Note: Descriptions are shown in the official language in which they were submitted.
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
NUCLEIC ACID CONSTRUCTS AND USES THEREOF
FOR DIRECT NUCLEIC ACID INCORPORATION INTO CELLS
This application claims the benefit of U. S. Provisional Application No:
60/033,816,
filed 23 December 1996.
The present invention relates to the technical field of nucleic acid
incorporation into
cells. The invention further relates to the technical field of gene therapy,
as techniques
described herein may be employed as part of a gene therapy protocol, wherein a
number of
genetic defects related to particular gene defects may be corrected and/or
treated.
BACKGROUND ART
Hematopoietic stem cell gene therapy offers significant promise for treatment
of
various diseases. At least three requirements must be satisfied for long-term
efficacy of stem
cell gene therapy: 1 ) direct genetic modification of hematopoietic stem
cells, 2) maintenance
of transgene sequences in stem cells and their progeny, and 3) long-term
transgene
expression in the appropriate cells.
The stem cell compartment, likely to be heterogeneous, consists of rare, long-
lived,
predominantly quiescent cells that are capable of both long-term
reconstitution of the
complete hematopoietic system in transplanted hosts and some degree of self
renewal
[Ogawa,1993]. Since stem cells require several months to establish
hematopoiesis following
transplantation, they must be supplemented with a larger number of short-term
reconstituting
cells for rapid engraftment [Jones et al., 1995]. For most gene therapy
applications, it will
likely be sufficient to modify only the stem cells - rapid reconstitution of
progenitor-derived
unmarked cells would be followed by long term engraftment with genetically
marked stem-
derived cells.
The introduced therapeutic genes) must be successfully transmitted from the
stem
cell to progeny cells requiring the genetic correction. Since currently
available episomal
plasmids generally demonstrate only a moderate level of persistence in the
absence of
selective pressure and artificial human chromosomes await further development
[Harrington
et al., 1997], chromosomal integration is presently the most viable option for
gene
maintenance.
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
Correction of genetic deficiencies will require that the therapeutic gene be
expressed
in the appropriate cells for the life of the patient. Genetic therapy for the
lysosomal storage
diseases, irrespective of whether they involve soluble or membrane-bound
enzymes, will
require life-long production of sufficient levels of the correct enzyme in
monocvte/macrophages. Production of insufficient amounts of enzyme will
generally lead
to redevelopment of disease.
It is well recognized that major problems currently beset the stem cell gene
therapy
field [Orkin and Motulsky, 1996]. Since the development of retroviral
transduction
technology in the mid 1980s, this has been a standard gene delivery technique
for
hematopoietic cells. However, retroviral transduction of primitive
hematopoietic cells has
revealed significant difficulties in satisfying requirements 1 ) and 3)
identified above. It has
been clearly demonstrated in laboratory studies, animal models, and now
clinical trials that
the presently employed retroviral vectors rarely transduce the quiescent human
hematopoietic
stem cell, thus failing to fulfill the first requirement [Miller et al., 1990;
Kohn et al., 1995;
Dick et al., 1996; Dick, 1996; Volta et al., 1996]. This is evidenced by the
extremely low
frequency (0.1-1.0%) of gene marked peripheral leukocytes several months after
transplant
in human trials - indicating stem cell transduction rates of less than or
equal to 1 % [Kohn et
al., 1995; Brenner et al., 1993]. The only early human hematopoietic cells
efficiently
transduced are cycling progenitors and long term culture initiating cells
(LTCICs) [Cassel
et al., 1995; Hughes et al., 1989], generally capable of sustaining high
levels of blood cell
production in vivo only for a finite period (i.e. approximately 2-12 months) -
before they are
replaced by the progeny of unmodified stem cells. These disappointing results
with human
stem cells contrast sharply with the efficient retroviral transduction of both
stem cells and
progenitors routinely demonstrated in the mouse system. Tluee distinct factors
are likely
to be responsible for the failure to directly transduce human stem cells: a)
the quiescent
nature of the stem cells, b) the absence of the appropriate receptors for
retroviral envelope
on the stem cells [Crooks and Kohn, 1995], and c) that the retroviral
transduction conditions,
requiring in vitro cycling of stem cells, may actually cause significant loss
of stem cell
function [Volta et al., 1996]. Although various techniques are being attempted
to overcome
these difficulties, the simultaneous solution of all three is not guaranteed.
For example,
although lentivirus-based vectors may be capable of transducing some non-
cycling cells
[Naldini et al., 1996], the failure of HIV-1 to infect quiescent primary CD4+
T-lymphocytes
2
CA 02275892 1999-06-22
WO 98/28417 PCTIiJS97/24236
[Zack et al., 1990] (i.e. generating only a partial, labile reverse
transcript) suggests that the
Go stem cells may yet prove resistant to transduction. Thus, significant
effort is now being
devoted to the evaluation of Adeno-associated virus (AAV) vectors for stem
cell
transduction. However, there is controversy and uncertainty regarding AAV's
ability to
transduce and stably integrate into quiescent primary cell genomes [Podsakoff
et al., 1994;
Halbert et al., 1995; Russell et al., 1994].
Even if these gene introduction issues can be solved, significant problems
remain in
satisfying the third requirement for long-term, cell type-specific expression.
For example,
the expression of retrovirus-transduced transgenes is frequently silenced in
the progeny of
transduced human or primate progenitors, and even in progeny of transduced
mouse
stem/progenitors [Akkina et al., 1994; Challita and Kohn, 1994; Lu et al.,
1994].
Furthermore, even in those cells demonstrating some expression, there is
significant
variability in the level of expression from cell to cell [Sadelain et al.,
1995]. As a
consequence of this dysregulated expression, hematopoietic cells, although
genetically
modified with corrective genes, may not efficiently display the corrected
phenotype.
Interestingly, these same features of dysregulated expression were also
observed in the early
transgenic mouse expression studies [Kollias and Grosveld, 1992]. Subsequent
studies
demonstrated that long-term, position-independent, copy number-dependent, cell-
type
specific expression required not only strong promoter/enhancer elements, but
also: a)
sufficient genomic sequences to dominantly confer the appropriate chromatin
configuration
(i.e, an open chromatin conformation in expressing cells) e.g. locus control
region (LCR)-
like elements [Kollias and Grosveld, 1992; Caterina et al., 1994; Talbot et
al., 1990] and
perhaps additional elements to shield the integrated sequences from the
effects of
neighboring chromatin, and b) sufficient intron/exon structure and sequences
for high level
expression [Brinster et al., 1988]. Unfortunately, the strict packaging
requirements for
retrovirus vectors (maximum of 8 kb inserted sequences), and the even stricter
requirements
for AAV vectors (maximum of 4 kb) [Miller et al., 1994], may preclude
inclusion of
sufficient regulatory sequences and/or intron/exon structure for therapeutic
applications
requiring even moderately regulated therapeutic gene expression. For example,
recent
studies examining inclusion of LCR sequences in retroviral and AAV vectors
showed
extreme variation in the level of transgene expression from cell to cell
[Sadelain et al., 1995;
Einerhand et al., 1995]. It is also possible that strong splicing signals
(i.e. intron/exon
3
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
structure) or cryptic splicing signals in transgene sequences will interfere
with retroviral
packaging of the desired unspliced full-length construct [Einerhand et al.,
1995].
The inability of the current technologies to efficiently transduce stem cells
is a major
deficiency, thus warranting distinct and innovative approaches for
transduction.
Electroporation and liposome-mediated transfection technologies have been
reported
for gene delivery to hematopoietic cells. However, these methods are
associated with
inherent features that raise questions regarding their appropriateness for
stem cell gene
therapy. These features include a) the inability of either method to transfect
a significant
percentage of enriched primary primitive hematopoietic cells of mouse and man
[Toneguzzo
and Keating, 1986; Harrison et al., 1996], b) significant variation from cell
to cell in the copy
number of DNA molecules transfected, and c) transient retention of the
transgene with only
a small minority of cells ( 1 in I 04 - 1 OS for electroporation) becoming
stably transduced
(Philip et al., 1994]. Although less information is available on the recently
developed
particle-mediated bombardment technique for gene delivery, a recent primary T-
cell
I S transfection study reported a 2-10% transfection rate 5 days post
bombardment with 1.6
micron gold particle/DNA complexes [Woffendin et al., 1994]. Based on the
present
inventor's studies with needle sizes in the size range of these particles,
stem cell damage
would be unacceptably high. It is also not clear that the available non-viral
transduction
methods would permit co-delivery of proteins with DNA - required for
anticipated future
applications.
Clinical applications of gene therapy require that therapeutic genes delivered
to
quiescent stem cells persist both in the self renewing stem cells and in their
maturing/differentiating progeny. Irrespective of the gene transfer method, it
is crucial to
understand how stem cells, and particularly quiescent stem cells, handle and
integrate foreign
DNA sequences. Very little is known regarding the fate of DNA (e.g. whether it
is integrated
into chromosomal DNA) introduced into the nuclei of stem cells, and
particularly quiescent
stem cells. Viral transduction of primary or quiescent cells may be blocked at
several points
before integration (e.g. incomplete reverse transcription or transport to the
nucleus for
retroviruses [Miller et al., 1990; Zack et al., 1990], incomplete conversion
of single stranded
DNA to double stranded proviral DNA for AAV [Russell et al., 1994]). This has
made it
very difficult, in the context of the normal AAV or retrovirus life cycle, to
focus specifically
on the transgene integration process in stem cells. The literature has not
revealed any
4
CA 02275892 1999-06-22
WO 98/28417 PCT/I1S97/24236
evidence that integration of microinjected sequences is dependent on cycling.
The ability of
wild-type HIV-1 to stably transduce quiescent macrophages [Weinberg et al.,
1991 ] and cell-
cycle arrested CD4+ HeLa or T lymphoid cells [Lewis et al., 1992] indicates
that integration
in non-proliferating cells is, in fact, possible. Integration of HIV-1
proviral DNA is mediated
by the Integrase enzyme. Some studies indicate that integration of M-MuLV
sequences need
not occur during mitosis [Roe et al., 1993]; in addition, both chromatin and
naked DNA can
serve as integration targets in vitro [Pryciak et al., 1992]. Although there
is little question
regarding the ability of wild-type HIV-1 to integrate in quiescent cells, this
has not yet been
conclusively demonstrated for HIV-1 based vectors. HIV-1 based vectors have
been reported
to be capable of establishing a stable transduction intermediate in quiescent
Rat 208F
fibroblasts [Naldini et al., 1996]. Cells recruited from quiescence even 8
days after original
infection had stable transduction frequencies equal to 50% of those infected
while in a
cycling state.
A need continues to exist in the medical arts for a method that provides for
an
improved cell viability upon introduction of genetic material into a cell.
DISCLOSURE OF THE INVENTION
The present invention in one aspect relates to the delivery of transgenes, or
transgenes
complexed with integration enzymes, directly to the nuclei of cells. Such has
resulted in the
increased incorporation of the transgene into the chromosomal DNA of the cell.
In some
embodiments, delivery is targeted to primitive cord blood stem cells. This
technology will
overcome the obstacles to transduction encountered by retroviruses and AAV
vectors. The
present invention proposes the use of Integrase-mediated integration of
appropriately
LTR-flanked transgenes in quiescent cells. When considered together with the
propensity
of retroviral DNAs to integrate into the chromatin of active genes, this
indicates to the
present inventor that integration is enhanced in the presence of open
transcriptionally active
chromatin. That is, AAV vectors and Type C retrovirus had not prior to this
time been
reported to be capable of accomplishing integration readily into quiescent
cells.
Generally stated, the present invention in some aspects provides for a method
of
introducing nucleic acid into the chromosomal nucleic acid of a cell employing
a particularly
defined composition that includes a protein and a transgene construct. The
transgene
S
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
construct may be further defined as comprising a nucleic acid sequence of
interest flanked
by a terminal fragment of a long terminal repeat sequence (LTR), such as a
retroviral LTR.
The terniinal fragment may include a length of about 10 to about 300
nucleotides, or between
about 10 to abut 250 nucleotides, or in even further defined embodiments,
between about 20
to about 200 nucleotides, in length.
