Note: Descriptions are shown in the official language in which they were submitted.
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
METHODS OF MAKING AN RNP PARTICLE
HAVING NUCLEOTIDE INTEGRASE ACTIVITY
BACKGROUND
Nucleotide integrases are molecular complexes that are capable of cleaving
nucleic
acid substrates at specific recognition sites and of concomitantly inserting
nucleic acid
molecules into the nucleic acid substrate at the cleavage site. Thus,
nucleotide integrases are
useful tools, particularly for genome mapping, genetic engineering and
disrupting the
synthesis of gene products. Structurally, nucleotide integrases are
ribonucleoprotein (RNP)
particles that comprise an excised, group II intron RNA and a group II intron-
encoded
protein, which is bound to the group II intron RNA.
Conventionally, nucleotide integrases are made by isolating RNP particles that
have
nucleotide integrase activity from source organisms which comprise a DNA
molecule that
encodes both the RNA and protein subunits of the nucleotide integrase. In
order to obtain
nucleotide integrases other than wild type, the source organisms are
mutagenized. The
mutagenesis is a laborious, multistep process. Moreover, this process yields
limited
quantities of the nucleotide integrase.
Accordingly, it is desirable to have methods for making nucleotide integrases
which
are not laborious and which permit the nucleotide integrase to be readily
modified from the
wild type. Methods which yield at least microgram quantities of substantially
pure nucleotide
integrases are especially desirable.
SUMMARY OF THE INVENTION
The present invention provides new, improved, and easily manipulable methods
for
making nucleotide integrases.
In one embodiment, the nucleotide integrase is prepared by introducing a DNA
molecule which comprises a group II intron DNA sequence into a host cell.
Preferably the
DNA molecule further comprises a sequence which encodes a tag that facilitates
isolation of
RNP particles having nucleotide integrase activity from the host cell.
Preferably, the tag
sequence is linked to the open reading frame (ORF) sequence of the group II
intron DNA.
The group II intron DNA sequence is then expressed in the host cell such that
RNP particles
having nucleotide integrase activity are formed in the cell. Such RNP
particles comprise an
excised group II intron RNA molecule and a group II intron-encoded protein,
both of which
1
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
are encoded by the introduced DNA molecule. Thereafter, the RNP particles
having
nucleotide integrase activity are isolated from the cell.
In another embodiment, the nucleotide integrase is prepared by combining in
vitro an
excised, group II intron RNA, referred to hereinafter as "exogenous RNA", with
a group II
intron-encoded protein. The exogenous RNA is prepared by in vitro
transcription of a DNA
molecule which comprises a group II intron sequence. The group II intron-
encoded protein is
made by introducing into a host cell a DNA molecule that comprises at least
the open reading
frame sequence of a group II intron and then expressing the open reading frame
sequence in
the host cell. The DNA molecule may comprise the open reading frame sequence
operably
linked to a promoter, preferably an inducible promoter. Thereafter, the cell
is fractionated and
the protein is recovered and combined in vitro with the exogenous RNA to
provide RNP
particles having nucleotide integrase activity. Alternatively, the DNA
molecule may
comprise a group II intron sequence that encodes both a group II intron RNA as
well as a
group II intron encoded protein. The DNA molecule is then expressed in the
host cell to
1 S provide RNP particles that comprise the group II intron-encoded protein
bound to the group II
intron RNA. Thereafter, the RNP particles comprising the group II intron-
encoded protein
and the group II intron RNA are isolated from the cell and treated with a
nuclease to remove
the RNA and to provide the group II-intron encoded protein. The group II
intron-encoded
protein is then combined in vitro with the exogenous RNA to provide RNP
particles having
nucleotide integrase activity.
The present invention also relates to isolated RNP particles having nucleotide
integrase activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the interaction at the target site between the EBS 1 and EBS2
sequences
of the group II intron RNA 2 of the S. cerevisiae mitochondrial COXI gene,
hereinafter referred
to as the "aI2" RNA, with the IBS1 and IBS2 sequences of a nucleic acid
substrate. The
cleavage site is represented by an arrow.
Figure 2 is a schematic representation of the domains in three representative
group II
intron encoded proteins, namely the protein which is encoded by the ORF
sequence of the
group II intron 2 of the S. cerevisiae mitochondria) COXI gene, the group II
intron 2 of the
2
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
M. polymorpha mitochondria) COXl gene, and the group II intron 1 of the N.
tabacum
chloroplast trnK gene.
Figure 3 is the plasmid map of pETLtrAl9.
Figure 4 shows the nucleotide sequence of the 2.8 kb HindIII fragment that is
present
in pETLtrAl9 and that includes the Ll.ItrB intron DNA sequence and portions of
the
nucleotide sequence of the flanking exons ltrBEl and ltrBE2, SEQ. ID. NO. 1.,
the nucleotide
sequence of the LtrA open reading frame, SEQ. ID. ND. 2, and the amino acid
sequence of
the LtrA protein, SEQ. ID. NO. 3.
Figure 5 is the plasmid map of plasmid pETLtrAI-1.
Figure 6 is a schematic representation of the inserts in pLEl2, pETLtrAl9 and
pETLtrAI-1.
Figure 7A is the sequence of the sense strand of a double-stranded DNA
substrate,
SEQ. ID. NO. 4, which is cleaved by RNP particles that comprise a wild-type
excised,
LLItrB intron RNA and an LtrA protein. Figure 7B is the sequence of the sense
strand of a
1 S double stranded DNA substrate which is cleaved by RNP particles that
comprise an excised
Ll.ItrB intron RNA having a modified EBS I sequence and an LtrA protein.
Figure 8a is a schematic depiction of the substrate which is cleaved by RNP
particles
comprising the wild-type Ll.ltrB intron RNA and the LtrA protein, and Figure
8b shows the
IBS 1 and IBS2 sequences of the substrate and the cleavage sites of the double-
stranded DNA
substrate which is cleaved by these RNP particles.
DETAILED DESCRIPTION OF THE INVENTION
Nucleotide InteQrases
Functionally, nucleotide integrases are endonucleases that are capable of
cleaving
nucleic acid substrates at specific recognition sites and of concomitantly
inserting nucleic
acid molecules into the substrate at the cleavage site. Structurally,
nucleotide integrases are
ribonucleoprotein (RNP) particles that comprise an excised, group II intron
RNA and a group
II intron-encoded protein, which is bound to the excised group II intron RNA.
"Excised
group II intron RNA," as used herein, refers to the RNA that is, or that is
derived from, an in
vitro or in vivo transcript of the group II intron DNA and that lacks flanking
exon sequences
at the 5' end and the 3' end of the intron sequence. The excised, group II
intron RNA
typically has six domains and a characteristic secondary and tertiary
structure, which is
3
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
shown in Saldahana et al., 1993, Federation of the American Society of
Experimental Biology
Journal, Vol 7 p15-24, which is specifically incorporated herein by reference.
Domain IV of
the group II intron RNA contains the open reading frame ("ORF") nucleotide
sequence which
encodes the group II intron encoded protein. The excised group II intron RNA
also has two
sequences in domain I which are capable of hybridizing with two sequences in
the target site
of the intended nucleic acid substrate. The first sequence, referred to
hereinafter as the
"EBS 1" sequence, is capable of hybridizing with a sequence, referred to
hereinafter as the
"IBS1" sequence, which is immediately upstream of the cleavage site in the
substrate. The
second sequence, referred to hereinafter as the "EBS2" sequence, is capable of
hybridizing
with a sequence, hereinafter referred to as the "IB S2" sequence, which is
upstream of the
IBS 1 sequence.
The excised group II intron RNA has a wild-type sequence, i.e. a sequence
which is
identical to the sequence of a group II intron RNA that is found in nature, or
the excised
group II intron RNA has a modified sequence, i.e. a sequence which is
different from the
sequence of group II intron RNA molecules that are found in nature. For
nucleotide integrases
in which the group II intron RNA has a wild-type sequence, the EBSI sequence
typically is
complementary to a sequence of about 5-7 nucleotides, hereinafter referred to
as the "first set" ,
which is located at the 3' end of the exon that is joined to the 5' end of the
intron in the gene.
