Note: Descriptions are shown in the official language in which they were submitted.
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
1
METHODS OF PRODUCTION OF AN AMIDATED PEPTIDE THROUGH THE USE OF A FUSION
PROTEIN
The present invention is directed to the production of peptides, especially
but not
exclusively with carboxy-terminal modifications such as amidation, by
recombinant
means.
"Peptide" is a term loosely applied to a chain of amino acids, arbitrarily
applied to
sequences of three to over one hundred components, but possibly more, joined
via
their amino- and carboxy termini. There are many examples of naturally
occurring
peptides which function as hormones, messengers, growth factors,
antimicrobials,
o surfactants etc and a wide variety of medicinal and other applications can
be
envisaged.
Currently, there are at least three major sources of peptides, extraction from
natural
sources, chemical synthesis and from organisms transformed with recombinant
DNA constructs. The advantage of the route using transformed organisms is the
biological fidelity of the synthetic process, the ability to synthesise
chemically
unfavourable sequences, the avoidance of chemical processes, using solvents,
etc
and, especially with longer peptides, cost-effectiveness.
2o The disadvantage of making peptides by recombinant technology is that the
organisms used tend to be poor at synthesising, and if necessary secreting,
short
sequences of amino acids. Therefore, many of the methods considered for
industrial use take advantage of fusion proteins where the short peptide
sequence is
made as either an amino- or a carboxy-terminal extension on another protein.
Although these fusion p:oteins can be produced in greater quantities, and
often
purified by exploiting special characteristics of the fusion partner to
simplify
purification, difficulties can be experienced in recovering the peptide.
Proteins are
chemically stable molecules and therefore require specific cleavage strategies
in
CA 02287204 1999-10-21
WO 98150563 PCT/GB98/01281
2
order to recover integral peptides with defined amino- and carboxy termini.
A wide panel of protein cleavage technologies can be envisaged. These range
from
chemical cleavage at specific amino acids to enzymatic cleavage using
sequence-specific enzymes. Examples of chemical cleavage include cyanogen
bromide cleavage after methionine residues and hydroxytamine cleavage between
the amino acid pair asparagine - gtycine. Examples of enzymes suitable for
cutting
at specific protein sequences include enterokinase, which cuts after the
sequence
(aspartic acid)4 -lysine, and thrombin, which cuts after the basic amino acids
lysine
or arginine.
A common problem with both of these cleavage strategies is that sequence
constraints operate on both the presence of internal sites within the peptide
and the
necessity to generate authentic amino-termini. For example, cyanogen bromide
is
~ 5 only useful when there are no internal methionines in the peptide and
thrombin can
cut at a number of different sites after basic amino acids. Enzymatic cleavage
has
additional problems in terms of process economics. The enzyme must come from
an acceptable and validated source (a common source of enterolcinase is calf
gut
endothelium) and be available in economically acceptable quantity.
Carboxy-terminal amidation is a common post-translational modification found
on
many biologically active peptides of potential commercial interest. Examples
include calcitonin, magainin and etc. . In many instances, for example,
calcitonin,
the natural amidated peptide is nearly two thousand times as active as the
non-amidated version.
There are many different chemical and biological methods designed to produce
carboxy-terminal amidated peptides. However, as with any extra process step,
each
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
3
has disadvantages in terms of adding to the overall cost of the finished
product.
This invention describes a method for the production of peptides as amino-
terminal
extensions of fusion proteins in recombinant systems. We provide novel methods
whereby cleavage of the peptide from the fusion protein and modifications of
the
peptide such as carboxy-amidation can occur as a series of linked reactions in
a
single process. Such an approach benefits from the low cost and fidelity of
synthesis in a biological expression system without the disadvantages posed by
the
necessity of a separate cleavage step.
Thus, in a first aspect, the present invention provides a method for the
production
of a peptide which comprises the step of expressing the peptide as part of a
fusion
protein followed ~y release of the peptide from the fusion protein by an acyl-
acceptor such as a sulphur containing reductant. Suitably, at least part of
the fusion
~ 5 protein is a molecule capable of catalysing transfer of the peptide, as an
acyl
moiety, to a suitable acceptor such as a proximal sulphur atom to form the
thio-ester.
