Note: Descriptions are shown in the official language in which they were submitted.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
Heregulin-like Factor
Field of the Invention
The present invention relates to a novel human gene encoding a
_ polypeptide which is a novel member of the heregulin family. More
s specifically, isolated nucleic acid molecules are provided encoding a human
polypeptide named heregulin-like factor, hereinafter referred to as "HLF". HLF
polypeptides are also provided, as are vectors, host cells and recombinant
methods for producing the same. Also provided are diagnostic methods for
detecting disorders related to primary cancers, and therapeutic methods for
to treating such disorders. The invention further relates to screening methods
for
identifying agonists and antagonists of HLF activity.
Background of the Invention
The proto-oncogene termed erbB2 (or HER2) encodes a 185 kDa
. transmembrane tyrosine kinase molecule designated p185erbB2. The
~ 5 overexpression of this receptor molecule correlates strongly with a poor
prognosis in a number of human cancers including, among others, breast,
ovarian, endometrium, fallopian tube, cervix, and colon (Nowak, F., et al.,
E.xp. Cell Res. 231:251-259; 1997; Cirisano, F. D. and Karlan, B. Y., J. Soc.
Gynecol. Investig. 3(3):99-105; 1996). Variously spliced transcripts of the
2o heregulin (HRG) gene have been found to indirectly stimulate p 185erbB2
through transphosphorylation or receptor heterodimerization with erbB3 and
p 180erbB4. A 45 kDa protein, designated HRG-a, specifically induces tyrosine
phosphorylation of p185erbB2 and has been purified from the conditioned
medium of a human breast tumor cell line {Holmes, W. E., et al., Science
2s 256:1205-1210; 1992). A second, related HRG molecule of 52 kDa, which
may be the product of a novel gene. rather than a novel HRG gene splice
product, has been identified which exhibits similar characteristics including
induction of transient membrane ruffling, lamellipodia formation, cell
motility
and proliferation of human breast cancer cells (Kung, W., et al., Biochem.
30 Biophys. Res. Common. 202(3):1357-1365; 1994). In addition, more recent
studies have reported that heregulins can induce tyrosine phosphorylation not
only of p 185erbB2, but of several additional EGFR-related family members
including erbB3 and p 180erbB4 (Tzahar, E., et al., J. Biol. Chem.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
269:25226-25223: 1994; Plowman, G. D., et al., Nature 366:473-475;
1993).
Lewis and colleagues (CancerRes. 56:1457-1465; 1996) recently
performed an extensive analysis of the effects of the heregulin family of
proteins
on a panel of breast and ovarian tumor cell lines. The biological responses to
HRG were also compared to EGF and to the growth-inhibitory anti-ErbB2
antibody 4D5. In nearly all cases, HRG stimulation of DNA synthesis
correlated with positive effects on cell cycle progression and cell number and
with enhancement of colony formation in soft agar. In addition to the effects
of
to the heregulin family of proteins on breast and ovarian cells, similar
effects have
also been recently observed on human Schwann cells (Levi, A. D., et al., J.
Nec~rosci. 15(2):1329-1340; 1995; Morrissey, T. K., et al., Proc. Natl. Acad.
Sci. USA 92(5):1431-1435; 1995) suggesting that the heregulin family of
proteins play a key role in the genesis of a number of cancers.
The heregulin family of proteins consists at least of a number of splice
variants of heregulin, the Neu differentiating factor, the glial growth
factors-I,
-II, and -III, and a protein that stimulates muscle acetylcholine receptor
synthsis
(ARIA). In addition to the obvious role such polypeptides may play in
oncogenic events, these proteins have also been exploited as Pseudomonas
2o exotoxin A fusion proteins to inhibit the growth of several mammary
carcinoma
cell lines as well as to cause growth retardation of transplanted human breast
tumor cells in mice (Jeschke, M., et al., Int. J. Cancer 60(5):730-739;1995).
Thus, there is a need for polypeptides that function as regulators of
oncogenic events and existing tumors. Therefore, there is a need for
?5 identification and characterization of such human polypeptides which can
play a
role in detecting, preventing, ameliorating or correcting such disorders.
Summary of the Invention
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding at least a portion of the HLF polypeptide
3o having the complete amino acid sequence shown in SEQ ID N0:2 or the
complete amino acid sequence encoded by the cDNA clone deposited was
deposited as plasmid DNA with the American Type Culture Collection
("ATCC") on June 19, 1997, and assigned ATCC Deposit Number 209123.
The ATCC is located at 10801 University Boulevard, Mantissas, Virginia
20110-2209. The nucleotide sequence determined by sequencing the deposited
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
HLF clone, which is shown in Figures 1 A and 1 B (SEQ ID NO:1 ), contains an
open reading frame encoding a complete polypeptide of 157 amino acid
residues, beginning in frame with a serine residue at the amino-terminal end
of
the polypeptide corresponding to nucleotide positions 2-4, and a predicted
molecular weight of about 17.7 kDa. Nucleic acid molecules of the invention
include those encoding the complete amino acid sequence shown in SEQ ID
N0:2, or the complete amino acid sequence encoded by the cDNA clone in
ATCC Deposit Number 209123, which molecules also can encode additional
amino acids fused to the N-terminus of the HLF amino acid sequence.
l0 The HLF protein of the present invention shares sequence homology
with the translation product of the human mRNA for heregulin (Figure 2; SEQ
ID N0:3), including the following conserved domains: (a) the predicted
extracellular domain of about 101 amino acids; (b) the predicted transmembrane
domain of about 19 amino acids, and (c) the predicted intracellular domain of
~ 5 about 35 amino acids. Heregulin is thought to be important in oncogenesis.
The homology between heregulin and HLF indicates that HLF may also be
involved in oncogenesis.
Thus, one aspect of the invention provides an isolated nucleic acid
molecule comprising a polynucleotide comprising a nucleotide sequence selected
2o from the group consisting of: (a) a nucleotide sequence encoding the HLF
polypeptide having the complete amino acid sequence in SEQ ID N0:2 (i.e.,
positions 1 to 157 of SEQ ID N0:2) or the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 209123; (b) a
nucleotide sequence encoding the predicted extracellular domain of the HLF
25 polypeptide having the amino acid sequence in SEQ ID N0:2 (i.e., positions
1
to 101 of SEQ ID N0:2) or as encoded by the eDNA clone contained in ATCC
Deposit No. 209123; (c) a nucleotide sequence encoding the predicted
transmembrane domain of the HLF polypeptide having the amino acid sequence
in SEQ ID N0:2 (i.e., positions 102 to 121 of SEQ ID N0:2) or as encoded by
3o the cDNA clone contained in ATCC Deposit No. 209123; (d) a nucleotide
sequence encoding the predicted intracellular domain of the HLF polypeptide
having the amino acid sequence in SEQ ID N0:2 (i.e., positions 122 to 157 of
SEQ ID N0:2) or as encoded by the cDNA clone contained in ATCC Deposit
No. 209123; (e) a nucleotide sequence encoding a soluble HLF polypeptide
35 having the extracellular and intracellular domains but lacking the
transmembrane
domain; and (f) a nucleotide sequence complementary to any of the nucleotide
sequences in (a) through (e) above.
CA 02295317 1999-12-17
WO 98/57989 PCTNS98/12403
4
Further embodiments of the invention include isolated nucleic acid
molecules that comprise a polynucleotide having a nucleotide sequence at least
90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99%
identical to (or as stated in another way, a nucleotide sequence at most 10%
different, and more preferably 5%, 4%, 3%, 2°~0 or 1 % different from),
any of
the nucleotide sequences in (a) through (f) above, or a polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide in (a)
through (f) above. This polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having a
nucleotide
to sequence consisting of only A residues or of only T residues. An additional
nucleic acid embodiment of the invention relates to an isolated nucleic acid
molecule comprising a polynucleotide which encodes the amino acid sequence
of an epitope-bearing portion of a HLF polypeptide having an amino acid
sequence in (a) through (e) above.
15 The present invention also relates to recombinant vectors, which include
the isolated nucleic acid molecules of the present invention, and to host
cells
containing the recombinant vectors, as well as to methods of making such
vectors and host cells and for using them for production of HLF polypeptides
or
peptides by recombinant techniques.
The invention further provides an isolated HLF polypeptide comprising
an amino acid sequence selected from the group consisting of: (a) the amino
acid sequence of the HLF polypeptide having the complete amino acid sequence
shown in SEQ ID N0:2 (i.e., positions 1 to 157 of SEQ ID N0:2) or the
complete amino acid sequence encoded by the cDNA clone contained in the
25 ATCC Deposit No. 209123; (b) the amino acid sequence of the predicted
extracellular domain of the HLF polypeptide having the amino acid sequence
shown in SEQ ID N0:2 (i.e., positions 1 to 101 of SEQ ID N0:2) or as
encoded by the cDNA clone contained in the ATCC Deposit No. 209123; (c)
the amino acid sequence of the predicted transmembrane domain of the HLF
3o polypeptide having the amino acid sequence shown in SEQ ID N0:2 (i.e.,
positions 102 to 121 of SEQ ID N0:2) or as encoded by the cDNA clone
contained in the ATCC Deposit No. 209123; (d) the amino acid sequence of the
predicted intracellular domain of the HLF polypeptide having the amino acid
sequence shown in SEQ ID N0:2 (i.e., positions 122 to 157 of SEQ ID N0:2)
35 or as encoded by the eDNA clone contained in the ATCC Deposit No. 209123;
and (e) the amino acid sequence of a soluble HLF polypeptide having the
extracellular and intracellular domains but lacking the transmembrane domain.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
The polypeptides of the present invention also include polypeptides having an
amino acid sequence at least 80°lo identical (or at most 20%
different}, more
preferably at least 90% identical (or at most 10% different), and still more
preferably 95%, 96%, 97%, 98% or 99% identical to (or 5%, 4%, 3%, 2% or
1 % different from) those described in {a), (b), {c), (d), or (e) above, as
well as
polypeptides having an amino acid sequence with at least 90% similarity, and
more preferably at least 95°lo similarity, to those above.
An additional embodiment of this aspect of the invention relates to a
peptide or polypeptide which comprises the amino acid sequence of an
epitope-bearing portion of a HLF polypeptide having an amino acid sequence
described in (a), (b), (c), (d), or (e) above. Peptides or polypeptides having
the
amino acid sequence of an epitope-bearing portion of a HLF polypeptide of the
invention include portions of such polypeptides with at least six or seven,
preferably at least nine, and more preferably at least about 30 amino acids to
about 50 amino acids, although epitope-bearing polypeptides of any length up
to
and including the entire amino acid sequence of a polypeptide of the invention
described above also are included in the invention.
In another embodiment, the invention provides an isolated antibody that
binds specifically to a HLF polypeptide having an amino acid sequence
2o described in (a), (b), (c), (d), or (e) above. The invention further
provides
methods for isolating antibodies that bind specifically to a HLF polypeptide
having an amino acid sequence as described herein. Such antibodies are useful
diagnostically or therapeutically as described below.
The invention also provides for pharmaceutical compositions comprising
HLF polypeptides, particularly human HLF polypeptides, which may be
employed, for instance, to treat many types of cancer. Methods of treating
individuals in need of HLF polypeptides are also provided.
The invention further provides compositions comprising a HLF
polynucleotide or an HLF polypeptide for administration to cells in vitro, to
cells ex vivo and to cells in vivo, or to a multicellular organism. In certain
particularly preferred embodiments of this aspect of the invention, the
compositions comprise a HLF polynucleotide for expression of a HLF
polypeptide in a host organism for treatment of disease. Particularly
preferred
in this regard is expression in a human patient for treatment of a dysfunction
associated with aberrant endogenous activity of a HLF
The present invention also provides a screening method for identifying
compounds capable of enhancing or inhibiting a biological activity of the HLF
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
6
polypeptide, which involves contacting a receptor which is inhibited or
enhanced by the HLF polypeptide with the candidate compound in the presence
of an HLF poiypeptide, assaying changes in tyrosine phosphorylation states of
the receptor and/or other molecules downstream in the corresponding signal
transduction cascade in the presence of the candidate compound and of HLF
polypeptide, and comparing the receptor activation state to a standard level,
the
standard being assayed when contact is made between the receptor and in the
presence of the HLF polypeptide and the absence of the candidate compound In
this assay, an increase in receptor activation state over the standard
indicates that
1 o the candidate compound is an agonist of HLF activity and a decrease in
receptor
actmation state compared to the standard indicates that the compound is an
antagonist of HLF activity.
In another aspect, a screening assay for agonists and antagonists is
provided which involves determining the effect a candidate compound has on
HLF binding to a receptor. In particular, the method involves contacting the
receptor with an HLF polypeptide and a candidate compound and determining
whether HLF polypeptide binding to the receptor is increased or decreased due
to the presence of the candidate compound. In this assay, an increase in
binding
of HLF over the standard binding indicates that the candidate compound is an
2o agonist of HLF binding activity and a decrease in HLF binding compared to
the
standard indicates that the compound is an antagonist of HLF binding activity.
It has been discovered that HLF is expressed only in the amygdala,
whole brain, and primary breast culture tissue. Therefore, nucleic acids of
the
invention are useful as hybridization probes for differential identification
of the
tissues) or cell types) present in a biological sample. Similarly,
polypeptides
and antibodies directed to those polypeptides are useful to provide
immunological probes for differential identification of the tissues) or cell
type(s). In addition, for a number of disorders of the above tissues or cells,
particularly of the neural system, significantly higher or lower levels of HLF
gene expression may be detected in certain tissues (e.g., cancerous and
wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid
or
spinal fluid) taken from an individual having such a disorder, relative to a
"standard" HLF gene expression level, i.e., the HLF expression level in
healthy
tissue from an individual not having the neural system disorder. Thus, the
invention provides a diagnostic method useful during diagnosis of such a
disorder, which involves: (a) assaying HLF gene expression level in cells or
body fluid of an individual; (b) comparing the HLF gene expression level with
a
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
7
standard HLF gene expression level, whereby an increase or decrease in the
assayed HLF gene expression level compared to the standard expression level is
indicative of disorder in the neural system.
An additional aspect of the invention is related to a method for treating
s an individual in need of an increased level of HLF activity in the body
comprising administering to such an individual a composition comprising a
therapeutically effective amount of an isolated HLF polypeptide of the
invention
or an agonist thereof.
A still further aspect of the invention is related to a method for treating
an individual in need of a decreased level of HLF activity in the body
comprising, administering to such an individual a composition comprising a
therapeutically effective amount of an HLF antagonist. Preferred antagonists
for use in the present invention are HLF-specific antibodies.
Brief Description of the Figures
~ 5 Figures 1 A and 1 B shows the nucleotide sequence (SEQ ID NO:1 ) and
deduced amino acid sequence (SEQ ID N0:2) of HLF. An extracellular
epidermal growth factor (EGF) domain, conserved in many other EGF-like
polypeptides, is underlined in Figures 1 A and 1 B.
Figure 2 shows the regions of identity between the amino acid
2o sequences of the HLF protein and translation product of the human mRNA for
heregulin (SEQ ID N0:3), determined by the computer program Bestfit
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer Group, University Research Park, 575 Science Drive, Madison, WI
53711 ) using the default parameters.
25 Figure 3 shows an analysis of the HLF amino acid sequence. Alpha,
beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability are shown.
