a 34-145 474 ~ 29b
C57BL/6 mice were injected s.c. (dorsal proximal midline) with 1 x 106 3LL
cells (derived from
s.c. tumors). When the tumors reached 12-15 mm in diameter (10-14 days for 3LL-
met and 24-28
days for 3LL-nm cells), the mice were anesthetized. The s.c. tumors were
resected from one group
of mice (n=10). The other group underwent sham-surgery. The mice were killed 2
weeks later.
The Iungs were weighed and fixed in Bouin's solution, and spontaneous
metastases were counted
under a dissecting microscope.
I 5 aP>0.05.
bP<0.01.
EXAMPLE 10
Macrophage Infiltration into s c Tumors and Exuression of Metalloproteinases
Macrophages in 3LL tumors or in cultures established from these tumors were
identified
by immunohistochemistry using the macrophage-specific F4/80 antibody
(Austyn.ar~d Gordon,
1981 ). Subcutaneous tumors (8-10 mm in diameter) were resected and the tumor
samples were
fixed in formalin for hematoxylin and eosin staining or in liquid nitrogen for
immunohistochemical staining using F4/80. Sections (8-10 mm) of frozen tumor
tissue or
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
118
cultured cells fixed with 0.125% glutaraldehyde in PBS were treated with a rat
monoclonal F4/80
antibody followed by gold-labeled secondary antibody as described in detail
previously (Bucana
et al. , 1992).
Immunohistochemistry staining of cryostat sections using marine macrophage-
specific
antibody F4/80 revealed that both 3LL-nonmetastatic (nm) and 3LL-metastatic
(met) s.c. tumors
were infiltrated by macrophages; the density in the 3LL-nm tumors was higher.
A similar
pattern of staining was observed using antibody against scavenger receptor
(Fraser et al. , 1993 ),
which also identifies macrophages.
Next, the expression of MMPs in the 3LL s.c. tumors and their cultured cells
was
examined. The mRNA was extracted from tumor tissue or cell cultures (>3
passages in culture)
using the Fast-Track kit (Invitrogen, San Diego, CA). For Northern blot
analysis, 1 p,g/lane of
mRNA was fractionated on 1 % denaturing formaldehyde/agarose gels,
electrotransferred to
GeneScreen nylon membrane (DuPont Co., Boston, MA), and UV cross-linked with
120,000
mJ/cm2 using a UV Stratalinker 1800 (Stratagene, La Jolla, CA). Hybridizations
using cDNA
probes were performed as previously described (Dong et al. , 1994a). The
filters were washed
two or three times at 50-60°C with 30 mM NaCI/3 mM sodium citrate, pH
7.2/0.1 % sodium
dodecyl sulfate. The DNA probes used were cDNA fragments corresponding to rat
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Dong et al., 1994b), MMP-2
(ATCC,
Rockville, MD), MMP-9 (Levy et al., 1991 ), and MME (Shapiro et al., 1992).
mRNA
expression was quantified on an LKB Ultrascan XL laser densitometer (Pharmacia
LKB
Biotechnology, Uppsala, Sweden). Each sample measurement was calculated as the
ratio of the
average area of the proteinase transcripts to that of the GAPDH transcript.
The quantitative analysis of proteinase expression is summarized in Table 8.
CA 02275438 1999-06-09
WO 98/22605 PCT/ITS97121475
119
TABLE8
Expression of Proteinase mRNA Transcripts in 3LL Tumors and Cultured Cells
MMP mRNA 3LL-nm 3LL-met
(MMP/GAPDI-n Tumor Cell Culture: Tumor Cell Culture
MME 339a 1 121 1
MMP-2 S 1 13 45
MMP-9 99 1 16 1
aT'he level of expression of the MMP genes vvas quantitated by densitometry
readings of
autoradiograms using the ImageQuant software program (Molecular Dynamics).
Each sample
measurement was expressed as the ratio of the average; area under the curve of
the specific mRNA
transcripts to 1.3-kb GAPDH mRNA transcripts.
High levels of MME mRNA were detected in both 3LL-nm and 3LL-met tumor
tissues,
low Levels were detected in the 3LL cells cultured in vitro. Correlated with
the extent of
macrophage infiltration, the 3LL-nm tumors expre;csed a significantly higher
level of MME
mRNA than did the 3LL-met tumors. The 3LL-nrn tumors also expressed a higher
level of
MMP-9 than did the 3LL-met tumors. Neither 3LL-run nor 3LL-met cultures
expressed MMP-9
transcripts. 3LL-nm and 3LL-met s.c. tumors expressed similar levels of MMP-2
mRNAs but
only 3LL-met cells expressed MMP-2 mRNA in culW re.
EXAMPLE 11
Expression of MME and Generation of Angiostatin
The above data indicate that the predominant: proteinase in the 3LL tumors was
MME.
Since elastase has been shown to cleave plasminogen to fragments that include
angiostatin
(O'Reilly, et al., 1994), the inventors next determined whether the MME in the
3LL tumors is
associated with generation of angiostatin activity. (:ells isolated by
enzymatic dissociation of
3LL-met tumors were cultured (as in Example 9 above). Immediately after
dissociation and
subsequent to a different number of passages in culh~re (to deplete
macrophages), the inventors
determined macrophage content (immunohistochemi stry staining with the
macrophage specific
F4/80 antibody; see Example 10 above), MME mRNA (northern blot as in Example
10 above),
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
120
MME activity in the culture supernatant (enzymatic assay), and generation of
angiostatin
subsequent to the addition of plasminogen (bioassay).
Elastase activity in the conditioned medium was determined by a method
described
previously using [3H)-NaBH4-reduced elastin as a substrate (Werb et al.,
1986). The samples
were mixed in reaction buffer { 100 mM Tris/HCI, 5 mM CaCl2, 0.2 mg/ml SDS and
0.006%
NaH3) and incubated at a concentration of 600 mglml at 37°C for 16 hr.
Free-form 3H release
was monitored, and the enzyme activity was expressed as cpm/reaction.
Angiostatin activity, i. e. , inhibition of endothelial cell proliferation,
was determined as
described previously (O'Reilly et al., 1994). Briefly, bovine capillary
endothelial cells {BCE),
obtained from Dr. O'Reilly {Harvard Medical School, Boston, MA) were seeded
onto gelatinized
24-well plates at 1.25 x 104/well/0.5 ml DMEM-10% calf serum (CS) supplemented
with 3
ng/ml of human bFGF (Genzyme, Cambridge, MA) in 10% C02 (O'Reilly et al.,
1994). The
cells were allowed to adhere overnight, rinsed, and incubated with 0.25
ml/well DMEM-5% CS
or test samples for 20 min. Additional medium containing bFGF was then added
to a final
concentration of 1 ng/ml at 0.5 ml/well. Seventy-two hours later, the cells
were harvested by
trypsinization and counted. Angiostatin activity was expressed as percent
inhibition of
endothelial cell growth in culture.
The data shown in FIG. 8A, FIG. 8B, FIG. 8C and FIG. 8D demonstrate that, with
increasing passage number, the number (content) of macrophages decreased, and
after three
passages in vitro, the inventors found no evidence of macrophages among the
3LL cells
(FIG. 8A). The level of MME transcript (FIG. 8B) and elastase activity (FIG.
8C) directly
correlated with the number of macrophages in the cultures. Human plasminogen
was added to
the cultures (at different passages). The supernatant fluids were recovered 72
hr later and tested
for angiostatin activity. The highest angiostatin activity was found in
cultures containing the
highest number of macrophages (immediate cultures, passage 0) and declined
with increasing
passage number. No angiostatin activity was found in cultures depleted of
macrophages or in the
absence of plasminogen (FIG. 8D). The angiostatin activity (antiproliferation)
was specific for
the endothelial cells: It did not inhibit division of 3LL cells, B 16 melanoma
cells, or NIH-3T3
cells, agreeing with a published report (O'Reilly et al., 1994).
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
121
The elastinolytic activity detected in the 3LL-met tumor was a MME. The
inventors base
this conclusion on the results of studies using various selective proteinase
inhibitors (Table 9).
TABLE 9
Identification of Elastase Derived from 3LL Tumor Tissue as Metalloproteinase
1.10-Phenanthraline PMSF
Samples Control 1 mM 10 mM 1 mM 10 mM
3LL tumor
tissue 8383 ~ 144a 57 ~ 44b Ob 8324 ~ 334 9758 ~ 937
(200 mg/ml)
Macrophage
supernatant 4084 ~ 47 1070 ~ 11846 Ob 3277 ~ 84 4637 ~ 115
Pancreatic
elastase 3497 ~ 96 3277 ~ 84 463 7 ~ 115 698 t 2146 440 ~ 327b
aFree 3H released from the labeled elastin in the reaction.
bP<0.001.
At 10 mM, the serine proteinase inhibitor PM:SF produced >80% inhibition of
pancreatic
serine elastase activity, but it did not inhibit the elastinolytic activity
from the 3LL tumor tissue
or from purified cultures of macrophages. In contrast, elastase activity from
both the tumor
tissue and macrophages, but not the pancreatic elastase, was completely
suppressed by the MMP
inhibitor 1,10-phenanthraline.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97I21475
122
EXAMPLE 12
Secretion of Elastase and Generation of Angiostatin in Cocultures of
3LL Cells and Macrophag-eses
To determine whether 3LL cells can regulate elastase activity and hence
regulate
production of angiostatin in macrophages, the inventors next cultured purified
peritoneal exudate
macrophages in serum-free medium with or without 3LL-met or 3LL-nm cells in
the absence
(FIG. 9A) or presence (FIG. 9B) of plasminogen. PEM were collected by
peritoneal lavage with
HBSS from mice given an intraperitoneal (i.p.) injection of 1.5 ml of
thioglycollate broth 4 days
previously. The PEM were plated onto 24-well dishes at a density of 2 x 105
cellslwell. After 2
hr, the adherent cultures were washed. The resultant PEM population was >98%
pure according
to morphologic and phagocytic criteria (Dong et al., 1993a).
