Note: Descriptions are shown in the official language in which they were submitted.
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
Human Tumor Necrosis Factor Receptor-Like 2 (TR2) Antibodies
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to antibodies to novel members of the Tumor
Necrosis
Factor (TNF) receptor family and their uses in pathological conditions.
Related Art
Human tumor necrosis factors alpha (TNF-alpha) and (TNF-beta or lymphotoxin)
are
related members of a broad class of polypeptide mediators, which includes the
interferons,
interleukins and growth factors, collectively called cytokines (Beutler, B.
and Cerami, A., Annu.
Rev. Immunol., 7:625-655 ( 1989)).
Tumor necrosis factor (TNF-alpha and TNF-beta) was originally discovered as a
result
of its anti-tumor activity, however, now it is recognized as a pleiotropic
cytokine playing
important roles in a host of biological processes and pathologies. To date,
there are ten known
members of the TNF-related cytokine family, TNF-alpha, TNF-beta (lymphotoxin-
aipha), LT-
beta , TRAIL and ligands for the Fas receptor, CD30, CD27, CD40, OX40 and 4-
1BB receptors.
These proteins have conserved C-terminal sequences and variable N-terminal
sequences which
are often used as membrane anchors, with the exception of TNF-beta. Both TNF-
alpha and
TNF-beta function as homotrimers when they bind to TNF receptors.
TNF is produced by a number of cell types, including monocytes, fibroblasts, T-
cells,
natural killer (NK) cells and predominately by activated macrophages. TNF-
alpha has been
reported to have a role in the rapid necrosis of tumors, immunostimulation,
autoimmune disease,
graft rejection, producing an anti-viral response, septic shock, cerebral
malaria, cytotoxicity,
protection against deleterious effects of ionizing radiation produced during a
course of
chemotherapy, such as denaturation of enzymes, lipid peroxidation and DNA
damage (Nata et
al., J. Immunol. 136(7):2483 ( 1987)), growth regulation, vascular endothelium
effects and
metabolic effects. TNF-alpha also triggers endothelial cells to secrete
various factors, including
PAF-I, IL-1, GM-CSF and IL-6 to promote cell proliferation. In addition, TNF-
alpha up-
regulates various cell adhesion molecules such as E-Selectin, ICAM-1 and VCAM-
1. TNF-
alpha and the Fas ligand have also been shown to induce programmed cell death.
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
TNF-beta has many activities, including induction of an antiviral state and
tumor
necrosis, activation of polymorphonuclear leukocytes, induction of class I
major
histocompatibility complex antigens on endothelial cells, induction of
adhesion molecules on
endothelium and growth hormone stimulation (Ruddle, N. and Homer, R., Prog.
Allergy 40:162-
182 (1988)).
Both TNF-alpha and TNF-beta are involved in growth regulation and interact
with
hemopoietic cells at several stages of differentiation, inhibiting
proliferation of various types of
precursor cells, and inducing proliferation of immature myelomonocytic cells.
Porter, A.,
Tibtech 9:158-162 (1991).
Recent studies with "knockout" mice have shown that mice deficient in TNF-beta
production show abnormal development of the peripheral lymphoid organs and
morphological
changes in spleen architecture (reviewed in Aggarwal et al., Eur Cytokine
Netw, 7(2):93-124
(1996)). With respect to the lymphoid organs, the popliteal, inguinal, para-
aortic, mesenteric,
axillary and cervical lymph nodes failed to develop in TNF-beta -/- mice. In
addition, peripheral
blood from TNF-beta -/- mice contained a three fold reduction in white blood
cells as compared
to normal mice. Peripheral blood from TNF-beta -/- mice, however, contained
four fold more B
cells as compared to their normal counterparts. Further, TNF-beta, in contrast
to TNF-alpha has
been shown to induce proliferation of EBV-infected B cells. These results
indicate that TNF-
beta is involved in lymphocyte development.
The first step in the induction of the various cellular responses mediated by
TNF-alpha
or TNF-beta is their binding to specific cell surface or soluble receptors.
Two distinct TNF
receptors of approximately 55-KDa (TNF-RI) and 75-KDa (TNF-RII) have been
identified
(Hohman et al., J. Biol. Chem., 264:14927-14934 (1989)), and human and mouse
cDNAs
corresponding to both receptor types have been isolated and characterized
(Loetscher et al., Cell,
61:351 (1990)). Both TNF-Rs share the typical structure of cell surface
receptors including
extracellular, transmembrane and intracellular regions.
These molecules exist not only in cell bound forms, but also in soluble forms,
consisting
of the cleaved extra-cellular domains of the intact receptors (Nophar et al.,
EMBO Journal, 9
( 10):3269-76 ( 1990)) and otherwise intact receptors wherein the
transmembrane domain is
lacking. The extracellular domains of TNF-RI and TNF-RII share 28% identity
and are
characterized by four repeated cysteine-rich motifs with significant
intersubunit sequence
homology. The majority of cell types and tissues appear to express both TNF
receptors and both
2
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09?44
receptors are active in signal transduction, however, they are able to mediate
distinct cellular
responses. Further, TNF-RII was shown to exclusively mediate human T-cell
proliferation by
TNF as shown in PCT WO 94/09137.
TNF-RI dependent responses include accumulation of C-FOS, IL-6, and manganese
superoxide dismutase mRNA, prostaglandin E2 synthesis, IL-2 receptor and MHC
class I and II
cell surface antigen expression, growth inhibition, and cytotoxicity. TNF-RI
also triggers
second messenger systems such as phospholipase A2, protein kinase C,
phosphatidylcholine-
specific phospholipase C and sphingomyelinase (Pfefferk et al., Cell, 73:457-
467 ( 1993)).
Several interferons and other agents have been shown to regulate the
expression of TNF
receptors. Retinoic acid, for example, has been shown to induce the production
of TNF
receptors in some cells type while down regulating production in other cells.
In addition, TNF-
alpha has been shown to effect the localization of both types of receptor. TNF-
alpha induces
internalization of TNF-RI and secretion of TNF-RII {reviewed in Aggarwal et
al., supra). Thus,
the production and localization of both TNF-Rs are regulated by a variety of
agents.
Both the yeast two hybrid system and co-precipitation and purification have
been used
to identify ligands which associate with both types of the TNF-Rs (reviewed in
AggarwaI et al.,
supra and Vandenabeele et al., Trends in Cell Biol. 5:392-399 (1995)). Several
proteins have
been identified which interact with the cytoplasmic domain of a murine TNF-R.
Two of these
proteins appear to be related to the baculovirus inhibitor of apoptosis,
suggesting a direct role
for TNF-R in the regulation of programmed cell death.
The present invention relates to antibodies to a novel member of the Tumor
Necrosis
Factor (TNF) receptor family. More specifically, antibodies which specifically
bind to a novel
human TNF receptor-related protein, referred to herein as the TR2 receptor of
SEQ ID NO: 2.
(SEQ ID NO: 1 is cDNA sequence encoding TR2 receptor.)
Our studies have shown that TR2 participates in the interaction of T cells
with antigen
presenting cells, activation of T cells, induction of inflammatory mediators
such as cytokines
and induction of immunoglobulin production by B cells. We have shown that TR2
is involved
in allogeneic proliferative responses which results from the interaction of T
cells and antigen
presenting cells such as B lymphocytes and monocytes/macrophages. Interactions
of cells of the
immune and hematopoietic system including T and B lymphocytes and cells of the
myeloid
lineage have been shown to be responsible for initiating and propogating
pathological conditions
such as inflammatory disorders, transplant rejections; autoimmune disorders,
including but not
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
limited to, systemic lupus erythomatosus (SLE); idiopathic thrombocytopenic
purpura (ITP);
rheumatoid arthritis (RA); multiple sclerosis {MS); psoriasis, inflammatory
bowel disease
(IBD); insulin dependent diabetes melititus (IDDM); allergic disorders,
including asthma,
allergic rhinitis, and atopic dermatitis; cancers, such as, lymphomas and
leukemias;
atherosclerosis; and viral infections, such as HSV infections and AIDS.
