Note: Descriptions are shown in the official language in which they were submitted.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
1
DESCRIPTION
TRUNCATED VEGF-RELATED PROTEINS
Field Of The Invention
The present invention relates to novel truncated forms of
vascular endothelial growth factor (VEGF)-related proteins.
More particularly, the invention relates to N-terminally
truncated VEGF-related proteins that are substantially free of
other proteins. Such truncated VEGF-related proteins may be
used to stimulate angiogenesis in vivo and in vitro.
The invention also relates to nucleic acids encoding such
novel truncated VEGF-related proteins, cells, tissues and
animals containing such nucleic acids; methods of treatment
using such nucleic acids; and methods relating to all of the
foregoing.
Background
Vascular endothelial growth factors (VEGFs), also called
vascular permeability factors (VPFs), are a family of proteins
that are produced by many different cell types in many organs
and act in a highly selective manner to stimulate endothelial
cells almost exclusively (reviewed in Ferrara et al., Endocr.
Rev. 13:18-32, (1992); Dvorak et al., Am. J. Pathol. 146:1029-
39, 1995; Thomas, J. Biol. Chem. 271:603-06, 1996). These
publications, and all other publications referenced herein, are
hereby incorporated by reference in their entirety.
When tested in cell culture, VEGFs are potently mitogenic
(Gospodarowicz et al., Proc. Natl. Acad. Sci. USA 86:7311-15,
- 1989) and chemotactic (Favard et al., Biol. Cell 73:1-6, 1991).
Additionally, VEGFs induce plasminogen activator, plasminogen
activator inhibitor, and plasminogen activator receptor
(Mandriota et al., J. Biol. Chem. 270:9709-16, 1995; Pepper et
al., 181: 902-06, 1991), as well as collagenases (Unemori et
al., J. Cell. Physiol. 153:557-62, 1992), enzyme systems that
regulate invasion of growing capillaries into tissues. VEGFs
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
2
also stimulate the formation of tube-like structures by
endothelial cells, an in vitro example of angiogenesis (Nicosia
et al., Am. J. Pathol., 145:1023-29, 1994).
In vivo, VEGFs induce angiogenesis (Leung et al., Science
246:1306-09, 1989) and increase vascular permeability (Senger
et al., Science 219:983-85, 1983). VEGFs are now known as
important physiological regulators of capillary blood vessel
formation. They are involved in the normal formation of new
capillaries during organ growth, including fetal growth (Peters
et al., Proc. Natl. Acad. Sci. USA 90:8915-19, 1993), tissue
repair (Brown et al., J. Exp. Med. 176:1375-79, 1992), the
menstrual cycle, and pregnancy (Jackson et al., Placenta
15:341-53, 1994; Cullinan & Koos, Endocrinology 133:829-37,
1993; Kamat et al., Am. J. Pathol. 146:157-65, 1995). During
fetal development, VEGFs appear to play an essential role in
the de novo formation of blood vessels from blood islands
(Risau & Flamme, Ann. Rev. Cell. Dev. Biol. 11:73-92, 1995), as
evidenced by abnormal blood vessel development and lethality in
embryos lacking a single VEGF allele (Carmeliet et al., Nature
380:435-38, 1996). Moreover, VEGFs are strongly implicated in
the pathological blood vessel growth characteristic of many
diseases, including solid tumors (Potgens et al., Biol. Chem.
Hoppe-Seyler 376:57-70, 1995), retinopathies (Miller et al.,
Am. J. Pathol. 145:574-84, 1994; Aiello et al., N. Engl. J.
Med. 331:1480-87, 1994; Adamis et al., Am. J. Ophthalmol.
118:445-50, 1994), psoriasis (Detmar et al., J. Exp. Med.
180:1141-46, 1994), and rheumatoid arthritis (Fava et al., J.
Exp. Med. 180:341-46, 1994).
VEGF expression is regulated by hormones (Schweiki et al.,
J. Clin. Invest. 91:2235-43, 1993) growth factors (Thomas, J.
Biol. Chem. 271:603-06, 1996), and by hypoxia (Schweiki et al.,
Nature 359:843-45, 1992, Levy et al., J. Biol. Chem. 271:2746
53, 1996). Upregulation of VEGFs by hypoxic conditions is of
particular importance as a compensatory mechanism by which
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
3
tissues increase oxygenation through induction of additional
capillary vessel formation and resulting increased blood flow.
This mechanism is thought to contribute to pathological
angiogenesis in tumors and in retinopathies. However,
upregulation of VEGF expression after hypoxia is also essential
in tissue repair, e.g., in dermal wound healing (Frank et al.,
J. Biol. Chem. 270:12607-613, 1995), and in coronary ischem~a
(Banai et al., Cardiovasc. Res. 28:1176-79, 2994; Hashimoto et
al., Am. J. Physiol. 267:H1948-H1954, 1994).
The potential of VEGF to pharmacologically induce
angiogenesis in animal models of vascular ischemia has been
shown in the rabbit chronic limb ischemia model by
demonstrating that repeated intramuscular injection or a single
intra-arterial bolus of VEGF can augment collateral blood
vessel formation as evidenced by blood flow measurement in the
ischemic hindlimb (Pu, et al., Circulation 88:208-15, 1993;
Bauters et al., Am. J. Physiol. 267:H1263-71, 1994; Takeshita
et al., Circulation 90 [part 2], II-228-34, 1994; Bauters et
al., J. Vasc. Surg. 21:314-25, 1995; Bauters et al.,
Circulation 91:2802- 09, 1995; Takeshita et al., J. Clin.
Invest. 93:662-70, 1994). In this model, VEGF has also been
shown to act synergistically with basic FGF to ameliorate
ischemia (Asahara et al., Circulation 92:[suppl 2], II-365-71,
1995). VEGF was also reported to accelerate the repair of
balloon-injured rat carotid artery endothelium thereby
inhibiting pathological thickening of the underlying smooth
muscle layers, and thus maintaining lumen diameter and blood
flow (Asahara et al., Circulation 91:2793-2801, 1995). VEGF
has also been shown to induce EDRF (Endothelium-Derived
Relaxing Factor (nitric oxide))-dependent relaxation in canine
coronary arteries, thus potentially contributing to increased
blood flow to ischemic areas via a secondary mechanism not
related to angiogenesis (Ku et al., Am. J. Physiol. 265:H586-
H592, 1993). Together, these data provide compelling evidence
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
4
for a potential therapeutic role of VEGFs in wound healing,
ischemic diseases and restenosis.
The VEGF family of proteins is comprised of at least 4
members VEGF-121, VEGF-165, VEGF-189, and VEGF-206. The
originally characterized VEGF is a 34-45 kDa glycosylated
protein which consists of 2 identical subunits of 165 amino
acid residues (Tischer et al., Biochem. Biophys. Res. Commun.
165:1198-1206, 1989). The VEGF-I65 cDNA encodes a 191-residue
amino acid sequence consisting of a 26-residue secretory signal
peptide sequence, which is cleaved upon secretion of the
protein from cells, and the 165-residue mature protein subunit.
VEGF-165 binds strongly to heparin for which the strongly basic
sequence between residues 115-159 is thought to be responsible
(Fig. 1) (Thomas, J. Biol. Chem., 271:603-06 (1996)). The
other members of the VEGF family are homodimeric proteins with
shorter or longer subunits of 121, 189 and 206 residues (VEGF-
121, VEGF-189, and VEGF-206, respectively) (Tischer et al., J.
Biol. Chem. 266:11947-54, 1991; Park et al., Mol Biol Cell
4:1317-26 (1993)). The 4 forms of VEGF arise from alternative
splicing of up to 8 exons of the VEGF gene (VEGF-121, exons 1-
5,8; VEGF-165, exons 1-5,7,8; VEGF-189, exons 1-5, 6a, 7, 8;
VEGF-206, exons 1-5, 6b, 7, 8 (exon 6a and 6b refer to 2
alternatively spliced forms of the same exon)) (Houck et al.,
Mol. Endocr., 5:1806-14 (1991)). The VEGF sequences contain
eight conserved disulfide-forming core cysteine residues. All
VEGF genes encode signal peptides that direct the protein into
the secretory pathway. However, only VEGF-121 and -165 are
found to be readily secreted by cultured cells whereas VEGF-189
and -206 remain associated with the extracellular matrix.
These VEGF forms possess an additional highly basic sequence,
corresponding to residues 115-139 in VEGF-189 and -206 (matrix-
targeting sequence), which confers high affinity to acidic
components of the extracellular matrix (Thomas, J. Biol. Chem.
271:603-06 (199&)).
_-. _ r ___ - ___ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
Mitogenic activity of the various VEGF isoforms varies
depending on each isoform. For example, VEGF-121 and VEGF-165
have very similar mitogenic activity for endothelial cells.
However, VEGF-189 and VEGF-206 are only weakly mitogenic
. 5 (Ferrara et al., Endocr. Rev. 13:18-32, 1992). The reduced
activity of these isoforms is attributed to their strong
association with cells and matrix, as evidenced by the normal
mitogenic activity of a mutant of VEGF-206 which lacks the 24-
residue "matrix targeting" sequence common to VEGF-189 and
VEGF-206 (residues 115-139 in Fig. 1) (Ferrara et al., Endocr.
Rev. 13:18-32, 1992).
An N-terminal fragment of VEGF-165 generated by plasmin
(VEGF (1-110)) bound with the same affinity to the KDR receptor
as VEGF-165 and VEGF-121 whereas the C-terminal VEGF-fragment
(111-165) had no binding activity (Keyt et al., J. Biol. Chem.
271:7788-95, 1996). Interestingly, in this study the mitogenic
activity of VEGF-121 and VEGF-110 was reduced by approximately
110-fold as compared to VEGF-165, suggesting a potential role
of the C-terminal domain of VEGF-165 in the biological potency
of VEGF isoforms. The significance of this finding is somewhat
unclear in view of earlier results showing the equivalent
potency of VEGF-121 and VEGF-165 on endothelial cell growth.
Furthermore, since functional interaction of VEGF with the KDR
receptor is thought to be dependent at least in part on cell
surface heparin sulfate proteoglycan(s) (Cohen et al., J. Biol.
Chem., 270:11322-26, 1995; Tessler et al., J. Biol. Chem.
269:12456-61; 1994) it is conceivable that differences in
results arise from differences in various experimental systems.
' In this context it is unclear to what extent cell surface
heparin sulfates regulate the functional interaction of VEGF
121 (lacking a heparin-binding domain) and VEGF-165 (possessing
a heparin-binding domain) (Tessler et al., J. Biol. Chem.
269:12456-61, 1994; Cohen et al., J. Biol. Chem. 270:11322-26,
1995; Gitay-Goren et al., J. Biol. Chem. 271:5519-23 (1996)).
CA 02287538 1999-10-22
WO 98/49300 PCTIUS98/07801
6
VEGFs are related to platelet-derived growth factor
(PDGF)(Andersson et al., Growth Factors 12:159-64, 1995).
VEGFs are also related to the family of proteins derived from
the Placenta Growth Factor (P1GF) gene, P1GF-129 and P1GF-150
(Maglione et al., Proc. Natl. Acad. Sci. USA 88:9267-71, 1991;
Oncogene 8:925-31, 1993). More recently several additional
VEGF-related genes have been identified and termed VEGF-B (also
called VEGF-related factor VRF-1) (Grimmond et al., Genome Res.
6:122-29, 1996; Olofsson et al., Proc. Natl. Acad. Sci. U.S.A.
93:2567-81, 1996) VRF-2 (Grimmond et al., Genome Res. 6:122-29,
1996), and VEGF-C (Joukov et al., EMBO J. 15:290-98, 1996; Lee
et al., Proc. Natl. Acad. Sci. USA 93:1988-92, 1996) and VEGF-3
(PCT Application No. PCT/US95/07283, published on December 12,
1996 as W096/39421). Finally, two virally encoded VEGF-related
sequences have been identified, poxvirus ORF-1 and ORF-2
(Lyttle et al., J. Virol. 68:84-92, 1994). With the exception
of PDGF, these proteins are referred to as VEGF-related
proteins [VRPs]. Sequences of examples of VRPs are depicted
in Figure 1.
The VRPs, and the PDGFs known so far have 8 cysteines.
within their sequences that are relatively positionally
conserved. The protein sequence spanning the conserved
cysteines is therefore referred to herein as the core sequence,
and the first N-terminal conserved cysteine of the sequence is
referred to herein as the "First cysteine of the core sequence"
or "first core cysteine."
Interestingly, members of the VEGF families can form
heterodimers, such as heterodimers consisting of VEGF and P1GF
subunits (DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao
et al., J. Biol. Chem. 271: 3154-62, 1996). Whereas VEGFs are
highly potent in stimulating angiogenesis and endothelial cell
proliferation, VEGF/P1GF heterodimers are less potent mitogens,
and P1GF homodimers have little or no mitogenic activity
(DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao et al.,
-__ _ T _. __....... _ __. __.____.__-_ __ _..
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
7
J. Biol. Chem. 271: 3154-62, 1996). In other experiments,
VEGF-165/VEGF-B heterodimers were found to . form after
transfection of cells with both genes (Olofsson et al., Proc.
Natl. Acad. Sci. U.S.A. 93:2567-81, 1996).
VEGFs interact with two receptors present on endothelial
cells, KDR/flk-1 (Terman et al., Biochem. Biophys. Res. Commun.
187:1579-86, 1992), and flt-1 (De Vries et al., Science
255:989-91, 1992). Systematic site-directed mutagenesis of
VEGF-165 by alanine scanning of charged residues has shown that
residues D63, E64 and E67 are involved in binding of VEGF to
flt-1 whereas the basic residues R82, KI84, and H86 contribute
strongly to binding to KDR (Keyt et al., J. Biol. Chem.
271:5638-46, 1996).
VRPs are known to bind to one or more of three different
endothelial cell receptors, each of which is a single
transmembrane protein with a large extracellular portion
comprised of 7 immunoglobulin-type domains and a cytoplasmic
portion that functions as a tyrosine kinase. These receptors
are KDR/flk-1 (Terman et al., Biochem. Biophys. Res. Commun.
187:1579-86, 1992), flt-1 (De Vries et al., Science 255:989-91,
1992), and flt-4 (Pajusola et al., Cancer Res. 52:5738-43,
1992). There are distinct selectivities between these
receptors and the various VEGF ligands that have not been
completely elucidated as yet. However, it is known that VEGF
binds to KDR and fltl (Terman et al., Growth Factors 11:187-95,
1994) but not flt4 (Joukov et al., EMBO J. 15:290-98, 1996),
P1GF binds to flt 1 but not KDR (Terman et al., Growth Factors
11:187-95, 1994) and flt4 (Joukov et al., EMBO J. 15:290-98,
1996), VEGF-C binds to flt-4 (Joukov et al., EMBO J. 15:290-98,
1996) but it is controversial whether it also binds to KDR
(Joukov et al., EMBO J. 15:290-98, 1996; Lee et al., Proc.
Natl. Acad. Sci. USA 93:1988-92, 1996). The receptor
specificity for VEGF-B/VRF-1, VRF-2 and the virally encoded
VRPs is not presently known. However, since VEGF-B stimulates
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
8
endothelial cell proliferation (Olofsson et al., Proc. Natl.
Acad. Sci. U.S.A. 93:2567-81, 1996) it may be speculated that
VEGF-B can bind to KDR because KDR is thought to be primarily
responsible for the angiogenic response of endothelial cells to
VEGF-like growth factors (Gitay-Goren et al., J. Biol. Chem.
271:5519-23 (1996)).
Most of the VRPs have been shown to activate the KDR
receptor which is thought to make endothelial cells
"angiogenesis-competent." Evidence for such activity has been
presented for VEGF-B which stimulates endothelial cell
proliferation (Olofsson et al., Proc. Natl. Acad. Sci. U.S.A.
93:2567-81, 1996), VEGF-C which stimulates endothelial cell
migration and proliferation (Joukov et al., EMBO J. 15:290-98,
1996; Lee et al., Proc. Natl. Acad. Sci. USA 93:1988-92, 1996),
and both known virally encoded VRPs which were reported to be
angiogenic (Lyttle et al., J. Virol. 68:84-92, 1994) . A
notable exception are P1GF isoform homodimers which have
negligible mitogenic activity for endothelial cells. However,
P1GF/VEGF heterodimers still retain considerable mitogenic
activity (DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao
et al., J. Biol. Chem. 271: 3154-62, 1996).
VEGFs are expressed in many different tissues. Similarly,
VRP genes are also expressed in multiple tissues but it is of
particular interest that VEGF-B and to a lesser extent VRF-2
are strongly expressed in human heart and skeletal muscle
(Grimmond et al. , Genome Res. 6: 122-29, 1996; Olofsson et al. ,
Proc. Natl. Acad. Sci. U.S.A. 93:2567-81, 1996). In fact,
VEGF-B is expressed considerably more strongly in mouse heart
tissue than VEGF (Olofsson et al., Proc. Natl. Acad. Sci.
U.S.A. 93:2567-81, 1996). VEGF-C is also strongly expressed in
several human tissues, most notably in heart and skeletal
muscle (Joukov et al., EMBO J. 15:290-98, 1996). This
expression pattern, and the exquisite specificity of VRPs for
endothelial cells, suggest that these factors play a
_~ ___- ___ . ..__._ ~_ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
9
physiological role in angiogenesis in these tissues. This is
thought to be relevant in pathological situations such as
coronary ischemia where collateral angiogenesis is required to
provide the heart muscle with an adequate capillary blood
vessel supply. It has been shown that transient ischemia
induced by coronary artery ligation or hypoxia rapidly
upregulates VEGF mRNA in the rat or pig heart in vivo and
hypoxia induces VEGF mRNA in cardiac myocytes and smooth muscle
cells in vitro (Hashimoto et al., Am. J. Physiol 267, H1948-
H1954, 1994 Banai, et al., Cardiovac. Res. 28:1176-79, 1994;
Circulation 90, 649-52, 1994). The strong expression of VEGF
and VRPs in the heart may help to ensure a redundant and
competent regulatory system capable of inducing new blood
vessel formation when it is needed. Collateral blood vessel
formation is also required in peripheral (lower limb) vascular
ischemias and in cerebral ischemias (stroke). Finally, new
blood vessel formation is required in tissue repair after
wounding. In this context, it is worth noting that VEGF is
upregulated in epidermal keratinocytes during skin wound
healing (Brown et al., J. Exp. Med. 176:1375-79, 1992). Thus,
therapy of various ischemic conditions such as cardiac
infarction, chronic coronary ischemia, chronic lower limb
ischemia, wound healing and stroke with VRPs may be potentially
clinically beneficial.
Summary Of The Invention
The present invention is directed to novel truncated forms
of VEGF-related proteins (VRPs), preferably human VRPs. The
preferred use of the truncated VRPs and nucleic acid molecule
compositions of the invention is to use such compositions to
aid in the treatment of patients with heart disease, wounds, or
other ischemic conditions by stimulating angiogenesis in such
patients. The amino acid sequences of VRPs include eight
disulfide-forming cysteine residues that are conserved between
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
VRPs and VEGF proteins (core cysteines). VRPs include, but are
not limited to, VEGF-B, VEGF-C, VRF-2, ORF-1, ORF-2, and PlGFs.
A first aspect of the invention provides for a truncated
VRP having a deletion of at least one of the amino acid
5 residues N-terminal to the first cysteine of the core sequence
of said subunit. Such compositions would be substantially free
of other proteins. Preferably, the truncations range from
truncating minimally the N-terminal residue of the mature
protein subunit only(not including the signal sequence) and
10 maximally all N-terminal amino acids of the mature protein up
to and including the residue N-terminal to (prior to) the first
core cysteine residue. In more preferred aspects, all of the
amino acid residues N-terminal to the first cysteine of the
core sequence, except the 1 to 5 amino acid residues
immediately N-terminal to said first cysteine, are deleted.
Although the amino acid deletions may consist of deletions
of non-adjacent amino acid residues in the N-terminal sequence,
it is preferred that the deletions be of consecutive amino acid
residues. Thus, in one preferred aspect, the invention
comprises human VRPs that have deletions of amino acid residue
sequences of increasing lengths from the N-terminus of the N-
terminal sequence up to the first cysteine of the core sequence
of the VRP subunit sequence.
In preferred aspects, the invention provides for truncated
versions of the VRPs VEGF-B, VRF-2, VEGF-C, VEGF-3, P1GF,
poxvirus ORF-1, and poxvirus ORF-2. In such truncated VRPs,
each subunit may independently have a deletion of at least one
of the amino acid residues N-terminal to the first cysteine of
the core sequence of said subunit, or only one of the subunits
may have such a deletion.
In particular embodiments, the truncated VRP subunit
comprises a VRP subunit wherein various numbers of amino acid
residues N-terminal to the first cysteine of the core sequence
are deleted. In one aspect, the remaining N-terminal residues
_T _--_ ___ -__
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
11
consist of consecutive amino acid residues derived from the N-
terminal sequence. These consecutive N-terminal residues may
be derived from any location in the N-terminal sequence,
however, a consecutive sequence starting from the N-terminus of
the N-terminal sequence is preferred, and a sequence consisting
of consecutive amino acid residues immediately N-terminal to
the first cysteine of the core sequence of the VRP subunit is
most preferred. Examples of such most preferred embodiments
are depicted in Figure 2.
In other embodiments, the amino acid residues N-terminal
to the first cysteine of the core sequence of the truncated
VRPs of the invention are a randomly selected amino acid
sequence, in yet other embodiments, these amino acid residues
are derived from the N-terminal sequence of the full length VRP
sequence, but are not necessarily consecutive amino acids from
the full length VRP sequence.
Thus, in one most preferred aspect, the invention provides
a truncated VRP subunit wherein the amino acid residues N
terminal to the first cysteine of the core sequence of said
subunit are deleted.