In
the "Antigenic Index - Jameson-Wolf' graph, the positive peaks indicate
locations of the highly antigenic regions of the HLF protein, i.e., regions
from
3o which epitope-bearing peptides of the invention can be obtained.
Figure 4 shows a demonstration of the biochemical activity of a
recombinant EGF domain of the HLF protein (designated "H" in the figure; as
described in Example 5). The figure shows a Western blot of MCF-7 cell
lysates prepared from cultures which were treated or mock-treated with
35 recombinant EGF domain of the HLF protein or with recombinant heregulin.
CA 02295317 1999-12-17
WO 98/57989 PCT/U598/12403
8
The blots were immunoblotted with an anti-phosphotyrosine monoclonal
antibody.
Figure 5 shows the amino acid sequences of the EGF/hercgulin family
of growth factors and of the NRG-3 novel sequences. Cysteines (C) defining
the basic structure of the EGF domain and highly conserved amino acids are in
bold. Listed are sequences for the EGF-like domains of transforming growth
factor (TGF)-a (SEQ ID NO:11); epidermal growth factor (EGF; SEQ ID
N0:12); heparin-binding EGF (HB-EGF; SEQ ID N0:13); amphiregulin
(Amph; SEQ ID N0:14); b-cellulin (b-Cell; SEQ ID N0:15); neuregulin (neuR;
SEQ ID N0:16); human heregulins 1-a (Hrgal; SEQ ID N0:17) and 1-b
(HRGb 1; SEQ ID N0:18); heregulin-related gene (HRG)-2 (SEQ ID N0:19);
and amino acids 29-80 of HLF of the present invention (amino acids 29-80 of
SEQ ID N0:2).
Detailed Description
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding a HLF polypeptide having the amino acid
sequence shown in SEQ ID N0:2, which was determined by sequencing a
cloned cDNA. The nucleotide sequence shown in Figures 1 A and 1 B (SEQ ID
NO:1 ) was obtained by sequencing the HAGFE38 clone, which was deposited
20 on June 19, 1997 at the American Type Culture Collection, 12301 Park Lawn
Drive, Rockville, Maryland 20852 (the ATCC is now located at 10801
University Blvd., Manassas, VA 201 10-2209), and given accession number
ATCC 209123. The deposited clone is contained in the pBluescript SK(-)
plasmid (Stratagene, La Jolla, CA).
25 The HLF protein of the present invention shares sequence homology
with the translation product of the human mRNA for heregulin (Figure 2; SEQ
ID N0:3). Heregulin is thought to be an important molecule in the activation
pathways of the erbB family of cell surface receptors. Altered expression of
heregulin and related ligand molecules, and/or the erbB family of receptor
3o molecules can often lead to the loss of regulation of cellular growth and
ultimately to oncogenesis. For example, the neu differentiation factor (NDF)
is
a homologue of both heregulin and HLF. NDF is a neuron/glia-specific
signaling molecule which has been observed to regulate survival,
proliferation,
and maturation of Schwann cell precursors (Dong, Z., et al., Neuron
35 15:585-596; 1995; Marchionni, M. A., et al., Nature 362:312-318; 1993).
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
9
HLF is a member of the same heregulin family of proteins and has, at least,
activities similar to those described above for heregulin and NDF.
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City,
CA), and all amino acid sequences of polypeptides encoded by DNA molecules
determined herein were predicted by translation of a DNA sequence determined
as above. Therefore, as is known in the art for any DNA sequence determined
t o by this automated approach, any nucleotide sequence determined herein may
contain some errors. Nucleotide sequences determined by automation are
typically at least about 90% identical (or 10% different), more typically at
least
about 95% to at least about 99.9% identical to (or at most about 5% to at most
about 0.1 % different from) the actual nucleotide sequence of the sequenced
~ 5 DNA molecule. The actual sequence can be more precisely determined by
other
approaches including manual DNA sequencing methods well known in the art.
As is also known in the art, a single insertion or deletion in a determined
nucleotide sequence compared to the actual sequence will cause a frame shift
in
translation of the nucleotide sequence such that the predicted amino acid
2o sequence encoded by a determined nucleotide sequence will be completely
different from the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or deletion.
By "nucleotide sequence" of a nucleic acid molecule or polynucleotide is
intended, for a DNA molecule or polynucleotide, a sequence of
25 deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, G, C and U), where each
thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U).
Using the information provided herein, such as the nucleotide sequence
3o in Figures lA and 1B (SEQ ID NO:1 ), a nucleic acid molecule of the present
invention encoding a HLF polypeptide may be obtained using standard cloning
and screening procedures, such as those for cloning cDNAs using mRNA as
starting material. Illustrative of the invention, the nucleic acid molecule
described in Figures 1 A and 1 B (SEQ ID NO: I ) was discovered in a cDNA
35 library derived from human amygdala.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
The determined nucleotide sequence of the HLF cDNA of Figures lA
and 1B (SEQ ID NO:1 ) contains an open reading frame encoding a protein of
157 amino acid residues, with an amino-terminal serine codon at nucleotide
positions 2-4 of the nucleotide sequence in Figure 1 A (SEQ ID NO: l ), and a
deduced molecular weight of about 17.7 kDa. The amino acid sequence of the
HLF protein shown in SEQ ID N0:2 is about 32.7% identical to human mRNA
for heregulin (Figure 2). The nucleotide and amino acid sequence of human
heregulin has been reported by Holmes and colleagues (Science 256:1205-
1210; 1992; GenBank Accession No. M94166).
1 o The open reading frame of the HLF gene shares sequence homology
with the translation product of the human mRNA for heregulin (Figure 2; SEQ
ID N0:3), including the conserved EGF domain in HLF of about 67 amino
acids (amino acids 26-93 of SEQ ID N0:2). Heregulin is thought to be
important in the regulation of the activation state of the erbB family of cell
surface receptors, in the regulation of cellular growth control, and
ultimately in
the regulation of oncogenesis. The homology between heregulin and HLF
indicates that HLF may also be involved in the regulation of the activation
state
of the erbB family of cell surface receptors, in the regulation of cellular
growth
control, and ultimately in the regulation of oncogenesis.
2o As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors discussed above, the actual complete HLF polypeptide
encoded by the deposited cDNA, which comprises about 157 amino acids, may
be somewhat longer or shorter. More generally, the actual open reading frame
may be anywhere in the range of ~100 amino acids, +20 amino acids, more
likely in the range of ~10 amino acids, of that predicted from the serine
codon at
the N-terminus shown in Figure 1 A (SEQ ID NO:1 ). It will further be
appreciated that, depending on the analytical criteria used for identifying
various
functional domains, the exact "address" of the extracellular, EGF,
transmembrane, and intracellular domains of the HLF polypeptide may differ
slightly from the predicted positions above. For example, the exact location
of
the HLF EGF domain in SEQ ID N0:2 may vary slightly (e.g., the address may
"shift" by about 1 to about 20 residues, more likely about 1 to about 5
residues)
depending on the criteria used to define the domain. In this case, the ends of
the
transmembrane domain and the beginning of the EGF domain were predicted on
3s the basis of the identification of the conserved cysteine residues at
positions 35,
43. 49, 62, 64, and 73 of SEQ ID N0:2, as shown in Figure 1 A. In any event,
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
as discussed further below, the invention further provides polypeptides having
various residues deleted from the N-terminus of the complete polypeptide,
including polypeptides lacking one or more amino acids from the N-terminus of
the extracellular EGF domain described herein, which constitute soluble forms
of the extracellular EGF domain of the HLF protein.
Leader and Mature Sequences
In addition, methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are available.
For
instance, the method of McGeoch (Virus Res. 3:271-286; 1985) uses the
to information from a short N-terminal charged region and a subsequent
uncharged
region of the complete (uncleaved) protein. The method of von Heinje (Nucleic
Acids Res. 14:4683-4690; 1986) uses the information from the residues
surrounding the cleavage site, typically residues -13 to +2 where +1 indicates
the amino terminus of the mature protein. The accuracy of predicting the
~ 5 cleavage points of known mammalian secretory proteins for each of these
methods is in the range of 75-80°~0 (von Heinje, supra). However, the
two
methods do not always produce the same predicted cleavage points) for a given
protein.
In the present case, the deduced amino acid sequence of the complete
2o HLF polypeptide was analyzed by the computer program PSORT, available
from Dr. Kenta Nakai of the Institute for Chemical Research, Kyoto University
(Nakai, K. and Kanehisa, M., Genomics 14:897-911; 1992), which is an
expert system for predicting the cellular location of a protein based on the
amino
acid sequence. As part of this computational prediction of localization, the
25 methods of McGeoch and von Heinje are incorporated. The analysis of the
HLF amino acid sequence by this program indicated that there appears to be no
N-terminal signal sequence associated with the HLF amino acid sequence
shown in SEQ ID N0:2, and that the HLF molecule, as shown in SEQ ID
N0:2, appears to be a type Ib membrane protein.
3o As indicated, nucleic acid molecules of the present invention may be in
the form of RNA, such as mRNA, or in the form of DNA, including, for
instance, cDNA and genomic DNA obtained by cloning or produced
synthetically. The DNA may be double-stranded or single-stranded.
Single-stranded DNA or RNA may be the coding strand, also known as the
35 sense strand, or it may be the non-coding strand, also referred to as the
anti-sense strand.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
12
By "isolated" nucleic acid molecules) is intended a nucleic acid
molecule, DNA or RNA, which has been removed from its native environment
For example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of
isolated
DNA molecules include recombinant DNA molecules maintained in
heterologous host cells or purified (partially or substantially) DNA molecules
in
solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts
of
the DNA molecules of the present invention. Isolated nucleic acid molecules
according to the present invention further include such molecules produced
synthetically.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) beginning in frame with a
serine codon at positions 2-4 of the nucleotide sequence shown in Figure lA
(SEQ ID NO:1 ).
~ 5 In addition, isolated nucleic acid molecules of the invention include
DNA molecules which comprise a sequence substantially different from those
described above but which, due to the degeneracy of the genetic code, still
encode the HLF protein. Of course, the genetic code and species-specific codon
preferences are well known in the art. Thus, it would be routine for one
skilled
2o in the art to generate the degenerate variants described above, for
instance, to
optimize codon expression for a particular host (e.g., change codons in the
human mRNA to those preferred by a bacterial host such as E. coli).
In another aspect, the invention provides isolated nucleic acid molecules
encoding the HLF polypeptide having an amino acid sequence encoded by the
25 cDNA clone contained in the plasmid deposited as ATCC Deposit No. 209123
on June 19, 1997.
The invention further provides an isolated nucleic acid molecule having
the nucleotide sequence shown in Figures 1 A and 1 B (SEQ ID NO: l ) or the
nucleotide sequence of the HLF cDNA contained in the above-described
3o deposited clone, or a nucleic acid molecule having a sequence complementary
to one of the above sequences. Such isolated molecules, particularly DNA
molecules. are useful as probes for gene mapping, by in situ hybridization
with
chromosomes, and for detecting expression of the HLF gene in human tissue,
for instance, by Northern blot analysis.
35 The present invention is further directed to nucleic acid molecules
encoding portions of the nucleotide sequences described herein as well as to
fragments of the isolated nucleic acid molecules described herein. In
particular,
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
13
the invention provides a polynucleotide having a nucleotide sequence
representing the portion of SEQ ID NO: l which consists of positions 1-2199 of
SEQ ID NO:1.
In addition, the invention provides nucleic acid molecules having
nucleotide sequences related to a portion of SEQ ID NO:1 which has been
determined from the following related cDNA clone: HAGFE38R.
Further, the invention includes a polynucleotide comprising any portion
of at least about 30 nucleotides, preferably at least about 50 nucleotides, of
SEQ
ID NO:1 from residue about 1 to about 220 and from about 400 to 2199. More
preferably, the invention includes a polynucleotide comprising nucleotide
residues 1 to 2199, 1 to 1500, 1 to 1000, 1 to 500, 1 to 250, 250 to 2199, 250
to 1500. 250 to 1000, 250 to 500, 500 to 2199, 500 to 1500, 500 to 1000,
1000 to 2199, and 1000 to 1500.
More generally, by a fragment of an isolated nucleic acid molecule
~ 5 having the nucleotide sequence of the deposited cDNA or the nucleotide
sequence shown in Figures 1 A and 1B (SEQ ID NO:1 ) is intended fragments at
least about 15 nt, and more preferably at least about 20 nt, still more
preferably
at least about 30 nt, and even more preferably, at least about 40 nt in length
which are useful as diagnostic probes and primers as discussed herein. Of
2o course, larger fragments 50-300 nt in length are also useful according to
the
present invention as are fragments corresponding to most, if not all, of the
nucleotide sequence of the deposited cDNA or as shown in Figures lA and 1B
(SEQ ID NO: l ). By a fragment at least 20 nt in length, for example, is
intended
fragments which include 20 or more contiguous bases from the nucleotide
25 sequence of the deposited cDNA or the nucleotide sequence as shown in
Figures 1 A and 1 B (SEQ ID NO: l ). Preferred nucleic acid fragments of the
present invention include nucleic acid molecules encoding epitope-bearing
portions of the HLF polypeptide as identified in Figure 3 and described in
more
detail below. Preferred nucleic acid fragments of the present invention also
30 include nucleic acid molecules encoding Gamier-Robson and/or Chou-Fasman
alpha, beta, and/or turn regions, Gamier-Robson coil regions, Kyte-Doolittle
hydrophilic regions, Hopp-Woods hydrophobic regions, Eisenberg alpha
and/or beta amphipathic regions, Karplus-Schulz flexible regions,
Jameson-Wolf antigenic regions, and/or Emini surface probability regions of
the
35 HLF polypeptide as identified in Figure 3 or in a tabular representation of
the
data presented in Figure 3.
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
14
In another aspect, the invention provides an isolated nucleic acid
molecule comprising a polynucleotide which hybridizes under stringent
hybridization conditions to a portion of the polynucleotide in a nucleic acid
molecule of the invention described above, for instance, the cDNA clone
contained in ATCC Deposit No. 209123, or, for example, any specific HLF
polynucleotide fragment described above (a non-limiting example is a
Chou-Fasman alpha turn region). By "stringent hybridization conditions" is
intended overnight incubation at 42° C in a solution comprising:
50°~°
formamide, 5x SSC ( 150 mM NaCI, I 5 mM trisodium citrate), 50 mM sodium
1o phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20
~tg/ml
denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x
SSC at about 65° C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
15 15 nucleotides (nt), and more preferably at least about 20 nt, still more
preferably at least about 30 nt, and even more preferably about 30-70 (e.g.,
50)
nt of the reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for
2o example, is intended 20 or more contiguous nucleotides from the nucleotide
sequence of the reference polynucleotide (e.g., the deposited cDNA or the
nucleotide sequence as shown in Figures I A and 1 B (SEQ ID NO: I )). Of
course, a polynucleotide which hybridizes only to a poly A sequence (such as
the 3' terminal poly(A) tract of the HLF cDNA shown in Figure 1 B (SEQ ID
25 NO:1 )), or to a complementary stretch of T (or U) residues, would not be
included in a polynucleotide of the invention used to hybridize to a portion
of a
nucleic acid of the invention, since such a polynucleotide would hybridize to
any nucleic acid molecule containing a poly (A) stretch or the complement
thereof (e.g., practically any double-stranded cDNA clone).