We have shown that TR2 is involved in IgE production and hence has potential.
utility
in allergic disorders, including, asthma and allergic rhinitis. The production
of IgE has been
linked to mechanism of disease in atopic asthma and allergic disease. This
disorder is
characterised by the increased ability of B lymphocytes to produce IgE
antibodies in response to
allergens which are presented to the immune system via ingestion, inhalation
or penetration
through the skin. IgE binds to high affinity receptors on mast cells and
basophils and in the
presence of specific antigen, triggers the release of vasoactive mediators,
chemoattractants and
cytokines associated with the symptoms of type I allergic hypersensitivity.
The interaction of
IgE with low affinity receptors present on B lymphocytes and platelets and
with both the high
IS and low affinity receptors on monocytes and eosinophils contributes to the
chronic inflammatory
response seen in atopic individuals. In addition, there is a close association
between levels of
serum IgE and airway hyper esponsiveness, suggesting that in a significant
number of patients,
allergy facilitates the development of clinical asthma.
TR2 has recently been identified as a receptor utilised by HSV to enter cells.
Antibodies
to TR2 are expected to have utility in modulating HSV infection or immune
responses to HSV.
Thus it is the intention of the present invention to provide a method for
treating the
above mentioned pathological conditions comprised of providing a patient with
antibodies to the
TR2 receptor. The antibodies of the invention include monoclonal antibodies
(Mobs) and
polyclonal antibodies.
SUMMARY OF THE INVENTION
The present invention relates to antibodies, one prefered embodiment being
monoclonal
antibodies (mAbs) but also including polyclonal antibodies, to novel members
of the Tumor
Necrosis Factor (TNF) receptor family called TR2 receptor and their uses in
pathological
conditions.
Hybridoma cell lines producing such mAbs, methods of in vivo imaging of a
pathological conditions, and methods of treating and diagnosing pathological
conditions, caused
4
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
by abnormal functioning, production or metabolism of TR2 receptors are also
provided. In vitro
assays for detecting the presence of TR2 and for evaluating the binding
affinity of a test
compound are also described.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
One aspect of this invention relates to antibodies to TR2 receptor
polypeptide. One
preferred class of antibodies of the present invention is monoclonal antibody.
The monoclonal
antibody according to this invention includes any naturally or non-naturally
occurring
polypeptide which binds to an epitope on TR2 receptor, inhibits TR2 ligand
binding with TR2
receptor, agonizes or antagonizes TR2 receptor. For example antibodies can be
those having the
binding specificity of 12C5, 18D4 or 3D6 (as described below). Preferably the
monoclonal
antibody or fragment thereof of the present invention binds to the linear or
conformational
epitope of the extra cellular domain of human TR2. Examples of such
polypeptides include a
half antibody molecule (a single heavy:light chain pair), or a fragment, such
as the univalent
fragments Fab or Fab' and the divalent fragment F(ab)2 {"FAB" meaning fragment
antigen
binding) A fragment, according to the present invention may also be a single
chain Fv fragment
produced by methods well known in the art. See Skerra et al. Science 240: 1038-
1041 (1988)
and King et al. Biochemical J. 290: 723-729 (1991), each of which is hereby
incorporated by
reference. The monoclonal of the present invention also includes a non-peptide
compound
which is a "mimetic," i.e. a compound that mimics the epitope binding site,
resistant to
proteolysis and non-immunogenic. Conformationally restricted cyclic organic
peptides which
mimic, for example, 12C5 or 18D4, can be produced in accordance with method
well-known to
the skilled artisan. See e.g., Saragovi, et al., Science 253:792-795 (1991),
hereby incorporated
by reference. The monoclonal antibody of the present invention also includes
anti-idiotypic
antibodies produced by methods well-known to the art of the invention. See
e.g. Cozenza, Eur.
J. Immonol. 6: 114 ( 1976) and Harlow et al., Antibodies: A Laboratory Manual,
Cold Spring
Harbor Publications pp. 726 (1988), each of which is hereby incorporated by
reference.
The term "epitope" as used in describing this invention, includes any
determinant
responsible for the specific interaction with an antibody molecule. Epitopic
determinants
usually consist of chemically active surface groupings of molecules such as
amino acids or sugar
side chains and have specific three-dimensional structural characteristics.
5
CA 02290067 1999-11-10
WO 98151346 PCT/US98/09744
The monoclonal antibody according to this invention also includes monoclonal
antibody
conjugates, which are for example, enzymes such as horseradish peroxidase,
alkaline
phosphatase, ~i-D-galactosidase, glucose oxidase, glucoamylase, carbanhydrase,
acetyl-
cholinesterase, lysozyme, malate dehydrogenase or glucose-6 phosphate dehydro.
Fluorescent
markers are also suitable conjugates and include fluorescein, fluorochrome,
rhodamine, and the
like. In such conjugates, the monoclonal antibody of the invention is bound to
the enzymes or
fluorescent markers directly or by way of a spacer or linker group, such as
ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid
(DPTA), or the
like. Other conjugates include chemiluminescents such as luminal and imidizol
and
bioluminescents such as luciferase and luciferin. Cytostatics are also
applicable as conjugates
for the monoclonal antibody of the present invention and include alkylating
substances, such as
mechlorethamine, triethylene phosphoramide, triaziquone, camustine, semustine,
methotrexate,
mercaptopurine, cytarabine, fluorouracile, antibiotics such as actinomycine,
and hormones and
hormone antagonists such as corticosteroids, such a prednisone or progestins.
The monoclonal
antibody conjugates may be prepared by conjugating a cytotoxic substance
containing either the
intact toxin or the A-chain derived from it to the monoclonal antibody or
fragment thereof,
according to techniques well-known in the art. Chaudry et al. J. Biol. Chem.
268:9437-9441
(1993); Sung et al. Cancer Res. 53:2092-2099 (1993) and Selvaggi et al., J.
Immuno-therapy
13:201-207 (1993), each of which is hereby incorporated by reference.
In one embodiment, the monoclonal antibody of the invention or fragment
thereof is
conjugated to a detectable label that is a radioisotope, such as 3H, 1251
1311, 32p, 35S 14C~
5lCr, 36C1~ 57Co 58Co, 59Fe 75Se, 152Eu, and 99mTc which can be detected by
known
means such as gamma and scintillation counters, autoradiographs and the like.
The monoclonal antibody of the present invention may also be a monoclonal
heteroconjugate, i.e., a hybrid of two or more antibody molecules. A suitable
heteroconjugate
includes, for instance, half of the 12C5 or 18D4 monoclonal antibody or
fragment thereof and
half of another monoclonal antibody, which is specific for a surface molecule
on an immune
effector cell, such as an NK cell or a macrophage. See Ken et al. J. Immun.
144:4060-4067
( 1990); Hsieh-Ma et al. Cancer Res. 52:6832-6839 ( 1992), hereby incorporated
by reference.
In another embodiment, the monoclonal antibody of the invention is a chimeric
monoclonal antibody. In one approach, the chimeric monoclonal antibody is
engineered by
cloning recombinant DNA containing the promoter, leader, and variable-region
sequences from
6
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
a mouse monoclonal, for example, 12C5 or 18D4, gene and the constant-region
exons of a
human antibody gene. The antibody encoded by such a recombinant gene is a
mouse-human
chimera. Its antibody specificity is determined by the variable region derived
from mouse
DNA; its isotype, which is determined by the constant region, is derived from
human DNA. See
Verhoeyn et al. BioEssays 8: 74 (1988), hereby incorporated by reference.
In another embodiment, the monoclonal antibody of the present invention is a
"humanized" monoclonal antibody, produced by techniques well-known in the art.
Carter et al.,
PNAS 89:4285-4289 ( 1992); Singer et al., J. Immun. 150:2844-2857 ( 1992) and
Mountain et al.
Biotechnol. Genet. Eng. Rev. 10:1-142 (1992), each of which is hereby
incorporated by
reference. That is, mouse complementary determining regions {"CDRs") are
transferred from
heavy and light V-chains of the mouse Ig into a human V-domain, followed by
the replacement
of some human residues in the framework regions by their murine counterparts.
"Humanized"
monoclonal antibodies in accordance with this invention are suitable for use
in in vivo
diagnostic and therapeutic methods.
Monoclonal antibodies can be produced in various ways using techniques well-
understood by those having ordinary skill in the art. Details of these
techniques are described in
Antibodies: A Laboratory Manual, Harlow et al. Cold Spring Harbor
Publications, p. 726
( 1988), which is hereby incorporated by reference.