Similarly, the EBS2 sequence of the wild-type group II intron RNA typically is
complementary
to a sequence of about 5-7 nucleotides in the 5' exon, hereinafter referred to
as the "second set" ,
which is upstream, typically immediately upstream, of the first set. Thus, the
EBS1 and EBS2
sequences of a wild-type group II intron RNA can usually be predicted by
finding sequences in
domain I of the intron that are complementary to the first set and second set
of nucleotides in the
5' exon.
In the wild-type group II intron RNA of the Lactococcus lactis ItrB gene,
hereinafter
referred to as the wild-type Ll.ItrB intron RNA, EBS1 comprises 7 nucleotides,
is located at
position 3132-3138 (numbered according to Mills et al., 1996, J. Bact., 178,
3531-3538), and
has the sequence GUUGUGG. EBS2 of the wild-type Ll.ltrB intron RNA comprises 6
nucleotides, is located at positions 3076-3081 and has the sequence AUGUGU. In
the wild-type
group II intron RNA 1 of the S. cerevisiae mitochondrial COXl gene,
hereinafter referred to as
the "wild-type all RNA", EBS1 comprises 6 nucleotides, is located at position
426-431
(numbered according to Bonitz et aL, 1980, J. Biol. Chem.: 255, 11927-11941),
and has the
4
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98154353 PCT/US98/10687
sequence CGUUGA. EBS2 of the wild-type aI l RNA comprises 6 nucleotides, is
located at
positions 376-381 and has the sequence ACAAUU. In the wild-type group II
intron RNA 2 of
the S. cerevisiae mitochondrial C'OXI gene, hereinafter referred to as the
"wild-type aI2" RNA,
EBS 1 comprises 6 nucleotides, is located at position 2985-2990 (numbered
according to Bonitz
S et al., 1980, J. Biol. Chem.: 2SS, 11927-11941) and has the sequence AGAAGA.
EBS2 of the
wild-type aI2 RNA comprises 7 nucleotides, is located at positions 2935-29410,
and has the
sequence UCAUUAA. The interaction between EBS1 and EBS2 of the wild-type aI2
RNA
with its intended substrate is depicted in Figure 1.
The excised group II intron RNA may also have a sequence different from a
group II
intron RNA that is found in nature, and thus be a modified, excised group II
intron RNA.
Modified excised group II intron RNA molecules, include, for example, group II
intron RNA
molecules that have nucleotide base changes or additional nucleotides in the
internal loop
regions of the group II intron RNA, preferably the internal loop region of
domain IV and group
II intron RNA molecules that have nucleotide base changes in the sequences of
EBS 1 and/or
1 S EBS2. Nucleotide integrases in which the group II intron RNA has
nucleotide base changes in
the sequences of EBS1 or EBS2, as compared to the wild type, typically have
altered specificity
for the intended nucleic acid substrate.
The group II intron-encoded protein has an X domain, a reverse transcriptase
domain,
and, preferably, a Zn domain. The X domain of the protein has a maturase
activity. The Zn
domain of the protein has Zn'' finger-like motifs. As used herein, a group II
intron-encoded
protein includes modified group II intron-encoded proteins that have
additional amino acids at
the N terminus, or C terminus, or alterations in the internal regions of the
protein as well as
wild-type group II intron-encoded proteins. The domains 'of three
representative group I1
intron-encoded proteins are depicted in Figure 2.
2S The RNP particles having nucleotide integrase activity cleave single-
stranded RNA
molecules, single-stranded DNA molecules, and double-stranded DNA molecules.
The RNP
particles having nucleotide integrase activity also insert the group II intron
RNA subunit of
the RNP particle into the cleavage site. Thus, RNP particles having nucleotide
integrase
activity both cleave nucleic acid substrates and insert nucleic acid molecules
into the cleavage
site. With double-stranded DNA substrates, the nucleotide integrase inserts
the group II intron
RNA into the first strand, i.e., the strand that contains the IBS1 and IBS2
sequences, of the
cleaved DNA substrate and, preferably, a cDNA molecule into the second strand
of the
5
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
cleaved DNA substrate. The excised group II intron RICA subunit of the
nucleotide
integrase catalyzes cleavage of the single-stranded-substrates and the first
strand of the double-
stranded DNA substrate. The cleavage that is catalyzed by the excised group II
intron RNA also
results in the insertion, either partially or completely, of the excised group
II intron RNA into
s the cleavage site, i.e. between nucleotide +1, which is immediately
downstream of the cleavage
site, and nucleotide -l, which is immediately upstream of the cleavage site.
The group II intron-
encoded protein subunit catalyzes cleavage of the second strand of the double-
stranded DNA
substrate. The second strand of the double stranded DNA substrate is cut at a
position from
about 9 to about 11 base pairs downstream of the cleavage site in the first
strand, i.e. at a site
between nucleotide positions +9, +10, and +11. It is believed that the group
II intron-encoded
protein also assists cleavage of the first strand of the double stranded DNA
substrate by
stabilizing the group II intron RNA. Thus, the RNP particle having nucleotide
integrase activity
is active under conditions that are similar to physiological conditions.
To cleave the substrates, it is preferred that the EBSI and EBS2 sequences of
the group
II intron RNA of the nucleotide integrase have at least 90% complementarity,
preferably full
complementarity, with the IBSI and IBS2 sequences, respectively, of the
intended substrate.
Thus, if there is not at least 90% complementarity between the EBS sequences
of the excised
group II intron RNA and IBS sequences of the intended substrate, it is
preferred that nucleotide
base changes be made in the non-complementary EBS sequences. To cleave single-
stranded
and double-stranded nucleic acid substrates efficiently, it is preferred that
the nucleotide delta,
which immediately precedes the first nucleotide of EBS1 be complementary to
the nucleotide at
+1 in the target site. Thus, if the delta nucleotide is not complementary to
the nucleotide at +1
in the target site, the group II intron RNA is modified to contain a delta
nucleotide which is
complementary to the nucleotide at +I on the sense strand of the substrate. To
cleave double
stranded DNA substrates efficiently, it is preferred that the target site has
a sequence that is
recognized by the group II intron-encoded protein of the nucleotide integrase.
For example,
cleavage of a double-stranded DNA substrate is achieved with a nucleotide
integrase
comprising a wild-type Ll.ltrB RNA and LtrA protein if the first strand of the
substrate contains
the sequence,
5'-TCGATCGTGAACACATCCATAACC'3', SEQ.ID.NO.- which represents the
sequence from -23 to +1 in the target site of the first strand.
6
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
A. Preparation of the Nucleotide Integrase b~~solation from a Genetically
Engineered Cell.
In one embodiment, RNP particles having nucleotide integrase activity are made
by
introducing an isolated DNA molecule which comprises a group II intron DNA
sequence into
a host cell. Preferably, the DNA molecule further comprises an IBS 1 sequence
and an IBS2
sequence just upstream of the 5' end of the group II intron DNA sequence to
allow splicing
of the group II intron RNA from a transcript of the group II intron DNA
sequence. Suitable
DNA molecules include, for example, viral vectors, plasmids, and linear DNA
molecules.
Following introduction of the DNA molecule into the host cell, the group II
intron DNA
sequence is expressed in the host cell such that excised RNA molecules encoded
by the
introduced group II intron DNA sequence and protein molecules encoded by
introduced
group II intron DNA sequence are formed in the cell. The excised group II
intron RNA and
group II intron-encoded protein are combined within the host cell to produce
an RNP particle
having nucleotide integrase activity.
Preferably, the introduced DNA molecule also comprises a promoter, more
preferably
an inducible promoter, operably linked to the group II intron DNA sequence.