PEM were incubated for 24 hr with tumor cells (2 x 105/well) or with tumor
cell
conditioned medium in MEM-5% FBS. The cultures were washed, and the cells were
incubated
in 0.5 ml serum-free DMEM-F 12 medium (for elastase assay) or medium
containing 200 mg/ml
plasminogen for 72 hr (for angiostatin activity assay). The medium was
collected and
centrifuged at 3000 g at 4°C for 30 min. The supernatants were used in
the assays as described
in Example 11.
In agreement with a previous report (Werb and Gordon, 1975), the inflammatory
macrophages constitutively secreted elastase (FIG. 9A) and expressed MME mRNA,
as
determined by northern blot analysis. A detectable (baseline) level of
elastinolytic activity was
detected in culture supernatants of 3LL-met and 3LL-nm cells. Since the 3LL
cells did not
express MME mRNA, the inventors attribute the elastinolytic activity to other
proteases released
by the tumor cells. Supernatants of macrophage-3LL cocultures contained a 3-
fold higher
elastinolytic activity than supernatants harvested ftom macrophages cultured
alone (FIG. 9A). In
parallel studies, the inventors added plasminogen to the macrophages cultured
alone, 3LL cells
cultured alone, or macrophage-3LL cocultures. Angiostatin activity (inhibition
of endothelial
cell proliferation) directly correlated with elastinolytic activity:
macrophages cultured alone
produced 24% inhibition of endothelial cell growth, whereas macrophages
cultured with 3LL
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
123
cells produced 43-46% inhibition of endothelial cell growth. The angiostatin
activity in
supernatants of 3LL cells cultured alone was <4% (FIG. 9B).
To verify that the inhibition of endothelial cf:ll proliferation was due to
angiostatin, the
- 5 inventors identified this 38-kDa fragment of ~plasminogen (O'Reilly et
al., 1994) by
immunoblotting with a monoclonal antibody against lysine-binding site-1. The
supernatants of
macrophages plus plasminogen, macrophages and 3LL-met plus plasminogen, or 3LL-
met plus
plasminogen were mixed with sample buffer (62.5 mM Tris/HCI, pH 6.8, 2.3% SDS,
100 mM
DTT, and 0.05% bromophenol blue), boiled, and separated on 10% SDS-PAGE. The
protein
IO was transferred onto 0.45 mm nitrocellulose membranes. The filter was
blocked with 3% BSA
in TBS (20 mM Tris/HCI, pH 7.5, 150 mM NaClj, probed with antibody against the
lysine
binding site I (LBS-1; 1 mg/ml) in TTBS (TBS containing 0.1 % Tween 20),
incubated with a
second antibody in the buffer, and visualized by the ECL Western blotting
detection system
(Dong et al., 1993a).
Consistent with the bioassay (FIG. 9B), the 38-kDa fragment was found in the
supernatant of the macrophage-3LL cocultures incubated in medium plus
plasminogen and, to a
lesser extent, in the supernatants of macrophages incubated alone in medium
containing
plasminogen but not in culture supernatants from 3LL-met cells incubated in
medium plus
plasminogen.
To ascertain that the increased generation of angiostatin in the 3LL
macrophage
cocultures was due to macrophage-derived MME, the inventors next incubated
macrophages in
medium (control) or medium conditioned by 3LL-mea cells in the presence or
absence of human
plasminogen. Elastinolytic and angiostatin activities were then determined
(FIG. l0A and
FIG. lOB). The data clearly demonstrate that incubation of macrophages with
supernatants of
the 3LL cultures significantly increased the secretion of elastase and the
generation of
angiostatin.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
124
EXAMPLE 13
GM-CSF Released by 3LL Cells is Responsible for Increased Secretion
of MME by Macrophages
Since GM-CSF is the only cytokine (among many examined) that can upregulate
MME
expression in murine macrophages (Example 8), the inventors next determined
whether 3LL
cells produced and released GM-CSF and whether it in turn increased
elastinoiytic activity in
macrophages and, hence, production of angiostatin. Polyadenylated mRNA
extracted from
subcutaneous 3LL-nm tumor, 3LL-nm cell culture, 3LL-met tumor and 3LL-met cell
culture was
treated with RQ1 RNase-free DNase and reverse transcribed using an AMV reverse
transcriptase
system (Promega). Resulting cDNA from 20 ng mRNA was amplified with 2.5 U of
Taq
polymerase in a reaction volume of 50 ml containing 10 mM Tris-HCI, pH 9.0 at
25°C, 1.5 mM
MgCl2, 50 mM KCI, 0.1% Triton X-100, 200 mM concentrations of each of the
dNTPs, and 200
nM concentrations each primer (primer number 1, CCCATCACTGTCACCCGGCCTTGG (SEQ
ID N0:5) and primer number 2, GTCCGTTTCCGGAGTTGGGGGGC (SEQ ID N0:6),
defining a 279-by fragment of GM-CSF; and primer number 3,
GTGGGCCGCTCTAGGCACCA (SEQ ID N0:3) and primer number 4,
CGGTTGGCCTTAGGGGTCAGGCTGG (SEQ ID N0:4), defining a 245-by fragment of (3-
actin [Stratagene, La Jolla, CA]). Amplification was carried out on a Perkin-
Elmer-Cetus
thermal cycler for 25 cycles ( 1 cycle = 94°C, 45 sec; 60°C, 45
sec; and 72°C, 1 min). Thirty-
microliter aliquots of each resulting mixture were separated on 1.5% agarose
gel and visualized
under ultraviolet light.
RT-PCRTM analysis showed the presence of GM-CSF mRNA in both the 3LL-nm and
3LL-met variants growing in culture. Similar levels of steady-state GM-CSF
mRNA were also
found in the s.c. tumors. Culture supernatants of 3LL-met and 3LL-nm variants
contained 28 pg
and 40 pg/106/72 hr of GM-CSF, respectively. Further evidence of the role of
GM-CSF
(released by 3LL cells) in the regulation of MME and production of angiostatin
activity came
from neutralization studies (FIG. 11 A and FIG. 11 B). Murine macrophages were
incubated with
medium (control) or medium conditioned by 3LL-nm or 3LL-met cells in the
absence of
presence of antibodies against mouse GM-CSF or control-nonspecific IgG.
Antibodies against
GM-CSF but not those against IgG significantly decreased production of
elastase (FIG. 11 A) and
CA 02275438 1999-06-09
WO 98/22605 PCT/US97I21475
125
angiostatin activity (FIG. 11 B). Neither the anti-(iM-CSF antibody nor the
nonspecific IgG
affected the generation of MME or angiostatin activity in macrophages
incubated in medium
alone.
EXAMPLE,14
Expression of MMP-9 is Not Reguired for Production of Angiostatin
MMP-9 is constitutively released from marine macrophages, and its secretion
can be
increased by a variety of stimuli (Xie et al., 1994). Since MMP-9 has some
elastinolytic activity
(Senior et al., 1991 ), the inventors wished to determine whether it
contributed to the generation
of angiostatin in the 3LL carcinoma-macrophage system. The inventors therefore
cultured
macrophages in medium alone (control) or medium containing 1 mg/ml LPS or 1000
U/ml GM-
CSF in the absence (for enzyme assays) or presence (for production of
angiostatin) of 200 mg/ml
plasminogen. Elastase and angiostatin activities were determined as described
in Example 11
above. MMP-9 activity was determined by gelatin zymography.
Aliquots of conditioned medium from control and test macrophages were
subjected to
substrate gel electrophoresis in a 7.5% polyacrylaJnide slab gel impregnated
with 2 mg/ml
gelatin (Sigma). After electrophoresis, the gel was washed for 30 min at room
temperature in
washing buffer (50 mM Tris-HCI, pH 7.5, 5 mM Ca.Cl2, 1 mM ZnCl2, 2.5% Triton X-
100) and
then incubated for 24 hr at 37°C with the washing buffer containing 1 %
Triton X-100. The gel
was stained with Coomassie Blue 8250. The gelatinolytic activity was
quantified using
densitometric scanning (Molecular Dynamics, Sunnyvale, CA) (Xie et al., 1994).
As shown in Table 10, while LPS increased secretion of MMP-9, it decreased
release of
MME. Incubation of macrophages with GM-CSF enhanced secretion of MME without
affecting
the levels of MMP-9. Since generation of angiostatin was suppressed by LPS and
augmented by
GM-CSF, the inventors conclude that MME (and not MMP-9) was responsible for
the generation
of angiostatin by macrophages (Table 10).
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
126
TABLE 10
Correlation of MME and MMP-9 Production by Macrophages
with Generation of An~iostatin
Macrophage Elastase MMP-9 Angiostatin
Treatment Activity Activity Activity
Medium 37.0 ~ 2.9 193 22.2 ~ 4.8~
LPS 6.5 ~ 2.6a 3896 8.9 ~ 7.1
GM-CSF 108.0 ~ 7.Sa 201 b 43.7 ~ 1.8°
aMME activity, cpm x 103/reaction.
bZymography, densitometry units.
~Angiostatin activity; percent inhibition of BCE growth.
EXAMPLE 15
Suppression of Metastases by Primary Tumors Engineered to Release GM-CSF
In a well-accepted animal model, the inventors show by this example effective
suppression of angiogenesis, and correlating suppression of metastases in
secondary tumor sites.
This suppression is achieved where GM-CSF released from a subcutaneous primary
tumor
recruits macrophages into the tumor lesion and stimulates MME expression in
these tumor
infiltrating macrophages. The MME in turn degrades plasminogen to angiostatin
that circulates
into distant capillary beds where angiogenesis and metastatic development is
inhibited.
I. Materials and Methods
Mice
Specific pathogen-free male athymic nude mice were purchased from Jackson
Laboratory, Bar Harbor, ME. The mice were maintained according to
institutional guidelines
under specific pathogen-free conditions in facilities approved by the American
Association for
Accreditation of .Laboratory Animal Care and in accordance with current
regulations and
standards of the Department of Agriculture, Department of Health and Human
Services, and the
National Institutes of Health. The mice were used when they were 8 to 12 weeks
old.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
127
Cell Culture
Marine metastatic Lewis lung carcinoma (31:.L-met), obtained by the method
described
by O'Reilly et al., incorporated herein by reference (O'Reilly et al., 1994a);
B16-F10-GM
(Dranoff, et al. , 1993 ), a variant of mouse B I 6-F 10 melanoma that was
transduced by using a
MFG retroviral vector encoding marine GM-CSF (obtained from Dr. D. Pardoll,
John Hopkins
University); K1735M2 melanoma cells (Staroselsky, et al., 1991); and renal
carcinoma RENCA
cells (Dinney et al., 1991) were maintained in tissue culture in Eagle's
minimal essential medium
(MEM) supplemented with S-10% fetal bovine serum (FBS), sodium pyruvate,
nonessential
amino acids, L-glutamine, and a twofold vitamin solution. Adherent cultures
were maintained
on plastic and were incubated in 5% C02-95% air at 37°C. The cultures
were free of
Mycoplasma and pathogenic mouse viruses.
