Note: Descriptions are shown in the official language in which they were submitted.
CA 02282859 1999-08-24
WO 98/36771
TIT1 E OF THE iNV>i NTION
Method for the Production of Vaccines
Against Cell Surface Proteins
PCT/US98/02913
GOVERNMENT SUP ORT
This work was supported in part by grant NIH HD 29099 and P30-28934 from the
National Institutes of Health. The government may have certain rights in the
invention.
BACKGROUND OF THE INVENTION
Field of the Invent~~n
The invention relates generally to a method for identifying the repertoire of
proteins
exposed on the surface of a cell, and to the preparation of vaccines thereto.
In particular, the
invention relates to a method for identifying the repertoire of proteins
present on the surface
of human spermatozoa (sperm) to the proteins identified by the method, and to
the production
of contraceptive vaccines therefrom.
Discussion of the Background
It is through their surfaces that living organisms interact with their
environments. It is
against the epitopes present on cell and viral surfaces that the immune system
directs both
antibody and T cell mediated immune responses. Methods which allow surface
molecules on
living organisms to be identified, isolated and genetically manipulated
provide a means to
develop vaccines, since it is against the cell/viral surface that immune
responses are directed.
The mammalian spermatozoon is a highly differentiated cell. It is the product
of a
complex series of changes which are organized spatially and temporally into a
set of cell
associations known as the cycle of the seminiferous epithelium ( 1 ). During
spermatogenesis,
round undifferentiated spermatogonia are transformed via spermatocytes and
spermatids into
highly asymmetric and motile spermatozoa, and in humans 12 steps in the
differentiation of
spermatids alone can be recognized (2). As a result of these numerous
differentiation events,
spermatozoa are unusual cells in many respects. The nuclear chromatin becomes
highly
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
condensed and inactive in synthesis of RNA, and unique cytoplasmic components
appear,
such as the acrosome of the sperm head and the outer dense fibers and fibrous
ribs of the tail.
Although not immediately apparent from its microscopic appearance, even the
sperm plasma
membrane undergoes extensive differentiation during spermatogenesis. Different
membrane
domains are formed on the sperm surface (3), as shown in freeze-fracture
preparations (4) and
in immunocytochemical studies of differences in the distributions of sperm
membrane
components (S). Furthermore, the sperm surface is not static after leaving the
seminiferous
epithelium; its components undergo alteration and redistribution as a result
of additional
maturation in the epididymis, and following capacitation and the acrosome
reaction in the
female reproductive tract (6,7).
It is through their surfaces that sperm interact with their surroundings in
the male and
female tracts as they pass from the testis to the oviduct. Most important, the
plasma
membrane (plasmalemma) of the sperm contacts the egg investments, and the
membrane
overlying the equatorial segment of the acrosome is believed to be the initial
site of fusion
with the egg plasma membrane (8).
Chong Xu et al. (2G) recently reported that G4 plasmalemmal silver stained
proteins
could be detergent extracted from human spermatozoa membrane vesicles isolated
by
nitrogen cavitation, differential centrifugation, IEF/PAGE electrophoresis.
However, a
drawback of the nitrogen cavitation technique in analysis of sperm surface
proteins is the
necessity of pooling samples collected over several weeks to achieve
sufficient starting
material. In addition, there are lingering uncertainties whether cavitation
methods yield
"membrane" proteins which derive only from the plasma membrane (20).
Although two-dimensional electrophoresis has been employed in the study of
human
sperm proteins in the past (18-2G), reconciliation of the protein patterns
between these
previous reports was difficult due to the lack of procedure standardization.
The
comprehensive cataloging of human sperm surface proteins has been hampered
because
available data were limited in one or more of the following ways: I )
resolution, 2)
reproducibility, 3) pH range, 4) specificity of surface labeling techniques,
or 5) plasma
membrane purification procedures.
-2-
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/02913
In view of the aforementioned deficiencies attendant with the prior art
methods of
. analyzing cell surface proteins, it is clear that there exists a need in the
art for a standardized
method of analysis, identification, characterization, isolation and cataloging
of cell surface
proteins in general, and sperm surface proteins in particular.
SUMMARY OF THE INVENTION
Accordingly, one object of this invention is to provide a novel method for the
analysis
of membrane surface proteins including the steps of
a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel
electrophoresis; and
c. sequencing the isolated membrane surface proteins.
Another object of the invention is to provide a method for producing a vaccine
against
membrane surface proteins including the steps of
a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel
electrophoresis;
c. sequencing the isolated membrane surface proteins;
d. cloning the DNA encoding the membrane surface proteins; and
e. recombinantly producing the membrane surface proteins using the DNA
isolated in step (d).
Yet another object of the invention is to provide a method for diagnosing
infertility
including
a. labeling the membrane surface proteins obtained in by the above-described
method;
b. reacting the labeled membrane surface proteins with sera from a patient in
which the presence or absence of infertility is to be diagnosed; and
c. detecting formation of an complex between an antibody present in the sera
and
the labeled membrane surface protein.
-3-
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/02913
Still another object is to provide a vaccine produced by the above-described
method.
A further object of the invention is to provide a diagnostic test kit
including the cell
surface proteins produced by the above-described method.
Another object of the invention is to provide a method for inducing
contraception in a
patient including administering to a patient in need thereof an amount of
sperm cell surface
proteins produced by the above-described method sufficient to prevent
fertilization of an egg
in said patient.
An additional object of the invention is to provide a method for producing a
contraceptive including administering to a mammal the recombinant proteins
produced by the
above-described method and isolating antibodies produced by the mammal against
the
recombinant proteins.
Still another object of the invention is to provide a contraceptive produced
by the
above-described method.
With the foregoing and other objects, advantages and features of the invention
that
will become hereinafter apparent, the nature of the invention may be more
clearly understood
by reference to the following detailed description of the preferred
embodiments of the
invention and to the appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
A more complete appreciation of the invention and many of the attendant
advantages
thereof will be readily obtained as the same becomes better understood by
reference to the
following detailed description when considered in connection with the
accompanying
drawings, wherein:
Figure 1 shows the two-dimensional gel electrophoretic analysis of silver
stained
human spermatozoa [A&B] and seminal plasma proteins from an azospermic patient
[C&D]
solubilized in lysis buffer A (see methods). Proteins were separated by
IEF/PAGE {A&C)
and by NEPHGE/PAGE (B&D) resulting in resolution of approximately 1300 sperm
protein
spots. The pH-gradients of the first dimensional gels are indicated at the top
of the figure.
Note the overlap in pH-range between the two first dimension techniques. SDS-
PAGE was
-4-
CA 02282859 1999-08-24
WO 98/36771
PCT/(JS98/02913
performed with the anode at the bottom of the gels. Molecular weights (x I 0-
3) are indicated
in the left margin. There are relatively few high molecular weight proteins in
the liquified
seminal plasma ~ & D), while numerous protein spots below 20 kDa are evident.
Degradation patterns of seminal plasma proteins can be followed by the oblique
trails seen
between basic proteins in D (horizontal arrows). Computer comparison of
seminal plasma
and sperm protein patterns identified 9 co-migrating proteins of similar shape
(black and
white arrows). The white arrow in A and C indicates the position of albumin,
which
apparently adheres to the sperm surface.
Figure 2 illustrates the variations in the amount of a 39.5 kDa protein in
sperm
obtained from three healthy young men. The 3 samples were treated identically
including
simultaneous electrophoretic separation in the same buffertank. The figure
shows enlarged
areas of the 3 IEF/PAGE gels. The estimated ratio of density of the silver
stained 39.5 lcDa
protein, indicated by arrows, varied from 0.412 in A to 3.703 in C. Such
concentration
variation was also observed among surface proteins (Figure 7).
Figure 3 is a time course study of radioiodine incorporation into human sperm
proteins. Four aliquots of 30 x I OG percoll harvested sperm from the same
donor were
radiolabeled, employing 10 IODO-BEADS and 150 pCi of Na'ZSI in 4 ml of
Dulbecco's PBS
per aliquot. The iodine incorporation was stopped after 5, 10, 15 and 20
minutes by removal
of the cells from the catalytic beads by pipetting. The spermatozoa were
pelleted by
centrifugation and the amount of iodine incorporated was compared to the
amount of iodine
in the reaction buffer by counting in a Gamma counter.
Figure 4 shows a comparison of labeled sperm proteins extracted in lysis
buffer A
without pre-treatment (A) and after a Percoll density centrifugation following
vectorial
labeling (B). The number of labeled proteins is decreased in the sperm sample
which
underwent the second Percoll separation (B). Proteins labeled in panel A
included the
polymorphic infra-acrosomal protein SP-10 (horizontal arrowheads) and actin
(white arrow),
indicating that labeling of cytoplasmic constituents had occurred. [See Figure
6 for an
immunoblot of SP-10]. In contrast, the control cytoplasmic markers were not
labeled in
panel B. Thus, the Percoll centrifugation following surface labeling was
considered essential
-5-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
to ensure that only surface proteins were analyzed.
Figure 5 illustrates the two-dimensional IEF PAGE of vectorially iodinated
human
sperm proteins showing companion western blots reacted with monoclonal
antibodies to
cytoplasmic components. Sperm from a single donor were radioiodinated,
subjected to
Percoll centrifugation and solubilized in buffer A under nonreducin~
conditions (A&B) or
with reducing agent present (100mM DTT)(C&D). An ampholine composition of 28%
pH 3
-3.5, 20% pH 5-7, 7% pH 7-9 and 45% pH 3.5- 10 was used to enhance resolution
of acidic
proteins. A: Autoradiogram of unreduced proteins immobilized on NC-membrane.
The
position of actin in the radioiodination pattern is indicated by arrows. B:
Western blot of the
proteins in A incubated with a rnAb to actin prior to autoradiography. Four
isoforms of actin
were resolved at the expected MW of 43 kDa and with pI's between 5.1-5.2. In
insert BI, the
autoradiogram was placed on top of the corresponding immunoblot. The expanded
region
clearly demonstrates that monomeric actin was not iodinated. The horizontal
arrows in B1
and B2 indicate the position of two proteins of 51 and 52 kDa, immunologically
crossreactive
with actin. The proteins were very weakly stained at a 1:3000 dilution of the
antibody
(Figure SB), but were more clearly demonstrated when the antibody was used at
a 1:1 S00
dilution (insert B2). C: Autoradiogram of reduced proteins immobilized on NC-
membrane.
Horizontal arrows indicate the position of several abundant proteins which
participate in high
molecular weight complexes stabilized by S-S bridges. D: Western blot of C
incubated with
mAb to ~3-tubulin prior to autoradiography. At least seven isoforms of (3-
tubulin were
immunostained at their expected MW of 57 kDa and with pI's between 4.6 and
5.4, following
sperm protein extraction in presence of DTT. The position of (3-tubulin in the
autoradiogram
is indicated by vertical arrows in Figure SC. Although the position of some of
the tubulin
isoforms on the autoradiogram is covered by emissions from surrounding
iodinated proteins,
~i-tubulin itself was not radioiodinated by the procedure.
Figure 6 shows protein imaging by reflected absorbance demonstrates that the
polymorphic intra-acrosomal protein SP-10 is not vectorially iodinated.
Radiolabeled
proteins were solubilized with NP-40 and urea, separated by IEF/PAGE,
transferred to NC-
paper and incubated with the mAb MHS 10. After colorometric development with
the DAB
-G-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
substrate, the SP-10 immunoreaction product was imaged on the autoradiogram
[B] by
reflectance from an image enhancement screen, allowing the exact position of
the SP-10
forms to be visualized as a shadow. The characteristic SP-10 pattern, in which
the higher
molecular weight forms are more acidic than the lower molecular weight fornis,
matches the
published data (32, 33). Although it contains 3 tyrosine and 12 histidine
residues (32) which
may potentially be iodinated, the intra-acrosomal protein SP-10 was not
detected as a
radioiodinated protein as long as acrosome reacted spermatozoa were removed by
a post
labeling Percoll gradient centrifugation.
Figure 7 compares autoradiograms of vectorially labeled human sperm proteins
from
two donors following 2-D electrophoresis and transfer to NC membranes shows
and
illustrates the overall high reproducibility of the patterns of iodinated
proteins from donor to
donor. An equal number of radioiodinated cells from each donor was solubilized
and equal
volumes of solubilizate applied to IEF/PAGE (A&C) and NEPHGE/PAGE (B&D).
Certain
iodinated surface proteins such as the 89->95 kDa group (vertical arrows)
displayed
variations in relative concentration as judged by the optical density
integrated against the
total density of all proteins on the autoradiogram.
Figure 8 is a two-dimensional gel electrophoretic analysis of NHS-LC-Biotin
labeled
human sperm proteins solubilized by NP-40 and urea, and separated by IEF/PAGE
(A,C and
E) or by NEPHGE/PAGE (B, D, F) before being transferred to NC-membranes. A and
B:
Biotinylated sperm proteins were visualized by ECL following incubation with
AP-
conjugated avidin. C and D: Non-biotinylated sperm proteins incubated with AP-
avidin
alone demonstrated five endogenous avidin-binding proteins with MW of 77 kDa
and pl
between 6 and 6.5 (vertical arrows in C). The position of these endogenous
avidin binding
proteins in the surface biotinylation pattern is indicated by similar arrows
in A. E and F:
Biotinylated sperm proteins stained by colloidal gold following transfer to NC-
paper. The
proteins in E were incubated with the polyclonal antisern R-10, raised against
recombinant
macaque PH-20, a sperm surface hyaluronidase. Three PH-20 protein spots of
apparent MW
of 53 kDa were immunolabeled (upwards pointing arrows in E). The 65 kDa
antigen (acidic
end of gel) was also stained with rabbit preimmune serum. The three 53 KDa
spots were
-7_
CA 02282859 1999-08-24
WO 98/36771 PC'f/US98/02913
labeled with biotin (similar arrows in A) indicating that three forms of PH20
are accessible to
_ surface biotinylation. In F the preimmune sera for PH20 was utilized. The
open arrow
indicates the position of the basic 53 kDa form on the NEPHGE gel. The 53 kDa
form of
PH20 was not immunostained.
Figure 9 shows a two-dimensional gel electrophoretic analysis of biotinylated
human
sperm proteins solubilized in lysis buffer B (SDS,CHAPS,UREA). A and B:
Proteins
visualized by silverstaining. C and D: Biotinylated proteins visualized with
AP-avidin and
ECL after electrotransfer to NC-paper. E: Immunoblot showing the position of
(3-tubulin
detected by incubation with mAb TU27. The position of ~3-tubulin in the
silverstained and
biotinylated 2-D patterns (A & C) is indicated by identical downward arrows.
The high
molecular weight complexes indicated by an open arrow in Figure 9A were shown
to contain
a-tubulin following immunoblotting with a mAb. Note that neither a- nor ~3-
tubulin was
biotinylated. F: Immunoblot showing the fibrous sheath antigens detected by
mAb S69. The
position of the fibrous sheath components in the silverstained and
biotinylated 2-D patterns is
indicated by a similar oblique arrow in B and D. The fibrous sheath proteins
were not biotin
labeled. G and H: Immunoblot of the sperm surface hyaluronidase PH20. Two
isotypes of
PH-20 were immunostained, at 64 kDa and at 53 kDa. At higher magnification the
53 kDa
form could be resolved into five isoforms. The strongest biotinylation
occurred of the most
acidic isoform of the 53 kDa component of PH-20. The weak immunoreactive spot
of 65
kDa (indicated by upward pointing oblique arrowhead in Figure 9G and by arrows
in Figures
8A & E) was also present in the rabbit pre-immune control (data not shown).
Figure 10 is an immunoblot with the mAb RC-20 showing sperm proteins
phosphorylated in tyrosine residues. Fresh human sperm were solubilized in
lysis buffer A,
separated by IEFFPAGE and transferred to a PVDF membrane. The dominant phospho-
proteins had a MW of 89-95 kDa and pI between 5.5 and 5.8. Several more weakly
stained
proteins can also be seen. Arrowheads indicate five groups of phosphoproteins
which were
vectorially labeled (see Table 1).
Figure 11 shows a composite computer image of the 1397 human spermatozoa)
proteins which could be detected by silver staining following NP-40/urea
solubilization.
_8_ _
CA 02282859 1999-08-24
WO 98/36771 PCT/ITS98/02913
Ninety four of the ninety eight proteins which were labeled by both surface
iodination and
surface biotinylation could be matched to silver stained proteins and are
encircled. The
characteristics of these proteins are given in Table 1. This Table is referred
to as the Spenm
Surface Index.
Figure 12 shows amino acid microsequence data obtained by Edman degradation
and
tandem mass spectrometry from a sperm protein of 63 Kda, pI 4.3 chosen for
design of
complementary and reverse-complementary oligonucleotides (SEQ ID NOS:16-18,
12, 19-
20). From this microsequence information pools of degenerate oligonucleotide
primers were
synthesized to initiate PCR [see Fig. 13].
Figure 13 shows PCR products resulting from amplification of human testis RNA
using degenerate oligonucleotides derived from microsequence data of 63 Kda,
pI 4.3 protein
reveal a single prominent PCR product at approximately 400 bp.
Figure 14 shows DNA sequence obtained from clone derived by RT-PCR utilizing
optimized, degenerate primers. Numbers indicate base pair position in
sequenced clone and in
the Calreticulin gene; (c) designates the RT-PCR clone (SEQ ID N0:25) while
(H) designates
the human Calreticulin cDNA from GenBank (SEQ ID N0:26).
Figure 15 shows microsequences derived by tandem mass spectrometry from sperm
surface protein I-23 and complementary and reverse-complement oligonucleotides
(SEQ ID
N0:27-40).
Figure 16 shows DNA sequence encoding a portion of sperm surface protein I-23
(SEQ ID N0:41 ). This DNA sequence was obtained from sequencing PCR products
amplified from human testicular DNA using pools of degenerate primers
synthesized based
upon microsequences shown in Figure 15.
Figure 17 is an Encyclopedia of 967 silver stained human sperm proteins in the
isoelectric point range of 3.5->6.5 obtained by laser scanning and computer
digitization of 2-
D electrophorograms in which the first dimension was iso-electric focusing.
Figure 18 is an Encyclopedia of 435 silver stained human sperm proteins in the
isoelectric point range of 6.5->10.5 obtained by laser scanning and
digitization of 2-D
electrophorograms in which the first dimension was nonequilibrium pH gradient
-9-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
electrophoresis.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
In accordance with the present invention there may be employed conventional
molecular biology, microbiology, and protein chemistry and recombinant DNA
techniques
within the skill of the art. Such techniques are explained fully in the
literature. See, e.g.,
Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current
Protocols in
Molecular Biology" Volumes I-III [Ausubel, R. M., ed. (1994)]; "Cell Biology:
A Laboratory
Handbook" Volumes I-III [J. E. Cells, ed. (1994))]; "Current Protocols in
Immunology"
Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J.
Gait ed. 1984);
"Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. ( 1985)];
"Transcription And
Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture"
[R.I.
Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B.
Perbal, "A
Practical Guide To Molecular Cloning" (1984).
Therefore, if appearing herein, the following terms shall have the definitions
set out
below.
A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that
functions
as an autonomous unit of DNA replication in vivo; i.e., capable of replication
under its own
control.
A "vector" is a replicon, such as plasmid, phage or cosmid, to which another
DNA
segment may be attached so as to bring about the replication of the attached
segment.
A "DNA molecule" refers to the polymeric form of deoxyribonucleotides
(adenine,
guanine, thymine, or cytosine) in its either single stranded form, or a double-
stranded helix.
This term refers only to the primary and secondary structure of the molecule,
and does not
limit it to any particular tertiary forms. Thus, this term includes double-
stranded DNA found,
inter alia, in linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and
chromosomes. In discussing the structure of particular double-stranded DNA
molecules,
sequences may be described herein according to the normal convention of giving
only the
sequence in the 5' to 3' direction along the nontranscribed strand of DNA
(i.e., the strand
-i0-
CA 02282859 1999-08-24
WO 98/36??1 PCT/US98/02913
having a sequence homologous to the mRNA).
An "origin of replication" refers to those DNA sequences that participate in
DNA
synthesis.
A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed
and translated into a polypeptide in vivo when placed under the control of
appropriate
regulatory sequences. The boundaries of the coding sequence are determined by
a start codon
at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl)
terminus. A
coding sequence can include, but is not limited to, prokaryotic sequences,
cDNA from
eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA,
and
even synthetic DNA sequences. A polyadenylation signal and transcription
termination
sequence will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory
sequences,
such as promoters, enhancers, polyadenylation signals, terminators, and the
like, that provide
for the expression of a coding sequence in a host cell.
A "promoter sequence" is a DNA regulatory region capable of binding RNA
polymerase in a cell and initiating transcription of a downstream (3'
direction) coding
sequence. For purposes of defining the present invention, the promoter
sequence is bounded
at its 3' terminus by the transcription initiation site and extends upstream
(S' direction) to
include the minimum number of bases or elements necessary to initiate
transcription at levels
detectable above background. Within the promoter sequence will be found a
transcription
initiation site (conveniently defined by mapping with nuclease S 1 ), as well
as protein binding
domains (consensus sequences) responsible for the binding of RNA polymerase.
Eukaryotic
promoters will often, but not always, contain "TATA" boxes and "CAT" boxes.
Prokaryotic
promoters contain Shine-Dalgarno sequences in addition to the -10 and -35
consensus
sequences.
An "expression control sequence" is a DNA sequence that controls and regulates
the
transcription and translation of another DNA sequence. A coding sequence is
"under the
control" of transcriptional and translational control sequences in a cell when
RNA
polymerase transcribes the coding sequence into mRNA, which is then translated
into the
-11-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
protein encoded by the coding sequence.
A "signal sequence" can be included before the coding sequence. This sequence
encodes a signal peptide, N-terminal to the polypeptide, that communicates to
the host cell to
direct the polypeptide to the cell surface or secrete the polypeptide into the
media, and this
signal peptide is clipped off by the host cell before the protein leaves the
cell. Signal
sequences can be found associated with a variety of proteins native to
prokaryotes and
eukaryotes.
The term "oligonucleotide," as used herein in referring to the probe of the
present
invention, is defined as a molecule comprised of two or more ribo- or
deoxyribo-nucleotides,
preferably more than three. Its exact size will depend upon many factors
which, in turn,
depend upon the ultimate function and use of the oligonucleotide.
The term "primer" as used herein refers to an oligonucleotide, whether
occurnng
naturally as in a purified restriction digest or produced synthetically, which
is capable of
acting as a point of initiation of synthesis when placed under conditions in
which synthesis of
a primer extension product, which is complementary to a nucleic acid strand,
is induced, i.e.,
in the presence of nucleotides and an inducing agent such as a DNA polymerise
and at a
suitable temperature and pH. The primer may be either single-stranded or
double-stranded
and must be sufficiently long to prime the synthesis of the desired extension
product in the
presence of the inducing agent. The exact length of the primer will depend
upon many
factors, including temperature, source of primer and use of the method. For
example, for
diagnostic applications, depending on the complexity of the target sequence,
the
oligonucleotide primer typically contains 15-25 or more nucleotides, although
it may contain
fewer nucleotides.