Preferably, the
DNA molecule further comprises a sequence which encodes a tag to facilitate
isolation of the
RNP particles having nucleotide integrase activity, such as, for example, an
affinity tag
and/or an epitope tag. Preferably, the tag sequences are at the 5' or 3' end
of the open reading
frame sequence. Suitable tag sequences include, for example, sequences which
encode a
series of histidine residues, the Herpes simplex glycoprotein D, i.e., the HSV
antigen, or
glutathione S-transferase. An especially suitable tag is a sequence which
encodes the intein
from the S. cerevisiae VMA1 gene linked to the chitin binding domain from
Bacillus
circulars. Typically, the introduced DNA molecule also comprises nucleotide
sequences that
encode a replication origin and a selectable marker. Optionally, the
introduced DNA
molecule comprises sequences that encode molecules that modulate expression,
such as for
example T7 lysozyme.
The DNA molecule comprising the group II intron sequence is introduced into
the
host cell by conventional methods, such as, by cloning the DNA molecule into a
vector and
by introducing the vector into the host cell by conventional methods, such as
electroporation
or by CaClz-mediated transformation procedures. The method used to introduce
the DNA
molecule depends on the particular host cell used. Suitable host cells are
those which are
7
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98154353 PCT/US98/10687
capable of expressing the group II intron DNA sequence. Suitable host cells
include, for
example, heterologous or homologous bacterial cells, yeast cells, mammalian
cells, and plant
cells. In those instances where the host cell genome and the group II intron
DNA sequence
use different genetic codes, it is preferred that the group II intron DNA
sequence be modified
to comprise codons that correspond to the genetic code of the host cell. The
group II intron
DNA sequence, typically, is modified by using a DNA synthesizer or by in vitro
site directed
mutagenesis, such as by PCR mutagenesis, to prepare a group II intron DNA
sequence with
different codons. Alternatively, to resolve the differences in the genetic
code of the intron
and the host cell, DNA sequences that encode the tRNA molecules which
correspond to the
genetic code of the group II intron are introduced into the host cell.
Optionally, DNA
molecules which comprise sequences that encode factors that assist in RNA or
protein
folding, or that inhibit RNA or protein degradation are also introduced into
the cell.
The DNA sequences of the introduced DNA molecules are then expressed in the
host
cell to provide a transformed host cell. As used herein the term "transformed
cell" means a
host cell that has been genetically engineered to contain and express
additional DNA,
primarily heterologous DNA, and is not limited to cells which are cancerous.
Then the RNP
particles having nucleotide integrase activity are isolated from the
transformed host cells.
The RNP particles having nucleotide integrase activity are isolated,
preferably by
lysing the transformed cells, such as by mechanically and/or enzymatically
disrupting the cell
membranes of the transformed cell. Then the cell lysate is fractionated into
an insoluble
fraction and soluble fraction. Preferably, an RNP particle preparation is
isolated from the
soluble fraction. The RNP particle preparations include the RNP particles
having nucleotide
integrase activity as well as ribosomes, mRNA and tRNA molecules. Suitable
methods for
isolating RNP particle preparations include, for example, centrifugation of
the soluble
fraction through a sucrose cushion. The RNP particles, preferably, are further
purified from
the RNP particle preparation or from the soluble fraction by, for example,
separation on a
sucrose gradient, or a gel filtration column, or by other types of
chromatography. For
example, in those instances where the group II-intron encoded protein subunit
of the desired
RNP particle has been engineered to include a tag, the RNP particles having
nucleotide
integrase activity are purified from the particle preparation by affinity
chromatography on a
matrix which recognizes and binds to the tag. For example, NiNTA SuperflowTH
from
Qiagen, Chatsworth CA, is suitable for isolating RNP particles having
nucleotide integrase
8
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
activity when the group II intron-encoded protein has a histidine tag. It has
been found that
the a system which employs a chitin column and an intein and chitin binding
domain tag on
the group II intron-encoded protein results in the production of RNP particles
that are
substantially pure, i.e., the intron encoded protein represents at least 95%
of the protein in the
RNP particles eluted from the column. Thus, the latter system is particularly
suitable for
isolating RNP particles having nucleotide integrase activity.
B. Prenaration of the Nucleotide lntegrase by Combining- Exogenous RNA with a
Group II Intron-Encoded Protein to Form a Reconstituted RNP Particle
In another embodiment, the nucleotide integrase is formed by combining an
isolated
exogenous RNA with an isolated group II intron-encoded protein in vitro to
provide a
reconstituted RNP particle having nucleotide integrase activity. The exogenous
RNA is made
by in vitro transcription of the group II intron DNA. The exogenous RNA may be
made by in
vitro transcription of the group II intron DNA only, i.e. the transcript lacks
flanking exon
sequences. Alternatively, the exogenous RNA is made by in vitro transcription
of the group
II intron DNA and the DNA of all, or portions, of the flanking exons to
produce an
unprocessed transcript which contains the group II intron RNA and the RNA
encoded by the
flanking exons or portions thereof. Then the exogenous RNA is spliced from the
unprocessed
transcript.
The purified group II intron-encoded protein is prepared by introducing into a
host
cell an isolated DNA molecule that comprises at least the open reading frame
sequence of a
group II intron. The DNA molecule may comprise a group II intron ORF sequence
operably
linked to an inducible promoter. Alternatively, the DNA molecule may comprise
a group II
intron DNA sequence. Preferably, the introduced DNA molecule also comprises a
sequence
at the 5' or 3' end of the group II intron ORF sequence which, when expressed
in the host
cell, provides an affinity tag or epitope on the N-terminus or C-terminus of
the group II
intron-encoded protein. Thus, the DNA molecule may comprise at the 5' or 3'
end of the
ORF, for example, a sequence which encodes a series of histidine residues, or
the HSV
antigen, glutathione-S-transferase, or an intein linked to a chitin binding
domain. Typically,
the DNA molecule also comprises nucleotide sequences that encode a replication
origin and a
selectable marker.
9
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
When the introduced DNA molecules comprise a group II intron ORF sequence
operably linked to an inducible promoter, the ORF sequence is then expressed
in the host cell
preferably by adding a molecule which induces expression, to provide a host
cell that
contains RNP particles comprising the group II intron-encoded protein
associated with
endogenous nucleic acids, particularly endogenous RNA molecules. Then the
transformed
cell is lysed, and preferably fractionated into a soluble fraction and an
insoluble fraction. The
RNP particles comprising the protein and the endogenous RNA are then isolated,
preferably
from the soluble fraction, preferably by using methods such as affinity
chromatography. The
RNP particles are then incubated with the exogenous RNA, preferably in a
buffer, to allow
the exogenous RNA to displace the associated RNA molecules and to form RNP
particles
having nucleotide integrase activity. Optionally, the RNP particles, are
treated with a
nuclease to remove the RNA that is associated with the group II intron encoded
protein prior
to incubation of the protein preparation with the exogenous RNA. The RNP
particles may be
treated with the nuclease by adding the nuclease to the soluble fraction.
Alternatively, the
RNP particles may be treated with the nuclease after isolation of the RNP
particles from the
soluble fraction.
When DNA molecules comprise a splicing-competent group II intron sequence, are
introduced and expressed in the host cells, RNP particles comprising a group
II intron-
encoded protein associated with an excised group II intron RNA that encodes
the protein are
produced. When DNA molecules comprise a splicing-defective group II intron
sequence, are
introduced and expressed in the host cells, the group II intron-encoded
protein is not
associated with an excised, group II intron RNA that encodes the protein The
RNP particles
that are produced when a splicing-defective group II intron DNA sequence is
introduced and
expressed in a host cell comprise other types of RNA molecules, such as for
example,
unspliced group II intron RNA molecules that encode the protein, ribosomal RNA
molecules,
mRNA molecules, tRNA molecules or other nucleic acids. Following formation of
the RNP
particles in the host cell, the transformed cell is lysed, and preferably
fractionated into a
soluble fraction and an insoluble fraction. The RNP particles comprising the
protein are then
isolated, preferably from the soluble fraction, preferably by using methods
such as affinity
chromatography. The isolated RNP particles are then treated with a nuclease
that degrades all
of the endogenous RNA molecules. Preferably the RNP particles are treated with
a nuclease
which can be chemically inactivated, such as for example, micrococcal
nuclease. The group
SUBSTITUTE SHEET (RULE 26) _ .