In preferred embodiments the peptide is chemically modified, eg amidated at
its
2o carboxy terminus after release from the fusion protein. Suitably, the
amidation step
is carried out in the presence of a source of ammonium ions at a suitable pH
and
the amidation step occurs simultaneously with release of the peptide. Examples
of
amidated peptides which could be prepared using these methods include Salmon
Calcitonin, Human Calcitonin, Lutenising hormone releasing hormone, Oxytocin,
25 Gastrin neuropeptide Y, Vasopressin, Corticotrophin releasing hormone,
Growth
hormone releasing hormone, Human Calcitonin gene related peptide, Gastrin, D-
tyr-trp-gly, phe-gly-phe-gly, gly-phe-gly, Melanocyte stimulation hormone
precursor, Sectetin, Thyrotrophin releasing hormone, Amylin, Substance P,
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
4
Pancreatic polypeptide, Cholecystokinin, Gastrin secretion factor, phe-his-
ile, phe-
tyr-tyr, Savagin, Mastoparin M, Caerulein and FMRF amide.
However, it is also possible to perform simple hydrolysis of the peptide in
the
absence of ammonia which would result in the formation of a free carboxylic
acid
terminal group. This makes the methods of the present invention suitable for
the
commercial production of peptides with free carboxy-termini for medicinal or
other
applications. Examples of such peptides include Hirulog, Magainin, thymosin
alpha-1, brain naturetic peptide, attial naturetic peptide or
bactericidal/permeability-increasing protein.
The methods of the present invention can for example utilise a commercially
available expression vector designed for making proteins as fusion proteins.
This
vector incorporates a modified self splicing protein, an intein, making it
possible to
liberate the protein from its fusion partner by a simple chemical reaction.
The
invention utilises modified chemical conditions/steps to result in cleavage of
the
fusion protein thereby liberating a desired peptide, which can be modified
e.g. by
ambition at the carboxy-terminus.
2o Inteins are proteins which are expressed with flanking protein sequences at
both
amino- and carboy-termini. The amino- and carboxy-terminal sequences have been
named exteins in keeping with the DNA nomenclature of exons and introns. A
seemingly typical member of the emerging family of inteins is the VMAI gene
product from yeast. This is approximately SOkDa in molecular mass and contains
essential amino acids at the amino terminal (Cysteine) and at the carboxy-
terminal
(histamine and asparagine). In addition, the carboxy-terminal extein must
start with
a cysteine. At some point after translation is completed, the amino-terminal
peptide
bond is broken and the extein transferred to the sulphur atom of the adjacent
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
cysteine to form a thio-ester. This bond is then exchanged with the cysteine
at the
start of the carboxy-terminal extein and then, with participation of the
adjacent
asparagine, exchanged with the peptide bond at this end of the intein. The
overall
effect of these concerted reactions is that the two exteins are seamlessly
joined and
5 the intein is released.
A detailed understanding of these reactions has emerged following the analysis
of a
series of mutants where essential groups at either end of the intein and the
proximal
ends of the exteins have been systematically replaced. This knowledge has
enabled
the design of mutant inteins where the amino-terminal extein can be replaced
by
any other protein and the self splicing function has been disabled. However,
cleavage of the resulting fusion protein is still possible by the addition of
extraneous chemical agents such as the reductant dithiothreitol. The fusion
protein
is liberated as a thio-ester with the added reductant which gradually
hydrolyses to
~ 5 the free acid in solution.
Calcitonin is an example of a medically and commercially important peptide
suitable for manufacture using the methods described in this invention. It
contains
thirty-two amino acids and is amidated at the carboxy-terminus. The functional
2o activity and amino acid sequence is highly conserved between species. Thus
salmon
Calcitonin , which was originally obtained mostly from natural sources but is
now
made by direct synthesis, is in widespread clinical use. In the past,
therapies have
focused on Paget's disease and hypocalcaemic shock. However, recently there
has
been a demand for larger amounts of material to treat osteoporosis in
25 post-menopausal women. This application requires substantive quantities of
material which makes the cost of production an increasingly important factor.
In order to make Calcitonin using the intein vector it is necessary to prepare
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
6
complimentary oligonucleotides which encode the Calcitonin sequence flanked by
restriction sites designed for insertion at the appropriate site 5' to the
modified
intein. These sites must be chosen so that the coding sequence of the peptide
is in
the same coding frame as the rest of the expressed protein. Suitable
oligonucleotides can be made by any number of methods, known to those skilled
in
the art, including most obviously direct synthesis and polymerise chain
reaction
amplification from a natural sequence using primers designed to contain
convenient
restriction sites. This DNA construct is then transformed into a suitable
expression
system and the resulting fusion protein harvested.