In some embodiments, the protein is defined as an enzyme, such as a retroviral
integrase. The protein in other embodiments of the invention may be further
defined as a
fusion protein, such as an enzyme fused to a nucleic acid binding protein. In
yet other
embodiments, delivery is particularly targeted to primitive cord blood stem
cells. The ability
to deliver larger regions of DNA (containing required regulatory elements and
significant
intron/exon structure) than those packageable in retrovirus or AAV virions
will avert the
dysregulated expression and silencing frequently observed in the progeny of
transduced
stem/progenitor cells.
The present invention provides improved compositions containing integrase for
delivery of genetic material to cells. In particular embodiments, the cells
are hematopoietic
stem cells. Microinjection has only rarely been used for primary hematopoietic
cells'3. This
has largely been due to the inability to effectively immobilize hematopoietic
cells for
microinjection, as well as the significant damage caused by standard
microinjection needles
to the much smaller hematopoietic cells. The present invention reduces both
these technical
difficulties. In this regard, the invention in one aspect, provides a novel
method for
temporary immobilization of primitive hematopoietic cells (CD34*, CD34+/CD38',
CD34*/CD38-/Thy-1'°) allowing cells to be rapidly microinjected and
then released for
subsequent culture and/or transplantation. Fine micropipets with 0.05 - 0.5
micron tip
diameter, or 0.12 - 0.2 micron tip outer diameter (O.D.), capable of
controllable minimal
flow rates, and causing minimal injury to microinjected cells (6-8 micron
diameter) are
employed in some embodiments of the invention employing the nucleic acid
injection
preparation described herein. One advantage of the herein described method is
that
microinjection of minute quantities of either DNA and/or proteins suffice for
injection of
numerous cells. Until recent years microinjection was not a reasonable option
for stem cell
modification due to inadequate characterization of the human stem cell
phenotype. But with
recent identification of enriched populations of primitive human hematopoietic
cells likely
to include stem cells (e.g. CD34*/liri /Thy-1'° ", CD34*/CD45Ra
"°/CD71'"°/Thy-f°'S,
CD34*/CD38-'6, CD34*/c-kit'°", CD34*/CD38'/CD33'/CD19-/CD45Ra/c-
kit*'8), the number
6
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
of cells requiring genetic modification has reached a point where gene
modification at a
single cell level may be a viable alternative.
This innovative approach, focused on modifying one cell at a time as well as
multiple
cell injection, including the automated injection techniques, provides an
economically
feasible approach to current cell modification and gene therapy approaches.
Primitive cord blood stem cells will be more efficient than delivery of same
with
retroviruses and AAV vectors. It is further contemplated that larger regions
of DNA, such
as those containing required regulatory elements and significant intron/exon
structure, than
those deliverable by retroviruses or AAV virions will be deliverable by the
present
microinjection method and will avert the dysregulated expression and silencing
frequently
observed in the progeny of transduced stem cells.
In some embodiments, the methods include the use of one or more integrases as
the
particular protein enzyme. By way of example, these integrases include AAV
Rep'$ or
retroviral integrases such as M-MuLV, HIV-1, SIV, FeLV, RSV, AMV, or EIAV.
These
integrases may be in the form of expressed recombinant proteins (expressed
either in
bacteria, insect cells, or eukaryotic cells) and be either wild-type integrase
protein or
modified in their amino acid sequence. Modification of the amino acid
sequences may occur
via several techniques, such as: a) by fusion with additional amino acids to
facilitate
purification (e.g. histidine tagged, Glutathione S-Transferase (GST) tagged,
Maltose Binding
Protein (MBP) tagged), b) by fusion with amino acid sequences which provide
for binding
to specific DNA sequences (DNA binding protein) - and therefore site-preferred
or site
specific targeting of integration to specific sites within chromosomal DNA),
c) by site
specific mutation in the integrase amino acid sequence to provide for greater
integrase
protein solubility, to provide for increased efficiency in performing the
integration reaction,
etc.
Although in vitro integration can be accomplished at some frequency with
OL.TR,.~,_,
sequences and Integrasea,v_, alone, inclusion of particular cellular proteins
(e.g. the human
homolog of yeast transcription factor SNFS [Kalpana et al. , 1994] and DNA
bending protein
HMG1 [Farnet and Bushman, 1997]) may also be used to even further increase the
efficiency
of the incorporation and integration. Increased integration efficiency may
therefore be
achieved by inclusion of such cellular proteins in the DNA/Integrase mixture
to be delivered
to cells.
7
CA 02275892 1999-06-22
WO 98128417 PCT/(1S97/24236
The present invention further provides for the co-delivery with the transgene
construct and retrovial integrase other viral proteins that are normally
present in the retroviral
pre-integration complex. For example, M-MuLV gag proteins are present in the M-
MuLV
pre-integration complex, potentially increasing the efficiency of the
integration reaction.
BRIEF DESCRIPTION OF DRAWINGS
The following drawings form part of the present specification and are included
to
further demonstrate certain aspects of the present invention. The invention
may be better
understood by reference to one or more of these drawings in combination with
the detailed
description of specific embodiments presented herein.
FIG. 1 Introduction of transgenes into cells together with specific enzymes
designed
to facilitate integration. Constructs flanked by the termini of retroviral
long terminal repeats
(LTR) will be co-delivered with retroviral integrase. This approach could
apply to any
retrovirus (e.g. a lenti-virus such as Human Immunodeficiency Virus type 1 or
a type C
retrovirus such as Moloney Murine Leukemia Virus). Constructs flanked by the
AAV
inverted terminal repeats (ITR) will be co-delivered with AAV Rep'8. Although
this
schematic shows introduction of both the transgene construct and the
integration enzyme by
microinjection, both transgene and enzyme could potentially be delivered by
other means,
such as electroporation, liposome-mediated gene transfer, or particle-mediated
bombardment.
In addition, it is possible that the integration enzyme would not need be
delivered as protein.
Rather. it could be co-delivered as a DNA expression construct together with
the transgene
targeted for integration. If only the transgene, and not the integration
enzyme expression
construct, was flanked with LTR or ITR sequences, this would facilitate
integration of only
the desired transgene.
FIG. 2. Strategies for integration. Simple introduction of the transgene and
regulatory elements into the cell, when resulting in integration, should
result in integration
at random sites, with possible head-to-tail concatamers. Simple addition of
the AAV ITR
sequences are expected to provide increased rates of integration. High
frequencies of
integration have been observed for rep' AAV vectors, which like this
construct, only contain
ITR sequences and no Rep'8. The precise structure of the rep AAV DNA prior to
integration
may either exist as a linear duplex flanked by ITRs, or be circularized in the
nucleus prior to
integration. Hence, the present invention proposes that increased rates of
integration may
8
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
result from circularization of the 2 ITR-containing construct. In the absence
of the rep gene
products the integrants generally show no specificity for the AAVS 1 region of
Chromosome
19. Addition of Rep'$ protein (shown in the next construct) is expected to
increase the
preference of integration for Chromosome 19, since Rep'B recognizes DNA
sequences both
in the AAV ITR and the Chromosome 19 AAVSI region. In the next construct, the
gene
construct is flanked by sequences derived from a retroviral LTR. For example,
the only
M-MuLV LTR sequences required for in vitro integration reactions are the
extreme 10-l2bp
LTR termini. The M-MuLV viral enzyme Integrase interacts with these sequences
to
facilitate integration in vitro and in vivo. There appears to be no site
specificity for
integration of M-MuLV based vectors, although there is some preference with
respect to
nucleosomal conformation. Shown in the next part of the diagram is the
interaction with the
LTR sequences of a fusion protein between Integrase and a DNA binding protein.
This DNA
binding domain could either be derived from an existing DNA binding protein,
or a novel
protein could be designed and synthesized to have a high affinity for specific
genomic DNA
sequences. For example, it is possible that specific targeting of transgenes
to the globin locus
would facilitate their expression specifically in erythroid cells.
FIG. 3. Diagramed are the two fusion proteins expressed and purified in our
laboratory to facilitate integration of microinjected DNA sequences. Shown
above is a fusion
between the maltose binding protein and the Rep'8 protein of AAV. This was
expressed from
an MBP-Rep'8 expression construct (Batchu et al., 1995). The MBP-Rep'e fusion
protein,
purified in the identical manner, was reported to exhibit in vitro binding to
the AAV ITRs,
endonuclease activity, and helicase activity. Should the MBP sequences
interfere with
integration activity (in the cell), they may be removed from Rep'8 by cleavage
with factor Xa
(a factor Xa cleavage site is present at the site of fusion between MBP and
Rep'8). Shown
below is a similar fusion between MBP and the integrase gene of M-MuLV. The M-
MuLV
integrase gene was cloned from a construct described in Jonsson et al. , (
1993 ) - and cloned
into the pMALc2 vector used for expression of MBP-Rep'8. However, the strategy
described
is not limited to MBP-fusion proteins in the practice of the present
invention. It could
equally well employ any expression and purification strategy - for example,
GST-fusions,
histidine-tagged expression and purification, baculovirus expression vs. E.
coli expression,
and expression in eukaryotic cells.
FIG. 4A and FIG. 4B. Purification of MBP-Rep'8 fusion protein. FIG. 4A:
bacterial
lysates from pMAI.-Rep'$ transformed bacteria - grown either in the absence of
IPTG, or the
9
CA 02275892 1999-06-22
WO 98/28417 PCTJUS97124236
presence of IPTG (to induce MBP-Rep'$ expression). FIG. 4B: A new band of
approximately
120 kD is present in the +IPTG lane. Bacteria grown in the presence of IPTG
were
sonicated, and the supernatant passed twice over an amylose column. MBP-Rep'8
was eluted
from the column by addition of maltose. There is an additional co-purifying
band, running
at a somewhat lower molecular weight. [Batchu et al., 1995] postulated that
this may be a
product of a favored proteolytic cleavage of the full length MBP-Rep'8 or due
to a favored
early termination product. By scanning the gel, the purity of this preparation
is estimated to
be 90-95%.
FIG. 5. Purification of MBP-Integrase fusion protein. An expression construct
fusing
the MBP sequences with the M-MuLV Integrase gene [Johnson et al., 1993] was
prepared.
Sequencing of the expression construct confirmed the appropriate in-frame
fusion. The
MBP-Integrase protein expressed and purified similarly to that described in
FIG. 4 above for
MBP-Rep'8. Bacteria grown in the presence of IPTG were sonicated, and the
supernatant
passed once over an amylose column. A strong band running slightly slower than
the 85 kD
molecular weight marker is consistent with the estimated 88 kD fusion protein.
The purity
of this preparation is estimated to be in the range of 70-80%.
FIG 6. Sample constructs to be employed in assaying integration enzyme-
mediated
integration; prsGFP-MGMT contains both the humanized red shifted Green
Fluorescent
Protein gene (GFP; from Gibco BRL, pGREEN) and the human O6-methylguanine DNA
methyltransferase gene. All transgenes in this and the following constructs
are driven by the
phosphoglycerate kinase (pgk) promoter sequences. This particular construct is
flanked by
rare enzyme sites (Fse 1, Pac 1, Asc 1, Sfi 1) to readily permit removal of
bacterial plasmid
sequences to obtain linearized transgene sequences only (by restriction enzyme
digestion and,
if necessary, eluting the correctly sized fragment from a preparative agarose
gel). prsGFP-
MGMT/ITR contains the AAV2 ITR sequences flanking the prsGFP-MGMT sequences.
Again, linear sequences absent of bacterial plasmid sequences will be obtained
by digestion
with Fse I and Sfi I enzymes. It is also possible to obtain this construct in
a circularized form
by converting the Sfi I site to an Fse I site, digesting with Fse 1, and
religating to form a 2-
ITR containing circle. Since this may be the appropriate substrate for AAV
integration, this
circularized construct may integrate more easily than the linearized, either
in the absence or
presence of Rep'8. The last construct consists of linearized rsGFP-MGMT/OLTR
obtained
by PCR amplification with primers containing, at their 5' ends, 20 bases of
sequence
corresponding to HIV-1 LTR termini. PCR amplification was used to generate
double
CA 02275892 1999-06-22
WO 98/28417 PCT/US97124236
stranded linear constructs flanked by the appropriate HIV-1 termini. If the 20
by of sequence
are not sufficient for efficient integration, the strategy may be modified to
include additional
LTR sequences.
