RCV 6Y- _ ln- 5-'~9 : 9:49.AN1 :__ ~'~3 151'7 98 05-i SM1ART & BIGGAR:# 2
FILE,~tN-tiV THIS AMENDED
TRANSLATION
A Method for Inactivating ~'a.thagens, in Particular
Viruses, in a Biological Mater~_a1.
The present invention relates to a method for
~.nactivating pathogens in a bialvgical material by
incubati.an with a chemical agent.
A biolagiGal material is derived from organisms or
body liquids or microorganisms.
Since a biological material may be contaminated
with pathogens, such as, e.g., infectious molecules or
microorganisms and viruses, and pyrogens, respectively,
Various methods for inactivating or depleting,
respectively, pathogens and pyragens, respectively,
have already been developed.
Such methods znclude physical and/or chemical
treatments, such ass, e.g., diverse filtrat7.on methods
(e. g, m,anv-, die- ar ultrafiltration), heat treatment,
treatment with an acid or a base, treatment with a
detergent and/or an organic solvent as well as
treatment with W light or with laser light. Also
various combinations oL such methods for inactivating
and dep7.eting, respectively, pathoger~s have been
suggested in the prior art.
From EP ~ 7.97 554, e.g., a. method c~f depyrvgex~izing
and inactivating viruses in a bis~logical or
pharmaceutical product is known, which comprises a
treatment with a virus-inactivating and depyrogenizing
- 1 -
CA 02285976 1999-10-07
RCV t3Y: 10- 5-99 :, .):4~aA'N :_~4:3 1 51.'~ 98 (r~-~ ~MAR'f Xz 13IGG:lR:t~ 3
agent, such as, e.g., an amphiphilic subairance az~djor a
solvent. on a solid phase on which the product has beer_
adsorbed. After this treatment, the virus-inactivating
and depyrogenizing agent is separated from the solid
phase, the adsorbed product ie washed arid finally
eluted from the sr~lid frhaee.
From ~P 0 131 740, the treatment of a protein--
containing composition in a solution with organic
solvents, such as di- or trialkyl phosphates,
optionally in the presence of a detergent
(aolvent/det.ergent treatment) is known, whereby
protein-compositions free from lipid-containing viruses
can be obtained.
From AT patent 402,151, a heat treatment is known
o~herein to a preparation present in an aqueous solution
a tensile is admixed at. a concentration of at least
by weight, prior to heating.
1~ further method for reducing or >~uppressing,
respectively, undesired activities its. biological yr
pharmaceutical products ie known from EF 0 083 999, The
latter is based on an extended Contact faith a solution
or suspension of a non-denaturing amphiphile. The
depyrogenized product: is treated with a~x~ ion Exchanger
4o remove the amphiphile.
1~ disadvantage of many of these methods known frt~m
the prior art is.the frequent accurrerce of losses of
activity of the J.abile proteins, e.g. blood proteins,
- 2 -
CA 02285976 1999-10-07
ft~ V BY : 1 ~> - 5- ~'~S : '~ : 4 i3A~1 _ ~-1 ~; . 1 ~ 1" J~; 05-~ SV1AR'1' &
B I GGAR : #t 4
contained in tk~e cac~posit i ons to be treated. In
particular when carrying out a chromatographic
purification step, inactivation of proteins occurs to a
relatively large extent. A degradation of protBirls may
also lead to an activation. Thus it is, e.g., known
that factor VII is vexy easily activated during a
chromatographic purification due to a.utoCatalytiC
processes to factvx villa vrhich factor i.s undesired
because it is very labile.
A further disadvantage consists in the large amount
of time and apparatus required for many methods, which
greatly seduces their practicability and thus often.
makes their use unsuitable on a large-technical scale.
The present invention is based on the object of
providing a mathod of effectively inactivating
pathogens in biological materials, which method is
protein-preserving, in particular labile blood
protsins, whic:rl can be transferred easily onto a large-
teGhnical scale and can be carrieii out ecanomicall~~. rn
particular, in the method fvr a.n;~ctivating pathogens, a
degradation and a possible activation o1- proteins
sus~:eptible thereto is to be largely avoided.
The afore-mentianed object is achieved in that a
method. is provided for inactivating' pathogens, in
particular, viruses, in a biological material by
incubatian with a chemical. agent, wherein the
incubation is carried out in the presence of an
- 3 -
CA 02285976 1999-10-07
RCV t3Y : l f)- 5_ -'3'~; 9 : ~.~A'\'1 ~ _ ~'~~ 1 51'? 98 05~ S'\1ART & t3I
GEAR ; # 5
eluotrvpic salt Corresponding to an NaC1 concenCration
of at least 200 mmvlf 1, preferably at least 300 rnmol/l.
Inactivation of pathogens in solution offers some
advantages over the treatment of ar. adsoxbent. Thus,
e.g., the practicability of such a method in a
homogenous, single-phase system is higher, and
validation of the inacti~ratiQn step is better possible.
The better accessibility of pathogens in a relatively
homogenous phase also seems to increase the efficiency
of the method step.
The biological material preferably comprises a
human protein and in particular is plasma or a plasma
fraction ar is derived frdrn a cell culture. Preferably,
the biolog~.cal material comprises a bland factor, such
as factor XII, XI, VIII, V, von Willebrand factor or
fibrinogen, in particular a vitamin K-dependent
prote~.n, such as factor II, factor VII, factor IX,
factr~r X, protein C, protein S or protein 2,
respectively.