Efforts to elicit immune responses and generate monoclonal antibodies without
time
consuming protein purification steps have taken advantage of rodent fibroblast
transfectants
expressing such proteins as v-fms or the CSF-1 receptor Sherr, et al., Blood
73: 1786-1793
( 1989), hereby incorporated by reference.
The monoclonal antibodies and fragments thereof according to this invention
are
multiplied according to in vitro and in vivo methods well-known in the art.
Multiplication in
vitro is carried out in suitable culture media such as Dulbecco's Modified
Eagle Medium or
RPMI 1640 medium, optionally replenished by a mammalian serum such as fetal
calf serum or
trace elements and growth-sustaining supplements, e.g. feeder cells, such as
normal mouse
peritoneal exudate cells, spleen cells, bone marrow macrophages or the like.
In vitro production
provides relatively pure antibody preparations and allows scale-up to give
large amounts of the
desired antibodies. Techniques for large scale hybridoma cultivation under
tissue culture
conditions are known in the art and include homogenous suspension culture,
e.g., in an airlift
reactor or in a continuous stirrer reactor or immobilized or entrapped cell
culture.
7
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
Large amounts of the monoclonal antibody of the present invention may also be
obtained by multiplying hybridoma cells in vivo. Cell clones are injected into
mammals which
are histocompatible with the parent cells, e.g. syngeneic mice, to cause
growth of antibody-
producing tumors. Optionally, the animals are primed with a hydrocarbon,
especially oils such
as pristane (tetramethyl-pentadecane) prior to injection. After one to three
weeks, the desired
monoclonal antibody is recovered from the body fluid of the mammal.
In accordance with the present invention, fragments of the monoclonal antibody
of the
invention can be obtained from the monoclonal antibody produced as described
above, by
methods which include digestion with enzymes such as pepsin or papain and/or
cleavage of
disulfide bonds by chemical reduction. Alternatively, monoclonal antibody
fragments
encompassed by the present invention can be synthesized using an automated
peptide
synthesizer as supplied by Applied Biosystems, Multiple Peptide Systems, etc.,
or they may be
produced manually, using techniques well known in the art. See Geysen, et al.
J. Immunol.
Methods 102:259-274 ( 1978), hereby incorporated by reference.
The monoclonal conjugates of the present invention are prepared by methods
known in
the art, e.g., by reacting a monoclonal antibody prepared as described above
with, for instance,
an enzyme in the presence of a coupling agent such as glutaraldehyde or
periodate. Conjugates
with fluorescein markers are prepared in the presence of these coupling agents
or by reaction
with an isothiocyanate. Conjugates with metal chelates are similarly produced.
Radioactively labeled monoclonal antibodies of the present invention are
produced
according to a well-known methods in the art. For instance, monoclonal
antibodies can be
iodinated by contact with sodium or potassium iodide and a chemical oxidizing
agent such as
sodium hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase.
Monoclonal
antibodies according to the invention may be labeled with technetium-99m by
ligand exchange
process, for example, by reducing pertechnate with stannous solution,
chelating the reduced
technetium onto a Sephadex column and applying the antibody to this column or
by direct
labelling techniques, e.g. by incubating pertechnate, a reducing agent such as
SNC 12, a buffer
solution such as sodium-potassium phthalate solution, and the antibody.
Thus, in one embodiment, the invention relates to a pharmaceutical composition
for in
vivo imaging of a pathological condition that expresses TR2 receptors
comprising the
monoclonal antibody or fragment thereof of the invention which binds TR2
receptor in vivo;
and a pharmaceutically acceptable carrier.
8
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
In another embodiment, the invention relates to an in vivo method of imaging a
pathological condition which expresses TR2 receptors using the above
pharmaceutical
composition.
Thus, with the discovery of monoclonal antibodies including, but not limited
to 12C5 or
18D4, the applicants have also discovered an in vivo method of imaging a
pathological
condition caused by abnormal functioning, production or metabolism of TR2
receptors.
Specifically, this method involves administering to a subject an imaging-
effective amount of a
delectably labeled monoclonal antibody or fragment thereof, and a
pharmaceutically effective
carrier; and detecting the binding of the labeled monoclonal antibody to the
TR2 receptors in
the pathological condition.
The term "pathological condition" refers to an abnormallity or disease, as
these terms
are commonly used. The pathological conditions of the present invention are
those which are
brought about by improper or inappropriate expression, production or
metabolism of TR2
receptors, such as, inflammatory disorders; transplant rejections; autoimmune
disorders,
including but not limited to, systemic lupus erythomatosus (SLE); idiopathic
thrombocytopenic
purpura (ITP); rheumatoid arthritis (RA); multiple sclerosis (MS); psoriasis,
inflammatory
bowel disease (IBD); insulin dependent diabetes meiititus (IDDM); allergic
disorders, including
asthma, allergic rhinitis, and atopic dermatitis; cancers, such as, lymphomas
and leukemias;
atherosclerosis; and viral infections, such as HSV infections and AIDS.
The term "in vivo imaging" refers to any method which permits the detection of
a
labeled monoclonal antibody of the present invention or fragment thereof that
specifically binds
to the TR2 located in the subject's body. A "subject" is a mammal, preferably
a human, and
most preferably a human known to have a neoplasia that expresses TR2
receptors.
An "imaging effective amount" means that the amount of the delectably labeled
monoclonal antibody or fragment thereof administered is sufficient to enable
detection of
binding of the monoclonal antibody or fragment thereof to the TR2 receptor.
Generally, the dosage of the detestably labeled monoclonal antibody or
fragment thereof
will vary depending on consideration such as age, condition, sex, and extent
of disease in the
patient, counter-indications, if any, concomitant therapies and other
variables, to be adjusted by
a physician skilled in the art. Dosage can vary from 0.01 mg/kg to 2,000
mg/kg, preferably 0.1
mg/tcg to 1,000 mg/kg.
9
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
As noted above, the present invention encompasses monoclonal antibody
conjugates in
which the conjugate may be a detectable label. For purposes of in vivo
imaging, the type of
detection instrument available is a major factor in selecting a given label.
For instance,
radioactive isotopes and paramagnetic isotopes are particularly suitable for
in vivo imaging in
the methods of the present invention. The type of instrument is used will
guide the selection of
the radionuclide. For instance, the radionuclide chosen must have a type of
decay which is
detectable for a given type of instrument. However, any conventional method
for visualizing
diagnostic imaging can be utilized in accordance with this invention.
Another factor to consider in selecting a radionuclide for in vivo diagnosis
is that the
half-life of a nuclide be long enough so that it is still detectable at the
time of maximum uptake
by the target, but short enough so that deleterious radiation upon the host,
as well as background,
is minimized. Ideally, a radionuclide used for in vivo imaging will lack a
particulate emission,
but produce a large number of photons in a 140-2000 keV range, which may be
readily detected
by conventional gamma cameras.
As discussed above in connection with the production of monoclonal conjugates,
a
radionuclide may be bound to an antibody either directly or indirectly by
using an intermediary
functional group. Intermediary functional groups which are used to bind
radioisotopes which
exist as metallic ions to antibody are diethylenetriaminepentaacetic acid
(DTPA) and ethylene
diaminetetracetic acid (EDTA). Examples of metallic ions suitable for use in
this invention are
99mTc 123h 1311 I l IIn, 1311 97Ru, 67Ga, 1251, 68Ga, 72As, 89Zr, and 201.
In accordance with this invention, the monoclonal antibody or fragment thereof
may be
labeled by any of several techniques known to the art. See, e.g., Wagner et
al., J. Nucl. Med.
20:428 (1979) and Saha et al., J. Nucl. Med. 6:542 (1976), hereby incorporated
by reference.
The methods of the present invention may also use paramagnetic isotopes for
purposes
of in vivo detection. Elements particularly useful in Magnetic Resonance
Imaging ("MRI")
include 157Gd, SSMn 162Dy 52Cr, and 56Fe.