In a further refinement of the system the fusion protein also comprises a
label,
which allows for identification and/or purification of the fusion protein, and
thus
the peptide, by affinity or other chromatographic methods. Examples of a
suitable
label include a specific chitin-binding domain, or part thereof, a repeat of
acidic or
~ 5 basic amino acids, a poly-histidine sequence, glutathione S transferase
and
lysozyme. For example, the carboxy-terminus of an intein can be fused with a
specific chitin-binding domain. This binds tightly to a packed column of
chitin
beads and can be used for the affinity-purification of the intact fusion
protein. After
extensive washing, the column can then be treated with an appropriate cleavage
2o reagent and the liberated target peptide eluted.
Any expression system which can operate on a commercial scale is suitable
although the intein based vector described above is designed for use in E.
coli.
Other vectors can be designed for optimal use in a particular expression
system.
25 For example, if a maic~malian expression system was chosen, then protein-
encoding
regions should have optimised colon usage for that particular system.
Expression
could also be improved by use of a smaller affinity tag for identification
and/or
purification such as a repeat of acidic or basic amino acids as described
above, to
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
7
permit resolution from contaminating proteins by ion-exchange chromatography
or
by the inclusion of a poly-histidine sequence for purification on a metal
chelate
matrix. A further modification which could improve secretion from a mammalian
system (the current E. coli vector is designed for intracellular protein
production)
would be to add a secretory leader sequence to the calcitonin to promote
secretion
into the media or into the milk of transgenic animals. Suitably, such a leader
sequence should be removed during the secretory process by natural processing
enzymes.
1 o Examples of expression systems which could be used to express peptide
fusion
proteins include bacteria (E.coli, B.subtilis etc.), yeast (S. cerevisiae,
P.pastoralis
etc.), insect cells (S. frugiperda), mamcnaiian expression systems (chinese
hamster
ovary, baby hamster kidney etc.), transgenic mammalian expression in milk or
other body fluids (preferably pig, cow, sheep, goat, rabbit etc) and plants
(potato,
~5 corn, etc). In the case of an E.coli expression system, the initiator
methionine will
be retained in the expression product. Thus, where the peptide of interest is
one
which does not include an additional methionine in its sequence, this
initiator
methionine can be removed using cyanogen bromide. One example of such a
peptide is Calcitonin.
Expression could be optimised for any of these systems, and for intracellular
or
extracellular production, by the appropriate selection of leader sequence,
codon
usage, intein or mutant thereof, and purification strategy. The skilled person
will
appreciate that this invention is not tied to any particular manifestation of
intein or
any species as a source. For instance, it may not be necessary to use a whole
intein
molecule, much of the sequence may be irrelevant to the desired process and
perhaps most of the molecule is functionally unnecessary. Indeed, other
proteins
outside the definition of "intein" may be capable of transferring the peptide
bond at
CA 02287204 1999-10-21
WO 98!50563 PCT/GB98/01281
8
the carboxy-terminus of the target peptide to an appropriate thiol group thus
creating the thin-ester group which is necessary for cleavage with concomitant
amidation.
Thio-esters are relatively reactive chemical groups, compared to either
peptide
bonds or oxygen-esters, and are therefore readily converted to amides under
mild
reactive conditions. There are two points in the nornial cleavage and release
pathway during which the fused peptide can be converted to a carboxy-terminal
amide. The first and probably most suitable point is after the peptide has
been
released from the fusion partner by the addition of a thiol reagent. The
preferred
reagent is dithiothreitol but any number of sulphur-containing reductants
could also
function effectively. This reaction is essentially a thiol-interchange
reaction where
the thiol-ester formed between the carboxy-terminus of the peptide and the
sulphur
of the intein cysteine is transferred to one of the dithiothreitol sulphur
atoms. As
with any chemical reaction, the acyl shift reaction, between the amine of the
cysteine at the amino-terminus of the intein and the sulphur of the same amino
acid
residue, is an equilibrium. With the yeast intein described above this
equilibrium is
shifted in favour of the amine group and the thio-ester is a minor component.
The added thiol reagent removes this thio-ester species and therefore drives
the
reaction in the direction of making more thio-ester until effectively all of
the
peptide is released as free thio-ester. The released thio-ester is relatively
stable to
hydrolysis by water (which would generate the unwanted free acid) and is thus
suitable for cleavage by any chemical conditions which will promote amide
formation.