The proteins may be present as single factors,
preferably in purified form, or in a complex mixture.
Tn a very particularlx preferred ernk~odiment, the
biological materia3. camprisea at least; one factor of
the prQthrombin complex and, in particular, is a
prothrombin complex-containing fractioxx or a factor
VII-containing material., e_g. after aryoprecipitation
of plasma, one departs from the corresponding
- 4 -
CA 02285976 1999-10-07
RCS BY- _ 1«- o-J~: 9:ylAb1 ~ _~4~i ~ ~1'~ '~B fW-~ SM1AR'i & BIGG.AR:# F.;
supernatant (cryosupernatant?.
~'he preparation according to the invention
preferably is one having FEIB activity (Factor Eight
Inhibitor Bypassing l~ctivity), i.e. a preparation which
a.s suitable for treating factor VIII inhibitor
patients.
The cell-culture-derived material preferably is a
material comprising recombinantly prepared blood
factors, among them factors of intrinsic or extrinsic
coagulation, of fibrinolysis, of thrombolysis, or the
inhibitors thereof, xn particular vitamin K-dependent
blood factors. As the cells, the cells commonly used
for the expression of recombinant proteins are
suitable, preferably mammalian cells, such as, e.g.,
Vero, CHO ox ~HK cells. The corresponding proteins may
be subjected to the method of the invention for
inactivation of possibly present pathogens either
directly fxom the crude cell extract, it may, howevex,
also be a pre-purified cell ~ra~tiori.
The chemical agent is, e.g., a detergent
(amphiph~.le, tenside?. which preferably is contained in
an amount of at least 1m, more preferred more than 5%,
most preferred more than 10%; yet also other chemical
agents may be employed aCCOrding to the invention, in
particular those of which a virucidal, bactericidal or
depyrogeni2ing effect is already known, or mixtures of
the most varying chemical agents.
- 5 -
CA 02285976 1999-10-07
RCL' BY : 1.~ - p -'~'J : '~ : W) AM ~ ~4 a 1 51'? ;)H ()5-> SMART & E31 GG.AR
: # 7
The croiCe is, however, limited by the fact that
the riat~.vity of the biological material sh.al.l. not be
substantially adversely affected. For an eranomical
mode o~ procedure, a chemical is chosen which retains
more than 505 of the biological activity of the
material, based on the activity prior to incubation,
preferably at least 70~s, in particular more than 85e.
Retention of the biological activity means that the
proteins contained in tk~e biological material are able
to~fulfill the function or the various functions
naturally ascribed to them. This blploglcal activity
may be determined and stated depending on the type of
protein, e.g. by means of a standardized chromogenic
test or by antigen determinaL.ivn.
Qptionally, the chemical agent is separated after
incubation.
13y ~~detergellt~, generally a synthet:io, organic,
surface-active Substance 1S to be understood.
Preferably, a r~on-ionic detergent is used in Lhe
method according to the inve.~tion_ Non-ionic tensideb,
such as polyether, in particular. alkyl phenol
palyglycol ether, are i.a. prvduc:l;s c~f er_hoxylation of
fatty acids, fatty acid amides, fatty amines, fatty
alcohols, amine oxides, fatty acid esters of
polyalcohols and sugar esters.
Such a tenside does not act denaturing oxi the
proteins and preferably is selected from the group of
- 6 -
CA 02285976 1999-10-07
RC1 BY' : _ 1 « - 5-~~- : :3 : 50A~~1 : _+'1 ~3 1 51 '~ 98 l)5-j SMART & B I
GGAR : #~ B
polysvrbate and triton. As the polysorbate, e.g. Tween~
is used.
If detergents are used as chemical agents,
according to a preferred embodiment they aze used
without the addition of other agents, in particular
without the addition of toxic organic substances or
solvents, such aa, e.g., TNBP. In this manner, a risk
of contamination is minimized.
According to the method of the invention, the
biological material is incubated with a chemical agent.
TncubatiQn means the contacting of the biological
material with. a solution, suspension or emulsion of a
chemical agent for a perxoc~ of time sufficiently long
for inactivation of pathogens ar pyrogenes,
respectively, possibly present, at a specific
temperature. Contacting may be simply effected by
allowing the mixture to stand for a defined period of
time.
2ncubation is effected according to the present
invention in the presence of are eluotropic salt. 8y
"eluotropic salt" hereinafter the salt in mixture with
chemical agent or the salt in a complex composition is
to be understood, with the property of dissolving
adsorbed substances otxt of solid or lic;uid-impregnated,
also gel-type adsorbents and/or to displace them.
Preferably, the eluotropic salt is a desorption agent
as is used in chromatographic methods. The adsorbed
CA 02285976 1999-10-07
6;CV f3Y : 1 ()- 5-~)J ; :3: 51 A!tt ~. . +'~B - 1 5t'? ;)8 1)~-~ SD1ART & B 1
GGAIt : #~ 9
s»bstance is i.a. sufficiently soluble in the presence
of the eluatx'opic salt, i.c,. preferably conditions are
Chosen which do not precipitate the biological
material.