Administration to the subject may be local or systemic and accomplished
intravenously,
intraarterially, via the spinal fluid or the like. Administration may also be
intradermal or
intracavitary, depending upon the body site under examination. After a
sufficient time has
lapsed for the monoclonal antibody or fragment thereof to bind with the TR2,
for example 30
minutes to 48 hours, the area of the subject under investigation is examined
by routine imaging
techniques such as MRI, SPECT, planar scintillation imaging and emerging
imaging techniques,
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
as well. The exact protocol will necessarily vary depending upon factors
specific to the patient,
as noted above, and depending upon the body site under examination, method of
administration
and type of label used; the determination of specific procedures would be
routine to the skilled
artisan. The distribution of the bound radioactive isotope and its decrease
with time is then
monitored and recorded. By comparing the results with data obtained from
studies of clinically
normal individuals, the presence and location of the abnormality can be
determined and
monitored.
The pharmaceutical composition of the present invention are advantageously
administered in the form of injectable compositions. And in some instances
they may also be
administered by inhalation. A typical composition for such purpose comprises a
pharmaceutically acceptable carrier. For instance, the composition may contain
about 10 mg of
human serum albumin and from about 20 to 200 micrograms of the labeled
monoclonal antibody
or fragment thereof per milliliter of phosphate buffer containing NaCI. Other
pharmaceutically
acceptable carriers include aqueous solutions, non-toxic excipients, including
salts,
preservatives, buffers and the like, as described, for instance, in
Remington's Pharmaceutical
Sciences, 15th Ed. Easton: Mack Publishing Co. pp 1405-1412 and 1461-1487
(1975) and The
National Formulary XIV, 14th Ed. Washington: American Pharmaceutical
Association (1975),
the contents of which are hereby incorporated by reference. Examples of non-
aqueous solvents
are propylene glycol, polyethylene glycol, vegetable oil and injectable
organic esters such as
ethyloeate. Aqueous carriers include water, alcoholic/aqueous solutions,
saline solutions,
parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
intravenous vehicles include
fluid and nutrient replenishers. Preservatives include antimicrobial, anti-
oxidants, chelating
agents and inert gases. The pH and exact concentration of the various
components the
pharmaceutical composition are adjusted according to routine skills in the
art. See Goodman
and Gilman's The Pharmacological Basis for Therapeutics (7th Ed.).
Particularly preferred pharmaceutical compositions of the present invention
are those
that, in addition to specifically binding the TR2 in vivo, are also non-toxic
at appropriate dosage
levels and have a satisfactory duration of effect.
In another embodiment, the invention. relates to a method using the antibodies
of the
present invention to inhibiting or treating pathological conditions such as:
inflammatory
disorders; transplant rejections; autoimmune disorders, including but not
limited to, systemic
lupus erythomatosus (SLE); idiopathic thrombocytopenic purpura (ITP);
rheumatoid arthritis
11
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
(RA); multiple sclerosis (MS); psoriasis, inflammatory bowel disease (IBD);
insulin dependent
diabetes melititus (IDDM); allergic disorders, including asthma, allergic
rhinitis, and atopic
dermatitis; cancers, such as, lymphomas and leukemias; atherosclerosis; and
viral infections,
such as HSV infections and AIDS. More specifically, the invention relates to a
method of
inhibiting or treating the above mentioned pathological conditions with a
therapeutic amount of
a monoclonal antibody or fragment thereof which specifically binds to an
epitope of TR2
receptor, inhibits TR2 ligand binding to TR2 receptor, or antagonizes or
agonizes TR2, by
administering to a patient in need thereof a therapeutic amount of the
antibody of the present
invention. Alternatively, a patient with the above pathological conditions can
be treated with the
antibodies by taking cells or tissues and incubating them with therapeutic
amounts of antibodies
ex-vivo; and re-administering the cells or tissues back to the patient.
The quantity of antibody of the present invention necessary for effective
therapy will
depend upon many different factors, including the means of administration,
target site,
physiological state of the patient, other medicants administered, etc. Thus
treatment dosages
should be titrated to optimize safety and efficacy. Typically, dosages used in
vitro ma}~ provide
useful guidance in the amounts useful for in situ administration of the
monoclonal antibody, and
as noted above, animal models may be used to determine effective dosages for
treatment of
particular disorders. Various considerations are described, e.g. in Gilman et
al. (eds.)(1990),
Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed.,
Pergamon Press;
and Remington's Pharmaceutical Sciences, 17th Ed. (1990), Mack Publishing Co.,
Easton, PA,
each of which is herein incorporated by reference. Methods of administration
are discussed
therein and include, oral, intravenous, intraperitoneal, or intra muscular
administration,
transdermal diffusion and others. Pharmaceutically acceptable carriers
include, water, saline,
buffers, and other compounds described, e.g., in Merck Index, Merck & Co.,
Rahway, NJ.
Because of the high affinity of binding of the monoclonal antibody of the
present invention with
TR2, low dosages of pharmaceutical compositions for purposes of inhibiting
neoplasia growth
would be effective. Thus, dosage ranges would ordinarily be expected to be in
amounts lower
than 1 mM concentrations, typically less than 10 N.M, usually less than about
i00 nM, preferably
less than about 10 nM (nanomolar), and most preferably less than about 1 fM
(femtomolar),
with the appropriate carrier. Slow release formulations, or slow release
apparatus may be
utilized for continuous administration.
12
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
In another embodiment, the invention relates to an in vitro assay for the
detection of
TR2 or its ligand in whatever kind of "sample" it may occur, such samples
including fluid, semi-
fluid or tissue samples, using the monoclonal antibody or fragment thereof of
the invention. The
assay can be a competitive or sandwich assay, or any assay well-known to the
artisan which
depends on the formation of an antibody-antigen immune complex. For purposes
of this
invention, the monoclonal antibody or fragment thereof can be immobilized or
labeled. Many
carriers are known to be the skilled artisan to which the monoclonal, antibody
or fragments
thereof of the present invention can be bound for immobilization. Where
required,
derivatization techniques can be used for immobilizing the monoclonal antibody
or fragment
thereof on a substrate. Well-known carriers include glass, polystyrene,
polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified celluloses etc.
The carrier can be
either soluble or insoluble. Immunoassays encompassed by the present invention
include, but
are not limited to those described in U.S. Pat. Nos. 4,367,110 (double
monoclonal antibody
sandwich assay); Wide et al., Kirkham and Hunter, eds. Radioimmunoassay
Methods, E. and S.
L:ivingstone, Edinburgh (1970); U.S. Pat. No. 4,452,901 (western blot); Brown
et al., J. Biol.
Chem. 255:4980-4983 (1980) (immunoprecipitation of labeled ligand); and Brooks
et al., Clin.
Exp. Immunol. 39:477 (1980) (immunocytochemistry).
The monoclonal antibodies and fragments thereof of the present invention may
be used
in in vitro assays designed to screen compounds which bind to TR2 (including
agonists and
antagonists) or its ligand. See Fodor et al. Science 251: 767-773 (1991),
incorporated herein by
reference. A method of using antibodies to TR2 for screening of compounds
which agonizes or
antagonizes TR2 comprise detecting the alteration of TR2 activity level in the
presence of both
TR2 antibodies and a candidate molecule which might otherwise be occupied by
TR2 receptor
ligand. Thus, the present invention contemplates a competitive drug screening
assay, where the
monoclonal antibodies or fragments thereof of the invention compete with a
test compound for
binding to TR2. In this manner the monoclonal antibodies and fragments thereof
are used to
detect the presence of any polypeptide or molecule which shares one or more
binding sites of the
TR2 and can be used to occupy binding sites on the receptor which might
otherwise be occupied
by TR2 receptor ligand.
In vitro assays in accordance with the present invention also include the use
of isolated
membranes from cells expressing a recombinant TR2 receptor, or fragments
attached to solid
phase substrates. These assays allow for the diagnostic determination of the
effects of either
13
CA 02290067 1999-11-10
WO 98/51346 PCT/LJS98/09744
binding segment mutations and modifications, or ligand mutations and
modifications, e.g.,
ligand analogues.
The monoclonal antibodies of the present invention are suitable for use in a
kit. Such a
kit may comprise a receptacle being compartmentalized to receive one or more
containers such
as vials, tubes and the like, such containers holding separate elements of the
invention. For
example, one container may contain a first antibody bound to an insoluble or
partly soluble
carrier. A second container may contain soluble, detectably-labeled second
antibody, in
lyophilized form or in solution. The receptacle may also contain a third
container holding a
detectably labeled third antibody in lyophilized form or in solution. A kit of
this nature can be
used in the sandwich assay of the invention.