In other aspects, the invention provides a truncated VRP
subunit wherein the amino acid sequence N-terminal to the core
sequence comprises 11 to 20, more preferably 11 to 15, more
preferably 6 to 10, and most preferably 2 to 5 amino acid
residues.
Preferably, the amino acid sequence N-terminal to the core
sequence comprises the consecutive amino acid residues
immediately N-terminal to the first cysteine of the core
sequence of said VRP subunit. Thus, in these preferred
embodiments, the truncated VRP comprises the core sequence, the
necessary C-terminal sequence to the core sequence, and further
comprises at the region N-terminal to the first cysteine of the
core sequence, the 11 to 20, more preferably the 11 to 15, more
preferably the 6 to 10, and most preferably the 2 to 5
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
12
consecutive amino acid residues of the amino acid sequence that
is immediately N-terminal to the first cysteine of the core
sequence of the full length VRP sequence.
Those skilled in the art will recognize that where a
truncated VRP subunit comprises, for example, (X) amino acids
N-terminal to the first cysteine of the core sequence, that
such a truncated VRP subunit is one where the corresponding
full length VRP subunit comprises (X + 1) amino acids N
terminal to the first cysteine of the core sequence.
The truncated VRPs of the invention include truncated VRP
homodimers comprising two truncated VRP subunits of the
invention, wherein the two truncated VRP subunits have the same
amino acid sequence, and also include truncated VRP
heterodimers comprising two truncated VRP subunits of the
invention wherein the two subunits have different amino acid
sequences from each other.
For purposes of the present invention, the term "first N-
NN" amino acids where N and NN each represent numbers of amino
acids, for example, the first 10-15 amino acids, denotes the
first N-NN amino acids (e. g., the first 10-15 amino acids)
after the signal peptide sequence of the designated VRP. The
term N-NN encompasses a deletion of anywhere from N to NN of
the first amino acids after the signal sequence. Thus, in more
preferred aspects, the truncated VRP subunit comprises a
truncated hVEGFB protein subunit wherein the first 10-15 amino
acids are deleted; more preferably, the first 15-20 amino acids
are deleted; more preferably, the first 20-25 amino acids are
deleted; and most preferably, the first 23-24 amino acids are
deleted.
In other more preferred aspects, the truncated VRP subunit
comprises a truncated hVRF2 protein subunit wherein the first
10-15 amino acids are deleted; more preferably, the first 15-20
amino acids are deleted: more preferably, the first 20-25 amino
_ _ _____ ___.___. _ . _.._a _____._~__ T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
13
acids are deleted; and most preferably, the first 23-24 amino
acids are deleted.
In other more preferred aspects, the truncated VRP subunit
compr ises a truncated hVEGFC protein subunit wherein the first
95-10 0 amino acids are deleted; more preferably, the first 100-
105 mino acids are deleted: more preferably, the first 105-110
a
amino acids are deleted; and most preferably, the first 108-109
amino acids are deleted.
In other more preferred aspects, the truncated VRP subunit
compr ises a truncated hPlGF protein subunit wherein the first
16-21 amino acids are deleted ; more preferably, the first 21-26
amino acids are deleted; more preferably, the first 26-31 amino
acids are deleted; and most preferably, the first 29-30 amino
acids are deleted.
In other more preferred aspects, the truncated VRP subunit
compr ises a truncated hVEGF3 protein subunit wherein the. first
10-15 amino acids are deleted ; more preferably, the first 15-20
amino acids are deleted; more preferably, the first 20-25 amino
acids are deleted; and most preferably, the first 23-24 amino
acids are deleted.
In other more preferred aspects, the truncated VRP subunit
compr ises a truncated pvORFl protein subunit wherein the first
20-25 amino acids are deleted ; more preferably, the first 25-30
amino acids are deleted; more preferably, the first 30-35 amino
acids are deleted; and most preferably, the first 33-34 amino
acids are deleted.
In other more preferred aspects, the truncated VRP subunit
compr ises a truncated pvORF2 protein subunit wherein the first
30-35 amino acids are deleted ; more preferably, the first 35-40
amino acids are deleted; more preferably, the first 40-45 amino
acids are deleted; and most preferably, the first 43-44 amino
acids are deleted. The sequences
of some exemplary preferred
truncated
VRP
subunits
are
set
out
in
Figure
2.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
14
The invention also provides for nucleic acid molecules
coding for the truncated VRP subunits described herein. The
nucleic acid molecules may be, for example, DNA, cDNA or RNA.
The invention also provides for recombinant DNA vectors
comprising the nucleic acid molecules encoding the truncated
VRPs, and host cells transformed with such recombinant DNA
vectors, wherein such vectors direct the synthesis of a
truncated VRP subunit such as those described herein.
The invention further provides for nucleic acid molecules
encoding biosynthetic precursor forms of N-terminally truncated
subunits of VRPs for the purpose of facilitating the expression
in suitable host systems. Such nucleic acid molecules are
comprised of DNA encoding a signal peptide that precedes the
truncated subunits at their N-termini. The signal sequences of
VEGF or VRPs would be used to construct appropriate signal
peptide-containing truncated forms of VRPs. The human VEGF
signal peptide is as follows:
mnfllswvhwslalllylhhakwsqa (I) -- [SEQ I.D. NO. 40] --
Alternatively, the signal peptides shown in Figure 1 may be
used. Preferably, the signal peptide specific for the
truncated VRP is used in the construct.
In order to facilitate signal peptide cleavage in
mammalian cells after fusion of the signal sequence to
truncated forms of VRP, it may be necessary to include the
first or the first two residues of the mature VRP peptide
sequence, e.g. proline (P), or proline-valine (PV) for hVEGFB.
Thus, an appropriate nucleic acid molecule would be comprised
of DNA encoding the signal sequence of VEGF-B, optionally
followed by a codon for proline (the first residue of mature
VEGF-B), optionally followed by a codon for valine (the second
residue of mature VEGF-B), and followed by DNA encoding the N-
terminally truncated VEGF-B. The invention also provides for
other appropriate signal peptide fusion constructs, best
suitable for non-mammalian hosts, as known by those skilled in
_. _ _ .~. ___ ___ __..__. -~____. T _ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
the art. Those skilled in the art will recognize that the
signal peptides should optionally include residues needed for
facilitation of signal peptide cleavage in mammalian cells for
the various truncated VRP subunits of the present invention.
. 5 Thus, the present invention provides for recombinant DNA
expression vectors wherein the 5' end of the nucleic acid
molecule coding for the truncated VRP subunit is operably
linked to a DNA sequence that codes for a signal peptide. The
signal peptide may be a human VRP signal peptide. Moreover,
10 the DNA sequence coding for said signal peptide may be operably
linked at the 3' end of said DNA sequence to DNA coding for the
first amino acid residue of the mature non-truncated VRP
subunit, and wherein the 3' end of said DNA coding for said
residue is operably linked to the nucleic acid molecule coding
15 for said truncated VRP subunit. In other aspects, the DNA
sequence coding for said signal peptide is operably linked at
the 3' end of said DNA sequence to DNA coding for the first two
amino acid residues of the mature non-truncated VRP subunits,
and wherein the 3' end of said DNA coding for said two residues
is operably linked to said nucleic acid molecule coding for
said truncated VRP subunit. Thus, in preferred aspects, the
invention also provides a truncated VRP subunit of the
invention as described above, further comprising at the N-
terminus of said truncated VRP subunit, the first one or two
amino acid residues of the mature non-truncated VRP subunit.
Those skilled in the art will recognize that such truncated VRP
subunits of the invention include those wherein the final
number of amino acids N-terminal to the first cysteine of the
core sequence (including the additional one or two amino acids
that may facilitate signal peptide cleavage) is at least one
less than the number of amino acids N-terminal to the first
cysteine of the core sequence of the corresponding full length
VRP.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
16
In other preferred aspects, the invention provides
truncated VRP homodimers or heterodimers comprising two
truncated VRP subunits wherein said truncated VRP subunits
comprise at the N-terminus of said truncated VRP subunits, the
first one or two amino acid residues of the mature non-
truncated VRP subunit.
In preferred aspects, the recombinant nucleic acid
molecule coding for a truncated VRP subunit of the invention is
operably linked to control sequences operable in a host cell
IO transformed with said vector. The present invention also
provides for transformed or transfected host cells comprising
the recombinant DNA vectors of the invention.
The present invention also includes delivery vectors which
comprise nucleic acid molecules coding for the truncated VRPs
of the invention. Such delivery vectors may be, for example,
viral vectors. Such viral vectors may be, for example,
adenovirus vectors or adenovirus-associated virus vectors. In
other aspects of the invention are provided an adenovirus
vector comprising a nucleic acid molecule coding for a
truncated VRP of the invention operably linked at the 5' end of
the nucleic acid molecule to a DNA sequence that codes for a
signal peptide. Preferably, the signal peptide is selected
from the group consisting of VEGF signal peptide, VEGF-B signal
peptide, VRF-2 signal peptide, VEGF-C signal peptide, P1GF
signal peptide, VEGF-3 signal peptide, poxvirus ORF-1 signal
peptide, and poxvirus ORF-2 signal peptide. Preferably said
signal peptide is VEGF-B signal peptide. In preferred aspects,
the DNA sequence coding for the signal peptide is operably
linked at the 3' end of the DNA sequence to DNA coding for the
first amino acid residue of the mature non-truncated VRP
subunit, and wherein the 3' end of said DNA coding for said
residue is operably linked to the nucleic acid molecule coding
for said truncated VRPs. In most preferred aspects, the
_ _ T _ _ ___ ~ __
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
17
adenovirus vector comprises a nucleic acid molecule which codes
for a truncated VRP subunit of Figure 2.
In further preferred aspects of the invention are provided
a filtered-injectable adenovirus vector preparation comprising
a recombinant adenoviral vector, said vector containing no
wild-type virus and comprising: a partial adenoviral sequence
from which the ElA/E1B genes have been deleted, and a transgene
coding for a truncated VRP subunit, driven by a promoter
flanked by the partial adenovirus sequence; and a
pharmaceutically acceptable carrier. In preferred aspects, the
preparation has been filtered through a 30 micron filter. In
other preferred aspects the truncated VEGF subunit is a
truncated VEGF subunit of Figure 2. In another preferred
aspect, the injectable adenoviral vector preparation comprises
a promoter selected from the group consisting of a CMV
promoter, a ventricular myocyte-specific promoter, and a myosin
heavy chain promoter.
In other aspects, the invention provides a method of
producing a truncated VRP polypeptide comprising growing, under
suitable conditions, a host cell transformed or transfected
with the recombinant DNA expression vector of the invention in
a manner allowing expression of said polypeptide, and isolating
said polypeptide from the host cell. Suitable conditions are
then provided for the truncated VRP peptide to fold into a
truncated VRP subunit. In mammalian cells, such conditions
should be naturally provided by the cell. In non-mammalian
cells, appropriate pH, isotonicity, and reducing conditions
must be provided, such as those described in, for example,
Example 2. Most preferably, the invention provides a method of
producing a truncated VRP wherein suitable conditions are
provided for said truncated VRP subunit to dimerize with a
second VRP subunit selected from the group consisting of VRP
subunits and truncated VRP subunits. In preferred aspects of
the invention are provided methods of producing a truncated VRP
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
18
homodimer comprising two truncated VRP subunits having the same
amino acid sequence.
In other aspects of the invention are provided methods of
producing truncated VRP heterodimers wherein the two VRP
subunits have different amino acid sequences. Such
heterodimers may consist of one truncated VRP subunit and one
non-truncated VRP subunit, or both VRP subunits may be
truncated. The two subunits may be derived from different
VRPs. For example, the heterodimer may consist of one VEGF-B
subunit and one truncated VEGF-C subunit, or both subunits may
be truncated.
In further preferred aspects, the present invention
provides pharmaceutical compositions comprising a truncated VRP
subunit of the present invention, in a suitable carrier. The
invention includes methods of stimulating blood vessel
formation comprising administering to a patient such a
pharmaceutical composition.
Methods are provided using the compounds of the present
invention to stimulate endothelial cell growth or endothelial
cell migration in vitro comprising treating said endothelial
cells with truncated VRPs.
The present invention also provides methods of treating a
patient suffering from a heart disease comprising administering
to said patient a nucleic acid molecule coding for at least one
truncated VRP subunit, said nucleic acid molecule capable of
expressing the truncated VRP subunit in said patient. In an
additional embodiment, methods are provided of stimulating
angiogenesis in a patient comprising administering a
therapeutic amount of a pharmaceutical composition comprising a
truncated VRP of the present invention.
Preferably, the pharmaceutical composition is in a
therapeutically suitable delivery system. In other preferred
aspects, a potentiating agent is administered to potentiate the
angiogenic effect of said truncated VRP. Such agents include,
___ _ .._ .. __r _ _ -____..___ __ .... _ _ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
19
for example, basic Fibroblast Growth Factor (bFGF) (FGF-2),
acidic FGF (aFGF) (FGF-1), FGF-4, FGF-5, FGF-6, or any FGF or
other angiogenic factor that stimulates endothelial cells.
Thus, in one aspect of the invention is provided a
pharmaceutical composition comprising a truncated VRP and one
or more potentiating agents. The pharmaceutical compositions
may also be used to treat patients suffering from ischemic
conditions such as cardiac infarction, chronic coronary
ischemia, chronic lower limb ischemia, stroke, and peripheral
vascular disease. Methods are also provided using the
pharmaceutical compositions of the present invention to treat
wounds, such as dermal or intestinal wounds.
In preferred embodiments, methods are provided of
stimulating angiogenesis in a patient comprising delivering a
delivery vector to the myocardium of the patient by
intracoronary injection directly into one or both coronary
arteries, said vector comprising a nucleic acid molecule coding
for at least one truncated VRP subunit, wherein said vector is
capable of expressing the truncated VRP subunit in the
myocardium.
In other preferred embodiments, the method may be used for
stimulating coronary collateral vessel development.
In more preferred embodiments, a method is provided for
stimulating vessel development in a patient having peripheral
vascular disease, comprising delivering a delivery vector to
the peripheral vascular system of the patient by intra-femoral
artery injection directly into one or both femoral arteries,
said vector comprising a transgene coding for a truncated VRP
subunit, and capable of expressing the truncated VRP subunit in
the peripheral vascular system, thereby promoting peripheral
vascular development.
Preferably the delivery vector used in the invention is a
viral delivery vector. In one preferred aspect, the delivery
vector is a replication-deficient adenovirus vector. In
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
another preferred aspect, the delivery vector is an adeno-
associated virus vector.
Brief Description Of The Drawings
5 Figure 1 depicts the amino acid sequences of VEGF-B [SEQ
I.D. NO. 1], VRF-2 [SEQ I.D. N0. 2], VEGF-C [SEQ I.D. NO. 3],
P1GF ( human P1GF-2 ) [ SEQ I . D . NO . 4 ] , VEGF-3 [ SEQ 5
I . D . NO . ]
,
poxvirus ORF-1 [SEQ I.D. NO. 6], and poxvirus ORF-2 [SEQ I.D.
NO. 7]. Lower case letters signify signal peptides that are
10 cleaved from the mature protein. The eight cysteines of the
core sequence are underlined. Sequences are described in the
following references: human VEGF-B: Grimmond et al., Ge nome
Res. 6:122-29 (1996); Olofsson et al., Proc. Natl. Acad. Sci.
U.S.A. 93:2567-81 (1996); mouse VEGF-B: Olofsson et al., P roc.
15 Natl. Acad. Sci. U.S.A. 93:2567-81 (1996); human VRF-2:
Grimmond et al., Genome Res. 6:122-29 (1996); human VEGF-C:
Joukov et al., EMBO J. 15:290-98 (1996); Lee et al., Proc.
Natl. Acad. Sci. USA 93:1988-92 (1996); P1GF: Maglione et al.,
Oncogene 8:925-31 (1993); Hauser & Weich, Growth Factors 9: 259-
20 68 (1993); human VEGF3: PCT Application Serial No.
PCT/US95/07283, published on December 12" 1996, as W096/39421;
poxvirus ORF-1 and ORF-2: Lyttle et al., J. Virol. 68:84-92
(1994).
Figure 2a-2f depicts examples of truncated VRP amino acid
sequences below the corresponding full length (F/L) VRP
sequence. The amino acid sequences of each truncation are
listed as follows:
2a (F/L) [SEQ I.D. N0. 34] (1) (SEQ I.D. N0. 8] ; 2a (2) [SEQ
I.D. N0. 9]; 2a (3) [SEQ I.D. N0. 10]; 2a (4) [SEQ I.D. N0. 11];
2a (5) [SEQ I. D. N0. 12] ; 2a (6) [SEQ I. D. NO. 13] ; 2b [SEQ
(F/L)
I.D. N0. 35]; (1) [SEQ I.D. N0. 14]; 2b(2) [SEQ I.D. N0. 15];
2b (3) [SEQ I.D. NO. 16]; 2b (4) (SEQ I.D. N0. 17]; 2c(F/L) [SEQ
I.D. N0. 36]; (1) [SEQ I.D. NO. 18];
_ __~. ~ _ .-_~__.. . _ ~.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
21
2c(2)[SEQ I.D. NO. 19]; 2c(3) [SEQ I.D.
NO. 20];
2c(4)
[SEQ I.D. NO. 21]; 2d(F/L)[SEQ I.D. N0. 37]; ~[SEQ I.D.
(1) N0.
22]; 2d(2}[SEQ I.D. NO. 23]; 2d(3) [SEQ I.D. N0. 24]; 2d(4)
[SEQ I.D. NO. 25]; 2e(F/L [SEQ I.D. N0. 38) (1) [SEQ I.D. NO.
26]; 2e [SEQ I.D. N0. 27]; 2e [SEQ I.D. N0. 28]; 2e
(2) (3) (4)
(SEQ I.D. NO. 29]; 2f(F/L)[SEQ I.D. N0. 39]; [SEQ I.D. N0.
(1}
30]; 2f(2}[SEQ I.D. N0. 31]; 2f(3 ) [SEQ I.D. N0. 32]; and
2f(4) (SEQ I.D. NO. 33].
Detailed Description Of The Invention
Construction of Novel Truncated VRP Sequences
In a first aspect the invention features a truncated VRP
comprising at least one truncated VRP subunit. By "truncated
VRP subunit" it is meant a VRP subunit having an amino acid
sequence substantially similar to one of the VRPs, for example,
but not limited to, one of the sequences shown in Figure 1, or
an analog or derivative thereof, wherein at least one of the N-
terminal amino-acid residues N-terminal to the first cysteine
of the core sequence of the mature subunit is deleted. A
sequence that is "substantially similar" to a VRP comprises an
amino acid sequence that is at least 25o homologous to the 8
cysteine core sequence of VEGF-B, comprises all of the
essential conserved cysteine residues of said core sequence,
and retains VRP activity. By "truncated VRP subunit" is also
meant a VRP subunit wherein at least one of the N-terminal
amino acid residues N-terminal to the first cysteine of the
VEGF core sequence is deleted, and, at least one of the
cysteines of the core sequence is deleted, wherein said
cysteine is non-essential. A non-essential cysteine is one
that is not required to retain VRP activity. Such non-
essential cysteines have been described in connection with
PDGF. (Potgens, et al. J. Biol. Chem. 269:32879-85 (1994)).
By "identity" is meant a property of sequences that
measures their similarity or relationship. Identity is
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
22
measured by dividing the number of identical residues by the
total number of residues and multiplying the product by 100.
Thus, two copies of exactly the same sequence have 100%
identity, but sequences that are less highly conserved and have
deletions, additions, or replacements may have a lower degree
of identity. In calculating sequence identity, the two
sequences are compared starting at the carboxy terminus of the
N-terminal deletion. Those skilled in the art will recognize
that several computer programs are available for determining
sequence identity.
Analogs of a truncated VRP polypeptide or subunit are
functional equivalents having similar amino acid sequence and
retaining, to some extent, one or more activities of the
related truncated VRP polypeptide or subunit. By "functional
equivalent" is meant the analog has an activity that can be
substituted for one or more activities of a particular
truncated VRP polypeptide or subunit. Preferred functional
equivalents retain all of the activities of a particular
truncated VRP polypeptide or subunit, however, the functional
equivalent may have an activity that, when measured
quantitatively, is stronger or weaker, as measured in VRP
functional assays, for example, such as those disclosed herein.
In most cases, such truncated VRP polypeptides or subunits must
be incorporated into a truncated VRP dimer in order to measure
functional activity. Preferred functional equivalents have
activities that are within 1% to 10,000% of the activity of the
related truncated VRP polypeptide or subunit, more preferably
between 10% to 1000%, and more preferably within 50% to 200%.
The ability of a derivative to retain some activity can be
measured using techniques described herein. Derivatives include
modification occurring during or after translation, for
example, by phosphorylation, glycosylation, crosslinking,
acylation, proteolytic cleavage, linkage to an antibody
_ ______ ~_ _T _ __.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
23
molecule, membrane molecule or other ligand (see Ferguson et
al., 1988, Annu. Rev. Biochem. 57:285-320).
Specific types of derivatives or analogs also include
amino acid alterations such as deletions, substitutions,
additions, and amino acid modifications. A "deletion" refers
to the absence of one or more amino acid residues) in the
related polypeptide. An "addition" refers to the presence of
one or more amino acid residues) in the related polypeptide.
Additions and deletions to a polypeptide may be at the amino
terminus, the carboxy terminus, and/or internal. Amino acid
"modification" refers to the alteration of a naturally
occurring amino acid to produce a non-naturally occurring amino
acid. A "substitution" refers to the replacement of one or
more amino acid residues) by another amino acid residues) in
the polypeptide. Derivatives can contain different
combinations of alterations including more than one alteration
and different types of alterations.