The primers herein are selected to be "substantially" complementary to
different
strands of a particular target DNA sequence. This means that the primers must
be sufficiently
complementary to hybridize with their respective strands. Therefore, the
primer sequence
need not reflect the exact sequence of the template. For example, a non-
complementary
nucleotide fragment may be attached to the 5' end of the primer, with the
remainder of the
primer sequence being complementary to the strand. Alternatively, non-
complementary
-12-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98102913
bases or longer sequences can be interspersed into the primer, provided that
the primer
sequence has sufficient complementarity with the sequence of the strand to
hybridize
therewith and thereby form the template for the synthesis of the extension
product.
As used herein, the terms "restriction endonucleases" and "restriction
enzymes" refer
to bacterial enzymes, each of which cut double-stranded DNA at or near a
specific nucleotide
sequence.
A cell has been "transformed" by exogenous or heterologous DNA when such DNA
has been introduced inside the cell. The transforming DNA may or may not be
integrated
(covalently linked) into chromosomal DNA making up the genome of the cell. In
prokaryotes, yeast, and mammalian cells for example, the transforming DNA may
be
maintained on an episomal element such as a plasmid. With respect to
eukaryotic cells, a
stably transformed cell is one in which the transforming DNA has become
integrated into a
chromosome so that it is inherited by daughter cells through chromosome
replication. This
stability is demonstrated by the ability of the eukaryotic cell to establish
cell lines or clones
comprised of a population of daughter cells containing the transforming DNA. A
"clone" is a
population of cells derived from a single cell or common ancestor by mitosis.
A "cell line" is
a clone of a primary cell that is capable of stable growth in vitro for many
generations.
Two DNA sequences are "substantially homologous" when at least about 75%
(preferably at least about 80%, and most preferably at least about 90 or 95%)
of the
nucleotides match over the defined length of the DNA sequences. Sequences that
are
substantially homologous can be identified by comparing the sequences using
standard
software available in sequence data banks, or in a Southern hybridization
experiment under,
for example, stringent conditions as defined for that particular system.
Defining appropriate
hybridization conditions is within the skill of the art. See, e.g., Maniatis
et al., supra; DNA
Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
Two amino acid sequences are "substantially homologous" when at least about
70%
of the amino acid residues (preferably at least about 80%, and most preferably
at least about
90 or 95%) are identical, or represent conservative substitutions.
A "heterologous" region of the DNA construct is m identifiable segment of DNA
-13-
CA 02282859 1999-08-24
WO 98/36771 PCT/IJS98/02913
within a larger DNA molecule that is not found in association with the larger
molecule in
nature. Thus, when the heterologous region encodes a mammalian gene, the gene
will
usually be flanked by DNA that does not flank the mammalian genomic DNA in the
genome
of the source organism. Another example of a heterologous coding sequence is a
construct
where the coding sequence itself is not found in nature (e.g., a cDNA where
the genomic
coding sequence contains introns, or synthetic sequences having codons
different than the
native gene). Allelic variations or naturally-occurring mutational events do
not give rise to a
heterologous region of DNA as defined herein.
An "antibody" is any immunoglobulin, including antibodies and fragments
thereof,
that binds a specific epitope. The term encompasses polyclonal, monoclonal,
and chimeric
antibodies, the last mentioned described in further detail in U.S. Patent Nos.
4,816,397 and
4,816,567.
An "antibody combining site" is that structural portion of an antibody
molecule
comprised of heavy and light chain variable and hypervariable regions that
specifically binds
antigen.
The phrase "antibody molecule" in its various grammatical forms as used herein
contemplates both an intact immunoglobulin molecule and an immunologically
active portion
of an immunoglobulin molecule.
Exemplary antibody molecules are intact immunoglobulin molecules,
substantially
intact immunoglobulin molecules and those portions of an immunoglobulin
molecule that
contains the paratope, -including those portions known in the art as Fab,
Fab', F(ab'), and F(v),
which portions are preferred for use in the diagnostic and therapeutic methods
described
herein.
Fab and F(ab')2 portions of antibody molecules are prepared by the proteolytic
reaction of papain and pepsin, respectively, on substantially intact antibody
molecules by
methods that are well-known. See for example, U.S. Patent No. 4,342,566 to
Theofilopolous
et al. Fab' antibody molecule portions are also well-known and are produced
from F(ab')Z
portions followed by reduction of the disulfide bonds linking the two heavy
chain portions as
with mercaptoethanol, and followed by alkylation of the resulting protein
mercaptan with a
-14-
CA 02282859 1999-08-24
W0 98/36771 PCT/US98/02913
reagent such as iodoacetamide. An antibody containing intact antibody
molecules is
preferred herein.
The phrase "monoclonal antibody" in its various grammatical forms refers to an
antibody having only one species of antibody combining site capable of
immunoreacting with
a particular antigen. A monoclonal antibody thus typically displays a single
binding affinity
for any antigen with which it immunoreacts. A monoclonal antibody may
therefore contain
an antibody molecule having a plurality of antibody combining sites, each
immunospecific
for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.
The phrase "pharmaceutically acceptable" refers to molecular entities and
compositions that are physiologically tolerable and do not typically produce
an allergic or
similar untoward reaction, such as gastric upset, dizziness and the like, when
administered to
a human.
The phrase "therapeutically effective amount" is used herein to mean an amount
sufficient to prevent, and preferably reduce by at least about 30 percent,
more preferably by at
least 50 percent, most preferably by at least 90 percent, a clinically
significant change in the S
phase activity of a target cellular mass, or other feature of pathology such
as for example,
elevated blood pressure, fever or white cell count as may attend its presence
and activity.
A DNA sequence is "operatively linked" to an expression control sequence when
the
expression control sequence controls and regulates the transcription and
translation of that
DNA sequence. The term "operatively linked" includes having an appropriate
start signal
(e.g., ATG) in front of the DNA sequence to be expressed and maintaining the
correct reading
frame to permit expression of the DNA sequence under the control of the
expression control
sequence and production of the desired product encoded by the DNA sequence. If
a gene that
one desires to insert into a recombinant DNA molecule does not contain an
appropriate start
signal, such a start signal can be inserted in front of the gene.
The term "standard hybridization conditions" refers to salt and temperature
conditions
substantially equivalent to 5 x SSC and 65 °C for both hybridization
and wash. However, one
skilled in the art will appreciate that such "standard hybridization
conditions" are dependent
on particular conditions including the concentration of sodium and magnesium
in the buffer,
-15-
CA 02282859 1999-08-24
WO 98/36771 PCT/IJS98/02913
nucleotide sequence length and concentration, percent mismatch, percent
formamide, and the
like. Also important in the determination of "standard hybridization
conditions" is whether
the two sequences hybridizing are RNA-RNA, DNA-DNA or RNA-DNA. Such standard
hybridization conditions are easily determined by one skilled in the art
according to well
known formulae, wherein hybridization is typically 10-20°C below the
predicted or
determined Tm with washes of higher stringency, if desired.
Detailed knowledge of the sperm surface molecules is useful, not only to aid
in
understanding the complex processes of differentiation and maturation, but
also because the
plasma membrane is critical to sperm function.
The combination of vectorial labeling and detergent solubilization in the
method of
the present invention permits analysis of relatively few cells, bacteria or
virus, allowing day
to day variations in specific protein patterns (physiologically or
experimentally induced) to be
studied in a single individual or sample. Further, vectorial labeling
techniques provide
information concerning the exofacial orientation of plasmalemmal proteins,
which cannot be
achieved by the nitrogen cavitation technique alone.
For the first time both acidic, neutral and basic human spermatozoa proteins
are
analysed in a single method, and two methods for labeling surface exposed
proteins are
compared. A comprehensive 2-D database for membrane surface proteins,
particularly
human spermatozoa proteins can be established.
One way in which a comprehensive understanding of the composition of the sperm
plasma membrane can be put to immediate use is in the design of contraceptive
vaccines.
Knowledge of the molecules accessible to antibodies and T cell mediators on
the surface of a
biological target provides a rational basis for the development of vaccines.
In the case of
contraceptive vaccines based on sperm antigens, immune responses are sought
which
agglutinate, immobilize, or lyse sperm or interact with surface-accessible
proteins to block
events in the fertilization process. Were females to develop antibodies to
sperm surface
proteins in the secretions of the cervix, uterus and oviduct, progress of
sperm through the
female genital tract can be interdicted at several anatomical levels.
The ideal sperm-based contraceptive vaccine may be envisioned to contain a
mixture
-1 G-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
of sperm antigens derived from all major domains of the sperm plasmalemma,
including
head, midpiece and tail, as well as the inner acrosomal membrane, which forms
the limiting
membrane over the sperm head following the acrosome reaction (9). Although
monoclonal
or polyclonal antibodies that block sperm functions have led to the
identification of several
candidate sperm vaccine immunogens on both the plasmalemma and associated with
the
inner acrosomal membrane ( 10), a comprehensive analysis of the full range of
potential
human sperm surface immunogens has not heretofore been undertaken.
Two-dimensional gel electrophoresis as developed by O'Farrell ( 11,12), which
is
incorporated herein by reference in its entirety, in combination with
computerized gel
analysis, can be used for analysis of complex mixtures of polypeptides.
Specialized computer
software facilitates the quantitative analysis of two-dimensional gels,
including the capability
for comparison of various computer images, which permits a detailed
description of
alterations in protein patterns resulting from experimental manipulations or
changing
environmental stimuli {13-17}.
The present invention identifies the major surface proteins by vectorial
labeling
followed by detergent extraction, 2-D electrophoresis and computer image
analysis. From
the information obtained using this method, a cell surface protein
encyclopedia index,
membrane surface protein encyclopedia or sperm protein encyclopedia may be
obtained
which assigns numbers to the various proteins (1397 total for sperm proteins),
defines their
coordinates {Mr and pI) and lists their "integrated intensity" which is a
measure of staining
intensity relative to all other proteins.
The cell or microbial membrane may be disrupted using any method known in the
art,
including detergent treatment, disruption using mortar and pestle, sonication
and the like.
Detergents may include Nonidet P-40 (NP-40), TWEEN, SDS and the like.
Denaturants such
as urea, among others, may also be used.
The labeling may be performed using any label suitable for labeling of surface
proteins. Examples of labels include iodine (I'zs ) and biotin. "Prime
targets" for further
analysis, including sequencing, are proteins which are preferably labeled
using more than one
method.
-17-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
The separation of proteins using two dimensional (2-D) gel electrophoresis is
well
known in the art. Preparative 2-D gels may be 1-un such that significant
(sequenceable)
amounts of proteins can be obtained from spots identified by gel analysis.
When necessary, electrophoretic separation of proteins is achieved by varying
the
ampholine concentrations of the first dimension, which allows a restricted
area of the 2-D
map to be expanded to fill the entire 2-D gel format. This permits greater
separation of
proteins within a given region of the pI and Mr spectrum, thus increasing
resolution in
regions where many proteins are clustered, and it allows higher loads of
protein, thus
optimizing yield. Proteins are stained with Ponceau, Coomassie, silver or gold
depending on
each protein's characteristics and subsequent uses. After electrophoresis on 2-
D gels, proteins
are electroblotted onto membrane supports or digested in the acrylamide gel
with trypsin or
lysyl peptidase to yield peptides for Edman degradation or tandem mass
spectrometry.
The database for the surface proteins can serve as a reference in future
analysis of
plasma membrane proteins and as a guide for selection of targets for
microsequencing or
generation of antibodies. Antigens that are candidates for microsequencing
include those
which are reactive with infertile or vasectomy sera. Another prime
microsequencing
candidate is sperm agglutinating antigen 1 [SAGA-1]. MES-8 mAb agglutinates
100% of
sperm in human semen, impedes sperm penetration of cervical mucus, inhibits
the penetration
of hamster ova by human sperm, inhibits irt vitro fertilization of mouse ova
with isologous
sperm and inhibits binding of human sperm to human zona pellucida by 70%. SAGA-
1
antigen is localized to the entire sperm surface.
Affinity purification methods may also be used for enriching proteins of
interest that
are present in relatively low abundance. Washed, harvested cell, bacteria or
viruses can be
vectorially labeled with NHS-SS-Biotin (alternatively with NHSO Iminobiotin),
a
biotinylation probe with a reducible disulfide. Proteins are solubilized under
non-reducing
conditions and the biotinylated surface complexes precipitated with beads
coated with
immobilized streptavidin. The precipitated proteins can be eluted by reduction
following
washing and analyzed by two-dimensional electrophoresis. Microsequencing of
biotinylated
surface proteins enriched with this affinity bead method can be undertaken
from heavily
-18-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
loaded preparative 2-D gels or following reverse phase HPLC separation.
Sequencing of protein spots is performed by any method known in the art.
Preferably,
the sequencing is performed by Edman degradation and mass spectrometry,
preferably
tandem mass spectrometry (TMS).
Coomassie stained protein spots on PVDF membrane are loaded into a blot
cartridge
for sequence analysis. To obtain internal sequence, the proteins are digested
in the gel in
particular with lysyl endopeptidase or other proteases, and the peptides
extracted and
separated on a column, particularly a 1 mm diameter C 18 column. The mass and
purity of
the separated peptides are determined by matrix assisted laser desorption and
ionization time
of flight mass spectrometry using a Finnigan LaserMAT. The solution containing
the
separated peptide of interest can be applied to a glass fiber filter which has
been subjected to
condition cycles after coating with Polybrene. The NH-terminal amino acid
sequence of the
peptide is determined with a protein sequences. lntact [whole] proteins cm be
subjected to
twenty to thirty cycles of Edman degradation, while sequencing of internal
peptides proceed
as far as appropriate based upon their mass, as calculated from mass
spectrometry. The
sequencing method may employ standard Edman chemistry in which the NH-terminal
amino
acid is derivatized with phenylisothiocyanate and then cleaved with
trifluoroacetic acid to
give an anilinothiozolinone amino acid, which is subsequently converted with
acid to a
phenylthiohydantoin (PTH) amino acid. The PTH amino acids can be identified
and
quantitated by an Applied Biosystems 140 HPLC, particularly by using a 2.1 mm
diameter
C18 column optimized for PTH amino acid analysis.
High sensitivity internal sequencing can be performed by tandem mass
spectrometry.
Protein spots are reduced and alkylated in the polyacrylamide gel before
treatment with
protease (typically trypsin) in ammonium bicarbonate. The peptides produced by
this means
can then be extracted from the polyacrylamide, particularly with SO%
acetonitrile/5% formic
acid, and the extract then concentrated to near dryness and reconstituted,
preferably in 1
acetic acid. The peptides can be analyzed in a LC-electrospray mass
spectrometry system,
particularly using 75 gm i.d. capillary HPLC column interfaced to a Finnigan
MAT TSQ7000
electrospray ionization-tandem quadrupole mass spectrometer. Results can be
analyzed to
-19-
CA 02282859 1999-08-24
WO 98J36771 PCT/US98/02913
determine the molecular weights of the peptides, and the information utilized
to reprogram
the tandem mass spectrometer for collisionally activated dissociation (CAD)
analysis of
specific peptides. In the CAD experiment, an ion of a given haze ratio (mlz)
is mass selected
by the first mass analyzer. This process selects the peptide for sequencing
based on its
molecular weight and effectively eliminates from analysis all other peptides.
The selected
peptide is fragmented by collision with argon atoms and the products of those
fragmentation
reactions are mass analyzed by the second mass analyzer of the tandem mass
spectrometer
system. This yields a CAD mass spectrum from the amino acid sequence of the
peptide. The
process is repeated under computer control to obtain sequence information for
each peptide in
the digest.
Sequencing by mass spectrometry is very sensitive and can yield internal
sequence
data from samples which contain 1 to 10 pico moles of starting material. The
use of the first
mass filter of the tandem mass spectrometer separates the various peptides
which result from
digestion of the protein, thus avoiding the chromatography step needed to
obtain pure
peptides in the Edman sequencing method. However, Edman sequencing can obtain
data
from the N-terminus of an intact protein (if the NTH terminus is not blocked)
yielding thirty,
or in some cases, more amino acid residues. Although less sensitive than mass
spectrometry
sequencing, Edman degradation can sequence longer peptides than the mass
spectrometer,
and it readily distinguishes leucine and isoleucine, where the mass
spectrometer does not.
The Edman method does require purification of the peptide before it is loaded
into the
instrument, highlighting the need to separate and concentrate proteins
carefully by
preparative 2-D electrophoresis. The Edman method requires approximately 10 to
15 pmoles
of starting material to achieve internal sequences of sufficient length for
designing
oligonucleotides. However, as little as 2 pmoles are sufficient for long amino
terminal
sequence analyses of full length proteins.
From the amino acid sequence information obtained, oligonucleotides may be
designed, preferably degenerate oiigonucleotides representing all possible
codon
combinations of the sequence (ar alternatively, using inosine in the third
position in the
codon), and such oligonucleotides can be used in cloning by hybridization to
libraries
-20-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
containing cDNA encoding membrane surface proteins, or amplification by
polymerase chain
reaction (PCR), preferably RT-PCR.
The RT-PCR approach utilizing two anchoring primers has the advantages of the
simplicity and speed of the PCR protocol. However, because the genetic code is
degenerate,
selection of oligonucleotides based upon known amino acid sequences may
require the
synthesis of a large number of probes corresponding to a given amino acid
sequence.
At least two amino acid sequences of 7 or more residues in length from each
protein
are desired. [However, in those cases where two sequences are not obtained,
one sequence
can be used in conjunction with 5' and 3' RACE]. Optimal primer length for PCR
is 20 to 30
nucleotides. It follows that a minimum of 7 contiguous amino acids of
unequivocal sequence
must be obtained from at least 2 locations in a given protein's primary
structure in order to
design two primers which are at least 20 bases in length.
A combination of factors should be considered in detecting the exact
composition of
each oligonucleotide and which portion of a given amino acid sequence will be
chosen for
targeting, including: the G-C content of the proposed oligonucleotide, the
number of reliable
amino acid residues that have been sequenced, and the temperature of melting
that is inherent
to a proposed oligonucleotide pool. In order to manufacture oligonucleotides
that fail within
the optimal size of 20-30 bases in length a minimum stretch of at least 7
amino acids should
be obtained by microsequencing. If longer amino acid sequences can be obtained
there are
more opportunities for optimal oligonucleotide design. An N-terminal and an
internal protein
sequence or two internal amino acid sequences will permit oligonucleotide
pools to be
created from separated regions of the RNA to be amplified in order to
facilitate RT-PCR of a
suitable length cDNA fragment. Probes can be employed in various ways: 1 ) two
sets of
anchored oligonucleotides can be used in RT-PCR reactions to amplify a cDNA
fragment
which can in turn be used to screen cDNA lbraries to obtain full length cDNAs,
2) one or
more oligonucleotide sets can be used to anchor a PCR-RACE reaction to amplify
a 3' or 5'
cDNA fragment which also can be used to screen cDNA libraries; 3) a
combination of PCR
and PCR-RACE can be used to obtain full length cDNAs by piecing together
sequences from
separate PCR reactions; and 4) oligonucleotides can be used to screen cDNA
libraries
-21-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/OZ913
directly.
In circumstances in which one amino acid sequence has been obtained from the
unknown protein, a modified RACE protocol may be employed using a single
"anchoring"
optimized oligonucleotide pool to derive either '3' or 5' sequences upstream
or downstream
from the known sequence. In this method a single internal amino acid sequence
can be used
to design reverse complementary oligonucleotides to either the proposed sense
(S'-RACE) or
anti-sense (3'-RACE) strands. The second oligonucleotide for anchoring the
amplification
reaction is derived from known sequences of linkers placed on the 5' or 3'-
ends of
commercially available cDNA libraries. This methodology is now available in
kit form
(Marathon-Ready cDNAST"''; Clonetech).
Suitable cDNA libraries include: 1) 5'-Stretch (Clonetech), 2) ~,-zap and 3)
.1-gt 11
cDNA libraries. All three libraries have been used to retrieve full length
ORFs of various
testis proteins. The methodology of probing libraries with amplified cDNA
probes is well
documented. Briefly, oligonucleotides can be end-labeled with (~,-'zP)-rATP
and
polynucleotide kinase according to manufacturers instructions, purified and
used for
hybridization. As a positive control, Northern Blots can be probed first to
establish whether
the PCR product will recognize a specific mRNA message within total RNA. The
5'-Stretch
cDNA library (Clonetech) can be plated according to the manufacturers
instructions on 150
mm agar and lifted in duplicate with MSI filters (Fisher). The filters can
then be LJV
crosslinked, prehybridized and hybridized in standard solutions overnight.
Filters can then be
exposed to X-ray film and the resulting positive clones identified from
duplicate filters to
eliminate false positives. The films can then be realigned with the original
culture plates and
cores taken. Primary plaques can be replated and rescreened until all plaques
on a given plate
give a positive response. Samples of the phage at each step of purification
should be retained
at -20°C. Once isolated, the clones will be amplified by PCR utilizing
primers manufactured
to phage sequences adjacent to the cloning site utilized during library
manufacture. PCR-
amplified cDNA inserts can be enzyme restricted and the resulting fragments
separated and
sized on agarose gels. Restriction analysis of separate clones may yield
fragments of similar
size, lending confidence that the degenerate oligonucleotide has recognized
identical clones.
-22-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Direct screening of cDNA libraries with degenerate oligonucleotides can be
done, but
generally are only performed if the PCR-based approaches have not worked. A
mixture of
32p end-labeled oligonucleotides can be chosen based on phylogenetically
biased codons
encoding the amino acid microsequence. Oligonucleolides are designed according
to the
parameters described above with the emphasis placed on developing a pool with
as low a
degeneracy as possible (c 300). Positive results have been obtained from
oligonucleotide
pools of 17-oligomers. In the event that the oligonucleotide pool is larger
than this cutoff,
multiple pools can be used that contain all the combinatorial possibilities. A
primary control
experiment can be performed first by hybridizing the end-labeled pools) to
Northern blots
containing poly-(A)- mRNA to determine the hybridization conditions that yield
positive
bands upon washing and exposure to X-ray films. Once hybridization and washing
conditions (salt and temperature) are set, cDNA libraries listed above can be
plated out in
duplicate, lifted and probed with the labeled oligonucleotide pools in
conditions as suggested
by Ausubel. Duplicate lifts can be compared to eliminate false positives and
secondary and
tertiary screening performed to ensure purity and correctness of the proposed
clone. If
available, the same library lifts can be rescreened with a second
oligonucleotide mixture
derived from another region of the unknown protein.
Alternatively, antibodies to the membrane surface proteins may be used to
screen
expression libraries.