Without further elaboration, it is believed that one skilled in the art can,
using the
preceding description, utilize the present invention to its fullest extent.
The following examples
are merely illustrative and not limitative of the remainder of the disclosure
in any way
whatsoever.
Examples
The examples below are carried out using standard techniques, which are well
known and
routine to those of skill in the art, except where otherwise described in
detail. The examples
illustrate, but do not limit the invention.
Generation of TR2-ig
Expression and Purification of TR2-Fc(TR2-I~ Fusion Protein) and Cleaved TR2
The putative transmembrane domain of translated TR2 receptor was determined by
hydrophobicity using the method of Goldman et al. (Ann. Rev. of Biophys.
Biophys. Chem.
15:321-353 (1986)) for identifying nonpolar transbilayer helices. The region
upstream of this
transmembrane domain, encoding the putative leader peptide and extracellular
domain, was
chosen for the production of an Fc fusion protein. Primers were designed to
PCR the
corresponding coding region from HTXBS40 (a clone containing TR2 receptor
clone) with the
addition of a BgIII site (single underlined), a Factor Xa protease site and an
Asp718I site
(double underlined) at the 3 end. PCR with this primer pair (forward 35-mer:
5' CAGGAATTCGCAGCCATGGAGCCTCCTGGAGACTG 3' (SEQ ID N0:3), and reverse
primer 53-mer:
14
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
5' CCATACCCAGG~CCTTCCCTCGATAGATCT
TGCCTTCGTCACCAGCCAGC 3' (SEQ ID N0:4)), which contains 18 nucleotides of the
TR2
coding sequence, resulted in one band of the expected size. This was cloned
into COSFclink to
give the TR2-Fclink plasmid. The PCR product was digested with EcoRI and
Asp718I and
ligated into the COSFclink plasmid (Johansen, et al., J. Biol. Chem. 270:9459-
9471 (1995)) to
produce TR2-Fclink.
COS cells were transiently transfected with TR2-Fclink and the resulting
supernatant
was immunoprecipitated with protein A agarose. Western blot analysis of the
immunoprecipitate using goat anti=human Fc antibodies revealed a strong band
consistent with
the expected size for glycosylated TR2-Fc (greater than 47.5 kD). A 15L
transient COS
transfection was performed and the resulting supernatant was purified (see
below). The purified
protein was used to immunize mice following DNA injection for the production
of mAbs.
CHO cells were transfected with TR2-Fclink to produce stable cell lines. Five
lines
were chosen by dot blot analysis for expansion and were adapted to shaker
flasks. The line with
the highest level of TR2-Fc protein expression was identified by Western blot
analysis. TR2-Fc
protein purified from the supernatant of this line was used for cell binding
studies by flow
cytometry, either as intact protein or after factor Xa cleavage and
biotinylation.
Clone HTXBS40 is an allelic variant of TR2 which differs from the sequence
shown in
SEQ ID NO:l in that HTXBS40 contains guanine at nucleotide 314, thymine at
nucleotide 386
and cytosine at nucleotide 627.
A plasmid suitable for expression of the extracellular domain of TR2 was
constructed as
follows to immunize mice for the production of anti-TR2 mAbs. The Fc fragment
was removed
from TR2-Fclink by a BgIII/XbaI digestion, Klenow was used to fill in the
overhangs, and the
blunt ends of the plasmid were religated. The resulting frame shift introduced
a stop codon
immediately following the amino acids which had originally been introduced
into TR2-Fclink
by the addition of the BgIII site. Thus, the C terminus of the extracellular
domain of TR2 is
followed by only 2 amino acids (RS) in this constructed (TR2exlink).
15
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
Purification of TR2-Fc from CHO E 1 A Conditioned Media Followed by Cleavage
and
Biotinylation of TR2.
Assays
Product purity through the purification was monitored on 15% Laemmli SDS-PAGE
gels run under reducing and non-reducing conditions. Protein concentration was
monitored by
A280 assuming an extinction coefficient of 0.7 for the receptor and 1.28 for
the chimera, both
calculated from the sequence. Extinction coefficients were confirmed by AAA.
Protein G Chromatography of the TR2-Fc Fusion Protein
All steps described below were carried out at 4oC. 15L of CHO conditioned
media
(CM) {0.2 ~t filtered following harvest in cell culture) was applied to a 5 X
10 cm column of
Protein G at a linear flow rate of 199 cm/h. The column had been washed with
100 mM glycine,
pH 2.5 and equilibrated in 20 mM sodium phosphate, 150 mM sodium chloride, pH
7 prior to
sample application. After the CM was loaded the column was washed with 5
column volumes
of 20 mM sodium phosphate, 150 mM sodium chloride, pH 7 and eluted with 100 mM
glycine,
pH 2.5. 435 ml of eluate was immediately neutralized with 3 M Tris, pH 8.5 and
0.2 a filtered.
Based on A280, extinction coefficient I.28, 65 mg of protein was recovered at
0.15 mg/ml.
Concentration/Dialysis
385 ml of Protein G eluate was concentrated in an Amicon stirred cell fitted
with a 30K
membrane to 34 ml at a final concentration of 1.7. The concentrate was
dialyzed against buffer.
Factor Xa Cleavage and Purification to Generate Free Receptor
Six ml (10.2 mg) of TR2-Fc was added to 50 p.g of Factor Xa resulting in a
1:200, ea
ratio. The mixture was incubated overnight at 4oC.
Protein G Chromatography of the Free TR2 receptor
A 1 ml column of Protein G was equilibrated in 20 mM sodium phosphate, 150 mM
sodium chloride, pH 6.5 in a disposable column using gravity flow. The cleaved
receptor was
passed over the column 3 times after which the column was washed with 20 mM
sodium
phosphate, 150 mM sodium chloride, pH 6.5 until no A280 absorbance was seen.
The column
I6
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
was eluted with 2.5 ml of 100 mM glycine, pH 2.5 neutralized with 83 a:l of 3
M Tris, pH 8.5.
TR2 eluted in the nonbound fraction.
Concentration
The nonbound fraction from the Protein G column, about 12 ml, was concentrated
in a
Centricon lOK cell (Amicon) to about 1 ml to a final concentration of 3.5
mg/ml estimated by
A280, extinction coefficient 0.7.
Mono S Chromatography
The concentrated sample was diluted to 5 ml with 20 mM sodium phosphate, pH 6
and
applied to a 0.5 X 5 cm Mono S column equilibrated in 20 mM sodium phosphate,
pH 6 at a
linear flow rate of 300 cm/h. The column was washed with 20 mM sodium
phosphate, pH 6 and
eluted with a 20 column volume linear gradient of 20 mM sodium phosphate, pH 6
to 20 mM
sodium phosphate, 1 M sodium chloride, pH 6. TR2 protein eluted in the
nonbound fraction.
Concentration/Dialysis
The 3 ml nonbound fraction from the Mono S column was concentrated to 1 ml as
above using a Centricon lOK cell and dialyze against 20 mM sodium phosphate,
150 mM
sodium chloride, pH 7. The concentration following dialysis was 2.1 mg/ml.
Biotinylation
0.5 mg of TR2 at 2.1 mg/ml was dialyzed against 100 mM borate, pH 8.5. A 20-
fold
molar excess of NHS-LC Biotin was added and the mixture was left on a rotator
overnight at
4~C. The biotinylated TR2 was dialyzed against. 20 mM sodium phosphate, 150 mM
sodium
chloride, pH 7, sterile filtered and stored at -70tbC. Biotinylation was
demonstrated on a
Western blot probed with strepavidin HRP and subsequently developed with ECL
reagent.
Monoclonal antibody generation
Mice (F1 hybrids of Balb/c and C57BL/6) were immunised subcutaneously with 10
ug
recombinant TR2 in Freunds complete adjuvant and 4 weeks later with l0ug TR2
in Freunds
incomplete adjuvant. On the basis of a good serum antibody titre to TR2 one
mouse received
further immunisations of 8 ug TR2 (i.p. in saline) at 8 weeks, and two days
later. Two days
17
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
following the final immunisation a splenectomy was performed. Mouse spleen
cells were used
to prepare hybridomas by standard procedures, (Zola, H.Ed., Monoclonal
Antibodies, CRC
Press Inc. 1987). Positive hybridomas were cloned by the limiting dilution
method.