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
II intron-encoded protein preparation is then combined with the exogenous RNA,
preferably
in a buffer, to allow formation of RNP particles having nucleotide integrase
activity
These methods enable production of increased quantities of nucleotide
integrases.
Conventional methods produce approximately 0.1 to 1 ~g of an RNP particles
having
nucleotide integrase per liter of cultured cells. However, these RNP particles
are highly
contaminated with other proteins. The methods of the present invention enable
the
production of at least 0.5 mg of RNP particles having nucleotide integrase
activity per liter of
cultured cells. Moreover, the RNP particles having nucleotide integrase
activity produced in
accordance with the present methods are substantially pure, i.e., at least 95%
of the protein in
the final RNP particle preparation is the group II intron-encoded protein. The
present methods
also offer the further advantage of permitting the sequences of the RNA
component and the
protein component of the nucleotide integrase to be readily modified.
Typically, the
nucleotide integrases are modified by introducing nucleotide base changes,
deletions, or
additions into the group II intron RNA by PCR mutagenesis of the group II
intron.
The following examples of methods for preparing a group II intron-encoded
protein
and for preparing nucleotide integrases are included for purposes of
illustration and are not
intended to limit the scope of the invention.
Preparing Nucleotide Inte~rases By Coexpression of a Group II Intron RNA and a
Group II
Intron Encoded Protein
Example 1
RNP particles having nucleotide integrase activity and comprising an excised
RNA
that is encoded by the Ll.ltrB intron of a lactococcal cojugative element
pRS01 of
Lactococcus lactic and the protein encoded by the ORF of the~Ll.ltrB intron
were prepared by
transforming cells of the BLR(DE3) strain of the bacterium Escherichia coli,
which has the
recA genotype, with the plasmid pETLtrAl9. Plasmid pETLtrAl9, which is
schematically
depicted in Figure 3, comprises the DNA sequence for the group II intron
Ll.ltrB from
Lactococcus lactic, shown as a thick line, positioned between portions of the
flanking exons
ltrBEl and ItrBE2, shown as open boxes. pETLtrAl9 also comprises the DNA
sequence for
the T7 RNA polymerase promoter and the T7 transcription terminator. The
sequences are
oriented in the plasmid in such a manner that the ORF sequence, SEQ. ID. NO.
2, within the
Ll.ltrB intron is under the control of the T7 RNA polymerase promoter. The ORF
of the
LLItrB intron, shown as an arrow box, encodes the protein LtrA. The sequence
of the Ll.ltrB
11
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
intron and the flanking exon sequences present in pETLtrAl9 are shown in
Figure 4 and SEQ.
ID. NO. I . Vertical lines in Figure 4 denote the junctions between the intron
and the flanking
sequences. The amino acid sequence of the LtrA protein, SEQ. ID. NO. 3 is
shown under the
ORF sequence, SEQ. ID. NO. 2, in Figure 4. The sequences of EBSI and EBS2
include
nucleotides 457 through 463 (EBS1), nucleotides 401 through 406 (EBS2a) , and
nucleotides
367 through 372 (EBS2b). Domain IV is encoded by nucleotide 705 to 2572.
pETLtrAl9 was prepared first by digesting pLE 12, which was obtained from Dr.
Gary
Dunny from the University of Minnesota, with HindIII and isolating the
restriction fragments
on a 1 % agarose gel. A 2.8 kb HindIII fragment which contains the LLItrB
intron together
with portions of the flanking exons ItrBEI and ItrBE2 was recovered from the
agarose gel and
the single-stranded overhangs were filled in with the Klenow fragment of DNA
polymerase I
obtained from Gibco BRL, Gaithersburg, MD. The resulting fragment was ligated
into
plasmid pET-l la that had been digested with XbaI and treated with Klenow
fragment. pET-
11 a was obtained from Novagen, Madison, WI.
pETLtrAl9 was introduced into the E. coli cells using the conventional CaCI,-
mediated transformation procedure of Sambrook et al. as described in
"Molecular Coning A
Laboratory Manual", pages 1-82, 1989 . Single transformed colonies were
selected on plates
containing Luria-Bertani (LB) medium supplemented with ampicillin to select
the plasmid
and with tetracycline to select the BLR strain. One colony was inoculated into
2 ml of LB
medium supplemented with ampicillin and grown overnight at 37°C with
shaking. 1 ml of
this culture was inoculated into 100 ml LB medium supplemented with ampicillin
and grown
at 37°C with shaking at 200 rpm until OD5~5 of the culture reached 0.4.
Then isopropyl-beta-
D-thiogalactoside was added to the culture to a final concentration of 1 mM
and incubation
was continued for 3 hours. Then the entire culture was harvested by
centrifugation at 2,200 x
g, 4°C, for 5 minutes. The bacterial pellet was washed with 150 mM NaCI
and finally
resuspended in 1/20 volume of the original culture in 50 mM Tris, pH 7.5, 1 mM
EDTA, 1
mM DTT, and 10% (v/v) glycerol (Buffer A)and 2 mg/ml lysozyme. Bacteria were
frozen at
-70°C.
To produce a lysate the bacteria were thawed and frozen at -70°C three
times. Then 4
volumes of 500 mM KCI, 50 mM CaCI,, 25 mM Tris, pH 7. 5, and 5 mM DTT (HKCTD)
were added to the lysate and the mixture was sonicated until no longer
viscous, i.e. for about
5 seconds or longer. The lysate was fractionated into a soluble fraction and
insoluble fraction
12
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
by centrifugation at 14,000 x g, 4°C, for 1 S minutes. Then 5 ml of the
resulting supernatant,
i.e., the soluble fraction, were loaded onto a sucrose cushion of 1.85 M
sucrose in HKCTD
and centrifuged for 17 hours at 4°C, 50,0000 rpm in a Ti 50 rotor from
Beckman. The pellet
which contains the RNP particles was washed with 1 ml water and then dissolved
in 25 ~1 10
mM Tris, pH 8. 0, 1 mM DTT on ice. Insoluble material was removed by
centrifugation at
15, 000 x g, 4°C, for 5 minutes. The result is a preparation of
partially-purified RNP particles
that comprise the excised Ll.ltrB intron RNA and the LtrA protein
The yield of RNP particles was 25 to 50 O.D.,bo units ( ~ 16 ~g protein) per
100 ml
culture, with 1 O.D.ZGO units of RNPs containing 0.3 to 3 pg LtrA protein. To
minimize
nuclease activity, the partially-purified RNPs were further purified by an
additional
centrifugation through a 1.85 M sucrose cushion, as described above.
Example 2
RNP particles having nucleotide integrase activity and comprising the LtrA
protein
and the excised Ll.ltrB intron RNA were prepared as described in example 1
except the
plasmid pETLtrAl9 was used to transform cells of the BL21(DE3) strain of E.
coli. The
transformed cells were fractionated into a soluble fraction and an insoluble
fraction as
described in Example 1 to provide a preparation of RNP particles having
nucleotide integrase
activity
Example 3
RNP particles having nucleotide integrase activity and comprising the LtrA
protein
and the excised Ll.ltrB intron RNA were prepared by transforming cells of the
E. coli strains
BLR(DE3) with gETLtrAl9 as described in Example I except that the transformed
E. coli
were grown in SOB medium and shaken at 300 rpm during the 3 hour incubation.