3o As indicated, nucleic acid molecules of the present invention which
encode an HLF polypeptide may include, but are not limited to those encoding
the amino acid sequence of the complete polypeptide, by itself; and the coding
sequence for the complete polypeptide and additional sequences, such as those
encoding an added secretory leader sequence, such as a pre-, or pro- or prepro-
35 protein sequence.
Also encoded by nucleic acids of the invention are the above protein
sequences together with additional, non-coding sequences, including for
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
example, but not limited to introns and non-coding 5' and 3' sequences, such
as
the transcribed, non-translated sequences that play a role in transcription,
mRNA processing, including splicing and polyadenylation signals, for example
- ribosome binding and stability of mRNA; an additional coding sequence which
s codes for additional amino acids, such as those which provide additional
functionalities.
Thus, the sequence encoding the polypeptide may be fused to a marker
sequence, such as a sequence encoding a peptide which facilitates purification
of
the fused polypeptide. In certain preferred embodiments of this aspect of the
invention, the marker amino acid sequence is a hexa-histidine peptide, such as
the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, CA, 913 I 1 ), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
( 1989), for instance, hexa-histidine provides for convenient purification of
the
15 fusion protein. The "HA" tag is another peptide useful for purification
which
corresponds to an epitope derived from the influenza hemagglutinin protein,
which has been described by Wilson et al., Cell 37: 767 ( I984). As discussed
below, other such fusion proteins include the HLF fused to Fc at the N- or
C-terminus.
2o Variant and Mutant Polynueleotides
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs or
derivatives of the HLF protein. Variants may occur naturally, such as a
natural
allelic variant. By an "allelic variant" is intended one of several alternate
forms
of a gene occupying a given locus on a chromosome of an organism. Genes ll,
Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally
occurring variants may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions,
deletions or additions. The substitutions, deletions or additions may involve
one or more nucleotides. The variants may be altered in coding regions,
non-coding regions, or both. Alterations in the coding regions may produce
conservative or non-conservative amino acid substitutions, deletions or
additions. Especially preferred among these are silent substitutions,
additions
and deletions, which do not alter the properties and activities of the HLF
protein
or portions thereof. Also especially preferred in this regard are conservative
substitutions.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
16
Most highly preferred are nucleic acid molecules encoding the EGF
domain of the protein having the amino acid sequence shown in SEQ ID N0:2
or the EGF domain of the HLF amino acid sequence encoded by the deposited
cDNA clone (nucleotides 77-280 of SEQ ID NO:1 ).
Thus, one aspect of the invention provides an isolated nucleic acid
molecule comprising a polynucleotide having a nucleotide sequence selected
from the group consisting of: (a) a nucleotide sequence encoding the HLF
polypeptide having the complete amino acid sequence in SEQ ID N0:2 (i.e.,
positions 1 to 157 of SEQ ID N0:2) or the complete amino acid sequence
1 o encoded by the cDNA clone contained in ATCC Deposit No. 209123; (b) a
nucleotide sequence encoding the predicted extracellular domain of the HLF
polypeptide having the amino acid sequence in SEQ ID N0:2 (i.e., positions 1
to 101 of SEQ ID N0:2) or as encoded by the cDNA clone contained in ATCC
Deposit No. 209123; (c) a nucleotide sequence encoding the predicted
transmembrane domain of the HLF polypeptide having the amino acid sequence
in SEQ ID N0:2 {i.e., positions 102 to 121 of SEQ ID N0:2) or as encoded by
the cDNA clone contained in ATCC Deposit No. 209123; (d) a nucleotide
sequence encoding the predicted intracellular domain of the HLF polypeptide
having the amino acid sequence in SEQ ID N0:2 (i.e., positions 122 to 157 of
SEQ ID N0:2) or as encoded by the cDNA clone contained in ATCC Deposit
No. 209123; (e) a nucleotide sequence encoding a soluble HLF polypeptide
having the extracellular and intracellular domains but lacking the
transmembrane
domain; and (f) a nucleotide sequence complementary to any of the nucleotide
sequences in (a) through (e) above.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise a polynucleotide having a nucleotide sequence at least
90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99%
identical, to any of the nucleotide sequences in (a), {b), (c), (d), (e) or
(f),
above, or a polynucleotide which hybridizes under stringent hybridization
conditions to a polynucleotide in (a), {b), (c), (d), (e) or (f), above. This
polynucleotide which hybridizes does not hybridize under stringent
hybridization conditions to a polynucleotide having a nucleotide sequence
consisting of only A residues or of only T residues. An additional nucleic
acid
embodiment of the invention relates to an isolated nucleic acid molecule
comprising a polynucleotide which encodes the amino acid sequence of an
epitope-bearing portion of an HLF poiypeptide having an amino acid sequence
in (a), (b), (c). (d) or (e), above.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
17
The present invention also relates to recombinant vectors, which include
the isolated nucleic acid molecules of the present invention, and to host
cells
containing the recombinant vectors, as well as to methods of making such
vectors and host cells and for using them for production of HLF polypeptides
or
peptides by recombinant techniques.
By a polynucleotide having a nucleotide sequence at least, for example,
95Qlo "identical" to a reference nucleotide sequence encoding an HLF
polypeptide is intended that the nucleotide sequence of the polynucIeotide is
identical to the reference sequence except that the polynucleotide sequence
may
i o include up to five point mutations per each 100 nucleotides of the
reference
nucleotide sequence encoding the HLF polypeptide. In other words, to obtain a
polynucleotide having a nucleotide sequence at least 95% identical to a
reference
nucleotide sequence, up to 5% of the nucleotides in the reference sequence may
be deleted or substituted with another nucleotide, or a number of nucleotides
up
15 to 5% of the total nucleotides in the reference sequence may be inserted
into the
reference sequence. These mutations of the reference sequence may occur at the
5' or 3' terminal positions of the reference nucleotide sequence or anywhere
between those terminal positions, interspersed either individually among
nucleotides in the reference sequence or in one or more contiguous groups
2o within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%,
4%, 3%, 2% or 1% different from), for instance, the nucleotide sequence
shown in Figures lA and 1B or to the nucleotides sequence of the deposited
25 cDNA clone can be determined conventionally using known computer programs
such as the Bestfit program (Wisconsin Sequence Analysis Package. Version 8
for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, WI 53711 ). Bestfit uses the local homology algorithm of
Smith and Waterman, Advances in Applied Mathematics 2:482-489 ( 1981 ), to
3o find the best segment of homology between two sequences. When using Bestfit
or any other sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence according to
the
present invention, the parameters are set, of course, such that the percentage
of
identity is calculated over the full length of the reference nucleotide
sequence
35 and that gaps in homology of up to 5% of the total number of nucleotides in
the
reference sequence are allowed.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
18
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to (or 5% different from) a reference nucleotide sequence of
the
present invention, it is intended that the nucleotide sequence of the
polynucleotide is identical to the reference sequence except that the
polynucleotide sequence may include up to five point mutations per each 100
nucleotides of the reference nucleotide sequence encoding the HLF polypeptide.
In other words, to obtain a polynucleotide having a nucleotide sequence at
least
95% identical to a reference nucleotide sequence, up to 5% of the nucleotides
in
the reference sequence may be deleted or substituted with another nucleotide,
or
to a number of nucleotides up to 5% of the total nucleotides in the reference
sequence may be inserted into the reference sequence. The query sequence may
be an entire sequence shown in SEQ ID NO:1, the ORF (open reading frame),
or any fragement specified as described herein.
As a practical matter, whether any particular nucleic acid molecule or
polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at
most 10%, 5°l0, 4%, 3%, 2% or 1% different from) a nucleotide sequence
of
the presence invention can be determined conventionally using known computer
programs. A preferred method for determing the best overall match between a
query sequence (a sequence of the present invention) and a subject sequence,
also referred to as a global sequence alignment, can be determined using the
FASTDB computer program based on the algorithm of Brutlag et al. (Comp.
App. Biosci. ( 1990) 6:237-245). In a sequence alignment the query and subject
sequences are both DNA sequences. An RNA sequence can be compared by
converting U's to T's. The result of said global sequence alignment is in
percent identity. Preferred parameters used in a FASTDB alignment of DNA
sequences to calculate percent identiy are: Matrix=Unitary, k-tuple=4,
Mismatch Penalty=1, Joining Penalty=30, Randomization Group Length=0,
Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or
the lenght of the subject nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5'
or 3' deletions, not because of internal deletions, a manual correction must
be
made to the results. This is becuase the FASTDB program does not account for
5' and 3' truncations of the subject sequence when calculating percent
identity.
For subject sequences truncated at the 5' or 3' ends, relative to the the
query
sequence, the percent identity is corrected by calculating the number of bases
of
the query sequence that are 5' and 3' of the subject sequence, which are not
matched/aligned. as a percent of the total bases of the query sequence.
Whether
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
19
a nucleotide is matched/aligned is determined by results of the FASTDB
sequence alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the specified
parameters, to arrive at a final percent identity score. This corrected score
is
what is used for the purposes of the present invention. Only bases outside the
5' and 3' bases of the subject sequence, as displayed by the FASTDB
alignment, which are not matched/aligned with the query sequence, are
calculated for the purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
i o sequence to determine percent identity. The deletions occur at the 5' end
of the
subject sequence and therefore, the FASTDB alignment does not show a
matched/alignement of the first 10 bases at 5' end. The 10 unpaired bases
represent 10% of the sequence (number of bases at the 5' and 3' ends not
matched/total number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the remaining
90 bases were perfectly matched the final percent identity would be 90%. In
another example, a 90 base subject sequence is compared with a 100 base query
sequence. This time the deletions are internal deletions so that there are no
bases on the 5' or 3' of the subject sequence which are not matched/aligned
with
2o the query. In this case the percent identity calculated by FASTDB is not
manually corrected. Once again, only bases 5' and 3' of the subject sequence
which are not matched/aligned with the query sequnce are manually corrected
for. No other manual corrections are to made for the purposes of the present
invention.
The present application is directed to nucleic acid molecules at least
90%, 95~1c, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%,
3%, 2% or 1% different from) the nucleic acid sequence shown in Figures lA
and 1B (SEQ ID NO:I) or to the nucleic acid sequence of the deposited cDNA,
irrespective of whether they encode a polypeptide having HLF activity. This is
3o because even where a particular nucleic acid molecule does not encode a
polypeptide having HLF activity, one of skill in the art would still know how
to
use the nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of
the present invention that do not encode a polypeptide having HLF activity
include, inter alia, ( 1 ) isolating the HLF gene or allelic variants thereof
in a
cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase
chromosomal spreads to provide precise chromosomal location of the HLF
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
gene, as described in Verma et al., Human Chromosomes: A Manual of Basic
Techniques, Pergamon Press, New York ( 1988); and Northern Blot analysis
for detecting HLF mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
5 90%, 95°l0, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%,
4%,
3%, 2% or 1% different from)the nucleic acid sequence shown in Figures lA
and 1B (SEQ ID NO: l) or to the nucleic acid sequence of the deposited cDNA
which do, in fact, encode a polypeptide having HLF protein activity. By "a
polypeptide having HLF activity" is intended polypeptides exhibiting activity
1o similar, but not necessarily identical, to an activity of the full-length
or soluble
EGF domain of the HLF protein of the invention, as measured in a particular
biological assay. For example, the HLF protein of the present invention can be
assayed for activity by analyzing changes in the phosphorylation state cell
surface receptors. As described by Marchionni and colleagues (Nature
~ 5 362:312-318; 1993), a tyrosine kinase activation assay may be used to
determine such activity. In this assay, a wide variety of cells and cell lines
are
allowed to become quiescent in low serum medium. HLF protein, or variants
thereof, may then be added exogenously to the growth medium. Cultured cells
are then lysed in an SDS-based lysis buffer and subject to SDS-PAGE. The
20 proteins separated by SDS-PAGE are then transfered to a membrane and
immunoblotted with an anti-phosphotyrosine antibody. Changes in tyrosine
phosphorylation state of cell surface receptor molecules may then be assessed
by comparing immunoblots of cell samples which were treated or not treated
with HLF, or a variant thereof. Such activity is useful for determining the
affect
of HLF, or variants thereof, on the stimulation of a wide variety of cell
surface
receptor molecules and determining which signal transduction cascades may be
initiated by the binding of HLF, or a variant thereof.
HLF protein binding modulates the tyrosine phosphorylation state and
initiates a variety of signal transduction cascades in erbB family or other
cell
3o surface receptor molecules in a dose-dependent manner in the above-
described
assay. Thus, "a polypeptide having HLF protein activity" includes polypeptides
that also exhibit any of the same binding and phosphorylation state altering
activities in the above-described assays in a dose-dependent manner. Although
the degree of dose-dependent activity need not be identical to that of the HLF
protein, preferably, "a polypeptide having HLF protein activity" will exhibit
substantially similar dose-dependence in a given activity as compared to the
HLF protein (i.e., the candidate polypeptide will exhibit greater activity or
not
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
2l
more than about 25-fold less and, preferably, not more than about tenfold less
activity relative to the reference HLF protein).
In addition, the binding of HLF, or variants thereof, to a particular
receptor molecule may be assayed by cross-linking HLF, or an HLF variant, to
whichever receptor it binds on the cell surface and then immunoprecipitating
the
resulting ligand/receptor complex with a specific antiserum. Such an assay
will
thereby indicate a specific receptor binding profile for the HLF protein{s).
As
described by Holmes and colleagues (Science 256:1205-1210; 1992),''-5I-
labeled HLF, or HLF variant, protein is cross-linked to any of a variety of
cells
to or cell lines by incubating a suspension of cells and 106 CPM of''-SI-
labeled
HLF, or HLF variant, proteins in Hank's balanced salts (Life Technologies,
Inc., Rockville, MD) for 30 minutes at 22°C. Bis(sulfosuccinimidyl)
suberate
is added to the cell suspensions to a final concentration of 1 mM and the
suspensions are incubated for an additional 30 minutes. Cells are washed
t5 Tris-buffered saline (TBS) and then lysed in TBS containing Triton X-100
(0.5%). Immunoprecipitations are then performed using portions of treated and
mock-treated cultures combined with antisera to specific cellular receptor
molecules. Samples are then prepared in SDS sample buffer, analyzed by
SDS-PAGE (5.5% polyacrylamide gels), and visualized by autoradiography.
2o Of course, due to the degeneracy of the genetic code, one of ordinary
skill in the art will immediately recognize that a large number of the nucleic
acid
molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to (or at most 10%, 5%, 4%, 3%, 2% or 1% different from) the
nucleic acid sequence of the deposited cDNA or the nucleic acid sequence
25 shown in Figures lA and 1B (SEQ ID NO:I) will encode a polypeptide "having
HLF protein activity." In fact, since degenerate variants of these nucleotide
sequences all encode the same polypeptide, this will be clear to the skilled
artisan even without performing the above described comparison assay. It will
be further recognized in the art that, for such nucleic acid molecules that
are not
3o degenerate variants, a reasonable number will also encode a polypeptide
having
HLF protein activity. This is because the skilled artisan is fully aware of
amino
acid substitutions that are either less likely or not likely to significantly
effect
protein function (e.g., replacing one aliphatic amino acid with a second
aliphatic
amino acid), as further described below.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
Vectors and Host Cells
The present invention also relates to vectors which include the isolated
DNA molecules of the present invention, host cells which are genetically
engineered with the recombinant vectors, and the production of HLF
polypeptides or fragments thereof by recombinant techniques. The vector may
be, for example, a phage, plasmid, viral or retroviral vector. Retroviral
vectors
may be replication competent or replication defective. In the latter case,
viral
propagation generally will occur only in complementing host cells.