While the effect of an amino acid change on VRP activity
varies depending upon factors such as phosphorylation,
glycosylation, intra-chain linkages, tertiary structure, and
the role of the amino acid in the active site or a possible
allosteric site, it is generally preferred that the substituted
amino acid is from the same group as the amino acid being
replaced. To some extent the following groups contain amino
acids which are interchangeable: the basic amino acids lysine,
arginine, and histidine: the acidic amino acids aspartic and
glutamic acids; the neutral polar amino acids serine,
threonine, cysteine, glutamine, asparagine and, to a lesser
extent, methionine; the nonpolar aliphatic amino acids glycine,
alanine, valine, isoleucine, and leucine (however, because of
size, glycine and alanine are more closely related and valine,
isoleucine and leucine are more closely related): and the
aromatic amino acids phenylalanine, tryptophan, and tyrosine.
In addition, although classified in different categories,
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
24
alanine, glycine, and serine seem to be interchangeable to some
extent, and cysteine additionally fits into this group, or may
be classified with the polar neutral amino acids.
Preferred derivatives have one or more amino acid
alterations) which do not significantly affect the activity
of the related truncated VRP polypeptide or subunit. In
regions of the truncated VRP polypeptide or subunit not
necessary for VRP activity, amino acids may be deleted, added
or substituted with less risk of affecting activity. In
regions required for VRP activity, amino acid alterations are
less preferred as there is a greater risk of affecting VRP
activity. Such alterations should be conservative alterations.
For example, one or more amino acid residues within the
sequence can be substituted by another amino acid of a similar
polarity which acts as a functional equivalent.
Conserved regions tend to be more important for protein
activity than non-conserved regions. Standard procedures can
be used to determine the conserved and non-conserved regions
important for VRP activity using in vitro mutagenesis
techniques or deletion analyses and measuring VRP activity as
described by the present disclosure.
Derivatives can be produced using standard chemical
techniques and recombinant nucleic acid molecule techniques.
Modifications to a specific polypeptide may be deliberate, as
through site-directed mutagenesis and amino acid substitution
during solid-phase synthesis, or may be accidental such as
through mutations in hosts which produce the polypeptide.
Polypeptides including derivatives can be obtained using
standard techniques such as those described in Sambrook et al.,
Molecular Cloning, Cold Spring Harbor Laboratory Press (1989).
For example, Chapter 15 of Sambrook describes procedures for
site-directed mutagenesis of cloned DNA.
By a "truncated VRP polypeptide" is meant a polypeptide
comprising the amino acid sequence of a truncated VRP subunit
_ _T_ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
of the invention, or a functional analog or derivative thereof
as described herein. The term "truncated VRP polypeptide" also
includes a truncated VRP subunit; the term subunit generally
referring to a peptide that has been folded into an active
5 three-dimensional structure.
By "truncated VRP" is meant a dimer of two VRP subunits.
The two subunits may be derived from two different VRPs where
both subunits are truncated VRP subunits. One or both of the
subunits may be truncated; the two subunits may also have
10 different N-terminal deletions.
It is advantageous that the truncated VRP, truncated VRP
subunit, or truncated VRP polypeptide be enriched or purified.
By the use of the term "enriched" in this context is meant that
the specific amino acid sequence constitutes a significantly
15 higher fraction (2 - 5 fold) of the total of amino acid
sequences present in the cells or solution of interest than in
normal or diseased cells or in the cells from which the
sequence was taken. This could be caused by a person by
preferential reduction in the amount of other amino acid
20 sequences present, or by a preferential increase in the amount
of the specific amino acid sequence of interest, or by a
combination of the two. However, it should be noted that
enriched does not imply that there are no other amino acid
sequences present, just that the relative amount of the
25 sequence of interest has been significantly increased. The
term "significant" here is used to indicate that the level of
increase is useful to the person making such an increase, and
generally means an increase relative to other amino acid
sequences of about at least 2 fold, more preferably at least 5
to 10 fold or even more. The term also does not imply that
there is no amino acid sequence from other sources. The other
source amino acid sequence may, for example, comprise amino
acid encoded by a yeast or bacterial genome, or a cloning
vector such as pUCl9. The term is meant to cover only those
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
26
situations in which man has intervened to elevate the
proportion of the desired amino acid sequence.
It is also advantageous for some purposes that an amino
acid sequence be in purified form. The term "purified" in
reference to a polypeptide does not require absolute purity
(such as a homogeneous preparation); instead, it represents an
indication that the sequence is relatively purer than in the
natural environment (compared to the natural level this level
should be at least 10 fold greater, e.g., in terms of mg/ml).
Purification of at least one order of magnitude, preferably two
or three orders, and more preferably four or five orders of
magnitude is expressly contemplated. The substance is
preferably free of contamination at a functionally significant
level, for example 900, 950, or 99% pure.
In another aspect the invention features a nucleic acid
molecule encoding a truncated VRP polypeptide or subunit.
In some situations it is desirable for such nucleic acid
molecule to be enriched or purified. By the use of the term
"enriched" in reference to nucleic acid molecule is meant that
the specific DNA or RNA sequence constitutes a significantly
higher fraction (2 - 5 fold) of the total DNA or RNA present in
the cells or solution of interest than in normal or diseased
cells or in the cells from which the sequence was taken. This
could be caused by a person by preferential reduction in the
amount of other DNA or RNA present, or by a preferential
increase in the amount of the specific DNA or RNA sequence, or
by a combination of the two . However, it should be noted that
enriched does not imply that there are no other DNA or RNA
sequences present, just that the relative amount of the
sequence of interest has been significantly increased. The
term significant here is used to indicate that the level of
increase is useful to the person making such an increase, and
generally means an increase relative to other nucleic acids of
about at least 2 fold, more preferably at least 5 to 10 fold or
_. _ _ _T . ___- _.___ ~.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
27
even more. The term also does not imply that there is no DNA
or RNA from other sources. The other source DNA may, for
example, comprise DNA from a yeast or bacterial genome, or a
cloning vector such as pUCl9. This term distinguishes from
naturally occurring events, such as viral infection, or tumor
type growths, in which the level of one mRNA may be naturally
increased relative to other species of mRNA. That is, the term
is meant to cover only those situations in which a person has
intervened to elevate the proportion of the desired nucleic
acid.
It is also advantageous for some purposes that a
nucleotide sequence be in purified form. The term "purified"
in reference to nucleic acid molecule does not require absolute
purity (such as a homogeneous preparation); instead, it
represents an indication that the sequence is relatively purer
than in the natural environment (compared to the natural level
this level should be at least 2-5 fold greater, e.g., in terms
of mg/ml).
The nucleic acid molecule may be constructed from an
existing VRP nucleotide sequence by modification using, for
example, oligonucleotide site-directed mutagenesis, or by
deleting sequences using restriction enzymes, or as described
herein. Standard recombinant techniques for mutagenesis such
as in vitro site-directed mutagenesis (Hutchinson et al., J.
Biol. Chem. 253:6551, (1978), Sambrook et al., Chapter 15,
supra), use of TAB~ linkers (Pharmacia), and PCR-directed
mutagenesis can be used to create such mutations. The nucleic
acid molecule may also be synthesized by the triester method or
by using an automated DNA synthesizer.
The invention also features recombinant DNA vectors and
recombinant DNA expression vectors preferably in a cell or an
organism. The recombinant DNA vectors may contain a sequence
coding for a truncated VRP or a functional derivative thereof
in a vector containing a promoter effective to initiate
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
28
transcription in a host cell. The recombinant DNA vector can
contain a transcriptional initiation region functional in a
cell and a transcriptional termination region functional in a
cell.
The present invention also relates to a cell or organism
that contains the above-described nucleic acid molecule or
recombinant DNA vector and thereby is capable of expressing a
truncated VRP peptide. The polypeptide may be purified from
cells which have been altered to express the polypeptide. A
cell is said to be "altered to express a desired polypeptide"
when the cell, through genetic manipulation, is made to produce
a protein which it normally does not produce or which the cell
normally produces at lower levels. One skilled in the art can
readily adapt procedures for introducing and expressing either
genomic, cDNA, or synthetic sequences into either eukaryotic or
prokaryotic cells.
A nucleic acid molecule, such as DNA, is said to be
"capable of expressing" a polypeptide if it contains nucleotide
sequences which contain transcriptional and translational
regulatory information and such sequences are "operably linked"
to nucleotide sequences which encode the polypeptide. The
precise nature of the regulatory regions needed for gene
sequence expression may vary from organism to organism, but
shall in general include a promoter region which, in
prokaryotes, contains both the promoter (which directs the
initiation of RNA transcription) as well as the DNA sequences
which, when transcribed into RNA, will signal synthesis
initiation. Such regions will normally include those 5'-non-
coding sequences involved with initiation of transcription and
translation, such as the TATA box, capping sequence, CART
sequence, and the like.
For example, the entire coding sequence of a truncated VRP
subunit or a fragment thereof, may be combined with one or more
of the following in an appropriate expression vector to allow
___-.~_ __ ___ _. _..--._ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
29
for such expression: (1) an exogenous promoter sequence (2) a
ribosome binding site (3) a polyadenylation signal (4) a
secretion signal. Modifications can be made in the 5'-
untranslated and 3'-untranslated sequences to improve
expression in a prokaryotic or eukaryotic cell; or codons may
be modified such that while they encode an identical amino
acid, that codon may be a preferred codon in the chosen
expression system. The use of such preferred codons is
described in, for example, Grantham et al., Nuc. Acids Res.,
9:43-74 (1981), and Lathe, J. Mol. Biol., 183:1-12 (1985)
hereby incorporated by reference herein in their entirety.
If desired, the non-coding region 3' to the genomic VRP
sequence may be operably linked to the nucleic acid molecule
encoding such VRP subunit. This region may be used in the
recombinant DNA vector for its transcriptional termination
regulatory sequences, such as termination and polyadenylation.
Thus, by retaining the 3'-region naturally contiguous to the
DNA sequence encoding a VRP gene, the transcriptional
termination signals may be provided. Alternatively, a 3'
region functional in the host cell may be substituted.
An operable linkage is a linkage in which the regulatory
DNA sequences and the DNA sequence sought to be expressed are
connected in such a way as to permit gene sequence expression.
Two DNA sequences (such as a promoter region sequence and a
truncated VRP sequence) are said to be operably linked if the
nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation in the
coding sequence, (2) interfere with the ability of the promoter
region sequence to direct the transcription of a truncated VRP
gene sequence, or (3) interfere with the ability of the a
truncated VRP gene sequence to be transcribed by the promoter
region sequence. Thus, a promoter region would be operably
linked to a DNA sequence if the promoter were capable of
effecting transcription of that DNA sequence. Thus, to express
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
a truncated VRP gene, transcriptional and translational signals
recognized by an appropriate host are necessary.
Expression and Purification of Novel Truncated VRP Sequences
Examples 2 and 3 describe the expression and purification
5 of novel truncated VRP sequences of the present invention as
expressed in baculovirus systems. Those skilled in the art
will recognize that the truncated VRPs of the present invention
may also be expressed in other cell systems, both prokaryotic
and eukaryotic, all of which are within the scope of the
10 present invention. Examples 9-6 provide examples of suitable
assays for functional activity of the novel truncated VRPs.
Although the truncated VRPs of the present invention may
be expressed in prokaryotic cells, which are generally very
efficient and convenient for the production of recombinant
15 proteins, the truncated VRPs produced by such cells will not be
glycosylated and therefore may have a shorter half-life in
vivo. Prokaryotes most frequently are represented by various
strains of E. coli. However, other microbial strains may also
be used, including other bacterial strains. Recognized
20 prokaryotic hosts include bacteria such as E. coli, Bacillus,
Streptomyces, Pseudomonas, Salmonella, Serratia, and the like.
The prokaryotic host must be compatible with the replicon and
control sequences in the expression plasmid.
In prokaryotic systems, plasmid vectors that contain
25 replication sites and control sequences derived from a species
compatible with the host may be used. Examples of suitable
plasmid vectors may include pBR322, pUC118, pUC119 and the
like; suitable phage or bacteriophage vectors may include ygtl0,
ygtll and the like; and suitable virus vectors may include pMAM
30 neo, pKRC and the like. Preferably, the selected vector of the
present invention has the capacity to replicate in the selected
host cell.
To express truncated VRP polypeptides or subunits (or a
functional derivative thereof) in a prokaryotic cell, it is
_T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
31
necessary to operably link the truncated VRP sequence to a
functional prokaryotic promoter. Such promoters may be either
constitutive or, more preferably, regulatable (i.e., inducible
or derepressible). Examples of constitutive promoters include
the int promoter of bacteriophage ~,, the bla promoter of the
~i-lactamase gene sequence of pBR322, and the CAT promoter of
the chloramphenicol acetyl transferase gene sequence of pPR325,
and the like. Examples of inducible prokaryotic promoters
include the major right and left promoters of bacteriophage ~,
(PL and PR) , the trp, recA, ~,ac2, ~,acI, and gal promoters of E.
coli, the a-amylase (Ulmanen et al., J. Bacteriol. 162:176-
182(1985)) and the g-28-specific promoters of B. subtilis
(Gilman et at., Gene sequence 32:11-20(1984)), the promoters of
the bacteriophages of Bacillus (Gryczan, In: The Molecular
Biology of the Bacilli, Academic Press, Inc., NY (1982)), and
Streptomyces promoters (Ward et at., Mol. Gen. Genet. 203:468-
478{1986)). Prokaryotic promoters are reviewed by Glick (J.
Ind. Microbiot. 1:277-282(1987)); Cenatiempo (Biochimie 68:505-
516(1986)); and Gottesman (Ann. Rev. Genet. 18:415-442 (1984)).
Proper expression in a prokaryotic cell also requires the
presence of a ribosome binding site upstream of the gene
sequence-encoding sequence. Such ribosome binding sites are
disclosed, for example, by Gold et at. (Ann. Rev. Microbiol.
35:365-404(1981)). The ribosome binding site and other
sequences required for translation initiation are operably
linked to the nucleic acid molecule coding for the truncated
VRP by, for example, in frame ligation of synthetic
oligonucleotides that contain such control sequences. For
expression in prokaryotic cells, no signal peptide sequence is
required. The selection of control sequences, expression
vectors, transformation methods, and the like, are dependent on
the type of host cell used to express the gene.
As used herein, "cell", "cell line", and "cell culture"
may be used interchangeably and all such designations include
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
32
progeny. Thus, the words "transformants" or "transformed
cells" include the primary subject cell and cultures derived
therefrom, without regard to the number of transfers.
Truncated VRP peptides expressed in prokaryotic cells are
expected to comprise a mixture of properly truncated VRP
peptides with the N-terminal sequence predicted from the
sequence of the expression vector, and truncated VRP peptides
which have an N-terminal methionine resulting from inefficient
cleaving of the initiation methionine during bacterial
expression. Both types of truncated VRP peptides are
considered to be within the scope of the present invention as
the presence of an N-terminal methionine is not expected to
affect biological activity. It is also understood that all
progeny may not be precisely identical in DNA content, due to
deliberate or inadvertent mutations. However, as defined,
mutant progeny have the same functionality as that of the
originally transformed cell.
Preferred prokaryotic vectors include plasmids such as
those capable of replication in E. coil (such as, for example,
pBR322, ColEl, pSC101, pACYC 184, ~VX. Such plasmids are, for
example, disclosed by Sambrook (cf. "Molecular Cloning: A
Laboratory Manual", second edition, edited by Sambrook,
Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)).
Bacillus plasmids include pC194, pC221, pT127, and the like.
Such plasmids are disclosed by Gryczan (In: The Molecular
Biology of the Bacilli, Academic Press, NY (1982), pp. 307-
329). Suitable Streptomyces plasmids include p1J101 (Kendall
et al., J. Bacteriol. 169:4177-4183 (1987)), and streptomyces
bacteriophages such as ~C31 (Chater et al., In: Sixth
International Symposium on Actinomycetales Biology, Akademiai
Kaido, Budapest, Hungary (1986), pp. 45-54). Pseudomonas
plasmids are reviewed by John et al. (Rev. Infect. Dis. 8:693-
704(1986)), and Izaki (Jpn. J. Bacteriol. 33:729-742(1978)).
_. _.. _T _____T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
33
Eukaryotic host cells which may be used in the expression
systems of the present invention are not strictly limited,
provided that they are suitable for use in the expression of
the truncated VRP peptide. Preferred eukaryotic hosts include,
for example, yeast, fungi, insect cells, mammalian cells either
in vivo, or in tissue culture. Mammalian cells which may be
useful as hosts include HeLa cells, cells of fibroblast origin
such as VERO or CHO-K1, or cells of lymphoid origin and their
derivatives.
The truncated VRPs of the present invention may also be
expressed in human cells such as human embryo kidney 293EBNA
cells which express Epstein-Barr virus nuclear antigen 1, as
described, for example, in Olofsson, B. et al., Proc. Natl.
Acad. Sci. USA 93:2576-2581 (1996). The cells are transfected
with the expression vectors of Example 2 by using calcium
phosphate precipitation, and the cells are then incubated for
at least 48 hours. The truncated VRP peptides may then be
purified from the supernatant as described in Example 3.
In addition, plant cells are also available as hosts, and
control sequences compatible with plant cells are available,
such as the cauliflower mosaic virus 35S and 195, and nopaline
synthase promoter and polyadenylation signal sequences.
Another preferred host is an insect cell, for example the
Drosophila larvae. Using insect cells as hosts, the Drosophila
alcohol dehydrogenase promoter can be used. Rubin, Science
2Q0:1453-1459(1988).
Any of a series of yeast gene sequence expression systems
can be utilized which incorporate promoter and termination
elements from the actively expressed gene sequences coding for
glycolytic enzymes are produced in large quantities when yeast
are grown in mediums rich in glucose. Known glycolytic gene
sequences can also provide very efficient transcriptional
control signals. Yeast provides substantial advantages in that
i.t can also carry out post-translational peptide modifications.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
34
A number of recombinant DNA strategies exist which utilize
strong promoter sequences and high copy number of plasmids
which can be utilized for production of the desired proteins in
yeast. Yeast recognizes leader sequences on cloned mammalian
gene sequence products and secretes peptides bearing leader
sequences (i.e., pre-peptides). For a mammalian host, several
possible vector systems are available for the expression of
truncated VRP peptides.
A wide variety of transcriptional and translational
regulatory sequences may be employed, depending upon the nature
of the host. The transcriptional and translational regulatory
signals may be derived from viral sources, such as adenovirus,
bovine papilloma virus, cytomegalovirus, simian virus, or the
like, where the regulatory signals are associated with a
particular gene sequence which has a high level of expression.
Alternatively, promoters from mammalian expression products,
such as actin, collagen, myosin, and the like, may be employed.
Transcriptional initiation regulatory signals may be selected
which allow for repression or activation, so that expression of
the gene sequences can be modulated. Of interest are
regulatory signals which are temperature-sensitive so that by
varying the temperature, expression can be repressed or
initiated, or are subject to chemical (such as metabolite)
regulation.
Expression of truncated VRPs in eukaryotic hosts requires
the use of eukaryotic regulatory regions. Such regions will,
in general, include a promoter region sufficient to direct the
initiation of RNA synthesis. Preferred eukaryotic promoters
include, for example, the promoter of the mouse metallothionein
I gene sequence (Hamer et al., J. Mol. Appl. Gen. 1:273-
288(1982)); the TK promoter of Herpes virus (McKnight, Cell
31:355-365 (1982)); the SV40 early promoter (Benoist et al.,
Nature (London) 290:304-310(1981)); the yeast gal4 gene
sequence promoter (Johnston et al., Proc. Natl. Acad. Sci.
___ __ _. __ __ ..... _____-
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
(USA) 79:6971-6975(1982); Silver et al., Proc. Natl. Acad. Sci.
(USA) 81:5951-5955 (1984)).
Translation of eukaryotic mRNA is initiated at the codon
which encodes the first methionine. For this reason, it is
5 preferable to ensure that the linkage between a eukaryotic
promoter and a DNA sequence which encodes a truncated VRP (or a
functional derivative thereof) does not contain any intervening
codons which are capable of encoding a methionine (i.e., AUG).
The presence of such codons results either in a formation of a
10 fusion protein (if the AUG codon is in the same reading frame
as the truncated VRP coding sequence) or a frame-shift mutation
(if the AUG codon is not in the same reading frame as the
truncated VRP coding sequence).
A truncated VRP nucleic acid molecule and an operably
15 linked promoter may be introduced into a recipient prokaryotic
or eukaryotic cell either as a nonreplicating DNA (or RNA)
molecule, which may either be a linear molecule or, more
preferably, a closed covalent circular molecule. Since such
molecules are incapable of autonomous replication, the
20 expression of the gene may occur through the transient
expression of the introduced sequence. Alternatively, permanent
expression may occur through the integration of the introduced
DNA sequence into the host chromosome.
A vector may be employed which is capable of integrating
25 the desired gene sequences into the host cell chromosome. Cells
which have stably integrated the introduced DNA into their
chromosomes can be selected by also introducing one or more
markers which allow for selection of host cells which contain
the expression vector. The marker may provide for prototrophy
30 to an auxotrophic host, biocide resistance, e.g., antibiotics,
or heavy metals, such as copper, or the like. The selectable
marker gene sequence can either be directly linked to the DNA
gene sequences to be expressed, or introduced into the same
cell by co-transfection. Additional elements may also be
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
36
needed for optimal synthesis of single chain binding protein
mRNA. These elements may include splice signals, as well as
transcription promoters, enhancers, and termination signals.
cDNA expression vectors incorporating such elements include
those described by Okayama, Molec. Cell. Biol. 3:280 (1983).
The introduced nucleic acid molecule can be incorporated
into a plasmid or viral vector capable of autonomous
replication in the recipient host. Any of a wide variety of
vectors may be employed for this purpose. Factors of
importance in selecting a particular plasmid or viral vector
include: the ease with which recipient cells that contain the
vector may be recognized and selected from those recipient
cells which do not contain the vector; the number of copies of
the vector which are desired in a particular host; and whether
it is desirable to be able to "shuttle" the vector between host
cells of different species.