The second point where the peptide exhibits a thio-ester is to the intein
itself but as
described above, this species is a minor component. However, even here it
would
CA 02287204 1999-10-21
WO 98!50563 PCT/GB98/01281
9
be possible to design chemical conditions to allow simultaneous release of the
peptide as an amidated species.
The conditions expected to favour thin-ester cleavage with concomitant
amidation
are many and the following is only meant to illustrate a representitive
selection of
the possible reagents and reactions. Chemically, amides can be formed by the
cleavage of thio-esters with ammonia and related compounds. This requires
conditions where the positive charge of the carbonyl is enhanced (which is an
effect
of the adjacent sulphur atom) and the lone pair of electrons on the nitrogen
of
ammonia are available. In aqueous solution the positively-charged ammonium
ion,
provided by a salt such as ammonium phosphate or sulphate, is in equilibrium
with
uncharged ammonia, the reactive species, and the concentration of free ammonia
is
thus increased with a lowering of the hydrogen ion concentration. It is
therefore
expected that the reaction promoting the formation of the amide product,
although
~ 5 likely to proceed at relatively low pH values, for example pH 4.0 to 6.0,
will occur
more rapidly as the pH is increased in the range 6.0 to 9.0 or even 10.0,
where the
equilibrium is shifted significantly in favour of ammonia formation.
The optimal range will be a compromise between the highest pH which will be
20 tolerated by the peptide substrate itself and the lowest pH whereby the
reaction still
proceeds at an acceptable rate. This optimum range will be determined by the
sequence of the peptide itself and other factors relating to the properties of
the
fusion partner and to process-related, especially purification, issues.
Similar
conditions and constraints are likely to apply whether the cleavage/amidation
25 reactions occur simultaneously or sequentially. There are many other
chemical
conditions which can be envisaged by those skilled in the art, both in aqueous
and
non-aqueous systems, which could achieve the desired reactions. The above is
meant simply as an illustration of a suitable method and is not intended to
exclude
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/OI281
these other possible approaches.
The invention will now be described by way of the following examples, which
should not be construed as limiting the invention in any way.
5
Example 1 : Glycine Extended Salmon Calcitonin
1.I. Cloning Strategy
Vector pCYBl, obtainable from New England Biolabs, containing a NdeI site for
1 o translation initiation and a SapI site directly adjacent to the intein,
was used to
clone and express glycine extended salinon calcitonin (sCT-G). The sCT-G
coding sequence was synthesised as two complementary single stranded
oligonucleotides of 103bases and 104bases. The codon usage was optimised for
expression in E.coli. Annealing of the two strands produced 5' overhangs
complementary to the Ndel (5' end) and the SapI site (3' end). The double
stranded oligonucleotide was inserted into pCYB 1 digested with Ndel and Sapl.
The expression of the fusion gene is under the control of the P"~ promoter and
is
regulated by IPTG due to the presence of a laclq gene on the vector.
1.2. Fusion Protein Expression and Analysis
The pCYB 1 vector containing sCT-G was transfected into DHS-a, cells grown,
induced with IPTG, harvested and lysed by sonication. Expressed fusion was
captured on chitin agarose which was washed and then boiled in SDS-PAGE
sample buffer. The supernatant was run on 16 ~ SDS-PAGE gels and the protein
visualised with cooma~sie stain or electroblotted to PVDF membrane for N-
terminal sequencing. The sequence analysis indicated that the sCT-G was N-
terminally truncated at two positions; Ser2 and Thr6.
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
11
1.3. Fusion Protein Cleavage and Peptide Amidation
Chitin agarose bound fusion was washed with 20mM Hepes pH 8.0, 40mM DTT
(cleavage buffer A) or with cleavage buffer A supplemented with 3.OM
ammonium bicarbonate (cleavage buffer B) and incubated at 4°C
overnight.
Released sCT-G was washed from the column and captured on a cation exchange
resin then eluted .with a salt step. C 18 RP-HPLC analysis after digestion
with
trypsin showed that the product formed with cleavage buffer B contained
greater
than 90 % amidated C-terminus while the product with cleavage buffer A had a
mixture of carboxylic C-terminus and an adduct extended by a single Cys
residue, presumably from the intein N-terminus (Figure 1).
Example 2 : Leutenizing Hormone Releasing Hormone (LHRH)
2.1 Cloning Strategy
Cloning was preformed exactly as described for sCT-G except that the
oligonucleotides contained the LHRH coding sequence (Tan, L. and Rousseau, P.