The polynucleotides may be joined to a vector containing a selectable
marker for propagation in a host. Generally, a plasmid vector is introduced in
a
precipitate, such as a calcium phosphate precipitate, or in a complex with a
charged lipid. If the vector is a virus, it may be packaged in vitro using an
appropriate packaging cell line and then transduced into host cells.
In one embodiment, the DNA of the invention is operatively associated
15 with an appropriate hetcrologous regulatory element (e.g. a promoter and/or
enhaneer), such as the phage lambda PL promoter, the E. coli lcac, trp, phoA
and tac promoters, the SV40 early and late promoters and promoters of
retroviral LTRs, to name a few. Other suitable promoters and enhancers will be
known to the skilled artisan.
?o In embodiments in which vectors contain expression constructs, these
constructs will further contain sites for transcription initiation,
termination and,
in the transcribed region, a ribosome binding site for translation. The coding
portion of the transcripts expressed by the constructs will preferably include
a
translation initiating codon at the beginning and a termination codon (UAA,
25 UGA or UAG) appropriately positioned at the end of the polypeptide to be
translated.
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase, 6418 or
neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or
30 ampicillin resistance genes for culturing in E coli and other bacteria.
Representative examples of appropriate hosts include, but are not limited to,
bacterial cells, such as E coli, Streptomyces and Salmonella typhimurium
cells;
fungal cells, such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS, 293 and Bowes
35 melanoma cells; and plant cells. Appropriate culture mediums and conditions
for the above-described host cells are known in the art.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
23
Among vectors preferred for use in bacteria include pQE70, pQE60 and
pQE-9, available from QIAGEN, Inc., supra; pBS vectors, Phagescript vectors,
Blucscript vectors, pNHBA, pNHl6a, pNHl8A, pNH46A, available from
Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available
from Pharmacia. Among preferred eukaryotic vectors are pWLNEO,
pSV2CAT, pOG44, pXTI and pSG available from Stratagene; and pSVK3,
pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will
be readily apparent to the skilled artisan.
Introduction of the construct into the host cell can be effected by calcium
t0 phosphate transfection, DEAF-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction, infection or other
methods. Such methods are described in many standard laboratory manuals,
such as Davis et al., Bnsic Methods In Molecular Biology ( 1986).
The polypeptide may be expressed in a modified form, such as a fusion
15 protein (comprising the polypeptide joined via a peptide bond to a
heterologous
protein sequence (of a different protein)), and may include not only secretion
signals, but also additional heterologous functional regions. Such a protein
can
be made by ligating polynucleotides of the invention and the desired nucleic
acid
sequence encoding the desired amino acid sequence to each other, by methods
2o known in the art, in the proper reading frame, and expressing the fusion
protein
product by methods known in the art. Alternatively, such a fusion protein can
be made by protein synthetic techniques, e.g. by use of a peptide synthesizer.
For instance, a region of additional amino acids, particularly charged amino
acids, may be added to the N-terminus of the polypeptide to improve stability
25 and persistence in the host cell, during purification, or during subsequent
handling and storage. Also, peptide moieties may be added to the polypeptide
to facilitate purification. Such regions may be removed prior to final
preparation
of the polypeptide. The addition of peptide moieties to polypeptides to
engender
secretion or excretion, to improve stability and to facilitate purification,
among
30 others, are familiar and routine techniques in the art. A preferred fusion
protein
comprises a heterologous region from immunoglobulin that is useful to
stabilize
and purify proteins. For example, EP-A-O 464 533 (Canadian counterpart
2045869) discloses fusion proteins comprising various portions of constant
region of immunoglobulin molecules together with another human protein or
35 part thereof. In many cases, the Fc part in a fusion protein is thoroughly
advantageous for use in therapy and diagnosis and thus results, for example,
in
improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
24
some uses it would be desirable to be able to delete the Fc part after the
fusion
protein has been expressed, detected and purified in the advantageous manner
described. This is the case when Fc portion proves to be a hindrance to use in
therapy and diagnosis, for example when the fusion protein is to be used as
antigen for immunizations. In drug discovery, for example, human proteins,
such as hIL-5, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5. See, D.
Bennett et al., J. Molecular Recognition 8:52-58 ( 1995) and K. Johanson et
al.,
J. Biol. Chem. 270:9459-9471 (1995).
The HLF protein can be recovered and purified from recombinant cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid extraction, anion or canon exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and lectin
15 chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification. Polypeptides of the present invention
include: products purified from natural sources, including bodily fluids,
tissues
and cells, whether directly isolated or cultured; products of chemical
synthetic
procedures; and products produced by recombinant techniques from a
20 prokaryotic or eukaryotic host, including, for example, bacterial, yeast,
higher
plant, insect and mammalian cells. Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present invention
may be glycosylated or may be non-glycosylated. In addition, polypeptides of
the invention may also include an initial modified methionine residue, in some
25 cases as a result of host-mediated processes. Thus, it is well known in the
art
that the N-terminal methionine encoded by the translation initiation codon
generally is removed with high efficiency from any protein after translation
in all
eukaryotic cells. While the N-terminal methionine on most proteins also is
efficiently removed in most prokaryotes, for some proteins this prokaryotic
3o removal process is inefficient, depending on the nature of the amino acid
to
which the N-terminal methionine is covalently linked.
Polypeptides and Fragments
The invention further provides an isolated HLF polypeptide having the
35 amino acid sequence encoded by the deposited cDNA, or the amino acid
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
sequence in SEQ ID N0:2, or a peptide or polypeptide comprising a portion of
the above polypeptides.
Variant and Mutant Polypeptides
To improve or alter the characteristics of HLF polypeptides, protein
5 engineering may be employed. Recombinant DNA technology known to those
skilled in the art can be used to create novel mutant proteins or ''muteins
including single or multiple amino acid substitutions, deletions, additions or
fusion proteins. Such modified polypeptides can show, e.g., enhanced activity
or increased stability. In addition, they may be purified in higher yields and
l0 show better solubility than the corresponding natural polypeptide, at least
under
certain purification and storage conditions.
N-Terminal and C-Terminal Deletion Mutants
For instance, for many proteins, including the extracellular domain of a
membrane associated protein or the mature forms) of a secreted protein, it is
15 known in the art that one or more amino acids may be deleted from the
N-terminus or C-terminus without substantial loss of biological function. For
instance, Ron and colleagues (J. Biol. Chem., 268:2984-2988; 1993) reported
modified KGF proteins that had heparin binding activity even if 3, 8, or 27
amino-terminal amino acid residues were missing. In the present case, since
the
2o protein of the invention is a member of the EGF polypeptide family,
deletions of
N-terminal amino acids up to the cysteine at position 35 of SEQ ID N0:2 may
retain some biological activity such as receptor binding and the inititation
of the
corresponding signal transduction cascade. Polypeptides having further
N-terminal deletions including the cysteine residue at position 35 of SEQ ID
25 N0:2 would not be expected to retain such biological activities because it
is
known that this residue in an EGF-like, or heregulin, polypeptide is one of
six
conserved cysteine residues required for both structure and biological
activity.
That is to say, the first cysteine is required for forming one of several
disulfide
bridges needed to provide structural stability which is, in turn, necessary
for
3o receptor binding and the inititiation of the signal transduction cascade.
However, even if deletion of one or more amino acids from the N-
terminus of a protein results in modification of loss of one or more
biological
functions of the protein, other biological activities may still be retained.
Thus,
the ability of the shortened protein to induce and/or bind to antibodies which
recognize the complete or extracellular domain of the protein generally will
be
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
26
retained when less than the majority of the residues of the complete or
extracellular domain of the protein are removed from the N-terminus. Whether
a particular polypeptide lacking N-terminal residues of a complete protein
retains
such immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the amino acid
sequence of HLF shown in SEQ ID N0:2, up to the cysteine residue at position
number 35, and polynucleotides encoding such polypeptides. In particular, the
1 o present invention provides polypeptides comprising the amino acid sequence
of
residues n-35 of SEQ ID N0:2, where n is an integer in the range of I-35, and
35 is the position of the first residue from the N-terminus of the complete
HLF
polypeptide (shown in SEQ ID N0:2) believed to be required for the HLG
protein to bind its receptor and initiate the corresponding signal
transduction
cascade.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues of 1-157, 2-157, 3-157, 4-157, 5-157, 6-157, 7-157, 8-157, 9-
157, 10-157, ll-157, 12-157, 13-157, 14-157, 15-157, 16-157, 17-157, 18-
157, 19-157, 20-157, 21-157, 22-157, 23-157, 24-157, 25-157, 26-157, 27-
157, 28-157, 29-157, 30-157, 31-157, 32-157, 33-157, 34-157, and 35-157 of
SEQ ID N0:2. Polynucleotides encoding these polypeptides also are provided.
Similarly, many examples of biologically functional C-terminal deletion
muteins are known. For instance, Interferon-gamma shows up to ten times
higher activities by deleting 8-10 amino acid residues from the carboxy
terminus
of the protein (Dobeli et al., J. Biotechnology 7:199-216; 1988). In the
present
case, since the protein of the invention is a member of the EGF or heregulin-
like
polypeptide family, deletions of C-terminal amino acids up to the most
carboxy-terminal cysteine of the extracellular domain (position 73 of SEQ ID
3o N0:2) may retain some biological activity such as such as receptor binding
and
the initiation of the corresponding signal transduction cascade. Polypeptides
having further C-terminal deletions including the cysteine residue at position
73
of SEQ ID N0:2 would not be expected to retain such biological activities
because it is known that this residue in an EGF-like, or heregulin-like,
polypeptide is one of six conserved cysteine residues required for both
structure
and biological activity. That is to say, the first cysteine is required for
forming
one of several disulfide bridges needed to provide structural stability which
is,
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
27
in turn, necessary for receptor binding and the inititiation of the signal
transduction cascade.
However, even if deletion of one or more amino acids from the
C-terminus of a protein results in modification of loss of one or more
biological
functions of the protein, other biological activities may still be retained.
Thus,
the ability of the shortened protein to induce and/or bind to antibodies which
recognize the complete or extracellular domain of the protein generally will
be
retained when less than the majority of the residues of the complete or
extracellular domain protein are removed from the C-terminus. Whether a
1o particular polypeptide lacking C-terminal residues of a complete protein
retains
such immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides having
one or more residues from the carboxy terminus of the amino acid sequence of
the HLF shown in SEQ ID N0:2, up to the cysteine residue at position 73 of
SEQ ID N0:2, and polynucleotides encoding such polypeptides. In particular,
the present invention provides polypeptides having the amino acid sequence of
residues 1-m of the amino acid sequence in SEQ ID N0:2, where m is any
integer in the range of 73 to 101, and residue 73 is the position of the first
2o residue from the C- terminus of the complete HLF polypeptide (shown in SEQ
ID N0:2) believed to be required for receptor binding and intitiation of the
corresponding signal transduction cascade.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues 1-73, 1-74, I -75, I -76, 1-77, 1-78, 1-79, 1-80, 1-81, I -82,
1-83, 1-84, I-85, 1-86, I-87, 1-88, I-89, 1-90, 1-91, I-92, 1-93,
1-94, 1-95, I -96, 1-97, I -98, 1-99, 1-100, and 1- I O I of SEQ ID N0:2.
Polynucleotides encoding these polypeptides also are provided.
The invention also provides polypeptides having one or more amino
3o acids deleted from both the amino and the carboxyl termini, which may be
described generally as having residues n-m of SEQ ID N0:2, where n and m are
integers as described above.
Also included are a nucleotide sequence encoding a polypeptide
consisting of a portion of the complete HLF amino acid sequence encoded by
the cDNA clone contained in ATCC Deposit No. 209123, where this portion
excludes from 1 to about 34 amino acids from the amino terminus of the
complete amino acid sequence encoded by the cDNA clone contained in ATCC
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
28
Deposit No. 209123, or from 1 to about 83 amino acids from the carboxy
terminus. or any combination of the above amino terminal and carboxy terminal
deletions, of the complete amino acid sequence encoded by the cDNA clone
contained in ATCC Deposit No. 209123. Polynucleotides encoding all of the
above deletion mutant polypeptide forms also are provided.
As mentioned above, even if deletion of one or more amino acids from
the N-terminus of a protein results in modification of loss of one or more
biological functions of the protein. other biological activities may still be
retained. Thus, the ability of the shortened HLF mutein to induce and/or bind
to
antibodies which recognize the complete or mature of the protein generally
will
be retained when less than the majority of the residues of the complete or
mature
protein are removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete protein retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an HLF mutein with a large
number of deleted N-terminal amino acid residues may retain some biological or
immungenic activities. In fact, peptides composed of as few as six HLF amino
acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the amino acid
sequence of the HLF shown in SEQ ID N0:2, up to the asparagine residue at
position number 152 and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising the amino
acid sequence of residues n'-152 of SEQ ID N0:2, where n' is an integer in the
range of 2-152, and 153 is the position of the first residue from the N-
terminus
of the complete HLF polypeptide believed to be required for at least
immunogenic activity of the HLF protein.