FIG 7. Generation of pgk-tk/OLTR~"~.,. Shown is the construct containing the
herpesvirus type 1 thymidine kinase (tk) gene, together with the
phosphoglycerate kinase
(pgk) promoter. Also shown are SV40 splice donor/acceptor and polyadenylation
sequences.
PCR primers were designed to generate a 2.74 kbp linear fragment containing
the pgk and
tk sequences, spanned by the terminal sequences of the HIV-1 LTR. The primer
(HIVU3;
36 bases) employed upstream of the Fse I site included 20 bases corresponding
to the
terminus of the U3 region (underlined) and 16 bases corresponding to sequences
in the
original pCMV(i vector (5' ACTGGA,AC,~'QGCTA_ATTCA,CTGTTGGGAAGGGCGATC 3')
(SEQ ID NO: 1). The primer (HIVUS; 35 bases) employed downstream of the Sfi
site
included 20 bases corresponding to the terminus of the US region (underlined)
and 15 bases
corresponding to sequences in pCMVp (S'
ACTGCTAGAGATTTTCCACACAGGA,AACAGCTATG 3') (SEQ ID NO: 2). Amplified
linear double stranded DNA was obtained after 30 cycles of PCR amplification
employing
Vent DNA polymerase (New England Biolabs). After PCR, the PCR.product was
extracted
with chloroform, precipitated with sodium acetate and alcohol, resuspended in
TE, subjected
to electrophoresis in a i % agarose gel, gel purified using a Geneclean kit
(Bio 1 O 1 ),
precipitated with sodium acetate and alcohol, resuspended in water, filtered
through a 0.1
micron filter, and stored at -20 deg C until use.
FIG 8. pgk-tk/ITR. Shown is the pgk-tk construct, flanked by AAV ITRs to
generate
pgk-tk/ITR. Linearized ITR-flanked pgk-tk sequences are obtained by digestion
with Fse
I and Sfi I, and then gel purified to eliminate bacterial plasmid sequences,
since bacterial
plasmid sequences have been shown to interfere with gene expression in
transgenic mice.
FIG 9. Generation of covalently closed circles for facilitating integration.
cir-rsGFP-
MGMT/ITR will be employed as a circular double-stranded DNA in some aspects of
the
present invention. A plasmid backbone containing the AAV ITRs has been
constructed, and
the rsGFP-MGMT sequences inserted between the Pac I and Asc I sites to
generate prsGFP-
MGMT/ITR. Linearized ITR-flanked rsGFP-MGMT sequences have been obtained as
described above by digestion with Fse I and Sfi I. Circularized rsGFP-MGMT/ITR
sequences, absent the plasmid backbone, will be generated as diagramed in Fig.
9. The Sfi
11
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
I site was converted in prsGFP-MGMT/ITR to create a second Fse I site. This
will be
linearized and the backbone plasmid sequences removed via Fse I digestion,
religate to
circularize at the Fse I site, and purified for circular molecules on an
agarose gel prior to
microinjection.
$FqT MODES FOR CA'ftRYING OUT THE INVENTION
The present invention in some embodiments provides a method for the
transduction
of hematopoietic stem cells (HSCs) and thus an alternative strategy for their
direct genetic
modification by: 1 ) direct delivery of DNA sequences into the nuclei of HSCs
by
microinjection; 2) integration of microinjected transgene sequences in the
chromatin of HSCs
and persistence of those sequences in the progeny of said HSCs; and 3)
microinjection of
sufficiently large ( 15-25 Kb) transgenic DNA constructs containing regulatory
elements, such
as promoters, enhancers and LCRs, and intron/exon structure necessary for
appropriate long-
term, cell type-specific expression of the introduced transgenes; and 4)
microinjection of
DNA/protein mixtures with the proteins) included in the injection sample
having gene
targeting activities.
Genetically modified HSCs prepared according to the methods of the present
invention can be employed for gene therapy applications once said modified
HSCs have been
delivered to humans for long-term reconstitution.
According to other embodiments of the present invention, hematopoietic stem
cells
that have been modified by microinjection of foreign material can be used to
treat a variety
of physiological disorders such as, by way of example and without limitation,
AIDS,
thalassemia, sickle cell anemia, and adenosine deaminase deficiency.
The physiological disorders contemplated within the invention will be
responsive to
gene therapy. By "responsive to gene therapy" is meant that a patient
suffering from such
disorder will enjoy a therapeutic or clinical benefit such as improved
symptomatology or
prognosis.
As indicated above, one aspect of the present invention relates to the use of
modified
HSCs, as cellular vehicles for gene transfer. The genes, or transgenes, can be
any gene
having clinical usefulness, for example, therapeutic or marker genes or genes
correcting gene
defects (e.g. mutant hemoglobin genes in thalassemia or sickle cell anemia) in
blood cells.
In some embodiments, the primary human cells are blood cells. The term "blood
cells" as
12
CA 02275892 1999-06-22
WO 98/28417
PCT/US97/24236
used herein is meant to include all forms of blood cells as well as
progenitors and precursors
thereof. as hereinabove described.
Thus, in one embodiment, the invention is directed to a method of enhancing
the
therapeutic effects of HSCs, comprising: (i) microinjecting into the HSCs of a
patient a DNA
segment encoding a product that enhances the therapeutic effects of the human
primary cells;
and (ii) introducing the genetically modified HSCs resulting from step (i)
into the patient.
The DNA produces the agent in the patient's body, and, in accordance with such
embodiment, the agent is expressed at the tissue site itself. Similarly, as
hereinabove
indicated, HSCs which are genetically engineered need not be targeted to a
specific site and,
in accordance with the invention, such engineered HSCs and their progeny
function as a
systemic therapeutic; e.g., a desired therapeutic agent can be expressed and
secreted from the
cells systemically.
More specifically, there is provided a method of enhancing the therapeutic
effects of
HSCs, that are infused in a patient, comprising: {i) microinjecting into the
HSCs of a patient
a DNA segment encoding a product that enhances the therapeutic effects of the
blood cells;
and (ii) introducing cells resulting from step {i) into the patient.
The primary human blood cells which are the progeny of modified HSCs and which
can be used in the present invention include, by way of example, leukocytes,
granulocytes,
monocytes, macrophages, lymphocytes, and erythroblasts. For example, stem
cells from
thalassemic or sickle cell anemia clients that are genetically modified with
the appropriate
hemoglobin gene may give rise to genetically corrected red blood cells.
The DNA carried by the HSCs can be any DNA having clinical usefulness, for
example, any DNA that directly or indirectly enhances the therapeutic effects
of the cells.
Alternatively, the DNA earned by the HSCs can be any DNA that allows the HSCs
to exert
a therapeutic effect that the HSCs would not normally exert. Examples of
suitable DNA,
which can be used for genetically engineering, for example, blood cells,
include those that
encode cytokines such as tumor necrosis factor (TNF), interleukins {for
example, interleukins
1-12), globin genes, DNA-repair genes, drug-resistance genes and HIV (Human
Immunodeficiency Virus) resistance genes.
The DNA which is used for transducing the human cells can be one whose
expression
product is secreted from the cells. Alternatively, it may encode for gene
products retained
within the cell. The human cells can also be genetically engineered with DNA
which
functions as a marker, as hereinafter described in more detail.
13
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
In one aspect, the inserted genes are marker genes which permit determination
of the
traffic and survival of the transformed cells in vivo. Examples of such marker
genes include
the neomycin resistance (neon) gene, multi-drug resistant gene, thymidine
kinase gene, (3-
galactosidase, dihydrofolate reductase (DHFR) and chloramphenicol acetyl
transferase.
The HSCs are genetically engineered in vitro. For example, cells may be
removed
from a patient and stem cells isolated; genetically engineered in vitro with
DNA encoding
the therapeutic agent, with such genetically engineered HSCs being
readministered along
with a pharmaceutically acceptable carrier to the patient. Such a treating
procedure is
sometimes referred to as an ex vivo treatment.
As part of a clinical treatment regiment for a patient having cancer or at
risk of
developing cancer, the progeny of the modified HSCs provide a population of
primary human
cells that express the product of the genetic foreign material microinjected
into the parent
HSCs.
The pharmaceutically acceptable carrier may be a liquid carrier (for example,
a saline
solution) or.a solid carrier; e.g., an implant. In employing a liquid carrier,
the engineered
cells may be introduced parenterally, e.g., intravenously, sub-cutaneously,
intramuscularly,
intraperitoneally, or intralesionaly.
The following abbreviations have been used in the preparation of this
disclosure.
pCMV-~i DNA plasmid expressing the ~i-gal reporter gene under
control of the cytomegalovirus (CMV) promoter/enhancer
sequences.
FITC-Dextran FITC coupled to dextran
CD34+CD38-Thy-I+ the CD38Thy-1+ (actually Thy-1'°) subpopulation
of CD34+
cells isolated by FACS.
IMDM ~scove's modified ~ulbeccos media.
The foregoing will be better understood with reference to the following
examples
which detail certain procedures according to the present invention. All
references made to
these examples are for the purposes of illustration. They are not to be
considered limiting
as to the scope and nature of the present invention.
14
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
EXAMPLE 1
DELIVERY OF FITC-DEXTRAN TO IMMOBI .l~Fn c~ 34+ CELLS
Purification and Culturing_of D 4' CELLS
S The CD34+ antigen, present on approximately 0.5-1.0% of mononuclear bone
marrow
and umbilical cord blood cells, marks measurable human hematopoietic stem and
progenitor
cells. Umbilical cord blood cells were obtained from normal human fetal
deliveries, and
mononuclear cells were purified by centrifugation over Ficoll-hypaque. CD34+
cells were
isolated by immunomagnetic selection with the Miltenyi MiniMACS CD34 Multisort
Isolation Kit (involves (1) incubation of cells with anti-CD34 antibody
coupled via dextran
to immunomagnetic particles, (2) isolation of magnetically-labeled cells by
passing through
a column attached to a magnet, (3) release of cells from magnetic particles by
cleavages with
dextranase, (4) separation of cells from magnetic particles by passing through
column
attached to a magnet). Subsequent FACS analysis; with another anti-CD34
antibody
recognizing a different CD34 epitope, demonstrated that the cells were 90%
pure for CD34
expressing cells. Purified cells were maintained overnight ( 18 hrs) in serum
free medium
(Iscoves Modified Dulbecco's Medium (IMDM, Gibco) supplemented with bovine
serum
albumin (2%, StemCell Technology), insulin (10 micrograms/ml,), transferrin
{200
microgram/ml, ICN), 2-mercaptoethanol (0.05 mM, Sigma), low-density
lipoprotein (40
microgram/ml, Sigma), and pen-strep (100 units and 50 microgram/ml,
respectively)
containing 20 ng/ml human Flt-3 ligand (Peprotech), 20 ng/ml human Interleukin-
3 (IL-3,
Peprotech), and 20 ng/ml human Stem Cell Factor (SCF, Peprotech) [IMDM/F-3-S]
at 37° C
with 5% CO2.
Preparation of Fibronectin-Coated Surface
A 6 mm glass cloning ring was attached via vaseline to a 35 mm tissue culture
dish
(Corning). The dish surface enclosed by the cloning ring was coated with
fibronectin by
adding 30-50 microliters of a 50 microgram/ml fibronectin solution (Boehringer
Mannheim,
#1051-407) in phosphate buffered saline (PBS, Sigma}, and incubating overnight
at 4 °C
(alternatively, can be for 45 min. at room temperature). Excess fibronectin-
containing
solution was removed from the cloning ring immediately prior to addition of
cells.