Monospecific antisera can be generated to protein spots isolated from 2-D
gels. Two
approaches can be taken: 1 ) Animals can be immunized with protein containing
cores of
acrylamide gel which are emulsified in Freunds complete adjuvant according to
standard
intramuscular immunization; or 2) strips of nitrocellulose containing specific
transferred
sperm proteins can be implanted subcutaneously and intraperitoneally after
dipping the strip
in Freunds complete adjuvant. Aliquots of the monospecific sera generated by
these methods
can be Western blotted to determine an endpoint titer and to verify
specificity to the protein
spot of interest. If a given antisera has a low titer, solutions of enriched
antibody may be
created using the Olmstead technique which employs nitrocellulose bound
proteins from a
specific protein band or spot to affinity purify antibodies. The expression
libraries can be
-23-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
plated in sufficient numbers to account for all three reading frames in both
directions (G X the
density used for nucleotide probing), grown at 37°C for 3-4 hours
before induction with 10
mM IPTG-soaked filters, and incubated at 42°C. Monospecific sera and
pre-immune sera
from the identical animal can be absorbed twice overnight at 4°C with
E.E. coli bound to
cyanogen bromide activated Sepharose, in order to eliminate reactivity with
E.E. coli proteins.
cDNA-bearing phage clones containing the largest inserts by restriction
analysis are
then converted to plasmid form. Highly purified plasmid DNA necessary for
accurate
sequencing of long stretches can be prepared by amplification of plasmid-
bearing bacteria in
large scale (% 100 ml) cultures followed by CsCI equilibrium centrifugation by
standard
methodologies. Standard primers to plasmid sequences bracketing the cloning
site are
manufactured to be used for sequencing. Sequencing is preferably performed by
dideoxy-
chain termination method utilizing a Sequenase~ kit. Sequencing proceeds in
both directions
and new cDNA-specific primers are manufactured to internal sequences and
sequencing
continues until the sequences overlap. Alternatively, four color sequencing
can be conducted
on a Applied Biosystems Prism 377 automated DNA sequencer. An open reading
frame can
be sought by computer analysis as well as a putative start site to determine
if the clone is full-
length. In addition, the original sequence of amino acids obtained by
microsequencing
should be identified.
In the event that sequences cannot be derived so as to allow "doubleanchored"
RT-
PCR derivation of cDNAs clones, oligo-d(T) can be used as the second
"anchoring"
oligonucleotide.
Occasionally some areas of clones yield ambiguous results due to compressions.
In
this event readable sequences can be obtained using the TaqTrack~ Sequencing
Kit
(Promega) that allows sequencing reactions to be performed at 72°C
rather than at 37°C.
Higher temperatures during the reaction stage usually result in more reliable
melting of any
potential single-stranded areas and yield reliable, lucid sequences.
Sequences can also be compared to gene data banks to search for identity or
homology with known proteins.
To assess the putative tissue specificity of antigens in human and primate
models,
-24-
CA 02282859 1999-08-24
WO 98136771 PCT/US98/02913
Northern blot analysis of RNA from major monkey and human organs can be
employed.
Total RNA can be isolated from various tissues stored at -70°C. Poly
(A+) RNA is purified
from total RNA by oligo-d(T) chromatography. RNA cm be concentrated by ethanol
precipitation prior to resuspension in sterile distilled water (105 ml). The
amount of Poly A+
RNA in each sample can be quantitated by reading its optical density at 260 nm
[OD 1.0= 40
mg/ml]. Equal amounts of Poly A+ RNA samples from each tissue to be tested
(e.g. 2 mg)
are separated on a denaturing agarose/formaldehyde gel and the RNA is
transferred to nylon.
After rinsing the nylon for 5 min in 2X SSC, the RNA is cross-linked to the
nylon with UV
light. The nylon is prehybridized and then hybridized overnight at 65°C
in fresh
hybridization buffer containing 10 mg/ml of probe labeled with 3zP-dCTP.
Probes may
consist of cDNA for the antigen under study or control probe of ~3-actin or
cyclophilin. The
probes can be labeled by random priming using a protocol and kit purchased
from Promega.
When necessary, both low stringency and high stringency conditions should be
tested.
Autoradiographs are exposed using an intensifying screen. Following
hybridization with a
test probe, the nylon blots are stripped and reprobed with one of the controls
(beta-actin or
cyclophilin) to check for equal loading of RNA.
The tissue specificity of antigens can also be assesed using RNA from each
tissue
which is reverse transcribed and the resulting cDNAs amplified by the
polymerise chain
reaction (PCR). Primers specific for the RNA of interest, which map to the
initiation and
termination of translation, respectively, can be employed. A positive control
can make use of
beta-actin specific primers, selected on the basis of conserved regions in
beta-actin cDNAs
and separated by 198 nucleotides of intervening sequence. PCR products are
visualized and
their sizes estimated following staining with ethidium bromide. Whether the
PCR products
actually correspond to the material of interest can be determined by
hybridization in southern
blots with cDNAs specific for the antigen under study.
Tissue specificity of antigens can be assessed in yet another way by
immunohistochemical studies, preferably employing affinity purified
antibodies. A bank of
paraffin embedded tissues can be collected and maintained. Proteins can be
localized in the
bank of tissues by immunoperoxidase labeling of paraffin-embedded sections.
Tissues can be
-25-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
fixed for several hours with 10% neutral buffered formalin (Sigma). The tissue
is dehydrated
- through an ethanol series, embedded in paraffin, sectioned and mounted onto
slides. Before
use, sections are dewaxed, rehydrated and treated with 0.25% hydrogen peroxide
to block
endogenous peroxidase activity. Non-specific protein binding sites can be
blocked by
incubating the slides in PBS with 5% normal goat serum (NGS). Slides are
incubated with
either affinity purified rabbit polyclonal antibodies generated to the
recombinant protein or
control preimmune sera diluted in PBS-NGS and washed, and then incubated with
peroxidase-conjugated goat anti-rabbit IgG/IgM in PBS-NGS. Slides are washed
with PBS,
and immunoreactive proteins can be visualized by staining with TrueBlue
peroxidase
substrate (KPL} or gold enhanced staining. The presence of a blue or black
precipitate
indicates immunoreactive protein(s).
In sperm surface protein microsequence analysis performed to date, homologies
to
heat shock protein 90 alpha (82%), gastrin binding protein (94.7%), human
calreticulin
( 100% with 15 amino acids), mouse fibrous sheath protein (64%), and serum
amyloid-
component precursor have been found.
Approximately 40% of the proteins microsequenced appear to be novel.
Table I shows the co-ordinates of the novel spern~ surface proteins.
Table I. Microsequenced Surface Proteins from the Sperm Encyclopedia [see
Table 11 for additional surfact proteins]
Protein Sample VectorialMethods Residues Data Analysis
of
Coordinates1=Protein immobilizedlabelingSequencingObtained*
MW, on
pl PVDF membrane I=125-I
2=Peptides B=Biotin
from in gel
digestion
92.5 kDa, 2 I/B TMS 12 seq., Novel surface
5.3 5-12 as
92 kDa, 2 I/B E 9 as Novel surtace
5.6
90 kDa. 2 I/B TMS 2 seq., Novel surface
5.7 7-10 as
90 kDa, 1 I/B E 6 as Novel surface
4.9
88 kDa, 2 I/B TMS 6 seq., Novel surface
4.0 5-10 as
32 kDa. 2 IIB TMS 3 seq., Novel surtace
5.2 8-9 as
. .~.a..l...,..1,f Innn+1,
.., of cnnmnnree
i
~-n-.umam ucyouuuvm .. ... r...r...,.,. ,. ., _..___ ____..._ , ,., ",
TMS=Tandem mass-spectrometry
-2G-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
The membrane surface proteins identified by the present method have both
diagnostic
and therapeutic uses.
In instances where it is desired to reduce or inhibit the binding of the
membrane
surface protein to a cell or other target, an appropriate inhibitor, including
antibodies to the
membrane surface protein, could be introduced to block the interaction of the
membrane
surface protein with a ligand or receptor thereto.
Agents exhibiting either mimicry or antagonism to the membrane surface
proteins or
control over their production, may be prepared in pharmaceutical compositions,
with a
suitable carrier and at a strength effective for administration by various
means to a patient
experiencing an adverse medical condition associated with the presence of the
target cell,
bacterium or virus, for the treatment thereof. A variety of administrative
techniques may be
utilized, among them parenteral techniques such as subcutaneous, intravenous
and
intraperitoneal injections, catheterizations and the like. Average quantities
of the membrane
surface proteins or their subunits may vary and in particular should be based
upon the
recommendations and prescription of a qualified physician or veterinarian.
In a preferred embodiment, the invention is directed to administration of the
membrane surface proteins or antibodies thereto to inhibit the interaction of
a sperm cell with
an egg, to inhibit the transport of sperm within the female reproductive
tract, or to immobilize
sperm, i.e., as a contraceptive.
The membrane surface proteins and antibodies including both polyclonal and
monoclonal antibodies, may possess certain diagnostic applications and may for
example, be
utilized for the purpose of detecting and/or measuring conditions such as
bacterial or viral
infection, immunity to sperm cells or the like. For example, the membrane
surface proteins
or their subunits may be used to produce both polyclonal and monoclonal
antibodies to
themselves in a variety of cellular media, by known techniques such as the
hybridoma
technique utilizing, for example, fused mouse spleen lymphocytes and myeloma
cells.
Likewise, small molecules that mimic or antagonize the activity(ies) of the
membrane surface
proteins of the invention may be discovered or synthesized, and may be used in
diagnostic
and/or therapeutic protocols.
-27-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
As an alternative to generating polyclonal antibodies to whole proteins,
sufficient
amino acid sequences may be obtained from microsequencing to permit
development of
synthetic peptide immunogens. These peptide immunogens may be used as
immunocontraceptive agents. Alternatively, if cloning a protein of interest is
not achieved
using the RT-PCR, or direct library probing with oligonucleotides or
polyclonal antibodies as
outfitted above, anti-peptide antisera can be generated to chimeric peptides.
In this strategy,
the amino acid sequence can be conjugated to a promiscuous T cell epitope from
tetanus
toxoid, VDDALRNSTKIYSYFPSV (SEQ ID NO:1), using an intervening, GPSL (SEQ ID
N0:2), linker. Antipeptide antisera can then be used to screen cDNA expression
libraries.
For generation of polyclonal antibodies to recombinant antigen, New Zealand
white
female rabbits can receive recombinant antigen (about 500 pg) in Complete
(once) and
Incomplete Freunds Adjuvant (five) for a total of six injections at three week
intervals. Sera
can be obtained weekly after the second injection.
For generation of affinity purified antibodies, cyanogen bromide activated
sepharose
{Sigma Chemical Co, St Louis MO) can be used as the immobilizing phase for the
purified
recombinant antigen. The polyclonal antibody is pumped over the antigen
affinity column to
allow antibody to bind. Bound antibody is eluted, and fractions are monitored
by UV
absorbance. Fractions can be pooled and then blotted with anti-rabbit Ig
reagents to
demonstrate which of the bands are purified Ig. ELISA end point titration of
the various
batches of purified IgG can be run at identical protein concentrations against
a constant
amount of recombinant antigen to demonstrate retention of antigen binding.
In studies of sperm antigens, affinity purified antibodies to recombinant
sperm
antigens can be immunoreacted with Western blots of 2-D gels loaded with sperm
membrane
extracts.
Sperm functional assays can be performed to evaluate the affinity purified
antibodies
to the recombinant antigen to react with the native antigen on the sperm
surface and to affect
sperm function{s). These assays can include localization of antigens on the
sperm by
immunofluorescence and confirmation of surface location by FACS; tests of
sperm/egg
[Sperm Penetration Assay) and sperm/zona interaction [Hemi-zona assay); sperm
-28-
CA 02282859 1999-08-24
WO 98/36771
agglutination and immobilization.
PCT/US98/02913
The general methodology for making monoclonal antibodies by hybridomas is well
known. Immortal, antibody-producing cell lines can also be created by
techniques other than
fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or
transfection
with Epstein-Barr virus. See, e.g., M. Schreier et al., "Hybridoma Techniques"
(1980);
Hammerling et al., "Monoclonal Antibodies And T-cell Hybridomas" ( 1981 );
Kennett et al.,
"Monoclonal Antibodies" (1980); see also U.S. Patent Nos. 4,341,761;
4,399,121; 4,427,783;
4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; 4,493,890.
Panels of monoclonal antibodies produced against the membrane surface peptides
can
be screened for various properties; i.e., isotype, epitope, affinity, etc. Of
particular interest
are monoclonal antibodies that neutralize the activity of the membrane surface
protein or its
subunits. High affinity antibodies are also useful when immunoaffinity
purification of native
or recombinant membrane surface proteins is possible.
Preferably, the antibody used in the diagnostic methods of this invention is
an affinity
purified polyclonal antibody. More preferably, the antibody is a monoclonal
antibody
(mAb). In addition, it is preferable for the antibody molecules used herein be
in the form of
Fab, Fab', F(ab')z or F(v) portions of whole antibody molecules.
As suggested earlier, the diagnostic method of the present invention comprises
examining a cellular or serum sample or medium by means of an assay including
an effective
amount of binding partner to a membrane surface protein, such as an antibody,
preferably an
affinity-purified polyclonal antibody, and more preferably a mAb. In addition,
it is preferable
for the antibody molecules used herein be in the form of Fab, Fab', F(ab')2 or
F(v) portions or
whole antibody molecules. As previously discussed, patients capable of
benefitting from this
method include those suffering from bacterial or viral infection, or those in
which
contraception is desired.
Methods for isolating the membrane surface proteins and inducing antibodies
and for
determining and optimizing the ability of antibodies to assist in the
examination of the target
cells are all well-known in the art. Methods for producing polyclonal anti-
polypeptide
antibodies are well-known in the art. See U.S. Patent No. 4,493,795 to Nestor
et al. A
-29-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
monoclonal antibody, typically containing Fab andlor F(ab')z portions of
useful antibody
molecules, can be prepared using the hybridoma technology described in
Antibodies - A
Laborator~~ Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory, New
York
(1988), which is incorporated herein by reference. Briefly, to form the
hybridoma from
which the monoclonal antibody composition is produced, a myeloma or other self
perpetuating cell line is fused with lymphocytes obtained from the spleen of a
mammal
hyperimmunized with the membrane surface proteins, or binding portions
thereof.
Splenocytes are typically fused with myeloma cells using polyethylene glycol
(PEG)
6000. Fused hybrids are selected by their sensitivity to HAT. Hybridomas
producing a
monoclonal antibody useful in practicing this invention are identified by
their ability to
immunoreact with the membrane surface proteins and their ability to inhibit
specified
infective activity or fertilization of target cells.
A monoclonal antibody useful in practicing the present invention can be
produced by
initiating a monoclonal hybridoma culture comprising a nutrient medium
containing a
hybridoma that secretes antibody molecules of the appropriate antigen
specificity. The
culture is maintained under conditions and for a time period sufficient for
the hybridoma to
secrete the antibody molecules into the medium. The antibody-containing medium
is then
collected. The antibody molecules can then be further isolated by well-known
techniques.
Media useful for the preparation of these compositions are both well-known in
the art
and commercially available and include synthetic culture media, inbred mice
and the like.
An exemplary synthetic medium is Dulbecco's minimal essential medium (DMEM;
Dulbecco
et al., Virol. 8:396 ( 1959)) supplemented with 4.5 gm/1 glucose, 20 mm
glutamine, and 20%
fetal calf serum. An exemplary inbred mouse strain is the Balb/c.
Methods for producing monoclonal antibodies are also well-known in the art.
See
Niman et al., Proc. Natl. Acad. Sci. USA, 80:4949-4953 ( 1983). Typically, the
membrane
surface proteins or peptide analogs are used either alone or conjugated to an
immunogenic
carrier, as the immunogen in the before described procedure for producing
monoclonal
antibodies. The hybridomas are screened for the ability to produce an antibody
that
immunoreacts with the membrane surface proteins.
-30-
CA 02282859 1999-08-24
W098/36771 PCT/US98/02913
The present invention further contemplates therapeutic compositions useful in
practicing the therapeutic methods of this invention. A subject therapeutic
composition
includes, in admixture, a pharmaceutically acceptable excipient (carrier) and
one or more of a
membrane surface protein,(i.e., of a cell, bacterium or virus) particularly a
sperm antigen
polypeptide analog thereof or fragment thereof, as described herein as an
active ingredient.
In a preferred embodiment, the composition comprises a sperm antigen or
mixture thereof
capable of inhibiting conception.
The preparation of therapeutic compositions which contain polypeptides,
analogs or
active fragments as active ingredients is well understood in the art.
Typically, such
compositions are prepared as injectables, either as liquid solutions or
suspensions, however,
solid fonms suitable for solution in, or suspension in, liquid prior to
injection can also be
prepared. The preparation can also be emulsified. The active therapeutic
ingredient is often
mixed with excipients which are pharmaceutically acceptable and compatible
with the active
ingredient. Suitable excipients are, for example, water, saline, dextrose,
glycerol, ethanol, or
the like and combinations thereof. In addition, if desired, the composition
can contain minor
amounts of auxiliary substances such as wetting or emulsifying agents, and/or
pH buffering
agents which enhance the effectiveness of the active ingredient.
A polypeptide, analog or active fragment can be formulated into the
therapeutic
composition as neutralized pharmaceutically acceptable salt forms.
Pharmaceutically
acceptable salts include the acid addition salts (formed with the free amino
groups of the
polypeptide or antibody molecule) and which are formed with inorganic acids
such as, for
example, hydrochloric or phosphoric acids, or such organic acids as acetic,
oxalic, tartaric,
mandelic, and the like. Salts formed from the free carboxyl groups can also be
derived from
inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or
ferric
hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-
ethylamino ethanol,
histidine, procaine, and the like.
The therapeutic polypeptide-, analog- or active fragment-containing
compositions are
conventionally administered intravenously, as by injection of a unit dose, for
example. The
term "unit dose" when used in reference to a therapeutic composition of the
present invention
-31-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
refers to physically discrete units suitable as unitary dosage for humans,
each unit containing
a predetermined quantity of active material calculated to produce the desired
therapeutic
effect in association with the required diluent; i.e., carrier, or vehicle.
The compositions are administered in a manner compatible with the dosage
formulation, and in a therapeutically effective amount. The quantity to be
administered
depends on the subject to be treated, capacity of the subject's immune system
to utilize the
active ingredient, and degree of binding capacity desired. Precise amounts of
active
ingredient required to be administered depend on the judgment of the
practitioner and are
peculiar to each individual. However, suitable dosages may range from about
0.1 to 20,
preferably about 0.5 to about 10, and more preferably one to several,
milligrams of active
ingredient per kilogram body weight of individual per day and depend on the
route of
administration. Suitable regimes for initial administration and booster shots
are also variable,
but are typified by an initial administration followed by repeated doses at
one or more hour
intervals by a subsequent injection or other administration. Alternatively,
continuous
intravenous infusion sufficient to maintain concentrations of ten nanomolar to
ten micromolar
in the blood are contemplated.
The therapeutic compositions may further include an effective amount of the
antagonist or antibody to the membrane surface proteins, and one or more of
the following
active ingredients: an antibiotic, a steroid.
Another feature of this invention is the expression of the proteins encoded by
the
DNA sequences obtained following labeling, analysis and sequencing. As is well
known in
the ari, DNA sequences may be expressed by operatively linking them to an
expression
control sequence in an appropriate expression vector and employing that
expression vector to
transform an appropriate unicellular host.
Such operative linking of a DNA sequence of this invention to an expression
control
sequence, of course, includes, if not already part of the DNA sequence, the
provision of an
initiation codon, ATG, in the correct reading frame upstream of the DNA
sequence.
A wide variety of host/expression vector combinations may be employed in
expressing the DNA sequences of this invention. Useful expression vectors, for
example,
-32-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
may consist of segments of chromosomal, non-chromosomal and synthetic DNA
sequences.
Suitable vectors include derivatives of SV40 and known bacterial plasmids,
e.g., E. coli
plasmids col El, pCRI, pBR322, pMB9 and their derivatives, plasmids such as
RP4; phage
DNAS, e.g., the numerous derivatives of phage ~,, e.g., NM989, and other phage
DNA, e.g.,
M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2p
plasmid or
derivatives thereof; vectors useful in eukaryotic cells, such as vectors
useful in insect or
mammalian cells; vectors derived from combinations of plasmids and phage DNAs,
such as
plasmids that have been modified to employ phage DNA or other expression
control
sequences; and the like.
Any of a wide variety of expression control sequences -- sequences that
control the
expression of a DNA sequence operatively linked to it -- may be used in these
vectors to
express the DNA sequences of this invention. Such useful expression control
sequences
include, for example, the early or late promoters of SV40, CMV, vaccinia,
polyoma or
adenovirus, the lac system, the tip system, the TAC system, the TRC system,
the LTR system,
the major operator and promoter regions of phage ~., the control regions of fd
coat protein, the
promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the
promoters of acid
phosphatase (e.g., PhoS), the promoters of the yeast a-mating factors, and
other sequences
known to control the expression of genes of prokaryotic or eukaryotic cells or
their viruses,
and various combinations thereof.
A wide variety of unicellular host cells are also useful in expressing the DNA
sequences of this invention. These hosts may include well known eukaryotic and
prokaryotic
hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomvces, fungi
such as yeasts,
and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey
kidney cells
(e.g., COS I, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf7), and
human cells
and plant cells in tissue culture.
It will be understood that not all vectors, expression control sequences and
hosts will
function equally well to express the DNA sequences of this invention. Neither
will all hosts
function equally well with the same expression system. However, one skilled in
the art will
be able to select the proper vectors, expression control sequences, and hosts
without undue
-33-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
experimentation to accomplish the desired expression without departing from
the scope of
this invention. For example, in selecting a vector, the host must be
considered because the
vector must function in it. The vector's copy number, the ability to control
that copy number,
and the expression of any other proteins encoded by the vector, such as
antibiotic markers,
will also be considered.
In selecting an expression control sequence, a variety of factors will
normally be
considered. These include, for example, the relative strength of the system,
its controllability,
and its compatibility with the particular DNA sequence or gene to be
expressed, particularly
as regards potential secondary structures. Suitable unicellular hosts will be
selected by
consideration of, e.g., their compatibility with the chosen vector, their
secretion
characteristics, their ability to fold proteins correctly, and their
fermentation requirements, as
well as the toxicity to the host of the product encoded by the DNA sequences
to be expressed,
and the ease of purification of the expression products.
Considering these and other factors a person skilled in the art will be able
to construct
a variety of vector/expression control sequence/host combinations that will
express the
protein encoded by the DNA sequences of this invention on fermentation or in
large scale
animal culture.
cDNAs are preferably cloned under the control of bacteriophage T7 RNA
polymerase/promoter system in the E coli expression vector pET22h(+) (Novagen,
Madison,
WI). If present, the endogenous signal peptide can be replaced with the
bacterial signal pelB
sequence. It is essential for expression in the pET vector that the foreign
gene be fused in
frame with a) the pelB sequence, at the 5' end (to facilitate the export of
produced protein into
the periplasmic space) and b) a stretch of six histidines {his-tag) at the 3'
end (to provide an
anchor for purification by immobilized ion affinity chromatography).
Polymerase chain
reaction (PCR) cloning strategy can be used for making the constructs for gene
expression
such that full length proteins will be expressed whenever possible. Inserts
can be verified by
sequencing. Clones bearing the antigen's coding regions can be grown in 3X
terrific broth
supplemented with ampicillin (100 ~g/ml) at 37°C. When cells reach an
A~~~ of O.G, cultures
can be induced by the addition of 0.4 mM IPTG. As a negative control, the host
cell culture
-34-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
can be treated in a similar manner.