More in particular, the invention provides poiynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues of S-2 to K-157; S-3 to K-157; S-4 to K-157; S-5 to K-157; A-6 to
K-157; T-7 to K-157; T-8 to K-157; T-9 to K-157; T- I O to K-157; P-11 to
K-157; E-12 to K-157; T-13 to K-I57; S-14 to K-157; T-15 to K-I57; S-16 to
K-157; P-17 to K-157; K-18 to K-157; F-19 to K-157; H-20 to K-157; T-21 to
K-157; T-22 to K-157; T-23 to K-157; Y-24 to K-157; S-25 to K-157; T-26 to
K-157; E-27 to K-157; R-28 to K-157; S-29 to K-157; E-30 to K-157; H-31 to
K-157; F-32 to K-157; K-33 to K-157; P-34 to K-157; C-35 to K-157; R-36 to
K-157; D-37 to K-157; K-38 to K-157; D-39 to K-157; L-40 to K-157; A-41 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
29
K-157; Y-42 to K-157; C-43 to K-157; L-44 to K-157; N-45 to K-157; D-46 to
K-157; G-47 to K-157; E-48 to K-157; C-49 to K-157; F-50 to K-I57; V-S 1 to
K-157; I-52 to K-157; E-53 to K-157; T-54 to K-157; L-SS to K-157; T-56 to
K-157; G-57 to K-157; S-58 to K-157; H-59 to K-157; K-60 to K-157; H-61
to K-157; C-62 to K-157; R-63 to K-157; C-64 to K-157; K-65 to K-157; E-66
to K-157; G-67 to K-157; Y-68 to K-157; Q-69 to K-157; G-70 to K-157; V-71
to K-157; R-72 to K-157; C-73 to K-157; D-74 to K-157; Q-7S to K-157; F-76
to K-157; L-77 to K-157; P-78 to K-157; K-79 to K-157; T-80 to K-157; D-81
to K-157; S-82 to K-157; I-83 to K-157; L-84 to K-157; S-85 to K-157; D-86
to K-157; P-87 to K-157; N-88 to K-157; H-89 to K-157; L-90 to K-157; G-91
to K-157; I-92 to K-157; E-93 to K-157; F-94 to K-157; M-95 to K-157; E-96
to K-157; S-97 to K-157; E-98 to K-157; E-99 to K-157; V-100 to K-157;
Y-101 to K-157; Q-102 to K-157; R-103 to K-157; Q-104 to K-157; V-105 to
K-157; L-106 to K-157; S-107 to K-157; I-108 to K-157; S-109 to K-157;
C-110 to K-157; I-111 to K-157; I-112 to K-157; F-113 to K-157; G-114 to
K-157; I-11S to K-157; V-116 to K-157; I-117 to K-157; V-1 18 to K-157;
G-119 to K-157; M-120 to K-157; F-121 to K-157; C-122 to K-157; A-123 to
K-157; A-124 to K-157; F-125 to K-157; Y-126 to K-157; F-127 to K-157;
K-128 to K-157; S-129 to K-157; K-130 to K-157; R-131 to K-157; N-132 to
2o K-157; I-133 to K-157; T-134 to K-157; A-135 to K-157; N-136 to K-157;
S-137 to K-157; V-138 to K-157; S-139 to K-157; E-140 to K-157; E-141 to
K-157; R-142 to K-157; W-143 to K-157; K-144 to K-157; G-145 to K-I57;
L-146 to K-157; P-147 to K-157; S-148 to K-157; Q-149 to K-157; E-150 to
K-157; P-151 to K-157; and N-152 to K-157 of the HLF sequence shown in
?s SEQ ID N0:2. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids
from the C-terminus of a protein results in modification of loss of one or
more
biological functions of the protein, other biological activities may still be
3o retained. Thus, the ability of the shortened HLF mutein to induce and/or
bind to
antibodies which recognize the complete or mature of the protein generally
will
be retained when less than the majority of the residues of the complete or
mature
protein are removed from the C-terminus. Whether a particular polypeptide
lacking C-terminal residues of a complete protein retains such immunologic
35 activities can readily be determined by routine methods described herein
and
otherwise known in the art. It is not unlikely that an HLF mutein with a large
number of deleted C-terminal amino acid residues may retain some biological or
CA 02295317 1999-12-17
WO 98/57989 PCT/US98112403
immungenic activities. In fact, peptides composed of as few as six HLF amino
acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the.amino acid
5 sequence of the HLF shown in SEQ ID N0:2, up to the alanine residue at
position number 6, and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising the amino
acid sequence of residues I-m' of SEQ ID N0:2, where m' is an integer in the
range of 7-156, and 6 is the position of the first residue from the C-terminus
of
1 o the complete HLF polypeptide believed to be required for at least
immunogenic
activity of the HLF protein.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues S-1 to D-156; S-1 to Q-155; S-I to Q-154; S-I to L-153; S-1 to
l5 N-152; S-1 to P-151; S-I to E-150; S-1 to Q-149; S-I to S-148; S-1 to P-
147;
S-1 to L-146; S-i to G-145; S-I to K-144; S-1 to W-143; S-1 to R-142; S-1 to
E-141; S-1 to E-140; S-1 to S-139; S-I to V-138; S-1 to S-137; S-1 to N-136;
S-1 to A-135; S-I to T-134; S-1 to I-133; S-I to N-132; S-1 to R-131; S-1 to
K-130; S-1 to S-129; S-1 to K-128; S-I to F-127; S-1 to Y-126; S-I to F-125;
20 S-1 to A-124; S-1 to A-123; S-I to C-122; S-1 to F-121; S-1 to M-120; S-I
to
G-119; S-1 to V-118; S-1 to I-I 17; S-1 to V-116; S-1 to I-1 I5; S-1 to G-114;
S-I to F-113; S-I to I-I 12; S-1 to I-I 1 I; S-1 to C-I 10; S-I to S-109; S-1
to
I-108; S-1 to S-107; S-1 to L-106; S-1 to V-105; S-1 to Q-104; S-1 to R-103;
S-1 to Q-102; S-1 to Y- I 01; S-1 to V-100; S- I to E-99; S- I to E-98; S- I
to
25 S-97; S-1 to E-96; S-I to M-95; S-I to F-94; S-1 to E-93; S-1 to I-92; S-1
to
G-91; S-I to L-90; S-I to H-89; S-1 to N-88; S-I to P-87; S-1 to D-86; S-1 to
S-85; S-1 to L-84; S-1 to I-83; S-1 to S-82; S-1 to D-81; S-1 to T-80; S-1 to
K-79; S-1 to P-78; S-I to L-77; S-1 to F-76; S-1 to Q-75; S-I to D-74; S-1 to
C-73; S-1 to R-72; S-1 to V-7 I ; S-1 to G-70; S- I to Q-69; S-1 to Y-68; S-1
to
3o G-67; S-1 to E-66; S-1 to K-65; S-1 to C-64; S-1 to R-63; S-1 to C-62; S-1
to
H-61; S-1 to K-60; S-1 to H-59; S-I to S-58; S-I to G-57; S-1 to T-56; S-I to
L-55; S-I to T-54; S-1 to E-53; S-1 to I-52; S-1 to V-51; S-I to F-50; S-1 to
C-49; S-1 to E-48; S-I to G-47; S-I to D-46; S-1 to N-45; S-1 to L-44; S-I to
C-43; S-I to Y-42; S-1 to A-41; S-1 to L-40; S-1 to D-39; S-I to K-38; S-I to
D-37; S-1 to R-36; S-1 to C-35; S-1 to P-34; S-1 to K-33; S-1 to F-32; S-1 to
H-31; S-1 to E-30; S-I to S-29; S-1 to R-28; S-1 to E-27; S-1 to T-26; S-1 to
S-25; S-1 to Y-24; S-I to T-23; S-I to T-22; S-1 to T-21; S-I to H-20; S-1 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
31
F-19; S-1 to K-18; S-1 to P-17; S-1 to S-16; S-1 to T-15; S-1 to S-14; S-1 to
T-13; S-1 to E-12; S-1 to P-11; S-i to T-10; S-1 to T-9; S-1 to T-8; S-1 to T-
7;
S-1 to A-6 of the HLF sequence shown in SEQ ID N0:2. Polynucleotides
encoding these polypeptides also are provided.
The invention also provides polypeptides having one or more amino
acids deleted from both the amino and the carboxyl termini of an HLF
polypeptide, which may be described generally as having residues n'-m' of
SEQ ID N0:2, where n' and m' are integers as described above.
Also as mentioned above, even if deletion of one or more amino acids
o from the N-terminus of a protein results in modification of loss of one or
more
biological functions of the protein, other biological activities may still be
retained. Thus, the ability of the shortened HLF mutein to induce andlor bind
to
antibodies which recognize the complete or mature of the protein generally
will
be retained when less than the majority of the residues of the complete or
mature
protein are removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete protein retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an HLF mutein with a large
number of deleted N-terminal amino acid residues may retain some biological or
2o immungenic activities. In fact, peptides composed of as few as six HLF
amino
acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the amino acid
sequence of the HLF shown in SEQ ID N0:22, up to the aspartic acid residue at
position number 715 and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising the amino
acid sequence of residues n"-715 of SEQ ID N0:22, where n" is an integer in
the range of 2-715, and 716 is the position of the first residue from the
N-terminus of the complete HLF polypeptide believed to be required for at
least
3o immunogenic activity of the HLF protein.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues of S-2 to K-720; E-3 to K-720; G-4 to K-720; A-5 to K-720; A-6 to
K-720; A-7 to K-720; A-8 to K-720: S-9 to K-720; P-10 to K-720; P-11 to
K-720; G-12 to K-720; A-13 to K-720; A-14 to K-720; S-1 S to K-720; A-16 to
K-720; A-17 to K-720; A-18 to K-720; A-19 to K-720; S-20 to K-720; A-21 to
K-720; E-22 to K-720; E-23 to K-720; G-24 to K-720; T-25 to K-720; A-26 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
32
K-720; A-27 to K-720; A-28 to K-720; A-29 to K-720; A-30 to K-720; A-31 to
K-720; A-32 to K-720; A-33 to K-720; A-34 to K-720; G-35 to K-720; G-36 to
K-720; G-37 to K-720; P-38 to K-720; D-39 to K-720; G-40 to K-720; G-41 to
K-720; G-42 to K-720; E-43 to K-720; G-44 to K-720; A-45 to K-720; A-46 to
K-720; E-47 to K-720; P-48 to K-720; P-49 to K-720; R-50 to K-720; E-51 to
K-720; L-52 to K-720; R-53 to K-720; C-54 to K-720; S-55 to K-720; D-56 to
K-720; C-57 to K-720; I-58 to K-720; V-59 to K-720; W-60 to K-720; N-61 to
K-720; R-62 to K-720; Q-63 to K-720; Q-64 to K-720; T-65 to K-720; W-66 to
K-720; L-67 to K-720; C-68 to K-720; V-69 to K-720; V-70 to K-720; P-71 to
t o K-720; L-72 to K-720; F-73 to K-720; I-74 to K-720; G-75 to K-720; F-76 to
K-720; I-77 to K-720; G-78 to K-720; L-79 to K-720; G-80 to K-720; L-81 to
K-720; S-82 to K-720; L-83 to K-720; M-84 to K-720; L-85 to K-720; L-86 to
K-720; K-87 to K-720; W-88 to K-720; I-89 to K-720; V-90 to K-720; V-91 to
K-720; G-92 to K-720; S-93 to K-720; V-94 to K-720; K-95 to K-720; E-96 to
K-720; Y-97 to K-720; V-98 to K-720; P-99 to K-720; T-100 to K-720; D-101
to K-720; L-102 to K-720; V-103 to K-720; D-104 to K-720; S-105 to K-720;
K-106 to K-720; G-107 to K-720; M-108 to K-720; G-109 to K-720; Q- I 10 to
K-720; D- I 1 I to K-720; P-112 to K-720; F-1 I 3 to K-720; F- I 14 to K-720;
L- I I 5 to K-720; S- I I 6 to K-720; K- I 17 to K-720; P-1 18 to K-720; S- I
19 to
2o K-720; S-120 to K-720; F-121 to K-720; P-122 to K-720; K-123 to K-720;
A-124 to K-720; M-125 to K-720; E- I 26 to K-720; T-127 to K-720; T-128 to
K-720; T-129 to K-720; T-130 to K-720; T-131 to K-720; T-132 to K-720;
S-133 to K-720; T-134 to K-720; T-135 to K-720; S-136 to K-720; P-137 to
K-720; A-138 to K-720; T-139 to K-720; P-140 to K-720; S-141 to K-720;
A-142 to K-720; G-143 to K-720; G-144 to K-720; A-145 to K-720; A-146 to
K-720; S-147 to K-720; S-148 to K-720; R-149 to K-720; T-150 to K-720;
P-151 to K-720; N-152 to K-720; R-153 to K-720; I-154 to K-720; S-155 to
K-720; T-156 to K-720; R-157 to K-720; L-158 to K-720; T-159 to K-720;
T-160 to K-720; I-16 I to K-720; T- I 62 to K-720; R- I 63 to K-720; A-164 to
3o K-720; P-165 to K-720; T-166 to K-720; R-167 to K-720; F-168 to K-720;
P-169 to K-720; G-170 to K-720; H-171 to K-720; R-172 to K-720; V-173 to
K-720; P-174 to K-720; I-175 to K-720; R- I 76 to K-720; A- I 77 to K-720;
S-178 to K-720; P-179 to K-720; R-180 to K-720; S- I 81 to K-720; T-182 to
K-720; T-183 to K-720; A-184 to K-720; R-185 to K-720; N-186 to K-720;
T-187 to K-720; A-188 to K-720; A-189 to K-720; P-190 to K-720; A-191 to
K-720; T-192 to K-720; V-193 to K-720; P-194 to K-720; S-195 to K-720;
T-196 to K-720; T-197 to K-720; A-198 to K-720; P-199 to K-720; F-200 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
33
K-720; F-201 to K-720; S-202 to K-720; S-203 to K-720; S-204 to K-720:
T-205 to K-720; L-206 to K-720; G-207 to K-720; S-208 to K-720; R-209 to
K-720; P-210 to K-720; P-21 i to K-720; V-212 to K-720; P-213 to K-720;
G-214 to K-720; T-215 to K-720; P-216 to K-720; S-217 to K-720; T-218 to
K-720; Q-219 to K-720; A-220 to K-720; M-221 to K-720; P-222 to K-720;
S-223 to K-720; W-224 to K-720: P-225 to K-72U; T-226 to K-720; A-227 to
K-720; A-228 to K-720; Y-229 to K-720; A-230 to K-720; T-231 to K-720;
S-232 to K-720; S-233 to K-720; Y-234 to K-720; L-235 to K-720; H-236 to
K-720; D-237 to K-720; S-238 to K-720; T-239 to K-720; P-240 to K-720;
S-241 to K-720; W-242 to K-720; T-243 to K-720; L-244 to K-720; S-245 to
K-720; P-246 to K-720; F-247 to K-720; Q-248 to K-720; D-249 to K-720;
A-250 to K-720; A-251 to K-720; S-252 to K-720; S-253 to K-720; S-254 to
K-720; S-255 to K-720; S-256 to K-720; S-257 to K-720; S-258 to K-720;
S-259 to K-720; S-260 to K-720; S-261 to K-720; T-262 to K-720; T-263 to
~ 5 K-720; T-264 to K-720; T-265 to K-720; P-266 to K-720; E-267 to K-720;
T-268 to K-720; S-269 to K-720; T-270 to K-720; S-271 to K-720; P-272 to
K-720; K-273 to K-720; F-274 to K-720; H-275 to K-720; T-276 to K-720;
T-277 to K-720; T-278 to K-720; Y-279 to K-720; S-280 to K-720; T-281 to
K-720; E-282 to K-720; R-283 to K-720; S-284 to K-720; E-285 to K-720;
2o H-286 to K-720; F-287 to K-720; K-288 to K-720; P-289 to K-720; C-290 to
K-720; R-291 to K-720; D-292 to K-720; K-293 to K-720; D-294 to K-720;