Hybridoma Screening Assay
96-well plates were coated with TR2-Fc (0.25ug/ml, 100u1/well in PBS) by
incubation
overnight at 4°C. The solution was then aspirated and non-specific
binding sites were blocked
with 250u1/well of 1 % bovine serum albumin (BSA) in TBS buffer (SOmM Tris,
150 mM NaCI,
0.02% Kathon, pH 7.4) for 5-60 minutes at RT. Following this and each of the
following steps,
the plate was washed 4 times in wash buffer ( 10 mM Tris, 150 mM NaCI, 0.05 %
Tween 20,
0.02% Kathon, pH 7.4). To each well, 50 uL hybridoma medium and 50 uL assay
buffer (0.5%
BSA, 0.05% bovine gamma globulin, 0.01 % Tween 40, 20uM
diethylenetriaminepentaacetic in
TBS buffer) was added and the plates were incubated for 60 min at RT in a
shaker-incubator,
followed by an incubation of 60 min at RT in a shaker-incubator with 100u1
O.Sug/mI Eu3+
labelled anti-mouse antibody in assay buffer. Finally 100 ul /well of enhancer
(Wallac) was
added and incubated for 5 min at RT and the fluorescence measured. Hybridomas
having counts
> 100K were expanded into 24-well plates.
Immunoassay
To determine the specificity of the anti-TRZ Mabs generated 96-well plates
were coated
(lug/ml TR2-Fc, 100u1/well) and blocked as above with TR2-Fc. All the
following incubations
were performed in a shaker-incubator at RT. After washing the wells 50 ul TR2
(2 u~/ml), TR2-
Fc (2 ug/ml), hIgG (2ug/ml) or assay buffer and 50 ul Mab were added and
incubated for 60
min. After washing the wells 100u1 O.Sug/ml Eu3+ labelled anti-mouse antibody
in assay buffer
was added for 60 min, the wells washed and then 100 ul /well of enhancer
(Wallac) was added
and incubated for 5 min at RT and the fluorescence measured. All positive
hybridomas showed
displacement of binding with TR2 and TR2-Fc and none with hIgG.
Purification of Mabs
Mabs were purified by ProsepA (Bio Processing) chromatography respectively
using the
manufacturer's instructions. Mabs were >95% pure by SDS-PAGE.
18
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
Biosensor Studies
Surface plasmon resonance (SPR) technology (BIAcore) was used to analyse the
epitope
specificity and affinity of the TR2 Mabs.
18D4 and 12C5 have similar/overlapping epitopes
Summary of BindinE Data
En'rton e determination of y surface
TR2 mAbs and affinity nlasmon
measurements b
resonance a BIAcore device
(SPRI
measurements
using
mAb K~sxlO=5~-~s-l~ Kd~sx104~s-~,} calc. K_D
12C5 5.9 5.4 0.91
18D4 0.57 10 18
The TR2-Fc was immobilized onto the sensor surface. Solutions of the mAbs were
passed over the surface. Equilibrium responses at each mAb concentration were
calculated from
the kinetic data (see attachment). The different maximal responses of the mAbs
suggest they
bind to different epitopes. The "affinities" of the mAbs appear good for the
TR2-Fc but may be
considerably lower for an expressed monomeric receptor. The association rate
constant is lower
than usually seen for most mAbs. Maybe this is a clue.
Binding of TR2 mAb 18D4 to activated human CD4~ T cells
Monoclonal antibodies 18D4 were tested for reactivity on freshly isolated
activated
CD4+T cells. CD4+T cells were purified from human peripheral blood by ficoll
density
gradient centrifugation, the depletion of B lymphocytes and
monocyte/macrophages in T cell
columns (R&D Systems) and subsequent depletion of CD8+ T cells using
immunomagnetic
CD8 dynabeads (Dynal). Cells were stimulated with PHA (Sug/ml) and PMA (
lOng/ml} for 72
hours in RPMI 1640 medium supplemented with 10% fetal calf serum, 2mM L-
Giutamine,
SOug/ml Gentomycin and 25 mM Hepes buffer. Activated cells were incubated with
different
concentrations of TR2 mAb 18D4for 30 minutes at 4 oC, washed twice in PBS
containing 0.2%
BSA and 0.1% Sodium Azide (Staining buffer) and incubated for another 30
minutes at 4 °C
with Goat anti-mouse FITC labelled antibody. Cells were washed three times and
fixed in
staining buffer containing 2% Formaldehyde. Samples were subsequently analysed
on a Becton
Dickinson FACSort using Cellquest software.
19
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
Specific binding to 72 hour activated CD4+T cells was demonstrated for the TR2
mAb.
Optimal binding was seen at 100ug1m1 for 18D4. This data indicates that TR2 is
expressed on
the surface of activated CD4+T cells and that the TR2 mAb 18D4 binds to this
molecule.
Kinetics of TR2 expression on activated CD4~T cells
Human peripheral blood CD4+T cells were isolated using density gradient
centrifugation, T cell columns (R&D Systems) and depletion of CD8+T cells
using
immunomagnetic CD8 beads (Dynal). Cells were activated using immobilised anti-
human CD3
mAb (lug/ml) in RPMI 1640 medium supplemented with 10% fetal calf serum, 2mM L-
Glutamine, l0ug/ml Gentomycin and 25 mM Hepes buffer. At 24 hour intervals
activated cells
were incubated with TR2 mAbs for 30 minutes on ice, washed twice in PBS
containing 0.2%
BSA and 0.1 % Sodium Azide (Staining buffer) and incubated for another 30
minutes with Goat
anti-mouse FITC labelled antibody. Cells were washed three times and fixed in
staining buffer
containing 2% Formaldehyde. Samples were subsequently analysed on a Becton
Dickinson
FACSort using Cellquest software.
TR2 mAb 18D4 showed moderate levels of binding to resting CD4+T lymphocytes
but
after 24 hours of stimulation with immobilised anti-CD3 mAb 18D4 binding
decreased to low
levels. After 48 hours, levels of TR2 cell surface expression increased to
maximal levels before
declining slightly at 72 hours. This data suggests that TR2 is expressed on
resting CD4+ T cells
and following anti-CD3 stimulation cell surface expression of TR2 increases to
maximal levels
by 48 hours.
Inhibition of mixed iymphocxte proliferation by- 1'R2 mabs
Peripheral blood T cells express TR2 and the role of this receptor in T cell
activation
was examined using a mixed lymphocyte reaction (MLR) proliferation assay.
Peripheral blood
mononuclear cells (PBMCs) from three healthy donors were purified by density
gradient
centrifugation. PBMCs from two donors were adjusted to 1 x 106 cells/ml in
RPMI 1640
medium supplemented with 10% fetal calf serum, 2mM L-Glutamine, SOug/ml
Gentomycin and
25 mM Hepes buffer. PBMCs from the third donor were adjusted to 2x105
cells/m1. Fifty
microliters of PBMCs from each donor were added to wells of a 96 well round
bottomed
microtitre plate. Dilutions of TR2 mAbs 12C5 and 18D4, anti-human CD4 mAb and
control
anti-hIL-5 mAb 2B6 were added in quadruplicate to the plate. Cells were
cultured for 6 days at
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
37oC in 5 % C02 and I uCi of 3H thymidine was added to wells for the last 6
hours of culture.
Cells were harvested using a Skatron cell harvester and 3H thymidine
incorporation was
determined using a Wallac ~i scintillation counter. Positive control anti-CD4
mAb inhibited
MLR proliferation at all concentrations tested (0.05-100ug/ml) whereas
negative control mAb
2B6 failed to inhibit allogeneic proliferation. TR2 mAb 12C5 inhibited
allogenic proliferation
from 0.4-100ug/ml. In comparison, TR2 mAb 18D4 inhibited proliferation from
only 25-
100ug/ml. A primary component of MLR proliferation can be attributed to T
cells as shown by
inhibition with the anti-CD4 mAb. This data suggests that TR2 mAbs 12C5 and
18D4 inhibit
allogenic proliferation responses and indicates that TR2 is involved in T cell
activation.