In order to optimize the time of harvest of expressed protein, the constructs
can be
analyzed for their time course of induction in E. coli. For large scale
production of
recombinant constructs, 14 liter cultures can be grown in a New Brunswick
ML410
fermentor. The 6 histidine residues at the carboxyl terminus will facilitate
process
purification method using His-BindTM metal chelation resin. To verify the
final purity of the
isolated recombinant antigens, Coomassie blue [Amido black] and silver
staining can be
conducted on SDS-PAGE gels loaded with varying concentrations of the purified
product.
Affinity purified antibodies may be generated to the recombinant protein can
be tested
on 2-D immunoblots to determine whether the identical protein spot originally
selected is
immunoreactive, thus providing an additional [immunological identity] proof
that the desired
cDNA has been obtained. By studying whether these antibodies bind to the sperm
surface in
immunofluorescence and FACS and evaluating their effects on protein function
in a variety
of in vitro assays, a role for a given protein in functional events mediated
at the cell or virus
surface can be confirmed.
It is further intended that membrane surface protein analogs may be prepared
from
nucleotide sequences of the proteins derived within the scope of the present
invention.
Analogs, such as fragments, may be produced, for example, by pepsin digestion
of material
separated by gel analysis, or produced recombinantly. Other analogs, such as
muteins, can be
produced by standard site-directed mutagenesis of coding sequences.
As mentioned above, a DNA sequence encoding the membrane surface protein can
be
prepared synthetically rather than cloned. The DNA sequence can be designed
with the
appropriate codons for the amino acid sequence. In general, one will select
preferred codons
for the intended host if the sequence will be used for expression. The
complete sequence is
assembled from overlapping oligonucleotides prepared by standard methods and
assembled
into a complete coding sequence. See, e.g., Edge, Nature, 292:756 (1981);
Nambair et al.,
Science, 223:1299 (1984); Jay et al., J. Biol. Chem., 259:6311 (1984).
Synthetic DNA sequences allow convenient construction of genes which will
express
membrane surface protein analogs or "muteins". Alternatively, DNA encoding
muteins can
-35-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
be made by site-directed mutagenesis of native genes or cDNAs, and muteins can
be made
directly using conventional polypeptide synthesis.
The present invention extends to the preparation of antisense oligonucleotides
and
ribozymes that may be used to interfere with the expression of the membrane
surface protein
at the translational level. This approach utilizes antisense nucleic acid and
ribozymes to
block translation of a specific mRNA, either by masking that mRNA with an
antisense
nucleic acid or cleaving it with a ribozyme.
Antisense nucleic acids are DNA or RNA molecules that are complementary to at
least a portion of a specific mRNA molecule. (See Weintraub, 1990; Marcus-
Sekura, 1988.)
In the cell, they hybridize to that mRNA, forming a double stranded molecule.
The cell does
not translate an mRNA in this double-stranded form. Therefore, antisense
nucleic acids
interfere with the expression of mRNA into protein. Oligomers of about fifteen
nucleotides
and molecules that hybridize to the AUG initiation codon will be particularly
efficient, since
they are easy to synthesize and are likely to pose fewer problems than larger
molecules when
introducing them into cells. Antisense methods have been used to inhibit the
expression of
many genes in vitro (Marcus-Sekura, 1988; Hambor et al., 1988).
Ribozymes are RNA molecules possessing the ability to specifically cleave
other
single stranded RNA molecules in a manner somewhat analogous to DNA
restriction
endonucleases. Ribozymes were discovered from the observation that certain
mRNAs have
the ability to excise their own introns. By modifying the nucleotide sequence
of these RNAs,
researchers have been able to engineer molecules that recognize specific
nucleotide sequences
in an RNA molecule and cleave it (Cech, 1988.). Because ribozymes are sequence-
specific,
only mRNAs with particular sequences are inactivated.
Investigators have identified two types of ribozymes, Tetrahymena-type and
"hammerhead"-type. (Hasselhoff and Gerlach, 1988) Tetrahymena-type ribozymes
recognize
four-base sequences, while "hammerhead"-type recognize eleven- to eighteen-
base
sequences. The longer the recognition sequence, the more likely it is to occur
exclusively in
the target mRNA species. Therefore, hammerhead-type ribozymes are preferable
to
Tetrahymena-type ribozymes for inactivating a specific mRNA species, and
eighteen base
-36-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
recognition sequences are preferable to shorter recognition sequences.
The DNA sequences described herein may thus be used to prepare antisense
molecules against, and ribozymes that cleave mRNAs for membrane surface
proteins and
their ligands.
The present invention also relates to a variety of diagnostic applications,
including
methods for detecting the presence of particular cells or infectious agents,
or antibodies
thereto (i.e., in patient sera) by reference to their ability to bind to or
compete with the
binding of the membrane surface proteins. As mentioned earlier, the membrane
surface
proteins can be used to produce antibodies to themselves by a variety of known
techniques,
and such antibodies could then be isolated and utilized as in tests for the
presence of
particular target cells or infectious agents. Such antibodies may be used to
analyze the cell
surface proteins, and particularly in the case of analysis of sperm proteins,
may be used to
characterized sperm agglutination, sperm immobilization, surface
immunofluorescence,
FACS analysis, sperm penetration assays, hemi-zona assays, and localization on
the 2-D
surface map.
As described in detail above, antibody(ies) can be produced and isolated by
standard
methods including the well known hybridoma techniques. For convenience, the
antibody(ies)
to the membrane surface protein will be referred to herein as Ab, and
antibody(ies) raised in
another species as Ab2.
The presence of cells or infectious agents containing the repertoire of
membrane
surface proteins can be ascertained by the usual immunological procedures
applicable to such
determinations. A number of useful procedures are known. Three such procedures
which are
especially useful utilize either the surface protein labeled with a detectable
label, antibody
Ab, labeled with a detectable label, or antibody Ab2 labeled with a detectable
label. The
procedures may be summarized by the following equations wherein the asterisk
indicates that
the particle is labeled, and "MSP" stands for the membrane surface protein:
A. MSP* + Ab, = MSP*Ab,
B. MSP + Ab* = MSPAb,*
C. MSP + Ab, + Abz* = MSPAb,Abz*
-3 7-
CA 02282859 1999-08-24
W0.98/36771 PCT/US98/02913
The procedures and their application are all familiar to those skilled in the
art and
accordingly may be utilized within the scope of the present invention. The
"competitive"
procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090 and
3,850,752.
Procedure C, the "sandwich" procedure, is described in U.S. Patent Nos. RE
31,006 and
4,016,043. Still other procedures are known such as the "double antibody," or
"DASP"
procedure.
In each instance, the membrane surface protein forms complexes with one or
more
antibody(ies) or binding partners and one member of the complex is labeled
with a detectable
label. The fact that a complex has formed and, if desired, the amount thereof,
can be
determined by known methods applicable to the detection of labels.
It will be seen from the above, that a characteristic property of Abz is that
it will react
with Ab,. This is because Ab, raised in one mammalian species has been used in
another
species as an antigen to raise the antibody Abz. For example, Abz may be
raised in goats
using rabbit antibodies as antigens. Abz therefore would be anti-rabbit
antibody raised in
goats. For purposes of this description and claims, Ab, will be referred to as
a primary or
anti-membrane surface protein antibody, and Abz will be referred to as a
secondary or anti-
Ab, antibody.
The labels most commonly employed for these studies are radioactive elements,
enzymes, chemicals which fluoresce when exposed to ultraviolet light, and
others.
A number of fluorescent materials are known and can be utilized as labels.
These
include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue
and Lucifer
Yellow. A particular detecting material is anti-rabbit antibody prepared in
goats and
conjugated with fluorescein through an isothiocyanate.
The membrane surface protein or its binding partners) can also be labeled with
a
radioactive element or with an enzyme. The radioactive label can be detected
by any of the
currently available counting procedures. The preferred isotope may be selected
from'H, '4C,
3zp~ 3sS~ s~Cl~ siCr~ s~Co~ saCo~ s9Fe~ ~oY~ izsl~ ~sil~ ~d ~a~Re.
Enzyme labels are likewise useful, and can be detected by any of the presently
utilized
colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or
gasometric
-38-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
techniques. The enzyme is conjugated to the selected particle by reaction with
bridging
molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like.
Many enzymes
which can be used in these procedures are known and can be utilized. The
preferred are
peroxidase,13-glucuronidase, I3-D-glucosidase, f3-D-galactosidase, urease,
glucose oxidase
plus peroxidase and alkaline phosphatase. U.S. Patent Nos. 3,654,090;
3,850,752; and
4,016,043 are referred to by way of example for their disclosure of alternate
labeling material
and methods.
In a further embodiment of this invention, commercial test kits suitable for
use by a
medical specialist may be prepared to determine the presence or absence of the
repertoire of
membrane surface proteins on suspected target cells. In accordance with the
testing
techniques discussed above, one class of such kits will contain at least the
labeled membrane
surface proteins) or its(their) binding partner(s), for instance an antibody
specific thereto,
and directions, of course, depending upon the method selected, e.g.,
"competitive,"
"sandwich," "DASP" and the like. The kits may also contain peripheral reagents
such as
buffers, stabilizers, etc.
Accordingly, a test kit may be prepared for the demonstration of the presence
or
capability of cells for presence of the cell or infectious agent, comprising:
(a) a predetermined amount of at least one labeled immunochemically reactive
component
obtained by the direct or indirect attachment of the present membrane surface
protein or a
specific binding partner thereto, to a detectable label;
(b) other reagents; and
(c) directions for use of said kit.
More specifically, the diagnostic test kit may comprise:
(a) a known amount of the membrane surface protein as described above (or a
binding
partner) generally bound to a solid phase to form an immunosorbent, or in the
alternative,
bound to a suitable tag, or plural such end products, etc. (or their binding
partners) one of
each;
(b) if necessary, other reagents; and
(c) directions for use of said test kit.
-39-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
In a further variation, the test kit may be prepared and used for the purposes
stated
above, which operates according to a predetermined protocol (e.g.
"competitive," "sandwich,"
"double antibody," etc.), and comprises:
(a) a labeled component which has been obtained by coupling the membrane
surface
protein to a detectable label;
(b) one or more additional immunochemical reagents of which at least one
reagent is a
ligand or an immobilized ligand, which ligand is selected from the group
consisting of:
{i) a ligand capable of binding with the labeled component (a);
(ii) a ligand capable of binding with a binding partner of the labeled
component
(a);
(iii) a ligand capable of binding with at least one of the components) to be
determined; and
(iv) a ligand capable of binding with at least one of the binding partners of
at least
one of the components) to be deternlined; and
(c) directions for the performance of a protocol for the detection and/or
determination of
one or more components of an immunochemical reaction between the membrane
surface
protein and a specific binding partner thereto.
In accordance with the above, an assay system for screening potential drugs
effective
to modulate the activity or binding of the membrane surface protein may be
prepared. The
membrane surface protein may be introduced into a test system, and the
prospective drug may
also be introduced into the resulting cell culture, and the culture thereafter
examined to
observe any changes in the activity of or binding of the cells, due either to
the addition of the
prospective drug alone, or due to the effect of added quantities of the known
membrane
surface protein. Suitable assays may include sperm motility assays or in vitro
fertilization.
In addition, suitable animal models, particularly for fertility trials,
include mouse and
macaque.
The membrane surface proteins may also be used as vaccines, or in the case of
spern~
antigens, as contraceptives.
Once several unique, testis specific sperm surface immunogens are identified,
they
-40-
CA 02282859 1999-08-24
WO 98/36x71 PCTNS98/02913
may be moved smoothly and efficiently through the contraceptive development
pathway
using a system of triage. Candidate molecules should meet the strict criteria
of surface
localization, testis specificity, and activity in at least one functional
test. Proteins whose
cDNAs have been cloned and sequenced are tested for tissue specificity. If
testis specific,
they will be expressed as recombinant proteins and antibodies to the
recombinant protein
generated. These antibodies will be used to validate the surface localization
and biological
effects of the immunogenic epitopes in functional assays.
Proteins repeatedly shown by vectorial labeling methods to be exposed on the
human
sperm surface proteins include isoantigens defined by infertile sera,
autoantigens defined by
sera from vasectomized men, and antigens which induce sperm agglutination.
These proteins
are candidates for immunocontraception.
In order to avoid autoimmune complications it is particularly important that
the
molecules selected for immunocontraceptive development exhibit tissue
specificity. i.e., that
they be expressed only in the intended target tissue, the testis, and on
sperm. It is prudent to
address tissue specificity at the vaccinogen discovery phase rather than later
during
toxicological and teratological safety studies. This strategy minimizes
unnecessary
expenditure of time and resources on immunogens which are widely distributed
in tissues aid
thus are potentially capable of inducing immune pathologies. The potential
complications of
immunization with contraceptive vaccines include: 1 ) immediate
hypersensitivity and
anaphylactic responses; 2) delayed hypersensitivity responses; and 3)
autoimmune response
and autoimmune disease due to immune reaction with endogenous antigens of the
immunized
subjects. Many of these concerns may be obviated by selection of non-
crossreactive
immunogens specific to the testis and sperm. Immunohistochemical, Northern and
RT-PCR
studies of tissue specificity of proposed contraceptive immunogens provide
important
supporting evidence. The Northern blots and RT-PCR methods, although providing
evidence
for tissue specificity at the mRNA level, may not detect epitopes present in a
selected
vaccinogen that may be present in another unrelated molecule [due to
conformational folding
or other types of molecular mimicry]. Thus, immunohistochemical tests
complement the
molecular methods and may reveal cross reactive epitopes which cannot be
predicted solely
-41-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
on the basis of comparisons of primary amino acid sequence.
The combination of Northern blot, RT-PCR and immunohistochemical methods can
identify gamete-specific antigens that carry less risk of autoimmune disease.
This provides
information as to the step of spermatogenesis at which a given protein is
first expressed,
providing insight - a given testis specific- gene is active before or
following meiosis. Such
knowledge is germane to identifying post-meiotic genes for study of
transcriptional
regulation, a possible route to discovering a means to regulate
spermatogenesis, and to
developing a male contraceptive.
In order to proceed with immunogenicity and fertility trials of candidate
sperm
immunogens, their homologues can be cloned in mice and monkeys and the
recombinant
proteins expressed and purified.
Both monkey and mouse homologues may be cloned using testis libraries
previously
reparted in the literature. [Proc. Natl. Acad. Sci. USA 84: 5311-5315 {1984);
Mol. Repd.
Dev. 34: 140-148 (1993).]
Female B6AF 1 mice, 6-8 weeks of age, can be immunized with approximately 20
ug
of the homologous recombinant immunogen. The immunogen can be emulsified with
an
equal volume of complete Freund's adjuvant (CFA) for a final volume of 100 ul.
Animals in
the control group will receive PBS/CFA. Each animal can be injected in two
sites at the base
of the tail. Two to three booster immunizations in incomplete Freund's
adjuvant can be given
at two week intervals. Blood is collected by tail bleeds before immunization,
two weeks
post-immunization and 7-10 days after each boost. Sera is assayed for
antibodies by ELISA
using sperm extract and recombinant immunogen as targets. The sera can be
further tested
for reactivity to native protein by immunofluorescence and immunoblot analyses
of mouse
sperm and sperm extracts, respectively. Beginning one week after the final
boost with
recombinant immunogen, each female mouse is housed continuously with one male
mouse of
proven fertility. The females will be checked each morning for the presence of
a vaginal plug
indicating mating has occurred. On day 1 S after introduction of the males,
the females are
sacrificed and the embryos counted.
Macaques can be injected intramuscularly with 500 ug in squalene-arlacel A
followed
-42-
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/OZ913
by booster immunizations at three week intervals with 200 ug or control
squalene. Sera,
cervical mucus and oviductal fluid (collected via a surgically implanted
oviductal cannula can
be collected prior to immunization and at weekly intervals. Antibodies can be
assessed by
ELISA on both recombinant immunogen and native sperm extract targets. The sera
can be
further tested for reactivity to native protein by immunoblot and
immunofluorescence
analyses with monkey and human sperm and sperm extracts. The sera can then be
further
tested for their ability to exhibit sperm functional tests. Imrnunogens that
evoke high titers of
antibodies to the recombinant immunogen that also cross react with the sperm
surface and
block at least one functional test proceed to fertility trials.
For the fertility trial, macaques are immunized as above with recombinant
immunogen ( 1 S animals) or control squalene ( 15 animals). Sera is collected
prior to
immunization and at weekly intervals. Antibodies are assessed by ELISA,
Western and
immunofluorescence analyses. Following the last immunization, each female is
co-habitated
for five days with a male of proven fertility during the fertile period of her
cycle beginning
three days prior to expected ovulation. Matings begin during the third cycle
after the initial
immunization and continue for nine consecutive cycles or until she is
confirmed pregnant.
Pregnancies are terminated by the administration of the anti-progestational
agent,
sulprostone. Daily observations is made to detect abortions prior to six weeks
of pregnancy.
In the fertility trial, test of significance between fertility rates for the
vaccinated and
control animals can rely primarily on nonparametric randomization procedures.
Fisher's
exact test and tests based on binomial proportion can be employed. In
addition, the
significance of the difference between vaccinated and control groups in
numbers of fertile
and non-fertile animals can be determined by traditional Chi square analysis.
The time to
pregnancy can be analyzed using a variety of life table methods, including
nonparametric
comparisons of survival curves, the test of Mantel-Haenszel, various
probability models and
proportional hazards regression models. Similar procedures can be utilized to
examine the
association between antibody titers and the time to a fertility outcome.
Depending on the
outcome of the study, for example, it may prove instructive to compare the
antisperm
antibody levels of vaccinated fertile animals with vaccinated non-fertile
animals.
-43-
CA 02282859 1999-08-24
WO 98/36771 PCTlUS98/02913
Alternatively, the antisperm antibody levels of animals that became fertile at
different times
may be compared. For group responses which involve continuous outcomes, two-
sample
comparisons can be made using the nonparametric Wilcox rank sum test and the
usual two-
sample t-test. In some instances, regression models (including analysis of
variance and
covariance) can be examined along with weighting and transformation of data to
improve
model fit and to optimize statistical estimation and inference.
If immunization of either mice or monkeys causes a high degree of infertility,
the
result supports the continued investigation of the immunogen. If the efficacy
is high in
primates, it indicates that the human immunogen would be useful in a
formulation for human
immunogenicity testing (Phase I). If the effect on fertility is modest, it
would support
inclusion of the immunogen as one component of a mufti-determinant
contraceptive vaccine
formulation. If a given immunogen shows no effect, the result would indicate
that the
immunogen should either 1) be discounted for further study or 2) retested in
an alternative
delivery systems which might induce higher or more sustained titers of
antibodies in the
female reproductive tract.
If 75% infertility or better is achieved for a given immunogen in the
experimental
group, two possible options are: 1 ) to continue to mate the infertile animals
and begin a
reversibility/continuing infertility study or 2) to perform histopathology. If
the latter is
chosen, tissues can be obtained at the conclusion of the fertility-trial from
vaccinated females
and immersed in fixative. Standard formaldehyde fixation, paraffin embedding
and H&E
staining can be performed on the cerebellum, cerebrum (frontal and temporal
regions), brain
stem, cardiac muscle, dorsal aorta, skeletal muscle, pancreas, spleen, letter,
adrenal, stomach,
gall bladder, duodenum, jejunum, colon, kidney, bladder, ovary, uterus,
mammary gland,
umbilical cord, and parotid gland.
An effective contraceptive vaccine against sperm antigens requires an immune
response that elicits maximal antibody titers in the female reproductive
tract. Systemic
immunization with the sperm antigen SP-10 evokes IgG antibody responses in the
oviductal
fluids and intracervical immunization affords an effective alternative
immunization route. If
systemic immunization alone results in insufficient amounts of antisperm
antibodies in the
-44-
CA 02282859 1999-08-24
WO 98/36771 PCT/(JS98/02913
reproductive tract fluid during immunogenicity trials, immunization regimens
that include
intra-cervical immunization to selectively increase the amount of IgA and IgG
antibodies in
female macaque reproductive tract fluids can be tested.
Having generally described this invention, a further understanding can be
obtained by
reference to certain specific examples which are provided herein for purposes
of illustration
only and are not intended to be limiting unless otherwise specified.
EXAMPLES
Experimental procedures
Materials
Ammonium persulfate, BSA, citric acid, PMSF (phenylmethylsulfonyl fluoride
diethanolamine, glycerol, urea (Sigma Uitra), Trizma Base (Sigma Ultra),
Nonidet P40,
CHAPS, PDA (N,N'-diacryloylpiperazine), DTT, iodoacetamide, leupeptin and
pepstatin A
were obtained from Sigma. EDTA was purchased from J.T. Baker. Silver nitrate
was from
Mallinckrodt Chemicals. Sodium bicarbonate, sodium chloride and sodium
hydroxide (all
ACS grade) were from Fisher. SDS (sodium dodecylsulfate, Ultrapure), glycine
(electrophoresis grade) and sodium phosphate were obtained from ICN. Percoll,
Ampholines
pH 3.5-5, pH 5-7, pH 7-9 and pH 3.5-10, Pharmalyte pH 6.5-9, pH 5-8 and pH 8-
10.5 and a
carbamylated calibration kit for 2D electrophoresis were purchased from
Pharmacia Biotech.
Enhanced chemiluminescence (ECL) kits for Western blot analyses were obtained
from
Amersham Corp. {for detection of peroxidase conjugates) and from Tropix (for
detection of
alkaline phosphatase conjugates). Protogold for staining of blotted proteins
was purchased
from Goldmark. TLCK (N-p-tosyl-L-lysine chloromethyl ketone) and TEMED were
from
Boehringer Mannheim. Lectin conjugates were from Vector. Carrier free Na'z5I
was from
Amersham Corp. Intensifying screens NEF-490 and NEF-491 were purchased from Du
Pont.
HRP-conjugated avidin and 2-D SDS-PAGE standards were obtained from BIO-RAD.
NHS-
LC-Biotin, Iodo-Beads and AP-conjugated avidin were from Pierce. All secondary
antibodies used in Western blotting were obtained from Jackson ImmunoResearch
Lab.
-45-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Example 1
Preparation of Spermatozoa
Semen specimens were obtained from normal, healthy young men by masturbation.
Only ejaculates with normal semen parameters (28) were used in this study.
Individual
semen samples were allowed to liquify at room temperature (normally for 1/2 to
3 hours) and
the mature sperm were separated from seminal plasma, immature germ cells and
non-sperm
cells (mainly white blood cells and epithelial cells) by Percoll density
gradient centrifugation.
Liquified semen was carefully loaded over a two-layer Percoll density gradient
consisting of
80% (l.m bottom layer) and 55% (2ml top layer) isotonic Percoll solution
prepared in Ham's
F-10 medium. After centrifugation at 300 x g for 18 minutes at room
temperature, the sperm
pellet at the bottom of the 80% layer was collected and washed three times in
Ham's F-10
medium by centrifugation at 450 x g. The cells were counted prior to the last
centrifugation,
and the pellet was used for vectorial labeling. Light microscopic evaluation
was used to
confirm enrichment of motile mature spermatozoa, and all samples showed > 90%
motility.