The type and Concentration of the salt or of the
composition, respectively, is generally selected
depending on the adscr~asnt used. The eluting effect of
a salt depends, e.g., on the polarity of the solvent,
i.e. it increases e.g. in the sequence ethanol -
acetone - methanol - water. The adsorbent may also be a
solid phase, in particular a matrix suitable tar. iQn
exchange chromatography. In the composition captaining
the eluotLOpic salt, also further additives, e.g.
fuwther salts, may be ccntaine3. PrGfera~bl.y, the
composition is an aqueous campositior having a pH
ranging between s.0 and 8.0, preferably around 7Ø
In a px.~eferred embodiment, sodium chloride is used
as the eluotxopic salt, yet also other a7.kaline or
alkaline earth salts, among them CaCl~, may be used. A9
the eluotropic salts, alsr~ so-called chnotropic agents,
such as, e.g., urea, rhodanides ar guanidinium, mayr be
employed. The concentration of ttie salt is at least
a 20ct mmol/1, pr2terably ~ 3U0 mmal/1. The upper limit
for the concentration employed will depend in
parrir_.ular on the salability of the respective sa~.t
and, for Na~l, is e.g. around 2 malfl. Chaotropic
substances, such as, e.g., urea, may be employed
_ g _
CA 02285976 1999-10-07
1ZCWSY ~ _ lU- ~-~'j~~ ° '-):51:'161 ~ -_ . +'~a3 L ,~ l'> a8 (io-j
SMrIR'I' & F3lGGAR ; #1(>
optionally even up to a concentration of $ mol/1.
Incubation of the biological material with the
chemical ager_t is effected far a period of time
sufficiently long to inactivate pathogens possibly
present, preferably for a period of between 10 min and
h, most preferred between 1 h ar>d 5 h_ The time
required for the method according tv the invention may
be,determined by means of model viruses, such as ATV,
Sindbig, TBE or hepatitis virusQS in a pre-assay.
Also the choice of temperature has an influence on
the period of time to be employed. In the method of the
invention, incubation preferably is carriEd out at roam
temperature, e.g. in a temperature range a.f_ bQt.ween 15
and 45°C, in particular between 20 anal. 3p°C.
In the method according tc the invention, the
biol.ogi:al material preferabJ.y is adsorbed on a solid
carrier, purified, arid incubation is effected
immediately after elution df the purified material.
~lutien and incubation may be carried out
consecutively, they may, hove°,rer, also be effected
s i, mu 1 ~. aneou» ly .
According to a further preferred embodiment,
incubaGi.on is effected after a chroa~atogaaphic
purification of a biological tt!aterial, the eluatt
having been still further processed, e.g.' by
centrifugation, filtration, or other physical methods.
Preferably, the solid carrier is a material
_ g _
CA 02285976 1999-10-07
~''C'V epi : 1W 5-9J : :j: ilAM :__ _+'1'~3 1 vl'? 98 Ot~-~ SMART' Xc
BIGGAR:#11
suitable for chromatography, iii particular a material
suitable for 7.on exchange chromatography, hydrophobic
chrarnatography, or affinit~~ chxvmatography. Materials,
such as sepharose~', 8uperdexf , Sephadex'~',. Spherodex°,
'~oyopearle, or inorganic materials, such as hydroxyl
apaCa.te, are aged.
As the ion exchanger, anion exchanger materials,
such as, e.g., DEAE Sephacel~, DEAF-sephadex°, DEAE-
Sepharose° CL6B, DEAF-Sepharr~se° Fart Flow, QAE-
Sephadex°, Q-Sepharose0 fast plow, ~-Sep.mrose~' Ftigh
Performance, DEAE-Tris Acryl, nEAE Spherodex°, ~-Hyper.-
D tabtainable through Sepra~or?, DEAE-Toyopearl~, QAE-
Tvyopearlf, Fractcgel~ ENm-TMAE ar other Fractogel
materials may bA used.
A~ examples of hydrophobic chromatographic
materials, butyl-Sepharoseo, octyl-Sepharose~, phenyl-
Sepharosef, Fz'actogel~TSK-Butyl, t-Butyl-H:Cc.'. Support or
TSx Gel Butyl Toyopearl~' ought to be mentioned.
The biological material may be directly adsorbed an
the carrier from a comglax mixture and purified, the
inactivation step may, however, also be preceded or
followed by further steps of. purifying the material,
further chromatographic purificatzan steps being
preferred within the scope of the present invention.
By the method according to the invention, pathogens
are inactivated. By pathogens, also fragments of, e.g.,
viruses, in particular also the isolated geriome or the
- 10 -
CA 02285976 1999-10-07
RCS' t3Y : _ 1W ~ W'~ ~ ~I ~ S'~AM v +'l~ 1 512 98 U5~ SMART & B I GGAR : # 12
fragments thereof, are understood.
ThE pathøgens may be lipid-enveloped pathogens,
such as, e.g., hepatitis B virus, or non-lipid
enve~,opad pathogens, such as, e.g., hepatitis A virus.
At present, virus inactivation methods azc called
effective if after applying the method to a sample of a
biological material which had been admixed with a high
dose of a test virus, e.g. HI virus car Sindbis virus as
a model virus fc~r hepatitis viruses, viruses can no
longer be detected in the sample, and the virus titer
thus has been reduced to below the detection limit.