CA 02275892 1999-06-22
WO 98/28417 PCT1US97/24236
Attachment of CD34+ Cells to Fibronectin- natPri rich
After overnight culture, cells were prepared at a concentration of 8 x 104
cells/ml in
IMDM/F-3-S. This cell-containing media (25 microliters containing
approximately 2000
cells) was mixed with 25 microliters of media (IMDM) conditioned 2 days by the
TS2/16.2.1
hybridoma cell line (ATCC #HB-243 which produces antibody reactive with
Integrin beta,
-human CD29). The 50 microliters of cell/antibody mixture was placed into a 6
mm glass
cloning ring enclosing the fibronectin-coated surface. 'Cells, in the presence
of antibody,
were allowed to attach to fibronectin for greater than 30 min. at 37 °C
in the presence of 5%
CO2. Subsequently, l ml of IMDM/F-3-S was added outside the cloning ring, and
the 35 mm
plate containing cells and cloning ring was spun at 600 rpm for 5 min (Beckman
low-speed
GS-6R centrifuge, swinging bucket rotor, brake ofd.
icroi jection of CD34+ Cells with FITC-Dextr~~
Fine glass microinjection needles were prepared from thin-walled borosilicate
glass
capillaries (Sutter, 1.2 mm O.D., 0.94 mm LD.) with an automated pipet puller
(Suffer, P-87,
3 mm box filament). Scanning Electron Transmission (SE) microscopy was used to
determine the outer diameter of microinjection needles pulled with the
identical program;
O.D.s between 0.17 and .22 micron were obtained. FITC-dextran (150,000 M.W.,
Sigma)
at a concentration of 0.25% (weight per volume) in 50 mM Hepes (pH 7.2/100 mM
KCl/5
mM NaH2P04) was passed through a 0.02 micron filter (World Precision
Instruments) and
centrifuged at high speed ( 10,000 rpm, IEC Centra-4b) before loading via an
Eppendorf
microloader into microinjection needles. Microinjections were performed
manually with a
Narishige micromanipulator mounted on an Olympus OMT-2 inverted microscope
(with
heated stage) with a 40x phase dry objective. Pressure for fluid delivery was
provided by an
SAS 10/2 Screw Actuated Air micro-injection/aspiration syringe. The cloning
ring was
removed immediately before microinjection. After flow of fluid from the needle
was
co~rmed, 60 cells (in approximately 30-45 minutes) were microinjected with
approximately
2-10 femtoliters of FiTC-dextran. Although delivery of material was targeted
for the
nucleus, some material was delivered to the cytoplasm.
Monitoring and Su~s~~zent Culture of Microiniected Cells
After microinjection, a larger cloning ring (8 mm diameter) was placed around
the
region of microinjected cells. Delivery of FITC-dextran to cells was monitored
by
16
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
fluorescence microscopy with a Nikon Diaphot 300 inverted microscope with
fluorescence
attachment (FITC.). Both bright-field and fluorescence images can be captured
and saved
with a Hamamatsu chilled CCD camera and controller, Sony Trinitron monitor,
frame
grabber, and networked Gateway 486-25. Within 30 min. after microinjection,
approximately 35 FITC-positive cells (out of 60 total; 58-67%) were clearly
identifiable. A
significant number of the cells clearly showed nuclear localization of
fluorescence; some
showed both nuclear and cytoplasmic localization, and a small number showed
only
cytoplasmic fluorescence. Twenty-four hours post microinjection,19 fluorescent
cells (32%)
were still visible; seventy-two hours post microinjection, 16 fluorescent
cells (32%) were
visible.
The present example is provided to demonstrate the utility of the present
invention
for providing transgene constructs that include a nucleic acid sequence
encoding a gene of
interest, such as a therapeutic gene, and the successful stable incorporation
and expression
of the therapeutic gene, in a cell. The gene may be any mammalian gene, or
pharmacologically active fragment thereof, and particularly a human gene.
The present example describes a number of transgene constructs that express
both the
red shifted Green Fluorescent Protein (rsGFP) reporter gene and the human O6-
methylguanine DNA methyltransferase (MGMT) gene. The MGMT gene is one that
would
provide chemotherapeutic agent resistance to cells, and hence would provide a
desired and
useful treatment for a patient exposed to chemotherapeutic agents. For
example, such may
include patients with cancer/tumors undergoing chemotherapy as part of an anti-
cancer
regimen.
Since the rsGFP reporter permits rapid and sensitive assessment of expression,
it will
permit a rapid determination of nuclear-specific gene deliver and transgene
persistence. The
human MGMT gene was chosen because MGMT transgene expression in mouse stem
cells
is sufficient to protect them from the toxic effects of alkylating agents such
as BCNU. The
present invention provides methods for targeted expression of MGMT in human
stem cells,
and further demonstrates the utility of the invention for in vivo enrichment
of transduced
stem cells.
17
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
In some embodiments, the invention provides a method for the stable
transduction
of primitive cord blood cells, and the preparation of immature cord blood
populations
enriched in SRC activity. Improved methods for stable integration frequency in
cell co
injected with constructs flanked by HIV-1 LTR or AAV ITR sequences together
with HIV-1
integrase or AAV Rep'8 are also provided.
Four particular transgene constructs are defined in FIG. 6. All include MGMT.
E3~AMPLE 3
HUMAN GENE THER_A_PY METHODS
The present example demonstrates the utility of the present invention for
providing
a gene therapy treatment for humans.
The number of stem cells that need be delivered to humans for long term
reconstitution may be extrapolated from mouse, large animal, and human studies
to permit
a reasonable estimate. Since the genetic therapies under consideration will
frequently be
directed to children, these estimates are based on their smaller body weight.
Although a
significant number of unmarked, short-term reconstituting cells may be co-
delivered to better
facilitate rapid engraftment and survival, the focus here is on the much
smaller number of
gene-modified, long-term reconstituting stem cells. a) Three independent mouse
studies have
reported long-term reconstitution with as few as 20 marrow cells [Halbert et
al., 1995], 10
marrow cells [Russell et al., 1994], or even 1 marrow cell (20% of mice
reconstituting
[Akkina et al., 1994]). If direct scaling by weight alone is appropriate, an
average
reconstitution requirement of 5 cells for mice would extrapolate into
approximately a 5,000
marrow cell requirement for a human child. b) In human marrow transplantation,
the
minimal dose typically delivered is 1 x 10g nucleated cells per kg body weight
[Challita and
Kohn, 1994], equivalent to 2.5 x 109 cells for a 25 kg child. Experimental
data and modeling
of feline hematopoiesis indicate that the stem cell frequency is approximately
1 in 1.7 x 106
marrow cells [Lu et al., 1994]. If this same frequency holds for human marrow,
delivery of
2.5 x 109 cells corresponds to delivery of 1450 stem cells. c) Children
reconstitute with as
little as 30 mls of transplanted cord blood, likely due to the significant
proliferative potential
of primitive hematopoietic cord blood cells [Sadelain et al., 1995]. Assuming
approximately
1.5 - 3 x 108 nucleated cells in this volume, with a stem cell frequency of 1
in 105 to 106 this
translates into successful engraftment with as few as 150 -3,000 stem cells.
d) Evidence from
engraftment of human cord blood cells in NOD/SCID mice suggests a very close
relationship
18
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
(if not equivalence) between NOD/SCID reconstituting cells (SRCs) and human
stem cells.
SRCs are present at a frequency of ~ 1 in 10' CD34+ cells [Kollias and
Grosveld, 1992;
Caterina et al., 1994]. Thus, 30 mls of cord blood (with approximately 3 x 10'
mononuclear
cells, 1 % of which are CD34+) contain approximately 30 SRCs. Even if the
seeding
efficiency of SRCs in NOD/SCID mice is only 10%, this translates into 300
SRCs. Thus,
all four calculations suggest a number of stem cells in the range of about 150
to about 5000
would be useful as a treatment in the practice of the present invention.
Successful
reconstitution is affected by stem cell delivery and engraftment by short-term
progenitors.
It is possible therefore that the stem cell requirements are even less than
those calculated in
b) and c) above.
Although the present hematopoietic stem cell-oriented work has been with
manual
microinjection (100-200 injected cells/hr), the presently disclosed methods
are expected to
easily accommodate the higher-speed (300-600 cells/hr) automated injection.
The automated
microinjection system may well be adequate for clinical gene therapy
applications.
Computer automated systems, capable of 1500 cell injections per hour
[Pepperkok et al.,
1988], may be employed to microinject a sufficient number of stem cells for
transplantation
(i.e. 1000-10,000 cells depending on the stable transduction frequency). Any
significant in
vitro or in vivo expansion of stem cells [Emerson, 1996], as well as together
with selection
for marked cells, would further decrease the number of microinjected stem
cells required for
engraftment.
A significant fraction of corrected stem cells present in vivo may be
accomplished by
in vitro selection for marked stem cells prior to engraftment (so that only
the successfully
transduced cells are transplanted into the patient) and/or by subsequent in
vivo selection for
marked stem cells (to enrich for gene marked stem cells at the expense of
endogenous,
unmarked stem cells). This will generally require transduction of stem cells
with two
independently regulated genes present on the same DNA construct: the
selectable gene
targeted for expression in stem/progenitor cells and the therapeutic gene
(e.g. ADA or globin)
- targeted for expression in the required cell type. Genes potentially useful
in in vitro
selection of transduced stem cells include rsGFP or truncated nerve growth
factor receptor
19
CA 02275892 1999-06-22
WO 98/28417 PCT/US97t24236
(tNGF-R). Transduction of stem cells with the human O6-methylguanine DNA
methyltransferase (MGMT) gene will enable in vivo selection of surviving,
marked stem cells
by briefly treating patients with alkylating agents of the nitrosourea class
(e.g. 1,3-bis (2-
chloroethyl)-1-nitrosourea; BCNU). Whereas most anti-neoplastic drugs (e.g.
Taxol) are
toxic to cycling hematopoietic progenitors, sparing the quiescent
hematopoietic stem cells,
nitrosoureas, such as BCNU, also exert their DNA-damaging and toxic effects
directly on the
stem cells. MGMT, which removes O6-alkylguanine induced in DNA by various
alkylating
agents, is normally expressed at very low levels in hematopoietic
stern/progenitor cells.
However, when exogenously expressed in cells, MGMT confers cell resistance to
BCNU,
CCNU, dacarbazine, N-methyl-N'-nitro-N-nitrosoguanidine, temozolomide, and
streptozotocin. For example, mice expressing MGMT in their stem cells were
resistant to
BCNU-induced hematosuppression [Maze et al., 1996]. The human multiple drug
resistance
gene (MDR-1) has been proposed for in vivo selection of transduced stem cells.
Human stem
cells already constitutively express MDR-1 [Chudhary and Roninson, 1991 J.
Hence, the
enrichment for transduced cells by MDR-1 resistant drugs (e.g. taxol) as
employed in the
practice of the present invention is expected to occur at the level of
progenitors but not stem
cells. As is true for any proposed in vivo selection (e.g. BCNU, taxol) for
marked
hematopoietic cells, drug toxicity for other organs and cells will be
minimized. MGMT
transgene expression, by itself, is expected to confer resistance in
hematopoietic cells to
agents such as BCNU employed in high-dose or repetitive chemotherapy for
breast and other
cancers [Maze et al., 1996].
In one aspect, gene therapeutic applications of stem cell microinjection may
include
the following elements: Approximately 1-10 x 10' highly enriched stem cells
will be obtained
from cord blood, and will be temporarily immobilized. Microinjection of these
cells will
deliver a reproducible volume- containing DNA, and in some embodiments, also
include
integration enzyme(s}-such that 1-3 copies of the DNA are successfully
integrated per cell.
Microinjected DNAs of 15-25 kb in size, containing two independently regulated
transgenes,
will be integrated without rearrangement. One transgene, targeted for
expression in stem
cells, will provide for in vitro (e.g. rsGFP, or truncated nerve growth factor
receptor; tNGF-
R) or in vivo (e.g. MGMT) selection of transduced stem cells. The therapeutic
transgene (e.g.
ADA for ADA SCID, globin for hemoglobinopathies, MDR-1 for chemoresistance)
will be
targeted for expression in the appropriate hematopoietic cells. Microinjection
would also be
an appropriate method for eventual nuclear delivery of artificial human
chromosomes and/or
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
episomal plasmids capable of persistent maintenance. In some embodiments, cell
viabilities
greater than 80% post microinjection and stable transduction frequencies
greater than 25%
are expected to be provided.
EXAMPLE 5
PURF~~,;CION AND BIOLOGICAL ASSAYS
OF PRIMITIVE CORD BLOOD CELLS
CD34+, CD34+/CD38', and CD34+/CD38'fThy-1'° populations of cord blood
cells are
provided. CD34' hematopoietic cells, representing approximately 0.5 - 1.0% of
nucleated
umbilical cord blood and bone marrow cells, comprise all measurable human
stem/progenitor
activity. The CD34+/CD38' phenotype (approximately 5-10% of CD34+ cord blood
cells)
characterizes an even more primitive subpopulation. Cells capable of
engrafting human
hematopoiesis in the immunodeficient NOD/SCID mice-considered to be more
primitive
than LTCICs and colony forming cells-are present exclusively in the
CD34+/CD38'
population [Dick et al., 1996; Dick, 1996). CD34+/CD38' cord blood cells are
highly
enriched in the primitive CD34+/CD45Ra "°/CD71'"° phenotype
identified by Mayani et al.