Example 2
Seminal plasma analysis
Seminal plasma samples from two patients which had undergone vasectomy were
analysed by 2D gel electrophoresis. Following collection the samples were
allowed to
liquefy at room temperature, examined by microscopy to verify the absence of
spermatozoa
or immature germ cells, centrifuged at 10,000 x g for 5 minutes to remove non-
germ cells and
prostatic crystals, and stored in aliquots at -70°C until use.
Example 3
Radioiodination
Percoll purified spermatozoa were suspended in Ham's F-10 medium to a final
concentration of 20 x 10''/ ml. Washed Iodo-Beads (one bead per 8 x 10~
spermatozoa) and
carrier free Na'ZSI (10 uCi per lOG spermatozoa) were added to the sample.
Radiolabeling was
performed by incubating the sample for 10 minutes at 20°C on a rocking
table. The cells
-46-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
were removed from the Iodo-Beads by pipetting and immediately subjected to a
second
Percoll density gradient centrifugation, prior to washing three times in Ham's
F-10 medium.
The cells were counted prior to the final wash and the resulting pellet was
used for extraction
of sperm proteins (see below). Autoradiography was performed using a sandwich
of
components in order: intensifying screen, blot, two layers of film and
intensifying screen. X-
ray films were routinely exposed for 3 weeks.
xa 1 4
Biotinvlation
Percoll purified spermatozoa were suspended in Dulbecco's phosphate buffered
saline
containing 3 mg/ml of NHS-LC-Biotin (~SmM), to a final concentration of 50 x
10''
spermatozoa per ml. Biotinylation of the sperm surface was performed by
incubating the
sample for 10 minutes at 37°C on a rocking table. The spermatozoa were
then subjected to a
second Percoll density gradient centrifugation followed by three washes in
Ham's F-10
medium. The cells were counted prior to the final wash and the resulting
pellet was used for
solubilization or stored at -70°C.
After preliminary studies to optimize detection of biotinylated proteins, the
procedure
to detect biotinylated sperm proteins following electrotransfer to NC-
membranes was as
follows: 2D western blots were rinsed twice in PBS pH 7.4 and then excess
binding sites on
the nitrocellulose membrane were blocked by incubation in PBS containing 5%
gelatin and
0.1% Tween 20 for lh at 20°C (29). This was followed by a 5 minute wash
in PBS and
incubation with alkaline phosphatase conjugated avidin (50 ul in 250 ml PBS
containing
0.5% gelatin and 0.01% Tween 20) for lh at 20°C. Chemiluminescence
detection of alkaline
phosphatase with the substrate CSPD was performed according to the
manufacturer's
directions {TROPIX). Colorimetric detection of AP was performed with the
substrates BCIP
and NBT as previously described (17). Samples from 5 donors (including samples
from 2 of
the 4 donors examined by radioiodination) were examined by this vectorial
labeling
technique.
-47-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Ex m 5
Solubilization Procedures
Spermatozoa were routinely solubilized in a lysis buffer {A) containing: 2%
(v/v) NP-
40; 9.8 M urea; 100 mM DTT; 2% (v/v) ampholines pH 3.5-10; and the protease
inhibitors 2
mM PMSF, 5 mM iodoacetamide, 5 mM EDTA, 3 mghnl TLCK, 1.46 ,uM Pepstatin A and
2.1 ,uM Leupeptin. S x 10g cells per ml were solubilized by constant shaking
at 4°C for 60
minutes. Insoluble material was removed by centrifugation at 10,000 x g for 2
minutes, and
the supernatant was applied to the first-electrophoretic dimension. Frozen
seminal plasma
samples from vasectomized patients were thawed by addition of four volumes of
Ivsis buffer
A containing the above noted protease inhibitors.
Other experiments employed an anionic/zwitterionic lysis buffer {B) [as given
by
Hochstrasser (30)], consisting of 2% (w/v) SDS, 3% (w/v) CHAPS, 7.2 M urea,
100 mM
DTT, 4% ampholines pH 3.5-10 and protease inhibitors. Solubilization took
place at 22°C
for 45 min. with a sperm concentration of 3.5 x I OR cells per nil. Samples
were agitated every
five minutes by inversion of the microcentrifuge tubes, to minimize unfolding
of DNA,
because constant shaking or heating in presence of SDS and reducing agents
leads to
solubilization of the nuclear envelope and unfolding of the supercoiled DNA
(Naaby-Hansen
and Bjerrum, unpublished results). Protein concentrations were determined by
using the
Pierce biocinchoninic acid method according to the manufacturer's
specifications, employing
bovine serum albumin (BSA) as a standard.
Example 6
Electrophoresis
Isoelectric focusing (IEF) was performed in 15 x 0.15 cm acrylamide rods,
using
either the gel composition proposed by Hochstrasser et al (30) or by Cells et
al ( 1 G). Carrier
ampholine compositions were either 20% pH 5-7, 20% pH 7-9 and 60% pH 3.5-10 or
28%
pH 3.5-~, 20% pH 5-7, 7% pH 7-9 and 45% pH 3.5-10.65 ,ul of sperm extract
(approx.
0. l5mg of protein) or 35 ,ul of seminal plasma sample (approx. O.I Smg of
protein) were
applied per rod. The tubes were filled by gently overlaying the sample with a
buffer
-48-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
containing 5% NP-40, 1% ampholines pH 3.5-10, 8 M urea and 100 mM DTT.
Focusing was
conducted for a total of 19,300 volt-hours using voltage stepping: 2h at 200V,
Sh at SOOV, 4h
at 800V, 6h at 1200V and 3h at 2000V.
Nonequilibrium pH gradient electrophoresis (NEPHGE) was performed in 14 x 0.15
cm acrylamide rods using the gel composition described by Celis et al ( 16).
The carrier
ampholyte composition was 37% pH S-8, 13% pH 6.5-9, 37% pH 8-10.5 and 13% pH
3.5-10.
55 ul (approx. 0.13 mg of protein) of spermatozoa extract or 30 ul of seminal
plasma sample
(approx. 0.13 mg of protein) were applied per rod. These protein
concentrations gave similar
spot sizes on NEPHGE gels as achieved by slightly higher concentrations on IEF
gels using
Hochstrasser's protocol. Electrophoresis was conducted for a total of 9800
volt-hours, 400
volts for 11 hours and 600 volts for 9 hours.
Second dimensional SDS-PAGE was carried out in 0.15 cm thick, 16 x 16 cm or 16
x
20 cm slab gels using linear gradient gels (T= 7.5-15% or 9-1 S%) in a Protean
II xi Multi-
Cell apparatus (Bio-Rad). Silver staining was performed according to
Hvchstrasser et al (30).
Electrotransfer to nitrocellulose membranes was accomplished as previously
described (23).
Electrotransfer to PVDF membranes (0.2 um pore size, Pierce) was carried out
as described
by Herizel et al. (31 ) using the transfer buffer composition of Matsudaira
(32)( l OmM 3-
[cyclohexylamino)-1-propanesulfonic acid, 10% methanol, pH 11 ). Routinely,
six 2-D gels
were transferred simultaneously at a constant current of O.SA for 2 hours
using three transblot
cells (Bio-Rad) connected to the same power supply.
Example 7
Immnnoblotting Analysis
Following electrophoretic transfer of the 2-D separated polypeptides, the
immobilizing membranes were rinsed twice for 5 minutes in PBS pH 7.4 and
excess binding
sites were blocked by incubation for 30 minutes at room temperature in PBS pH
7.4
containing 5% dry milk and 0.05% Tween 20. 2-D blots were incubated with 100
ml of
primary antibody for 2 hours at 22 °C
or overnight at 4°C, under constant slow rocking. The following
antibodies were employed:
-49-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98l02913
antiactin (mouse mAb clone C4, Boehringer Mannheim, 0.3 ,ug/ml), anti-~i-
tubulin (mouse
mAb Tu 27BC, hybridoma supernatant, gift from Dr. Robert Bloodgood, University
if
Virginia, diluted 1:5), anti-a-tubulin (mouse mAb, clone DM-lA, Sigma, diluted
1:10,000),
anti-SP-10 (mouse mAb MHS-10, diluted 1:5,000), anti-fibrous sheath proteins
(mouse mAb
S69, gift from Dr. C.G.Lee, University of Vancouver, BC, diluted 1:1,000) and
anti-PH-20
(rabbit polyclonal Ab R-10, gift from Dr. Paul Primakoff, UC Davis, diluted
1:3,000).
Secondary enzyme conjugated antibodies (goat anti mouse Ig and goat anti
rabbit Ig) were
diluted 1:5000 in PBS plus 0.05% Tween 20, and the blots were incubated for
1.5 h at 20°C.
None of the secondary antibodies bound to blotted human sperm proteins.
Horseradish
peroxidase conjugates were visualized calorimetrically using DAB as a
substrate or by ECL
using the manufacturer's protocol (Amersham Corp.).
To detect phosphorylated tyrosine residues the mAb RC-20 (Transduction
Laboratories) was employed. The blots were blocked by incubation in 1% BSA in
IOmM
Tris, pH7.5, O.1M NaCI, 0.1% Tween 20, for 20 minutes at 7°C.
Horseradish peroxidase
conjugated mAb RC-20 was diluted 1:2500 in the above buffer, the blots were
incubated for
20 minutes at 37°C, and binding was detected by ECL.
In order to identify the exact location of an immunoreactive antigen in the
complex 2-
D protein pattern, in some experiments antibody incubations were preceded by
gold staining
with Protogold (Goldmark Biologicals). The manufacturer's protocol was
followed, with the
modification that blocking of the membrane was performed in 0.05% Tween 20 for
30
minutes. This concentration of Tween 20, instead of the recommended 0.3% Tween
20,
resulted in better spot resolution with less confluent staining patterns in
areas with high
density of polypeptides.
Example 8
Gel Scanning and Computer Analysis
Stained gels were scanned in a wet state with a high resolution Kodak camera,
and the
information was digitized on a SUN computer. X-ray films from autoradiographic
and
chemiluminescence experiments were scanned with either the Kodak camera or a
Howtek
-50-
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/02913
scanmaster 3+ Laser scanner. The resulting 2-D images were analysed with a
Bioimage
program "2D Analyzer". Sperm samples from 40 donors were analysed in over 500
2-D gels
in order to optimize the procedures. Following establishment of a reliable
protocol, sperm
samples from 8 donors were analysed repeatedly on 2-D gels, and the protein
patterns were
compared in order to reduce the likelihood of cataloging artifactual spots.
Spots that
appeared on two or more analyses from each donor were considered valid. Spot
matching in
different gel images was performed by the computer program after as many
reference spots as
possible (for silver stained gels the maximum 100 allowed by the software) had
been
manually matched by the operator. The isoelectric points and molecular weights
of unknown
spots were interpolated by the computer program on the basis of the position
of co-migrating
internal standards, and, in addition, the molecular weight results were
manually verified by
calculation from semilogarithmic plots. The internal standards (BIO-RAD) were:
hen egg
white conalbumin type I, MW 76,000, pI 6.0,6.3 and 6.6; bovine serum albumin,
MW
66,200, pI 5.4, S.S and 5.6; bovine muscle actin, MW 43,000 pI 5.0 and 5.1;
rabbit muscle
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), MW 36,000, pI 8.3 and 8.5;
bovine
carbonic anhydrase, MW 31,000, pI 5.9 and 6.0; soybean trypsin inhibitor, MW
21,500, pI
4.5; and equine myoglobin, MW 17,500, pI 7Ø Carbamylated creatine
phosphokinase (MW
40,000 and apparent pI range 4.9-7.1) and carbamylated GAPDH (MW 36,000 and
apparent
pI range 4.7-8.3) (Pharmacia) were applied as pI markers.
Results
Silver stained 2-D gels (20 x 16 cm) of nonionic detergent/urea solubilized
human
sperm proteins resolved 1397 different protein spots (963 by IEF/PAGE and 434
by
NEPHGE/PAGE) (Figure I A&B). 1345 of the 1397 proteins were identified in
samples
from at least two of the donors. 1191 proteins (838 by IEF/PAGE and 353 by
NEPHGE/PAGE) were resolved when the anionic/zwitterionic lysis buffer was
employed for
sperm solubilization (Figure 9 A&B). The protein pattern was highly
reproducible, although
minor variations between donors were observed. For example, Figure 2
illustrates
differences in the abundance of a 39.5 kDa protein among 3 donors.
-51-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
The 2-D pattern of human sperm proteins differs significantly from the 2-D
pattern of
human seminal plasma (HSP) proteins (Figure 1 ). More than 300 seminal plasma
proteins
were visualized by silver staining following 2-D electrophoretic separation
(Figure l, C&D).
Seminal plasma polypeptides which co-migrated with sperm proteins were
identified by
computer matching of silverstained gels containing sperm proteins, seminal
plasma proteins,
or a mixture of both, which insured a precise comparison. By this approach
nine proteins
with MW above 20 kDa were identified as sperm coating proteins derived from
the seminal
plasma (indicated by arrows in Figure 1 ). All nine were vectorially labeled
with either
radioiodine or biotin or both (see Figures 7,8 and 11). In general, the
identification of sperm
coating proteins from the seminal plasma with molecular masses below 20 kDa
was difficult
due to an abundance of seminal plasma degradation products, especially in the
basic pH-
range (Figure 1D), in accordance with the observations by Edwards et at. {33).
In one
experiment silver stained gels containing sperm harvested after 1 hour were
compared to gels
loaded with proteins from the same sample allowed to liquify for 3 hours. No
significant
difference in the protein pattern could be detected, indicating that no major
modifications of
the sperm surface proteins were induced by seminal plasma enzymes following
liquefaction
(data not shown).
Example 9
Radioiodination of human spermatozoa surface proteins
The kinetics of'ZSI incorporation into human sperm proteins were examined with
and
without IODO-BEADS catalysis. The optimal reaction time was 10 minutes, after
which the
rate of incorporation of radioiodine into the sperm pellet declined,
indicating that surface
accessible phenols were saturated (Figure 3). In the absence of the catalytic
N-
chlorobenzenesulfoamide coated beads, less than 1 % of the '25I was
incorporated into the
cells. Although radioiodine was incorporated at a higher rate with higher
concentrations of
beads, the use of more beads resulted in progressive membrane destruction,
radiolabeling of
internal protein standards, and decreased sperm motility. Therefore, we
further reduced the
number of the oxidating beads to one bead per 8 x l OG spermatozoa. This
reduced the amount
-52-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
of radioiodine incorporation to 50% compared to the former bead/cell ratio,
but preserved
postlabeling sperm motility.
To determine whether radioiodination occurred only on the sperm surface,
autoradiography was performed from nitrocellulose or PVDF blots which had been
immunostained with antibodies for cytoskeletal and intra-acrosomal proteins
(Figures 4, 5
and 6). To eliminate damaged or acrosome reacted cells from the analysis, the
sperm
population was separated by Percoll density gradient centrifugation
immediately following
radioiodination. Comparison of iodinated sperm with [Fig 4B] and without [Fig
4A] the
Percoll density centrifugation showed that, although extracts of sperm that
underwent the
second density gradient centrifugation had fewer labeled proteins, there was
higher resolution
of individual proteins, and no labeling of the intracellular control marker
proteins (the
acrosomal protein, SP-10, Figures 4 and 6; actin, Figures 4 and S; fibrous
sheath components,
Figure 9; and tubulin, Figure S). This strongly supports the surface
specificity of the
modified radioiodination procedure. When extracts of radioiodinated sperm in
presence and
absence of reducing agents were compared, several surface proteins
participating in high
molecular weight complexes, stabilized by interchain disulfide bridges, were
identified
(Figure 5).
Samples of spermatozoa from 4 donors were analysed after radioiodination, post-
labeling Percoll density gradient separation, and extraction with NP-40 and
urea. The pattern
of radioiodinated proteins was highly reproducible from donor to donor as may
be
appreciated by comparing two of the donors, Figures 7A+B to 7C+D. Computer
image
analysis of gels from the four donors showed consistent radioiodination of 181
spernz surface
proteins ( 103 IEF/PAGE and 78 NEPHGE/PAGE ) with Mr between 5 and 150 Kd and
pI
ranging from pH 4 to 11. Minor interdonor variations were noted in the charge
as well as in
the relative concentration of some of the labeled proteins, as estimated by
optical density;
e.g., the 90-95 Kd protein complexes indicated by arrows in Figure 7. The high
level of
reproducibility from experiment to experiment may be further appreciated by
comparing
iodinated proteins in Figures 4 and 7.
-53-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Example 10
Biotinylation of human sperm surface proteins
The 2-D patterns of biotinylated proteins from samples of spermatozoa
incubated with
the sulfonated NHS-LC-biotin for 10, 20, 30 and 45 minutes were compared using
the ECL
detection method (data not shown). No difference was observed between the
number of
proteins labeled after a 10 or 20 minute exposure to biotin. However longer
incubation times
(30-45 minutes) resulted in progressive labeling of cytoskeletal and
intraacrosomal proteins;
thus, a 10 minute biotinylation period was used in subsequent studies. Because
addition of
1 % bovine serum albumin to the first washing buffer to react with residual
biotin (as
recommended in many biotinylation protocols), resulted in adherence of
significant amounts
of biotinylated BSA to the spermatozoa) surface, sperm samples were instead
submitted to
Percoll density gradient centrifugation following labeling.
Figures 8A & B display chemiluminescent films of two-dimensional gels
containing
biotinylated spermatozoa) proteins solubilized by the nonionic lysis buffer A.
Biotinylated
sperm samples from 5 donors were separated by IEF and NEPHGE, and the images
were
compared by computer analysis. Two hundred twenty eight biotinylated protein
spots with
Mr between 5 and 120 Kd and pH ranging from pH 4 to pH 10 were resolved and
catalogued.
Interestingly, when unbiotinylated sperm proteins were incubated with AP-
avidin
alone as a control (Figures 8C and 8D), a cluster of five spermatozoa)
proteins with Mr of 76
kDa and pI between 6 and 6.5 bound labeled avidin. The nature of these
endogenous avidin-
binding proteins is presently being investigated. No endogenous alkaline
phosphatase
activity was detected in these or other proteins when control blots were
developed without
prior exposure to AP- avidin (data not shown).
When the anioniclzwitterionic lysis buffer B was employed to extract sperm
protein
(Figures 9A & B) 208 biotinylated proteins could be resolved (Figures 9C & D).
Several
protein constellations in the biotin pattern could be recognized from the
pattern achieved
following extraction with non-ionic detergent (compare Figures 9C and 9D to
Figures 8A and
8B).
To validate the specificity of the biotinylation and extraction methods for
the sperm
-54-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
surface, control cytoplasmic proteins were immunolocali2ed and their
biotinylation status
was determined by comparison to the ECL-film. None of the internal controls
actin, tubutin,
fibrous sheath components or SP-10 were biotinylated (Figure 9).
In contrast to results with known cytoplasmic proteins, the immunoblots in
Figures
9G and H show the position of the sperm surface hyalurorlidase PH-20 after
SDS/CHAPS
extraction and immunobIotting with the polyclonal rabbit antiserum R-10. Two
molecular
weight forms of PH-20 at 64 and 53 kDa were extracted by SDS/CHAPS (arrows in
Figures
9G and H). The 53 kDa antigen could be resolved into 3 isoforms following
solubilization
with NP-40/Urea (Figure 8E) and into 5 isoforms following solubilization with
SDS1CHAPS/urea (Figure 9G). The exact position of the PH-20 antigens in the
silver stained
and biotinylated 2-D patterns is shown in Figures 9A and 9C. Biotinylation of
PH-20, a
known surface protein (34) serves as a positive control for surface
specificity of the labeling
procedure.
Exam) la a 11
Demonstration of surface proteins phosphorylated on tyrosine residues
The anti-phosphotyrosine Mab, RC-20 bound phosphoproteins from fresh
ejaculated
sperm (Figure 10). The proteins which were most heavily phosphorylated in
tyrosine
residues had molecular masses of 89-95 Kda (arrows in Figure l0A). Computer
analysis
revealed five groups of surface proteins phosphorylated in tyrosine residues.
The 22 protein
isoforms of these groups are indicated by a star in Table III.
Exams l2
Computer analysis of 2D results
Figure 11 presents a computer generated image of the human spermatozoa)
proteins
visualized by silver staining following solubilization with NP-40 and UREA.
Ninety four of
the ninety eight proteins which were labeled by both surface iodination and
surface
biotinylation and could be matched to silver stained proteins are encircled in
Figure 11. The
Mr, Pi and relative abundance (based on gaussian quantification) are recorded
in Table III for
-5 S-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
the dual labeled surface proteins. Blots of labeled proteins were exposed for
various lengths
of time to ensure optimal detection of both weak and strong signals. To
eliminate the
possibility that variations in migration between labeled and unlabeled
proteins affected the
analyses, autoradiograms and biotin ECL films were matched to the
corresponding silver
stained gels or gold stained blots. These composite images were then matched
to composite
images of silver stained gels of unlabeled proteins.
The present invention advances understanding of the composition of membrane
proteins, particularly of human sperm by establishing a comprehensive 2-D gel
database
including 1397 proteins which were solubilized by NP-40/IJREA and 1191
proteins which
were resolved following SDS/CHAPS/UREA treatment. To generate this database,
techniques were developed to achieve high resolution and to permit detection
of a range of
acidic. neutral and basic sperm proteins using both IEF and NEPHGE for first-
dimensional
electrophoretic separation. A recent report described the resolution of 680
human sperm
proteins in one 2-D gel (26), while the present invention utilized conditions
by which more
than 1000 protein spots were resolved in one gel. The improved resolution was
achieved by
modif cation of the sperm purification and solubilization procedures,
adjustment of the
ampholine composition, and optimization of the run times and voltage stepping
for both IEF
and NEPHGE [see methods]. In particular, the increased voltage during NEPHGE
had a
profound effect on the resolution of SDS/CHAPS solubilized proteins, causing
less horizontal
streaking than when shorter focusing times and less voltage were used.
Comparison of the repertoire of sperm proteins solubilized by the two lysis
buffers
employed in the present method showed important differences. For example, the
anionicizwitterionic/urea lysis buffer was required to achieve solubilization
of several
cytoskeletal components. Further, this extraction method led to the resolution
of five 53 kDa
isofotms of the sperm surface hyaluronidase PH-20, whereas only three 53 k-Da
PH20
isoforms were resolved using a nonioniciurea lysis buffer. Nevertheless, the
non-ionic/urea
solubilization method was the method of choice for this study because it
readily solubiiized
the plasma membrane with minimal contamination from cytoskeletal structures
and because
it resulted in the most reliable pI determination (e.g.,compare the migration
of (3-tubulin in
-56-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Figure 5 and 9).
Forty-four silver stained gels representing different sperm samples from 8
donors
were analyzed by the "2-D Analyzer" software. Minor inter-individual
variations in the
abundance and/or the electrophoretic migration of some proteins were observed.