Detection and quantitation of nucleic acids may, e.g.;
be effected by means of a pCR method as described in AT
patent 401,062, or by direct titration,
Ae a measure far inantivation, the so-called
reduction factor ie known which, after a single
addition of test virus, is calculated from the decad~.c
logarithm of the quotient of initial and final v;.xos
titers. From European Guideline EC III/8115~89-EN of
the Commission of the European Communities,
furthermore, the so-called total reduction factor is
known. It. is calculated from the sum of the reduction
factors of individual, subsequent inactivation
measures.
Freferably, a further, independent step for
inactivating or depleting pathogens, respectively, is
carried out. For this, all methods known from the prior
- ii -
CA 02285976 1999-10-07
RC'V F3Y : ~~- p-~~~ . : '1: 5-~,'1~'1 _: _ _ 4W 1 51 '? 5313 05> Sb9AR't' &
131 GGAR : #t l a3
art are usable to minimize the risk of infection.
In particular, a filtration and/or a heat treatment
is effected as a further step Eor' inact~.vation or
depletion, respectively. _
As the filtration, preferably a nanofiltration is
performed. A preferred heat treatment is carried out ~on
the salzd biological material, e.g. on a lyophilisate
having a controlled water content, e.g. a water content
of between 5 and 8%', and at a temperature of between 50
and 80°C, as is described in EP-o X59 311.
In a preferred embodiment, a 2-step treatment with
a detergent ag the chemical agent ~.s provided. In doing
so, a detergent is used in a first step in an amount oL
at least 1~, preferably at Least 5%, mast preferred at
leant 10%. In a second step, a further detergent is
used in an amount of at least z0%, preferably at least
12%, moat preferred at least 14s. The detergent used
may be the same one for both steps; howe~rer, also
different detergents may be used. Quite generally, the
risk of a virus infection lfter administration of a
corresponding preparation can be greati.y reduced ox
eliminated, respectively, by the combination of steps
for virus inactivation.
According to the present invention, also a
chramatographically purified preparation is provided
which comprises an autodyx~amically aCtivatable blood
factor having a portion of activated blood factor of
- ~.2 -
CA 02285976 1999-10-07
RCS' !3Y : 1 ~- ~-r ~'O:-) : 9 = 5'?AM ~ ._. ~W3 l 512 J8 p5-: SMART & B 1
GGAR : # 14
less than 50%, based on the coxa.tent of activated and
non-activated blood Factor, preferably less than 40%,
more preferred less than 30%, still more preferred less
than ~Q%, further preferred less than 10%, mast
preferred less Chan 1%, and a detergent content.
In particular, the preparation is a prothrombin
complex containing preparation having a factor vlza
nativity of less than 50%, based or: the content of
activated and non-activated factor VII, preferably less
than 10%, most preferred less than 1%. The detergent
content of the preparation according to the invention
is pr~aent in a pharmaceutically acceptable amount,
preferably between l% and the detection limit of the
detergent.
By ~~autodynamically activatable bland factor~~,
according to the present invention a blood factor is to
be understood which is autc~caGalytically activatable by
surface contact or by processes, such as, e.g.,
chromatographic processes. In particular, such a blood
factor is a blood factor selected fro~rn the group of
factor VII, factor XII, factor XT and pre-kallil~rein.
In a further preferred embodiment, the preparation
is free from serine protease inhibitors, such as, e.g.,
thrombin inhibitors, ar cofactors, such as, e.g.,
heparin. In a special embodiment, the freedom from sucks.
substances exists already during a chromatographic
process.
- 13 -
CA 02285976 1999-10-07
RCS- BY' lU- ?-'~9 :g:53A!vl ~ +9:3 1. 51'? 98 U5-j SMART & BtC,GAR:~tlS
Therefore, the pre6erit invention also relates to
correspox~ding preparatioils obtainable by the method
according to the invention.
Ire trie preparation according to the invention, also
further additives may be contained, e.g. substances,
such as arnirla acids, which act in a stabilizing manner.
The present invenr.ion shall be explained in more
datail by way of the Following examples without,
howevex, being restricted thereto.
EXA1~F~8 1:
Detei,geat treatment of activated prothrombin
complex I~ETHA in the p~reeenae of TWEEN~~-80
15 m3 of DEAF-Sephadex~ A-5~, from Fhaz-nacia, were
incubated far 15 min at room temperature with 1 ml of a
solution of 30 g/1 EJaCl in water until swelling.
Thereafter, the gel was separated from tree swell~.ng
supernatant by centrifugation. There followed five
washings of the gel wz.irh Z ml of 1-;uffer each (9 gel
Nay FiPO,~ . 2H? O, 7 g/1 BTaCl, pH 7 - 0; and twa further
washp.ngs with a buffer (7 g/1 Na3 c~itr3te .2~iz D, 7 g/1
NaCl) also by resuspension and centri.fugati~on.
30 ml of fresh frozen human citrated. plasma were
thawed a>"- 0 to +4~C, and the oryopreclpitate incurred
was separated by centriftag&tion at +2°C. The
'"cryosupernatant" resulting therefrom was irzc.ubated
with the washed DEF.E-Sephadex~, FEiHA being generated
and adsorbed on the gel together with the factors of
- 14 -
CA 02285976 1999-10-07
RCV ~3Y~ ~«- ?-~''~ : ~3:~i:3:~11 ~ 't'1z;- 1 ~IZ 98 t) i~-~ SilI.ART &
BIGCiAk:#LE.
tha prothrombin complex and inert protein. Thez~eafter,
coadsarbed inert protein was removed from the DEAE gel
by washing with a buffer (9 g/1 Nay HPO~ . 2Hz O, 7 gJl
NaCl).