L-295 to K-720; A-296 to K-720; Y-297 to K-720; C-298 to K-720; L-299 to
K-720; N-300 to K-720; D-301 to K-720; G-302 to K-720; E-303 to K-720;
C-304 to K-720; F-305 to K-720; V-306 to K-720; I-307 to K-720; E-308 to
25 K-720; T-309 to K-720; L-310 to K-720; T-311 to K-720; G-312 to K-720;
S-313 to K-720; H-314 to K-720; K-315 to K-720; H-316 to K-720; C-3 i 7 to
K-720; R-318 to K-720; C-319 to K-720; K-320 to K-720; E-321 to K-720;
G-322 to K-720; Y-323 to K-720; Q-324 to K-720; G-325 to K-720; V-326 to
K-720; R-327 to K-720; C-328 to K-720; D-329 to K-720; Q-330 to K-720;
3o F-331 to K-720; L-332 to K-720; P-333 to K-720; K-334 to K-720; T-335 to
K-720; D-336 to K-720; S-337 to K-720; I-338 to K-720; L-339 to K-720;
S-340 to K-720; D-341 to K-720; P-342 to K-720; T-343 to K-720; D-344 to
K-720; H-345 to K-720; L-346 to K-720; G-347 to K-720; I-348 to K-720;
E-349 to K-720; F-350 to K-720; M-351 to K-720; E-352 to K-720; S-353 to
35 K-720; E-354 to K-720; E-355 to K-720; V-356 to K-720; Y-357 to K-720;
Q-358 to K-720; R-359 to K-720; Q-360 to K-720; V-361 to K-720; L-362 to
K-720; S-363 to K-720; I-364 to K-720; S-365 to K-720; C-366 to K-720:
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
34
I-367 to K-720; I-368 to K-720; F-369 to K-720; G-370 to K-720; I-371 to
K-720; V-372 to K-720; I-373 to K-720; V-374 to K-720; G-375 to K-720;
M-376 to K-720; F-377 to K-720; C-378 to K-720; A-379 to K-720; A-380 to
K-720; F-381 to K-720; Y-382 to K-720; F-383 to K-720; K-384 to K-720;
s S-385 to K-720; K-386 to K-720; K-387 to K-720; Q-388 to K-720; A-389 to
K-720; K-390 to K-720; Q-391 to K-720; I-392 to K-720; Q-393 to K-720;
E-394 to K-720; Q-395 to K-720; L-396 to K-720; K-397 to K-720; V-398 to
K-720; P-399 to K-720; Q-400 to K-720; N-401 to K-720; G-402 to K-720;
K-403 to K-720; S-404 to K-720; Y-405 to K-720; S-406 to K-720; L-407 to
t o K-720; K-408 to K-720; A-409 to K-720; S-410 to K-720; S-411 to K-720;
T-412 to K-720; M-413 to K-720; A-414 to K-720; K-415 to K-720; S-416 to
K-720; E-417 to K-720; N-418 to K-720; L-419 to K-720; V-420 to K-720;
K-421 to K-720; S-422 to K-720; H-423 to K-720; V-424 to K-720; Q-425 to
K-720; L-426 to K-720; Q-427 to K-720; N-428 to K-720; Y-429 to K-720;
t s S-430 to K-720; K-431 to K-720; V-432 to K-720; E-433 to K-720; R-434 to
K-720; H-435 to K-720; P-436 to K-720; V-437 to K-720; T-438 to K-720;
A-439 to K-720; L-440 to K-720; E-441 to K-720; K-442 to K-720; M-443 to
K-720; M-444 to K-720; E-445 to K-720; S-446 to K-720; S-447 to K-720;
F-448 to K-720; V-449 to K-720; G-450 to K-720; P-451 to K-720; Q-452 to
2o K-720; S-453 to K-720; F-454 to K-720; P-455 to K-720; E-456 to K-720;
V-457 to K-720; P-458 to K-720; S-459 to K-720; P-460 to K-720; D-461 to
K-720; R-462 to K-720; G-463 to K-720; S-464 to K-720; Q-465 to K-720;
S-466 to K-720; V-467 to K-720; K-468 to K-720; H-469 to K-720: H-470 to
K-720; R-471 to K-720; S-472 to K-720; L-473 to K-720; S-474 to K-720;
2s S-475 to K-720; C-476 to K-720; C-477 to K-720; S-478 to K-720; P-479 to
K-720; G-480 to K-720; Q-481 to K-720; R-482 to K-720; S-483 to K-720;
G-484 to K-720; M-485 to K-720; L-486 to K-720; H-487 to K-720; R-488 to
K-720; N-489 to K-720; A-490 to K-720; F-491 to K-720; R-492 to K-720;
R-493 to K-720; T-494 to K-720; P-495 to K-720; P-496 to K-720; S-497 to
3o K-720; P-498 to K-720; R-499 to K-720; S-500 to K-720; R-501 to K-720;
L-502 to K-720; G-503 to K-720; G-504 to K-720; I-505 to K-720; V-506 to
K-720; G-507 to K-720; P-508 to K-720; A-509 to K-720; Y-510 to K-720;
Q-511 to K-720; Q-512 to K-720; L-513 to K-720; E-514 to K-720; E-515 to
K-720; S-516 to K-720; R-517 to K-720; I-518 to K-720; P-519 to K-720;
3s D-520 to K-720; Q-521 to K-720; D-522 to K-720; T-523 to K-720; I-524 to
K-720; P-525 to K-720; C-526 to K-720; Q-527 to K-720; G-528 to K-720;
I-529 to K-720: E-530 to K-720; V-531 to K-720; R-532 to K-720; K-533 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
K-720; T-534 to K-720; I-535 to K-720; S-536 to K-720; H-537 to K-720;
L-538 to K-720; P-539 to K-720; I-540 to K-720; Q-541 to K-720; L-542 to
K-720; W-543 to K-720; C-544 to K-720; V-545 to K-720; E-546 to K-720;
R-547 to K-720; P-548 to K-720; L-549 to K-720; D-550 to K-720; L-551 to
5 K-720; K-552 to K-72U; Y-553 to K-720; S-554 to K-720; S-555 to K-720;
S-556 to K-720; G-557 to K-720; L-558 to K-720; K-559 to K-720; T-560 to
K-720; Q-561 to K-720; R-562 to K-720; N-563 to K-720; T-564 to K-720;
S-565 to K-720; I-566 to K-720; N-567 to K-720; M-568 to K-720; Q-569 to
K-720; L-570 to K-720; P-571 to K-720; S-572 to K-720; R-573 to K-720;
E-574 to K-720; T-575 to K-720; N-576 to K-720; P-577 to K-720; Y-578 to
K-720; F-579 to K-720; N-580 to K-720; S-581 to K-720; L-582 to K-720;
E-583 to K-720; Q-584 to K-720; K-585 to K-720; D-586 to K-720; L-587 to
K-720; V-588 to K-720; G-589 to K-720; Y-590 to K-720; S-591 to K-720;
S-592 to K-720; T-593 to K-720; R-594 to K-720; A-595 to K-720; S-596 to
~ 5 K-720; S-597 to K-720; V-598 to K-720; P-599 to K-720; I-600 to K-720;
I-601 to K-720; P-602 to K-720; S-603 to K-720; V-604 to K-720; G-605 to
K-720; L-606 to K-720; E-607 to K-720; E-608 to K-720; T-609 to K-720;
C-610 to K-720; L-611 to K-720; Q-6I2 to K-720; M-613 to K-720; P-614 to
K-720; G-615 to K-720; I-616 to K-720; S-617 to K-720; E-618 to K-720;
2o V-619 to K-720; K-620 to K-720; S-621 to K-720; I-622 to K-720; K-623 to
K-720; W-624 to K-720; C-625 to K-720; K-626 to K-720; N-627 to K-720;
S-628 to K-720; Y-629 to K-720; S-630 to K-720; A-631 to K-720; D-632 to
K-720; V-633 to K-720; V-634 to K-720; N-635 to K-720; V-636 to K-720;
S-637 to K-720; I-638 to K-720; P-639 to K-720; V-640 to K-720; S-641 to
25 K-720; D-642 to K-720; C-643 to K-720; L-644 to K-720; I-645 to K-720;
A-646 to K-720; E-647 to K-720; Q-648 to K-720; Q-649 to K-720; E-650 to
K-720; V-651 to K-720; K-652 to K-720; I-653 to K-720; L-654 to K-720;
L-655 to K-720; E-656 to K-720; T-657 to K-720; V-658 to K-720; Q-659 to
K-720; E-660 to K-720; Q-661 to K-720; I-662 to K-720; R-663 to K-720;
3o I-664 to K-720; L-665 to K-720; T-666 to K-720; D-667 to K-720; A-668 to
K-720; R-669 to K-720; R-670 to K-720; S-671 to K-720; E-672 to K-720;
D-673 to K-720; Y-674 to K-720; E-675 to K-720; L-676 to K-720; A-677 to
K-720; S-678 to K-720; V-679 to K-720; E-680 to K-720; T-681 to K-720;
E-682 to K-720; D-683 to K-720; S-684 to K-720; A-685 to K-720; S-686 to
3s K-720; E-687 to K-720; N-688 to K-720; T-689 to K-720; A-690 to K-720;
F-691 to K-720; L-692 to K-720; P-693 to K-720; L-694 to K-720; S-695 to
K-720; P-696 to K-720; T-697 to K-720; A-698 to K-720; K-699 to K-720;
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
36
S-700 to K-720; E-701 to K-720; R-702 to K-720; E-703 to K-720; A-704 to
K-720; Q-705 to K-720; F-706 to K-720; V-707 to K-720; L-708 to K-720;
R-709 to K-720; N-710 to K-720; E-711 to K-720; I-712 to K-720; Q-713 to
K-720; R-714 to K-720; and D-715 to K-720 of the HLF sequence shown in
SEQ ID N0:22. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids
from the C-terminus of a protein results in modification of loss of one or
more
biological functions of the protein, other biological activities may still be
retained. Thus, the ability of the shortened HLF mutcin to induce and/or bind
to
antibodies which recognize the complete or mature of the protein generally
will
be retained when less than the majority of the residues of the complete or
mature
protein are removed from the C-terminus. Whether a particular polypeptide
lacking C-terminal residues of a complete protein retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an HLF mutein with a large
number of deleted C-terminal amino acid residues may retain some biological or
immungenic activities. In fact, peptides composed of as few as six HLF amino
acid residues may often evoke an immune response.
?0 Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino acid
sequence of the HLF shown in SEQ ID N0:22, up to the alanine residue at
position number 6, and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising the amino
acid sequence of residues 1-m" of SEQ ID N0:22, where m" is an integer in the
range of 7-718, and 6 is the position of the first residue from the C-terminus
of
the complete HLF polypeptide believed to be required for at least immunogenic
activity of the HLF protein.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues M-1 to T-719; M-1 to L-718; M-1 to A-717; M-I to S-716; M-1 to
D-715 ; M-1 to R-714; M-1 to Q-713 ; M-1 to I-712; M- I to E-711; M- I to
N-710; M-I to R-709; M-1 to L-708; M-1 to V-707; M-I to F-706; M-1 to
Q-705; M-1 to A-704; M- I to E-703; M-1 to R-702; M-1 to E-701; M-1 to
S-700; M-1 to K-699; M-1 to A-698; M-1 to T-697; M-1 to P-696; M-1 to
S-695 ; M-1 to L-694; M-1 to P-693 ; M-1 to L-692; M-1 to F-691; M-1 to
A-690; M-i to T-689; M-1 to N-688; M-1 to E-687; M-1 to S-686; M-1 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
37
A-685; M-1 to S-684; M-1 to D-683; M-1 to E-682; M-1 to T-681; M- I to
E-680; M-1 to V-679; M-I to S-678; M-1 to A-677; M-1 to L-676; M-I to
E-675; M-1 to Y-674; M-1 to D-673; M-I to E-672; M-I to S-671; M-1 to
R-670; M- I to R-669; M-1 to A-668; M-1 to D-667; M- I to T-666; M-1 to
L-665; M-1 to I-664; M-1 to R-663; M-1 to I-662; M-1 to Q-661; M-1 to E-660;
M-I to Q-659; M-I to V-658; M-1 to T-657; M-1 to E-656; M-1 to L-655; M-1
to L-654; M-1 to I-653; M-1 to K-652; M- I to V-65 I ; M- I to E-650; M- I to
Q-649; M-1 to Q-648; M-1 to E-647; M-1 to A-646; M-1 to I-645 ; M-1 to
L-644; M-1 to C-643; M-1 to D-642; M-1 to S-641; M-1 to V-640; M-1 to
P-639; M-1 to I-638; M-1 to S-637; M-1 to V-636; M-I to N-63_5; M-1 to
V-634; M-1 to V-633; M-1 to D-632; M-1 to A-631; M- I to S-630; M-1 to
Y-629; M-1 to S-628; M-1 to N-627; M-1 to K-626; M-1 to C-625; M-1 to
W-624; M-1 to K-623; M-I to I-622; M-1 to S-621; M-1 to K-620; M-1 to
V-619; M-1 to E-618; M-1 to S-617; M-1 to I-616; M-1 to G-615; M-1 to
P-6 I 4; M-1 to M-6 I 3; M-1 to Q-612; M- I to L-611; M-1 to C-610; M- I to
T-609; M-1 to E-608; M-1 to E-607; M-1 to L-606; M-1 to G-605; M-1 to
V-604; M-1 to S-603; M-1 to P-602; M-1 to I-60 I ; M- I to I-600; M-1 to P-
599;
M-1 to V-598; M-1 to S-597; M-1 to S-596; M-1 to A-595; M- I to R-594; M- I
to T-593; M-1 to S-592; M-1 to S-591; M-1 to Y-590; M-1 to G-589; M-1 to
2o V-588; M-1 to L-587; M-1 to D-586; M-1 to K-585; M-1 to Q-584; M-1 to
E-583; M-1 to L-582; M-1 to S-581; M-1 to N-580; M-I to F-579; M-1 to
Y-578; M-1 to P-577; M-I to N-576; M-1 to T-575; M-1 to E-574; M-1 to
R-573; M-1 to S-572; M-1 to P-571; M- I to L-570; M-1 to Q-569; M-1 to
M-568; M-1 to N-567; M-1 to I-566; M-I to S-565; M-1 to T-564; M-1 to
N-563; M-I to R-562; M-1 to Q-561; M-1 to T-560; M-1 to K-559; M-1 to
L-558; M-1 to G-557; M-1 to S-556; M-1 to S-555; M-1 to S-554; M-I to
Y-553; M-1 to K-552; M-1 to L-551; M-1 to D-550; M-1 to L-549; M-1 to
P-548; M-I to R-547; M-1 to E-546; M-1 to V-545; M-1 to C-544; M-1 to
W-543; M-I to L-542; M-1 to Q-541; M-1 to I-540; M-1 to P-539; M-I to
3o L-538; M-1 to H-537; M-1 to S-536; M-I to I-535; M-1 to T-534; M-I to
K-533; M-I to R-532; M-I to V-531; M-I to E-530; M-I to I-529; M-I to
G-528; M-1 to Q-527; M-1 to C-526; M-1 to P-525; M-1 to I-524; M-1 to
T-523; M-1 to D-522; M-I to Q-521; M-1 to D-520; M-1 to P-519; M-1 to
I-518; M-1 to R-517; M-1 to S-516; M-I to E-515; M-1 to E-514; M-1 to
3 5 L-513 ; M- I to Q-512; M-1 to Q-511; M-1 to Y-510; M-1 to A-509; M- I to
P-508; M-1 to G-507; M-1 to V-506; M-1 to I-505; M-1 to G-504; M-1 to
G-503; M-1 to L-502; M-1 to R-501; M-1 to S-500; M- I to R-499; M-1 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
38
P-498; M-1 to S-497; M-1 to P-496; M-1 to P-495; M-I to T-494; M-I to
R-493; M- I to R-492; M-1 to F-491; M- I to A-490; M- I to N-489; M-1 to
R-488; M-1 to H-487; M-1 to L-486; M-I to M-485; M-1 to G-484; M-I to
S-483; M-1 to R-482; M-I to Q-481; M-I to G-480; M-I to P-479; M-1 to
S-478; M-1 to C-477; M-1 to C-476; M-1 to S-475; M-1 to S-474; M-1 to
L-473; M-1 to S-472; M-I to R-471; M-1 to H-470; M-1 to H-469; M-1 to
K-468; M-1 to V-467; M-1 to S-466; M-1 to Q-465; M-I to S-464; M-1 to
G-463 ; M- I to R-462; M-1 to D-461; M-1 to P-460; M-1 to S-459; M-1 to
P-458; M-1 to V-457; M-1 to E-456; M-1 to P-455; M-1 to F-454; M-1 to
S-453; M-1 to Q-452; M-1 to P-451; M-I to G-450; M-I to V-449; M-I to
F-448; M-I to S-447; M-1 to S-446; M-1 to E-445; M-1 to M-444; M-I to
M-443; M-1 to K-442; M-1 to E-441; M-1 to L-440; M- i to A-439; M-1 to
T-438; M-1 to V-437; M-1 to P-436; M-1 to H-435; M-1 to R-434; M-1 to
E-433; M-1 to V-432; M-1 to K-431; M-1 to S-430; M-1 to Y-429; M-1 to
~5 N-428; M-1 to Q-427; M-1 to L-426; M-1 to Q-425; M-1 to V-424; M-1 to