Variations
in gene expression, genetic heterogeneity, and variations in post-
translational modifications
could account for these differences. An example of the latter is
phosphorylation in tyrosine
residues of the heterogeneous group of surface proteins with MW between 89-95
kDa. A
similar size tyrosine-phosphorylated protein has recently been shown to
possess protein
kinase activity (35) which was stimulated by human ZP-3, suggesting that this
protein might
be involved in zona pellucida binding and initiation of the acrosome reaction.
Although
variations in phosphorylation and glycosylation may account for the some of
the inter-
individual variations in electrophoretic migration observed, further studies,
such as analysis
of surface changes during capacitation, carbohydrate sidechain analysis,
protein
microsequencing and cDNA cloning, are needed before definite conclusions about
the nature
and functional importance of the variations can be drawn.
"Sperm coating" proteins derived from secretions of the epididymis, prostate
or
seminal vesicles are known to adhere to the surface of ejaculated spermatozoa
(36,37). The
migration of several seminal plasma proteins was similar to that of
spennatozoal proteins in
2-D gels, and 9 sperm surface proteins were identified that appeared to be of
seminal plasma
origin. Additional analyses are also contemplated by the present invention,
including
analysis of unliquified seminal plasma proteins (33,38), different washing and
harvesting
procedures, analysis of epididymal fluid and sperm, and microsequencing of the
electrophoretically separated proteins, to confirm the origin of these surface
proteins.
Some of the protein spots in the 2-D patterns were identified through
immunoblotting
or comigration analysis (e.g.,albumin and carbonic anhydrase). The preparation
of
immunological reagents to sperm proteins allows the identification of many of
the protein in
the sperm surface protein encyclopedia by immunoblotting. Tentative identif
cation of some
sperm proteins has also been made by comparison of the sperm database with
other 2-D gel
protein databases (16,39). Moreover, selected surface proteins may be
microsequenced
-5 7-
CA 02282859 1999-08-24
WO 98/36771 PCT/fJS98/02913
following purification by 2-D gel electrophoresis, Edman degradation and
tandem mass-
spectrometry. Previously unknown protein sequences have been successfully
obtained by
this approach (Naaby-Hansen et al., in preparation). Thus, updating of the
sperm protein
encyclopedia on a continuing basis can be used to monitor progress in
understanding the
molecular identity of sperm proteins and to serve as guide to the proteins
that remain to be
characterized. The database of membrane proteins is also useful in the study
of clinical,
genetic and toxicologic disorders affecting the male gamete and/or
gametogenesis.
181 radio-iodinated sperm protein spots were resolved following NP-40/UREA
solubilization, and 228 proteins were labeled by surface biotinylation. 98
proteins were
labeled by both techniques. One explanation for the differing results between
radioiodination
and biotinylation is that different amino acid residues were targeted by the
labeling agents. In
radioiodination, labeling occurs by electrophilic addition of cationic 125-
iodine to tyrosine
residues and to a lesser extent to the other phenols, histidine and trytophan
(40), while NHS-
LC-biotin reacts with primary amine groups (e.g., lysine residues or free
amino-groups on
carbohydrates or lipids) (41 ). Further, stearic hindrance by carbohydrate
sidechains may
interfere with biotinylation or its subsequent detection by avidin binding. If
it is assumed that
only 60% of the proteins in sperm are detected by silver staining as
previously shown for a
somatic cell line (42), an estimate of approximately 2300 sperm proteins is
deduced. The
deduced number approximates the number of [35S] methionine labeled proteins
(>3000) found
in somatic cells (16,39) by similar separation techniques. Thus the 311
surface proteins
labeled by one or the other method represent approximately 12% of the total
sperm proteins.
The 98 proteins labeled by both iodination and biotinylation comprise a subset
of proteins
which are considered prime candidates for microsequencing.
Principal concerns in procedures for labeling cell surface proteins with radio-
iodine or
biotin include: 1) establishing surface specificity (e.g., little or no
labeling of cytoplasmic
components); and 2) achieving sufficient specific labeling in surface
accessible residues
(43,44). Surface specific labeling has been previously reported with iodine
using N-
chlorobenzenesulfonamide as the oxidizing reagent on polystyrene beads [IODO-
BEADS)
(45) and with sulfonated N-hydroxysuccinimide ester forms of biotin
(41,46,47). In the
-58-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
present method the known intracellular proteins actin, tubulin, fibrous
sheathin, and the intra-
acrosomal protein, SP-10, all lacked labeling by both methods, but it was
important to
remove damaged and acrosome reacted cells with Percoll density gradient
centrifugation
following the labeling procedures to ensure the surface specificity of the
analysis.
EXAMPLE 13
A sperm protein with an apparent mass of G3 kDa and an isoelectric point of
4.3 was
separated from other sperm proteins using lysis buffer A [NP-40/Urea] and
preparative 2-
dimensional gel electrophoresis using 23 x 23 cm gels. The protein was
transferred to PVDF
membrane and the membrane was stained with Coomassie blue and the protein spot
of
interest was cut for Edman rnicrosequencing. For mass spectrometry, the 60kDa
protein spot
was cored directly out of the preparative acrylamide gel using a fine scaple
and the protein
was digested as below. Two methods of microsequencing were utilized, Edman
degradation
and Tandem Mass Spectrometry.
Edman degradation
The protein spot on PVDF membrane was sequenced in an Applied Biosystems 470A
protein sequencer operated according to the manufacturers specifications,
using a cartridge
and cycles for PVDF membranes.
Mass-spectrometry analysis
The spot was cut from the gel as closely as possible, minimizing extra
polyacrylamide
and divided into a number of smaller pieces. The pieces were washed and
destained in 500 pl
50% methanol overnight. The gel pieces were dehydrated in acetonitrile,
rehydrated in 50 pl of
mM dithiolthreitol in 0.1 M ammonium bicarbonate and reduced at 55°C
for 1 h. The DTT
solution was removed and the sample alkylated in 50 ul 50 mM iodoacetamide/0.1
M ammonium
bicarbonate at room temperature for 1 h in the dark. The reagent was removed
and the gel pieces
washed with 100 pl 0.1 M ammonium bicarbonate and dehydrated in 100 p.l
acetonitrile for 5
min. The acetonitrile was remove and the gel pieces rehydrated in 100 pl 0.1 M
ammonium
bicarbonate. The pieces were dehydrated in 100 p.l acetonitrile, the
acetonitrile removed and the
-5 9-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
pieces completely dried by vacuum centrifugation. The gel pieces were
rehydrated in 12.5 ng/pl
trypsin [blocked for autodigestion] in SO mM ammonium bicarbonate and
incubated on ice for
45 min. Any excess trypsin solution was removed and 20 pl 50 mM ammonium
bicarbonate
added. The sample was digested overnight at 37 °C and the peptides
formed extracted from the
polyacrylamide in two 200 p.l 50% acetonitrile/5% formic acid. These extracts
were combined
and evaporated to <20 ~1 for LC-MS analysis.
The LC-MS system constisted of Finningan-MAT TSQ7000 system with an
electrospray
ion source interfaced to a 10 cm x 75 um id POROS 10 RC reversed phase
cappilary column.
One ql volumes of the extract were injected and the peptides eluted from the
column by an
acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.6 uL/min. The
electrospray ion source
was operated at 4.5 kV with a 1.2 ~Lhnin coaxial sheath liquid flow of 70%
methanol/30%
water/0.125% acetic acid and a coaxial nitrogen flow adjusted as needed for
optimum sensitivity.
The digest was analyzed by capillary LC-electrospray mass spectrometry to
measure the
molecular weight of the peptides present in the digest. Peptide sequences for
the peptides
detected were determined by collisionally activated dissociation using LC-
electrospray-tandem
mass spectrometry with argon as the collision gas.
RESULTS
Edman degradation
15 N-terminal amino acids were determined by Edman degradation. The obtained
sequence EPAVYFKEQFLDGDG (SEQ ID No: 3)revealed 100% identity to human
calreticulin (GenPep. accession # M84739).
Mass-spectrometry
The molecular weights determined by LC-MS analysis and amino acid sequences
determined by LC-tandem MS of peptides in this digest are shown in Table 1.
Nine peptides
were observed and sequence information was obtained for six of the peptides.
Database
searches using CAD spectrum information (MSTag) and partial peptide sequences
(BLAST)
identified five of these peptides in the sequence of human calreticulin (Table
2).
-60-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
r
ca
N
cC
d~
N
.b
i
vi
w
U
M
et' _
bn
~1.
M U
J
cn
v~ c~
cd
L
w U
O
Cd
O N
N
N
L
C~- w v f~
)
H
w
~
~' w x ~ u"
c ., a
> z w
n o
o b ~, ~ ~ ~ > ~
> x ~- w
> > ~ a ~, Q
U
>,
art
.o Ll
A
-d d + 3
U x o
O
x
w
A
o b~ ~, ~ ; w a ~ ~ ~ ~b
~. C7 ~.~. b
~
a d ~ ~ ~ ~
~ O ~ ~ o
~ C
~
. y
L1,~ ~ ..r~~ U'~ ~ W~ ~ ~ ~c~t
i
'~ ~
U
3
n
r.w U
~ ~-.
~
,~
x x
v 4+ 3
~
. . y n ~rc~ O o Wit;~o00 "..a
~ o ~ o
x
N ~ N ~ O ~ O v -
~
N 1 00
b V'1 O ..-~..., N -~ r
fi
M c V 00 ~
00 .-~ .~.-, - --.
r . ~ .-.
0~ c~
_ O O
3
N , ~ N M cY ~ ~D l~- 00O~ .
N
O
.~ ~ z '
x
-61-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Design of Degenerate Oligonucleotides.
Two peptide sequences were chosen as templates for the design of degenerate
oligonucleotides: Peptide Sequence #1- EPAVYFKEQFLD (SEQ ID NO: 15) and
Peptide
Sequence #2- KVHVIFNYK (SEQ ID NO: 11 ). See Figure 12.
Figure 12 shows amino acid microsequence data obtained by Edman degradation
and
tandem mass spectrometry from a sperm protein of 63 Kda, pI 4.3 chosen for
design of
complimentary and reverse-complimentary oligonucleotides. From this
microsequence
information pools of degenerate oligonucleotide primers were synthesized to
initiate PRC
[see Fig. 13].
Protein seauence #I and its Sense-Oligonucleotide is shown below (SEQ ID NOS:
16-18).
N-Terminus- E P A V Y F
5'-GA(A/G)-CC(T/C/A/G)-GC(T/C/A/G)-GT(T/C/A/G)-TA(T/C)-TT(T/C)-
Optimized Oligo 5'-GC(T/C)- GT(C/G)- TAC- TTC-
K E Q F L -C-Terminus
AA(A/G)-GA(A/G)-CA(A/G)-TT(T/C)-CT(T/C/A/G)
AAG- GAG- CAG- TTC- CT-3'
Protein sequence #2 and its Sense-Oligonucleotide is shown below (SEQ ID NOS:
12, 19, 20).
N-Terminus- K V H V I F
5'-AA(A/G)-GT(T/C/A/G)-CA(T/C)-GT(T/C/A/G)-AT(T/C)-TT(T/C)-
Optimized Oligo 5'-AG- -GTG-CA(T/C)-GTG- ATC- TTC-
N Y K
AA(T/C)-TA(T/C)-AA(A/G)-3'
AAC- TAC- AAG-3'
-62-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Due the degeneracy of the genetic code, optimum codon usage (Lathe, 1985) was
employed
to design "optimized oligonucleatides". Additional parameters that went into
the design were
that: A) areas of protein sequence with the least degeneracy were utilized to
decrease the
complexity of the oligonucleotide design; B) degenerate oligonucleotides were
manufactured
in order to cover all reasonable sequence permutations and C) oligonucleotides
were
maufactured in lengths of 20-30 nucleotides (Ausubel et al., 1996) depending
on the G-C
content of the proposed oligonucleotide, the number of reliable amino acid
residues that were
sequenced and the temperature of melting that is inherent to that particular
oligonucleotide
pool. Protein sequence #1 (EPAVYFKEQFLDGD)(SEQ ID NO: 21) gave rise to the
possible
oligonucleotide sequence 5'-GA(A/G)-CC(T/C/A/G)-GC(T/C/A/G)-GT(T/C/A/G)-
TA(T/C)-
TT(T/C)-AA(A/G)-GA(A/G)-CA(A/G)-TT(T/C)-CT(T/C/A/G) or (SEQ ID NO: 17)
TT(A/G)-GA(T/C)-GG(T/C/A/G)-GA(T/C)-3' (SEQ ID NO: 22). Applying optimized
codon
usage and the other parameters described above a final oligonucleotide
sequence was derived
as follows: 5'-GC(T/C)-GC(C/G)-TAC-TTC-AAG-GAG-CAG-TTC-CT-3' {SEQ ID NO:
23). Likewise, Protein sequence #2 (KVHV(I/L)FNYK)(SEQ ID NO: 7) when
optimized and
the reverse compliment taken, gave rise to the oligonucleotide sequence S'-CTT-
GTA-GTT-
GAA-GAT-CAC-(A/G)TG-CAC-CT-3' (SEQ ID NO: 24). Manufacture of oligonucleotide
probes was performed by the Unversity of Virginia Core Group Facilities.
RT PCR-Cloning Using Pools of Degenerate Oligonucleotides
PCR cloning was performed by first reverse transcribing 0.05 ~cg poly-(A)+ RNA
in a 20 /.cl
reaction by combining 0.5 ,ug oligo-d(T),2_,R RNA and diethylpyrocarbonate
(DEPC)-treated
H20 prior to heating to 65°C for 10 min. Subsequently, 2 /cl 10X RT
buffer, 0.5 ~cl placental
ribonuclease inhibitor (36 U/~l;Promega), 1 ,ul 10 mM 4dNTPs and 1 ~1 AMV
reverse
transcriptase (23 U/~l;Stratagene) were added, vortexed and the mixture was
incubated for 60
min at 42°C. After the addition of 80 ~cl DEPC-treated H20, 1 ,ul
aliquots of the cDNA
solution were amplified for 40 cycles (94°C for 45 sec,
38/44/50/56°C for 45 sec, 72°C for 2
min) as specified by the Taq polymerase manufacturer (Promega or Perkin
Elmer).
Separation and isolation of the PCR products was achieved by electrophoresis
of reaction
aliquots in 2.4% agarose gels made 1 X in TAE (40 mM Tris-acetate, 1 mM EDTA)
buffer
-63-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
and collection of specific fragments. After precipitation and quantitation PCR
fragments were
ligated into pCR-Script vectors according to manufacturers instructions
(Stratagene) and
sequenced.
The degenerate optimized oligonucleotides were employed in PCR reactions with
testicular cDNA manufactured by reverse transcription of human testicular poly-
(A)+ RNA.
The PCR reactions were analyzed on agarose gels [Figure 13] to demonstrate a
single
prominent PCR product migrating at approximately 400 bps from the reactions
with the 38,
44 and 50°C annealing temperatures (Fig. 13, lanes 5, 8, 11 ) versus
the negative controls
performed at the same temperatures (Fig. 13, lanes 3, 4, G, 7, 9, 10, 12, 13).
Electroelution of
the 400 by band, cloning into the pCR-Script vector, sequencing and computer
analysis
revealed that the sequence of the band, was identical to somatic calreticulin
cDNA (GenBank
accession #m84739) and therefore the 2-D gel spot from which the
oligonucleotides primers
were derived, was a testicular form of calreticulin (Figure 14).
Figure 14 shows the DNA sequence (SEQ ID NO: 25) obtained from clone derived
by
RT-PCR utilizing optimized, degenerate primers. Numbers indicate base pair
position in
sequenced clone and in the Calreticulin gene; (c) designates the RT-PCR clone
(SEQ ID NO:
25) while (H) designates the human Calreticulin cDNA from GenBank (SEQ ID NO:
2G).
TTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTCTCAGTTCCGG 80c
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIilllllllllll
TTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTCTCAGTTCCGG269H
CAAGTTCTACGGTGACAGAGNAAAANATAAAGGTTTGCAGACAAGCCAGGATGCACGCTT 140c
IIIIIIIillllllll I III IIIIIIIIIII~IIIIIillllllllllllllll
CAAGTTCTACGGTGACGAGGAGAAAGATAAAGGTTTGCAGACAAGCCAGGATGCACGCTT329H
TTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAAACGCTGGTGGTGCA 200c
IIIIIIIIIIIIIIIIIIIIIIIiilllllllillllllllllll Illlllllllllll
TTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCA389H
GTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCC260c
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIilllllllllllllllllllll
GTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCC449H
TAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCC320c
111111111111111111111111111111111111111111111111 l l l l l l l l i l l l
-64-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98J02913
TAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCC509H
CGACATCTGTGGCCCTGGCACCAAAAAGGTGCATGTGATCTTCAACTACAAG372c
IIIIIIIIIIIIIIIIIIIIIIII IIlII IIIII IIIIIIIIIIIIIII
CGACATCTGTGGCCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAG561H
This example demonstrates successful isolation of human testicular cDNA
employing the
amino acid sequence data obtained by microsequencing a 2-D gel protein spot.
EXAMPLE 14
A sperm protein, I-23, from the sperm surface encyclopedia {index} [Table III]
with an
apparent mass of 54 kDa and an isoelectric point of 5.3 was separated from
other sperm
proteins using lysis buffer A j NP-40/Clrea] and preparative 2-dimensional gel
electrophoresis
using 23 x 23 cm gels. This protein was selected as one example of a dually
vectorially
labelled cell surface molecule. For mass spectrometry, the I-23 protein spot
was cored
directly out of the preparative acrylamide gel using a fine staple and the
protein was digested
in the acrylamide gel and processed for tandem mass spectrometry as described
above in
Example 13.
Figure 1 S shows protein microsequences derived by tandem masss spectrometry
from
sperm surface protein I-23.
Figure 1 S shows microsequences obtained from Protein I-23 in the Sperm
Surface
Index. A) Sequences are a compilation of both CAD analysis and CAD analysis of
N-
terminal derivative. X designates I or L which cannot be distinguished by low
energy CAD. (-
designates an unknown amino acid which will require further analysis. (Y/Z)
designates two
possible alternative amino acids for that position which will require further
analysis. Lower
case letters designate preliminary assignments of sequence. B) Design of
complimentary and
reverse-complimentary oligonucleotides.
A) Peptide Seauences- (SEQ ID NOS: 27-35)
Peptide #1- SPXXSXK Peptide #7- VTNSTGGSpxk
-65-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
Peptide #2- XQANNA--K Peptide #8- uninterpretable
_ Peptide #3- VATEFAFR Peptide #9- --PEVD--tR
Peptide #4- --XSXNXR Peptide #10-uninterpretable
Peptide #S- --SMXXDTK Peptide #11- --QAENA---K
Peptide #6- MET(x/n)(e/q)XDR
B) Protein sequence #3: Sense-Oligonucleotide is shown (SEQ ID NOS: 29, 36,
37).
N-Terminus-V A T E F
S'-GT(C/T/A/G)-GC(C/T/A/G)-AC(C/T/A/G)-GA(A/G)-TT(T/C)-
Optimized Oligo S'-GTG- G(C/T)C- AC(A/C)- GAG- TT(T/C)-
A F R- C-Terminus
GC(CTAG)-TT(TC)-CG(CTAG)[AG(A/G)]-3'
G(CT)C- TTC- (C/A)G-3'
Protein sequence #7: Sense-Oligonucleotide is shown (SEQ ID NOS: 38-40).
N-Terminus-V T N S T
S'-GT(CTAG)-AC(CTAG)-AA(TC)-AG(TC)-AC(CTAG)-
TC(C/T/A/G)
Optimized Oligo S'-GT(G/C)- ACC- AAC- (A/T)(G/C)C-ACC
G G- C-Tern~inus
GG(C/T/A/G)-GG(C/T/A/G)-3'
GGC- GCC-3'
RT-PCR was performed as described above in example 13 and the products
analysed
on agarose gels as shown in example 13. The major PCR product was
approximately 1000
-66-
CA 02282859 1999-08-24
WO 98/36771 PCT/ITS98/029I3
bp. This was cloned into the pCR-Script vector and sequenced. The sequence of
this novel
sperm surface protein is shown in figure 16.
Figure 16 shows 1011 by DNA sequence (SEQ ID NO: 41 ) obtained from clone
derived by RT-PCR utilizing optimized, degenerate primers for sperm surface
protein I-23.
1 TCNNCGNNGG GGGGNNANGC GCGGNANANN GGCTANNNAG GCGGNGANNC
51 NGAGCAGNNC ATTCGCGGGN GAGGCNNTNN TANAAAANAC NNNTGNANCC
101 NNAATANGCC AAACGCCANA GGAGGGGNNG NAAANCGGCN NAANNCNCCN
151 NAAAAAANAN NTNCNAANCN CGGNTGGGGA GAAAATNCCC ATTACAGGNC
201 NTCTNCCCAN NCAGTTTTTT CCAATTACAA GGNGGGGGGN NGGGNTTTTC
25 I NAAAAANGCG CGTTCCCNTT CNGGGGNTNA AAAAAAANAG GGNNGCCTTT
301 TCCAAGACTN NGCGGGCCCC TTTGGNCTGC ACNANCACGC GGGTCAAAGG
351 CTNNACCGNA AGGGGGAACC CTAANAGTTT TTCAAGGCCC CAGGGGGNNC
401 GGCCCNGGCT TCAAAAAAGN CTTGCCAGNA ATGNAGATTC NAACATNNAG
451 AGGAAGNCCA NCCAGGNCCN TCGGGTAAGA TTAAAAGGGA GGTTTTTTTT
501 CCAAGTTCCN ACGGCCGGCA AGAAAAGGCT NAGGGGCNCN TGAGNNCCCC
551 CTGGGAGGGG NCCGAAGCCG GCNNGAGGTC ATCCCGGAAA TGGGGGTNGN
GO1 AGAGCNGGNA ACAGCAGTGG GNTGAGGCAG GNAGGCAGGG GCCAGCANCA
651 ACAGCAGGAC AGACTTGANG GCCTCGGGCG NGACAGGGAA GAGGCCCAGC
701 ATGGAGGCGA AGCTGAGGAA GGCCACGGNA CAGTAGAGGA GCCCGTCTGA
751 GAAGATGANN NAGGCCACGT GCCTNACCAT GGNGCAGTCC GANAACGGCT
801 TCAAAGTNGC CCCGCGGNAN GTNACAGTAN AATTTGANAT AGGCACCGGC
851 CACGACCAGG AAACAGAAGG AGNTNATNAT NACCAGGGCC ACGGTGAAGC
901 CCAGGGATGN NGGCTGACCC TNAGGTGGGG CGTAGGGCAN GNAGAATNGG
951 GNGNCNCAGT ATTCTCCNAT CTGAGTCCAG GGTATGTGTC NGCCTCCATA
1001 TCCTCCCNGT T
This example demonstrates the process of identifying and isolating cDNAs of
novel
cell surf ce vaccinogens beginning with dually labelled cell surface proteins
on 2-D gels
followed by microsequencing, optimized oligonucleotide design and RT-PCR. This
combined process thus creates a rational procedure for vaccine design to
surface antigens on
any biological target and with respect to sperm, paves the way for
contraceptive vaccine
design to relevant surface antigens that may evoke immobilizing or
agglutinating antibodies.