Marine K1735M2 melanoma cells were maintained in MEM supplemented with
5% FBS. The cells were transfected with the plasmid pcDNA3-GM-CSF driven by
human
cytomegalovirus promoter (obtained from Dr. W. gang, Academia Sinica, Taiwan)
to derive
KI735M2-GM cells or a control plasmid encoding neomycin resistance gene. The
cells were
then selected in 6418 for up to 3 weeks. Bovine capillary endothelial cells
(BCE) obtained from
Dr. O'Reilly (Harvard Medical School, Boston, MA) were cultured on gelatinized
surfaces in
DMEM-10% calf serum (CS) supplemented with 3 ng/ml human bFGF (Genzyme,
Cambridge,
MA) in 10% C02 (O'Reilly et al., 1994b).
Animal Studies
Aliquots of B 16-F 10-GM or K 173 SM2-GM cells in 0.1 ml of HB S S were inj
ected into
the dorsal subcutis in the proximal midline. When tumors were 12-15 mm in
diameter, the mice
were anesthetized with methoxyflurane. The tumors in one group of mice were
surgically
excised, and the area closed with metal wound clips. The other group underwent
a sham surgical
procedure, which left the subcutaneous tumors intact. One day later, 105 of
3LL-met or
K 173 SM2 cells were inj ected intravenously or 1 O5 o:f RENCA cells were inj
ected subcapsularly
into one kidney of the mice. The mice were killed a! 1-28 days (3LL-met) or 15
days (RENCA)
later. The lungs or kidney were weighed and fixed in Bouin's solution. The
tumor nodules in the
lungs were counted under a dissecting microscope.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
128
Collection and Cultivation of Mouse Peritoneal Macrophages (PEM)
PEM were collected by peritoneal lavage with HBSS from mice given an
intraperitoneal
(i.p.) injection of 1.5 ml of thioglycollate broth 4 days previously. The PEM
were plated onto
24-well dishes at a density of 2 x 105 cells/well. After 2 hr, the adherent
cultures were washed.
The resultant PEM population was > 98% pure according to morphologic and
phagocytic criteria
(Dong et al., 1993b).
Elastase and angiostatin.
PEM were incubated for 24 hr with tumor cells (2 x 1OS/well) in MEM-5% FBS.
The
cultures were washed, and the cells were incubated in 0.5 ml serum-free DMEM-F
12 medium
(for elastase assay) or medium containing 100 pg/ml plasminogen for 72 hr (for
angiostatin
activity assay). The medium was collected and centrifuged at 3000 x g at
4°C for 30 min. The
supernatants were used in the assays as described below.
1 S Elastase assay
Elastase activity in the conditioned medium was determined by a method
described
previously using [3H]NaBH4-reduced elastin as a substrate (Werb et al., 1986).
The samples
were mixed in reaction buffer ( 100 mM Tris/HCI, 5 mM CaCl2, 0.2 mg/ml SDS and
0.006%
NaH3) and incubated at a concentration of 600 mg/ml at 37°C for 16 hr.
Free-form 3H release
was monitored, and the enzyme activity was expressed as cpm/reaction.
Immunohistochemistry
Macrophages in B 16-F 10-GM tumors were identified by using the macrophage-
specific
scavenger receptor antibody (Hughes et al., 1994). Sections (8-10 mm) of
frozen tumor tissue or
cultured cells fixed with 0.125% glutaraldehyde in PBS were treated with a rat
monoclonal
scavenger receptor antibody followed by gold-labeled secondary antibody as
described in detail
previously (Bucana et al., 1992).
Angiostatin Assay
Angiostatin activity, i.e., inhibition of endothelial cell proliferation, was
determined as
described previously (O'Reilly et al., 1994b). Briefly, BCE were seeded onto
gelatinized 24-well
plates at 1.25 x 104/well/0.5 ml DMEM-10% CS, allowed to adhere overnight,
rinsed, and
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
129
incubated with 0.25 ml/well DMEM-5% CS or test: samples for 20 min. Additional
medium
containing bFGF was then added to a final concentration of 1 ng/ml at 0.5
ml/well. Seventy-two
hours later, the cells were harvested by trypsinization and counted.
Angiostatin activity was
expressed as percent inhibition of endothelial cell growth in culture.
RNA Isolation and Northern Blot Analyses
The mRNA was extracted from tumor tissue or cell cultures using the Fast-Track
kit
(Invitrogen, San Diego, CA). One ~.g mRI~i~A was fractionated in 1 %
denaturing
formaldehyde/agarose gels, electrotransferred to GeneScreen nylon membrane
(DuPont Co.,
Boston, MA), and UV cross-linked with 120,000 mJ/cm2 using a UV Stratalinker
1800
(Stratagene, La Jolla, CA). Hybridization was performed as previously
described (Dong et al.,
1994). The filters were washed at SO-60°C with 30 mM NaCI/3 mM sodium
citrate, pH 7.2/0.1
sodium dodecyl sulfate. The probes used were; cDNA fragments corresponding to
rat
glyceraldehyde-3-phosphate dehydrogenase (GAPD:H) , GM-CSF, and MME (Shapiro
et al.,
1992).
Western Blot Analysis
Samples isolated from culture supernatants were mixed with sample buffer (62.5
mM
Tris/HCI, pH 6.8, 2.3% SDS, 100 mM DTT, and 0.05% bromophenol blue), boiled,
and
separated on 10% SDS-PAGE. The protein was transferred onto 0.45 mm
nitrocellulose
membranes. The filter was blocked with 3% BSA in TBS (20 mM Tris/HCI, pH 7.5,
150 mM
NaCI), probed with antibody against the lysine binding site I ( 1 ~g/ml) in
TTB S (TB S containing
0.1 % Tween 20), incubated with a second antibody in the buffer, and
visualized by the ECL
Western blotting detection system (bong et al., 1993a).
II. Expression of GM-CSF in engineered B16-F10 melanoma and K1735M2 melanoma
cells
B 16-F 10-GMCSF cells were subcloned in tissue culture to derive B 16-F 10-
GMCSF(control), B 16-F 10-GMCSF(medium), and B 16-F 10-GMCSF(high) lines. The
B 16-
F 10-GMCSF-P (the mixture of the GM-CSF gene-transduced B 16-F 10), B 16-F 10-
GMCSF(control), B 16-F 10-GMCSF(medium), and B 16-F 10-GM(high) cells produced
30,
< 0.01, 18, and 75 ng/106 cells/24 hr of marine GM-CSF, respectively.
Similarly, K1735-M2-
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
130
GMCSF cells were subcloned in tissue culture to obtain K1735M2-GMCSF(control),
K1735M2-
GMCSF(medium), and K1735M2-GMCSF(high) cells that constitutively released <
0.01, 0.35,
1.8 ng/106 cells/24 hr of marine GM-CSF, respectively. GM-CSF was not detected
in the culture
supernatants of wild-type B 16-F 10, K 173 SM2, and K 173 SM2-Neo (transfected
by control
vector) cells.
Correlated with expression levels of GM-CSF protein, significant amount of GM-
CSF
mRNA was found in the tumor cells containing the transgene of GM-CSF. Southern
blot
analysis indicated that the cells engineered with GM-CSF, including B 16-F 10-
GMCSF-P, B 16-
F 10-GMCSF(control), B 16-F 10-GMCSF(medium), and B 16-F 10-GM(high), and K
173 5 M2-
GMCSF(control), K1735M2-GMCSF(medium), and K1735M2-GMCSF(high), contained
similar level of GM-CSF cDNA.
III. Effects of the tumor cells secreting GM-CSF on secretion of elastase and
generation
of angiostatin by macrophages
Tumor cells of B 16-F 10 lines (FIG. 12A and FIG. I2B) or K1735M2 lines (FIG.
13A and
FIG. 13B) were cultured with purified peritoneal macrophages in the absence
(FIG. 12A and
FIG. 13A) or presence (FIG. 12B and FIG. 13B) of 100 ~g/ml of human
plasminogen. The
inventors found that macrophages incubated with tumor cells constitutively
releasing GM-CSF,
but not wild-type or non-GM-CSF releasing cells, secreted significantly higher
amounts of
elastase activity (FIG. 12A and FIG. 13A). In the parallel cultures containing
plasminogen,
significant amounts of angiostatin were found by the western blot analysis and
the bioassay
measuring suppression of the growth of bovine capillary endothelial cells
(FIG. 12B and
FIG. 13B).
IV. Macrophage infiltration in the subcutaneous tumors and expression of GM-
CSF
and MME
Immunohistochemistry staining of cryostat sections using marine macrophage-
specific
antibody scavenger receptor revealed that B 16-F 10-GMCSF(high) tumors
contained significant
more infiltrating macrophages than those of B 16-F 10-GMCSF(medium) and B 16-F
10-
GMCSF(control) tumors.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
131
The inventors next examined the expression of GM-CSF and MME in the tumors.
GM-CSF mRNA was detected in B 16-F 10-GMCSF(high), B 16-F 10-GMCSF(medium) and
B 16-
F 10-GMCSF-P, but not in B 16-F 10 or B 16-F 10-GMCSF(control) tumors.
Moreover, correlated
with extent of macrophage infiltration, the B 1 G-F 1 OGMCSF(high) tumors
expressed a
significantly higher level of GM-CSF mRNA than i:hat in B 16-F 10-
GMCSF(medium) tumors.
Low level of MME mRNA was found in B 16-F 10 .and B 16-F 10-GMCSF(control)
tumors. In
contrast, B 16-F 10-GMCSF(high) and B 16-F 10-GMCSF(medium) tumors expressed
significantly higher levels of MME mRNA.