The buffer-moist gel/prote~.n complex was then
suspended for i h at asqv with z.5 ml of a solution a~
150 mg/ml TWEEN~-80 arid 30 mg/ml NaCl. By the treatment
with the solution of high iania strength, protein was
desorbed tpgether with the factors of the prr~thrombin
complex and pathogens possibly present. Subsequently,
the suspension was diluted by adding 6.5 ml of water
and readsaxbed for 2 h at roam temperature, the protein
fraction bei.z~g readsorbed again" whereas components of
the inactivated pathagez~ remained in sr~luticn togethex
with the detergent. 'The gel/pratein complex was then
washed five times, each with I m? of a solution of
g/i h'aCl in water go ae to be detsrgent~free.
Ear elSaLa.on, the gel was treated under stirring
with 0.7 ml of a solution of-. 30 g/1 NaCl in water. The
eluate was then dialysed against distilled water,
frozen, and lyophili2ed. Azter reconstitution of 4he
lyophilisate, the FEIH~activity was determ:~neci
according to AZ'-B 350 726.
preparation of FEIBA prepared in the same manner,
yet without treatment witri a detergent, was used as the
cor~>r xo 1 .
The analysis of the preparation obtained exhibited
- 15 -
CA 02285976 1999-10-07
1O _ 5 _ ~g : :3 : 53A~1 _:_ . ~'13 - 1 51 '? :3f3 05-~ SMART & B I GGAR : #
17
a specific activity of 3.2 U FEIBA/mg protein at a
protein content of 16.6 mg/ml after reconstitution of
the lyophilisate and was~comparabse with the method
variant without detergent treatment, a specific
activity of 2.8 U/mg protein being obLai.ned at a
protein concentration of 16.5 mg/ml.
E~CI~MPLE Z
Detergent tr~atmeat at the de~orption of FETBA with
ext~rid~d ineubatioxi time
The prothrombin complex fraction was adsorbed on
DEAE-Sephadex~ az~alogoug to Example 1, washed free from
inert protein, subsequently ~.t was desorbed with a
TWBEN°/NaCl solution. However, the protein fraction was
kept for 2 or 3 hours, respectively, in the desarbed
state under otherwise equal conditiorxs. thereafter it
was worked up to the final. product ae described in
example 1.
The analysis of these formulations yielded a
specific activ~.ty of 2.5 U of FEIBA/mg of protein at a
protein content of 16.6 mg/ml with 2 h of incubation in
the presence of TWEENR'-84, and a specific activity of
2.3 T1 of FEIBA/mg of protein at a protein content of
17.4 mg/ml with 3 h of incubatic~n'with detergent.
Thus it could be demonstrated that also the
extended contact time with the detergent was not
connected w~.th any substantial inactivation of the
active suk~stance or reduction of yi.eJ.d.
- 16 -
CA 02285976 1999-10-07
RCV BY ~ _ ~W W g~3; ~'O : 58A~I .;_. _ _ ~4:3 I ' 1 '' B8 05~ SMAR'C & B I
GGAR ; # 18
EX~1M8LE 3:
Dstergaat traatmeat of F'8I8A with readaorption on a
differrut gel
rEIB~r was prepared as described in Example 1, After
the treatment and desorption with detergent, the
solutiozz obtained was transferred irntr~ a co~ztairaer in
which 15 mg of DE1~E-Sephadex° A-50 , from Phr~t~macia,
were pre-incubated to swelling xn a solution of 30 g/1
Nacl anal subsequently were provided by ;~i.ve washings
each with .Z n21 df a buffer ( 9 g/1 Nay HPO~ . 2Hz O, 7 g/1
NaCl, pH 7_0?, and two further washings with a buffer
(7 g/1 Na3citrate.2Ha0, 7 g/1 NaCl~, each by re-
suspension and centrifugatiar~. After a 1 h adsorption
of the diluted protein complex for separat:i.rzg the
detergent, working up was effected according to the
process described in Example 1. The thus obtained final
praduat had a yield of 95~ as compared to a FEI$A
prepared aaaarding to the standard vax'iant, i.e.
withcut treatment with detergent, and was of comparable
specific activity.
BXAMFhE 4:
DetergGat treatment o~ activated pr~thrombia
complex FEIBA i,n the preaeace of TWEENn-$0 at irmreaeed
temperaturo
15 mg of DEAE-Sephadex° A-5o, from Pharmacies, were
incubated for 15 min at room temperature with 1 ml of a
solution of 30 g/1 NaCI in water until swelling.
- 17 -
CA 02285976 1999-10-07
RCV f3Y ' 1.~'- ?-O~3 : 8 : ,~ ,~M ~ . - ~4:3 1 . 51'' G~ OWj SMART & B I GGAR
; # 1:1
'fhereaftex~, the gel was segarated from the swelling
supernatant by centrifugation. There followed five
washings of the gel with 1 ml of buffer each (9 g/1
Na" HP01 . 2H~ O, 7 g/1 NaCl, pH 7. 0) arid two further
washings with a buffer (7 g/1 Na3eitrate.~H~O, 7 g/1
NaCI) also by xesusp$nsion and centrifugation.