The following is a list of documents related to the above disclosure and
particularly to
the experimental procedures and
-67-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
discussions. The documents should be considered as incorporated by reference
in their
_ entirety.
References
1 Clermont,Y. (1963) Amer. J. Anat., 112,35-45
2 Clermont,Y. (1955) Amer. J. Anat., 96,229-253
3 Myles,D.G. and Primakoff,P. (1985) pp. 239-250 in "Hybridoma technology in
the
biosciences", Ed. Springer,T.A., Plenum Press, New York.
4 Friend,D.S. (1982) J.Cell.Biol., 93,243-249
S Myles,D.G.,PrimakoffP., and Bellve,A.R. ( 1981 ) Cell, 23,433-439
6 Myles,D.G.,and PrimakoffP.(1984) J.Cell Biol.,99,1634- 1641
7 Bearer,E.,and Friend,D.S.(1990) J.Electron Microsc.Technol., 16,281-297
8 Yanagimachi,R. (1994) pp. 189-317 in "The Physiology of Reproduction",
Eds.Knobil,E. and Neill,J.D., Raven Press, New York.
9 Herr,J.C., Flickinger,C.J., Homyk,M., Klotz,K., and John,E. (1990) Biol.
Reprod. 42,
181-193
Alexander,N.J., Griffin,D., Spieler,J.M., and Waiter,G.M.H. (1990) Gamete
Interaction: Prospects for Immunocontraception. Wiley-Liss, Inc.
11 O'Farrell,P. (1975) J.Biol.Chem. 250, 4007-4021
12 O'Farrell,P.Z., Goodman,H.M., and O'Farrell,P.H. (1977) Cell. 12, 1133-1142
13 Garrels,J.I. (1989) J.Biol.Chem. 264, 5269-5282
14 Garrels,J.L, and Franza,B.R. (1989) J.Biol.Chem, 264, 5283-5298
Garrels,J.L, and Franza,B.R. (i989) J,Biol.Chem. 264, 5299-5312
16 Celis,J.E., et al. (1992) Electrophoresis. 13,893-959
17 Wirth,P.J., Doninger,J., Thorgeirsson,S.S., and Di Paolo,J.A. (1986) Cancer
Res. 46,
390-399
18 Ochs,D., and WoIfD.P. (1985) Biol. Reprod. 33, 1223-1226
19 Naaby-Hansen,S., Lihme,A.O.F., Bog-Hansen,T.C., and Bjerrum,O.J. (1985) pp.
241-
251 in "Lectins", Vol.4, Eds. T.C. Bog-Hansen and J.Breborowicz. Walter de
Gruyter
-68-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
aid Co., Berlin-New York
- 20 Mack,S.R., Zaneveld.L.J.D., Peterson,R.N., Hunt,W., and Russell,L.D.
(1987)
J.Exp.Zoology.,243, 339-346
21 Morgentaler,A.,Schopperle,W.M., Crocker.R.H., and De Wolf,W.C. (1990)
Fert.Steril. 54 (5),902-905
22 Primakoff,P., Lathrop,W., and Bronson,R. (1990) Biol.Reprod. 42,929-942
' 23 Naaby-Hansen,S. (I 990) J.Reprod.Immunol. 17,167-185
24 Naaby-Hansen,S. ( 1990) J.Reprod.Imrnunol. 17,187-205
25 Kritsas,J.J., Schopperle,W.M., DewoIf,W.C., and Morgentaler,A. (1992)
Electrophoresis. 13,445-449
26 Xu,C., Rigney,D.R., and Anderson,D.J. (1994) J.Androl. 15,595-602
27 Hunt,D.F., Yates,J.R., Shabanowitz,J., Winston,S., and Hauer,C.R. (1986)
Proc.Natl.Acad.Sci.,USA. 83, 6233-6237
28 World Health Organization. WHO Laboratory Manual for the Examination of
Human
Semen and Semen-Cervical Mucus Interaction. Cambridge,UK : Cambridge
University Press; 1992
29 Lee,S-L., Stevens,J., Wang,W.W., and Lanzillo,J.J. (1994) Biotechniques.
17,60-62
30 Hochstrasser,D.F., Harrington,M.G., Hochstrasser,A-C., Miller,M.J., and
Merril,C.R.
(1988) Anal.Biochem. 173, 424-435
31 Henzel,W.J., Billeci,T.M., Stults,J.T., Wong,S.C., Grimley,C., and
Watanabe,C.
{1993) Proc.Natl.Acad.Sci.,USA. 90,5011-5015
32 Matsudaira,P. (1987) J.Biol.Chem. 262,10035-10038
33 Edwards,J.J., Tollaksen,S.L., and Anderson,N.G. (198I) Clin.Chem. 27(8),
1335-
1340
34 Myles,D.G., and PrimakoffP. (1984) J.Cell Biol. 99, 1634-1641
35 Burks,D.J., Carballada,R., Moore,H.D.M., and P.M.Salling (1995) Science.
269, 83-
s6
36 Eddy,E.M., and O'Brien,A. (1994) pp. 29-77 in "The Physiology of
Reproduction",
second edition. Eds. Knobil,E., and Neill,J.D. Raven Press,Ltd.,New York
-69-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
37 Boue,F., Lassalle,B., Duquenne,C., Villaroya,S., Testart,J., Lefevre,A.,
and Finaz,C.
( 1992) Mol.Reprod.Devel. 33,470-480
38 Lee,C., Keefer,M., Zhao,Z.W., Kroes,R., Berg,L., Liu,X., and Sensibar,J.
(1989) J.
Androl. 10(6), 432-438
39 Celis, J.E., et al. ( 1991 ) Electrophoresis, 12, 765-801
40 Seevers,R.H., and Counsell,R.E. (1982) Chem.Rev. 82,575-590
41 Cole,S.R., Ashman,L.K., and Ey,P.L. (1987) Mol.immunol. 24(7),699-705
42 Patton,W.F., Pluskat, M.G., Skea,W.M., Buecher,J.L., Lopez,M.F.,
Zimmermann,R.,
Belanger,L.M., and Hatch, P.D. (1990) Biotechniques. 8, 518-527
43 Markwell,M.A.K., and Fox,C.F. (I 978) Biochemistry. 17(22), 4807-4817
44 Hubbard,A., and Cohn,Z. (1975) J,Cell Biol. 64,438-460
45 Richardson,K., and Parker,C.D. (1985} Infect.Immun. 48, 87-93
46 Hurley,W.L., Finkelstein,E., and Holst,B.D. (1985) J.Immun.Meth. 85, 195-
202
47 Ingalls,H.M., Goodloe-Holland,C.M., and Luna,E.J. {1986)
Proc.Natl.Acad.Sci.,USA.
83, 4779-4783
Having now fully described the invention, it will be apparent to one of
ordinary skill
in the art that many changes and modifications can be made thereto without
departing from
the spirit or scope of the invention as set forth herein.
-70-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
H
Gl
W H
z ~ o
H ',~ O
U W ~r
z
W
H
H
L7 O W cn
z, H
H
H O
U] H ~(,'
H H 3
a ~ r~
a o ~
x
z x a
w w w
a H
W
x U
v~ h E~ ~ Ca
~ Z
w W
O R~ O ~ fi;
~ W 't'3
O c1 r
U H x cn w ~.,
U W ~ W
U
d' Cn
~
~ ~ n
O C7 U Ix u7 -l cnO ~ C~.
~
~ z H z w a r~ H
z
W 3 O U O tnC7 ~ W
U~
~ U x W ~ H
t~ H ~ ~ c~
a
z x ~ H a z x w w ~ a ~ o
a
o w a o w a U w x a ..N r~ H
w
x z w 3 ~ ~ w ~ H ~ ~ N w
a a
H ~1 W W ..H
H W
fx
w o o a ~ H ~ ~ a~ a
z ~'
x
O O ~ H H H O H W W
H
z H ~ w ~ ~ U cnU N
w W
H a a a~ x -. w ~.
~c
' ~ H o ~ m U a w w
~L H
~
r.~ H U U
W
-
W ~-- .,.i -,~ -,..~ .r
C~ .
.
_7
CA 02282859 1999-08-24
WO 98/36.771 PCT/US98/02913
0
M
r-1
O
.,
N
i
N
l~ O
C~O rl O
p
(~r1 lfl N
W $ O lQ
N C!) CO M I~
r~~",v \ I~L
,p\ U7 OD O .
-,~~n~a o ~ _ .. z
~ o a~ o, o rx o 0
c~~ ~ ~ M ~ b
~ ~ z N o o
O z " ~ ~ M N .. -rl 4J
i N U7 U ~-I
~ H
U ~ R;W H S W Z CY.M N U rt3 D~
H ~C W Cza W W O .-ii ,~ H
~
U ~ .~-Wl CICIi E-~ E-~f=.~crM E-~ O ''Cj
~ ~ ~ O cn ~ .~m
rd
w w ~ z ~ ~n. x cnz w z M S z H .~~ v
H a~ N z o x H
~ o z o w U o ~ x
~ H H z r~z o z ~ M a w ~a ~.~,
H tnw H z W E-aH W O ~ O o H H O cn
~
, O E'~FC IrIH \ H l~ U CO~,W
U H ~ U H a H w H w a ~ ~ -~z
w~
rxz w H H a H z w ~ U ~C z " w
w H c~ a ~ w w x z a o ~ v, ~ ..~ w
o H w H x x a
o
H H ~ w U c~H
~ a, H z cn ~c ~nrx ~ a~w x U H " a
W H W W W O C7W O
~
P.~ E- mC a H c~ \
~ w w w a r~ ~ ~ o w ~ a a w w z a~a~
O W O E-~C1rH a W W W ~ W W U W ,'~E-~
O
U O u~ W r.~G4U ~ z c.~fx O E-aE-~ O W a E-~v~
E-~
W O W H .~
as~ a x ~ m v H ~ cnv a ~ a~ H a ~ m ~
a
O
.,~ .,-~ ~C f~., -,
z --
H
N
_TL _
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/02913
O
a
w
v
a~ '-,
E1
v
H
v
H
.. ~ p ..
rl a H N
O ~ O
z x z
H
a a
H ,~.I H
v W
a cn 2s v a
w ~n ~ w
-~
v~ ~ U b~ cra
U
v Ul N H ~1 v
rtf
3 ~; ~ -r-I~-I''[j
't~
o H ~' o
~
~
~ z ~ v ~
v W ~
.
~
H ~C ~-l E ~ - ~ H
Ra W H H Cn ri C1~ W
~
O
H ~ U W H
-~a
v a a ~ 4 v
'~
w ~n ~ ~ w
w ~n ~n ~ w ~ w cn
..
ca
w r~ x a o ~ w
E-~ Ll ~ L~ UN a H f~ v
~ zw ~ o a
w w w w w w
a a sy v ~ H o a a
w
U W O W ~ ~ ~ U W
a
d
w ,'~ H ~ W
~
- o a ~ ~ H a~ v a a o
~n
o
o ~,
-~ -;~ ra v rs., .~ .~ -~,
-~ ~ ~ ~ ~n z -- ~~ x o
H ~- .r
N
-73-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
m n
c7
m
L~
v
a
v
.. ,~ o
a~ ~
0
z
a
U1 H
.. .~, v a c7 b v
Cn U .--i W cIa .~-I rl
~ H ~ ~'
v ~ ~r v
H o b -~~ ro . a .. E., ~ -~~ b
o cn ~ .~~nr~ .~ z o m o .~,~nra
z H .~U v ~ o v z H ~ U v
,~~ f~ ~ LJ.I~--'i~i A-irl~S ~, ~J
-Wn
~l W~ cn.~ N E-~ !~ Ca WE cra.~ N
H H O U7rl ~ W H HfaO Cl~rl
Um ~ W H ~ U ~ W
W U H m W ~ ~ ~ ~ ~ W
W
c rtiW L7 0.~ v~ cra r~W C7 W
ra
~ q ~ ~
~ W O ~ O
O ~ W ~ O ~ W ~
w w z w w w w w w z w ~ w
U W ~ E-~O ~ U rti U W ~ C-~O ~l
a E-ac~E-~ '.'aE-acryH
O W U W aC O W
w O O W
H O~ ~C!~U W -ll ~ O H t ~Cf~U Cl -l
r ~
W ,.~ _.~ O W ~ W '.~ .r~. O
u7 ~ U~ Pa U~
C4' f~.'
O ~ O
Gr.,-r-1 .~-I.~-I~I C~ .
z -- .~ ?C C.7~ z -- .~,
H _ ~ ~. H
N N
-74-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
z z
a a
H ~ H U7
O a w a~ a a w a~
w u~ ~ w ~n
-~ ~~,
~
~ m n N ~ N m
~ ~
~ - ~ ~ ~ -
o z H 'u'~v ' ~'
~
t~ ~ o ~ z H
~
u
H ,~r 04' (fS ~i ~ H Ul ~. ..
-ri -ri
fa
N N a w cnw a~ N ~ a w cn
~ ~
H ~ ~ W ~, a~ ~ H '~
~
v ~ w
~
a ~ ~n a ~ E a ~ w v W
' ~
.n w
rn cn r.C raw C7 w u~ cn ~ w
..
r~
w ~s x r~o ~ w ~a x a
G7 ~ GY x a H ~1 rt Ix U
U E-~
E-n
~ ~
w w ~ w w x w
z z
w
U ~ U ~ E-~O a U H U ~ N
W W
W p W E-~cl~N U W ''a Ei U7
''~
C7 ~ O W
O d W d
r r~ H ~C f~U ~l r u~ H O~ U
-ll ~C
al
w ,-, w., ~ ~ ~
E ~
x
O O -, --, .., ~ O
' ~ ~
?C ,--i Z
H ~ v H
N N
_7
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
O O
z z
a w
H H ~-I
o, ...~ v o, H
w ~n ~ w
-~
cn U 01 cn
U
l~ H ~i N U1
(a
~ -~- y -~
n
z o o r z
a
a~~ o z H U a~ ~ o
~
_ ~ ~ ~
w
v H Ca E cn- H
rl~ ~ H ~ ~ ~
~ U S-iW H
x ~ a' ~ a ~
'
~ ~ ~ w
'~ ~ '~a o ~ w
o ~ w ~ x
x
a H a ~n x uH a H a ra
~ z w ~
w w w .n w w
~
o a v ~ a ~ N o a a
w
o W H ~nH U w x
a
a w ~
H
o a a~ arc w ~ a o a
g m r~ ~ m ~ cn
0
x w -~ -
x H ~ z -- ~~ x a
H
N
-76-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
a
rt
o
O S.~
H
W
(l~ H ~ (n
'b
cl~U r-I W Cn U r--I
H ~ ~' ~ ~ ~ '
0o N os H ~ N
- ~ - ~ y
n
H ~ ~ ~ ~ o ~ o ~ ~ n r
a
. z _
tx E r~..~ C~ H rd ~ E
Ca W rt cn.~ N H ~ ~1 W rti ~ -~ N
H H O U~r-IQ~ W H E-i O Cl)ri C
~-'
.. ~ ~ o, ~ -~z .. ..
~ ~
'~ 'TW O ~ w '~ ~ '~
x ~a x x a o
rx a H -.~ a H r~ ~a rx a H ~~ a H
z ~ x ~
w w w w z w w w
U W ~ E-~O a U ~ a W ~ E-~O ~-l
O W a H t11E-~U W H W '~E-ru~E-~
O
H ",~.,....-..~ W ~ H '~ W
H a r~cna r~ a o~ ~ H a ~ w a a a
w .J~ ~..v o w ~
w ~ ~ o
o ~ o
w -;-~ .~ .~ ~ w -
z _. .~, ~ a ,~ z --
H ~. .r H .r
N N
_77_
CA 02282859 1999-08-24
WO 98/36771 PCTIUS98/029I3
v
..
.. "~ 0
0
o~ E~ H
H
~ z
z a ~
,
a
H ~., H N
ri U1 .G'
a o ~ ~ W ~
" ~ ..
cn Q, o U U ~1 U~ S~ ~ U
U
Ul rl H fCj ~ N W -I H
(~
~ ~ -~n ~ -~ H -~ -n
a
z o o z o n
o
c
o ~ z H ~ U v ~ o ~ z H
~
U
H r-I (~a-ri(~~ ~'-.C~ ~'--~~ P.~. ..
~ -rl
(ff
H ~ Ll W ~ u7-~ v E-~ ~ a W C!~
E
W H ca r-~Ra ~ H U
~
~
~ U ~ W ~ W
rx cn pr o,-.~Z .. .. ~ r-, a m z
~ -~
~
U ~ ~ W ~ ~1?-~W U ~C W ~ C~
~
cJ~ U~ ..raW L7 W Cn U7 FC W
w
~
w ~s ~ x a o ~ w o x a
O U ~ ~ q W O x
U
L7
W
5C -7W ~ O
L
W Cra W z W I3~W W Gc.iW
z
c~
U N U W ?-~E-~O ~-l U ~ U E-~
W
~
W '-aE-~U~H U W O W v~
'~
Ei
W ~ O L7
O
a ~ H a ~cP4U ~1 ~-l t t~ H d U
FC
fYl
O
O ~
-rir-I Cs, -ri -ri -r-I~ fi.i-r-I -
x o ,~ z -- -~ ~ ~ H z --
H .J ~ H
N N
_7$_
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
N
H H
z z
a
a
H Ul H S-1
a
a ~ v a H
_ W
Cn i-~ N U t57 c
U la
N ',~ ri H ~'', v U7
f~
N ~ .~-n~ ro
z o o z
a~ .~ o ~ z H U m .~ o a~
~
H ~ _ '~ ~
w
a ~ cn~ v H w
r-i S~ P.i H E-~O U7ri a pa
(~
~
~ ~ ~ ~ H
L(1
W Ul ~ W C7 f~ ~
H ~ ~H q
~l -r ~ ~ N
r
O ~
W U U
W
O ~ ~ ~ O a U
-l
U W O W H C!1E~ U
''~
~ W x
a a O W
a m H ~ f.~1U CW - O~
r.~ -l
x
.
-~ ~C ~ ,-n
a
~
H
N
-79-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
a
it
o
O
z x
H
H v U1
b
v Ot a~ .. -,~ v
. craU ri W cn U r--I
~ ~ ~
riH ~ N ri v-I H
E-~O T5-~~ '-d ' L7 .. E-, O 'Lj-~l-a'CS
Z v~ ~ -~cn~ -~ z o v~ ~ -~~nr
H -.-1U N 1.1 p r-I ~., H rlU N l~
Ri E ~ G' ~ H (IS LY.~ (tS S-'-.
LlW c~ u7-~ N N ~ fa Wc~ u~-~ v
H E-a O U7r-ISaa W H L'-~ O U1rl S1~
U ~ ~ W H ~ UN ~ W
~ . a U a ~ ~ E q ~ W
E ~ W Wn
cn r~W C7 W cn cn r~W L7 ~
~ p
~ ~ H a N H ~
fx H ~ ~ E1
~ '~ w ~
w z w w w w z w w
v w ~ H o a a s~ a w ~ H o a
W a H cnE-~U W H O W '~H cnE-~
O
W O O W
H O~ aCf~U fW l i C H i ~Cf~U fW -l
- -
W ~.~ .~~ p W ~ W
O ~ E
p
p ., ., ~ ~., .-.
Z v
~C C7
~
H . ~ H
N N
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
m
v a~
..
o in ,~
o
H ~ ~ w
O c~ o ~
z
H C7
W
H ~., U1 H ~ UJ
r-i '~ ri
o, ~ .. .~., v
W Cn U r-I W CA U r1
tn f.~, u1 U t~ ~ U1 Um o U to Us
~ ~ ~ ~
r.~ H O '~- ~-tb H O 't3-~
Z O cn ~ -~m rt -~ Z O u~ ~ -Hu~
O ?, Z H -~U N ~ O N Z H -~U
H rl Ra E ~ .~rCZI H .~i (1~.,E fa..
H C7 C~ W rtf cn-~ a~ H W p Wr~ cn
(~ H H O cn~ Q., W H H O tn
H ~, U N ~ W H ~ U~ ~ W
a ~ ~ w~ ~ ~ ~ ~ ~ w a H
~
~r, w
cn u~ ~ ..r~w c~ a, ~n ~n ~C ~ r~w
~
w ~ x a o ~ w H x x
a a~ rx U H a H a ~s c~ U H ..
'~ z w ~ ~
w w w w w z w
U O U W ~ H O ~l U ~ U W ~ H
W ~ O W '~H u~H U W O W a H u~
FC
d d a O
~ H FC04U fa t O H O W t~lU
C
C7 ~ ~ " '..~.~.~ ~ W
O ~ O
~ -
x ~ ~-, z
H ~ ~ H
N N
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
M
M
N
a
.. v ..
0
b
.. -,~ ..
~ ~ z
z
a
~ a
- z
m a~ N
or o " ~ a~ ~ a U
~ _ w
r u~ ~ U ~drdtT W l1 ~ co
rl
~ ~
~ b ~ H
ra -~ z o cn v ~ u~~a s~ z ~ o
~ o v z H cn a~ v o ~c z
, H ~ (x rdU " G ..~ H U
-~ a~ N a~ r~ w .~-~cn-~ ~ N ~ r~
ri ~ W H N ~ Cnrl O L1 W, H
H S-1 U C''1r~W H U'
~ ~ o
a N '~ a M ~ w ~ w ~
w c ~ ~
n
H A H w H a
a ~ rx " a x
~ ~ ~ H
w w w z w w w
o a U ~a U w ~ N o a U ~
N w o w a N 'nN ~ w H o
a c
H
a o a o H a ~calU f~ O W H
~ ~ cn
u~ cn Z
O O
-~ .~ ~ .rt -~ .~ L7
.~ ~ c~ z -- -~ x z z
,~
- _ . H '-' .~ U H
U
N FC N
-82-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
N N
ri
.. -,~ ..
z
a z
U ~1 U
H -ri H
v u~ v
v ~ a ~ v ~ a
CJs -r-1 r~ U W Ul -rl .-i U W
U rti''~~1 ~ cn ~ U ~ b ~1 ~ W
H C~.I-r-1~a ~r r-i H C~-r1~i ~,
H ~ ~ ~ ~ -
c v c ~ Z O c v ~ m ~ ~ Z
n n n
H m v v o E-~ z H ~n v v o
f~'~ U ~ ~ H U fx rtSU ~ ,.~ H
W .i~-~U~-~ ~ E-~ U Ca W .~-~U~-~ .u N
H v m r--~o w E-r H E-~ v cn~ o w
U lflr-IW H E--~ U I~r-iW H H
N U z .. .. ~ O a ~ N U z .. ..
fa~ W U
W ~ Ca~ W U
W C7 GL cn aC W ~ ..~ W C7 W
x A O ~ W U x a
C O ~ W
U N O N q U H ~ W
C W ~ ~ O L W ~ O
7 7
W z c1c Pa W W C7 G~ W z W C.uW W N
U W ~ E-~O ~l U L7 U W ~ E-nO ~l U
a E-~cnE-~U W ~ O W '~E-~U7E-~
U W d
H
- ~ ~CasU a o a H a ~c~ClU f~ O ~ H
~ '-'..~ .-,
v~ N ~
- ~ -~ x ~' '~
z -~ x z
- .., ~ H
,-.