V. Effects of B16-F10-GM tumors on the growth of distant tumors in nude mice
Three models were used to determine whether tumors engineered to
constitutively release
GM-CSF could modulate the growth of a distant tumor. To exclude the
involvement of T-cells
in these process, which may complicate interpretation of the results, nude
mice were used in
these studies. In the first model, the inventors inve;~tigated whether B 16-F
10-GMCSF tumors
could suppress the growth of lung metastasis of 3LL-met cells. B 16-F 10-
GMCSF(high) or B 16-
F 10-GMCSF(control) cells were implanted subcutaneously into nude mice. When
the tumors
reached 10-12 mm in diameter, control or the tumor-bearing mice received 3LL-
met cells
intravenously. As shown in Table 11, subcutaneous tumors of B 16-F 10-
GMCSF(high), but not
B16-F10-GMCSF(control), cells produced significant suppression on the growth
of 3LL-met
lung metastases. Similar results were observed in a second model in which
K1735M2 melanoma
cells were injected intravenously (Table 12). The inhibitory effect of
subcutaneous B 16-F 10-
GMCSF(high) tumors on the growth of lung metastases of K1735M2 cells could be
abolished by
removal of the subcutaneous tumors (Table 12). The suppression was not
observed in mice
bearing B 16-F 10-GMCSF(control) tumors (Table 11 and 12). These results,
therefore,
concluded that the suppression of the lung metastases was dependent on
expression of GM-CSF
in the subcutaneous tumor lesions.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97l21475
132
TABLE 11
Suppression of 3LL-met lung metastasis in nude mice by
GM-CSF gene-transduced B16-F10 cells ~rowin~ subcutaneous)
Subcutaneous Lung metastases Lung Weight
tumor median range (mg)
no tumor 56 49 - 62 1074 ~ 237
B16-F10-GMCSF (high) 19* 8 - 31 356* ~ 59
B16-F10-GMCSF (control) 41 341 - 60 790 t 143
*, p < 0.05
TABLE 12
Suppression of K1735M2 metastasis in nude mice by
GM-CSF gene-transduced B16-F10 cells ~rowin~ subcutaneous)
Subcutaneous tumor Lung metastases Lung Weight
tumor resection median range (mg)
no tumor --- 162 124 - 179 568 ~ 74
B 16-F 10-GMCSF (high) Sham surgery53 * 41 - 75 280* ~ 69
Resection 103 93 - 173 527 ~ 122
B 16-F 10-GMCSF (control) Sham surgery158 128 - 184 450 ~ 85
Resection 162 134 - 179 503 ~ 126
*, p < 0.05
In the third model, the inventors determined whether the suppression was only
restricted
to the growth of lung metastasis, the inventors investigated effects of the
subcutaneous BI6-F10-
GMCSF tumors on the growth of RENCA cells in the kidney of nude mice. The data
shown in
Table 13 indicated that B 16-F 10-GMCSF(high) but not B 16-F 10-GMCSF(control)
tumors did
slow down the growth of RENCA tumors in the kidney.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
133
TABLE ~3
Suppression of the growth of RENCA calls in the kidney of nude mice by
GM-CSF gene-transduced B16-F10 cells growing subcutaneously
Subcutaneous tumor Kidney weight (mg)
no tumor 439 t 141
B 16-F 10-GMCSF (control) 363 ~ 19
B16-F10-GMCSF (high) 244* t 60
*, p < 0.05
The inventors have thus successfully utilized animal models well accepted in
the field to
show that in three tumor systems, GM-CSF released from a subcutaneous tumor
recruits
macrophages into the tumor lesion and stimulates MME expression in these tumor
infiltrating
macrophages. MME in turn degrades plasminogen to angiostatin that circulates
into distant
capillary beds where it suppresses angiogenesis and hence the growth of the
distant metastases.
All of the compositions and methods disclosed and claimed herein can be made
and
executed without undue experimentation in light of the present disclosure.
While the
compositions and methods of this invention have been described in terms of
preferred
embodiments, it will be apparent to those of skill in the art that variations
may be applied to the
compositions and methods and in the steps or in the sequence of steps of the
method described
herein without departing from the concept, spirit and scope of the invention.
More specifically,
it will be apparent that certain agents which are both chemically and
physiologically related may
be substituted for the agents described herein whrile the same or similar
results would be
achieved. All such similar substitutes and modifications apparent to those
skilled in the art are
deemed to be within the spirit, scope and concept oi° the invention as
defined by the appended
claims.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
134
REFERENCES
The following references, to the extent that they provide exemplary procedural
or other
details supplementary to those set forth herein, are specifically incorporated
herein by reference.
Adams and Hamilton, Inflammation: Basic Principles and Clinical Correlates, J.
I. Gallin, I. M.
Goldstein, and R. Snyderman, eds., Raven Press, New York, 471, 1988.
Albini, Melchiori, Santi, Liotta, Brown, Stetler-Stevenson, J. Natl. Cancer
Inst., 83:775, 1991.
Alt, Kellems, Bertino and Schimke, J. Biol. Chem., 253:1357, 1978.
Anderson, Science 226:401, 1984.
Angel, Bauman, Stein, Dellus, Rahmsdorf, and Herrlich, Mol. Cell. Biol.,
7:2256, 1987a.
Angel, Baumann, Stein, Delois, Rahmsdorf, Herrlich, Mol. Cell Biol., 7:2256,
1987.
Angel, Imagawa, Chiu, Stein, Imbra, Rahmsdorf, Jonat, Herrlich, and Karin,
Cell, 49:729,
1987b.
1 S Atchinson and Perry, Cell, 46:253, 1986.
Atchinson and Perry, Cell, 48:121, 1987.
Aukerman, Price, Fidler, J. Natl. Cancer Inst., 77(4):915-924, 1986.
Austyn and Gordon, Eur. J. Immunol, 11:805-815, 1981.
Bahnemann et al. Abs. Pap. ACS, 180:5. 1980.
Baichwal and Sugden, In: Kucherlapati R, ed. Gene transfer. New York: Plenum
Press, pp.
117-148, 1986.
Banda and Werb, Biochem. J., 193:589-605, 1981.
Banda, Clark, Werb, J. Exp. Med., 152:1563-1570, 1980.
Banda, Ciark, Werb, J. Exp. Med., 157:1184-1196, 1983.
Banda, Werb, McKerrow, Methods Enzymol., 144:288, 1987.
Banerji, Olson, and Schaffner, Cell, 35:729, 1983.
Banerji, Rusconi, and Schaffner, Cell, 27:299, 1981.
Bao, Zhang, Kuo, Hum. Gene Ther., 7:355-365,1996.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
135
Bar-Schavit, Teitelbaum, Sticklin, Eisen, Kahn, Welgus, Proc. Natl. Acad. Sci.
USA, 82:5380,
1985.
Barrett, Methods Enzymol., 244:1, 1994.
Barrett, Proteinases in Mammalian Cells and T~'ssues, A. J. Barrett, ed.,
North-Holland
S Publishing Co., Amsterdam, 1, 1977.
Bass, Cabrera, Elgavish, Robert, Siegal, Anderson, Maneval, Curiel, Cancer
Gene Ther., 2:97-I04,
1995.
Basset, Bellocq, Wolf, Stoll, Limacher, Podhajeer, Chenard, Rio, Chambon,
Nature, 348:699,
1990.
Belaaouaj, Shipley, Kobayashi, Zimonjic, Popescu, Silverman, Shapiro, J. Biol.
Chem.,
270:14568-14575, 1995.
Belardelli et al., J. Gen. Virol., 68:2203-2212,1987a.
Belardelli, Vignaux, Proietti, Gresser, Proc. Natl. Acad. Sci. USA, 81:602-
606,1987b.
Berkhout, Silverman, and Jeang, Cell, 59:273, 1989.
1 S Berzal-Herranz et al., Genes and Devel., 6:129-134, 1992.
Birkeal-Hansen, Moore, Bodden, Windsor, Birkedal-Hansen, DeCarlo, Engler,
Crit. Rev. Oral
Biol. Med., 4:197, 1993.
Blake, Allen, Lunec, Br. Med. Bull., 43:371, 1987.
Blanar, Baldwin, Flavell, and Sharp, EMBO J., 8:1139, 1989.
Bodine and Ley, EMBO J., 6:2997, 1987.
Boshart, Weber, Jahn, Dorsch-Hasler, Fleckenstein, and Schaffner, Cell,
41:521, 1985.
Bosze, Thiesen, and Charnay, EMBO J., 5:1615, 1986.
Brach and Hernnan, Acta Haematol., 86:128, 1991.
Braddock, Chambers, Wilson, Esnouf, Adams, Kingslnan, and Kingsman, Cell,
58:269, 1989.
Brody, Metzger, Danel, Rosenfeld, Crystal, Hum. Gene Ther., 5:821-836,1994.
Bucana, Fabra, Sanchez, Fidler, Am. J. Pathol., 141:1;?25-1236, 1992.
Bulla and Siddiqui, J. Virol., 62:1437, 1986.
Busiek, Ross, McDonnell, Murphy, Matrisian, Welgus, J. Biol. Chem., 267:9087-
9092, 1992.
Campbell, Laboratory Techniques in Biochemistry and Molecular Biology, Vol.
I3, Burden and
Von Knippenberg, Eds. pp. 75-83, Amsterdam, Elseview, 1984.
CA 02275438 1999-06-09
WO 98/22605 PCT/IIS97/21475
136
Campbell and Villarreal, Mol. Cell. Biol., 8:1993, 1988.
Campbell, Cury, Lazarus, Welgus, J. Biol. Chem., 262:15862, 1987.
Campbell, Cury, Shapiro, Goldberg, and Welgus. J. Immunol. 146:1286, 1991.
Campere and Tilghman, Genes and Dev., 3:537, 1989.
Campo, Spandidos, Lang, and Wilkie, Nature, 303:77, 1983.
Capaldi et al., Biochem. Biophys. Res. Comm., 76:425, 1977.
Cech et al., Cell, 27:487-496, 1981.
Celander and Haseltine, J. Virology, 61:269, 1987.
Celander, Hsu, and Haseltine, J. Virology, 62:1314, 1988.
Chalfie et al., Science, 263:802-805,1994.