The
transformed cells were fractionated into a soluble fraction and an insoluble
fraction as
described in Example 1 to provide a preparation of RNP particles having
nucleotide integrase
activity
Example 4
RNP particles having nucleotide integrase and comprising the LtrA protein and
the
excised Ll.ltrB intron RNA were prepared as described _above in sample 1
except that the
plasmid pETLtrAl9 was used to transform cells of the E. coli strain BL21(DE3).
The cells
13
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
were also transformed with plasmid pOM62 which is based on the plasmid
pACYC184 and
has an approximately 150 by insert of the argU(dnaY) gene at the EcoRI site.
The argU gene
encodes the tRNA for the rare arginine codons AGA and AGG. The LtrA gene
contains 17
of the rare arginine codons. The transformed cells were grown in SOB medium
and
fractionated into a soluble fraction and an insoluble fraction as described in
Example 1 to
provide a preparation of RNP particles having nucleotide integrase activity.
Example 5
RNP particles having nucleotide integrase and comprising the excised LLItrB
intron
RNA and the LtrA protein were prepared by transforming host cells as described
above in
Example 1 except that the LtrA ORF was tagged at the C-terminus with a Hisb
affinity tag
and an epitope derived from the Herpes simplex virus glycoprotein D. The tag
is used to
facilitate isolation of the RNP particles. The plasmid adding the tags was
made in two steps
by using PCR. In the first step, a fragment containing exon 1 and the LtrA ORF
was
1 ~ amplified using primers LtrAexl.Xba having the sequence 5'
TCACCTCATCTAGACATTTTCTCC 3', SEQ. ID. NO. 5 which introduces an Xba I site in
exon 1 of LtrB, and LtrAexpr3 5'CGTTCGTAAAGCTAGCCTTGTGTTTATG 3', SEQ. ID.
NO. 6, which substitutes a CGA (arginine) codon for the stop codon and
introduces an Nhe I
site at the 3' end of the LtrA ORF. The PCR product was cut with XbaI and Nhe
I, and the
restriction fragments gel purified and cloned into pET-27b(+), cut with Xba I
and Nhe I
obtained from Novagen, Madison, WI. The resulting plasmid pIntermediate-C
fuses the 3'
end of the LtrA ORF to an HSV tag and Hisb purification tag, both of which are
present on
the vector pET-27b(+). In a second step, intron sequences 3' to the ORF and
exon 2 are
amplified using pLEl2 as a template and the 5' primer LtrAConZnl, having the
sequence
5'CACAAGTGATCATTTACGAACG 3', SEQ. ID. No. 7 and the 3' primer LtrAex2, which
has the sequence 5'TTGGGATCCTCATAAGCTTT GCCGC 3', SEQ. ID. NO. 8. The PCR
product is cut with BcII and BamHI, the resulting fragment filled in, gel
purified and cloned
into pIntermediate-C, which has been cleaved with Bpu1102I and filled in. The
resulting
plasmid is designated pC-hisLtrAl9.
Cells of the BLR(DE3) strain of E. coli were transformed as described in
example 1
with pIntermediate-C and cultured at 37°C for 3 hours in SOB medium as
described in
example 3. The cells were also fractionated into a soluble fraction, which
contains RNP
14
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98110687
particles having nucleotide integrase activity, and an insoluble fraction as
described in
example 1. The RNP particles were further purified as described in example 1.
EXAMPLE 6
RNP particles having nucleotide integrase activity and comprising an excised
Ll.ltrB
intron RNA and the LtrA protein were prepared by transforming host cells as
described above
in example 1 except that the LtrA ORF was tagged at the N-terminus with a Hisb
affinity tag
and the epitope tag XPRESSTM which was obtained from Invitrogen, San Diego,
CA. The tag
is used to facilitate isolation of the RNP particles. The plasmid adding the
tags was made in
two steps by using PCR. In the first step, a fragment was made in two steps by
using PCR
mutagenesis. In the first step, the LtrA ORF and 3' exon were amplified and
BamHl sites
were appended to both the 5' an 3' end of the LtrA ORF using pLEl2 as a
substrate and the
following pair: 5' primer N-LtrA 5', having the sequence
5'CAAAGGATCCGATGAAACCA ACAATGGCAA 3', SEQ. ID. NO. 9; and the 3' primer
LtrAex2, SEQ. ID. NO. 8. The PCR product was cut with BamHl and the resulting
restriction fragment was gel purified and cloned inta the BamHl site of
plasmid pRSETB
obtained from Invitrogen, San Diego, CA. The resulting plasmid pIntermediate-N
fuses the
N terminus of the LtrA ORF to a Hisb purification tag, and adds an XPRESSTM
epitope tag
from the vector. In a second step, the 5' exon and LLItrB intron sequences 5'
to the ORF
were amplified using pLEl2 as a substrate and the 5' primer NdeLTRS, having
the sequence
5'AGTGGCTTCCATATGCTTGGTCATCACCTCATC 3', SEQ. ID. No. 10 and 3' primer
NdeLTR3', which has the sequence 5'
GGTAGAACCATATGAAATTCCTCCTCCCTAATCAATTTT 3', SEQ. ID. NO. I 1. The
PCR product was cut with Nde I, the fragment gel purified and cloned into
plntermediate-N,
which had also been cut with Nde I. Plasmids were screened for the orientation
of the insert,
and those oriented such that the 5' exon was proximal to the T7 promoter were
used to
transform the host cells. The resulting plasmid pFinal-N expresses a message
under the
control of the T7 polymerase promoter which comprises the El and E2 portions
of the exons 1
LtrBEI and LtrBE2, and the LtrA ORF fused at the 5'end with an Hisb
purification tag and the
XPRESST"'' epitope tag.
Cells of the BLR(DE3) strain of E. coli were transformed as described in
example 1
with plntermediate-N and cultured at 37°C f or 3 hours in SOB medium as
described in
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
example 3. The cells were also fractionated into a soluble fraction, which
contains RNP
particles having nucleotide integrase activity, and an insoluble fraction as
described in
example 1. The RNP particles were further purified as described in example 1.
EXAMPLE 7
RNP particles having nucleotide integrase activity and comprising an excised
Ll.ltrB
intron RNA and the LtrA protein were prepared as described by transforming
host cells as
described above in example 1 except that the LtrA ORF was tagged at the C-
terminus with
an intein from Saccharomyces cerevisiae VMA 1 gene and the chitin binding
domain (CBD)
from Bacillus circulan.r . The tag was used to facilitate purification of the
RNP particles and
was added using components of the Impact="" purification system obtained from
New
England Biolabs, Beverly, MA. A plasmid adding the tags was made in two steps
by using
PCR. In the first step, the LtrA ORF was amplified by PCR using pETLtrA 19 as
template
and using 5' primer LtrAexpr, 5'-AAACCTCCATATGAAACCAACAATG-3', SEQ. ID.
NO. and 3' primer ltrimpact: 5'TAACTTCCCGGGCTTGTGTTTATGAATCAC-3',
SEQ. ID. NO. which deletes the termination codon and introduces a SmaI site.
The
PCR product was cut with NdeI and SmaI and cloned into pCYB2, obtained from
New
England Biolabs, Beverly, MA, and cleaved with the same enzymes. Colonies were
screened
for inserts and two independent colonies with the desired insert were retained
to yield
pLI 1 PInt21 and pLI 1 PInt22. In a second step, pLI 1 PInt21 was cleaved with
PstI, the
overhangs repaired with T4 DNA polymerase in the presence of 0.2 mM dNTPs. The
DNA
was then phenol extracted, ethanol precipitated and then partially digested
with Pml I. The
approximately 1580 by PmII- Pst I fragment was cloned into pETLtrAl9 digested
with Pml I.
The clones with correct insert were screened and one oriented such that the
intein is fused to
the C terminus of the LtrA ORF was called pLI llnt. The resulting construct
expresses the
Ll.ltrB intron and fuses the LtrA ORF with the sequences that encode VMAI
intein and CBD.