C7
N
-83-
CA 02282859 1999-08-24
WO 98/36771 PCTNS98/02913
N
O
N
-,1 ..
U O
U f~
-ri H Il~
U1 v 'L~
v r, a .. -,~ v
.. ~ -,~ ,--~ U W U7 U r-I
o U ~Sb tT ~ cn H U rt 01
N H j.2i-rl.~"', .f', N H .S', v
a - ~ ~ -~~ ~
~
o c v ~ ~ ~ ~ z o r
n n
z H m v v o ~ z H -~U v
p.' c~U ~ .~ E-- y Y ~ ca
f~ W .~-rlCl~-~-I.u E-~ Ca W rti as-rIN
H E-~ v ~n~ O f~ U H E-~ O cn~ C~
U U
N U 'Z,.. .. (L; H O~ r-)-ri'z,.. ..
~ ~
~ w ~ p., U7 U U7 .. W ~ G1,
x x w o ~ w ~ x x a o
~ U E-a l E-~
!x U E-~ ~ ~l E-a C~ H z ~ w -
w ~
w z w w w w
U W ~ E-~O ~-l U N U W ~ E-~O ~-l
'~Enc~H W O W '~Eia~H
O W U H
a a ~ o a
N O~ ~CcnU a .7 H ~ ~ m U a
c.
o ~ ~ ~ ~, o
-~ ~ z -
z :~ x
H . . v ~ (~ H '-'
N
L7 --
N N
~
_
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
N
H
r1
N
.. ~ ..
-i ~-i N
O
N W rl '~ N
.. -~
z
~ ~ z
a ~ a
~ .
v
a c~ ~ ai '
o
, ~ . v w .. ~; i
.~
c!~ U~ N U ~ '~b1 ~ Cl) r1 U '(~bl
ca
N ~ ~ -~~ r' N H -rlG
C2~
. ~ y
~
z o ~n a~racnra s~ z o ~ ~ ~
v r
a
o v z H ~, a~ v o z H
~
tx rtSU ~ ,.~ H 0.,' U
rti
H c~ Ca W ~ -~cn-~ .N En C-~ W -~ua
~ -~
H H ~ O ~'i' H E-~ N U1
rl
S-1 U N rlW U ~ W
~
P.'. ~ O~ ~ r-IU z .. .. ~y Ot ~ U
U f-m N
n W ~ f~~ W U W ~ f~
?a
v~ U ~ ..~ W C7 W cu ~ ~ ~ W
.. C~
f~ ca ~ U H ~ H ~1 C~: UN ..q0
~ ~
~ W ~ ~
W W z W W W ~
z
U it U W ~ E-~O ~ U U ~ E-r
W O
W O W '.'aEiU~H ~ W "~ E-~cn
E-~
~ O W
o H a
r o ~CPOU ~l ~ O~ r.~ H O~ CllU
_ FC f~
cWl~ p --..r.r'. O W W
,
~ ~ o o
. .~ .~ .~, ~
,
_ C~ ',~.," -v ,~ H ~.
r~ r-I
H ~
L~
N E-~N
-85-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98102913
N
M
'L~N ''C~
-,~..
U O U
itz
U L U
rIH -rl
-,o~ ~ s~ v
U W cn -~-i ~-iU
~ ~n ~r U ~''d
.~', CV H ~'rl~i
.. . [--~ U
~ z o ~n vra ~nr~
z
.~ a ~ ~U
H U r~ w ,~-~ cn.~
O i~ H H E-~ N cJ~~ O
H E-r U ~~ W
U ~ N a
W U W ~ ~ W
U ~ x ~ O
~ W x la
E-~(~ L~ C~ U En aH
~ ~ Z~ ~ O
W W C W P
7 .~W
H ~
a ~ U
U W ~ O W
W ~ U H ~ ~. W
a a H H a ~m ~ a a
H
U fx
r.~ O
-~-~ E-~ C=.~w -~ -
-~~ ~ z --
U N
U
-86-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
0 0 0 0 0
N l0 N CO d' O
~-1 rl N M
~7 H FC U
U
C7 H U U
U
U U C7 H
H
U C7 H H
C7
H U C7 H
C7
H FC C7 C7
H
C7 U H H
H
FC C7 C7 U
H
U H C7 U
C7
H ~C H ~C
H
U C7 U r.~
rC
H C7 C7 C7
U
H FC U H
H
~
H L~ r~
U U
U
H
FC C7 C7
N ~
N ~ U C7
"
z z H N ~
a
~
a r~ H H H
a
c~
a a
-~ ai a ~ ~
a . ~
H ~ -~~ ~ H ~
N H ~ L
7
~7
.. .. E-, N U -,...a~ U [~ H UU
z o cn ~nr~m r~ z r~ U H
O H z H ~ ~ FC O ~ U rC
U
H U P:.i7U " ~ z H U C7 U
C7
H U ~1 W -~~ -.~~1 H ~C r'~
~
G4 ~ H HN (UCn~-1U W U C7 rC
U U a ~ M a ~ ~ z H ~C
~C
~ ~ W
v~ H u~ ~C ~ W C7 !~ ~ aC C~ H U
C7
W tx x x CaO ~ W U FC H C7
~C
W U fx U H ~-IH f~ U C7 C7 r.~U
O ~ H U U H
~
U W C
7
E-~ U ~ H O a U ~
z r.~ z z ~ H cnH ~ z C7 C7 U
U
W L7 O W U W U H C7 U
H ~ _..-.~ ,-.W ~ H C7 U
~ ~
Or H d r~ppU ~1 O r.~C7 H C7
~ W ~
cn C7 c ~ U~ L7 U C7 C7
J~ C7
H O U H U H
C- L
-~ .7H
-~ -
?C r.~ z -~ ?C C7 H U U
C7
. ~ -- ~ U U
E._., H
.
~7 C-
-~
N ~
U H H U'
_87_
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
n7 O O O O O N
l~ N CO ~ O II)
rl r-i N ('~1C'~1
t7 H ~C U U
C7 H U U U
U U L7 H H
U C7 H H C7
H U L7 E-~ C7
H FC C7 L7 H
C7 U H H H
H ~
H ~C ~C C rC
-~
U L7 U FC ~C ~C
~ H U H H
(- .7 FC C FC
-~ C 7
H C7
H U U U U
U ~ ~ U U H H
H C C
7 .7
U ~ U ~
C7 C FC
7
H H U U
H z ~ C H
.7
H p ~
~ C7 C7 ~C
U U
. -~ v O~ ~C ~C ~ L-~
cl~rt ~ W
~-''T31 ~ ~
U' N H ~ H H C7 L7 L7
C7 H N U -~~ C7 H H U U C7
o cn ~nr~~n~s z ~ ~c U H
z z o ~ a ~
~ ,~U . ~ U o
q H _ ~ ~ W ~ U ~ ~
~
N C r U P .7
II- .~ C
U 111,-iGx] H C'J U C7 U U
~
U O~ ~ M ~ ~ FC H ~ ~C U
~ ~ W
W C~ W ua r.~ L7 H U C7 r.~
U x f~O ~ W U C7 H C~ FC U
C7 fx U H ~-IH f~ U FC C7 FC U C7
C7 O L7W ~ O E-i L7 ~C C7 FC L7
E-~LL, W z f~ figW W ~ U U
O ~ ~ ~
''~H ~ U W U U
U O W H L,7 U U
O H ,.'7.-.~ ~ ~ W ~ H C7 U FC CJ
~
o H a ~ r~v r o o~ ~c o H ~ o
U N H H H
7 ~C C
L 7
U O ~ U U H H
-~ x C7 H L
7
H H U H U
U C
7
U ~ r.~ H ~ FC
U
U E-i U H C~ H
CA 02282859 1999-08-24
WO 98/36771 PCT/LJS98/02913
N N
O O m
z z
a
a a
H H ([5
U7 (n (iS
.. v o~ " w v a x
.~
.. ~, ~ w " u~ -~ ~ w
_~,
t~ U ~f u~ u~ oo U U 0~ u7
U
N H ~ v ~ N H r~ ~ v ra
~s
H zs-~ ~ b " a .. H b -~ s~v " x
o ~n .~u~ ~a -~ z o cn o .~m ~a-~ z
o
z ~--~ U N 1-1 O rtS z ~--~f.~U N 1J Q (a
~i
~, (~" ~. C~.iH ~ Qi 'r1~ " .~rNI H r-I
-ri
~ W t!a.~ v H >C fa W E Ua .~v E~ ~C
~
H E-a O Clar-IC~ W H E~ caO (/~r-IR.~ W
(~
w a ~ ~ ~ ~ ~ ~ ~ w v ~
~n w ~n
n " ~ w a a~ m u~ " ~ w ~ a~ cn
~
x r~ o ~ w ~ x x a o ~ w
rx a " a H a ra x a H " a H a
H
z w ~ ~ z w ~
w w w w w w w w
v ~ H o a a ra a w ~ H o a v
w
o W N ~n H ~ w ~ o ~ a H ~n H ~ w
a
C
H
w cnU a o a o H W ~Ccnv a o
~
w
cn a ~ --,.~ v
~ ~ ~n a
x x
~.. ~ ~ o --
r~ -~ .~ .~ v w -v .~ .~ ~s
-
z ~ -~, ~ ~ ~ z -~ x
H _ ~.. ~- H
N N
_89_
CA 02282859 1999-08-24
WO 98/36771 PCT/ITS98/02913
o~
N
O
z
H tJ1
.. a~ a ~ b
~
.. c~ ~ w .. ~n
-~, -~
U bl Cl) N o U Ol
U U
N H .(''-, ~ ,.f., (-~1H Li, N
fa fIS
.. E-, b -~~ 'd W .. ~., ~ -~i-~'ty
o cn -~ m ra-~ z o ~n -~m ~a
o o
z H U a~.~ o ~ z H ~ ~
~ ~
r-If~ ~"'.,~ H rl LY. (fS ~i C~
-ri
~ ~ ~
H H ~ U1r1~ W H H ~ Ulr~
f~$ (f5
U 's~"W H U U ~ W
~ a ~ w ~ w ~ -~a ~ w
'
~ w a a~ u~ ~ w .. ~aw a a~
cn ~x a o
x
rx x a o ~ w ~ rx U H a H
U a H r~ ~
H
~ a z ~ ~ ~
W ~ ~ w w w w
z
U ~ H O a U ~ U ~ H O a
W W
a ~ ~ N w w ~ ~ ~ U
a
O w U H O
W as v r~o a a H a cnv a o
~ ~C
~
x
o ~ o
w -~ -~-I -~ ra w
z -- -~ ~ ~ ,~ z --
H .~ .~ H
N N
-90-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
0
M M
z z
a
a a
H ~J1 H ~-1
a ~C ., v o~ N .. v
b ~
w .. u, ,--~ w ..
.~
cn rd H U ~1 Cl~p, N CJ C31
U U
((S M H ~ v CJs M H ~.,-' v
fa ((f
,~' . (-I ''(~-rl~-1'L~ ~' ~ '"~-r-1$~-I'Lj
z o ~n -.~u~~ -~ z o u~ -~u~~
o o
o ~ z H a v ~ o ra z H v v
~ ~
H U7 Qi ~S ~ QI I--I~ f1i ~ ~.iC.11
-rl -r-I
E-~ ~C ~1 w cn-~ v E-~~C C~ w cn-~ v
E E
U ~ W ri ~ P.v H U rl
(a f(f
~ ~ W
a x ~, w ~ ~ a ~ w v ~ ~ ~ a ~ w
' ~
~ w
~n ~n ~ raw a a~ cn ~ .. ~ w a a~
..
w s~ x a o ~ w .u ~ a o
cvn o x w o ~ ~' ~ o x w o
a ~ a
~ ~
~
w w w w a~ w w w w w w w
z z
a ~a a ~ H o a a a a ~ H o a
w w
w ~ o W H ~nH ~ w ~ o W H ~nH
a a
H ,"> ~ .-..~ W ~ H ~ W
~.
o~ ~a H a caa a a a ra H a cna ca a
~ ~c
x ~ ~ ._.r
~
~a o ~s o
-~ ~ w -~ :~ -:-,~s w
~s x ,~ z -- ~~ ~ x ,~ z --
H v v H
N N
-9t-
CA 02282859 1999-08-24
WO 98/36771 PCT1IJS98/02913
a
..
N M ~ O
M M x H
~ ~
H [j1 U1 H f-1 W
N 'Z3
o, ~, .. .~,
W U7 U i-I W U7 U r-I
cn p, M U ~ ~ cn ~., ~ U c~ t51
U~ M H ~', N r-1 M H
H O '~-~~ 'b C7 . E-~ 0 ''~-~~ 'b
z o v~ ~ .~u~~a ~~ z o m a -,~~n~a
o ra z H ~~U v ~ o ~ z H -~~ v
H (CS fYa~ fa' ~i pi H r-I Qi W CS ~i
N x ca w ra cn-.~a~ H ~ a wra cn-~ a~
H H O CI~r-IO-~ f~ H E-~ O Cl~rl (7a
H rti U ~ ~ w H i~ Uo ~ W
a ~ ,~.r.,z .. .. ~ .~ a ~ ,~-r,z .. ..
~
U x ~n W ~ a ~ w U H ~n w r~~ w
cn v~ r.~ c~w L7 w cn ~n ~ ..rtiw L7 w
w ~a x x a o ~ w ~ x a o
~a rx U H a H a a~ x U H a H
~
x w ~ '~ z ~
w w z w w w w
U ~ U W ~ H O a U ~ U W ~ E-~O a
'~H v~~ ~ W O W a H vaH
W H O W ~C
o o
a ~ H a ~ m U r~ a ~ ~ H ~ ~ r~U a
~ --~ .J_. ~ w H
C7 c
o
O ~ O
N C~ -~ -~ -~ rtS w
z -- -~, ~c ~ ~ z -~,
H ~ ~ H
N N
_92_
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
a
.. ~,
S.a m rt
o o
M ~ ,~ M x
.. .. _
O S-I O rd U
z ,~ z
H x
C-.1 U
H ((f U7 H t~ -rl
td 'b ~ U7 N
a x -~ a~ a x
W U7 U r-I W Cl~ -r-I r-IU
U7 (CS Lf7 U (a C31 Cl~ tip l0 U r~''OOl
(~ M H ("., N r-~ f'7 H Q~rl~i[".,
.. x .. [~ p b -r-I~ 'b r.~ E-~ U -~-Ii-1
z o cn ~ -.~~n~a -~, z o ~n a~~a~n~a
s~
~ Z ~ a Z
~ E ..~ R~ c x~ U ..
n
E-~~C ~1 W rti cn-~ ~ N FC ~1 W.~-~cn
W H H O Cnr1 Cdr ~ H H v Cnrl
O
H ~ U .--i~ W H ~ U~ ~ W
~ a ~ ',.iz .. .. ~; ,-~ Or N U z ..
~ ..
U ,n ~ Ca~ W U CWn W ~ q ~ W
u) cry rdW C7 W U7 U) FC w ~ W C7
w ~ ~ x o ~ w ra x x w o
~1 ~ t~ U H a E-~ ~7 ~ ~ U H aE-~
~
a z w ~ w ~
w w w w W z w
U o U w ~ H o a U ~ U w ~ H o a
z s~ z z a N ~ H ~ z ~ z z a H ~nN
W W O W U W L~ O W U
H ~ ~ W ~ H ~ ~ W
a r~ H a ~cm a a a a ~ N o~ ~ cna a a
m
x x
~s o ~a o
=
-~,~ w ~ .~, .;~ ~a w -~
-.
~c x ~ z -- -~ ~ x ~ z -- -
.... H ~ ~.- H
N N
-93-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
N N
M '~ M M
.. .,.~.. ..
z ~ z z
U (~ W
H -rl H H
, ~ U a ~ ~ ~ a
'
o .. ~ . ~ ..
U7 r U rd'dt5~ ~ U7 co U U p1 c!~
M H ~ -ri~i ~ M H (~ ~., UJ
E-, U .,-~~ .. .. ~, '~-.~S~ 'd
z rx o ~ a~~ ~ ~ ~ z o ~ o -~~ ~ -~ z
o c~ z H cn a~ v o z H ~ ~ a~ .~ o
H Q,' R:(dU " S"...~; H ~J"~ CY,-r1(Ij W-,'CSI H
H z ~l W ,.~w cn-~ ~ E-~ 3 L1 W E cn-.-~~ E-~
G4 C~ H H N Cl~ri O W z H H cCSO CJ~rl Cla GL
H U U ~nrrW H N U ~ W
fx ~ O~ ~ N U z .. ., p; C7 O~ ~ L~.r1Z .. ..
~ ~ ~ W U
U W ~ ~l~ W U W f
U7 E-~U1 r.C w ~ W C7 W cJ W 1~ ~ ..r~W L7
x C O ~ W
~
W H x x C~O ~ W .
U O U C7W ~ O ~ q t~l~O U C7W ~ p ~ f~
W C7 C~ W Z L4 W W W U f~ W z W W W W
U ~ U W ~ E-~O a U ~ U W ~ H O a U
z H z z a H ~ H ~ z ~ z z a H cnN ~ z
W E-~O W U W ~ O W U W
fx H ~ W ',> Cl~ H ~ W
o~ ~ H a ~ a~~ a a o~ cn H a ~ r~a a a a
o ~ o : ~
.;~ .~ .~ x _ .
~ ,
x ~ z --
~ .-~
? . V ~ H _.
z
.
~
an
H N U N
U
-94-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
N
O
M '~ V~
_~ .. -,~ ..
z ~ z
U l~ U f~
rl H -ri H
U7 v W v
v r-, o~ .. ~ v
W
., ov U rti'd01 ~ CJ~ o U ~ Tl0~ ~ c
J~
rd M H (~1rl~, ~i '~ H A-IrlGi ~i
C7 H U -r-I~-I .. . ~.., U ,.~~ ..
.
o cn v ra~nr~ ~ z o cn v ~ ~nca ~ z
z H in N v O z H U7 v ~ O
r-I R.'UfU C: ..L~,H p'.,(~U 'S..,',i; H
C7 f~ W .C7-~c~~ ~ H ~1 W .caw cn-~ .u H
H H v cn~ O W H H N cn~-IO W
~-1 U t-1riW H U n-IriW H
N U z .. .. ~ z pr ~ N U z .. ..
H u1 W ~ Ll~ W U
W ~ fa~ W U
cn ~ W U 0. W L7 cla ~ W C7 W C!)
~x x a o ~ w ~ x
~ x A O ~ w
O U C7W ~ O H W CZ O U 7 W ~ p H f~
7
w w z a a~ w w . w w z a~ w w w
o z
U W ?~H O a U z U W ~ H O a U
O W '~H cnH U W O W a H cnH
~C FC U W
H '.7 W ~ ~ H ~ .-.~..~ ~ W
~ H a ~ r~u ~ a a o H a ~cw u a a a
H
~, o ._ ~ ~ o
a z ~ ~ '~
~ ~~ x z z ~~ x
H ~ '. U H
.
z
N H N
U
-95-
I
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
0 0 0 0 0 0 0 0
N lD N CO ~' O l0 N CO
v-I r1 N M M d~
U ~ ~ z H ~ z
~ ~ ~ H ~ v
z a ~
a
c~ U c~ v U U
U C7 C7 U U H
U C7 H C7 C7 rC C7
C7 U z C7 z L7
~
U
U ~ L U H H
7
a ~
~ ~ ~ a
~ ~
v ~ H z
z H z H U U
U H U U
L ~ ~ ~ C
7 7
U z H U L7 C7 U
C~ z z U C7 C7 z
U ~ H z C7 z U
~ ~ ~
o Z a H z ~ z
z ~ z H ~ U c~ v
H H U ~ U
m ~1 H E- C C C
~ 7 7 7
U ~ FC L7 z C7 C7
~ U
.. ~ N OI L7 z z z ~C ~C
p_, ,-i W
U 'di~ ~ U z H U U C7
~
H N U -~~ ~ ~ U z H U
p cJ~ ~ rt3tnrt5 z z U U U C7
z ~ .C7 N FC O ~ U U U z C7 H
U s~ z H z z z U C7 ~C
f~ W .-I-~ct~-.~C~ H C7 H H C7 ~ U
--~ H r-IN C!~r-nU C1~ C7 ~ ~ U H H U
H
z o U C7 H z Z U H E z
n
a ~ ~ A ~ W
U ~ ..p W O p-, ~ U z U L7 U H U
L7 ~ x f~O ~ W L7 ~ U z U U H H
z cx U H ~l H L H c7 U C7 U H H
C7 C7W ~ O ~ z C7 ~7 U C7
O
w w z w w w w ~ z U ~C t7 ~C c~
U U W ~ H O ~l U U U C~ FC
U z z ~ H cnH D z L7 L7 FC C~ ~ z
W ~ H H
~ r.~ C7 H
H Or r.~CqU 4a O d C7 C7 z ~C z Z U FC
~.~ ~ ~
~ ~ ~ U U H H U Z
U ~ ~
~ U U H H ~ ~ ~
Z -~ >C ~ C
.7
'~ '~ U Z ~
~ C7 ~ C C~ C7
7
V ~ U
H
C H FC O z H r.C
7
-96-
CA 02282859 1999-08-24
WO 98/36771 PCT/US98/02913
0 0 0 0 0 0 0 0
ct' O l0 N dD ~ O l0 rl
LJ1 l0 1D I~ I~ c0 01 01 O
U C7 ~C ~ ~ ~
r. C7 C7
Z C7 L7 U
~ H H
H ~ z
a ~
~ a ~ z
z H ~ ~ ~ ~ ~ ~ H
z z
a ~ ' ~ z
'
c~ v ~ v
z
~ z ~ H
r.~ U C7 U Z
z ~ ~C ~ H
~ U
C7 t C FC ~ ~ Z U C
7 7
U U U U F
~C H L7 FC C U
7
U U U ~ U
C7 C C C C H ~ U
7 7 7 7
~C L7 ~ U Z E-~ U
~ ~
FC L~ L7 U ~ U
~ U
H ~ U
E-~ L7 C7 U C
7
U ~ H
~C ~C C7 ~
U H U ~ U
FC ~C H
U z ~ U
Z C Z C~ H H C
7 7
U ~
E-~ L7 C~ 7 U ~ U
C
H ~ N U U
C C FC C U r.~ U
_7 7 7
U
H U H N ~
7 C7 C U
C 7
H U U
C7 U ~C ~ FC C H
7
C7 U ~C C7 U C7 U Z U
~ Z U Z U ~
C. U C7 L. ~C
.7 .7
~
C7 U C7 L7 L7 U ~ U
Z ~ U U U U
C C7 Ch C U
7 7
~ FC ~C U ~ C7 ~C E-a
H H U U
FC FC C C ~C U FC
.7 .7
_97_