Preferred eukaryotic plasmids include, for example, BPV,
vaccinia, SV40, 2-micron circle, and the like, or their
derivatives. Such plasmids are well known in the art (Botstein
et al., Miami Wntr. Symp. 19:265-274(1982); Broach, In: "The
Molecular Biology of the Yeast Saccharomyces: Life Cycle and
Inheritance", Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY, p. 445-470 (1981); Broach, Cell 28:203-204 (1982);
Bollon et al., J. Clin. Hematol. Oncol. 10:39-48 (1980);
Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3,
Gene Sequence Expression, Academic Press, NY, pp. 563-
608(1980).
Once the vector or nucleic acid molecule containing the
constructs) has been prepared for expression, the DNA
constructs) may be introduced into an appropriate host cell by
any of a variety of suitable means, i.e., transformation,
transfection, conjugation, protoplast fusion, electroporation,
particle gun technology, lipofection, calcium phosphate
precipitation, direct microinjection, DEAE-dextran
_ .T ____ _..___ .__ __ ___._. _ _ T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
37
transfection, and the like. The most effective method for
transfection of eukaryotic cell lines with plasmid DNA varies
with the given cell type. After the introduction of the
vector, recipient cells are grown in a selective medium, which
selects for the growth of vector-containing cells. Expression
of the cloned gene molecules) results in the production of
truncated VRP or fragments thereof. This can take place in the
transformed cells as such, or following the induction of these
cells to differentiate (for example, by administration of
bromodeoxyuracil to neuroblastoma cells or the like). A
variety of incubation conditions can be used to form the
peptide of the present invention. The most preferred conditions
are those which mimic physiological conditions.
Production of the stable transfectants, may be
accomplished by, for example, transfection of an appropriate
cell line with an eukaryotic expression vector, such as pCEP9,
in which the coding sequence for the truncated VRP polypeptide
or subunit has been cloned into the multiple cloning site.
These expression vectors contain a promoter region, such as
the human cytomegalovirus promoter (CMV), that drive high-level
transcription of desired DNA molecules in a variety of
mammalian cells. In addition, these vectors contain genes for
the selection of cells that stably express the DNA molecule of
interest. The selectable marker in the pCEP9 vector encodes an
enzyme that confers resistance to hygromycin, a metabolic
inhibitor that is added to the culture to kill the
nontransfected cells.
Cells that have stably incorporated the transfected DNA
will be identified by their resistance to selection media, as
described above, and clonal cell lines will be produced by
expansion of resistant colonies. The expression of the
truncated VRPs DNA by these cell lines will be assessed by
solution hybridization and Northern blot analysis.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
38
Pharmaceutical Compositions and Therapeutic Uses
One object of this invention is to provide truncated VRP
in a pharmaceutical composition suitable for therapeutic use.
Thus, in one aspect the invention provides a method for
stimulating angiogenesis in a patient by administering a
therapeutically effective amount of pharmaceutical composition
comprising a truncated VRP.
By "therapeutically effective amount" is meant an amount
of a compound which produces the desired therapeutic effect in
a patient. For example, in reference to a disease or disorder,
it is the amount which reduces to some extent one or more
symptoms of the disease or disorder, and returns to normal,
either partially or completely, physiological or biochemical
parameters associated or causative of the disease or disorder.
When used to therapeutically treat a patient it is an amount
expected to be between 0.1 mg/kg to 100 mg/kg, preferably less
than 50 mg/kg, more preferably less than 10 mg/kg, more
preferably less than 1 mg/kg. The amount of compound depends on
the age, size, and disease associated with the patient.
The optimal formulation and mode of administration of
compounds of the present application to a patient depend on
factors known in the art such as the particular disease or
disorder, the desired effect, and the type of~patient. While
the compounds will typically be used to treat human patients,
they may also be used to treat similar or identical diseases in
other vertebrates such as other primates, farm animals such as
swine, cattle and poultry, and sports animals and pets such as
horses, dogs and cats.
Preferably, the therapeutically effective amount is
provided as a pharmaceutical composition. A pharmacological
agent or composition refers to an agent or composition in a
form suitable for administration into a multicellular organism
such as a human. Suitable forms, in part, depend upon the use
or the route of entry, for example oral, transdermal, or by
_ . r __ _. ___ i
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
39
injection. Such forms should allow the agent or composition to
reach a target cell whether the target cell is present in a
multicellular host or in culture. For example, pharmacological
agents or compositions injected into the blood stream should
be soluble. Other factors are known in the art, and include
considerations such as toxicity and forms which prevent the
agent or composition from exerting its effect.
The claimed compositions can also be formulated as
pharmaceutically acceptable salts (e. g., acid addition salts)
and/or complexes thereof. Pharmaceutically acceptable salts
are non-toxic salts at the concentration at which they are
administered. The preparation of such salts can facilitate the
pharmacological use by altering the physical-chemical
characteristics of the composition without preventing the
composition from exerting its physiological effect. Examples
of useful alterations in physical properties include lowering
the melting point to facilitate transmucosal administration and
increasing the solubility to facilitate the administration of
higher concentrations of the drug.
Pharmaceutically acceptable salts include acid addition
salts such as those containing sulfate, hydrochloride,
phosphate, sulfonate, sulfamate, sulfate, acetate, citrate,
lactate, tartrate, methanesulfonate, ethanesulfonate,
benzenesulfonate, p-toluenesulfonate, cyclolexylsulfonate,
cyclohexylsulfamate and quinate. Pharmaceutically acceptable
salts can be obtained from acids such as hydrochloric acid,
sulfuric acid, phosphoric acid, sulfonic acid, sulfamic acid,
acetic acid, citric acid, lactic acid, tartaric acid, malonic
acid, methanesulfonic acid, ethanesulfonic acid,
benzenesulfonic acid, p-toluenesulfonic acid,
cyclcohexylsulfonic acid, cyclohexylsulfamic acid, and quinic
acid. Such salts may be prepared by, for example, reacting the
free acid or base forms of the product with one or more
equivalents of the appropriate base or acid in a solvent or
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
medium in which the salt is insoluble, or in a solvent such as
water which is then removed in vacuo or by freeze-drying or by
exchanging the ions of an existing salt for another ion on a
suitable ion exchange resin.
5 Carriers or excipients can also be used to facilitate
administration of the compound. Examples of carriers and
excipients include calcium carbonate, calcium phosphate,
various sugars such as lactose, glucose, or sucrose, or types
of starch, cellulose derivatives, gelatin, vegetable oils,
10 polyethylene glycols and physiologically compatible solvents.
The compositions or pharmaceutical composition can be
administered by different routes including intravenously,
intraperitoneal, subcutaneous, and intramuscular, orally,
topically, or transmucosally.
15 The desired isotonicity may be accomplished using sodium
chloride or other pharmaceutically acceptable agents such as
dextrose, boric acid, sodium tartrate, propylene glycol,
polyols (such as mannitol and sorbitol), or other inorganic or
organic solutes. Sodium chloride is preferred particularly for
20 buffers containing sodium ions.
The compounds of the invention can be formulated for a
variety of modes of administration, including systemic and
topical or localized administration. Techniques and
formulations generally may be found in Remington's
25 Pharmaceutical Sciences, 18th Edition, Mack Publishing Co.,
Easton, PA, 1990. See also Wang, Y.J. and Hanson, M.A.
"Parenteral Formulations of Proteins and Peptides: Stability
and Stabilizers," Journal of Parenteral Science and Technology,
Technical Report No. 10, Supp. 42:25 (1988). A suitable
30 administration format may best be determined by a medical
practitioner for each patient individually.
For systemic administration, injection is preferred, e.g.,
intramuscular, intravenous, intraperitoneal, subcutaneous,
intrathecal, or intracerebroventricular. For injection, the
..~ _ -_____ _____ __ ._~__.._ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
41
compounds of the invention are formulated in liquid solutions,
preferably in physiologically compatible buffers such as Hank's
solution or Ringer's solution. Alternatively, the compounds of
the invention are formulated in one or more excipients (e. g.,
propylene glycol) that are generally accepted as safe as
defined by USP standards. They can, for example, be suspended
in an inert oil, suitably a vegetable oil such as sesame,
peanut, olive oil, or other acceptable carrier. Preferably,
they are suspended in an aqueous carrier, for example, in an
isotonic buffer solution at a pH of about 5.6 to 7.4. These
compositions may be sterilized by conventional sterilization
techniques, or may be sterile filtered. The compositions may
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
buffering agents. Useful buffers include for example, sodium
acetate/acetic acid buffers. A form of repository ar "depot"
slow release preparation may be used so that therapeutically
effective amounts of the preparation are delivered into the
bloodstream over many hours or days following transdermal
injection or delivery. In addition, the compounds may be
formulated in solid form and redissolved or suspended
immediately prior to use. Lyophilized forms are also included.
Systemic administration can also be by transmucosal or
transdermal means, or the molecules can be administered orally.
For transmucosal or transdermal administration, penetrants
appropriate to the barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration, bile
salts and fusidic acid derivatives. In addition, detergents
may be used to facilitate permeation. Transmucosal
administration may be, for example, through nasal sprays or
using suppositories. For oral administration, the molecules
are formulated into conventional oral administration dosage
forms such as capsules, tablets, and liquid preparations.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
42
For topical administration, the compounds of the invention
are formulated into ointments, salves, gels, or creams, as is
generally known in the art.
If desired, solutions of the above compositions may be
thickened with a thickening agent such as methyl cellulose.
They may be prepared in emulsified form, either water in oil or
oil in water. Any of a wide variety of pharmaceutically
acceptable emulsifying agents may be employed including, for
example, acacia powder, a non-ionic surfactant (such as a
Tween), or an ionic surfactant (such as alkali polyether
alcohol sulfates or sulfonates, e.g., a Triton).
Compositions useful in the invention are prepared by
mixing the ingredients following generally accepted procedures.
For example, the selected components may be simply mixed in a
blender or other standard device to produce a concentrated
mixture which may then be adjusted to the final concentration
and viscosity by the addition of water or thickening agent and
possibly a buffer to control pH or an additional solute to
control tonicity.
The amounts of various compounds of this invention to be
administered can be determined by standard procedures.
Generally, a therapeutically effective amount is between about
1 nmole and 3 mole of the molecule, preferably between about
10 nmole and 1 mole depending on the age and size of the
patient, and the disease or disorder associated with the
patient. Generally, it is an amount between about 0.1 and 50
mg/kg, preferably 1 and 20 mg/kg of the animal to be treated.
For use by the physician, the compositions will be
provided in dosage unit form containing an amount of a
truncated VRP, VRP polypeptide, or VRP subunit.
Gene Therapy
A truncated VRP or its genetic sequences will also be
useful in gene therapy (reviewed in Miller, Nature 357:455-460
_ -~-.~ __ ____.___ .. _ _._ _ _.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
43
(1992)). Miller states that advances have resulted in
practical approaches to human gene therapy that have
demonstrated positive initial results. The basic science of
gene therapy is described in Mulligan, Science 260:926-931
(1993). One example of gene therapy is presented in Example 7,
which describes the use of adenovirus-mediated gene therapy.
As another example, an expression vector containing the
truncated VRP coding sequence may be inserted into cells, the
cells are grown in vitro and then injected or infused in large
numbers into patients. In another example, a DNA segment
containing a promoter of choice (for example a strong promoter)
is transferred into cells containing an endogenous truncated
VRP in such a manner that the promoter segment enhances
expression of the endogenous truncated VRP gene (for example,
the promoter segment is transferred to the cell such that it
becomes directly linked to the endogenous truncated VRP gene).
The gene therapy may involve the use of an adenovirus
vector including a nucleotide sequence coding for a truncated
VRP subunit, or a naked nucleic acid molecule coding for a
truncated VRP subunit. Alternatively, engineered cells
containing a nucleic acid molecule coding for a truncated VRP
subunit may be injected. Example 7 illustrates a method of
gene therapy using an adenovirus vector to provide angiogenesis
therapy.
Expression vectors derived from viruses such as
retroviruses, vaccinia virus, adenovirus, adeno-associated
virus, herpes viruses, several RNA viruses, or bovine papilloma
virus, may be used for delivery of nucleotide sequences (e-g.,
cDNA) encoding recombinant truncated VRP subunit into the
targeted cell population. Methods which are well known to
those skilled in the art can be used to construct recombinant
viral vectors containing coding sequences. See, for example,
the techniques described in Maniatis et al., Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
44
(1989), and in Ausubel et al., Current Protocols in Molecular
Biology, Greene Publishing Associates and Wiley Interscience,
N.Y. (1989). Alternatively, recombinant nucleic acid molecules
encoding protein sequences can be used as naked DNA or in
reconstituted system eg., liposomes or other lipid systems for
delivery to target cells (See e.g., Felgner et al., Nature
337:387-8, 1989). Several other methods for the direct
transfer of plasmid DNA into cells exist for use in human gene
therapy and involve targeting the DNA to receptors on cells by
complexing the plasmid DNA to proteins. See, Miller, Nature
357:455-60, 1992.
In its simplest form, gene transfer can be performed by
simply injecting minute amounts of DNA into the nucleus of a
cell, through a process of microinjection. Capecchi MR, Cell
22:479-88 (1980). Once recombinant genes are introduced into a
cell, they can be recognized by the cells normal mechanisms for
transcription and translation, and a gene product will be
expressed. Other methods have also been attempted for
introducing DNA into larger numbers of cells. These methods
include: transfection, wherein DNA is precipitated with
calcium phosphate and taken into cells by pinocytosis (Chen C.
and Okayama H, Mol. Cell Biol. 7:2745-52 (1987));
electroporation, wherein cells are exposed to large voltage
pulses to introduce holes into the membrane (Chu G. et al.,
Nucleic Acids Res., 15:1311-26 (1987)); lipofection/liposome
fusion, wherein DNA is packaged into lipophilic vesicles which
fuse with a target cell (Felgner PL., et al., Proc. Natl.
Acad. Sci. USA. 84:7413-7 (1987)); and particle bombardment
using DNA bound to small projectiles (Yang NS. et al., Proc.
Natl. Acad. Sci. 87:9568-72 (1990)). Another method for
introducing DNA into cells is to couple the DNA to chemically
modified proteins.
It has also been shown that adenovirus proteins are
capable of destabilizing endosomes and enhancing the uptake of
_ _. _. _.... __... _
CA 02287538 1999-10-22
WO 98149300 PCT/US98/07801
DNA into cells. The admixture of adenovirus to solutions
containing DNA complexes, or the binding of DNA to polylysine
covalently attached to adenovirus using protein crosslinking
agents substantially improves the uptake and expression of the
5 recombinant gene. Curiel DT et al., Am. J. Respir. Cell. Mol.
Biol., 6:247-52 (1992).
In addition, it has been shown that adeno-associated virus
vectors may be used for gene delivery into vascular cells
(Gnatenko, D., J. of Invest. Med. 45:87-97, (1997)).
10 As used herein "gene transfer" means the process of
introducing a foreign nucleic acid molecule into a cell. Gene
transfer is commonly performed to enable the expression of a
particular product encoded by the gene. The product may
include a protein, polypeptide, anti-sense DNA or RNA, or
15 enzymatically active RNA. Gene transfer can be performed in
cultured cells or by direct administration into animals.
Generally gene transfer involves the process of nucleic acid
molecule contact with a target cell by nori-specific or receptor
mediated interactions, uptake of nucleic acid molecule into the
20 cell through the membrane or by endocytosis, and release of
nucleic acid molecule into the cytoplasm from the plasma
membrane or endosome. Expression may require, in addition,
movement of the nucleic acid molecule into the nucleus of the
cell and binding to appropriate nuclear factors for
25 transcription.
As used herein "gene therapy" is a form of gene transfer
and is included within the definition of gene transfer as used
herein and specifically refers to gene transfer to express a
therapeutic product from a cell in vivo or in vitro. Gene
30 transfer can be performed ex vivo on cells which are then
transplanted into a patient, or can be performed by direct
administration of the nucleic acid molecule or nucleic acid-
protein complex into the patient.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
46
In another preferred embodiment, a vector having nucleic
acid molecule sequences encoding a truncated VRP is provided in
which the nucleic acid molecule sequence is expressed only in a
specific tissue. Methods of achieving tissue-specific gene
expression as set forth in International Publication No. WO
93/09236, filed November 3, 1992 and published May 13, 1993.
In another preferred embodiment, a method of gene
replacement is set forth. "Gene replacement" as used herein
means supplying a nucleic acid molecule sequence which is
capable of being expressed in vivo in an animal and thereby
providing or augmenting the function of an endogenous gene
which is missing or defective in the animal.
In all of the preceding vectors set forth above, a further
aspect of the invention is that the nucleic acid sequence
contained in the vector may include additions, deletions or
modifications to some or all of the sequence of the nucleic
acid, as defined above.
Examples
To assist in understanding the present invention, the
following Examples are included which describes the results of
a series of experiments. The experiments relating to this
invention should not, of course, be construed as specifically
limiting the invention and such variations of the invention,
now known or later developed, which would be within the purview
of one skilled in the art are considered to fall within the
scope of the invention as described herein and hereinafter
claimed.
T ______~___ _ _ _-.__ _ _ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
47
Example 1
Cloning of N-Terminally Truncated VEGF-B, (des-(1-20)-p21-VEGF-
B (or des(2-21)-VEGF-B).
In order to create a novel VEGF-B-related protein that
lacks the first 20 amino acids, a cDNA construct is created in
the following manner:
A DNA encoding human VEGF-B is amplified from a human
heart or skeletal muscle cDNA),or a human fetal brain cDNA
library, or a cDNA preparation from another suitable human
tissue source by PCR with oligonucleotides corresponding to the
published sequence of human VEGF-B. Using standard molecular
biology techniques (Sambrook et al., Molecular Cloning, A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor NY), a DNA fragment then is generated that
encodes at its 5' end the signal sequence of human VEGF-B,
followed by a codon for proline, the first amino acid residue
in mature VEGF-B, and then followed by codons corresponding to
amino acids from residues 22 to the C-terminus of human VEGF-B,
followed by a stop codon. Appropriate additional non-coding
nucleotide sequences are added to the 5' and 3' ends of this
DNA construct so as to allow insertion of the DNA into an
appropriate expression vector.
In this manner the cleavage site for the signal peptide is
preserved in a manner identical to that found in native VEGF
B. However, this strategy results in a change in the new N
terminal amino acid of the truncated VEGF-B. Whereas the
normal N-terminal amino acid residue in des(1-20)-VEGF-B is a
tyrosine residue:
mspllrrlllvallqlartqa[PVSQFDGPSHQKKVVPWIDV]YTRAT, the new
N-terminal amino acid is proline, and the resulting truncated
VEGF-B is equivalent to des(2-21)-VEGF-B):
msp11rr111va11qlartqaPTRAT...
The change from the native amino acid of the truncated
VEGF-B (tyrosine in the case of a a)20-residue truncation) is
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
48
not expected to have any effect on the biological activity of
the truncated VEGF-B. The advantage of this strategy is that
the signal peptide sequence is maintained thus ensuring
efficient cleavage of the signal peptide from the precursor
during protein processing/secretion.
In another example, truncated VEGF-B, des(1-15)-VEGF-B, is
constructed by deleting the first 15 amino acids. The signal
peptide cleavage site would be preserved in this case because
residue#16 and residue#1 (the new and old N-termini) are
identical (proline):
mspllrrillvallqlartqa[PVSQFDGPSHQKKVV]PWIDVYTRAT...
mspllrri11va11qlartqaPWIDVYTRAT..
One of skill in the art would understand that other signal
peptides may be used in the present invention. For example,
the signal peptide of VEGF-B or VEGF-C could be used which
would require that the first amino acid of the truncated
protein be an alanine or glycine, respectively, in order to
preserve the respective signal peptide cleavage sites. A
further alternative would be to use signal peptide sequences
from other known proteins; some of these may have cleavage
sites compatible with the N-terminal tyrosine of the truncated
des(1-20)-VEGF-B.
Another alternative would be to generate a construct that
encodes a precursor protein with a cleavage site that
incorporates two, rather than one, amino acids from the N
terminus of the original VEGF-B protein sequence. The purpose
of this strategy would be to ensure more fully that the
cleavage site is compatible with signal peptidase function.
This would introduce two new amino acids at the N-terminus of
the truncated VEGF-B sequence but such a change would not be
expected to alter biological function of the truncated
peptide.
__--_.. -_1 _ _ __~--._~ .__ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
49
The strategy described to generate DNA for expression of
des(1-20)-VEGF-B is useful for generation in an analogous
manner of VEGF-B mutants with N-terminal truncations of other
desired lengths. Further, the strategy is useful to generate
N-terminal truncations of other desired lengths in other VEGF-
related forms and their isoforms of other species.
Example 2: Expression Of N-Terminally Truncated VEGF-B Subunits
The DNA fragment encoding truncated VEGF-B from Example 1
may be cloned into a suitable plasmid vector.
Sf9 (Sporoptera frugiperda) cells are co-transfected with
baculovirus transfer vector pAcUW51 containing cDNA encoding
truncated VEGF-B and baculovirus (Baculogold, Pharmingen, San
Diego, CA). Selection and plaque purification of recombinant
virus are performed according to established protocols using
Blue agar overlays (Gibco BRL). High stock of recombinant
virus is produced in exponentially growing Sf9 cells using a
multiplicity of infection of 0.05. For expression of truncated
VEGF-B, Sf9 cells (1x106 cells/ml) growing in serum free medium
are infected with recombinant virus at a multiplicity of 10.
Supernatant is collected after 72 hours post infection. VEGF
expression in baculovirus-infected insect cells, which can be
used to express the truncated VRPs of the present invention is
also described in Fiebich et al., (Eur. J. Biochem. 211: 19-26,
1993). In this system, VEGF has been shown to be produced in
high yield, with efficient glycosylation similar to that seen
in mammalian cells. In fact, those skilled in the art will
recognize that expression in other systems, including mammalian
cell expression systems, is considered to be within the scope
of this invention. Methods of expressing VEGF proteins which
can be used to express the truncated VRPs of the present
invention using baculovirus systems are also provided in
references which describe VEGF expression, for example, U.S.