Chandler, Maler, and Yamamoto, Cell, 33:489, 1983.
Chang et al., Hepatology, 14:134A, 1991.
Chang, Barr, Seltzer, Jiang, Nabel, Nabel, Parmacek, Leiden, Science, 267:518-
525,1995.
Chang, Erwin, and Lee, Mol. Cell. Biol., 9:2153, 1989.
1 S Chatterjee, Lee, Rentoumis, and Jameson, Proc. Natl. Acad. Sci. U.S.A.,
86:9114, 1989.
Cheeseman and Slater. Br. Med. Bull., 49:481, 1993.
Chen, Clark, Chon. Blood, 71:997, 1988.
Choi, Chen, Kriegler, and Roninson, Cell, 53:519, 1988.
Chowrira et al., Biochemistry, 32:1088-1095, 1993.
Chowrira et al., J.B.C., 269:25856-25864, 1994.
Chu, Sperber, Mayer, Hsu, Virology, 188:793-800,1992.
Clark, Voulgaropoulou, Fraley, and Johnson, Human Gene Therapy, 6:1329-1341,
1995.
Coffin, Virology, Fields et al. (eds.), New York: Raven Press, pp. 1437-1500,
1990.
Cohen, Walter, and Levinson, J. Cell. Physiol., 5:75, 1987.
Colberre-Garapin et al., .I. Mol. Biol., 150:1, 1981.
Costa, Lai, Grayson, and Darnell, Mol. Cell. Biol., 8:81, 1988.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
137
Cotten, Wagner, Zatloukal, Phillips, and Curiel, P. N .A. S. USA, 89:6094-
6098, 1992.
Couch et al., Am. Rev. Resp. Dis., 88:394-403, 1963.
Coupar et al., Gene, 68:1-10, 1988.
Cripe, Haugen, Turk, Tabatabai, Schmid, Durst, i3issmann, Roman, and Turek,
EMBO J.,
6:3745, 1987.
Croen,J. Clin. Invest., 91:2446-2452,1993.
Crosier and Clark, Semin. Oncol., 19:349, 1992.
Crystal et al., Nat. Genet., 8:42-50,1994.
Crystal, Science, 270:404-410,1995.
Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989.
Curiel, Viruses in Human Gene Therapy, J.-M.H. Vos (Ed.), Carolina Academic
Press, Durham,
N.C., pp. 179-212, 1994.
Cury, Campbell, Lazarus,.Albin, Welgus, J. Immunol., 141:4306, 1988.
Dandolo, Blangy, and Kamen, J. Virology, 47:55, 1983.
I5 De Villiers, Schaffner, Tyndall, Lupton, and Kamen, Nature, 312:242, 1984.
Dean, Martel-Pelleier, Pelleter, Howell, Woessner, Jr.., J. Clin. Invest.,
84:678, 1989.
DeClerck, Yean, Chan, Shimada, Langley, Cancer RE~s., 51:2151, 1991.
Deisseroth et al., Blood, 83:3068-3076,1994.
Deisseroth,Hum. Gene Ther., 4:71-85, 1993.
Deschamps, Meijlink, and Verma, Science, 230:1174., 1985.
Devlin, Devlin, Myambo, Lilly, Rado, Warren, J. Leukoc. Biol., 41:302, 1987.
Ding, Nathan, Stuehr, J. Immunol., 141:2407, 1988.
Dinney, Bucana, Utsugi, Fidler, von Eschenbach, Killion, Cancer Res, 51:3741-
3747, 1991.
Docherty, Lyons, Smith, Wright, Stephens, Harris, Murphy, Reynolds, Nature
318:66, 1985.
Dong, Qi, Fidler, J. Exp. Med., 173:1071-1077, 1993x.
Dong, Qi, Xie, Fidler, J. Immunol, 151:2717-2724, 1993b.
Dong, Radinsky, Fan, Tsan, Bucana, Wilmanns, Fidler, J. Natl. Cancer Inst.,
86:913-920, 1994x.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
138
Dong, Staroselsky, Qi, Xie, Fidler, Cancer Res., 54:789-793,1994b.
Dong, Wang, Van Ginkel, Pascual, Frizzell, Hum. Gene Ther., 7:319-331,1996.
Dong, Yang, Xie, Juang, Llansa, Fidler, J. Leukoc. Biol., 58:725-732, 1995.
Dranoff, Jaffee, Lazenby, Golumbek, Levitsky, Brose, Jackson, Hamada, Pardoll,
Mulligan,
Proc. Natl. Acad. Sci. USA, 90:3539-3543, 1993.
Dudon and Vogel, Infect. Immunol., 49:709, 1985.
Edbrooke, Burt, Cheshire, and Woo, Mol. Cell. Biol., 9:1908, 1989.
Edlund, Walker, Barr, and Rutter, Science, 230:912, 1985.
Fang, Eisensmith, Wang, Kay, Cross, Landen, Gordon, Bellinger, Read, Hu,
Brinkhous, Woo,
Hum. Gene Ther., 6:1039-1044,1995.
Feinberg and Vogelstein, Anal. Biochem., 132:6, 1983.
Feng and Holland, Nature, 334:6178, 1988.
Fidler, Biomedicine 32:1-3, 1980.
Fidler, Cancer Res., 50:6130-6138, 1990.
Fidler, Cancer Res., 45:4714-4726, 1985.
Fidler, J. Natl. Cancer Inst., 87:1588, 1995.
Fidler, Res. Immunol., 143:199-204, 1992.
Fidler, Adv. Pharmacol., 30:271-326, 1994.
Fidler and Balch, Curr. Probl. Surg. 24:137-208, 1987.
Fidler and Ellis, Cell, 79:185-188, 1994.
Fidler and Poste, Semin. Oncol. 12:207-221, 1985.
Fidler and Schroit, Biochim. Biophys. Actor, 948:151-173, 1988.
Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986.
Flotte, Afione, Conrad, McGrath, Solow, Oka, Zeitlin, Guggino, and Carter,
Proc. Natl. Acad
Sci. USA, 90:10613-10617, 1993.
Flotte, Barraza-Ortiz, Solow, Afione, Carter, and Guggino, Gene Therapy, 2:29-
37, 1995.
Flotte, Solow, Owens, Afione, Zeitlin, and Carter, Am. J. Respir. Cell Mol.
Biol., 7:349-356,
1992.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
139
Foecking and Hofstetter, Gene, 45:101, 1986.
Folkman, Cancer Res. 46, 467-473, 1986.
Folkman, Nature Med., 1:27-31,1995.
Folkmanand Shing,J. Biol. Chem., 267:10931-10934" 1992.
Forster and Symons, Cell, 49:211-220, 1987.
Fort, Morty, Piechaczyk, Sabrouty, Dani, Jeanteur, Blanchard, Nucleic Acids
Res., 13:1431,
1985.
Foulke, Marshall, Trotta, Von Hoff, Cancer Res., 50:6264, 1990.
Fraser, Hughes, Gordon, Nature, 364:343-346, 1993.
Friedmann, Science, 244:1275-1281) 1989.
Fu, Watson, Jimenez, Wang, Lopez, Cancer Res., 50:227, 1990.
Fujihara, Ito, Pace, Watanabe, Russell, Suzuki, J. Biol. Chem., 269:12?73-
12778,1994.
Fujita, Shibuya, Hotta, Yamanishi, and Taniguchi, Cell, 49:357, 1987.
Gefter et al., Somatic Cell Genet. 3:231-236, 1977.
Gerlach et al., Nature (London), 328:802-805, 1987.
Gessani, Belardelli, Borghi, Boraschi, Gresser,J. Immimol., 139:1991-
1998,1987.
Ghosh-Choudhury et al., EMBO J., 6:1733-1739, 198.7.
Ghosh and Bachhawat, Liver diseases, targeted diagnosis and therapy using
specific receptors
and ligands, Wu G. and C. Wu ed. New York: Marcel Dekker, pp. 87-104, 1991.
Gilles, Morns, Oi, and Tonegawa, Cell, 33:717, 1983.
Ginsberg et al., Proc. Natl. Acad. Sci. USA, 88:1651-1655,1991.
Gius, Grossman, Bedell, and Laimins, J. Virology, 62:665, 1988.
Gloss, Bernard, Seedorf, and Klock, EMBO J., 6:373.'i, 1987.
Godbout, Ingram, and Tilghman, Mol. Cell. Biol., 8:1169, 1988.
Goding, Monoclonal Antibodies: Principles and Practice, 2d ed., Orlando, Fla.,
Academic Press,
1986, pp. 60-61, 65-66, 71-74.
Gornez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992.
Goodbourn and Maniatis, Proc. Natl. Acad Sci. USA, 85:1447, 1988.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
140
Goodbourn, Burstein, and Maniatis, Cell, 45:601, 1986.
Gorelik, Adv. Cancer Res., 39:71-120, 1983a.
Gorelik, Cancer Res., 43:138-145, 1983b.
Gorelik, Segal, Feldman, Int. J. Cancer, 27:847-856, 1981.
Graham et al., J. Gen. Virol., 36:59-72, 1977.
Graham and PreveY, Gene Transfer and Expression Protocols, Murray, E.J., ed.,
Humana, New
Jersey, vol. 7, 109-128,1991.
Graham and Prevec, Biotechnology, 20:363-390, 1992.
Greene, Bohnlein, and Ballard, "Immunology Today, 10:272, 1989.
Grosschedl and Baltimore, Cell, 41:885, 1985.
Grubb et al., Nature, 371:802-806,1994.
Grunhaus and Horwitz, Seminar in Virology, 3:237-252, 1992.
Gutterman,Proc. Natl. Acad. Sci. USA, 91:1198-1205,1994.
Guzman, Hirschowitz, Brody, Crystal, Epstein, Finkel, Proc. Natl. Acad. Sci.
USA, 91:10732-
10736,1994.
Hanania and Deisseroth, Cancer Gene Ther., 1:21-25, 1994.
Hart and Fidler, Biochem. Biophys. Acta, 651:37-50,1981.
Haseloff and Gerlach, Nature, 334:585-591, 1988.
Haslinger and Karin, Proc. Natl. Acad. Sci. U.S.A., 82:8572, 1985.
Hauber and Cullen, J. Virology, 62:673, 1988.