H-423; M-1 to S-422; M-1 to K-421; M-I to V-420; M-1 to L-419; M-1 to
N-418; M- I to E-417; M-1 to S-416; M-1 to K-415; M-1 to A-414; M- I to
M-413; M-1 to T-412; M-1 to S-41 l; M-I to S-410; M-I to A-409; M-1 to
K-408; M-1 to L-407; M-I to S-406; M-1 to Y-405; M-1 to S-404; M-1 to
2o K-403; M-1 to G-402; M-I to N-401; M-1 to Q-400; M-1 to P-399; M-1 to
V-398; M-1 to K-397; M-1 to L-396; M-1 to Q-395; M-I to E-394; M-1 to
Q-393; M-1 to I-392; M-1 to Q-391; M-I to K-390; M-1 to A-389; M-1 to
Q-388; M-1 to K-387; M-1 to K-386; M-1 to S-385; M-1 to K-384; M-1 to
F-383; M-1 to Y-382; M-1 to F-381; M-1 to A-380; M-1 to A-379; M-1 to
25 C-378; M-1 to F-377; M-I to M-376; M-1 to G-375; M-I to V-374; M-1 to
I-373; M-1 to V-372; M-1 to I-371; M-1 to G-370; M-1 to F-369; M-I to I-368;
M-1 to I-367; M-I to C-366; M-1 to S-365; M-1 to I-364; M-1 to S-363; M-I to
L-362; M-1 to V-361; M-I to Q-360; M-1 to R-359; M-1 to Q-358; M-1 to
Y-357; M-I to V-356; M-I to E-355; M-1 to E-354; M-1 to S-353; M-I to
3o E-352; M-1 to M-351; M-1 to F-350; M-1 to E-349; M-1 to I-348; M-1 to
G-347; M-1 to L-346; M-1 to H-345; M- I to D-344; M- I to T-343; M-1 to
P-342; M-1 to D-341; M-1 to S-340; M-1 to L-339; M-1 to I-338; M-1 to
S-337; M-1 to D-336; M-1 to T-335; M-1 to K-334; M-I to P-333; M-1 to
L-332; M-I to F-331; M-I to Q-330; M-1 to D-329; M-1 to C-328; M-1 to
35 R-327; M-I to V-326; M-1 to G-325; M-1 to Q-324; M-1 to Y-323; M-1 to
G-322; M-1 to E-321; M-I to K-320; M-1 to C-319; M-1 to R-318; M-1 to
C-317; M- I to H-316; M-1 to K-315; M-1 to H-314; M-1 to S-313; M-1 to
CA 02295317 1999-12-17
WO 98/57989 PCTNS98/12403
39
G-312; M-1 to T-311; M-1 to L-310; M-1 to T-309; M-1 to E-308; M-1 to
I-307; M-1 to V-306; M-1 to F-305; M-1 to C-304; M-1 to E-303; M-1 to
G-302; M-1 to D-30 I ; M- I to N-300; M-1 to L-299; M-1 to C-298; M-1 to
Y-297; M-1 to A-296; M-1 to L-295; M-1 to D-294; M-1 to K-293; M-1 to
D-292; M-1 to R-291; M-1 to C-290; M-I to P-289; M-1 to K-288; M-1 to
F-287; M-I to H-286; M-1 to E-285; M-1 to S-284; M-1 to R-283; M-1 to
E-282; M-1 to T-281; M-1 to S-280; M-1 to Y-279; M-1 to T-278; M-1 to
T-277; M-I to T-276; M-1 to H-275; M-I to F-274: M-1 to K-273; M-1 to
P-272; M-1 to S-271; M-1 to T-270; M-1 to S-269; M-1 to T-268; M-1 to
to E-267; M-1 to P-266; M-1 to T-265; M-1 to T-264; M-I to T-263; M-1 to
T-262; M-1 to S-261; M-1 to S-260; M-1 to S-259; M-I to S-258; M-1 to
S-257; M-1 to S-256; M-I to S-255; M-1 to S-254; M-1 to S-253; M-1 to
S-252; M-1 to A-251; M-1 to A-250; M-1 to D-249: M-1 to Q-248; M-I to
F-247; M-1 to P-246; M-1 to S-245; M-I to L-244; M-1 to T-243; M-1 to
W-242; M-1 to S-241; M- I to P-240; M-1 to T-239; M-1 to S-238; M-1 to
D-237; M-1 to H-236; M-1 to L-235; M-1 to Y-234; M-I to S-233; M-1 to
S-232; M-1 to T-231; M-I to A-230; M-1 to Y-229; M-1 to A-228; M-1 to
A-227; M-1 to T-226; M-1 to P-225; M-1 to W-224; M-1 to S-223; M-I to
P-222; M-1 to M-22 i ; M-1 to A-220; M-1 to Q-219; M- I to T-218 ; M-1 to
2o S-217; M-1 to P-216; M-I to T-215; M-I to G-214; M-1 to P-213; M-I to
V-212; M- I to P-211; M-1 to P-210; M-1 to R-209; M- I to S-208; M-1 to
G-207; M-1 to L-206; M-1 to T-205 ; M-1 to S-204; M-1 to S-203 ; M-1 to
S-202; M-1 to F-201; M-1 to F-200; M- I to P-199; M- I to A-198 ; M-1 to
T-197; M-1 to T-196; M-1 to S-195; M-1 to P-194; M-1 to V-193; M-1 to
T-192; M-1 to A-191; M-I to P-190; M-I to A-189; M-1 to A-188; M-I to
T-187; M-1 to N-186; M-1 to R-185; M-1 to A-184; M-1 to T-183; M-1 to
T-182; M-1 to S-181; M-1 to R-180; M-I to P-179; M-1 to S-178; M-1 to
A-177; M-1 to R-176; M-I to I-175; M-1 to P-174; M-1 to V-173; M-I to
R-172; M-1 to H-171; M- I to G-170; M-1 to P-169; M-1 to F- I 68 ; M-1 to
3 o R- I 67; M-1 to T-166; M-1 to P-165 : M- I to A-164; M- I to R-163; M-1 to
T-i62; M-1 to I-161; M-1 to T-160; M-I to T-159; M-1 to L-158; M-1 to
R-157; M-1 to T-156; M-1 to S-155; M-1 to I-154; M-1 to R-153; M-1 to
N-152; M-1 to P-151; M-1 to T-150; M-1 to R-149; M-1 to S-148 ; M-1 to
S-147; M-1 to A- I 46; M-1 to A-145 ; M-1 to G-144; M- I to G-143 ; M-1 to
A-142; M-1 to S-141; M-1 to P-140; M-1 to T-139; M-1 to A-138; M-1 to
P-137; M-1 to S-136; M-1 to T-135; M-I to T-134; M-1 to S-133; M-I to
T-132; M-I to T-131; M-1 to T-130: M-1 to T-129; M-1 to T-128; M-1 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
T-127; M-1 to E-126; M-1 to M-125; M-1 to A-124; M-1 to K-123; M-1 to
P-122; M-I to F-121; M-1 to S-120; M-1 to S-1 19; M-I to P-118; M-1 to
K-117; M-1 to S-116; M-I to L-I 15; M-1 to F-1 14; M-1 to F-I 13; M-1 to
P-112; M-1 to D-111; M-1 to Q-1 I 0; M- I to G-109; M-1 to M- I 08; M- I to
5 G-107; M-1 to K-106; M-1 to S-105; M-1 to D-104; M-I to V-103; M-I to
L-102; M-1 to D-101; M-1 to T-100; M-1 to P-99; M-I to V-98; M-1 to Y-97;
M-1 to E-96; M-1 to K-95; M-1 to V-94; M-1 to S-93; M-1 to G-92; M-I to
V-9 I ; M-1 to V-90; M-1 to I-89; M-1 to W-88 ; M-1 to K-87; M-1 to L-86; M-1
to L-85; M-1 to M-84; M-1 to L-83; M-1 to S-82; M-1 to L-81; M-1 to G-80;
M-I to L-79; M-1 to G-78; M-1 to I-77; M-1 to F-76; M-1 to G-75; M-1 to I-74;
M-1 to F-73; M-1 to L-72; M-1 to P-71; M-1 to V-70; M-1 to V-69; M-1 to
C-68; M-1 to L-67: M-1 to W-66; M-1 to T-65; M-1 to Q-64: M- I to Q-63; M-1
to R-62; M-1 to N-61; M-1 to W-60; M-1 to V-59; M-1 to I-58; M-1 to C-57;
M-1 to D-~6; M-1 to S-55; M-1 to C-54; M-1 to R-53; M-I to L-52; M-1 to
15 E-51; M-1 to R-50; M-1 to P-49; M-1 to P-48; M-1 to E-47; M-1 to A-46; M-1
to A-45; M-1 to G-44; M- I to E-43; M-1 to G-42; M-1 to G-41; M-1 to G-40;
M-1 to D-39; M-1 to P-38; M-1 to G-37; M-1 to G-36; M-1 to G-35; M-1 to
A-34; M-1 to A-33; M-1 to A-32; M-1 to A-31; M-1 to A-30; M-1 to A-29; M-1
to A-28; M-1 to A-27; M-1 to A-26; M-I to T-25; M-1 to G-24; M-1 to E-23;
2o M-1 to E-22; M-1 to A-21; M-1 to S-20; M-1 to A-19; M-1 to A-18 ; M-1 to
A-17; M-1 to A-16; M-1 to S-15; M-1 to A-14; M-1 to A-13; M-1 to G-12; M-1
to P- I I ; M-1 to P-10; M-1 to S-9; M-1 to A-8 ; M- I to A-7 ; M-1 to A-6 of
the
HLF sequence shown in SEQ ID N0:22. Polynucleotides encoding these
polypeptides also are provided.
25 The invention also provides polypeptides having one or more amino
acids deleted from both the amino and the carboxyl tern>ini of an HLF
polypeptide, which may be described generally as having residues n"-m" of
SEQ ID N0:22, where n" and m" are integers as described above.
Other Mutants
30 In addition to terminal deletion forms of the protein discussed above, it
also will be recognized by one of ordinary skill in the art that some amino
acid
sequences of the HLF polypeptide can be varied without significant effect of
the
structure or function of the protein. If such differences in sequence are
contemplated, it should be remembered that there will be critical areas on the
35 protein which determine activity.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
41
Thus, the invention further includes variations of the HLF polypeptide
which show substantial HLF polypeptide activity or which include regions of
HLF protein such as the protein portions discussed below. Such mutants
include deletions, insertions, inversions, repeats, and type substitutions
selected
according to general rules known in the art so as have little effect on
activity.
For example, guidance concerning how to make phenotypically silent amino
acid substitutions is provided by Bowie and colleagues (Science
247:1306-1310; 1990), wherein the authors indicate that there are two main
approaches for studying the tolerance of an amino acid sequence to change. The
first method relies on the process of evolution, in which mutations are either
accepted or rejected by natural selection. The second approach uses genetic
engineering to introduce amino acid changes at specific positions of a cloned
gene and selections or screens to identify sequences that maintain
functionality.
As the authors state, these studies have revealed that proteins are
surprisingly tolerant of amino acid substitutions. The authors further
indicate
which amino acid changes are likely to be permissive at a certain position of
the
protein. For example, most buried amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally conserved.
Other such phenotypically silent substitutions are described in Bowie, J. U.
et
2o al., supra, and the references cited therein. Typically seen as
conservative
substitutions are the replacements, one for another, among the aliphatic amino
acids Ala, Val, Leu and Ile; interchange of the hydroxyl residues Ser and Thr,
exchange of the acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg and
replacements among the aromatic residues Phe, Tyr.
Thus, the fragment, derivative or analog of the polypeptide of SEQ ID
N0:2, or that encoded by the deposited cDNA, may be (i) one in which one or
more of the amino acid residues are substituted with a conserved or non-
conserved amino acid residue (preferably a conserved amino acid residue) and
3o such substituted amino acid residue may or may not be one encoded by the
genetic code, (ii) one in which one or more of the amino acid residues
includes a
substituent group, (iii) one in which the extracellular domain of the HLF
polypeptide is fused with another compound, such as a compound to increase
the half life of the polypeptide (for example, polyethylene glycol), (iv) one
in
which the EGF domain of the HLF polypeptide is fused with another
compound, such as a compound to increase the half-life of the polypeptide (for
example. polyethylene glycol), (v) one in which the additional amino acids are
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
42
fused to the extracellular form of the polypeptide, such as an IbG Fc fusion
region peptide or leader or secretory sequence or a sequence which is employed
for purification of the above form of the polypeptide or a proprotein
sequence,
or (vi j one in which the additional amino acids are fused to the EGF form of
the
polypeptide, such as an IgG Fc fusion region peptide or leader or secretory
sequence or a sequence which is employed for purification of the above form of
the polypeptide or a proprotein sequence. Such fragments, derivatives and
analogs are deemed to be within the scope of those skilled in the art from the
teachings herein
to Thus, the HLF of the present invention may include one or more amino
acid substitutions, deletions or additions, either from natural mutations or
human manipulation. As indicated, changes are preferably of a minor nature,
such as conservative amino acid substitutions that do not significantly affect
the
folding or activity of the protein (see Table I ).
TABLE 1. Conservative Amino Acid Substitutions
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine
Polar Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Gl cine
In specific embodiments, the number of substitutions, deletions or
additions in the amino acid sequence of Figure 1 A and/or any of the
polypeptide
fragments described herein is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19,
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
43
18, 17, 16, 15, 14, 13, 12 ,I1, 10, 9, 8, 7, 6, 5, 4, 3, 2, I or 30-20, 20-10,
20- I 5, 15-10, 10-5 or I -5.
Amino acids in the HLF protein of the present invention that are
essential for function can be identified by methods known in the art, such as
s site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and
Wells, Science 244:1081-1085 ( 1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting mutant
molecules are then tested for biological activity such as receptor binding or
in
vitro or in vitro proliferative activity.
Of special interest are substitutions of charged amino acids with other
charged or neutral amino acids which may produce proteins with highly
desirable improved characteristics. such as less aggregation. Aggregation may
not only reduce activity but also be problematic when preparing pharmaceutical
formulations, because aggregates can be immunogenic (Pinckard et al., Clin.
~ 5 Exp. Immirnol. 2:331-340 ( 1967); Robbins et al., Diabetes 36: 838-845 (
1987);
Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems J0:307-377 {
1993).
Replacement of amino acids can also change the selectivity of the
binding of a ligand to cell surface receptors. For example, Ostade et al.,
Nature
361:266-268 ( 1993) describes certain mutations resulting in selective binding
of
2o TNF-a to only one of the two known types of TNF receptors. Sites that are
critical for ligand-receptor binding can also be determined by structural
analysis
such as crystallization, nuclear magnetic resonance or photoaffinity labeling
(Snuth et al., J. Mol. Biol. 224:899-904 ( 1992) and de Vos et al. Science
255:306-3 I 2 ( 1992)).