Patent Serial No. 5,521,073, and in 0'Reilly et al.,
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
(Baculovirus Expression Vectors: A Laboratory Manual (W. H.
Freeman, New York), 1992).
Those skilled in the art will recognize that other
expression systems may also be used to express functionally
5 active truncated VRPs.
Functionally active recombinant VEGF isoforms have been
expressed in E. Coli (Wilting et al., Dev. Biol. 176, 76-85,
1996) from inclusion body by refolding according to the
procedure described previously for homo- and heterodimers of
10 PDGF (Schneppe et al., Gene 143, 201-09, 1994) and in yeast
(Mohanraj et al., Biochem. Biophys. Res. Commun. 215:750-56,
1995 ) .
Still other methods of expressing VEGF which can be used
to express VRPs in the present invention are described, for
15 example, in Jasny, Science 238:1653, 1987; and Miller et al.,
In: Genetic Engineering, 1986), Setlow, J.K., et al., eds.,
Plenum, Vol. 8, pp. 277-297).
Example 3: Purification Of Recombinant Truncated VRPS
20 For purification of the baculovirus-expressed truncated
VEGF-B of Example 2 from insect-cell supernatant, a number of
standard techniques can be used. These techniques include, but
are not limited to ammonium sulfate precipitation, acetone
precipitation, ion-exchange chromatography, size exclusion
25 chromatography, hydrophobic interaction chromatography,
reverse-phase HPLC, concanavalin A affinity chromatography,
isoelectric focusing, and chromatofocusing. Other standard
protein purification techniques are readily obvious to one
skilled in the art. For example, proteins with specific tags,
30 such as histidine tags, antigen tags, etc., could be produced
by engineering DNA encoding such tags into the VEGF-B DNA such
that proteins containing said tags in a manner compatible with
the protein's biological activity would be expressed and
purified by affinity chromatography directed at the tag. Such
_ . _- _.~_._.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
51
methods are considered within the scope of the present
invention.
A preferred purification method for truncated forms of
VEGF-B is described in the following: Sf9 Cell supernatant is
centrifuged at 10000 rpm for 30 minutes to remove cell debris
and viral particles. Supernatant is then concentrated and
dialyzed against 20 mM Tris (pH 8.3) for 24 hours. The
dialyzed supernatant is centrifuged again to remove insoluble
material and loaded onto a Sepharose Q anion exchange column.
Protein is eluted from the column by gradient elution using a
gradient of NaCl (0 - 1 M NaCl). Chromatography fractions are
analyzed by SDS polyacrylamide gel electrophoresis and by ELISA
using an antibody that recognizes VEGF-B. Fractions with VEGF-
B immunoreactivity are pooled, concentrated, and dialyzed
overnight against O.lo trifluoroacetic acid. Material so
prepared is further purified by reverse phase HPLC. Typically
approximately 2-5 mg of protein is loaded on a semipreparative
C4 column and eluted with a gradient of acetonitrile in O.lo
trifluoracetic acid as described in Esch et al., Meth. Enzymol.
103, 72-89, 1983. Fractions containing truncated VEGF-B are
pooled and stored at -80 degrees Celsius until further use.
A preferred method of purification of the basic and
heparin-binding N-terminally truncated forms of VEGF-related
protein subunits and analogs thereof includes the combined use
of heparin-Sepharose affinity chromatography and cation
exchange chromatography, optionally followed by reverse-phase
HPLC, essentially as described in Connolly et al., J. Biol.
Chem. 264:20017-24, 1989, Gospodarowicz et al., (Proc. Natl.
Acad. Sci. USA, 86:7311-15, 1989), or Plouet et al., (Embo J.
8:3801-06, 1989).
Purification is monitored by following the elution of VRP-
like material using a number of techniques including
radioreceptor assay using izsI-labeled VRP and receptor
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
52
preparations consisting of cells or cell membrane preparations
in functional assays as described in Examples 4-6.
The truncated VRPs expressed in other eukaryotic cell
systems such as yeast or mammalian cells, may be purified in
the same manner.
Truncated VRPs expressed in prokaryotic cells will likely
need to undergo a re-folding step for proper dimerization of
subunits, as described in, for example, Schneppe et al., (Gene
143:201-09, 1994).
Example 4: Receptor-Binding Assay
The binding of truncated VRPs to VEGF receptors can be
assessed in various ways. Useful methods include the
determination of the ability of VRP analogs to bind to
endothelial cells or to cells artificially transfected with
KDR, or to soluble forms of the KDR receptor (for example, a
KDR/alkaline phosphatase fusion protein (Gitay-Goren et al., J.
Biol. Chem. 271:5519-23 (1996)). A preferred procedure has
been described by Terman et al. (Biochem. Biophys. Res. Commun.
187:1579-86, 1992).
In this procedure, KDR cDNA is transfected into CMT-3
monkey kidney cells by the DEAF-dextran method by incubating
plated cells with DMEM containing 1 ~g/ml DNA, 0.5 ~.g/ml DEAE
dextran, and 100 ~M chloroquine. Following incubation for 4
hours at 37 degrees Celsius, the medium is aspirated and cells
are exposed to loo DMSO in PBS for one minute. The cells are
then washed once with DMEM containing loo calf serum and then
incubated for 40 hours at 37 degrees Celsius in DMEM/10% calf
serum containing 100 ~,M ZnClz and 1 ~M CdClz.
. VEGF-B is radioiodinated using either the Iodogen method
or the chloramine T method. Radiolabelled VEGF-B is separated
from excess free iodine-125 using gel filtration on a Sephadez
G25 column or a heparin-Sepharose column. Specific activity of
radiolabelled lzsl-VEGF-B analog should typically be in the
_. _ T T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
53
order of 105 cpm/ng. For radioceptor assays, CMT-3 (105
cells/well) are plated in 12-well plates. Twenty four hours
later, cells are washed twice with PBS, and 0.5 ml of DMEM
containing 0.150 gelatin and 25 mM HEPES, pH 7.9 is added.
i25I-VEGF-B, at concentrations ranging from 1-500 pM, is then
added. Binding experiments are done in the presence or absence
of 0.5 nM unlabeled VEGF-B for the determination of specific
binding. After a 90-minute incubation at room temperature, a
50 ~,1 sample of the media from each well is used to determine
the concentration of free radioligand, and the wells are washed
3 times with ice cold PBS containing 0.1% BSA. Cells are
extracted from the wells by incubation for 30 minutes with 1%
Triton X100 in 100 mM sodium phosphate, pH 8.0, and the
radioactivity of the extract is determined in a gamma counter.
Example 5: Mitogenic Assay
The mitogenic activity of truncated VRPs on endothelial
cells of human or mammalian origin can be determined by a
number of different procedures, including assays where cell
proliferation is measured by growth of cell numbers or by
incorporation of radioactive DNA precursors (thymidine
incorporation) or otherwise appropriately labeled DNA
precursors (bromo-deoxyuridine incorporation). These and other
methods generally used to determine cell proliferation,
including those methods where mitogenic activity is assessed in
vivo (for example by determining the mitotix index of
endothelial cells) are considered within the scope of this
invention. A preferred method is described herein (Bohlen et
al., Proc. Natl. Acad. Sci. USA 81:5364-68, 1994): Bovine
aortic arch endothelial cells maintained in stock cultures in
the presence of Dulbecco's modified Eagle's medium supplemented
with loo calf serum and antibiotics (gentamycin at 50 ~tg/ml and
fungizine at 0.25 ~,g/ml) and basic fibroblast growth factor (1-
10 ng/ml, added every 48 h) are passaged weekly at a split
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
54
ratio of 1:64. For mitogenic assays, cell monolayers from
stock plates (at passages 3-10) are dissociated using trypsin.
Cells are then seeded at a density of approximately 8000
cells/well in 24-well plates in the presence of DMEM and
antibiotics as described above. Samples to be assayed (1-10
~,1), appropriately diluted in DMEM/O.lo bovine serum albumin),
are added six hours after plating of cells and again after 48
hours. After 4 days of culture, endothelial cells are detached
from plates with trypsin and counted using a Coulter particle
counter.
Another mitogenic activity assay is provided in Olofsson,
B. et al., Proc. Natl. Acad. Sci. USA 93:2576-81, 1996).
Second passage human umbilical vein endothelial cells (HUVECs)
are plated into 96-well plates (4 X 103 cells per well) in M-199
medium supplemented with 10% (vol/vol) fetal bovine serum and
incubated for 24 hours. Cell culture conditioned medium
containing the truncated VRP, in the presence of 1-10 ~tg/ml
heparin, or purified truncated VRP is added to_ the HUVECs, and
the cells are stimulated for 48 hours. Fresh cell culture
conditioned medium containing [3H] thymidine (Amersham; 10
~tCi/ml) is added to the cells and stimulation is continued for
another 48 hours. Cells are washed with PBS and trypsinized
and the incorporated radioactivity is determined by liquid
scintillation counting. The activity of truncated VRP is
compared to the activity of non-truncated VRP.
In another alternative method, bovine capillary
endothelial (BCE) cells are seeded into 24-well plates and
grown until confluence in minimal essential medium (MEM)
supplemented with loo fetal calf serum. Cells are starved in
MEM supplemented with 3o fetal calf serum for 72 hours, after
which conditioned medium diluted into serum-free medium is
added to the cells and the cells are stimulated for 24 hours.
[3H] thymidine is included during the last 4 hours of the
stimulation (1 ~Ci/ml). Cells are washed with PBS and lysed
_ _-.-___.__.T ___.__ _._.~_._
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
with NaOH, and incorporated radioactivity is determined by
liquid scintillation counting. The activity of truncated VRP
is compared to that of non-truncated VRP. Bovine fibroblast
growth factor (b-FGF) may be used as an additional control for
5 mitogenic activity, and may also be used to measure its
potentiating activity of truncated VRP activity.
Example 6: Angiogenic Activity Of Truncated VRPS
The angiogenic activity of substances can be determined
10 using a variety of in vivo methods. Commonly used methods
include the chick chorioallantoic membrane assay, the corneal
pouch assay in rabbits, rats, or mice, the matrigel implant
assay in mice, the rabbit ear chamber angiogenesis assay, the
hamster cheek pouch assay, the Hunt-Schilling chamber model and
15 the rat sponge implant model. Other assay methods to assess
the formation of new blood vessels have been described in the
literature and are considered to be within the scope of this
invention.
A preferred method for demonstrating the angiogenic
20 activity of truncated VRPs is the rabbit corneal pouch assay.
In this assay, Elvax (ethylene vinyl acetate) polymer pellets
containing approximately 1-1000 ng of the growth factor and a
constant amount of rabbit serum albumin as carrier is implanted
into a surgical incision in the cornea as described in more
25 detail in Phillips and Knighton, Wound Rep. Reg. 3, 533-539,
1995; Gimbrone et al., J. Natl. Canc. Inst. 52:413-27, 1974;
Risau, Proc. Natl. Acad. Sci. USA 83:3855-59, 1986). Growth
factor-induced vascularization of the cornea is then observed
over a period of 2 weeks. Semiquantitative analysis is
30 possible with morphometric and image analysis techniques using
photographs of corneas.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
56
Example 7: Gene-Transfer-Mediated Anqioqenesis Therapy Usin
Truncated VRPS
Truncated VRPs are used for gene-transfer-mediated
angiogenesis therapy as described, for example, in
PCT/US96/02631, published September 6, 1996 as W096/26742,
hereby incorporated by reference herein in its entirety.
Adenoviral Constructs
A helper independent replication deficient human
adenovirus 5 system may be used for gene-transfer. A nucleic
acid molecule coding for a truncated VRP subunit may be cloned
into the polylinker of plasmid ACCMVPLPA which contains the CMV
promoter and SV40 polyadenylation signal flanked by partial
adenoviral sequences from which the E1A and E1B genes
(essential for viral replication) have been deleted. This
plasmid is co-transferred (lipofection) into 293 cells with
plasmid JM17 which contains the entire human adenoviral 5
genome with an additional 4.3 kb insert making pJMl7 too large
to be encapsidated. Homologous rescue recombination results in
adenoviral vectors containing the transgene in the absence of
ElA/E1B sequences. Although these recombinants are
nonreplicative in mammalian cells, they can propagate in 293
cells which have been transformed with E1A/E1B and provided
these essential gene products in trans. Transfected cells are
monitored for evidence of cytopathic effect which usually
occurs 10-14 days after transfection. To identify successful
recombinants, cell supernatant from plates showing a cytopathic
effect is treated with proteinase K (50 mg/ml with 0.5% sodium
dodecyl sulfate and 20 mM EDTA) at 56°C for 60 minutes, phenol/
chloroform extracted and ethanol precipitated. Successful
recombinants are then identified with PCR using primers
(Biotechniques 15:868-72, 1993) complementary to the CMV
_.. _ _ 1 ___ ~__ ______ _. i
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
57
promoter and SV40 polyadenylation sequences to amplify the
truncated VRP subunit nucleic acid insert and primers
(Biotechniques 15:868-72, 1993) designed to concomitantly
amplify adenoviral sequences. Successful recombinants then are
plaque purified twice. Viral stocks are propagated in 293
cells to titers ranging between 101° and 1012 viral particles,
and are purified by double CsCl gradient centrifugation prior
to use. The system used to generate recombinant adenoviruses
imposed a packing limit of 5kb for transgene inserts. The
truncated VRP genes, driven by the CMV promoter and with the
SV40 polyadenylation sequences are well within the packaging
constraints. Recombinant vectors are plaque purified by
standard procedures. The resulting viral vectors are
propagated on 293 cells to titers in the 101°-1012 viral
particles range. Cells are infected at 80% confluence and
harvested at 36-48 hours. After freeze-thaw cycles the
cellular debris is pelleted by standard centrifugation and the
virus further purified by double CsCl gradient
ultracentrifugation (discontinuous 1.33/1.45 CsCl gradient;
cesium prepared in 5 mM Tris, 1 mM EDTA (pH 7.8): 90,000 x g (2
hr), 105,000 x g (18 hr)). Prior to in vivo injection, the
viral stocks are desalted by gel filtration through Sepharose
columns such as G25 Sephadex. The resulting viral stock has a
final viral titer approximately in the 101°-1012 viral particles
range. The adenoviral construct should thus be highly
purified, with no wild-type (potentially replicative) virus.
Porcine Ischemia Model For Angiogenesis
A left thoracotomy is performed on domestic pigs (30-40
kg) under sterile conditions for instrumentation. (Hammond, et
al. J Clin Invest. 92:2644-52 (1993); Roth, et al. J. Clin.
Invest. 91:939-49, 1993). Catheters are placed in the left
atrium and aorta, providing a means to measure regional blood
flow, and to monitor pressures. Wires are sutured on the left
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
58
atrium to permit ECG recording and atrial pacing. Finally, an
ameroid constrictor (ameroid), a metal ring including an
ameroid substance, is placed around the proximal left
circumflex coronary artery (LCx) (Hammond et al. J. Clin.
Invest. 92:2644-52 (1993)). After a stable degree of ischemia
develops, the treatment group receives an adenoviral construct
that includes a truncated VRP gene driven by a CMV promoter.
Control animals receive gene transfer with an adenoviral
construct that includes a reporter gene, lacZ, driven by a CMV
promoter.
Studies are initiated 35 + 3 days after ameroid placement,
at a time when collateral vessel development and pacing-induced
dysfunction are stable (Roth, et al. Am J Physiol 253:1-11279-
1288, 1987, and Roth, et al. Circulation 82:1778-89).
Conscious animals are suspended in a sling and pressures from
the left ventricle (LV), left atrium (LA) and aorta, and
electrocardiogram are recorded in digital format on-line (at
rest and during atrial pacing at 200 bpm). Two-dimensional and
M-mode images are obtained using a Hewlett Packard ultrasound
imaging system. Images are obtained from a right parasternal
approach at the mid-papillary muscle level and recorded on VHS
tape. Images are recorded with animals in a basal state and
again during right atrial pacing (HR=200 bpm). These studies
are performed one day prior to gene transfer and repeated 14 +
1 days later. Rate-pressure products and left atrial pressures
should be similar in both groups before and after gene
transfer, indicating similar myocardial oxygen demands and
loading conditions. Echocardiographic measurements are made
using standardized criteria (Sahn, et al. Circulation 58:1072,
1978). End-diastolic wall thickness (EDWTh) and end-systolic
wall thickness (ESWTh) are measured from 5 continuous beats and
averaged. Percent wall thickening (%WTh) is calculated
[(EDWTh-ESWTh)/EDWTh] X 100. Data should be analyzed without
knowledge of which gene the animals had received. To
_...- -._...___ T _
CA 02287538 1999-10-22
WO 98/49300 PCTIUS98/07801
59
demonstrate reproducibility of echocardiographic measurements,
animals should be imaged on two consecutive days, showing high
correlation (r2=0.90; p=0.005).
35 ~ 3 days after ameroid placement, well after ameroid
closure, but before gene transfer, contrast echocardiographic
studies are performed using the contrast material (Levovist)
which is injected into the left atrium during atrial pacing
(200 bprn). Studies are repeated 14 + 1 days after gene
transfer. Peak contrast intensity is measured from the video
images using a computer-based video analysis program (Color Vue
II, Nova Microsonics, Indianapolis, Indiana), that provides an
objective measure of video intensity. The contrast studies are
analyzed without knowledge of which gene the animals have
received.
At completion of the study, animals are anesthetized and
midline thoracotomy performed. The brachycephalic artery is
isolated, a canula inserted, and other great vessels ligated.
The animals receive intravenous heparin (10,000 IU) and
papaverine (60 mg). Potassium chloride is given to induce
diastolic cardiac arrest, and the aorta cross-clamped. Saline
is delivered through the brachycephalic artery cannula (120
mmHg pressure), thereby perfusing the coronary arteries.
Glutaraldehyde solution (6.25%, 0.1 M cacodylate buffer) was
perfused (120 mmH pressure) until the heart is well fixed (10-
15 min) . The heart is then removed, the beds identified using
color-coded dyes injected anterograde through the left anterior
descending (LAD), left circumflex (LCx), and right coronary
arteries. The ameroid is examined to confirm closure. Samples
taken from the normally perfused and ischemic regions are
divided into thirds and the endocardial and epicardial thirds
are plastic-imbedded. Microscopic analysis to quantitate
capillary number is conducted as previously described (Mathieu-
Costello, et al. Am J Physiol 359:H204, 1990). Four 1 ~,m thick
transverse sections are taken from each subsample (endocardium
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
and epicardium of each region) and point-counting is used to
determine capillary number per fiber number ratio at 400X
magnification. Twenty to twenty-five high power fields are
counted per subsample. Within each region, capillary number to
5 fiber number rations should be similar in endocardium and
epicardium so the 40-50 field per region should be averaged to
provide the transmural capillary to fiber number ratio.
To establish that improved regional function and blood
flow result from transgene expression, PCR and RT-PCR may be
10 used to detect transgenic truncated VRP DNA and mRNA in
myocardium from animals that have received truncated VRP gene
transfer. Using a sense primer to the CMV promoter
[GCAGAGCTCGTTTAGTGAAC] [SEQ I.D. NO. 41]; and an antisense
primer to the internal truncated VRP subunit sequence, PCR is
15 used to amplify the expected 500 by fragment. Using a sense
primer to the beginning of the truncated VRP subunit sequence,
and an antisense primer to the internal truncated VRP sequence,
RT-PCR is used to amplify the expected 400 by fragment.
Finally, using a polyclonal antibody directed against VRP,
20 truncated VRP expression may be demonstrated 48 hours as well
as 14 ~ 1 days after gene transfer in cells and myocardium from
animals that have received gene transfer with a truncated VRP
gene.
The helper independent replication deficient human
25 adenovirus 5 system is used to prepare transgene containing
vectors. The material injected in vivo should be highly
purified and contain no wild-type (replication competent)
adenovirus. Thus adenoviral infection and inflammatory
infiltration in the heart are minimized. By injecting the
30 material directly into the lumen of the coronary artery by
coronary catheters, it is possible to target the gene
effectively. When delivered in this manner there should be no
transgene expression in hepatocytes, and viral RNA should not
1 _.. - ___~___._ _ T.
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
61
be found in the urine at any time after intracoronary
injection.
Injection of the construct (4.0 ml containing about 1011
viral particles of adenovirus) is performed by injecting 2.0 ml
into both the left and right coronary arteries (collateral flow
to the LCx bed appeared to come from both vessels). Animals
are anesthetized, and arterial access acquired via the right
carotid by cut-down; a 5F Cordis sheath is then placed. A 5F
Multipurpose (A2) coronary catheter is used to engage the
coronary arteries. Closure of the LCx ameroid is confirmed by
contrast injection into the left main coronary artery. The
catheter tip is then placed 1 cm within the arterial lumen so
that minimal material is lost to the proximal aorta during
injection. This procedure is carried out for each of the pigs.
Once gene transfer is performed, three strategies are used
to establish successful incorporation and expression of the
gene. (1) Some constructs may include a reporter gene (lacZ);
(2) myocardium from the relevant beds is sampled, and
immunoblotting is performed to quantitate the presence of
truncated VRP and ( 3 ) PCR is used to detect truncated VRP mRNA
and DNA.
The regional contractile function data obtained should
show that control pigs show a similar degree of pacing-induced
dysfunction in the ischemic region before and 14 + 1 days after
gene transfer. In contrast, pigs receiving truncated gene
transfer should show an increase in wall thickening in the
ischemic region during pacing, demonstrating that truncated VRP
subunit gene transfer in accordance with the invention is
associated with improved contraction in the ischemic region
during pacing. Wall thickening in the normally perfused region
(the interventricular septum) should be normal during pacing
and unaffected by gene transfer. The percent decrease in
function measured by transthoracic echocardiography should be
very similar to the percentage decrease measured by
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
62
sonomicrometry during atrial pacing in the same model (Hammond,
et al. J. Clin. Invest. 92:2644, 1993), documenting the
accuracy of echocardiography for the evaluation of ischemic
dysfunction.