Hen, Borrelli, Fromental, Sassone-Corsi, and Chambon, Nature, 321:249, 1986.
Henney, Wakely, Davies, Foster, Henbry, Murphy, Humphries, Proc. Natl. Acad.
Sci. USA,
88:815, 1991.
Hensel, Meichle, Pfizenmaier, and Kronke, Lymphokine Res., 8:347, 1989.
Hermonat and Muzyczka, Proc. Nat'l. Acad. Sci. USA, 81:6466-6470, 1984.
Herr and Clarke, Cell, 45:461, 1986.
Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990.
Herz and Gerard, Proc. Nat'1 Acad. Sci. USA 90:2812-2816, 1993.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
141
Hibbs, Hoidal, Kang, J. Clin. Invest., 80:1644, 1987.
Hibbs, Taintor, Vavrin, Science, 235:473, 1987.
Higashi, Sokawa, Watanabe, Kawade, Ohno, Takaoka, Taniguchi, J. Biol. Chem.,
258:9522-9529,
1983.
Hirochika, Browker, and Chow, J. Virol., 61:2599, I S>87.
Hirsch, Gaugler, Deagostini-Bauzin, Bally-Cuif, and Gordis, Mol. Cell. Biol.,
10:1959, 1990.
Holbrook , Gulino, and Ruscetti, Yirolo~, 157:211, 1987.
Holmgren L, O'Reilly MS, Folkman J., Nature Med 1995;149.
Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989.
Horwich et al., J. Virol., 64:642-650, 1990.
Huang, Ostrowski, Berard, and Hagar, Cell, 27:245, 1981.
Hug, Costas, Staeheli, Aebi, and Weissmann, Mol. CE~II. Biol., 8:3065, 1988.
Hughes, Fraser, Gordon, Immunology Letters, 43:7-1 ~l, 1994.
Hwang, Lim, and Chae, Mol. Cell. Biol., 10:585, 1990.
Imagawa, Chiu, and Karin, Cell, 51:251, 1987.
Imbra and Karin, Nature, 323:555, 1986.
Imler, Lemaire, Wasvlyk, and Waslyk, Mol. Cell. Biol., 7:2558, 1987.
Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984.
Ioannides, Freedman, Platsoucas et al., J. Immunol., 146:1700-1705,1991.
Jakobovits, Smith, Jakobovits, and Capon, Mol. Cell. Biol., 8:2555, 1988.
Jameel and Siddiqui, Mol. Cell. Biol., 6:710, 1986.
Jaynes, Johnson, Buskin, Gartside, and Hauschka, Mol. Cell. Biol., 8:62, 1988.
Johnson, Wold, and Hauschka, Mol. Cell. Biol., 9:3393, 1989a.
Jones and Castro, Br. J. Cancer, 35:519-527, 1977.
Jones and Shenk, Cell, 13:181-188, 1978.
Joraschkewitz, Depenbrock, Freund, Erdmann, Meyer, DeRiese, Nenkem, Hanauske,
Krumwieh,
Poliwade, Hanaciske, Eur. J. Cancer, 26:1070, 1992.
CA 02275438 1999-06-09
WO 98/22605 PCT/LTS97/21475
142
Joyce, Nature, 338:217-244, 1989.
Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986.
Kaneda et al., Science, 243:375-378, 1989.
Kaplitt, Leone, Samulski, Siao, Pfaff, O'Malley, and During, Nature Genetics,
8:148-154, 1994.
Karin, Haslinger, Heguy, Dietlin, and Cooke, Mol. Cell. Biol. , 7:606, 1987.
Karlsson et al., EMBO J., 5:2377-2385, 1986.
Karupiah, Xie, Butler, Nathan, Duarte, MacMicking, Science, 261:1445-
1448,1993.
Katinka, Vasseur, Montreau, Yaniv, and Blangy, Nature, 290:720, 1981.
Katinka, Yaniv, Vasseur, and Blangy, Cell, 20:393, 1980.
Kato et al., J. Biol. Chem., 266:3361-3364, 1991.
Katsuda, Okada, Okada, Imai, Nakanishi, Am. J. Pathol., 145:1208-1218, 1994.
Kaufman, Methods in Enrymology, 185:537-566, 1990.
Kawamoto, Makino, Niw, Sugiyama, Kimura, Anemura, Nakata, and Kakunaga, Mol.
Cell. Biol.,
8:267, 1988.
Kay, Landen, Rothenberg, Taylor, Leland, Wiehle, Fang, Bellinger, Finegold,
Thompson, Read,
Brinkhous, Woo, Proc. Natl. Acad. Sci. USA, 91:2353-2357,1994.
Kelleher and Vos, Biotechniques, 17(6):1110-1117, 1994.
Keller, Adv. Exp. Med. Biol., 155:289-302, 1982.
Kerr, Miller, Matrisian, Cell, 61:267, 1990.
Khokha, Waterhouse, Yagel, Lale, Overall, Norton, Denhardt, Science, 243:947,
1989.
Kiledjian, Su, and Kadesch, Mol. Cell. Biol., 8:145, 1988.
Kim and Cech, Proc. Natl. Acad. Sci. USA, 84:8788-8792, 1987.
Klamut, Gangopadyhay, Worton, and Ray, Mol. Cell. Biol. , 10:193, 1990.
Klein et al., Nature, 327:70-73, 1987.
?S Knight, Proteinases in Mammalian Cells and Tissues, A. J. Barrett, ed.,
North-Holland
Publishing, Co., Amsterdam, 583, 1977.
Knowles, Hohneker, Zhou, Olsen, Noah, Hu, Leigh, Engelhardt, Edwards, Jones,
Grossman,
Wilson, Johnson, Boucher, N. Engl. J. Med., 333:823-831,1995.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
143
Koch, Benoist, and Mathis, Mol. Cell. Biol., 9:303, 1989.
Kohler and Milstein, Nature, 256:495-497, 1975.
Kohler and Milstein, Eur. J. Immunol., 6:511-519, 19'76.
Kohn, Hollister, DiPersio, Wahl, Liotta, Schiffman, Int. J. Cancer, 53:968,
1993.
Kotin, Siniscalco, Samulski, Zhu, Hunter, McLaughlin, Muzyczka, and Berns,
Proc. Natl.
Acad.,Sci. USA, $7:2211-2215, 1990.
Kriegler and Botchan, Eukaryotic Viral Vectors, ed. Y. Gluzman. Cold Spring
Harbor: Cold
Spring Harbor Laboratory, NY, 1982.
Kriegler and Botchan, Mol. Cell. Biol. 3:325, 1983.
Kriegler, Perez, and Botchan, Gene Expression, eds. D. Hamer and M. Rosenberg.
New York:
Alan R. Liss, 1983.
Kriegler, Perez, Defay, Albert and Liu, Cell, 53:45, 1 ~~88.
Kriegler, Perez, Hardy and Botchan, Cell, 38:483, i 984a.
Kriegler, Perez, Hardy, and Botchan, Cancer Cells 2,iOncogenes and Viral
Genes, G. F. Van de
Woude, A. J. Levine, W. C. Topp, and J. D. Watson, Cold Spring Harbor: Cold
Spring
Harbor Laboratory, 1984b.
Kuhl, De La Fuenta, Chaturvedi, Parinool, Ryals, Meyer, and Weissman, Cell,
50:1057, 1987.
Kumar, Dong, Fidler, J. Immunol., 1996.
Kunz, Zimmerman, Heisig, and Heinrich, Nucl. Acids Res., 17:1121, 1989.
Lacraz, Nicod, Rochemonteix, Baumberger, Dayer, Welgus, J. Clin. Invest.,
90:382-388, 1992.
LaFace, Hermonat, Wakeland, and Peck, Viology, 162:483-486, 1988.
Lallemand, Lebon, Blanchard, Tovey, J. Leukoc. Biol., 60:137-146,1996.
Larsen, Harney, and Moore, Proc. Natl. Acad. Sci. U.~S.A., 83:8283, 1986.
Larsson and Litwin, Dev. Biol. Standard., 66:385-390, 1987.
Laspia, Rice, and Mathews, Cell, 59:283, 1989.
Latimer, Bergen and Baumann, "Highly Conserved Upstream Regions of the a~-
Antitrypsin
Gene in Two Mouse Species Govern Liver-Specific Expression by Different
Mechanisms," Mol. Cell. Biol., 10:760, 1990.
Laughlin, Cardellichio, and Coon, J. Virol., 60:515-5:?4, 1986.
Le Gal La Salle et al., Science, 259:988-990, 1993.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
144
Lebkowski, McNally, Okarma, and Lerch, Mol. Cell. Biol., *:3988-3996, 1988.
Lee, Mulligan, Berg, and Ringold, Nature, 294:228, 1981.
Levinson, Khoury, VanDeWoude, and Gruss, Nature, 295:79, 1982.
Levrero et al., Gene, 101:195-202, 1991.
Levy, Cioce, Sobel, Garbisa, Grigioni, Liotta, Stetler-Stevenson, Cancer Res.,
5 i ( 1 ):439-444,
1991.
Lieber and Strauss, Mol. Cell. Biol., 15: 540-551, 1995.
Lim, US Patent 4,352,883, October 5, 1982.
Lin, Cross, Halden, Dragos, Toledano, and Leonard, Mol. Cell. Biol., 10:850,
1990.
Luo, Zhou, Cooper, Munshi, Boswell, Broxmeyer, and Srivastava, Blood,82
(Supp.): 1,303A,
1994.
Luria, Gross, Horowitz, and Givol, EMBO J., 6:3307, 1987.
Lusky and Botchan, Proc. Natl. Acad. Sci. U.S.A., 83:3609, 1986.
Lusky, Berg, Weiher, and Botchan, Mol. Cell. Biol. 3:1108, 1983.
MacGregor, Nolan, Fiering, Roederer, Herzenber, Gene Transfer and Expression
Protocols,
Murray, E.J., ed., Humans, New Jersey, vol. 7, 217-235,1991.
Majors and Varmus, Proc. Natl. Acad. Sci. U.S.A., 80:5866, 1983.
Mann et al., Cell, 33:153-159, 1983.
Mantovani, Bottazzi, Colotta, Sozzani, Ruco, Immunol. Today, 13:265-270, 1992.