Cells of the BLR(DE3) strain of E. coli were transformed as described in
example 1
with pLlInt. The transformants were restreaked on ampicillin selective plates
and single
colonies were inoculated inta 50 mL of LB medium and grown overnight at
37° C. This
culture was used to inoculate 0.5 liters of SOB in 4 liter flasks at a 1:100
dilution. The
cultures were grown to an OD5~5 0.7-1.0 and induced with 1mM IPTG at room
temperature
for 4 hours. The cultures were harvested, washed with 150 mM NaC 1 10mM Tris-
HCl (pH
16
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
7.5), and repelleted and stored in 50 ml of Buffer I (20 mM Tris-HC 1 (pH8.0),
0.5 M NaC 1,
0.1 mM EDTA, 0.1 % NP-40). The cells were broken by sonicating for I minute 3
times in a
Bronson sonicator at setting 7. The lysate was cleared by centrifugation at
12,000 x g for 30
minutes. The cleared lysate was loaded on a chitin affinity column
equilibrated with Buffer I.
The RNP particles comprising a tagged protein are retained on the column. Then
15 ml of
elution buffer (Buffer I+30 mM DTT) was passed through the column, the column
flow was
stopped, and the column incubated overnight at 4° C to allow self
cleavage of the intein tag
and release of the purified RNP particles from the chitin. Flow was restarted
and the RNP
particles comprising an excised LLItrB intron RNA and the LtrA protein were
collected.
EXAMPLE 8
RNP particles having nucleotide integrase activity and comprising the LtrA
protein
and an excised LLItrB intron RNA having an altered EBS1 sequence were prepared
as
described above in example 1 except that the cells were transformed and the
RNP particles
were made using pLI 1-EB S 1 /-6C. The pLI 1-EBS 1 /-6C construct which has a
single
nucleotide change G to C at position 6 in the EBS 1 (G3137C as based on Mills
et al, 1996)
sequence of the wild-type intron and a complementary change in the 5' exon at
position -6
relative to the 5' splice site to permit splicing was constructed via two PCR
steps. In the first
step pETLtrAl9 was subjected to PCR with primers OP2, 5'-
GGATCGAGATCTCGATCCCG, SEQ. ID. NO. and IP11: 5'CGCACGT
TATCGATGTGTTCAC, SEQ. ID. NO. to introduce the single nucleotide change in the
exon, and with primers IP4, S'-TTATGGTTGTCGACTTATCTGTTATC, SEQ.ID.NO.-
and OPI, OP1: 5'-CTTCGAATACCGGTTCATAG, SEQ. ID. NO. to introduce the
single nucleotide change in EBS 1. The single nucleotide change in the IP4
primer introduces
a SaII site in the EBS 1 sequence, which was subsequently used to identify the
desired clones.
The second PCR step was performed using the above two PCR products as Primers
and
pETLtrAl9 DNA linearized with BgIII and BamHI as the template. The second PCR
product
was reamplified with flanking primers OP2 and OP 1 using Pfu polymerase from
Stratagene
and digested with BgIII and BsrGI to yield a 554-by fragment that was cloned
between the
BsrGI and BgIII sites of pETLtrAl9. The desired clones were identified by
digestion with
HindIII and SalI, and the region that had been generated by PCR was sequenced
completely
to insure that no adventitious mutations had been introduced.
EXAMPLE 9
17
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
A partially-purified preparation of the LtrA protein, which is encoded by the
ORF of
the Ll.ItrB intron, using plasmid pETLtrA 1-1 was prepared. Plasmid pETLtrA 1-
1 is ~
derivative of pETLtrAl9 and lacks exon 1 and the intron sequences upstream of
the LtrA
ORF. Accordingly, the LtrA ORF is directly downstream of the phage T7 promoter
following the Shine-Dalgarno sequence in the plasmid. The plasmid map of
pETLtrAI-1 is
shown in Figure 5.
pETLtrAI-1 was made by using the polymerase chain reaction to amplify the LtrA
ORF using the 5' primer LtrAexpr . SEQ.ID. , which introduces an NdeI site and
3'
primer LtrAex2, SEQ. ID. NO. 8. The PCR product was cut with NdeI and BamHI,
gel
purified on a 1%. agarose gel, and cloned into pET-l la. The inserts of pLEl2,
pETLtrAl9
and pETLtrA 1-1, each of which contain the LtrA ORF are depicted in Figure 6.
pETLtrAI-1 was introduced into cells of the E. coli strain BLR(DE3) as
described in
Example 1 and the transformed cells grown for 3 hours in SOB medium at
37°C as described
in Example 3. Thereafter, the cells were lysed and the resulting lysate
fractionated into a
soluble fraction and insoluble fraction by low speed centrifugation as
described in Example 1
to provide fractions containing a partially-purified preparation of LtrA
protein.
Preparing Nucleotide Integrases using in vitro-synthesized intron RNA
EXAMPLE 10
RNP particles having nucleotide integrase activity and comprising an excised,
Ll.ltrB
intron RNA which lacks the ORF and an LtrA protein was prepared by mixing an
in vitro-
synthesized intron RNA with an LtrA protein preparation that was made by
digesting the
RNP particles prepared as described above in example 1 with micrococcal
nuclease (MN).
Specifically, 1.0 O.DZbo of the RNP particle preparation were resuspended in
40 pl of 10 mM
Tris, HCI, pH 7.5, 10 mM MgClz, 2.5 mM CaCI,, 5 mM DTT and incubated with 12
or 36
units of MN from Pharmacia for 10 minutes at 22° C , after which the MN
was inactivated by
addition of EGTA to 7.5 mM.
The group II intron RNA was generated by in vitro transcription of pLI2-DORF.
pLI2-DORF, which has a large deletion in the intron ORF, was derived from pLI2
by inverse
PCR with primers ~ORFa: 5'-
GGGGGGGCTAGCACGCGTCGCCACGTAATAAATATCTG GACG, SEQ. ID.
NO. and DORFb: 5'-GGGGGGGCTAGCACGCGTTGGGAAATG GCAATG ATAGC,
SEQ.ID.NO. , each containing an MIuI site. The PCR product was digested with
MIuI and
18
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
self ligated to generate pLI2-tlORF, thereby replacing amino acids 40 to 572
of the LtrA
ORF with threonine and arginine. The plasmid was linearized with BamHI and
transcribe
with phage T3 RNA polymerase, and the in vitro-synthesized RNA (30 to SO~g)
was spliced
for 60 min at 42°C in 100 pl of 1 M NH4C1, 100 mM MgClz, and 50 mM Tris-
HC 1 (pH 7.5).
S Prior to reconstitution, the RNA was heated to 85 to 90°C for 2
minutes, then stored on ice.
0.05 O.D.zbo units of the MN-treated RNP particles was added to 20 pl of
reaction
medium containing 50 mM Tris-HCl (pH7.5), 10 mM MgCl2, 10 mM KCI, 5 mM DTT,
and 1
p.g of the spliced RNA to provide RNP particles having nucleotide integrase
activity and
comprising a modified, excised, Ll.ltrB intron RNA and an LtrA protein.
EXAMPLE 11.
RNP particles having nucleotide integrase and comprising the LtrA protein and
an
excised Ll.ItrB intron RNA having a kanamycin resistance gene inserted in
domain IV in
place of the LtrA ORF were prepared as described above in example 10 except
that the RNA
component was made using pLI2-~ORFkanR. pLI2-DORFkanR, which replaces amino
acids
39-573 of the LtrA ORF with a kanR gene, was constructed by cloning the 1,252-
by SaII
fragment containing the kanR gene from pUK4K (Pharmacia, Piscataway, NJ) into
the MIuI
site of pLl2-ORF by blunt-end ligation after filling in both the SaII and MluI
sites with
Klenow polymerise (Life Technologies, Gaithersburg, MD)
Comparative Example A
RNP particles lacking nucleotide integrase activity were prepared as described
in
Example 1 from cells of the BLR(DE3) strain of E. coli that had been
transformed with
plasmid pETI la, which lacks a group II intron. Accordingly, is these RNP
particles do not
comprise excised, group II RNA or group II intron-encoded proteins and
therefore, do not
have nucleotide integrase activity.