30 ml of fresh frozen human citrated plasma were
thawed at 0 bis +4°C, and the cryoprecipitate incurred
was separated by centrifugati4r~ at +2dC. The "cryo-
superziatant" resultir~g therefrom was incubated with the
washed DEAF-Sephadex'~, FEIBI~r being generated atZd ad-
sorbed on the geJ. together with the factors of the pro-
thrombin complex and inert protein. Thereafter, coad-
sorbed inert protein was removed fxom the DEP.E gel by
washing with a buffer (9g/1 Naa HPO~ .2Hx 0, 7 g/1 NaCl ) .
The buffer-moist gel/protein complex was then
suspended with 1.~ ml of a solution of 1 mg/ml TWDEN~-
80 and 30 mg/m1 NaCl for 1 h at room temperal:ure, the
protein fraction and non specifically adsorbed
impurities being desorbed. Subsequently, the gei was
separated by filtration. By further addition of '~E'WEEN~'-
80, tre protein :solution then was brought to a
detergent concentration of 150 mg/m1, and subsequently
was incubated either far x h at 25°c or for 1 h at 40°C
with stirring sv as to inactivate øny pathogens
possibly present. Thereafter, it was diluted by the
addition of 6.5 ml of water, and a freshly washed
- 18 -
CA 02285976 1999-10-07
RCV BY- _ _ I«- 5-9:3 : g:S.I.A,~1 ~. +'1B 1 512 ~~8 (15y SMART & C31GGAR:#20
prepared DEAF-Sephadex~ A-50 gel was readsorbed. Then
it was washed detergent-free by five waghinge with 1 ml
each of a solution of 7 g/1 NaC1 in water, anc~ F-i~rAaJ.1_y
the prepa,rati.on wary further worked ~p as dpacribed in
example 1
The analysis of both variants of tx'ea~:mer~C at. 25°C
and at 40°C showed a specific activity of the fEI~3A
preparation comparable to that of a standard variant
urithout vix-~: s inactivation. The yields were 'i~~ of the
standard variant.
g7C7~PLE 5:
Detergent treatment of prothrombiri CompleaC iri th.e
praaez~ce of Tw~:EN~-84 (at present ar~nsidared icy
Applicant to be the best mode of carrying vut the
invontioss)
30 ml of fresh froaen human citrated plasma were
thawed at 0 to +4~C, and the cryoprecipitate incurred
was separated by centrifugation at +2~C. The ~~tryo-
supernatant~~ resulting therefrom was admixed with 2 rU
of heparinrml. Subsequently, the prpteins of the pro-
thrombin complex were adsorbed v~rith T1SAE-Sephadexc° A-50
from Pharmacia, at a concentration of 0.5 mg/ml. The
gel/protein complex was separated from the solution arid
washed each With a buffer I (4 gll Na3citrate.2H20,
7 g/1 NaCl, 9 g/1 Na~HP0i.2Hz0, 500 IU of heparin/1, pH
7.5) azxd subsequEntly washed with buffer 2 (4 g/1
Na~citrate.2H=p, 7 g/1 NaCl, 500 TU of hepariri/l, pH
- 19 -
CA 02285976 1999-10-07
Rl i' BY : 1_« - > v ~3~') : ~ : >9 ,1M ~ .. +'1:.3 1 i l '1 JF3 0.5-> SiIIART
& 1B 1 GGAR : # '__> 1
7.5) -
The washed gel wa$ then suspended for pathogen
inactivation with 1.5 mJ_ of a solut:i.on containing
150 mg of TWEEN~-80/ml and. 3l1 mg of NaCIJml, for 1 h at
2~°C. By this treatment, the protAin fraction was
deaorbed together with any pathogQns or pathUgen
fragments possibly present, and in the cn:.~rse c~f
incuk~at?on with the detergent, such pathcagens were
inactivated. Subsequently, it was diluted with 5 mJ. caf
water as described in example l, and the grotein
fraction including tt~e active substance was readaorbed
t4 the ion exchange matrix for 1 h at room tempex'ature.
Theri it was v~rashed five ti;ttes with 1 ml. of a suffer
(4 g/1 Na, citrate; 7 g/i NaCI , 5C~ TU of heparin~'1, pH
'7.5) sc~ ass to be detergent-free, and eluted with a
solution of 1 g/1 Na3 citrate.2I~~C7, 30 g/1 NaCl,
1,00 TU of heparin, pH 7Ø To the el.uate, 1 zU of
heparin/ml was ad,.~,ixed. The prat~hrombin complex-
containing solut=an was rebuffered against a buffer
containing 4 g/1 Na3citrate.2H~G, 8 g/1 NaCl, pH 7.0,
and lyoph~.li~ed. In the reCOtlsL:itvted, lyophilized
p:rc~thrombin complex the protein content al.d the content
of prot:rsroxbin complex factoz°s was tested; the result;
can tae t~ake~: from Table 1 ,
A Celt mixture wit.~lout TWEEN~' treatment was
prepared ds the control. The analysis results can also
be Oaken from Table 1.