[Mayani et al., 1993]. Their further demonstration that the Thy-f°
subset of
CD34+/CD45Ra "°/CD71'"° cells represents an even more primitive
population of cells-is
consistent with the characterization of human fetal liver stem cells as being
CD34+/liri /Thy-
f°. The present inventors have observed that CD34+/CD38'/Thy-f°
cells (approximately 10-
25% of CD34+/CD38' cells) are significantly more enriched than CD34+/CD38'/Thy-
f cells
in LTCICs that produce colony forming cells generating large numbers of
progeny. Based
on the above considerations, CD34+, CD34+/CD38', and CD34+/CD38'/Thy-
1'° phenotypes
represent increasingly enriched populations of human stem cells.
Protocols to purify and functionally assay these particular cell populations-
to permit
the microinjection and stable transduction assays-are thus to also be
provided.
EXAMPLE 6
P 1FI ATION OF CD34+/CD38': AND
~i7~~+/CD38/THY-1'° CELLS
Umbilical cord blood cells were obtained on a weekly basis (2-4 samples per
week;
total of 100-250 mls) from normal deliveries at UTMB, and pooled mononuclear
cells are
isolated by centrifugation over Ficoll-hypaque. CD34+ cells are isolated by
immunomagnetic
21
CA 02275892 1999-06-22
WO 98/28417 PCT/US97124236
selection with the Miltenyi MiniMACS CD34 Multisort Isolation Kit. Isolated
cells are
obtained free of attached magnetized particles (by cleaving the dextran
antibody-particle
linker with dextranase). Recovery was typically 70-90% of the expected CD34
cell number
(100 mls of cord blood typically yields 1-2 x 108 mononuclear cells, with CD34
isolation
giving 1-2 x 106 cells with 90-95% viability and 80-95% CD34 positivity).
Fluorescence
activated cell sorting (FACS) with a Becton-Dickinson FACS Vantage instrument
is then
employed to isolate specific CD34+ cell subpopulations. Cells satisfying the
sort criteria are
either bulk sorted into tubes or a pre-specified number are deposited into
individual wells of
a 96 well plate via an Automated cell deposition unit (ACDU): For purification
of
CD34'/CD38' cells, the enriched CD34+ cells are stained with PerCP-CD34 and PE-
CD38
antibodies, and cells satisfying both the CD34+/CD38' and low side and forward
scatter
criteria are isolated. CD34+/CD38- cells typically comprise approximately 5-
10% of the total
CD34' cells; with an actual sort recovery rate of 50%, we yield approximately
2 - 5 x 104
CD34'/CD38' cells per sort. Excellent purity of the sorted CD34+/CD38- cells
was obtained.
The primitive nature of the sorted CD34+/CD38' cells was substantiated by the
vast majority
of them exhibiting the CD45Ra ~'°/CD71-"° phenotype. The
CD34+/CD38- population may
in some instances subdivide into Thy-l~° (approximately 10-25% of the
CD34+/CD38-cells)
and Thy-1- (approximately 75-90% of CD34'/CD38- cells) subsets. Approximately
2-10 x
103 CD34+/CD38'/Thy-1~° enriched cells can be typically recovered in
such sorts. Such
provides a method for enhancing a population of cells for primitive
(CD34+/CD38-,
CD34'/CD38-fThy-1~°) populations of cord blood cells to be used in the
microinjection and
functional assays.
EXAMPLE 7
EXPRESSION OF rsGFP BY MICROINJECTED
CD34+. CD34+/CD38/THY-1'° C~LS
Transient reporter gene expression in cells microinjected with DNA is
demonstrated
in the present example. The rsGFP reporter is the represented DNA employed. It
permits
rapid assessment of gene expression, without the need for additional antibody
labeling or
enzymatic assays.
Cells are isolated and attached to fibronectin. Cells are generally
microinjected with
about 100 to about 250 ng/microliter solution, in microinjection buffer, of
plasmid DNA
expressing the humanized rsGFP protein under control of the cytomegalovirus
(CMV)
22
*rB
CA 02275892 1999-06-22
WO 98/28417 PCT/US97124236
promoter/enhancer. Microinjection needles of 0.2 +/- 0.02 micron O.D. are
presently
employed. rsGFP expression is monitored by fluorescence microscopy using a
filter set
optimized for rsGFP detection. rsGFP expression in 10-15% of injected cells, S-
24 hours
post injection was generally observed. Although this frequency gradually
decreases with
increasing time of culture and observation, expressing cells (and a smaller
number of
dividing, expressing cells) were observed as late as 4-5 days after
microinjection. Since the
FITC-dextran injection results suggest that approximately 30-50% of injected
cells survive
quantitative delivery of injected material (24 hrs post injection), then
approximately 20-50%
of successfully injected cells transiently expressed rsGFP 5-24 hours post
injection. In
general. the rsGFP-expressing cells appear to be in very good condition, with
normal
morphology. However, there are occasional expressing cells whose condition
deteriorates
with time. No significant difference in the expression frequency among CD34+,
CD34'/CD38-, and CD34+/CD38~/Thy-1'° populations was observed. This
data provides
dispositive evidence for transgene expression in primitive CD34+/CD38'/Thy-
1'° cells.
Further studies will be required to elucidate the gradual decline in the
number of rsGFP-
expressing cells. However, this pattern is not unexpected since almost all
expression should
be from unintegrated DNA copies-and expression should decrease as the
unintegrated
copies become degraded.
EXAMPLE 8
FXPRF~~1ON AND PiIRIFICATION OF AAV Ren'8
M-MuLV INTEGRASE PROTEINS
Integration of microinjected DNA sequences is facilitated in some aspects of
the
invention by flanking them with specific AAV (ITR) or M-MuLV (LTR) sequences,
and
coinjecting them with proteins (AAV Rep'8 or M-MuLV Integrase, respectively),
which by
interacting with these sequences, will enhance and/or facilitate their
integration. Bacterially
expressed and purified protein has been used in these studies. A fusion
protein consisting
of the maltose binding protein (MBP) fused to AAV Rep'a has been expressed in
bacteria.
It has been purified to approximately 90-95% homogeneity by double passage
over an
amylose column (MBP-Rep'a 120 kD, total protein obtained ~ 1 mg; Figure 4).
The MBP-
Rep'$ expression construct used is described in Batchu et al. (1995). The MBP-
Rep'8 fusion
protein. purified in the identical manner, was reported herein to exhibit in
vitro binding to
the AAV ITRs, endonuclease activity, and helicase activity [Batchu et al.,
1995]. The
23
CA 02275892 1999-06-22
WO 98/28417 PCT/US97124236
present investigators purified material exhibits binding to the AAV ITR
sequences.
Additional experiments confirm that the binding of MBP-Rep'8 to AAV ITR
sequences is
sequence specific (i.e. minimal binding to control, irrelevant DNA sequences)
and results in
the expected endonucleolytic cleavage of the ITR hairpin structure. These data
demonstrate
that the purified MBP-Rep'8 protein has in vitro activity consistent with that
of Rep'$ alone.
It is therefore expected that it will be active in microinjected cells. Should
the fused MBP
sequences interfere with integration activity, they will be removed from Rep'8
by cleavage
with factor Xa (a factor Xa cleavage site in present at the site of fusion
between MBP and
Rep'$). A similar construct for expression of an MBP-Integrase fusion protein
has been
generated in the present inventor's laboratory (the M-MuLV Integrase sequences
described
in Johnson et al., (1993). Sequencing of the expression construct has
confirmed the
appropriate in-frame fusion. The fusion protein has already been over-
expressed in bacteria
and has already been purified to ~70-80% homogeneity by single passage over
amylose
(Fig. 5; MBP-Integrase 88 kD). Similar GST- and histidine-Integrase fusions
have
previously been shown to function in in vitro integration reactions. Again if
MBP interferes
with Integrase activity, MBP will be released by factor Xa cleavage.
Alternatively, the GST-
Integrase fusion protein will be expressed and purified [Dotan et al., 1995]).
EXAMPLE 9
1.INEARIZED LTR-DNA AND ITR-DNA CONSTRUCTS
For evaluation of integration strategies in hematopoietic stem cells,
constructs will
be employed that are capable of expressing both the red shifted Green
Fluorescent Protein
(rsGFP) reporter gene and the human MGMT gene. The rsGFP reporter gene in
microinjection has been employed by the present investigators. It permits
rapid assessment
of transgene expression, without the need for additional antibody labeling or
enzymatic
assays. In addition, it may be employed for in vitro selection of successfully
transduced stem
cells prior to transplantation into humans. The human MGMT transgene will be
employed
because its expression in stem cells is sufficient to protect them from the
toxic effects of
specific alkylating agents (e.g. BCNU; [Maze et al., 1996]), allowing rapid in
vitro selection
of gene-modified stem cells. We believe that inclusion of MGMT as a selectable
marker
gene may eventually enable in vitro or in vivo enrichment of stem cells co-
transduced with
a therapeutic gene (e.g. glucocerebrosidase). rsGFP and human MGMT will be
employed
24
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
from the rsGFP-MGMT family of constructs (Fig. 6; all of these constructs have
already
been generated). The phosphoglycerate kinase (pgk) promoter, highly active in
immature
and mature hematopoietic cells, as well as in fibroblasts, will be used to
drive expression of
both rsGFP and MGMT genes.
There are two potential strategies for stable in vitro transduction of
quiescent
hematopoietic stem cells. The first is to facilitate the integration event
directly in the
quiescent cell ex vivo (denoted 'integration-quiescent'). The second is to
deliver the DNA
(perhaps together with integration enzymes) to the quiescent cell and
establish a stable
transduction intermediate, which can later be integrated when the cell is
returned to its in
vivo environment and undergoes a self renewing cell division (denoted
'integration-
quiescent/cycling'). There is evidence (AAV vectors [Russell et al., 1994] and
HIV-1 based
vectors [Naldini et al. , 1996]), for the existence of such transduction
intermediates in
quiescent cells, capable of subsequent integration when cells go into cycle.
A plasmid backbone containing the AAV ITRs has been completed, and the rsGFP-
MGMT sequences inserted between the Pac I and Asc I sites to generate prsGFP-
MGMT/ITR. Linearized ITR-flanked rsGFP-MGMT sequences will obtained by
digestion
with Fse I and Sfi I. Circularized rsGFP-MGMT/ITR sequences, absent the
plasmid
backbone, will be generated as diagramed in Figure 9. The Sfi I site has been
converted in
prsGFP-MGMT/ITR to create a second Fse I site. The construct will be
linearized and
backbone plasmid sequences removed via Fse I digestion, religated to
circularize at the Fse
I site, and circular molecules purified on an agarose gel prior to
microinjection.
Co-delivery of Integrase with LTR-flanked transgenes and co-delivery of Rep'8
with
ITR-flanked transgenes are expected to increase the rate of integration.
Examining both
linear and circular ITR-containing constructs will demonstrate which substrate
Rep'8 utilizes
for wild-type AAV integration.
The joint delivery of naked DNA (i.e., DNA not within a delivery vehicle such
as
liposome) and Integrase or Rep'8 to cell nuclei has not previously been
attempted, and as part
of the present invention provides an improved approach to genetically
modifying important
cell types.
25
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
FKAMPLE 10
T TR~TTEGRA~F ANTS TTR/RPp~g ~~rErmATED Il';TEGRATT(~N
A characteristic of retroviruses (both lentiviruses (e. g. HIV-1 ) and type C
retroviruses
(e.g. M-MuLV)) and wild-type AAV is the ability to incorporate gene sequences,
with high
efficiency, into the chromosomal DNA of the target cell. Provided that the
multiplicity of
' infection is sufficiently high, a significant fraction, if not all, of the
target cells may acquire
an integrated proviral copy. The only retroviral LTR sequences required for in
vitro
integration reactions are the extreme 10-12 by LTR termini [Goff, 1992;
Goodarzi et al.,
1995; Reicin et al., 1995; LaFemina et al., 1991]. The retroviral Integrase
enzyme interacts
with these sequences to facilitate integration in vitro and in vivo (Goff,
1992; Goodarzi et
al., 1995; Reicin et al., 1995; LaFemina et al., 1991]. There appears to be no
site specificity
for integration of retroviral vectors, although there is a preference for
integration into the
chromatin of transcriptionally active genes [Vijaya et al., 1986; Withers-Ward
et al., 1994]
and a preference with respect to nucleosomal conformation [Pruss et al.,
1994). Wild-type
AAV is unique in its preferential integration into a specific region of the
human genome.