Comparative Example B.
RNP particles lacking nucleotide integrase activity were prepared as described
in
Example 1 from cells of the BLR(DE3) strain of E. coli that had been
transformed with
plasmid pETLtrAI9FS, which comprises the sequence of an LtrA ORF having a
frame shift
372 base pairs downstream from the initiation colon of the LtrA ORF. frame.
Accordingly,
the RNP particles contain a truncated LtrA protein, i.e_ an LtrA protein
lacking the Zn
domain and, therefore, do not have nucleotide integrase activity.
19
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
Characterization of the RNP~articles of Examples 1 and 2.
A portion of the RNP particle preparation of examples 1 and 2 and comparative
examples A and B were subjected to SDS polyacrylamide gel electrophoresis.
Staining of the
resulting gel with Coomassie Blue permitted visualization of the proteins in
each of the
fractions. A band of approximately 70 kDa, which corresponds to the predicted
molecular
weight of the LtrA protein was seen in the lanes containing aliquots of the
RNP particles of
Examples 1 and 2. This band was absent from the lanes containing the RNP
particles
prepared from comparative examples A and B. On the basis of the staining
intensity of the 70
kDa band, the quantity of LtrA protein in 10 ODzGO units of RNP particles was
estimated to be
approximately 3 pg. Thus, RNP particles containing the group II intron-encoded
protein
LtrA can be prepared by expression of the group II intron Ll.ltrB in a
heterologous host cell.
The reverse transcriptase activities of the RNP particles of examples l and 2
and the
RNP particles of comparative examples A and B were assayed by incubating each
of the RNP
particle preparations with a poly(rA) template and oligo (dT,g) as a primer.
The RNP particles
of examples 1 and 2 exhibited reverse transcriptase activity, while the RNP
particles of
comparative examples A and B exhibited no reverse transcriptase activity.
Thus, the methods
described in examples 1 and 2 are useful for preparing RNP particles that have
reverse
transcriptase activity. The reverse transcriptase activity that is present in
nucleotide
integrases allows incorporation of a cDNA molecule into the cleavage site of
the double
stranded DNA which is cut by the nucleotide integrase.
Characterizing the Distribution and Yield of the LtrA Protein
A portion of the insoluble fraction and soluble fraction of the lysates from
the cells
transformed and cultured according to the methods described in examples l, 2,
3, 4 and 9
were subjected to SDS polyacrylamide gel electrophoresis. Following
electrophoresis, the
SDS gels were stained with Coomassie blue to compare the yield of the LtrA
protein and the
distribution of the 70 kDa LtrA protein prepared by the methods of examples 1,
2, 3, 4 and 9.
As shown on the gel, more of the LtrA protein was found in the soluble
fraction when the
transformed BLR (DE3) cells were grown in SOB medium and shaken at 300 rpm
than when
the transformed BLR cells were grown in LB medium and shaken at 200 rpm. In
addition,
the total amount of LtrA protein produced by the transformed BLR cells, that
is the amount of
LtrA in both the soluble and insoluble fractions, increased when, as described
in example 4, a
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
plasmid comprising the Ll.ltrB intron and a plasmid comprising argU(dna~ gene
were both
introduced into the host cells, the LtrA protein which was expressed in cells
transformed with
a plasmid which lacks the 5' segment of the Ll.ltrB.intron, as described in
example 9, was
significantly more insoluble than the LtrA protein which was expressed in
cells transformed
with a plasmid that contained the 5'segment of the intron as well as the
LtrAORF.
Characterization of the Group II Intron-Encoded Protein Prepared According to
the Methods
of Examples 5-and 6.
A portion of the insoluble fraction and soluble fractions of the lysates from
the cells
transformed and cultured according to the methods described in examples 5 and
6 and in
comparative examples A and B were subjected to electrophoresis on duplicate
SDS-
polyacrylarnide gels. One of the gels was stained with Coomassie blue and the
proteins on
the duplicate were transferred to nitrocellulose paper by Western blotting. A
primary
antibody to the HSV antigen and an alkaline phosphatase-labeled anti-mouse IgG
secondary
antibody were used in an enzyme-linked immunoassay to identify proteins
carrying the HSV
epitope or the XpressTM tag. The anti-HSV antibody and the anti-XpressT"' tag
antibody
bound to a protein having a molecular weight of approximately 70 kDa, which is
close to the
calculated molecular weight of the LtrA protein. The HSV tagged LtrA protein
and the
XpressTM tagged LtrA protein were found in the soluble and insoluble fractions
from cells
transformed with pIntermediateC and pIntermediateN but not in the soluble
fractions and
insoluble fractions of cells transformed with pET27b(+) and pRSETB. Thus, the
methods of
examples 5 and 6 are useful for preparing an RNP particle comprising a tagged
group II
intron encoded protein. These assays also demonstrated that the amount of the
tagged group
II intron-encoded protein present in the soluble fraction, from which the RNP
particles are
derived, increases when the transformed and induced cells are incubated at
22°C as compared
to 37°C. In cells grown at 22°C, the yield of the tagged protein
was 0.4 to 2 mg per 1 culture,
which is 2 to 5% of the total protein, with about 30% being soluble and 40 to
90% of the
soluble protein being recovered in RNP particles (0.3 to 3 ~g LtrA
protein/O.D.26°). In cells
grown at 37°C, a high proportion of the protein was insoluble. However,
a significant
amount of the tagged LtrA protein that was found in the soluble fraction was
present in RNP
particles.
21
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98154353 PCT/US98/10687
Characterization of the Purity and Yield of the Protein in the RNP Particles
Prepared
According to the Method of Example 7
A portion of the RNP particle preparation of example 7 and comparative
examples A
and B were subjected to SDS polyacrylamide gel electrophoresis, which was
subsequently
stained with Coomassie Blue. A band of approximately 70 kDa, which corresponds
to the
predicted molecular weight of the LtrA protein was seen in the lanes
containing aliquots of
the RNP particles of Example 7 and was absent from the lanes containing the
RNP particles
prepared from comparative examples A and B. On the basis of the Bradford
protein assays of
the column eluant, the quantity of LtrA protein in RNP particles in the eluant
from the chitin
column was estimated to be approximately 0.5 mg/liter of start culture. The
LtrA protein in
these RNP particles was approximately 95% pure. Accordingly, the method of
claim 7 is
highly preferred for making large amounts of highly purified RNP particles
having nucleotide
integrase activity.
Using the RNP Particles to Cleave Double-Stranded DNA and to Insert Nucleotide
Sequences
into the Cleavage Site.
Nucleotide integrases are useful for cleaving RNA substrate, single-stranded
DNA
substrates and one or both strands of a double-stranded DNA substrate,
catalyzing the
attachment of the excised, group II intron RNA molecule to the RNA substrate,
the single-
stranded DNA substrate, and to the first strand, i.e. the strand that contains
the IBSl and IBS2
sequence, of the double-stranded DNA substrate. Nucleotide integrases also
catalyze the
formation of a cDNA molecule on the second strand, i.e. the strand that is
complementary to
the first strand, of a cleaved double-stranded DNA substrate. Thus, the
nucleotide integrases
are useful analytical tools for determining the location of a defined sequence
in a double-
stranded DNA substrate. Moreover, the simultaneous insertion of the nucleic
acid molecule
into the first strand of DNA permits tagging of the cleavage site of the first
strand with a
radiolabeled molecule. In addition, the automatic attachment of an RNA
molecule onto one
strand of the DNA substrate permits identification of the cleavage site
through hybridization
studies that use a probe that is complementary to the attached RNA molecule.