2~ _
CA 02285976 1999-10-07
RC'V f3Y - _ 1 «- 5-:)9 : ~) : 55A)9 : . _ +'1W ~>1'~ 9~3 US-> S!41AR'f & f3I
GGAR : #'?2
TABLE 1
Comparison of the activities of the prvthrombin
complex frxctar~ after carrying out the Method acoazding
to the invention and without that method
V
f~
M
C1
ra
W
Q :
'~
f3a N N
~J N '
,-t
ii
~
Lt~ N CV
~
x
H
o
-1-' a e.~
~
V
...
to "~ cV
~
Gv N ~V
~
H
H
r~
~-I
rv
O
~
rn o
0
o ~
~ N
i
o
u° ~ o
- 21 -
CA 02285976 1999-10-07
RCV BY : 1()- 5-;~9 ; 9: 5 iAYI : 'f''Ia3 - 1 51'~ '3f; (1?-j 541.ART & E31
CIGAR : #2a3
Tt has been. shown that no aubatantial change of the
composition of the prvthrombin complex was effected by
the detergent treatment.
EX~rMPLE 6:
Deirergm>;tt treatment of factor V== with TWEEt~1'~-80 as
compared to vxrul: 3,xzsctivation of factor VYr according
to a conventional method
From human citrated plasma, the px~ot,tlr~ontbin complex
graction containing the coagulation factors
prothrombin, alight portions of factor VTT, factor IX
and factor x were separated as described in example 5.
The major portian of coagulation factor Vrr remaining
in the supernatant after adsorption on rFRF Sephadex~'
A-50 was then recovered by adsorption on aluminum
hydroxide. To this end, 10 ml of a 2% axuminum hydrogel
suspension were admixed per 1 1 supernatant after
separation of the prothrombin complex and stirred at
4~C for 30 min. Subsec,~uently, the aluminum
hydrax~.de/protein complex was separated by
centrifugai<a,an at 5, 000 rpm far 10 ;nin at approximateJ.y
4~C in a Sorvall RC3B ratar H~aOOA, the supernatant was
discarded, and the precipitate was suspended with 3.5 %
of the volume of the prothrombin campl.ex supernatant
used for adsorpticn, in a solution of ~ g/1 of
Na~citrste.2HaO axed 7 gf1 of Nafl, pH 7.5, and stirred
fQr 30 miri. By thi~9, inert protein was desarbed from
the aluminum hydroxide. The factor VTI rema~.ning on the
- 22 -
CA 02285976 1999-10-07
RC\ t3Y : _ 1«- 5-:~~_ : 9: 55AM ~ . +4~ l >1'' :1F3 Ou--i SM_AR'1' & B 1 GGAR
: #24
aluminum hydroxide was pelletiaed by renes~red
centrifugation as described abaue. The supernatant was
discarded, and the precipitate was further used far
further processing. For desorption of the protein
fra,ctio7n, the aluminum hydroxide/~actor VII complex was
stirred for 3Q rnin with 1 % by volume of the
prvthrombirr complex supernatant of a ~.3 mal/1
phosphate buffer, pH 8 .6 (53 .4 g/1 of Na2 HPO' .2H2 O were
adjusted to pH 8.& with a solut~.on of 41.1 gjl
NaH~ PO~ Ha O) used for adsorption and containing 1 % of
TWEEN~~-so. S2:bsequeatly, far pathogen irlactirration,
detergent was added to a final concentration of 15 % of
TWEEN~~BD, and then it was stirred for 1 h at 40°C.
Thereafter, the soluC:ion was cooled to approximately
22°C and diluted with 9 parts of aqua dest.. The factor
VII fraction was then readsorbed on 1 g/1 D>;AE-
Sephadex'~ A-50 under stirring for. ~. h at approximately
22°C. Then the gel/protein complex was washed
detergent-free on the sintered suction. filter by
washing threA times, with 100 ml each per l~.ter. c~f_
em~aloyed, diluted Z'WEENm solution, with a buffer
conta.i,ning 4 g/1 Naj citrate.2H; O an~~'. 7 g NaCl/1, pH
7.5, containing 500 I1;1 of heparin/1. The elution Gf the
factor vII fraction was effected by stirring of the ion
exchanger protein complex and 1ao ml/1 of diluted
TWEEN~ solution of a 85 g/1 Na~l containing solutio>Z
for 30 min at 22°C. In the eluate, subsequently the
- 23 -
CA 02285976 1999-10-07
RCV' 131' : _ 1~- ~-~9 : 9: Sg.AM ~ ._ +ha3 1 512 9f3 05--~ SA9ART & 131 GGAR
: #'?5
faotr~r VII content wa~3 measured by means of a
chromogenic factor VIZ test, (Tmmunock~rom Faktor VII: C,
Z1~IT1N0 AG, Vienna, measured against the international
prothrornbin complex standard), the protean content was
c~uantitated according to the method of Pradford [Anal.
Biochem. '72 :248-254 {1976) ) arrd factor VIIa according
to the method from US 683,682 (measured against the
intez'national factot~ VIIa standard). The results can be
taken from Table 2.
For a comparison, factor VIT was separated from the
other proteins of the prvthrombir complex by adsorption
on aluminum hydroxide, as described above, and in the
adsorbed state it was treated according to EP 0 x.97 554
with the virus-inactivating agents from EP 0 1f1 740
with T'WEENe-80 and tri-(N-butyl?-phosphate (TNBP). To
r_his end, the alhydrogel protein complex was stirred in
an. aqueous solution of 1% TWEEN~-8o and o.3% tri-(N-
butyl?-phosphate for 18 h at 4°C w'iCxx a volume of
50 ml/1 prothrombin complex supernatant. Su~asequently
it was centr,i.fuged as described above to separate the
aluminum hydroxide protein complex, and by wasx7i,r,g with
3 x 100 ml of a soll~r.ion of 4~ g/1 Na3 citrate.2H~ O,
7 g/1 NaCl, pH 7.5, it was freed from an excess of
TwEEN~-80 a~td tri-(N-butyl.)-phosphate by resuspending.