AAV Rep'8 is required for chromosome 19 specific integration, since rep AAV
vectors do
not have the same pattern of site-specific integration as rep+ AAV vectors
[Muzyczka, 1992].
The Rep's protein is believed to play several essential roles in chromosome 19
specific AAV
integration -- mediating the formation of a complex between a 12 nucleotide
sequence within
the ITRs and a similar sequence on chromosome 19 (the AAVS1 region) prior to
integration,
and also introducing a strand-specific break within AAV S 1 [Linden et al. ,
1996]. It was
recently reported that co-transfection of cells with an ITR-flanked gene
(lacZ) together with
a Rep'8 expression construct yielded a 10 fold increase in the number of
stable lacZ-
expressing cells. In addition, the majority of integrants were Chromosome 19
specific and
constructs up to 35 kb in size could be integrated - provided they contained
at least a single
ITR [Natsoulis et al., 1995]. These results strongly indicate that simple
delivery of ITR-
flanked sequences together with Rep'8 protein will also facilitate integration
- likely to occur
in a site-specific, or at least site-preferred, manner. Providing the purified
Integrase or Rep'8
protein together with the delivered DNA, possibly as a preformed DNA/ protein
complex,
may have advantages over producing the integration proteins in cells from an
expression
construct. Already delivering an ~L,TR/Integrase or ITR/Rep'8 DNA/protein
complex will
26
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
eliminate the need for the expressed proteins to translocate from the
cytoplasm to the
nucleus, and then to find and form complexes with the OL,TR or ITR sequences.
HIV-1 is capable of delivering proviral DNA to nuclei of quiescent cells and
stably
transducing quiescent macrophages [Wenberg et al., 1991; Lewis et al., 1992].
Although it
has not yet been conclusively demonstrated that HIV-1 based vectors can
integrate in Go
cells, they are capable of establishing a stable transduction intermediate in
quiescent Rat
208F fibroblasts ('integration-quiescent/cycling') [Naldini et al., 1996].
Cells recruited from
quiescence even 8 days after original infection had stable transduction
frequencies equal to
50% of those infected while in a cycling state. We have chosen to initially
examine HIV-1
Integrase (rather than M-MuLV Integrase) will be examined for its ability to
facilitate
integration. HIV-1 is known to be capable of the 'full-site' integration
events in vitro
[Goodarzi et al., 1995] and to stably transduce quiescent cells. Whether M-
MuLV Integrase
is also capable of accomplishing integration in quiescent cells is unknown,
since pre-
integration complexes of wild-type M-MuLV and M-MuLV vectors are incapable of
transport into the nuclei of quiescent cells [Miller et al., 1990]. However,
previous studies
have indicated that the actual integration of M-MuLV sequences need not occur
during
mitosis [Roe et al., 1993].
High frequencies of integration are also observed for cells transduced with
rep AAV
vectors [Muzyczka,1992). Although the precise structure of the AAV vector DNA
prior to
integration is unknown, it is likely that it either exists as a linear duplex
flanked by ITRs or,
as is postulated to be the case for wild-type AAV, is circularized in the
nucleus prior to
integration [Linden et al., 1996]. AAV vector DNA integrates into cellular DNA
as one to
several tandem copies joined to chromosomal DNA through the ITR termini
[Flotte and
Carter, 1995). When linked to other transgene sequences, the ITRs alone are
sufficient to
confer increased rates of integration [Philip et al., 1994]. T'here is
controversy regarding the
ability of rep' AAV vectors to directly transduce non-cycling cells [Podsakoff
et al. , 1994;
Russell et al., 1994]. Although AAV-vectors prefer cycling cells for
transduction, they either
directly integrate at low frequency in non-cycling cells ('integration-
quiescent') [Podsakoff
et al., 1994) or exist as single stranded episomes in non-cycling cells and
subsequently
integrate as double stranded DNA when the cells go through S-phase
('integration-
quiescentlcycling') [Russell et al., 1994].
z~
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
The ability of Integrase to facilitate integration of linearized ~LTR-flanked
rsGFP-
MGMT sequences. The rsGFP-MGMT sequences will be flanked by the most terminal
20
by HIV-1 LTR sequences to generate rsGFP-MGMT/OLTR. This linear construct will
be
generated by PCR employing primers 35 bases in length - 15 bases corresponding
to the
extreme rsGFP-MGMT sequences and 20 bases identical to HIV-1 LTR termini.
Cells will
be microinjected with either PCR-generated linear molecules of rsGFP-MGMT/~LTR
pre-
incubated with Integrase, or with PCR-generated linear molecules of rsGFP-
MGMT/DLTR
alone. Since 20-30 kb sequences can be generated by PCR amplification using
optimized
protocols, this approach should be generally applicable to larger transgene
constructs. For
evaluation of the ITR/Rep'$ strategy, cells will be microinjected either with
linearized rsGFP-
MGMT/ITR pre-incubated with Rep'8, or linearized rsGFP-MGMT/ITR alone.
Circular
double-stranded proviral DNA may be the relevant substrate for normal AAV
integration.
This will be evaluated by employing cir-rsGFP-MGMT/ITR. In order to maximize
the
possibility that the integration enzymes locate and bind to their target LTR
or ITR sequences,
DNA and proteins will be incubated together prior to microinjection into a
cell.
Optimization of integration frequency will likely require varying the
following experimental
parameters: a) # of DNA molecules delivered per cell, b) # of Integrase or
Rep'8 molecules
per DNA molecule, and c) conditions for preloading of DNA with Integrase or
Rep'a. In
addition, it will be determined if the rsGFP-MGMT/ITR integration events were
in the
Chromosome 19 region preferentially used by wild-type AAV -- by performing PCR
with
primers that span the potential junction between the AAV genome and Chromosome
19
sequences.
EXAMPLE 11
STABLE TItA_NfSDUCTION WITH CO-DELIVERY OF INTE ASF~v-~
AND ~LTR H,v-, FLANKED TRANSGENE CONSTR CTS
The present example demonstrates the utility of the present invention for
increased
frequency of stable transduction with co-delivery of Integrase,~v_, together
with transgene
constructs flanked by OLTRH,v-, sequences. The ability of Integrase,~v., to
facilitate
integration of linearized OLTR,,w-,-flanked pgk-tk sequences is also further
identified. The
pgk-tk sequences were flanked by the most terminal 20 by HIV-1 LTR U3/tT5
sequences to
generate pgk-tk/~LTRHIV-~ (Figure 7). This linear construct was generated by
PCR
28
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
employing primers 3 S-36 bases in length, with 1 S-16 bases corresponding to
the extreme
pgk-tk sequences and 20 bases identical to LTRH,v_, U3/US termini. Rat-2tk(-)
cells were
microinjected with either PCR-generated linear molecules of pgk-tk/OLTR,~,v_,
pre-incubated
with IntegraseH~,_,, or with PCR-generated linear molecules of pgk-
tk/OLTRH,v_, alone.
Since 20-30 kb sequences can be generated by PCR amplification using optimized
protocols,
this approach should be generally applicable to larger transgene constructs.
The HIV-lr".,~.3
Integrase enzyme was utilized. This integrase enzyme has been modified at two
amino acids
to make it more soluble, without affecting its in vitro integration ability.
This general
technique is known to those of skill in the art, and is described in Jenkins
et al., 1996. The
expression construct pINSD.His.Sol may be used to express and purify
additional enzyme,
as needed.
Rat-2(tk-) cells were grown in Dulbecco's Modified Eagles Medium (DMEM)
containing 10% Fetal Bovine Serum (FBS), 100 units/ml penicillin, 100
microgram/ml
streptomycin, and 2 mM glutamine. On the day prior to injection, cells were
plated at 20,000
1 S cells per 3 S mm dishes that previously had 0.4 mm rectangular grids
etched into the tissue
culture surface. DNA or DNA + protein were delivered into the nuclei of cells
using
borosilicate microinjection needles having a tip outer diameter of
approximately 0.3 - 0.45
micron. Solutions of DNA alone contained approximately 42 ng/microliter of pgk-
tk/~LTR,"v_, (23 nM) in lx microinjection buffer (SO mM Hepes [pH 7.2], 100 mM
KCI, S
mM NaH2P04) containing 10 mM MgCl2. Injection of S-10 femtoliters is estimated
to
deliver approximately 70-140 DNA molecules per cell. Solutions of DNA and
protein
contained the same concentration of DNA together with 17 ng/microliter
IntegraseHw_, (44S
nM). This value was chosen to yield approximately 20 molecules of injected
protein per
molecule of injected DNA. The DNA solution was passed through a 0.1 micron
filer to
2S remove any aggregates including crystals believed to be MgP04.
Typically, 2S-30 cells were injected per 3S mm dish, with only one cell
injected per
square of the gridded plate. This was done to facilitate scoring of stably
transduced colonies
after selection in media containing HAT (0.1 mM sodium hypoxanthine, 0.4 micro
M
aminopterin, I6 micro M thymidine). The day following injection, the media was
removed
and media containing HAT was added. HAT medium was changed every 3-S days. S-7
days
post injection, dishes were scanned under the microscope, and the position of
potential
colonies growing out of stably transduced cells was marked on the bottom
surface of the
29
CA 02275892 1999-06-22
WO 98128417 PCT/US97/24236
dish. Colonies consisted of 50-200 cells which continued to show proliferation
of cells. The
colonies were checked by scanning the dishes twice per week for 3 weeks. Only
stable
colonies (i.e., present at 3 weeks postinjection) were analyzed in the present
studies.
The present studies were performed with pgk-tk/OLTRH,v_,, with or without
IntegraseH~,-,. The results are presented in Table 1. These data demonstrate
that the
frequency of stable transductants for pgk-tk/OLTRH,v-, co-delivered with
Integrase,w-~ was
4.5% vs. 1.9% for pgk-tk/OLTRH,v-, alone. This 2.4 fold increase in stable
transduction
frequency was shown to be significant (p<.OS) in a paired Student t test (2
tailed). Even
further optimization may be appreciated by varying, for example, 1 ) the
relative ratio of
Integrase molecules to DNA molecules, 2) the composition of the microinjection
buffer, 3)
the conditions (e.g. temperature) for pre-incubating the DNA together with
Integrase prior
to microinjection. Even greater increases in stable transduction efficiency
may thus be
achieved employing the techniques of the present invention.
CA 02275892 1999-06-22
WO 98128417 PCT/LTS97/24236
Table 1
HIV-1 OLTR/HIV-1 Integrase Strategy
Pgk-tk/OLTR H~l-1 Pgk-tk/~LTRHIV-1 +Inte a HIV-1_
2/56 {3.6%) 1/47 (2.1%)
3/59 (5.1%) 5/62 (8.1%)
1/SO (2%) 3/50 (6%)
0/50 (0%) 2/50 (4%)
0/50 (0%) 2/50 (4%)
0/50 (0% 1/50 (2%)
6/315 (1.9%) 14/309 (4.5%) 2.4-fold improvement
Statistical analysis of the data in Table 1 demonstrates a statistically
significant improvement
in the number of cells in which stable DNA integration was obtained. This
analysis revealed
a statistically significant improvement (paired Student t test (2-tailed),
p<.OS)
31
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
F AMPL 1 .
STABLE TRAN D TION WITH C'O 1~FT lyFuv
OF REP'a AND AAV ITR FLAN Fn Tu AN~~Tr.~T~ CON~TR T 1('T~
The present example is provided to demonstrate the use of the present
invention for
use in conjunction with proteins. By way of example, the protein used in the
present study
was an enzyme, Rep'8. Those of ordinary skill in the art will appreciate that
many other
proteins may be used given the present disclosure.