TR2 mAbs inhibit anti-CD3-stimulated CD4~T cell proliferation and TNF
alpha.production
The capacity of TRZ Mabs to interfere with anti-CD3 driven CD4+T cell
proliferation
was examined. In addition, secreted TNFa levels were also determined. Human
peripheral
blood CD4+T cells were isolated by density gradient centrifugation, T cell
columns and
depletion of CD8+T cells using magnetic CD8 dynabeads. Purified CD4+T cells
were adjusted
to 1x106 cell/ml in RPMI 1640 medium supplemented with 10% fetal calf serum,
2mM L-
Glutamine, 50ug/ml Gentomycin and 25 mM Hepes buffer. 96 well flat bottomed
microtitre
plates with immobilised anti-CD3 mAb (5ug/ml) received 100u1 of cell
suspension, 50u1 of
either TR2 mab 12C5 or 18D4 dilutions and 50u1 of medium in quadruplicate.
Cells were
incubated at 37oC in 5% C02. After 48 hours, IOOuI of supernatant was removed
and pooled for
each quadruplicate. 100u1 of fresh medium was then added back to each well.
Cells were cultured for another 24 hours and IuCi of 3H thymidine was added to
wells
for the last 6 hours of culture. Cells were harvested using a Skatron cell
harvester and thymidine
incorporation was determined using a Wallac ~i scintillation counter.
Supernatant TNFa levels
were determined using ELISA detection kit for human TNFa (R&D Systems)
Both TR2 mAbs 12C5 and 18D4 inhibited anti-CD3 induced CD4+T proliferation.
18D4 inhibited proliferation from 0.025-100ug/ml whereas 12C5 showed activity
from 0.0062-
100ug/ml suggesting that 12C5 was more active than 18D4. Complete inhibition
of
proliferation was seen with both mabs between 25 and 100ug/ml. Mabs 18D4 and
12C5
inhibited CD4 + T cell proliferation with IC 5p's of 8nM and O.OSnM,
respectively. TNFa levels
in culture supernatants followed a similar pattern, with 12C5 and 18D4 showing
a dose
dependent inhibition of TNFa production. 18D4 appeared to be more active than
12C5 at
21
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
inhibiting TNFa production. Both TR2 mAbs completely suppressed TNFa
production at
1 OOug/ml.
This data suggests that TR2 mAbs 12C5 and 18D4 are capable of inhibiting anti-
CD3-
stimulated CD4+T cell proliferation and the production of TNFa indicating that
TR2 is involved
in modulating T cell proliferative responses and the production of T cell
derived pro-
inflammatory cytokines.
TR2 mAbs inhibit anti-CD3 and anti-CD28-stimulated CD4-+'T cell proliferation
TNFa and IL-2
production
The capacity of TR2 Mabs to interfere with anti-CD3 and anti-CD28 driven CD4+T
cell
proliferation was examined. In addition, the effect of TR2 Mabs on secreted
TNFa and IL-2
levels were also determined. Human peripheral blood CD4+T cells were isolated
by denisty
gradient centrifugation, T cell columns and depletion of CD8+T cells using
magnetic CD8
dynabeads. Purified CD4+T cells were adjusted to 1 x 106 cell/ml in RPMI 1640
medium
supplemented with 10% fetal calf serum, 2mM L-Glutamine, SOuglml Gentomycin
and 25 mM
Hepes buffer. 96 well flat bottomed microtitre plates with immobilised anti-
CD3 mAb (5ug/ml)
received 100u1 of cell suspension, 50uI of either TR2 mab 12C5 or 18D4
dilutions and 50u1 of
anti-CD28 mAb in quadruplicate. Cells were incubated at 37oC in 5% C02. After
48 hours,
100u1 of supernatant was removed and pooled for each quadruplicate. I OOuI of
fresh medium
was then added back to each well.
Cells were cultured for another 24 hours and luCi of 3H thymidine was added to
wells
for the last 6 hours of culture. Cells were harvested using a Skatron cell
harvester and thymidine
incorporation was determined using a Wallac ~i scintillation counter.
Supernatant TNFa and IL-
2 levels were determined using ELISA detection kits for human TNFa and IL-2
(R&D Systems).
Both TR2 mAbs I2C5 and 18D4 inhibited anti-CD3 and CD28 mAb induced CD4+'F
proliferation. 18D4 inhibited proliferation from 1.5-100ug/ml whereas 12C5
only showed
activity from 25-100ug1m1. Complete inhibition of proliferation was seen with
both mabs at
100ug/ml. Mabs 18D4 and 12C5 inhibited CD3/CD28 stimulated proliferation with
IC 50' s of
93 and 780nM, respectively. TNFa levels in culture supernatants followed a
similar pattern,
with 12C5 and 18D4 showing a dose dependent inhibition of TNFa production.
18D4 appeared
to be more active than 12C5 which correlated with the capacity of these mAbs
to inhibit
proliferation.
22
CA 02290067 1999-11-10
WO 98151346 PCT/US98/09744
A similar dose dependent inhibition of IL-2 production by both TR2 mAbs was
also
observed, with no detectable IL-2 present in cells treated with 100uglml TR2
mAb.
This data suggests that TR2 mAbs 12CS and 18D4 are capable of inhibiting
CD4'~T cell
proliferation and the production of cytokines such as TNFa and IL-2. This
indicates that TR2 is
S involved in T cell proliferative responses, pro-inflammatory cytokine
production and mitogenic
T cell cytokine production.
TR2 mAbs inhibit in vitro IeE production in response to IL-4 and anti CD40 mAb
The capacity of TR2 mAb 12CS to inhibit human IgE production was examined.
Human peripheral blood mononuclear cell (PBMCs) were purified by density
gradient
centrifugation and adjusted to l.2Sx106 cells/ml in HB101 medium supplemented
with insulin
(Sug/ml), transferrin (Sug/ml) and selenious acid (Sng/ml), 10% Fetal calf
serum, 2mM L-
glutamine, 2SmM Hepes and SOug/ml gentomycin. SOuI of anti-CD40 mAb (0.2ug/ml
final) and
SOuI of hIL-4 (3ng/ml final), 100u1 of TR2 mAb and 800u1 of cell suspension
were added to
were added to wells of a 48 well flat bottomed microtitre plates in
triplicate. Controls included
anti-CD40 and IL-4 alone, medium and IL-4 alone. Cells were cultured for 14
days at 37°C in
S%C02. 700u1 of supernantant from individual wells were harvested and stored
at -20oC.
Supernantants were assayed for human IgE using a human IgE ELISA detection
assay. Briefly,
Immunlon II ELISA plates were coated with Rabbit anti-human IaE antibody
(Dako) in PBS
containing 0.02% Sodium Azide at 4oC overnight. Plates were washed 4 times
with PBS
containing O.OS% Tween 20 and 0.02% Sodium Azide (wash buffer). Plates were
blocked for
60 minutes at 37 oC with PBS containing 0.1 % gelatin and 0.02% Sodium Azide.
After 4
washes using wash buffer, 100u1 of IgE standard or sample diluted in PBS
containing 0.1
gelatin, 0.02% Sodium Azide and O.S% Tween 20 (assay buffer) were added to
wells in
2S duplicate and incubated at 37oC for 60 minutes. Plates were washed and
incubated with
monoclonal mouse anti-human IgE (Serotec) for 60 minutes at 37 oC in assay
buffer. After
washing the plates Goat anti-mouse antibody conjugated to alkaline phosphatase
in assay buffer
was added to each well and incubated at 37 oC for 60 minutes. Plates were
washed and 100u1 of
p-nitrophenyl phosphate (lmg/ml) in substrate buffer containing diethanolamine
was-added to
each well. Plates were allowed to develop and optical densities read at 40Snm
on an ELISA
plate reader.
23
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
In two separate experiments using 3 different donors, IgE production by PBMCs
were
inhibited by TR2 mAb 12C5 in a dose dependent manner. ICSO values for the
three donors were
calculated to be <3nM, 30nM and SnM, respectively. These results indicate that
TR2 mAb 12C5
is capable of inhibiting IgE production in response to hIL-4 and anti-CD40
mAb. This suggests
that the TR2 receptor is involved directly or indirectly in regulating PBMC
IgE production in
response to IL-4 and anti-CD40 mAb.