Between each wash, thexe followed a palletizing of the
aluminum hydroxide/protein complex by centrifugation.
Elution was carried out under the same conditions as ~.n
- 24 -
CA 02285976 1999-10-07
RCS' f3Y ~ 10- 5-99 ; 9 : SE~AW1 : ~4a3 1 51 '? 98 05~ SMAKT & B I GGAR : #2G
the parallel test mixture according to the method of
the invention. Likewise, the ana3.yses of the final
pxoduct were carried out analogously. The results can
be taken from Table 2.
T ~ 2
Factor VTIa activities after carrying out the method of
the invention and after carrying out the method
aCCOrding to EP 0 197 554.
25 -
CA 02285976 1999-10-07
l2C.'V 6Y v _ J U- ~>-X79 : .3: ,F>.hM : _ ~'IW 1 51'? '.3f1 05-~ SM~R'f & B I
C~G~1R : N'?7
rl H
i ''r
U m
tt~ H ~' s~
r1 ao .-r
W ,"y
H '-" C M
r.
U '.. ~'-
W ~ H
N v-i
~ r
ri ~
~
1 ~, N ID
V -
V ~ ~'1 t~
~v
(a
I'1
+i V
~.
~t1
C4 U O G
'-'
O
w~ .IJ
m -a
.--
_
~
~~
Q,
H
~:
n ~ ~
a
V I~ r1 r'7
n1 '-'
U
N
~
U ~
r1
s~
a
O at-~
ri w-)
~ C1
h
O ~ rd
rti rtl
d ~7
H
Sa N e'~1
i~
~
I ~
O
Qf Gf
f-1 iN
~ 0
W
W I=4
-ri t1
Gti
- 26 -
CA 02285976 1999-10-07
kCV FIY~ lU- y-99 : g:;pE>A:M :. +'l~ l 51'? ,)8 ()5-~ SMART' & C31GGAR:#''>8
I~ has lean shown that by applying this method, i~he
faotar VIIa content was marked7~y .i.noreased as anmp~red
to the method aaoor_di_z~g to the ~.nvenU-zc~2l, yer. despite
the complex treatment of factor v:t I. nc~ ac~ti.vatznn could
be round. Moreover, with the method accord-ng to the
invention, the specific act~.vity of the obtained
product was higher than in the comparative preparation.
BXA~pLE 7:
S~amiqua~atit~tiv~ doterrn,i~a~,tioia of hepatitis G virus
In the pathogen inactivation formulations of
examples 1 to 6, the samples were drawn from each of
the starting materials, supernatant after
cryoprecipitatier~ or adsorption supernatant after
separatioil o~ the coagulation factors Ir, r~ and X, as
well as the corresgoc~dingly purified and concentrated
cvaguJ.~atian factor preparations. U.5 ml of these
rsamples were diluted 1 + 1. with physiological
phosphate-saline buffer, and viruses possibly present
were pelJ.etiz~d by ultracentritugation. The RNA was
extracted from the viral pellets by means of the RN~zal
reagent method (Bivtecx, Houston, Texas), and dissolved
in sterile a. dart..
RT-SCR for h°patitis ~ virus (HGV)nucleic acids was
~:arried out with the primer pair NS5a 1 and NS5a 2
(Linnen, J. et al., Science 271: 5~5-5Q8 (1996)). The
sequence of the primer used (obtai:~able from Hoehringer
Mannheim, Germany) for N85a 1 was:
CA 02285976 1999-10-07
RCS' B1': _ 1«- 5-aJ : a:57AN : ..~9~<3 1 51? 98 05--j SY1AR7' X~
E31GG.AR:#2:3
5'CTCTTTGTGGTAGTAGCCGAGAGAT ~~, and for NSSa 2:
5'CGAAT'GA.pTCAGAGGACGGGGTAT 3'. The primers were
labelled with a fluorescent dye, and the fluorescent
amplicons resulting therefrom accord~.ng to Gha routine
methods of common pevR protocols were analysed on an ,A,~3I
377-Sequencer of Applied Biogystem~s. tn order to ba
able to exclude the presence of RT-PCR inhibitors iz~
the samples, the samples were spiked with hepatitis C
virus-RNA mimics and analyzed in a hepatitis C-PCR
carried out according to EP 0 '~14 988. Exclusively
extracts which did not show any inhibition in the HCV-
PCR were used as evaluatable for HaV-PCR. The intensity
of the fluorescence was taken as a measuxe for the
content of hepatitis G virws_ zt hag been shown that
starting materials used for fx~actianation had highly
positive signals prior to pathogen inactivation
according' tQ the inventive method, i.e. t>.ad a high
concentration. of HGV nucleic acid amplificates, whereas
in the eluates after readsortpion and separation of irhe
vixus-inactivating agents, rio HGV-RNA could be detected
any longer.
Tn parallel assays without carryzng out a detergent
treatment, the eluates as well ae the starting
matera.als used v~rexe HGV-PCR-positive.
_ 28 _
CA 02285976 1999-10-07