_. _ _T. _____ ___..._ . T _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
63
Sec.~uenceListing
(1) GENERAL
INFORMATION:
(i) APPLICANT: Collateral Therapeutics
(ii) TITLE OF INVENTION: TRUNCATED VEGF-RELATED PROTEINS
(iii) NUMBER OF SEQUENCES: 41
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Lyon & Lyon
(B) STREET: 633 West Fifth Street
Suite 9700
(C) CITY: Los Angeles
(D) STATE: California
(E) COUNTRY: U.S.A.
(F) ZIP: 90071-2066
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5" Diskette, 1.44 Mb
storage
2 (B) COMPUTER: IBM Compatible
5
(C) OPERATING SYSTEM: IBM P.C. DOS 5.0
(D) SOFTWARE: FastSEQ for Windows 2.0
3 (vi) CURRENT APPLICATION
O DATA:
(A) APPLICATION NUMBER:08/842,984
(B) FILING DATE: April 25, 1997
(C) CLASSIFICATION:
35
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
4 O (B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
4 5 (A) NAME: Warburg, Richard J.
(B) REGISTRATION NUMBER: 32,32?
(C) REFERENCE/DOCKET NUMBER: 221/062
50 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (213) 489-1600
(B) TELEFAX: (213) 955-0440
(C) TELEX: 67-3510
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 188 amino acids
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
64
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: Protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 1:
Met Ser Pro Leu Leu Arg Arg Leu Leu Leu Val Ala Leu Leu Gln Leu
1 5 10 15
Ala ArgThr GlnAla ProValSerGln PheAspGly ProSer HisGln
20 25 30
1 Lys LysVal ValPro TrpIleAspVal TyrThrArg AlaThr CysGln
5
35 40 45
Pro ArgGlu ValVal ValProLeuSer MetGluLeu MetGly AsnVal
50 55 60
Val LysGln LeuVal ProSerCysVal ThrValGln ArgCys GlyGly
65 70 75 80
Cys CysPro AspAsp GlyLeuGluCys ValProThr GlyGln HisGln
85 90 95
Val ArgMet GlnIle LeuMetIleGln TyrProSer SerGln LeuGly
100 105 110
Glu MetSer LeuGlu GluHisSerGln CysGluCys ArgPro LysLys
115 120 125
Lys GluSer AlaVal LysProAspSer ProArgIle LeuCys ProPro
130 135 140
Cys ThrGln ArgArg GlnArgProAsp ProArgThr CysArg CysArg
195 150 155 160
Cys ArgArg ArgArg PheLeuHisCys GlnGlyArg GlyLeu GluLeu
165 170 175
Asn ProAsp ThrCys ArgCysArgLys ProArgLys
180 185
4 (2) INFORMATION FOR SEQID 2:
5 NO:
(i)SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 206amino
acids
(B) TYPE: amino id
ac
(D) linear
TOPOLOGY:
(ii)MOLECULE Protein
TYPE:
5 (xi)SEQUENCE SEQ ID 2:
5 DESCRIPTION: N0:
Met SerPro LeuLeu ArgArgLeuLeu LeuAlaAla LeuLeu GlnLeu
1 5 10 15
Ala ProAla GlnAla ProValSerGln ProAspAla ProGly HisGln
20 25 30
_ ~ r _ _ i
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
Arg LysValVal SerTrpIle AspVal TyrThrArg AlaThrCys Gln
35 40 45
5 Pro ArgGluVal ValValPro LeuThr ValGluLeu MetGlyThr Val
50 55 60
Ala LysGlnLeu ValProSer CysVal ThrValGln ArgCysGly Gly
65 70 75 80
10
Cys CysProAsp AspGlyLeu GluCys ValProThr GlyGlnHis Gln
85 90 95
Val ArgMetGln IleLeuMet IleArg TyrProSer SerGlnLeu Gly
15 100 105 110
Glu MetSerLeu GluGluHis SerGln CysGluCys ArgProLys Lys
115 120 125
2 Asp SerAlaVal LysProAsp ArgAla AlaThrPro HisHisArg Pro
0
130 135 140
Gln ProArgSer ValProGly TrpAsp SerAlaPro GlyAlaPro Ser
145 150 155 160
25
Pro AlaAspIle ThrHisPro ThrPro AlaProGly ProSerAla His
165 170 175
Ala AlaProSer ThrThrSer AlaLeu ThrProGly ProAlaAla Ala
30 180 185 190
Ala AlaAspAla AlaAlaSer SerVal AlaLysGly GlyAla
195 200 205
(2) INFORMATION ID 3:
FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 419 amino
acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
4 (ii)MOLECULE TYPE: Protein
5
(xi)SEQUENCE DESCRIPTION: SEQID N0: 3:
Met His Leu Leu Gly PheSerValAla Cys LeuLeu AlaAia
Phe Ser
1 5 10 15
Ala Leu Leu Pro Gly ArgGluAlaPro Ala AlaAla AlaPhe
Pro Ala
20 25 30
Glu Ser Gly Leu Asp SerAspAlaGlu Pro AlaGly GluAla
Leu Asp
35 40 45
Thr Ala Tyr Ala Ser AspLeuGluGlu Gln ArgSer ValSer
Lys Leu
50 55 60
Ser Val Asp Glu Leu ThrValLeuTyr Pro TyrTrp LysMet
Met Glu
70 75 80
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
6-6
Tyr Lys Cys Gln Leu Arg Lys Gly Gly Trp Gln His Asn Arg Glu Gln
85 90 95
Ala Asn Leu Asn Ser Arg Thr Glu Glu Thr Ile Lys Phe Ala Ala Ala
100 105 110
His Tyr ThrGluIle LeuLys SerIleAsp AsnGluTrp ArgLys
Asn
115 120 125
Thr GlnCys MetProArg GluVal CysIleAsp ValGlyLys GluPhe
130 135 140
Gly ValAla ThrAsnThr PhePhe LysProPro CysValSer ValTyr
145 150 155 160
Arg CysGly GlyCysCys AsnSer GluGiyLeu GlnCysMet AsnThr
165 170 175
Ser ThrSer TyrLeuSer LysThr LeuPheGlu IleThrVal ProLeu
180 185 190
2 Ser GlnGly ProLysPro ValThr IleSerPhe AlaAsnHis ThrSer
5
195 200 205
Cys ArgCys MetSerLys LeuAsp ValTyrArg GlnValHis SerIle
210 215 220
Ile ArgArg SerLeuPro AlaThr LeuProGln CysGlnAla AlaAsn
225 230 235 240
Lys ThrCys ProThrAsn TyrMet TrpAsnAsn HisIleCys ArgCys
245 250 255
Leu AlaGln GluAspPhe MetPhe SerSerAsp AlaGlyAsp AspSer
260 265 270
4 Thr AspGly PheHisAsp IleCys GlyProAsn LysGluLeu AspGlu
0
275 280 285
Glu ThrCys GlnCysVal CysArg AlaGlyLeu ArgProAla SerCys
290 295 300
Gly ProHis LysGluLeu AspArg AsnSerCys GlnCysVal CysLys
305 310 315 320
Asn LysLeu PheProSer GlnCys GlyAlaAsn ArgGluPhe AspGlu
325 330 335
Asn ThrCys GlnCysVal CysLys ArgThrCys ProArgAsn GlnPro
340 345 350
Leu AsnPro GlyLysCys AlaCys GluCysThr GluSerPro GlnLys
355 360 365
Cys LeuLeu LysGlyLys LysPhe HisHisGln ThrCysSer CysTyr
370 375 380
Arg ArgPro CysThrAsn ArgGln LysAlaCys GluProGly PheSer
385 390 395 400
_T - __ _ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
67
Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys~Arg Pro
405 410 415
Gln Met Ser
(2) INFORMATION FOR SEQ ID N0: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 170 amino acids
(H) TYPE: amino acid
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE
DESCRIPTION:
SEQ
ID
N0:
4:
2 Met Pro ValMet ArgLeuPhe ProCysPhe LeuGlnLeu LeuAlaGly
0
1 5 10 15
Leu Ala LeuPro AlaValPro ProGlnGln TrpAlaLeu SerAlaGly
20 25 30
Asn Gly SerSer GluValGlu ValValPro PheGlnGlu ValTrpGly
35 40 45
Arg Ser TyrCys ArgProIle GluThrLeu ValAspIle PheGlnGlu
50 55 60
Tyr Pro AspGlu IleGluTyr IlePheLys ProSerCys ValProLeu
65 70 75 80
3 Met Arg CysGly GlyCysCys AsnAspGlu GlyLeuGlu CysValPro
5
85 90 95
Thr Glu GluSer AsnValThr MetGlnIle MetArgIle LysProHis
100 105 110
Gln Ser GlnHis IleGlyGlu MetSerPhe LeuGlnHis SerLysCys
115 120 125
Glu Cys ArgPro LeuArgGlu LysMetLys ProGluArg ArgArgPro
130 135 140
Lys Gly ArgGly LysArgArg ArgGluLys GlnArgPro ThrAspCys
145 150 155 160
5 His Leu CysGly AspAlaVal ProArgArg
0
165 170
5 5 (2) INFORMATION FOR SEQ ID N0: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 221 amino acids
6 0 (H) TYPE: amino acid
(D) TOPOLOGY: linear
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
68
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ID
DESCRIPTION: NO:
SEQ 5:
Met Arg ArgCysArg IleSerGly ArgProPro AlaPro ProGlyVal
1 5 10 15
Pro Ala GlnAlaPro ValSerGln ProAspAla ProGly HisGlnArg
20 25 30
Lys Val ValSerTrp IleAspVal TyrThrArg AlaThr CysGlnPro
35 40 45
Arg Glu ValValVal ProLeuThr ValGluLeu MetGly ThrValAla
50 55 60
Lys Gln LeuValPro SerCysVal ThrValGln ArgCys GlyGlyCys
65 70 75 80
2 Cys Pro AspAspGly LeuGluCys ValProThr GlyGln HisGlnVal
0
85 90 95
Arg Met GlnIle MetIleArg TyrPro SerSerGln LeuGlyGlu
Leu
loo l05 ilo
Met Ser LeuGlu HisSerGln CysGlu CysArgPro LysLysLys
Glu
115 120 125
Asp Ser AlaVal GlnAspArg AlaAla ThrProHis HisArgPro
Lys
130 135 140
Gln Pro ArgSer ProGlyTrp AspSer AlaProGly AlaProSer
Val
145 150 155 160
Pro Ala AspIle GlnSerHis SerSer ProArgPro LeuCysPro
Thr
165 170 175
Arg Cys ThrGln HisGlnCys ProAsp ProArgThr CysArgCys
His
180 185 190
Arg Cys ArgArg SerPheLeu ArgCys GlnGlyArg GlyLeuGlu
Arg
195 200 205
4 Leu Asn ProAsp CysArgCys ArgLys LeuArgArg
5 Thr
210 215 220
(2) INFORMATION SEQID 6:
FOR NO:
5 (i) SEQUENCE
O CHARACTERISTICS:
(A)LENGTH: 133 amino
acids
(B)TYPE: amino id
ac
(D)TOPOLOGY: linear
55
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQID O: 6:
DESCRIPTION: N
60 Met Lys LeuLeu GlyIleLeu ValAla ValCysLeu HisGlnTyr
Val
1 5 10 15
_ _ _ ._ _T _~ _.. _ _..
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
69
Leu Leu Asn Ala Asp Ser Asn Thr Lys Gly Trp Ser Glu Val Leu Lys
20 25 30
Gly SerGlu CysLys ProArgPro IleValVal ProValSer GluThr
35 40 45
His ProGlu LeuThr SerGlnArg PheAsnPro ProCysVal ThrLeu
50 55 60
Met ArgCys GlyGly CysCysAsn AspGluSer LeuGluCys ValPro
65 70 75 80
Thr GluGlu ValAsn ValThrMet GluLeuLeu GlyAlaSer GlySer
85 90 95
Gly SerAsn GlyMet GlnArgLeu SerPheVal GluHisLys LysCys
100 105 110
Asp CysArg ProArg PheThrThr ThrProPro ThrThrThr ArgPro
115 120 125
Pro ArgArg ArgArg
130
(2) INFORMATION FOR SEQID 7:
NO:
(i)SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 148
amino
acids
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE
DESCRIPTION:
SEQ
ID
NO:
7:
Met LysLeu ThrAla ThrLeuGln ValValVal AlaLeuLeu IleCys
1 5 10 15
Met TyrAsn LeuPro GluCysVal SerGlnSer AsnAspSer ProPro
20 25 30
Ser ThrAsn AspTrp MetArgThr LeuAspLys SerGlyCys LysPro
35 40 45
Arg AspThr ValVal TyrLeuGly GluGluTyr ProGluSer ThrAsn
50 55 60
Leu GlnTyr AsnPro ArgCysVal ThrValLys ArgCysSer GlyCys
65 70 75 80
Cys AsnGly AspGly GlnIleCys ThrAlaVal GluThrArg AsnThr
85 90 95
Thr ValThr ValSer ValThrGly ValSerSer SerSerGly ThrAsn
100 105 110
Ser GlyVal SerThr AsnLeuGln ArgIleSer ValThrGlu HisThr
115 120 125
Lys CysAsp CysIle GlyArgThr ThrThrThr ProThrThr ThrArg
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
130 135 140
Glu ProArg Arg
145
5
(2) INFORMATION ID 8:
FOR NO:
SEQ
(i)SEQUENCE CHARACTERISTICS:
10 (A) LENGTH: 160 ds
amino
aci
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
15
(xi)SEQUENCE DESCRIPTION:
SEQ ID NO:
B:
Pro SerHis Gln Lys ValValPro Trp AspValTyr Thr Arg
Lys Ile
1 5 10 15
20
Ala ThrCys Gln Pro GluValVal Val LeuSerMet Glu Leu
Arg Pro
20 25 30
Met GlyAsn Val Val GlnLeuVal Pro CysValThr Val Gln
Lys Ser
25 35 90 45
Arg CysGly Gly Cys ProAspAsp Gly GluCysVal Pro Thr
Cys Leu
50 55 60
30
Gly GlnHis Gln Val MetGlnIle Leu IleGlnTyr Pro Ser
Arg Met
65 70 75 80
3 5 Ser GlnLeu Gly Glu SerLeuGlu Glu SerGlnCys Glu Cys
Met His
85 90 95
Arg ProLys Lys Lys SerAlaVal Lys AspSerPro Arg Ile
Glu Pro
100 105 110
40
Leu CysPro Pro Cys GlnArgArg Gln ProAspPro Arg Thr
Thr Arg
115 120 125
Cys ArgCys Arg Cys ArgArgArg Phe HisCysGln Gly Arg
Arg Leu
45 130 135 190
Gly LeuGlu Leu Asn AspThrCys Arg ArgLysPro Arg Lys
Pro Cys
145 150 155 160
50
(2) INFORMATION ID NO:9:
FOR
SEQ
(i)SEQUENCE CHARACTERISTI CS:
55
(A) LENGTH: 155 o
amin acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
60 (ii)MOLECULE TYPE: Protein
(xi)SEQUENCE DESCRIPTION:SEQ ID NO: 9:
_.__ ~ __ ___ _~_ ___ __
. T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
71
Lys Val Val Pro Trp Ile Asp Val Tyr Thr Arg Ala Thr Cys~Gln Pro
1 5 10 15
Arg Glu ValVal ValProLeuSer MetGluLeu MetGly AsnValVal
20 25 30
Lys Gln LeuVal ProSerCysVal ThrValGln ArgCys GlyGlyCys
35 40 45
Cys Pro AspAsp GlyLeuGluCys ValProThr GlyGln HisGlnVal
50 55 60
Arg Met GlnIle LeuMetIleGln TyrProSer SerGln LeuGlyGlu
65 70 75 80
Met Ser LeuGlu GluHisSerGln CysGluCys ArgPro LysLysLys
85 90 95
2 Glu Ser AlaVal LysProAspSer ProArgIle LeuCys ProProCys
0
100 105 110
Thr Gln ArgArg GlnArgProAsp ProArgThr CysArg CysArgCys
115 120 125
Arg Arg ArgArg PheLeuHisCys GlnGlyArg GlyLeu GluLeuAsn
130 135 190
Pro Asp ThrCys ArgCysArgLys ProArgLys
195 150 155
(2) INFORMATION FORSEQID 10:
N0:
(i) SEQUENCE HARACTERISTICS:
C
(A)LENGTH: 152amino
acids
(B)TYPE: amino id
ac
(D)TOPOLOGY: linear
4 (ii)MOLECULE Protein
0 TYPE:
{xi)SEQUENCE SEQID 10:
DESCRIPTION: N0:
Pro Trp IleAsp ValTyrThrArg AlaThrCys GlnPro ArgGluVal
4 1 5 10 15
5
Val Val ProLeu SerMetGluLeu MetGlyAsn ValVal LysGlnLeu
20 25 30
50 Val Pro SerCys ValThrValGln ArgCysGly GlyCys CysProAsp
35 40 45
Asp Gly LeuGlu CysValProThr GlyGlnHis GlnVal ArgMetGln
50 55 60
55
Ile Leu MetIle GlnTyrProSer SerGlnLeu GlyGlu MetSerLeu
65 70 75 80
Glu Glu HisSer GlnCysGluCys ArgProLys LysLys GluSerAla
60 85 90 95
Val Lys ProAsp SerProArgIle LeuCysPro ProCys ThrGlnArg
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
72
100 105 110
Arg Gln Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg
115 120 125
Arg Phe Leu His Cys Gln Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr
130 135 140
Cys Arg Cys Arg Lys Pro Arg Lys
145 150
(2) INFORMATION ID 11:
FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 150 acids
amino
(B) TYPE: amino d
aci
2 (D) TOPOLOGY: linear
0
(ii)MOLECULE TYPE: Protein
(xi)SEQUENCE DESCRIPTION: 1:
SEQ ID NO:
1
Ile Asp Val Tyr Thr AlaThr CysGln ArgGlu ValValVal
Arg Pro
1 5 10 15
Pro Leu Ser Met Glu MetGly AsnVal LysGln LeuValPro
Leu Val
20 25 30
Ser Cys Val Thr Val ArgCys GlyGly CysPro AspAspGly
Gln Cys
35 40 95
Leu Glu Cys Val Pro GlyGln HisGln ArgMet GlnIleLeu
Thr Val
50 55 60
Met Ile Gln Tyr Pro SerGln LeuGly MetSer LeuGluGlu
Ser Glu
65 70 75 80
His Ser Gln Cys Glu ArgPro LysLys GluSer AlaValLys
Cys Lys
85 90 95
Pro Asp Ser Pro Arg LeuCys ProPro ThrGln ArgArgGln
Ile Cys
100 105 110
Arg Pro Asp Pro Arg CysArg CysArg ArgArg ArgArgPhe
Thr Cys
115 120 125
Leu His Cys Gln Gly GlyLeu GluLeu ProAsp ThrCysArg
Arg Asn
130 135 140
Cys Arg Lys Pro Arg
Lys
145 150
(2) INFORMATION ID NO: 12:
FOR
SEQ
(i) SEQUENCE CHARACTER ISTICS:
(A) LENGTH: 147 ids
amino
ac
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
__ _ T _. _ _.-.._.- _. __ .. -_ j
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
'~ 3
{ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQID 12:
DESCRIPTION: NO:
Tyr Thr ArgAla ThrCysGln ProArgGlu ValValVal ProLeuSer
1 5 10 15
Met Glu LeuMet GlyAsnVal ValLysGln LeuValPro SerCysVal
20 25 30
Thr Val GlnArg CysGlyGly CysCysPro AspAspGly LeuGluCys
35 40 45
1 Val Pro ThrGly GlnHisGln ValArgMet GlnIleLeu MetIleGln
5
50 55 60
Tyr Pro SerSer GlnLeuGly GluMetSer LeuGluGlu HisSerGln
65 70 75 80
Cys Glu CysArg ProLysLys LysGluSer AlaValLys ProAspSer
85 90 95
Pro Arg IleLeu CysProPro CysThrGln ArgArgGln ArgProAsp
2 100 105 110
5
Pro Arg ThrCys ArgCysArg CysArgArg ArgArgPhe LeuHisCys
115 120 125
Gln Gly ArgGly LeuGluLeu AsnProAsp ThrCysArg CysArgLys
130 135 140
Pro Arg Lys
195
(2) INFORMATION ID 13:
FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 145 amino acids
(B) TYPE: amino aci d
(D) TOPOLOGY: linear
4 (ii)MOLECULE TYPE: Protein
5
(xi)SEQUENCE DESCRIPTION: SEQ ID NO: 3:
1
Arg Ala Thr Cys Gln Arg GluVal Val ProLeuSerMet Glu
Pro Val
1 5 10 15
Leu Met Gly Asn Val Lys GlnLeu Val SerCysValThr Val