24
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
SEQUENCE LISTING
S (1) GENERAL
INFORMATION
(i} APPLICANT: Harrop, Jeremy
Holmes, Steven
Reddy, Manjula
Truneh, Alemseged
(ii) TITLE OF THE INVENTION: Human Tumor Necrosis
Factor
Receptor-Like 2 (TR2) Antibodies
1S {iii) NUMBER OF SEQUENCES: 4
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SmithKline Beecham Corporation
(B) STREET: 709 Swedeland Road
(C) CITY: King of Prussia
(D} STATE: PA
(E) COUNTRY: USA
(F) ZIP: 19406-0939
2S {v) COMPUTER
READABLE
FORM:
(A) MEDIUM TYPE: Diskette
(B) COMPUTER: IBM Compatible
(C) OPERATING SYSTEM: DOS
(D) SOFTWARE: FastSEQ for Windows Version 2.0
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: UNKNOWN
(B} FILING DATE: HEREWITH
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
" {A) APPLICATION NUMBER: 60/046,249
(B) FILING DATE: May 12, 1997
25
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Han, William T
(B) REGISTRATION NUMBER: 34,344
(C) REFERENCE/DOCKET NUMBER: GH50027
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 610-270-5219
(B) TELEFAX: 610-270-5090
(C) TELEX:
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1704 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
GCACGAGCTG CCTCCCGCAGGCGCCACCTGTGTCCCCCAGCGCCGCTCCACCCAGCAGGC60
CTGAGCCCCT CTCTGCTGCCAGACACCCCCTGCTGCCCACTCTCCTGCTGCTCGGGTTCT120
GAGGCACAGC TTGTCACACCGAGGCGGATTCTCTTTCTCTTTCTCTTTCTCTTCTGGCCC180
ACAGCCGCAG CAATGGCGCTGAGTTCCTCTGCTGGAGTTCATCCTGCTAGCTGGGTTCCC240
GAGCTGCCGG TCTGAGCCTGAGGCATGGAGCCTCCTGGAGACTGGGGGCCTCCTCCCTGG300
AGATCCACCC CCAAAACCGACGTCTTGAGGCTGGTGCTGTATCTCACCTTCCTGGGAGCC360
3O CCCTGCTACG CCCCAGCTCTGCCGTCCTGCAAGGAGGACGAGTACCCAGTGGGCTCCGAG420
TGCTGCCCCA AGTGCAGTCCAGGTTATCGTGTGAAGGAGGCCTGCGGGGAGCTGACGGGC480
ACAGTGTGTG AACCCTGCCCTCCAGGCACCTACATTGCCCACCTCAATGGCCTAAGCAAG540
TGTCTGCAGT GCCAAATGTGTGACCCAGCCATGGGCCTGCGCGCGAGCCGGAACTGCTCC600
AGGACAGAGA ACGCCGTGTGTGGTTGCAGCCCAGGCCACTTCTGCATCGTCCAGGACGGG660
GACCACTGCG CCGCGTGCCGCGCTTACGCCACCTCCAGCCCGGGCCAGAGGGTGCAGAAG720
GGAGGCACCG AGAGTCAGGACACCCTGTGTCAGAACTGCCCCCCGGGGACCTTCTCTCCC780
AATGGGACCC TGGAGGAATGTCAGCACCAGACCAAGTGCAGCTGGCTGGTGACGAAGGCC840
GGAGCTGGGA CCAGCAGCTCCCACTGGGTATGGTGGTTTCTCTCAGGGAGCCTCGTCATC900
GTCATTGTTT GCTCCACAGTTGGCCTAATCATATGTGTGAAAAGAAGAAAGCCAAGGGGT960
4O GATGTAGTCA AGGTGATCGTCTCCGTCCAGCGGAAAAGACAGGAGGCAGAAGGTGAGGCC1020
ACAGTCATTG AGGCCCTGCAGGCCCCTCCGGACGTCACCACGGTGGCCGTGGAGGAGACA1080
26
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
ATACCCTCAT TCACGGGGAGGAGCCCAAACCACTGACCCACAGACTCTGCACCCCGACGC 1140
CAGAGATACC TGGAGCGACGGCTGAATGAAAGAGGCTGTCCACCTGGCGGAACCACCGGA 1200
GCCCGGAGGC TTGGGGGCTCCACCCTGGACTGGCTTCCGTCTCCTCCAGTGGAGGGAGAG 1260
GTGGCGCCCC TGCTGGGGTAGAGCTGGGGACGCCACGTGCCATTCCCATGGGCCAGTGAG 1320
GGCCTGGGGC CTCTGTTCTGCTGTGGCCTGAGCTCCCCAGAGTCCTGAGGAGGAGCGCCA 1380
' GTTGCCCCTC GCTCACAGACCACACACCCAGCCCTCCTGGGCCAACCCAGAGGGCCTTCA 1440
GACCCCAGCT GTGTGCGCGTCTGACTCTTGTGGCCTCAGCAGGACAGGCCCCGGGCACTG 1500
CCTCACAGCC AAGGCTGGACTGGGTTGGCTGCAGTGTGGTGTTTAGTGGATACCACATCG 1560
GAAGTGATTT TCTAAATTGGATTTGAATTCGGCTCCTGTTTTCTATTTGTCATGAAACAG 1620
lO TGTATTTGGG
GAGATGCTGTGGGAGGATGTAAATATCTTGTTTCTCCTCAF~~~AAAA.AAA1680
1704
(2) INFORMATION FOR SEQ ID N0:2:
'(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 291 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: 5EQ ID N0:2:
Met Glu Pro Pro Gly Asp Trp Gly Pro Pro Pro Trp Arg Ser Thr Pro
1 5 10 15
Lys Thr Asp Val Leu Arg Leu Val Leu Tyr Leu Thr Phe Leu Gly Ala
20 25 30
Pro Cys Tyr Ala Pro Ala Leu Pro Ser Cys Lys Glu Asp Glu Tyr Pro
35 40 45
Val Gly Ser Glu Cys Cys Pro Lys Cys Ser Pro Gly Tyr Arg Val Lys
50 55 60
Glu Ala Cys Gly Glu Leu Thr Gly Thr Val Cys Glu Pro Cys Pro Pro
65 70 75 80
Gly Thr Tyr Ile Ala His Leu Asn,Gly Leu Ser Lys Cys Leu Gln Cys
85 90 95
Gln Met Cys Asp Pro Ala Met Gly Leu Arg Ala Ser Arg Asn Cys Ser
100 105 110
Arg Thr Glu Asn Ala Val Cys Gly Cys Ser Pro Gly His Phe Cys Ile
J
115 120 125
Val Gln Asp Gly Asp His Cys Ala Ala Cys Arg Ala Tyr Ala Thr Ser
27
CA 02290067 1999-11-10
WO 98/51346 PCT/US98/09744
130 235 140
Ser ProGlyGln ArgValGln LysGlyGly ThrGluSer GlnAspThr
145 150 155 160
Leu CysGlnAsn CysProPro GlyThrPhe SerProAsn GlyThrLeu
165 170 175
Glu Glu.CysGln HisGlnThr LysCysSer TrpLeuVal ThrLysAla
180 185 190
Gly AlaGlyThr SerSerSer HisTrpVal TrpTrpPhe LeuSerGly
195 200 205
Ser LeuValIle ValIleVal CysSerThr ValGlyLeu IleIleCys
210 215 220
Val LysArgArg LysProArg GlyAspVal ValLysVal IleValSer
225 230 235 240
Val GlnArgLys ArgGlnGlu AlaGluGly GluAlaThr ValIleGlu
245 250 255
Ala LeuGlnAla ProProAsp ValThrThr ValAlaVal GluGluThr
260 265 270
Ile ProSerPhe ThrGlyArg SerProAsn His
275 280
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
CAGGAATTCG CAGCCATGGA GCCTCCTGGA GACTG 35
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
{A) LENGTH: 53 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
28
CA 02290067 1999-11-10
WO 98151346 PCT/US98/09744
(ii) MOLECULE TYPE: other
S
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
~ CCATACCCAG GTACCCCTTC CCTCGATAGA TCTTGCCTTC GTCACCAGCC AGC 53
29