Biochem. Biophys. Res. Com. 109: 1061-1071 (1982)).
2.2. Fusion Protein Expression and Analysis
As described for sCT-G. N-terminal sequencing demonstratred the LHRH was
extended at the N-terminus by a single Met residue, retained from the E.coli
initiation signal.
2.3. Feision Protein Cleavage and Peptide Amidation
The LHRH fusion was treated in the same manner as the sCT-G fusion until the
final cation capture step. The column wash was applied directly to an
elecrospray
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
12
mass spectrometer and the data reconstructed to give the mass of the parent
ion
(Figure 2). LHRH from cleavage buffer B (as described in example 1) resulted
in a parent ion with a mass of 1331Da consitent with the Met extended,
amidated
molecule. LHRH from cleavage buffer A (as described in example 1) gave a
parent ion mass of 1332 Da consistent with the Met extended free acid. The
difference of 1Da is the expected mass difference between an amide and
carboxylic acid.
EXAMPLE 3
1 o Cloning of Human Amylin
The IMPACT I (Intein Mediated Purification with an Affinity Chitin-binding
Tag)
protein purification system from New England Biolabs (NEB) offers 4 E. coli
expression vectors, which differ in their available cloning sites. Human
Amylin
~ 5 is cloned using the NEB vector pCYB 1, which contains a NdeI site for
translation
initiation and a SapI site directly adjacent to the intein.
The Human Amylin sequence is synthesised as two complementary single
stranded oligo nucleotides of 115 and 116 bases respectively. The codon usage
is
20 optimised for expression in E. toll. Annealing of the two strands produces
5'
overhangs complementary to the NdeI (5' end) and the SapI site (3' end). The
double stranded oligo nucleotide can be inserted directly into pCYB 1 which
has
previously been digested with both NdeI and SapI.
PCYB1:
5' CAT ATG GCT ACC...........................GGC TCT TCC TGC TTT 3'
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
13
3' GTA TAC CGA TCG...........................CCG AGA AGG AGC AAA 5'
NdeI SapI
Human Amylin:
NdeI BspMI
CATATGAAATGCAACACCGCGACCTGCGCGACCCAGCGCCTGGCG
GTATACTTTACGTTGTGGCGCTGGACGCGCTGGGTCGCGGACCGC
MboI DdeI
AACTTCCTGGTGCATAGCAGCAACAACTTCGGCGCGATCCTGAGC
TTGAAGGACCACGTATCGTCGTTGTTGAAGCCGCGCTAGGACTCG
AGCACCAACTGGGCAGCAACACCTATTGCTTT
TCGTGGTTGACCCGTCGTTGTGGATAACGAAA
EXAMPLE 4
General Protcol for expressing peptide fusion proteins in E. coli and
purification
of fusion protein and released peptide
Expression in bacteria requires transformation of cells with an expression
construct using any one of a range of standard methods (Maniatis et al,
supra).
After cell growth, it is usual to induce expression of the target fusion
protein
using a combination of an inducible promoter, for example the ~3-galactosidase
promoter, and a small molecule inducer such as IPTG. The fusion protein is
then
recovered after cell harvesting and breakage and then purified by affinity
CA 02287204 1999-10-21
WO 98/50563 PCT/GB98/01281
14
chromatography. Most usually, this involves passing the clarified cell lysate
through a column of an appropriate affinity matrix displaying a ligand to
which
the fusion protein binds. Contaminants are then washed from the matrix before
either specific elution of the fusion protein or cleavage of the bound fusion
protein in situ. For instance, with the Impact vector described in Examples 2
and
3, the fusion protein containing lysozyme would be purified by cation exchange
chromatography. In this case, cleavage in situ is probably not an option,
unless
cleavage conditions can be found which do not promote elution of the fusion
protein. Under these circumstances, cleavage in solution phase would be
required. Cleavage of the fusion protein whilst bound to a matrix simplifies
the
subsequent purification of the peptide.
Cleavage of the fusion protein can be done by the direct addition of a thiol
acyl-
acceptor, such as IOmM DTT, to yield a thioester intermediate, which can
subsequently be converted to the amide by treatment with ammonia salts at a pH
above 6Ø Simultaneous cleavage and conversion t an amide may also be
possible with the addition of a suitable mixture of acceptor thiol and ammonia
salt.
2o Released peptide is then further purified, if necessary, using conventional
techniques such as solvent partitioning and HPLC.