Val Pro
20 25 30
5 Gln Arg Cys Gly Gly Cys ProAsp Asp LeuGluCysVal Pro
5 Cys Gly
35 40 45
Thr Gly Gln His Gln Arg MetGln Ile MetIleGlnTyr Pro
Val Leu
50 55 60
Ser Ser Gln Leu Gly Met SerLeu Glu HisSerGlnCys Glu
Glu Glu
70 75 80
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
74
Cys Arg Pro Lys Lys Lys Glu Ser Ala Val Lys Pro Asp Ser~Pro Arg
85 90 95
Ile Leu Cys Pro Pro Cys Thr Gln Arg Arg Gln Arg Pro Asp Pro Arg
100 105 110
Thr Cys Arg Cys Arg Cys Arg Arg Arg Arg Phe Leu His Cys Gln Gly
115 120 125
Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Pro Arg
130 135 140
Lys
145
(2) INFORMAT ION SEQ ID 19:
FOR N0:
(i)SEQ UENCE
CHARACTERISTICS:
2 (A) LENGTH: 1 78 minoaci ds
0 a
(B) TYPE: amino acid
(D) TOPOLOGY: linea r
(ii)MOL ECULE Prote in
TYPE:
(xi)SEQUENCE 4:
DESCRIPTION:
SEQ
ID
NO:
1
Pro GlyHis Gln Lys ValValSer TrpIleAsp ValTyr ThrArg
Arg
1 5 10 15
Ala ThrCys Gln Arg GluValVal ValProLeu ThrVal GluLeu
Pro
20 25 30
Met GlyThr Val Lys GlnLeuVal ProSerCys ValThr ValGln
Ala
35 40 45
Arg CysGly Gly Cys ProAspAsp GlyLeuGlu CysVal ProThr
Cys
50 55 60
4 Gly GlnHis Gln Arg MetGlnIle LeuMetIle ArgTyr ProSer
0 Val
65 70 75 80
Ser GlnLeu Gly Met SerLeuGlu GluHisSer GlnCys GluCys
Glu
85 90 95
Arg ProLys Lys Ser AlaValLys ProAspArg AlaAla ThrPro
Asp
100 105 110
His HisArg Pro Pro ArgSerVal ProGlyTrp AspSer AlaPro
Gln
115 120 125
Gly AlaPro Ser Ala AspIleThr HisProThr ProAla ProGly
Pro
130 135 140
5 Pro SerAla His Ala ProSerThr ThrSerAla LeuThr ProGly
5 Ala
145 150 155 160
Pro AlaAla Ala Ala AspAlaAla AlaSerSer ValAla LysGly
Ala
165 170 175
Gly Ala
__~_. _ ___ T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
(2) INFORMATION ID 15:
FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTICS:
5 (A)LENGTH: 173
amino
acids
(B)TYPE: amino
acid
(D)TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
10
(xi)SEQUENCE DESCRIPTION: ID N0:
SEQ 15:
Lys Val ValSer Trp Asp ValTyrThr AlaThr CysGlnPro
Ile Arg
1 5 10 15
15
Arg Glu ValVal Val Leu ThrValGlu MetGly ThrValAla
Pro Leu
20 25 30
Lys Gln LeuVal Pro Cys ValThrVal ArgCys GlyGlyCys
Ser Gln
20 35 40 45
Cys Pro AspAsp Gly Glu CysValPro GlyGln HisGlnVal
Leu Thr
50 55 60
2 5 Arg Met GlnIle Leu Ile ArgTyrPro SerGln LeuGlyGlu
Met Ser
65 70 75 80
Met Ser LeuGlu Glu Ser GlnCysGlu ArgPro LysLysAsp
His Cys
85 90 95
30
Ser Ala ValLys Pro Arg AlaAlaThr HisHis ArgProGln
Asp Pro
100 105 110
Pro Arg SerVal -Pro Trp AspSerAla GlyAla ProSerPro
Gly Pro
35 115 120 125
Ala Asp IleThr His Thr ProAlaPro ProSer AlaHisAla
Pro Gly
130 135 190
4 0 Ala Pro SerThr Thr Ala LeuThrPro ProAla AlaAlaAla
Ser Gly
145 150 155 160
Ala Asp AlaAla Ala Ser ValAlaLys GlyAla
Ser Gly
165 170
45
(2) INFORMATION ID 16:
FOR NO:
SEQ
(i) SEQUENCE
CHARACTERISTICS:
50 (A)LENGTH: 168 o
amin acids
(B)TYPE: amino id
ac
(D)TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
55
(xi)SEQUENCE SEQID N0: 16:
DESCRIPTION:
Ile Asp ValTyr Thr Ala ThrCysGln ArgGlu ValValVal
Arg Pro
1 5 10 15
60
Pro Leu ThrVal Glu Met GlyThrVal LysGln LeuValPro
Leu Ala
20 25 3C
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
76
Ser Cys ValThr ValGln ArgCysGlyGly CysCys ProAsp~AspGly
35 40 45
Leu Glu CysVal ProThr GlyGlnHisGln ValArg MetGlnIleLeu
50 55 60
Met Ile ArgTyr ProSer SerGlnLeuGly GluMet SerLeuGluGlu
65 70 75 80
His Ser GlnCys GluCys ArgProLysLys AspSer AlaValLysPro
85 90 95
Asp Arg AlaAla ThrPro HisHisArgPro GlnPro ArgSerValPro
loo 105 110
Gly Trp AspSer AlaPro GlyAlaProSer ProAla AspIleThrHis
115 120 125
Pro Thr ProAla ProGly ProSerAlaHis AlaAla ProSerThrThr
I30 135 190
Ser Ala LeuThr ProGly ProAlaAlaAla AlaAla AspAlaAlaAla
145 150 155 160
Ser Ser ValAla LysGly GlyAla
165
(2) INFORMATION FORSEQ ID 17:
NO:
(i) SEQUENCE
CHARACTERISTICS:
(A}LENGTH: 163
amino
acids
(B)TYPE: amino
acid
(D)TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE
DESCRIPTION:
SEQ
ID
NO:
17:
90
Arg Ala ThrCys GlnPro ArgGluValVal ValPro LeuThrValGlu
1 5 10 15
Leu Met GlyThr ValAla LysGlnLeuVal ProSer CysValThrVal
20 25 30
Gln Arg CysGly GlyCys CysProAspAsp GlyLeu GluCysValPro
35 90 45
Thr Gly GlnHis GlnVal ArgMetGlnIle LeuMet IleArgTyrPro
50 55 60
Ser Ser GlnLeu GlyGlu MetSerLeuGlu GluHis SerGlnCysGlu
65 70 75 80
Cys Arg ProLys LysAsp SerAlaValLys ProAsp ArgAlaAlaThr
85 90 95
Pro His HisArg ProGln ProArgSerVal ProGly TrpAspSerAla
loo 105 110
Pro Gly AlaPro SerPro AlaAspIleThr HisPro ThrProAlaPro
_~ _ ____.-- _. _ _____ 1
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
'~ 7
115 120 125
Gly Pro SerAlaHis AlaAlaPro SerThr ThrSerAlaLeu ThrPro
130 135 140
Gly Pro AlaAlaAla AlaAlaAsp AlaAla AlaSerSerVal AlaLys
145 150 155 160
Gly Gly Ala
(2) INFORMATION FOR SEQID 18:
NO:
(i) SEQUENCE
CHARACTERISTICS:
1 5 (A)LENGTH: 194 mino
a acids
(B)TYPE: aminoacid
(D)TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ID 18:
DESCRIPTION: N0:
SEQ
Pro Gly HisGlnArg LysValVal SerTrp IleAspValTyr ThrArg
1 5 10 15
Ala Thr CysGlnPro ArgGluVal ValVal ProLeuThrVal GluLeu
20 25 30
Met Gly ThrValAla LysGlnLeu ValPro SerCysValThr ValGln
35 40 45
Arg Cys GlyGlyCys CysProAsp AspGly LeuGluCysV ProThr
al
50 55 60 _
3 5 Gly Gln HisGlnVal ArgMetGln IleLeu MetIleArgTyr ProSer
65 70 75 80
Ser Gln LeuGlyGlu MetSerLeu GluGlu HisSerGlnCys GluCys
85 90 95
Arg Pro LysLysLys AspSerAla ValLys GlnAspArgAla AlaThr
100 105 110
Pro His HisArgPro GlnProArg SerVal ProGlyTrpAsp SerAla
4 5 115 120 125
Pro Gly AlaProSer ProAlaAsp IleThr GlnSerHisSer SerPro
130 135 140
Arg Pro LeuCysPro ArgCysThr GlnHis HisGlnCysPro AspPro
145 150 155 160
Arg Thr CysArgCys ArgCysArg ArgArg SerPheLeuArg CysGln
165 170 175
Gly Arg GlyLeuGlu LeuAsnPro AspThr CysArgCysArg LysLeu
180 185 190
Arg Arg
(2) INFORMATION FOR SEQ ID NO: 19:
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
78
(i)SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 189
amino
acids
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
(ii)MOL ECULE TYPE: Protein
(xi)SEQ UENCE DESCRIPTION:
SEQ ID
N0: 19:
Lys ValVal Ser Trp AspValTyrThr Ala ThrCysGln Pro
Ile Arg
1 5 10 15
Arg GluVal Val Val LeuThrValGlu Met GlyThrVal Ala
Pro Leu
20 25 30
Lys GlnLeu Val Pro CysValThrVal Arg CysGlyGly Cys
Ser Gln
35 40 45
2 Cys ProAsp Asp Gly GluCysValPro Gly GlnHisGln Val
0 Leu Thr
50 55 60
Arg MetGln Ile Leu IleArgTyrPro Ser GlnLeuGly Glu
Met Ser
65 70 75 80
Met SerLeu Glu Glu SerGlnCysGlu Arg ProLysLys Lys
His Cys
85 90 95
Asp SerAla Val Lys AspArgAlaAla Pro HisHisArg Pro
Gln Thr
100 105 110
Gln ProArg Ser Val GlyTrpAspSer Pro GlyAlaPro Ser
Pro Ala
115 120 125
3 Pro AlaAsp Ile Thr SerHisSerSer Arg ProLeuCys Pro
5 Gln Pro
130 135 140
Arg CysThr Gln His GlnCysProAsp Arg ThrCysArg Cys
His Pro
145 150 155 160
Arg CysArg Arg Arg PheLeuArgCys Gly ArgGlyLeu Glu
Ser Gln
165 170 175
Leu AsnPro Asp Thr ArgCysArgLys Arg Arg
Cys Leu
180 185
(2) INFORMATION ID 20:
FOR NO:
SEQ
(i)SEQUENCE CS:
CHARACTERISTI
(A) LENGTH: 184 o
amin acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQID NO: 20:
DESCRIPTION:
Ile AspVal Tyr Thr AlaThrCysGln Arg GluValVal Val
Arg Pro
1 5 10 15
Pro LeuThr Val Glu MetGlyThrVal Lys GlnLeuVal Pro
Leu Ala
_ _ _ _ .-._ ~_.._ i
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
79
20 25 30
Ser CysVal ThrValGln ArgCysGly GlyCysCys ProAsp AspGly
35 40 45
Leu GluCys ValProThr GlyGlnHis GlnValArg MetGln IleLeu
50 55 60
Met IleArg TyrProSer SerGlnLeu GlyGluMet SerLeu GluGlu
65 70 75 80
His SerGln CysGluCys ArgProLys LysLysAsp SerAla ValLys
85 90 95
Gln AspArg AlaAlaThr ProHisHis ArgProGln ProArg SerVal
100 105 110
Pro GlyTrp AspSerAla ProGlyAla ProSerPro AlaAsp IleThr
115 120 125
Gln SerHis SerSerPro ArgProLeu CysProArg CysThr GlnHis
130 135 140
His GlnCys ProAspPro ArgThrCys ArgCysArg CysArg ArgArg
2 145 150 155 160
5
Ser PheLeu ArgCysGln GlyArgGly LeuGluLeu AsnPro AspThr
165 170 175
Cys ArgCys ArgLysLeu ArgArg
180
(2) INFORMATION FORSEQ ID 21:
NO:
(i)SEQUENCE ARACTERISTICS:
CH
(A) LENGTH: 179
amino
acids
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ID
DESCRIPTION: N0:
SEQ 21:
4 Arg AlaThr CysGlnPro ArgGluVal ValValPro LeuThr ValGlu
5
1 5 10 15
Leu MetGly ThrValAla LysGlnLeu ValProSer CysVal ThrVal
20 25 30
Gln ArgCys GlyGlyCys CysProAsp AspGlyLeu GluCys ValPro
35 40 45
Thr GlyGln HisGlnVal ArgMetGln IleLeuMet IleArg TyrPro
50 55 60
Ser SerGln LeuGlyGlu MetSerLeu GluGluHis SerGln CysGlu
70 75 80
60 Cys ArgPro LysLysLys AspSerAla ValLysGln AspArg AlaAla
85 90 95
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
Thr Pro HisHisArg ProGlnPro ArgSer ValProGly TrpAspSer
100 105 110
Ala Pro GlyAlaPro SerProAla AspIle ThrGlnSer HisSerSer
5 115 120 125
Pro Arg ProLeuCys ProArgCys ThrGln HisHisGln CysProAsp
130 135 140
10 Pro Arg ThrCysArg CysArgCys ArgArg ArgSerPhe LeuArgCys
145 150 155 160
Gln Gly ArgGlyLeu GluLeuAsn ProAsp ThrCysArg CysArgLys
165 170 175
15
Leu Arg Arg
(2) INFORMATION FOR SEQID 22:
N0:
20 (i) SEQUENCE
CHARACTERISTICS:
(A)LENGTH: 307
amino
acids
(B)TYPE: amino
acid
(D)TOPOLOGY: linear
25
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE
DESCRIPTION:
SEQ
ID
NO:
22:
30 His Tyr AsnThrGlu IleLeuLys SerIle AspAsnGlu TrpArgLys
1 5 10 15
Thr Gln CysMetPro ArgGluVal CysIle AspValGly LysGluPhe
20 25 30
35
Gly Val AlaThrAsn ThrPhePhe LysPro ProCysVal SerValTyr
35 90 45
Arg Cys GlyGlyCys CysAsnSer GluGly LeuGlnCys MetAsnThr
40 50 55 60
Ser Thr SerTyrLeu SerLysThr LeuPhe GluIleThr ValProLeu
65 70 75 80
4 Ser Gln GlyProLys ProValThr IleSer PheAlaAsn HisThrSer
5
85 90 95
Cys Arg CysMetSer LysLeuAsp ValTyr ArgGlnVal HisSerIle
100 105 110
50
Ile Arg ArgSerLeu ProAlaThr LeuPro GlnCysGln AlaAlaAsn
115 120 125
Lys Thr CysProThr AsnTyrMet TrpAsn AsnHisIle CysArgCys
55 130 135 190
Leu Ala GlnGluAsp PheMetPhe SerSer AspAlaGly AspAspSer
145 150 155 160
60 Thr Asp GlyPheHis AspIleCys GlyPro AsnLysGlu LeuAspGlu
165 170 175
_ r _ __.__ __--_ _ 1
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
81
Glu Thr Cys Gln Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys
180 185 190
Gly Pro HisLysGlu LeuAspArg AsnSerCys GlnCys ValCysLys
195 200 205
Asn Lys LeuPhePro SerGlnCys GlyAlaAsn ArgGlu PheAspGlu
210 215 220
1 Asn Thr CysGlnCys VaiCysLys ArgThrCys ProArg AsnGlnPro
0
225 230 235 290
Leu Asn ProGlyLys CysAlaCys GluCysThr GluSer ProGlnLys
245 250 255
Cys Leu LeuLysGly LysLysPhe HisHisGln ThrCys SerCysTyr
260 265 270
Arg Arg ProCysThr AsnArgGln LysAlaCys GluPro GlyPheSer
275 280 285
Tyr Ser GluGluVal CysArgCys ValProSer TyrTrp LysArgPro
290 295 300
2 Gln Met Ser
5
305
(2) INFORMATION FOR SEQID 23:
NO:
3 (i) SEQUENCE
O CHARACTERISTICS:
(A)LENGTH: 302
amino
acids
(B)TYPE: amino
acid
(D)TOPOLOGY: linear
35
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ID
DESCRIPTION: N0:
SEQ 23:
4 Ile Leu LysSerIle AspAsnGlu TrpArgLys ThrGln CysMetPro
0
1 5 10 15
Arg Glu ValCysIle AspValGly LysGluPhe GlyVal AlaThrAsn
20 25 30
45
Thr Phe PheLysPro ProCysVal SerValTyr ArgCys GlyGlyCys
35 40 45
Cys Asn SerGluGly LeuGlnCys MetAsnThr SerThr SerTyrLeu
50 50 55 60
Ser Lys ThrLeuPhe GluIleThr ValProLeu SerGln GlyProLys
65 70 75 80
5 Pro Val ThrIleSer PheAlaAsn HisThrSer CysArg CysMetSer
5
85 90 95
Lys Leu AspValTyr ArgGlnVal HisSerIle IleArg ArgSerLeu
100 105 110
60
Pro Ala ThrLeuPro GlnCysGln AlaAlaAsn LysThr CysProThr
115 120 125
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
82
Asn Tyr Met Trp Asn Asn His Ile Cys Arg Cys Leu Ala Gln-Glu Asp
130 135 140
Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser Thr Asp Gly Phe His
145 150 155 160
Asp Ile Cys Gly Pro Asn Lys Glu Leu Asp Glu Glu Thr Cys Gln Cys
165 170 175
Val Cys ArgAlaGly LeuArg ProAlaSer CysGly ProHisLys Glu
180 185 190
Leu Asp ArgAsnSer CysGln CysValCys LysAsn LysLeuPhe Pro
195 200 205
Ser Gln CysGlyAla AsnArg GluPheAsp GluAsn ThrCysGln Cys
210 215 220
Val Cys LysArgThr CysPro ArgAsnGln ProLeu AsnProGly Lys
225 230 235 240
2 Cys Ala CysGluCys ThrGlu SerProGln LysCys LeuLeuLys Gly
5
245 250 255
Lys Lys PheHisHis GlnThr CysSerCys TyrArg ArgProCys Thr
260 265 270
Asn Arg GlnLysAla CysGlu ProGlyPhe SerTyr SerGluGlu Val
275 280 285
Cys Arg CysValPro SerTyr TrpLysArg ProGln MetSer
290 295 300
(2) INFORMATION FOR SEQID 24:
NO:
(i) SEQUENCE
CHARACTERISTICS:
(A)LENGTH: 297
amino
acids
(B)TYPE: amino
acid
(D)TOPOLOGY: linear
4 (ii)MOLECULE Protein
5 TYPE:
(xi)SEQUENCE ID
DESCRIPTION: NO:
SEQ 24:
Asp Asn GluTrpArg LysThr GlnCysMet ProArg GluValCys Ile
1 5 10 15
Asp Val GlyLysGlu PheGly ValAlaThr AsnThr PhePheLys Pro
20 25 30
5 Pro Cys ValSerVal TyrArg CysGlyGly CysCys AsnSerGlu Gly
5
35 40 45
Leu Gln CysMetAsn ThrSer ThrSerTyr LeuSer LysThrLeu Phe
50 55 60
Glu Ile ThrValPro LeuSer GlnGlyPro LysPro ValThrIle Ser
70 75 80
.1 _ _.~-___. _.. __ _-._ ___.-..-_
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
83
Phe Ala Asn His Thr Ser Cys Arg Cys Met Ser Lys Leu Asp Val Tyr
85 90 95
Arg GlnVal HisSerIle IleArgArgSer Leu ProAlaThrLeu Pro
100 105 110
Gln CysGln AlaAlaAsn LysThrCysPro Thr AsnTyrMetTrp Asn
115 120 125
Asn HisIle CysArgCys LeuAlaGlnGlu Asp PheMetPheSer Ser
130 135 140
Asp AlaGly AspAspSer ThrAspGlyPhe His AspIleCysGly Pro
145 150 155 lf>0
Asn LysGlu LeuAspGlu GluThrCysGln Cys ValCysArgAla Gly
165 170 175
Leu ArgPro AlaSerCys GlyProHisLys Glu LeuAspArgAsn Ser
180 185 190
Cys GlnCys ValCysLys AsnLysLeuPhe Pro SerGlnCysGly Ala
195 200 205
Asn ArgGlu PheAspGlu AsnThrCysGln Cys ValCysLysArg Thr
210 215 220
Cys ProArg AsnGlnPro LeuAsnProGly Lys CysAlaCysGlu Cys
225 230 235 240
Thr GluSer ProGlnLys CysLeuLeuLys Gly LysLysPheHis His
245 250 255
Gln ThrCys SerCysTyr ArgArgProCys Thr AsnArgGlnLys Ala
260 265 270
Cys GluPro GlyPheSer TyrSerGluGlu Val CysArgCysVal Pro
275 280 285
Ser TyrTrp LysArgPro GlnMetSer
290 295
(2) INFORMATION FORSEQ ID 25:
N0:
(i)SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 292 aminoacids
(B) TYPE: amino d
aci
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQID 5:
DESCRIPTION: N0:
2
Lys ThrGln CysMetPro ArgGluValCys Ile AspValGlyLys Glu
1 5 10 15
Phe GlyVal AlaThrAsn ThrPhePheLys Pro ProCysValSer Val
20 25 30
Tyr ArgCys GlyGlyCys CysAsnSerGlu Gly LeuGlnCysMet Asn
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
84
35 40 45
Thr SerThrSer TyrLeuSerLys ThrLeu PheGluIle ThrVal Pro
50 55 60
Leu SerGlnGly ProLysProVal ThrIle SerPheAla AsnHis Thr
65 70 75 80
Ser CysArgCys MetSerLysLeu AspVal TyrArgGln ValHis Ser
85 90 95
Ile IleArgArg SerLeuProAla ThrLeu ProGlnCys GlnAla Ala