Mantovani, Giavazzi, Polentarutti, Spreafico, Garattini, Int. J. Cancer,
25:617-620, 1980.
Markowitz et al., J. Virol., 62:1120-1124, 1988.
Marshall, Science, 269:1050-1055,1995.
Matrisian, Trends Genet., 6:121, 1990.
Matrisian, BioEssays, 14:455-463, 1992.
McCarty, Christensen, and Muzyczka, J. Virol. , 65:2936-2945, 1991.
McLaughlin, Collis, Hermonat, and Muzyczka, J. Virol., 62:1963-1973, 1988.
McNeall, Sanchez, Gray, Chesterman, and Sleigh, Gene, 76:81, 1989.
Melkova and Esteban, J. Immunol., 155:5711-5718,1995.
CA 02275438 1999-06-09
WO 98/22605 PCT/CTS97/21475
145
Metcalf, Cancer, 65:2185, 1990.
Michel and Westhof, J. Mol. Biol., 216:585-610, 1990.
Mignatti, Robbins, Rifkin, Cell, 47:487, 1986.
Miksicek, Heber, Schmid, Danesch, Posseckert, Beato, and Schutz, Cell, 46:203,
1986.
Mizrahi, Process Biochem., (August):9-12, 1983.
Moncade, Palmer, Higgs, Pharmacol. Rev. , 43 :109, 1991.
Mordacq and Linzer, Genes and Dev., 3:760, 1989.
Moreau, Hen, Wasylyk, Everett, Gaub, and Chambon., Nucl. Acids Res., 9:6047,
1981.
Morikawa, Walker, Nakajima, Pathak, Jessup, Fidler, Cancer Res., 48:6863-6871,
1988.
Murphy and Docherty, Am. J. Resp. Cell Mol. Biol., i':120, 1992.
Muesing, Smith, and Capon, Cell, 48:691, 1987.
Muzyczka, Curr. Top. Microbiol. Immunol., 158:97-1.29, 1992.
Nakajima, Morikawa, Fabra, Bucana, Fidler, J. Natl. Cancer Inst., 82:1890,
1990.
Nakamura, Merchav, Carter, Ernst, Demetri, Fumkawa, Anderson, Freedman,
Griffin, J.
Immunol., 143:3543, 1989.
Nathan, Fed. Proc., 41:2206, 1982.
Nathan, J. Clin. Invest., 79:319-326, 1987.
Nicolas and Rubinstein, Vectors: A survey of molecular cloning vectors and
their uses,
Rodriguez and Denhardt (eds.), Stoneham: Butterworth, pp. 494-513, 1988.
Nilsson and Mosbach, Dev. Biol. Standard , 66:183-193, 1987.
Ng, Gunning, Liu, Leavitt, and Kedes, Nuc. Acids Res., 17:601, 1989.
Normann, Cancer Metastasis., (Rev. 4}, 277-291, 19F~5.
O'Reilly, Holmgren, Chen, Folkman, Nature Med., 2:689-692, 1996.
O'Reilly, Holmgren, Shing, Chen, Rosenthal, Moses, Lane, Cao, Sage, Folkman,
Cell, 79:315-
~5 328, 1994.
Ohi, Dixit, Tillery, and Plonk, Gene, 89L:279-282, 1990.
Ohlsson and Olsson, Eur. J. Biochem., 42:519, 1974.
Ondek, Sheppard, and Herr, EMBO J., 6:1017, 1987.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/2I475
146
Ornitz, Hammer, Davison, Brinster, and Palmiter, Mol. Cell. Biol., 7:3466,
1987.
Palmiter, Chen, and Brinster, Cell, 29:701, 1982.
Palukaitis et al., Virology, 99:145-151, 1979.
Paskind et al., Virology, 67:242-248, 1975.
Pech, Rao, Robbins, and Aaronson, Mol. Cell. Biol., 9:396, 1989.
Perez-Stable and Constantini, Mol. Cell. Biol., 10:1116, 1990.
Perriman et al., Gene, 113:157-163, 1992.
Petricciani, Dev. Biol. Standard., 66:3-12, 1985.
Pieard and Schaffner, Nature, 307:83, 1984.
Phillips et al., Large Scale Mammalian Cell Culture (Feder, J. and Tolbert, W.
R., eds.),
Academic Press, Orlando, FL, U.S.A., 1985.
Pinkert, Ornitz, Brinster, and Palmiter, Genes and Dev., 1:268, 1987.
Polverini, Macrophage-derived Cell Regulatory Factors, C. Sorg, ed., (Basel:
Karger), 54-73,
1989.
Ponta, Kennedy, Skroch, Hynes, and Groner, Proc. Natl. Acad. Sci. U.S.A.,
82:1020, 1985.
Porton, Zaller, Lieberson, and Eckhardt, Mol. Cell. Biol., 10:1076, 1990.
Poste and Fidler, Nature, 283:139-146,1980.
Prehn, Cancer Res., S 1:2-4, 1991.
Prehn, Cancer Res., 53:3266-3269, 1993.
Prody et al., Science, 231, 1577-1580, 1986.
Queen and Baltimore, Cell, 35:741, 1983.
Quinn, Farina, Gardner, Krutzsch, and Levens, Mol. Cell. Biol., 9:4713, 1989.
Racher et al., Biotechnology Techniques, 9:169-174, 1995.
Radinsky, Kraemer, Raines, Xung, Culp, Proc. Natl. Acad Sci. USA, 84:5143,
1987.
Ragot et al., Nature, 361:647-650, 1993.
Ramakrishnan, Brandt, Niedel, Bast, Jr., Brown, J. Clin. Invest., 83:921,
1989.
Redondo, Hata, Brocklehurst, and Krangel, Science, 247:1225, 1990.
CA 02275438 1999-06-09
WO 98122605 PCT/US97/21475
147
Reinhold-Hurek and Shub, Nature, 357:173-176, 1992.
Reisman and Rotten Mol. Cell. Biol., 9:3571, 1989.
Renan, Radiother. Oncol., 19:197-218, 1990.
Resendez Jr., Wooden, and Lee, Mol. Cell. Biol., 8:4~~79, 1988.
Rich et al., Hum. Gene Ther., 4:461-476, 1993.
Ridgeway, Rodriguez RL, Denhardt DT, ed. Vectors: A survey of molecular
cloning vectors and
their uses. Stoneham: Butterworth, pp. 467-492, 1988.
Ripe, Lorenzen, Brenner, and Breindl, Mol. Cell. Biol., 9:2224, 1989.
Riffling, Coutinho, Amarm, and Kolbe, Nuc. Acids Res., 17:1619, 1989.
Rosen, Sodroski, and Haseltine, Cell, 41:813, 1988.
Rosenberg, Biologic Therapy of Cancer, DeVita VT, Hellman S, Rosenberg SA,
eds., 2nd ed., pp.
487-506, Philadelphia, J.B. Lippincott Co., 1995.
Rosenfeld, Siegfried, Yoshimura, Yoneyama, , Fukayama, Stier, Paakko, Gilardi,
Stratford-
Perricaudet, Perncaudet, Jallat, Pavirani, Lecocq, Crystal, Science, 252:431-
434,1991.
Rosenfeld, Yoshimura, Trapnell, Yoneyama, Rosenthal, Dalemans, Fukayama,
Bargon, Stier,
Stratford-Perricaudet, Perncaudet, Guggino, Pavirani, Lecocq, Crystal, Cell,
68:143-155,
1992.
Roux et al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989.
Saiki and Fidler, J. Immunol., 135:684, 1985.
Sakai, Helms, Carlstedt-Duke, Gustafsson, Rottman, and Yamamoto, Genes and
Dev., 2:1144,
1988.
Sampson-Johannes and Cerlino, J. Immunol., 141:3680, 1988.
Samulski, Chang, and Shenk, J. Virol., 63:3822-3828, 1989.
Samulski, Zhu, Xiao, Brook, Housman, Epstein, and Hunter, EMBOJ., 10:3941-
3950, 1991.
Santerre, et al., Gene, 30:147, 1984.
Sarver et al, Science, 247:1222-1225, 1990.
Satake, Furukawa, and Ito, J. Virology, 62:970, 1988.
Scanlon et al., Proc Natl Acad Sci USA, 88:10591-10'.>95, 1991.
Schaffner, Schirm, Muller-Baden, Wever, and Schaffr~er, J. Mol. Biol., 201:81,
1988.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
148
Schreck, Rieber, Baeuerle, EMBO J., 10:2247, 1991.
Searle, Stuart, and Palmiter, Mol. Cell. Biol., 5:1480, 1985.
Sen and Lengyel, J. Biol. Chem., 267:5117-5120,1992.
Sen and Ransohoff,Adv. Virus Res., 42:57-102,1993.
Senior, ConnoIly, Cury, Welgus, Campbell, Am. Rev. Respir. Dis., 139:1251,
1989.
Senior, Griffin, Fliszar, Shapiro, Goldberg, Welgus, J. Biol. Chem., 266:7870-
7875, 1991.
Sessa, Harrison, Barber, Zeng, Durieux, D'Angelo, Lynch, Peach, J. Biol.
Chem., 267:15274,
I 992.
Shapiro, Am. J. Respir. Crit. Care Med , 150:5160, 1994.
Shapiro, Campbell, Kobayashi, Welgus, J. Immunol., 146:2724, 1991.
Shapiro, Campbell, Kobayashi, Welgus, J. CI in. Invest. , 86:1204, 1990.
Shapiro, Griffin, Gilbert, Jenkins, Copeland, Welgus, Senior, Ley, J. Biol.
Chem., 267:4664-
4671, 1992.
Shapiro, Kobayashi, Ley, J. Biol. Chem., 268:23824-23829, 1993a.
Shapiro, Kobayashi, Pentland, Welgus, J. Biol. Chem., 268:8170-8175, I993b.
Shapiro, Kobayashi, Welgus, J. Biol. Chem., 267:13890, 1992.
Sharp and Marciniak, Cell, 59:229, 1989.
Shaul and Ben-Levy, EMBO J., 6:1913, 1987.
Sherman, Basta, Moore, Brown, and Ting, Mol. Cell. Biol., 9:50, 1989.
Shipley, Doyle, Fliszar, Ye, Johnson, Shapiro, Welgus, Senior, J. Biol. Chem.,
271:4335-4341,
1996a.