The present example demonstrates the utility of the present invention for
providing
increased frequency of stable transduction with co-delivery of Rep'$ together
with transgene
constructs flanked by AAV ITR sequences. For evaluation of the ITR/Rep'$
strategy, cells
were microinjected either with linearized pgk-tk/ITR co-delivered with Rep'$,
or linearized
pgk-tk/ITR alone. Linearized ITR-flanked pgk-tk sequences were obtained by
digestion with
Fse I and Sfi I, and then gel purified to eliminate bacterial plasmid
sequences. The purified
MBP-Rep'$ protein described in Figure 4 was used. MBP-Rep'8 has been
previously
observed by the inventors to be active in in vitro ITR binding and
endonuclease reactions.
These studies were performed as described in Example 11 except that the DNA
solution
contained pgk-tk/ITR at a concentration of 50 ng/microliter (23 nM), the
DNA/protein
solution contained pgk-tk/ITR at 50 ng/microliter and MBP-Rep'8 at 56
ng/microliter
(475 nM), and the MgCl2 concentration was 2 mM. These values were chosen to
yield
approximately 20 molecules of injected protein per molecule of injected DNA.
Although the
exact volume delivered per cell was not known, injection of 5-10 femtoliters
would deliver
approximately 70-140 DNA molecules per cell.
The present results are provided in Table 2. A 2.3-fold increase in stable
transduction
frequency was achieved when Rep'8 was included together with pgk-tkIITR. For
these
studies, the MBP-Rep'8 protein was added to the DNA solution immediately prior
to loading
of solution into the microinjection needle. Comparison with an initial
experiment (not
shown) in which the DNA/protein solution was not prepared immediately prior to
microinjection, but rather was maintained for several hours before
microinjection, suggests
that the timing of addition of protein to DNA may be important.
32
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
Table 2
AAV ITR/Rep'8 Strategy
pg~gk-tk/ITR + Ren'8
3/72 (4.2%) 5/80 (6.3%)
4/76 (5.3%) 8/66 ( 12.1 %)
2/76 (2.6%) 7/72 (8.7%)
9/224 (4.0%) 20/218 (9.2%)
2.3-fold improvement
C~RCULARIZF~ CONSTRUCTS FOR
NUCLEIC ,A,CID TNTEGRA_TION
The present example demonstrates the utility of the present invention for the
generation of covalently closed circles for facilitating integration. Since
circular double-
stranded proviral DNA may be the relevant substrate for normal AAV
integration, and
possibly for retroviral integration, it may be useful to first circularize the
transgene
constructs. One such circularized construct is shown for cir-rsGFP-MGMT/ITR in
Figure 9.
A plasmid backbone containing the AAV ITRs has been constructed, and the rsGFP-
MGMT
sequences inserted between the Pac I and Asc I sites to generate prsGFP-
MGMT/ITR.
Linearized ITR-flanked rsGFP-MGMT sequences have been obtained as described
above by
digestion with Fse I and Sfi I. The Sfi I site (the backbone plasmid
sequences) in prs GFP-
MGMT/ITR was converted to create a second Fse I site. The molecule will be
linearized and
removed via Fse I digestion. The molecule will then be religated to
circularize at the Fse I
site. The circular molecules will then be purified on an agarose gel prior to
microinjection.
The above strategy may also be used to facilitate retroviral Integrase-
mediated
integration of transgene constructs. Although the constructs shown in Figure 6
containing
OhTR sequences (or possibly also the complete LTR sequences) are all linear,
it is possible
that presenting the transgene flanked by DhTR or LTR sequences on a circular
construct
33
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
would lead to increased frequencies of integration. For example, although the
substrate for
retroviral provirus integration is believed to be a linear molecule flanked by
LTRs, it is
conceivable that the circular proviral molecules (containing either one or two
LTRs) present
in the nucleus of retrovirally infected cells are also potential substrates
for integration. In fact,
use of such circular constructs, co-delivered with retroviral Integrase
protein may lead to
increased efficiency of integration in comparison with the linear form. It is
possible that the
LTRs, or LTR terminal sequences included in such circular constructs may be
either in
juxtaposition to each other, or separated by some distance. By way of example,
this distance
may be defined by a number of nucleic acid bases. For example, the number of
nucleic acid
i 0 bases separating the first and the second LTR terminal sequences could be
between 2 to
about 200 nucleotide bases. In some embodiments of the circularized nucleic
acid the LTR
terminal fragments are separated by about 10 to about 20 nucleotide bases.
Fx a h~pLE 14 SITE SPECIFIC TARGETIN~OF TR-ANSGENE INTEGRATION BY
Fh~PLOYING RFTROV~L INTEGRASE PROTEIN FUSED TO PROTEINS
HAVING HIGH SPECIFICITY OF BINDING TO SPECIFIC DNA SEOUENC S
Wild-type AAV exhibits preferential integration into a specific region of the
human
genome. AAV Rep'$ is required for chromosome 19 specific integration, since
rep' AAV
vectors do not have the same pattern of site-specific integration as rep+ AAV
vectors
[Muzyczka, 1992]. The Rep'8 protein is believed to play several essential
roles in
chromosome 19 specific AAV integration -- mediating the formation of a complex
between
a 12 nucleotide sequence within the ITRs and a similar sequence on chromosome
19 (the
AAVS1 region) prior to integration, and also introducing a strand-specific
break within
AAVS1 [Linden et al., 1996]. As such, Rep'8 may itself be described as a
protein having
both a binding activity for specific DNA sequences, and an integrase activity.
There appears to be no site specificity for integration of retroviral vectors,
although
there is a preference for integration into the chromatin of transcriptionally
active genes
[Vijaya et al.,1986; Withers-Ward et al.,1994] and a preference with respect
to nucleosomal
conformation [Pruss et al., 1994]. However, it may ultimately be possible to
target the
precise integration site by employing Integrase linked to high-specificity DNA
binding
domains (Fig. 2) [Goulaouic and Chow, 1996; Bushman, 1994]. The DNA binding
domain
34
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
could either be derived from an existing DNA binding protein, or a novel
protein could be
designed and synthesized to have a high affinity binding specificity for
specific genomic
DNA sequences. For example, it is possible that specific targeting of
transgenes to the
globin locus (by fusing retroviral integrase to the DNA binding domains of
GATA-1 or NF-
S E2 erythroid specific transcription factors) would facilitate transgene
expression specifically
in erythroid cells. Another potential example would be targeting the
integration to chromatin
known to be 'open' in monocyte/macrophages may facilitate long-term expression
of
therapeutic genes for lysosomal storage diseases. It may be possible to
increase the affinity
and specificity of DNA binding proteins for specific DNA sequences by
structural analysis
(e.g. X-ray crystallographic and/or NMR analysis of the interaction between
the DNA
binding domain and the DNA target) of the protein and site directed
mutagenesis. For
example, mutants of the DNA binding domain of the c-myc protein having
increased affinity
for DNA have been described.
EXAMPLE 1 S USE OF CONSTRUCTS
In some embodiments, this invention provides for the co-delivery to a cell of
a first
and a second DNA sequence. This first and second nucleic acid sequence may be
created as
two separate constructs, one containing the transgene(s) of interest flanked
by appropriate
LTR or ITR sequences, and the other being an expression construct encoding a
protein,
particularly an enzyme capable of facilitating the incorporation of the
transgene sequence into
the cellular chromosomal DNA (i.e. retroviral integrase or Rep'8).
Microinjection would be
capable of co-delivering both the transgene construct and integrase-expression
construct to
the nucleus of cells to be genetically modified. After expression and then
translation of the
integrase protein in the cytoplasm, it would necessarily have to translocate
to the nucleus to
interact with the transgene construct to facilitate integration. It has
previously been described
that certain retroviral integrases localize to the nucleus after expression in
cells. An
expression construct for the M-MuLV Integrase under the control of the
cytomegalovirus
(CMV) promoter/enhancer sequences has been prepared by the present inventors.
In
addition, an expression construct for the AAV Rep'8 protein under the control
of the CMV
promoter/enhancer sequences has also been generated.
CA 02275892 1999-06-22
WO 98!28417 PCT/US97l24236
REFERENCES
The following references, to the extent that they provide exemplary procedural
or
other details supplementary to those set forth herein, are specifically
incorporated herein by
reference.
Abkowitz JL, Catlin SN, Guttorp P, "Evidence that hematopoiesis may be a
stochastic
process in vivo) "Nature Medicine, 2:190, 1996.
Akkina, RK, Rosenblatt, JD, Campbell, AG, Chen, IS, Zack, JA, "Modeling human
lymphoid
precursor cell gene therapy in the SCID-hu mouse," Blood, 84:1393, 1994.
Batchu, RB, Miles, DA, Rechtin, TM, Drake, RR, Hermonat, PL, "Cloning,
Expression and
Purification of Full Length Rep'$ of Adeno-Associated Virus as a Fusion
Protein with
Maltose Binding Protein in Escherichia coli," BBRC, 208:714-720, 1995.
Brenner, MK, Rill, DR, Holladay, MS, Heslop, HE, Moen, RC, Buschle, M, Krance,
RA,
Santana, VM, Anderson, WF, Ihle, JN, "Gene marking to determine whether
autologous
marrow infusion restores long-term haemopoiesis in cancer patients," Lancet,
342:1134,
1993.
Brinster, RL, Allen, JM, Behringer, RR, Gelinas, RE, Palmiter, RD, 'Introns
increase
transcriptional efficiency in transgenic mice," Proc. Natl. Acad. Sci. USA,
85:836, 1988.
Bushman, FD, "Tethering human immunodeficiency virus 1 integrase to a DNA site
directs
integration to nearby sequences," Proc. Natl. Acad. Sci. USA, 91:9233, 1994.
Cassel, A, Cottler-Fox, M, Doren, S, Dunbar, C," Retroviral-mediated gene
transfer into
CD34-enriched human peripheral blood stem cells," Exp. Hematol., 21:585, 1995.
Catering, JJ, Ciavatta, DJ, Donze, D, Behringer, RR, Townes, TM, "Multiple
elements in
human beta-globin locus control region 5' HS 2 are involved in enhancer
activity ad
position-independent, transgene expression," Nucleic Acids Res., 22:1006,
1994.
Challita, PM, Kohn, DB, "Lack of expression from a retroviral vector after
transduction of
marine hematopoietic stem cells is associated with methylation in vivo," Proc.
Natl. Acad.
Sci. USA, 91:2567, 1994.
Chaudhary, PM, Roninson, IB, "Expression and activity of P-glycoprotein, a
multidrug efflux
pump, in human hematopoietic stem cells," Cell, 66:85, 1991.
Crooks, GM, Kohn, DB, "Growth factors increase amphotropic retrovirus binding
to human
CD34+ bone marrow progenitor cells," Blood, 3290, 1995.
Dick, JE, Larochelle, A, Vormoor, J, Hanenburg, H, Williams, DA, "Evaluation
of
Procedures for Gene Transfer into Primitive Human Hematopoietic Cells Using
the
36
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
SCID-Repopulation Assay," Gene Therapy for Hematopoietic Stem Cells in Genetic
Disease
and Cancer, 1996.
Dick JE, "Normal and leukemic human stem cells assayed in SCID mice," Seminars
in
Immunology) 8:197, 1996.
Dotan, I, Scottoline, BP, Heuer, TS, Brown, PO, "Characterization of
recombinant marine
leukemia virus integrase," J. Virol., 69:456, 1995.
Einerhand, MP, Antoniou, M. Zolotukhin, S, Muzyczka, N, Berns, KI, Grosveld,
F, Vaierio,
D, "Regulated high-level human beta-globin gene expression in erythroid cells
following
recombinant adeno-associated virus-mediated gene transfer," Gene Ther., 2:336,
1995.
Emerson SG, "Ex vivo expansion of hematopoietic precursors, progenitors, and
stem cells:
the next generation of cellular therapeutics," Blood, 87:3082, 1996.
Farnet, CM, Bushman, FD, "HIV-1 cDNA Integration: Requirement of HMG I(Y)
Protein
for Function of Preintegration Complexes In Vitro," Cell, 88:483-492,
February, 1997.
Flotte, TR, Carter, BJ, "Adeno-associated virus vectors for gene therapy,"
Gene Ther., 2:357,
1995.
Gnirke, A, Huxley, C, "Transfer of the human HPRT and GART genes from yeast to
mammalian cells by microinjection of YAC DNA," Somat. Cell. Mol. Genet.,
17:573, 1991.