An attached
RNA molecule that is tagged with a molecule such as biotin also enables the
cleaved DNA to
be affinity purified. Moreover, the cleavage of RNA molecules, single stranded
DNA
molecules, and one or both strands of a double stranded DNA molecule and the
concomitant
22
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
insertion of a nucleotide sequence into the cleavage site permits
incorporation of new genetic
information or a genetic marker into the cleavage site, as well as disruption
of the clea~sl
gene. Thus, the nucleotide integrases are also useful for rendering the
substrate DNA
nonfunctional or for changing the characteristics of the RNA and protein
encoded by the
substrate DNA.
While RNP particles having nucleotide integrase activity can be used to cleave
nucleic
acid substrates at a wide range of temperatures, good results are obtained at
a reaction
temperature from about 30°C to about 42°C, preferably from about
30° to about 37°C. A
suitable reaction medium contains a monovalent cation such as Na+ or K+, and a
divalent
canon, preferably a magnesium or manganese ion, more preferably a magnesium
ion, at a
concentration that is less than 100 mM and greater than I mM. Preferably the
divalent canon
is at a concentration of about 5 to about 20 mM. The preferred pH for the
medium is from
about 6.0-8.5, more preferably about 7.5-8Ø
Because of its reverse transcriptase activity, the LtrA protein, either in the
form of an
RNP particle which comprises the LtrA protein or as a free protein, i.e., a
protein which is not
bound to a group II intron RNA, is also useful for transcribing RNA molecules.
Cleavage of Double Stranded DNA Substrates
A. Cleaving a Double-Stranded DNA Substrate with the RNP Particles of Example
1
0.025 O.D 26° of the RNP particles of Example 1 and comparative
examples A and B
were incubated for 20 minutes with 150,000 cpm of each of a 5' and 3' end-
labeled double-
stranded DNA substrate that comprises the wild-type exon 1 and the wild-type
exon 2
junction of the Itt~B gene. The sequence of the 129 base pair substrate, which
comprises the
70 base pair exon 1 and exon 2 junction of the ItrB gene, plus sequences of
the plasmid is
depicted in Figure 7A and SEQ. ID. NO. 4. To verify cleavage, the products
were isolated on
a 6% polyacrylamide gel.
The substrate which is cleaved by the nucleotide integrase, which comprises
the
excised LLItrB intron RNA and the LtrA protein, is schematically depicted in
Figure 8(a). In
addition, the IBS 1 and IBS2 sequence of the substrate is shown in figure
8(b). As shown in
Figure 8, the IBS1 and IBS2 sequences which are complementary to the EBS
sequences of
the Lltr.B intron RNA are present in exon 1 of the ltrB gene. As depicted in
Figure 8, the
RNP particles prepared according to the method of example 1 cleaved the sense
strand of the
substrate at position 0, which is the exon 1 and exon 2 junction, and cleaved
the antisense
23
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98J54353 PCT/US98/10687
strand at +9. When the RNP particles prepared according to the method of
example 1 were
treated with either RNase A/T1 to degrade the RNA in the particles, or with
proteinase K~o
degrade the protein component of the particles prior to incubation of the
particles with the
substrate, no cleavage of the substrate was observed. These results indicate
that both the
RNA component and the protein component of the nucleotide integrase are needed
to cleave
both strands of the substrate DNA.
0.025 O.D.,~o units of the RNP particle preparation of example 1 were reacted
with
125 fmoles ( 150,000 cpm) of the 129 base pair internally-labeled DNA
substrate for 20
minutes. To verify cleavage, the products were glyoxalated and analyzed in a
1% agarose gel.
A dark band of radiolabel of approximately 1.0 kb RNA and lighter bands of
approximately 0.8, 1.1, 1.4, 1.5, 1.G, 1.9, 2.5, 3.2 were observed on the gel.
Pretreatment of
the reaction products with RNase prior to separation on the agarose gel
resulted in the
complete disappearance of these bands. These results indicate that the Ll.ltrB
intron RNA
was attached to the DNA substrate during reaction of the substrate with the
RNP particles of
example 1. On the basis of the size of Ll.trB intron, it is believed that the
band at 2.5 kb
represents the integration of the full length group II intron RNA into the
cleavage site of the
sense strand. The presence of smaller radiolabeled products on the gel is
believed to be due
to degradation of the integrated intron RNA by RNases which may be present
during
purification. The finding that the RNA-DNA products withstand denaturation
with glyoxal
indicates a covalent linkage between the intron RNA and the DNA substrate.
B. Cleaving Double-Stranded DNA Substrates using Nucleotide Inte~rases
Prepared by the
Methods of Examples 8. 10. and 11.
0.025 ~O.D.zbo units of the RNP particle preparation of examples 10 and 11
were
reacted with 125 fmoles ( 150,000 cpm) of the 129 base pair internally-labeled
DNA substrate
for 20 minutes. To verify cleavage, the products were glyoxalated and analyzed
in a 1%
agarose gel. To verify that the RNA component of the nucleotide integrase had
been partially
or fully integrated into the cleavage site, sequences of the exon 1 DNA-intron
RNA and exon
2 DNA junctions were analyzed by RT-PCR. The RNP particles prepared as
described in
examples 10 and 11 were able to efficiently cleave the double-stranded DNA
substrate and to
either partially or fully integrate the intron RNA subunit of the nucleotide
integrase into the
cleavage site. Thus, RNP particles that comprise LtrA protein and an Ll.ltrB
intron RNA
which lacks an ORF sequence have complete nucleotide integrase activity.
Similarly RNP
24
SUBSTITUTE SHEET (RULE 26)
CA 02291512 1999-11-24
WO 98/54353 PCT/US98/10687
particles that comprise an LtrA protein and an LItrB intron RNA in which the
ORF has been
replaced with a sequence encoding a different gene product also have complete
nucleotide
integrase activity
0.025 O.D.zGO units of the RNP particle preparations of example 8 were reacted
with
S I 25 fmoles ( 150,000 cpm) of the I 29 base pair internally-labeled double-
stranded DNA
substrate which comprises the sequence depicted in Figure 7A for 20 minutes.
In addition,
0.025 O.D.zeo units of the RNP particle preparations of example 8 were reacted
with 125
fmoles (150,000 cpm) of a 129 base pair internally-labeled double-stranded DNA
substrate
which comprises a modified exon 1 and wild-type exon 2 of the LLItrB gene for
20 minutes.
The sequence of the first strand of the 129 base pair substrate, in which the
nucleotide at
position -6 relative to the putative cleavage site in the wild-type exon 1 is
changed from a C
to a G is underlined in Figure 7B. The putative cleavage sites in the first
~tranc~ r,f rhP
substrates shown in Figure 7A and 7B are depicted by a vertical line. To
verify cleavage, the
products were glyoxalated and analyzed in a 1% agarose gel. Endonuclease
assays were also
I S conducted to confirm that cleavage occurred between nucleotides -1 an +1
in the first strand
of the substrate and at position +9 in the second strand of the substrate, and
also to confirm
that a nucleic acid molecule had been inserted into the cleavage site. The RNP
particles
prepared as described in example 8 were able to efficiently cleave the double-
stranded DNA
substrate shown in Figure 7b and to either partially or fully integrate the
intron RNA subunit
of the RNP particles into the cleavage site. The EBS I sequence of the
modified Ll.ItrB intron
in the RNP particles prepared as described in example 8 is complementary to
the IBSl
sequence of the substrate shown in Figure 7b. The RNP particles prepared as
described in
example 8, however, were not able to efficiently cleave the substrate depicted
in Figure 7a.
The EBS 1 sequence of the modified Ll.ItrB intron in the RNP particles
prepared as described
2S in example 8 is not complementary to the IBS 1 sequence of the substrate
shown in Figure 7a.
These results indicate that changing the EBS 1 sequence of a group II intron
RNA alters the
target site specificity of the nucleotide integrase that comprises the
modified group II intron
RNA.
2S
SUBSTITUTE SHEET (RULE 26j