Shipley, Wesselschmidt, Kobayashi, Ley, Shapiro, Proc. Natl. Acad. Sci. USA,
93:3942-3946,
1996b.
Shotton and Hartley, Nature, 225:802, 1970.
Simon et al., Hum. Gene Ther., 4:771-780,1993.
Sioud et al.,.JMoI. Biol., 223:831-835, 1992.
Sleigh and Lockett, J. EMBO, 4:3831, 1985.
Smith and Rutledge, Natl. Cancer Inst. Monogr., 42:141-143, 1975.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
149
Sottrup-Jensen, Claeys, Zajdel, Petersen, Magnusson, Prog. Chem. Fibrinol.
Thrombol., 3:191,
1978.
Spalholz, Yang, and Howley, Cell, 42:183, 1985.
Spandau and Lee, J. Virology, 62:427, 1988.
Spandidos and Wilkie, EMBO J , 2:1193, 1983.
Staroselsky, Pathak, Chernajovsky, Tucker, Fidler, Cancer Res, 51:6292-6298,
1991.
Stephens and Hentschel, Biochem. J. , 248:1, 1987.
Stratford-Perricaudetet al., Hum. Gene. Ther. 1:241-256,1991.
Stratford-Perricaudetand Perricaudetp, Human Gene Transfer, Eds, O. Cohen-
Haguenauer and M.
Boiron, Editions John Libbey Eurotext, France:, p. 51-61, 1991.
Stratford-Perricaudet,Makeh, Perricaudet, Briand, J. C.'lin. Invest., 90:626-
630,1992.
Stuart, Searle, and Palmiter, Nature, 317:828, 1985.
Stuehr and Griffith, Advances in Enrymology ana' Related Areas of Molecular
Biology, A.
Meister, ed., Interscience, New York, 65, 287, 1992.
Stuehr and Nathan, J. Exp. Med , 169:1543, 1989.
Sugarbaker, Curr. Prob. Cancer 3:1-59, 1979.
Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987.
Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975.
Symons, R.H., Annu. Rev. Biochem., 61:641-67I, 19!2.
Symons, R.H., NA.R., 9:6527-6537, 1981.
Takebe, Seiki, Fujisawa, Hoy, Yokota, Arai, Yoshida, and Arai, Mol. Cell.
Biol., 8:466, 1988.
Takeda, Fujii, Nitta, Sakihara, Nakayama, Rikiishi, Kumagai, Jpn. J. Cancer
Res., 82:1299-
1308, 1991.
Takeda, Hatakeyama, Tsuchiya, Rikhshi, Kumagai, Lnt. J. Cancer, 47:413-420,
1991.
Talmadge and Fidler, J. Natl. Cancer Inst., 69:975-980, 1982.
Talmadge, Key, Fidler, J. Immunol., 126:2245-2248, 1981.
Taniguchi, Ohno, Fujii-Kuriyama,Muramatsu, Gene, 10:11-15,1980.
Tavernier, Gheysen, Duerinck, Can Der Heyden, and Fiers, Nature, 301:634,
1983.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
150
Taylor and Kingston, Mol. Cell. Biol. , I 0:176, 1990b.
Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a.
Taylor, Solomon, Weiner, Paucha, Bradley, and Kingston, J. Biol. Chem.,
264:15160, 1989.
Temin, Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-188,
1986.
Tests and Quigley, J. Natl. Cancer Inst., 83:740, 1991.
Thiesen, Bosze, I-Ienry, and Charnay, J. Virology, 62:614, 1988.
Thompson, J.D. et al., Nature Medicine, 1:277-278, 1995.
Top et al., J. Infect. Dis., 124:155-160, 1971.
Topalian, Biologic Therapy of Cancer, DeVita VT, Hellman S, Rosenberg SA,
eds., 2nd ed., pp.
467-486, Philadelphia, J.B. Lippincott Co., 1995.
Topalian, Solomon, Rosenberg,J. Immunol., 142-3714-3720,1989.
Tratschin, Miller, Smith, and Carter, Mol. Cell. Biol., 5:32581-3260, 1985.
Tratschin, West, Sandbank, and Carter, Mol. Cell. Biol., 4:2072-2081, 1984.
Treisman, Cell, 42:889, 1985.
Tronche, Ropier, Bach, Weiss, and Yaniv, Mol. Cell. Biol., 9:4759, 1989.
Tronche, Ropier, Herbomel, Bach, Cereghini, Weiss, and Yaniv, Mol. Biol. Med.,
7:173, 1990.
Trudel and Constantini, Genes and Dev., 6:954, 1987.
Tsuchiya, Igarashi, Suzuki, Kumagai, J. Immunol., 141:699, 1988.
Tudor, Groves, Badesch, Voelkel,Am. J. Pathol., 144:275-285,1994.
Tyndall, La Mantis, Thacker, Favaloro, and Kamen, Nuc. Acids. Res., 9:6231,
1981.
Vannice and Levinson, J. Virology, 62:1305, 1988.
van Wezel, Nature, 216:64-65, 1967.
Vasseur, Kress, Montreau, and Blangy, Proc. Natl. Acad Sci. US.A., 77:1068,
1980.
Vodvotz, Bogdan, Paik, Xie, Nathan, J. Exp. Med. , 178:605, 1993.
?S Vose and White, Cancerlmmunol. Immunother., 15:227-234,1983.
Walsh, Nienhuis, Samulski, Brown, Miller, Young, and Liu, Proc. Nalt. Acad.
Sci. USA,
89:7257-7261, 1994; J. Clin. Invest., 94:1440-1448, 1994.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
151
Wang and Calame, Cell, 47:241, 1986.
Weber, De Villiers, and Schaffner, Cell, 36:983, 1984.
Wei, Wei, Samulski, and Barranger, Gene Therapy, 1:261-268, 1994.
Weidner N, Semple JP, Welch JR, Folkman J., N Engl J Med 1991;324:1-8.
Weidner N, Carroll PR, Flax J, Flumenfeld W, Folkm an J., Am J Pathol 1993;143
:401-409.
Weinberger, Jat, and Sharp, Mol. Cell. Biol., 8:988, 1!84.
Weisz, Oguchi, Cicatiello, Esumi, J. Biol. Chem., 269:8324, 1994.
Welgus, Campbell, Bar-Shavit, Senior, Teitelbaum, J. Clin. Invest., 76:219-
230, 1985.
Welgus, Campbell, Cury, Eisen, Senior, Wilhelm, Goldberg, J. Clin. Invest.,
86:1494, 1990.
Welgus, Connolly, Senior, J. Clin. Invest., 77:1675, 1986.
Welgus, Senior, Parks, Kahn, Ley, Shapiro, Campbell, Matrix, (Suppl. I), 363-
367, 1992.
Werb and Gordon, J. Exp. Med., 142:361-377, 1975.
Werb, Textbook of Rheumatolo~, 3rd Ed., W. N. :Kelly, E. D. Harris, S. Ruddy,
and C. B.
Sledge, eds., W.B. Saunders, Philadelphia, 300, 1989.
Werb, Banda, Takemura, Gordon, Handbook of Experimental Immunology, Vol. 2.,
Cellular
Immunology, D. M. Weir, C. Blackwell, ~ and L. A. Herzenberg, eds., Blackwell
Scientific, Oxford, pp. 47.21-47.24, 1986.
White and Kuhn, J. Exp. Med., 146:802, 1977.
Whitworth, Pak, Esgro, Kleinerman, Fidler, Cancer lLletastasis Rev., 8:319-
351, 1990.
WilIiams, McCIanahan, and Morimoto, Mol. Cell. Biol., 9:2574, 1989.
Winoto and Baltimore, Cell, 59:649, 1989.
Woessner, Jr., FASEB J., 5:2146, 1991.
Xie, Dong, Fidler, J. Immunol., 152:3637-3644, 1994.
Yang, Chen, Trempe, J. Virol., 68:4847-4856, 1994.
2~ Yei, Mittereder, Wert, Shitsett, Wilmott, Trapnell, Hum. Gene Ther., 5:731-
744,1994.
Yoder, Kang, Zhou, Luo, and Srivastava, Blood, 82 (Supp.): 1:347A, 1994.
Young et al., N. Engl. J. Med., 299:1261-1266, 1978.
Young, Aquino, Young, J. Leukoc. Biol., 45:262, 1980.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
152
Young, Lozano, Googan, Wright, Young, Bagash, Int. J. Cancer, 50:628-634,
1992.
Yuan et al., P.N.A.S., 89:8006-8010, 1992.
Yuan and Altman, Science, 263:1269-1273, 1994.
Yutzey, Kline, and Konieczny, Mol. Cell. Biol., 9:1397, 1989.
Zhang, Alley, Russell, Morrison, Infect. Immunol., 62:33-40,1994a.
Zhang, Mazur, French, Georges, Roth, Cancer Gene Ther., 1:5-13,1994b.
Zhou, Broxmyer, Cooper, Harrington, and Srivastava, Exp. Hematol. (NY), 21:928-
933, 1993.
Zhou, Cooper, Kang, Ruggieri, Heimfeld, Srivastava, and Broxmeyer, J. Exp.
Med. , 179:1867-
1875, 1994.
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
153
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Board of Regents, The University of Texas
System
(B) STREET: 201 W. 7th Street
(C) CITY: Austin
(D) STATE: TX
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 78701
(G) TELEPHONE: 512-418-3000
(H) TELEFAX: 512-474-7677
(ii) TITLE OF INVENTION: IMPROVED METHODS FOR TRANSDUCING CELLS
(iii) NUMBER OF SEQUENCES: 6
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO)
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/031,330
(B) FILING DATE: 20-NOV-1996
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: l:
CCAAGAAAGG ACGAACATT lg
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C} STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
ATCTCTGCTC GGACCACCA lg
(2) INFORMATION FOR SEQ ID NO: 3:
CA 02275438 1999-06-09
WO 98/22605 PCT/US97/21475
154
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GTGGGCCGCT CTAGGCACCA 20
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CGGTTGGCCT TAGGGGTCAG GCTGG 25
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
CCCATCACTG TCACCCGGCC TTGG 24
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
GTCCGTTTCC GGAGTTGGGG GGC 23