Goff, SP, "Genetics of Retroviral Integration," Annu. Rev. Genet., 26:527,
1992.
Goodarzi, G, IM, GJ, Brackmann, K, Grandgenett, D, "Concerted Integration of
etrovirus-Like DNA by human Immunodeficiency Vius Type 1 Integrase," Journal
of
Virology, 69:6090, 1995.
Goulaouic, H, Chow, SA, "Diected integration of viral DNA mediated by fusion
proteins
consisting of human immunodeficiency virus type 1 inegrase and Escherichia
coli LexA
protein," J. Virol., 70:37, 1996.
Halbert, CL, Alexander, IE, Wolgamot, GM, Miller, AD, "Adeno-associated virus
vectors
transduce primary cells much less efficiently than immortalized cells," J.
Virol. , 69:1473,
1995.
Harrington, JJ, Bokkelen, GV, Mays, RW, Gustashaw, K, Willard, HF, "Formation
of de
novo centromeres and construction of first-generation human artificial
microchromosomes,"
Nature Genetics, 15:345, 1997.
Harrison, GS, Wang, Y, Tomczak, J, Hogan, C, Shpall, EJ, Curiel, TJ, Felgner,
PL,
"Optimization of Gene Transfer Using Cationic Lipids in Cell Lines and Primary
Human
CD4+ and CD34+ Hematopoietic Cells," BioTechniques, 19:816; 1995.
Hughes, PF, Eaves, CJ, Hoge, DE, Humphries, RK, "High-efficiency gene transfer
to human
hematopoietic cells maintained in long-term marrow culture," Blood, 74:1915,
1989.
37
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
Jandl JH, BLOOD: Textbook of Hematology, 136, 1987
Johnson et al., "Characterization of the Forward and Reverse Integration
Reactions of the
Moloney Murine Leukemia Virus Integrase Protein Purified from Eschrichia
coli," JBC,
268:1462-9, 1993.
Jones RJ, Collector Ml, Barber 3P, Vala MS, Fackler MJ, May S, Gritiin CA,
Hawkins AL,
Zehobauer BA, Hilton J, Colvin OM, Sharkis SJ, "Characterization of Mouse
Lymphohematopoietic stem cells lacking spleen colony-forming activity," Blood,
88:487,
1996.
Jones, RJ, Wagner, JE, Celano, P, Zicha, MS, Sharkis, SJ, "Separation of
pluripotent
hematopoietic stem cells from spleen colony forming cells," Nature, 347:188,
1995.
Kalpana, GV, Marmon, S, Wang, W, Crabtree, GR, Goff, SP, "Binding and
stimulation of
HIV-1 integrase by a human homolog of yeast transcription factor SNFS,"
Science, 266:2002,
1994.
Kohn, DB, Weinberg KL, Nolta, JA, Heiss, LN, Lenarsky, C, Crooks, GM, Hanley,
ME,
Annett, G, Brooks, JS, el-Khoureiy, A, et al., "Engraftment of gene-modified
umbilical cord
blood cells in neonates with adenosine deaminase deficiency," Nature Medicine,
1:1017,
1995.
Kollias, G, Grosveld, F, "The study of gene regulation in transgenic mice," in
Transgenic
Animals, Grosveld, F and Kollias, G (eds.), San Diego, California, Academic
Press Limited,
p. 79, 1992.
Kurtzberg J, Laughlin M, Graham ML, Smith C, Olson JF, Halperin EC, Ciocci G,
Carrier
C, Stevens CE, Rubinstein P, "Placental blood as a source of hematopoietic
stem cells for
transplantation into unrelated recipients," New England Journal of Medicine,
335:157, 1996.
LaFemina, RL, Callahan, PL, Cordingley, MG, "Subsrate Specificity of
Recombinant Human
Immunodeficiency Virus Integrase Protein," Journal of Virology, 65:5624, 1991.
3 5 Lewis, P, Hensel, M, Emerman, M, "Human immunodeficiency virus infection
of cells
arrested in the cell cycle," EMBO Journal, 11:3053, 1992.
Linden, RM, Winocour, E, Berns, KI, "The recombination signals for adeno-
associated virus
site specific integration," Proc. Natl. Acad. Sci. USA, 93:7966, 1996.
Lu, M, Mauyama, M, Zhang, N, Levine, F, Friedmann, T, Ho, AD, "High efficiency
retroviral-mediated gene transduction into CD34+ cells purified from
peripheral blood of
breast cancer patients primed with chemotherapy and granulocyte-macrophage
colony-stimulating factor," Hum. Gene Ther., 5:203, 1994.
Mayani, H, Dragowska, W, Lansdorp, PM, "Characterization o Functionally
Distinct
Subpopulations of CD34+ Cord Blood Cells in Serum-Free Long-Term Cultures
Supplemented with Hematopoietic Cytokines," Blood, 82:2664, 1993.
38
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
Maze, R, Carney, JP, Kelley, MR, Glassner, BJ, Williams, DA, Samson, L,
"Increasing DNA
repair methyltransferase levels via bone marrow stem cell transduction rescues
mice from the
toxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea, a chemothereapeutic
alkylating agent,"
Proc. Natl. Acad. Sci. USA, 93:206, 1996.
Miller, DG, Adam, MA, Miller, AD, "Gene transfer by retrovirus vectors occurs
only in cells
that are actively replicating at the time of infection." Mol. Cell Biol.,
10:4239, 1990.
Miller, JL, Donahue, RE, Sellers, SE, Samulski, RJ, Young, NS, Nienhuis, AW,
"Recombinant adeno-associated virus (rAAV)-mediated expression of a human
gamma-globin gene in human progenitor-derived erythroid cells," Proc. Natl.
Acad. Sci.
USA, 91:10183, 1994.
Muzyczka, N, "Use of adeno-associated virus as a general transduction vector
for mammalian
cells," Curr. Top. Microbiol. Immunol.,158:97, 1992.
Naldini, L, Blomer, U, Gallay, P, Ory, D, Mulligan, R, Gage, FH, Verma, IM,
Trono, D, "In
vivo gene delivery and stable transduction of nondividing cells by a
lentiviral vector,"
Science, 272:263, 1996.
Natsoulis, G, Surosky, R, Godwin, S, McQuiston, S, Kurtzman, G, "A system for
specifically
targeting genes to Chromosome 19," Blood, 86:236a, 1995.
Nolta, JA, Dao, M, Wells, S, Smogorzewska, EM, Kohn, DB, "Transduction of
pluripotent
human hematopoietic stem cells demonstrated by clonal analysis after
engraftment in
immune deficient mice," Proc. Natl. Acad. Sci. USA, 93:2414, 1996.
Ogawa, M., "Differentiation and Proliferation of Hematopoietic Stem Cells,"
Blood, 81:2844,
1993.
Orkin, SH, Motulsky, AG, "Report and Recommendations of the Panel to Assess
the NIH
Investment in Research on Gene Therapy," 1996.
Osawa M, Hanada K, Hamada H, Nakauchi H, "Long-term Lymphohematopoietic
reconstitution by a single CD34-low/negative hematopoietic stem cell,"
Science, 273:242,
1996.
45
Pepperkok, R, Schneider, C, Philipson, L, Ansorge, W, "Single cell assay with
an automated
capillary microinjection system," Exp. Cell. Res., 178:369, 1988.
Philip, R, Brunette, E, Kilinski, L, Murugesh, D, McNally, MA, Ucar, K,
Rosenblatt, J,
Okarma, TB, Lebkowski, JS, "Efficient and sustained gene expression in primary
T
lymphocytes and primary cultured tumor cells mediated by adeno-associated
virus plasmid
DNA complexed to cationic liposomes," Mol. Cell. Biol., 14:2411, 1994.
Podsakoff, G, Wong, KK, Jr., Chatterjee, S, "Efficient gene transfer into
nondividing cells
by adeno-associated virus-based vectors," J. Virol., 68:5656, 1994.
39
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
Pruss, D, Reeves, R, Bushman, FD, Wolffe, AP, "The influence of DNA and
nucleosome
structure on integration events directed by HIV integrase," J. Biol. Chem.,
269:25031. 1994.
Pryciak, PM, Sil, A, Varmus, HE, "Retroviral integration into minichromosornes
in vitro,"
EMBO Journal, 11:291, 1992.
Reicin, AS, Kalpana, G, Paik, S, Marmon, S, Goff, S, "Sequences in the Human
Immunodeflciency Virus Type 1 U3 Region Required for in vivo and in vitro
Integration,"
Journal of Virology, 69:5904, 1995.
Roe, T, Reynolds, TC, Yu, G, Brown, PO, "Integration of marine leukemia virus
DNA
depends on mitosis," EMBO Journal, 12:2099, 1993.
Russell, DW, Miller, AD, Alexander, IE, "Adeno-associated virus vectors
preferentially
transduce cells in S phase," Proc. Natl. Acad Sci. USA, 91:8915, 1994.
Sadelain, M, Wang, CH, Antoniou, M, Grosveld, F, Mulligan, RC, "Generation of
a
high-titer retroviral vector capable of expressing high levels of the human
beta-globin gene,"
Proc. Natl. Acad. Sci. USA, 92:6728, 1995.
Serrano F, Chinen J, Aguilar-Cardova E, Belmont JW, "Anti HIV-1 gene therapy
with Trev.
high level of hematopoietic engraftment and retroviral transduction in the
CD34+ hulscid
mouse, "Gene Therapy for Hematopoietic Stem Cells in Genetic Disease and
Cancer, 22,
1996.
Spangrude GJ, Heimfeld S, Weissman IL, "Purification and Characterization of
Mouse
Hematopoietic Stem Cells," Science, 241:58, 1988.
Talbot, D, Philipsen, S, Fraser, P, Grosveld, F, "Detailed analysis of the
site 3 region of the
human beta-globin dominant control region," EMBO Journal, 9:2169, 1990.
Toneguzzo, F, Keating, A, "Stable expression of selectable genes introduced
into human
hematopoietic stem cells by electric field-mediated DNA transfer," Yroc. Natl.
Acad. Sci.
USA, 83:3496, 1986.
Vijaya, S, Steffen, DL, Robinson, HL, "Acceptor sites for retroviral
integrations map near
DNase 1-hypersensitive sites in chromatin," Journal of Virology, 60:683, 1986.
Wenberg, JB, Matthews, TJ, Cullen, BR, Malim, MH, "Productive human
immunodeficiency
virus type 1 (HIV-I) infection of nonproliferating human monocytes," Journal
of
Experimental Medicine, 174:1477, 1991.
Withers-Ward, ES, Kitamura, Y, Barnes, JP, Coffin, JM, "Distribution of
targets for avian
retrovirus DNA integration in vivo," Genes & Development, 8:1473, 1994.
Woffendin C, Yang ZY, Udaykomar, Xu L, Yang NS, Sheehy MJ, Nabel GJ, "Nonviral
and
viral delivery of a human immunodeficiency virus protective gene into primary
human T
cells," Proc. Natl. Acad. Sci. USA, 91:11581, 1994
CA 02275892 1999-06-22
WO 98/28417 PCT/I1S97I24236
Zack, JA, Arngo, SJ, Weitsman, SR, Go, AS, Haislip, A, Chen, IS, "HIV-1 Entry
into
Quiescent primary Lymphocytes: Molecular Analysis Reveals a Labile, Latent
Viral
Structure," Cell, 61:213, 1990.
41
CA 02275892 1999-06-22
WO 98/28417 PCT/IJS97/24236
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Gene-Cell, Inc.
(ii) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Gene-Cell, Inc.
(B) STREET: 1010 Hercules Avenue
(C) CITY: Houston
(D) STATE: Texas
(E) COUNTRY: USA
(F) ZIP: 77058
(G) TELEPHONE NUMBER: (512) 495-8400
(iii) TITLE OF INVENTION: NUCLEIC ACID CONSTRUCTS AND
USES THEREOF FOR DIRECT NUCLEIC
ACID INCORPORATION INTO CELLS
(iv) NUMBER OF SEQUENCES: 2
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
42
CA 02275892 1999-06-22
WO 98/28417 PCT/US97/24236
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
ACTGGAAGGG CTAATTCACT GTTGGGAAGG GCGATC 36
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
ACTGCTAGAG ATTTTCCACA CAGGAAACAG CTATG 35
43