100 105 110
1 Asn LysThrCys ProThrAsnTyr MetTrp AsnAsnHis IleCys Arg
5
115 120 125
Cys LeuAlaGln GluAspPheMet PheSer SerAspAla GlyAsp Asp
130 135 190
Ser ThrAspGly PheHisAspIle CysGly ProAsnLys GluLeu Asp
145 150 155 160
Glu GluThrCys GlnCysValCys ArgAla GlyLeuArg ProAla Ser
165 170 175
Cys GlyProHis LysGluLeuAsp ArgAsn SerCysGln CysVal Cys
180 185 190
3 Lys AsnLysLeu PheProSerGln CysGly AlaAsnArg GluPhe Asp
0
195 200 205
Glu AsnThrCys GlnCysValCys LysArg ThrCysPro P.rgAsn Gln
210 215 220
Pro LeuAsnPro GlyLysCysAla CysGlu CysThrGlu SerPro Gln
225 230 235 290
Lys CysLeuLeu LysGlyLysLys PheHis HisGlnThr CysSer Cys
90 295 250 255
Tyr ArgArgPro CysThrAsnArg GlnLys AlaCysGlu ProGly Phe
260 265 270
4 Ser TyrSerGlu GluValCysArg CysVal ProSerTyr TrpLys Arg
5
275 280 285
Pro GlnMetSer
290
50
(2) INFORMATION FORSEQID N0: 26:
(i)SE QUENCE CS:
CHARACTERISTI
5 (A ) ENGTH: 116 amino ids
5 L ac
(B ) YPE: amino
T acid
(D ) OPOLOGY: linear
T
(ii)MO LECULE YPE: Protein
T
60
(xi)SE QUENCE ESCRIPTION: SEQID 26:
D N0:
_T ___ __ _.._ i
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
Leu Asn Ala Asp Ser Asn Thr Lys Gly Trp Ser Glu Val Leu Lys Gly
1 5 10 -15
Ser GluCys LysProArg ProIleVal ValPro ValSerGlu ThrHis
5 20 25 30
Pro GluLeu ThrSerGln ArgPheAsn ProPro CysValThr LeuMet
35 40 45
10 Arg CysGly GlyCysCys AsnAspGlu SerLeu GluCysVal ProThr
50 55 60
Glu GluVal AsnValThr MetGluLeu LeuGly AlaSerGly SerGly
65 70 75 80
15
Ser AsnGly MetGlnArg LeuSerPhe ValGlu HisLysLys CysAsp
85 90 95
Cys ArgPro ArgPheThr ThrThrPro ProThr ThrThrArg ProPro
20 loo l05 llo
Arg ArgArg Arg
115
(2) INFORMATION ID 27:
FOR NO:
SEQ
(i)SEQUENCE CHARACTERISTICS:
(A) LENGTH: 111 aminoacids
(B) TYPE: amino d
aci
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
(xi)SEQUENCE DESCRIPTION: SEQID NO: 7:
2
Asn ThrLys Gly Trp Glu LeuLys Gly SerGluCys LysPro
Ser Val
1 5 10 15
Arg ProIle Val Val Val GluThr His ProGluLeu ThrSer
Pro Ser
20 25 30
Gln ArgPhe Asn Pro Cys ThrLeu Met ArgCysGly GlyCys
Pro Val
35 40 95
Cys AsnAsp Glu Ser Glu ValPro Thr GluGluVal AsnVal
Leu Cys
50 55 60
Thr MetGlu Leu Leu Ala GlySer Gly SerAsnGly MetGln
Gly Ser
65 70 75 80
Arg LeuSer Phe Val His LysCys Asp CysArgPro ArgPhe
Glu Lys
85 90 95
Thr ThrThr Pro Pro Thr ArgPro Pro ArgArgArg Arg
Thr Thr
100 105 110
(2) INFORMATION ID 28:
FOR NO:
SEQ
(i)SEQUENCE CHARACTERISTI CS:
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
86
(A)LENGTH: 106 amino acids
(B)TYPE: amino aci d
(D)TOPOLOGY: linear
( ii) MOLECULE TYPE: Protein
( xi) SEQUENCE PTION:
DESCRI SEQ
ID
NO:
28:
Ser Glu ValLeu Lys SerGlu Cys Lys ArgPro IleValVal
Gly Pro
1 5 10 15
Pro Val SerGlu Thr ProGlu Leu Thr GlnArg PheAsnPro
His Ser
20 25 30
Pro Cys ValThr Leu ArgCys Gly Gly CysAsn AspGluSer
Met Cys
35 40 45
Leu Glu CysVal Pro GluGlu Val Asn ThrMet GluLeuLeu
Thr Val
50 55 60
Gly Ala SerGly Ser SerAsn Gly Met ArgLeu SerPheVal
Gly Gln
65 70 75 80
Glu His LysLys Cys CysArg Pro Arg ThrThr ThrProPro
Asp Phe
85 90 95
Thr Thr ThrArg Pro ArgArg Arg Arg
Pro
100 105
(2) INFORMATION ID 29:
FOR N0:
SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A)LENGTH: 101 amino
acids
(B)TYPE: amino acid
(D)TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE 29:
DESCRIPTION:
SEQ
ID
NO:
Gly Ser GluCys Lys ArgPro Ile Val ProVal SerGluThr
Pro Val
1 5 10 15
His Pro GluLeu Thr GlnArg Phe Asn ProCys ValThrLeu
Ser Pro
20 25 30
Met Arg CysGly Gly CysAsn Asp Glu LeuGlu CysValPro
Cys Ser
35 40 95
Thr Glu GluVal Asn ThrMet Glu Leu GlyAla SerGlySer
Val Leu
50 55 60
Gly Ser AsnGly Met ArgLeu Ser Phe GluHis LysLysCys
Gln Val
70 75 80
Asp Cys ArgPro Arg ThrThr Thr Pro ThrThr ThrArgPro
Phe Pro
85 90 95
60
Pro Arg ArgArg Arg
100
_ . T ___- ___ _ _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
87
~(2) INFORMATION ID 30:
FOR NO:
SEQ
(i)SEQ UENCE CHARACTERISTICS:
(A) LENGTH: 121
amino
acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
20 (ii)MOL ECULE TYPE: Protein
(xi)SEQ UENCE DESCRIPTION: ID 30:
SEQ NO:
Asn AspSer Pro Pro ThrAsnAsp Trp Arg Thr LeuAspLys
Ser Met
1 5 10 15
Ser GlyCys Lys Pro AspThrVal Val Leu Gly GluGluTyr
Arg Tyr
20 25 30
2 Pra GluSer Thr Asn GlnTyrAsn Pro Cys Val ThrValLys
0 Leu Arg
35 40 45
Arg CysSer Gly Cys AsnGlyAsp Gly Ile Cys ThrAlaVal
Cys Gln
50 55 60
Glu ThrArg Asn Thr ValThrVal Ser Thr Gly ValSerSer
Thr Val
65 70 75 80
Ser SerGly Thr Asn GlyValSer Thr Leu Gln ArgIleSer
Ser Asn
85 90 95
Val ThrGlu His Thr CysAspCys Ile Arg Thr ThrThrThr
Lys Gly
100 i05 110
Pro ThrThr Thr Arg ProArgArg
Glu
115 120
(2) INFORMAT ION FOR ID 31:
SEQ NO:
(i)SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 116 o
amin acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQ ID 31:
DESCRIPTION: NO:
Ser ThrAsn Asp Trp ArgThrLeu Asp Ser Gly CysLysPro
Met Lys
1 5 10 15
Arg AspThr Val Val LeuGlyGlu Glu Pro Glu SerThrAsn
Tyr Tyr
20 25 30
Leu GlnTyr Asn Pro CysValThr Val Arg Cys SerGlyCys
Arg Lys
35 40 45
Cys AsnGly Asp Gly IleCysThr Ala Glu Thr ArgAsnThr
Gln Val
50 55 60
Thr ValThr Val Ser ThrGlyVal Ser Ser Ser GlyThrAsn
Val Ser
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
8-8
65 70 75 80
Ser Gly Val Ser Thr Asn Leu Gln Arg Ile Ser Val Thr Glu His Thr
B5 90 95
Lys Cys Asp Cys Ile Gly Arg Thr Thr Thr Thr Pro Thr Thr Thr Arg
100 105 110
Glu ProArg Arg
115
(2) INFORMATION ID NO: 32:
FOR
SEQ
(i)SEQUENCE CHARACTERISTICS:
(A) LENGTH: 111 amino
acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
2 (ii)MOLECULE TYPE: Protein
0
(xi)SEQUENCE DESCRIPTION:
SEQ ID NO:
32:
Met ArgThr Leu Asp Ser Cys Lys Pro Asp ThrValVal
Lys Gly Arg
1 5 10 15
Tyr LeuGly Glu Glu Pro Ser Thr Asn Gln TyrAsnPro
Tyr Glu Leu
20 25 30
Arg CysVal Thr Val Arg Ser Gly Cys Asn GlyAspGly
Lys Cys Cys
40 45
Gln IleCys Thr Ala Glu Arg Asn Thr Val ThrValSer
Val Thr Thr
50 55 60
35
Val ThrGly Val Ser Ser Gly Thr Asn Gly ValSerThr
Ser Ser Ser
65 70 75 80
Asn LeuGln Arg Ile Val Glu His Thr Cys AspCysIle
Ser Thr Lys
85 90 95
Gly ArgThr Thr Thr Pro Thr Thr Arg Pro ArgArg
Thr Thr Glu
100 105 110
4 (2) INFORMATION ID N0: 33:
5 FOR
SEQ
(i)SEQUENCE CHARACTERISTICS:
(A) LENGTH: 106 amino
acids
5 (B) TYPE: amino acid
0
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
5 (xi)SEQUENCE DESCRIPTION:SEQ ID NO:
5 33:
Lys SerGly Cys Lys Arg Thr Val Val Leu GlyGluGlu
Pro Asp Tyr
1 5 10 15
60 Tyr ProGlu Ser Thr Leu Tyr Asn Pro Cys ValThrVal
Asn Gln Arg
20 25 30
_. _. T _. __.. .__ _-__.._._. r. _ _ T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
8'9
Lys Arg Cys Ser Gly Cys Cys Asn Gly Asp Gly Gln Ile Cys Thr Ala
35 40 45
Val Glu Thr Arg Asn Thr Thr Val Thr Val Ser Val Thr Gly Val Ser
50 55 60
Ser Ser Ser Gly Thr Asn Ser Gly Val Ser Thr Asn Leu Gln Arg Ile
65 70 75 80
Ser Val Thr Glu His Thr Lys Cys Asp Cys Ile Gly Arg Thr Thr Thr
85 90 g5
Thr Pro Thr Thr Thr Arg Glu Pro Arg Arg
100 105
(2) INFORMATION FORSEQID NO:39:
(i) SEQUENCE ISTICS:
CHARACTER
(A) LENGTH: 167 amino
acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE SEQID O: 34:
DESCRIPTION: N
Pro Val Ser GlnPheAspGly ProSerHis GlnLys LysValVal Pro
1 5 10 15
Trp Ile Asp ValTyrThrArg AlaThrCys GlnPro ArgGluVal Val
20 25 30
Val Pro Leu SerMetGluLeu MetGlyAsn ValVal LysGlnLeu Val
35 40 95
Pro Ser Cys ValThrValGln ArgCysGly GlyCys CysProAsp Asp
50 55 60
Gly Leu Glu CysValProThr GlyGlnHis GlnVal ArgMetGln Ile
65 70 75 80
Leu Met Ile GlnTyrProSer SerGlnLeu GlyGlu MetSerLeu Glu
85 90 95
Glu His Ser GlnCysGluCys ArgProLys LysLys GluSerAla Val
100 105 110
Lys Pro Asp SerProArgIle LeuCysPro ProCys ThrGlnArg Arg
115 120 125
Gln Arg Pro AspProArgThr CysArgCys ArgCys ArgArgArg Arg
130 135 140
Phe Leu His CysGlnGlyArg GlyLeuGlu LeuAsn ProAspThr Cys
145 150 155 160
Arg Cys Arg LysProArgLys
165
(2) INFORMAT IONFORSEQID 35:
N0:
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
(i}SEQUENCE CHARACTERISTICS:
(A) LENGTH: 185 ds
amino
aci
5 (B) TYPE: amino
acid
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
Z (xi)SEQUENCE DESCRIPTION:
O SEQ ID NO:
35:
Pro ValSer Gln Pro AlaProGly His ArgLysVal ValSer
Asp Gln
1 5 10 15
1 Trp IleAsp Val Tyr ArgAlaThr Cys ProArgGlu ValVal
5 Thr Gln
20 25 30
Val ProLeu Thr Val LeuMetGly Thr AlaLysGln LeuVal
Glu Val
35 40 95
20
Pro SerCys Val Thr GlnArgCys Gly CysCysPro AspAsp
Val Gly
50 55 60
Gly LeuGlu Cys Val ThrGlyGln His ValArgMet GlnIle
Pro Gln
25 65 70 75 80
Leu MetIle Arg Tyr SerSerGln Leu GluMetSer LeuGlu
Pro Gly
85 90 95
30 Glu HisSer Gln Cys CysArgPro Lys AspSerAla ValLys
Glu Lys
100 105 110
Pro AspArg Ala Ala ProHisHis Arg GlnProArg SerVal
Thr Pro
115 120 125
35
Pro GlyTrp Asp Ser ProGlyAla Pro ProAlaAsp IleThr
Ala Ser
130 135 190
His ProThr Pro Ala GlyProSer Ala AlaAlaPro SerThr
Pro His
4 145 150 155 160
0
Thr SerAla Leu Thr GlyProAla Ala AlaAlaAsp AlaAla
Pro Ala
165 170 175
4 Ala SerSer Val Ala GlyGlyAla
5 Lys
180 1B5
(2) INFORMATION ID 36:
FOR N0:
SEQ
50
(i)SEQUENCE CHARACTERISTI CS:
(A) LENGTH: 201 o
amin acids
(B) TYPE: amino id
ac
5 (D) TOPOLOGY: linear
5
(ii)MOLECULE TYPE: Protein
(xi)SEQUENCE DESCRIPTION: SEQ ID N0: 36:
60
Pro ValSer Gln Pro AlaProGly ArgLysVal ValSer
Asp His
Gln
1 5 10 15
. T _ .____-____.T
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
91
Trp Ile Asp Val Tyr Thr Arg Ala Thr Cys Gln Pro Arg Glu Val Val
20 25 30
Val ProLeu ThrValGlu LeuMetGlyThr ValAla LysGlnLeu Val
35 40 45
Pro SerCys ValThrVal GlnArgCysGly GlyCys CysProAsp Asp
50 55 60
Gly LeuGlu CysValPro ThrGlyGlnHis GlnVal ArgMetGln Ile
65 70 75 80
Leu MetIle ArgTyrPro SerSerGlnLeu GlyGlu MetSerLeu Glu
85 90 95
Glu HisSer GlnCysGlu CysArgProLys LysLys AspSerAla Val
100 105 110
2 Lys GlnAsp ArgAlaAla ThrProHisHis ArgPro GlnProArg Ser
0
115 120 125
Val ProGly TrpAspSer AlaProGlyAla ProSer ProAlaAsp Ile
130 135 140
Thr GlnSer HisSerSer ProArgProLeu CysPro ArgCysThr Gln
145 150 155 160
His HisGln CysProAsp ProArgThrCys ArgCys ArgCysArg Arg
165 170 175
Arg SerPhe LeuArgCys GlnGlyArgGly LeuGlu LeuAsnPro Asp
180 185 190
3 Thr CysArg CysArgLys LeuArgArg
5
195 200
(2) INFORMATION FORSEQ ID 37:
NO:
4 (i)SEQUENCE
O CHARACTERISTICS:
(A) LENGTH: 399
amino
acids
(B) TYPE: amino
acid
(D) TOPOLOGY: linear
45
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ID
DESCRIPTION: N0:
SEQ 37:
5 Gly ProArg GluAlaPro AlaAlaAlaAla AlaPhe GluSerGly Leu
0
1 5 10 15
Asp LeuSer AspAlaGlu ProAspAlaGly GluAla ThrAlaTyr Ala
20 25 30
55
Ser LysAsp LeuGluGlu GlnLeuArgSer ValSer SerValRsp Glu
35 40 45
Leu MetThr ValLeuTyr ProGluTyrTrp LysMet TyrLysCys Gln
60 50 55 60
CA 02287538 1999-10-22
WO 98/49300 PCT/IJS98/07801
92
Leu ArgLysGly GlyTrp GlnHisAsn ArgGlu GlnAlaAsn LeuAsn
65 70 75 80
Ser ArgThrGlu GluThr IleLysPhe AlaAla AlaHisTyr AsnThr
85 90 95
Glu IleLeuLys SerIle AspAsnGlu TrpArg LysThrGln CysMet
100 105 110
1 Pro ArgGluVal CysIle AspValGly LysGlu PheGlyVal AlaThr
0
115 120 125
Asn ThrPhePhe LysPro ProCysVal SerVal TyrArgCys GlyGly
130 135 140
Cys CysAsnSer GluGly LeuGlnCys MetAsn ThrSerThr SerTyr
145 150 155 160
Leu SerLysThr LeuPhe GluIleThr ValPro LeuSerGln GlyPro
165 170 175
Lys ProValThr IleSer PheAlaAsn HisThr SerCysArg CysMet
180 185 190
2 Ser LysLeuAsp ValTyr ArgGlnVal HisSer IleIleArg ArgSer
5
195 200 205
Leu ProAlaThr LeuPro GlnCysGln AlaAla AsnLysThr CysPro
210 215 220
Thr AsnTyrMet TrpAsn AsnHisIle CysArg CysLeuAla GlnGlu
225 230 235 240
Asp PheMetPhe SerSer AspAlaGly AspAsp SerThrAsp GlyPhe
245 250 255
His AspIleCys GlyPro AsnLysGlu LeuAsp GluGluThr CysGln
260 265 270
4 Cys ValCysArg AlaGly LeuArgPro AlaSer CysGlyPro HisLys
0
275 280 285
Glu LeuAspArg AsnSer CysGlnCys ValCys LysAsnLys LeuPhe
290 295 300
Pro SerGlnCys GlyAla AsnArgGlu PheAsp GluAsnThr CysGln
305 310 315 320
Cys ValCysLys ArgThr CysProArg AsnGln ProLeuAsn ProGly
325 330 335
Lys CysA1aCys GluCys ThrGluSer ProGln LysCysLeu LeuLys
340 345 350
Gly LysLysPhe HisHis GlnThrCys SerCys TyrArgArg ProCys
355 360 365
Thr AsnArgGln LysAla CysGluPro GlyPhe SerTyrSer GluGlu
370 375 380
Val CysArgCys ValPro SerTyrTrp LysArg ProGlnMet Ser
385 390 395
-_.__.__._. ~ -_ _ _. _ . - _
CA 02287538 1999-10-22
WO 98/49300 PCT/US98/07801
93
(2) INFORMATION SEQID N0: 38:
FOR
(i)SEQUENCE HARACTER ISTICS:
C
(A) LENGTH: 133 o
amin acids
(B) TYPE: amino id
ac
(D) TOPOLOGY: linear
(ii)MOLECULE Protein
TYPE:
(xi)SEQUENCE ON: SEQID NO: 38:
DESCRIPTI
Met LysLeu Leu GlyIleLeu ValAla Cys LeuHisGln Tyr
Val Val
1 5 10 15
Leu LeuAsn Ala SerAsnThr LysGly Ser GluValLeu Lys
Asp Trp
20 25 30
Giy SerGlu Cys ProArgPro IleVal Pro ValSerGlu Thr
Lys Val
35 40 45
His ProGlu Leu SerGlnArg PheAsn Pro CysValThr Leu
Thr Pro
50 55 60
Met ArgCys Gly CysCysAsn AspGlu Leu GluCysVal Pro
Gly Ser
65 70 75 80
Thr GluGlu Val ValThrMet GluLeu Gly AlaSerGly Ser
Asn Leu
85 90 95
Gly SerAsn Gly GlnArgLeu SerPhe Glu HisLysLys Cys
Met Val
100 105 I10
Asp CysArg Pro PheThrThr ThrPro Thr ThrThrArg Pro
Arg Pro
115 120 125
Pro ArgArg Arg
Arg
130
(2) INFORMATION ID N0: 39:
FOR
SEQ
(i) SEQUENCE CHARACTERISTI CS:
(A) LENGTH: 148 amino
acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: Protein
(xi)SEQUENCE DESCRIPTION: SEQID NO: 39:
Met Lys Leu Thr Ala Leu ValVal Val LeuLeu Ile
Thr Gln Ala Cys
1 5 10 15
Met Tyr Asn Leu Pro Cys SerGln Ser AspSer Pro
Glu Val Asn Pro
20 25 30
Ser Thr Asn Asp Trp Arg LeuAsp Lys GlyCys Lys
Met Thr Ser Pro
35 40 45
CA 02287538 1999-10-22
WO 98/49300 94 PCT/US98/07801
Arg Asp Thr Val VaI Leu Glu Glu ProGlu Ser Thr Asn
Tyr Gly Tyr
50 55 60
Leu Gln Tyr Asn Pro Cys Thr Val ArgCys Ser Gly Cys
Arg Val Lys
65 70 75 80
Cys Asn Gly Asp Gly Ile Thr Ala GluThr Arg Asn Thr
Gln Cys Val
85 90 95
1 Thr Val Thr Val Ser Thr Val Ser SerSer Gly Thr Asn
0 Val Gly Ser
100 105 110
Ser Gly Val Ser Thr Leu Arg Ile ValThr Glu His Thr
Asn Gln Ser
115 120 125
Lys Cys Asp Cys Ile Arg Thr Thr ProThr Thr Thr Arg
Gly Thr Thr
130 135 190
Glu Pro Arg Arg
145
(2) INFORMATION ID 40:
FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTI CS:
(A) LENGTH: 26 aminoacids
(B) TYPE: amino id
ac
(D} TOPOLOGY: linear
3 (ii)MOLECULE TYPE: Protein
0
(xi)SEQUENCE DESCRIPTION: SEQ ID NO: 40:
Met Asn Phe Leu Leu Trp His Trp LeuAla Leu Leu Leu
Ser Val Ser
1 5 10 15
Tyr Leu His His Ala Trp Gln Ala
Lys Ser
20 25
4 (2) INFORMATION ID 41:
0 FOR NO:
SEQ
(i) SEQUENCE CHARACTERISTI CS:
(A) LENGTH: 20 basepairs
4 (B) TYPE: nucleicacid
5
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi)SEQUENCE DESCRIPTION: SEQ ID NO: 41:
50
GCAGAGCTCG 20
TTTAGTGAAC
- T_e ___ _~ ___ 1