25 Since HLF is a member of the EGF-related protein family, to modulate
rather than completely eliminate biological activities of HLF, preferably
mutations are made in sequences encoding amino acids in the HLF conserved
domain, i.e., in amino acid positions about 26 to about 93 of SEQ ID N0:2,
more preferably in residues within this region which are not conserved in all
3o members of the EGF family. Also forming part of the present invention are
isolated polynucleotides comprising nucleic acid sequences which encode the
above HLF mutants.
The polypeptides of the present invention are preferably provided in an
isolated form, and preferably are substantially purified. A recombinantly
35 produced version of the HLF polypeptide can be substantially purified by
the
one-step method described by Smith and Johnson (Gene 67:31-40; 1988).
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
44
Polypeptides of the invention also can be purified from natural or recombinant
sources using anti-HLF antibodies of the invention in methods which are well
known in the art of protein purification.
The invention further provides an isolated HLF polypeptide comprising
an amino acid sequence selected from the group consisting of: (a) the amino
acid sequence of the HLF polypeptide having the complete amino acid sequence
shown in SEQ ID N0:2 (i.e., positions I to 157 of SEQ ID N0:2) or the
complete amino acid sequence encoded by the cDNA clone contained in the
ATCC Deposit No. 209123; (b) the amino acid sequence of the predicted
1 o extracellular domain of the HLF polypeptide having the amino acid sequence
shown in SEQ ID N0:2 (i.e., positions I to 101 of SEQ ID N0:2) or as
encoded by the cDNA clone contained in the ATCC Deposit No. 209123; (c)
the amino acid sequence of the predicted transmembrane domain of the HLF
polypeptide having the amino acid sequence shown in SEQ ID N0:2 (i.e.,
i s positions 102 to I 21 of SEQ ID N0:2 ) or as encoded by the cDNA clone
contained in the ATCC Deposit No. 209123; (d) the amino acid sequence of the
predicted intracellular domain of the HLF polypeptide having the amino acid
sequence shown in SEQ ID N0:2 (i.e., positions 122 to 157 of SEQ ID N0:2)
or as encoded by the cDNA clone contained in the ATCC Deposit No. 209123;
2o and (e) the amino acid sequence of a soluble HLF polypeptide having the
extracellular and intracellular domains but lacking the transmembrane domain.
The polypeptides of the present invention also include polypeptides having an
amino acid sequence at least 80% identical, more preferably at lease 90%
identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to
25 (or at most 20% different, more preferably at most 10% different, and still
more
preferably 5%, 4%, 3%, 2% or 1 % different from) those described in (a), (b),
(c), (d), or (e) above, as well as polypeptides having an amino acid sequence
with at least 90% similarity, and more preferably at least 95% similarity, to
those above.
3o Further polypeptides of the present invention include polypeptides
which have at least 90% similarity, more preferably at least 95% similarity,
and
still more preferably at least 96%, 97%, 98% or 99% similarity to those
described above. The polypeptides of the invention also comprise those which
are at least 80% identical, more preferably at least 90% or 95% identical,
still
35 more preferably at least 96%, 97%, 98% or 99% identical to (or at most 20%
different, more preferably at most 10°~0 or 5% different, still more
preferably at
most 4%. 3%. 2% or 1% different from) the polypeptide encoded by the
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
deposited cDNA or to the polypeptide of SEQ ID N0:2, and also include
portions of such polypeptides with at least 30 amino acids and more preferably
at least 50 amino acids.
By "% similarity" for two polypeptides is intended a similarity score
5 produced by comparing the amino acid sequences of the two polypeptides using
the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, WI 5371 l ) and the default settings for determining
similarity.
Bestfit uses the local homology algorithm of Smith and Waterman (Adv. Appl.
I o Math. 2:482-489; 1981 ) to find the best segment of similarity between two
sequences.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to a reference amino acid sequence of an HLF polypeptide is
intended that the amino acid sequence of the polypeptide is identical to the
~ 5 reference sequence except that the polypeptide sequence may include up to
five
anuno acid alterations per each 100 amino acids of the reference amino acid of
the HLF polypeptide. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a reference amino acid sequence, up to
5% of the amino acid residues in the reference sequence may be deleted or
2o substituted with another amino acid, or a number of amino acids up to 5% of
the
total amino acid residues in the reference sequence may be inserted into the
reference sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid sequence
or
anywhere between those terminal positions, interspersed either individually
25 among residues in the reference sequence or in one or more contiguous
groups
within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%. 97%, 98% or 99% identical to (or at most 10%, 5%, 4%, 3%, 2%
or 1 % different from), for instance, the amino acid sequence shown in SEQ ID
3o N0:2 or to the amino acid sequence encoded by deposited cDNA clone can be
determined conventionally using known computer programs such the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer Group, University Research Park, 575 Science Drive, Madison, WI
53711 ). When using Bestfit or any other sequence alignment program to
3~ determine whether a particular sequence is, for instance, 95% identical to
(or
5% different from) a reference sequence according to the present invention,
the
parameters are set, of course, such that the percentage of identity is
calculated
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
46
over the full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in the
reference sequence are allowed.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to (or 5% different from) a query amino acid sequence of the
present invention, it is intended that the amino acid sequence of the subject
polypeptide is identical to the query sequence except that the subject
polypeptide
sequence may include up to five amino acid alterations per each 100 amino
acids
of the query amino acid sequence. In other words, to obtain a polypeptide
having an amino acid sequence at least 95% identical to a query amino acid
sequence, up to 5% of the amino acid residues in the subject sequence may be
inserted, deleted, (indels) or substituted with another amino acid. These
alterations of the reference sequence may occur at the amino or carboxy
terminal
positions of the reference amino acid sequence or anywhere between those
terminal positions, interspersed either individually among residues in the
reference sequence or in one or more contiguous groups within the reference
sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%, 3%, 2%
2o or 1 % different from) for instance, the amino acid sequences shown in SEQ
ID
N0:2 or to the amino acid sequence encoded by deposited DNA clone can be
determined conventionally using known computer programs. A preferred
method for determing the best overall match between a query sequence (a
sequence of the present invention) and a subject sequence, also referred to as
a
global sequence alignment, can be determined using the FASTDB computer
program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990)
6:237-245). In a sequence alignment the query and subject sequences are either
both nucleotide sequences or both amino acid sequences. The result of said
global sequence alignment is in percent identity. Preferred parameters used in
a
3o FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch
Penalty=1, Joining Penalty=20, Randomization Group Length=0, Cutoff
Score=1, Window Size=sequence length, Gap Penalty=5, Gap Size
Penalty=0.05, Window Size=500 or the length of the subject amino acid
sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to N- or
C-terminal deletions, not because of internal deletions, a manual correction
must
be made to the results. This is becuase the FASTDB program does not account
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
47
for N- and C-terminal truncations of the subject sequence when calculating
global percent identity. For subject sequences truncated at the N- and C-
termini, relative to the the query sequence, the percent identity is corrected
by
calculating the number of residues of the query sequence that are N- and C-
terminal of the subject sequence, which are not matched/aligned with a
corresponding subject residue, as a percent of the total bases of the query
sequence. Whether a residue is matched/aligned is determined by results of the
FASTDB sequence alignment. This percentage is then subtracted from the
percent identity, calculated by the above FASTDB program using the specified
I o parameters, to arrive at a final percent identity score. This final
percent identity
score is what is used for the purposes of the present invention. Only residues
to
the N- and C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of manually adjusting
the percent identity score. That is, only query residue positions outside the
farthest N- and C-terminal residues of the subject sequence.
For example, a 90 amino acid residue subject sequence is aligned with a
100 residue query sequence to determine percent identity. The deletion occurs
at the N-terminus of the subject sequence and therefore, the FASTDB alignment
does not show a matching/alignment of the first 10 residues at the N-terminus.
2o The 10 unpaired residues represent 10% of the sequence (number of residues
at
the N- and C- termini not matched/total number of residues in the query
sequence) so 10% is subtracted from the percent identity score calculated by
the
FASTDB program. If the remaining 90 residues were perfectly matched the
final percent identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time the
deletions are internal deletions so there are no residues at the N- or C-
termini of
the subject sequence which are not matched/aligned with the query. In this
case
the percent identity calculated by FASTDB is not manually corrected. Once
again, only residue positions outside the N- and C-terminal ends of the
subject
3o sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequnce are manually corrected for. No other
manual corrections are to made for the purposes of the present invention.
The polypeptide of the present invention could be used as a molecular
weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns
using methods well known to those of skill in the art.
As described in detail below, the polypeptides of the present invention
can also be used to raise polyclonal and monoclonal antibodies, which are
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
48
useful in assays for detecting HLF protein expression as described below or as
agonists and antagonists capable of enhancing or inhibiting HLF protein
function. Further, such polypeptides can be used in the yeast two-hybrid
system to "capture" HLF protein binding proteins which are also candidate
agonists and antagonists according to the present invention. The yeast two
hybrid system is described in Fields and Song, Nature 340:245-246 (1989).
Epitope-Bearing Portions
In another aspect, the invention provides a peptide or polypeptide
comprising an epitope-bearing portion of a polypeptide of the invention. The
t0 epitope of this polypeptide portion is an immunogenic or antigenic epitope
of a
polypeptide of the invention. An "immunogenic epitope" is defined as a part of
a protein that elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to which an
antibody can bind is defined as an "antigenic epitope." The number of
immunogenic epitopes of a protein generally is less than the number of
antigenic
epitopes (Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002; 1983).
As to the selection of peptides or polypeptides bearing an antigenic
epitope (i.e., that contain a region of a protein molecule to which an
antibody
can bind), it is well known in that art that relatively short synthetic
peptides that
mimic part of a protein sequence are routinely capable of eliciting an
antiserum
that reacts with the partially mimicked protein (Sutcliffe, J. G., et al.,
Science
219:660-666; 1983). Peptides capable of eliciting protein-reactive sera are
frequently represented in the primary sequence of a protein, can be
characterized
by a set of simple chemical rules, and are confined neither to immunodominant
regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or
carboxyl terminals. Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including monoclonal
antibodies, that bind specifically to a polypeptide of the invention. See, for
instance, Wilson et cal., Cell 37:767-778 ( l 984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention
preferably contain a sequence of at least seven, more preferably at least nine
and most preferably between about 15 to about 30 amino acids contained within
the amino acid sequence of a polypeptide of the invention. Non-limiting
examples of antigenic polypeptides or peptides that can be used to generate
HLF-specific antibodies include: a polypeptide comprising amino acid residues
from about Ser-1 to about Thr-8, about Thr-9 to about Lys-18, about Thr-23 to
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
49
about His-31, about Phe-32 to about Leu-40, about Cys-43 to about Val-51,
about Thr-56 to aboutTyr-68, about Gln-75 to about Leu-84, about Tyr-126 to
about Ala-135, about Ser-137 to about Leu-146, and about Ser-148 to about
Lys-157. These polypeptide fragments have been determined to bear antigenic
epitopes of the HLF protein by the analysis of the Jameson-Wolf antigenic
index, as shown in Figure 3, above.
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means. See, e.g., Houghten, R. A. ( 1985)
"General method for the rapid solid-phase synthesis of large numbers of
1 o peptides: specificity of antigen-antibody interaction at the level of
individual
amino acids." Proc. Natl. Acad. Sci. USA 82:5131-5135; this "Simultaneous
Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent
No. 4,631.211 to Houghten et al. ( 1986).
Epitope-bearing peptides and polypeptides of the invention are used to
induce antibodies according to methods well known in the art. See, for
instance, Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al.,
Proc.
Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J. et al., J. Gen. Virol.
66:2347-2354 ( 1985}. Immunogenic epitope-bearing peptides of the invention,
i.e., those parts of a protein that elicit an antibody response when the whole
protein is the immunogen, are identified according to methods known in the
art.
See, for instance, Geysen et al., supra. Further still, U.S. Patent No.
5,194,392 to Geysen ( 1990) describes a general method of detecting or
determining the sequence of monomers (amino acids or other compounds)
which is a topological equivalent of the epitope (i.e., a "mimotope") which is
2~ complementary to a particular paratope (antigen binding site) of an
antibody of
interest. More generally, U.S. Patent No. 4,433,092 to Geysen ( 1989)
describes a method of detecting or determining a sequence of monomers which
is a topographical equivalent of a ligand which is complementary to the ligand
binding site of a particular receptor of interest. Similarly, U.S. Patent No.
5,480,971 to Houghten, R. A. et al. ( 1996) on Peralkylated OIigopeptide
Mixtures discloses linear C1-C7-alkyl peralkylated oligopeptides and sets and
libraries of such peptides, as well as methods for using such oligopeptide
sets
and libraries for determining the sequence of a peralkylated oligopeptide that
preferentially binds to an acceptor molecule of interest. Thus, non-peptide
analogs of the epitope-bearing peptides of the invention also can be made
routinely by these methods.
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
Fusion Proteins
As one of skill in the art will appreciate, HLF polypeptides of the
present invention and the epitope-bearing fragments thereof described above
can
be combined with parts of the constant domain of immunoglobulins (IgG),
5 resulting in chimeric polypeptides. These fusion proteins facilitate
purification
and show an increased half-life in vivo. This has been shown, e.g., for
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the heavy or
light chains of mammalian immunoglobulins (EP A 394,827; Traunecker et al.,
t o Nature 331:84-86; 1988). Fusion proteins that have a disulfide-linked
dimeric
structure due to the IgG part can also be more efficient in binding and
neutralizing other molecules than the monomeric HLF protein or protein
fragment alone (Fountoulakis, et al., J. Biochent. 270:3958-3964; 1995).
Furthermore, HLF polypeptides of interest of the present invention, for
15 example the extracellular EGF-like domain shown in Figure lA, can be
combined with a recombinant toxin. Such a fusion polypeptide can be used to
target the toxin, for example Pseudomonas exotoxin A, to a tumor through the
efficient binding of the extracellular or smaller soluble domains of the HLF
molecule of the present invention. In fact, Jeschke and colleagues (Int. J.
20 Cancer 60:730-739; 1995) and Fiddes and coworkers (Cell Growth Differ.
6:1567-1577; 1995) have demonstrated that heregulin-toxin fusion proteins can
be utilized in such a fashion.
Antibodies
HLF-protein specific antibodies for use in the present invention can be
25 raised against the intact HLF protein or an antigenic polypeptide fragment
thereof, which may be presented together with a carrier protein, such as an
albumin, to an animal system (such as rabbit or mouse) or, if it is long
enough
(at least about 25 amino acids), without a carrier.
As used herein, the term "antibody" (Ab) or "monoclonal antibody"
3o (Mab) is meant to include intact molecules as well as antibody fragments
(such
as. for example, Fab and F(ab')2 fragments) which are capable of specifically
binding to HLF protein. Fab and F(ab')2 fragments lack the Fc fragment of
intact antibody, clear more rapidly from the circulation, and may have less
non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med.
35 24:316-325 ( 1983)). Thus, these fragments are preferred.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
51
The antibodies of the present invention may be prepared by any of a
variety of methods. For example, cells expressing the HLF protein or an
antigenic fragment thereof can be administered to an animal in order to induce
the production of sera containing polyclonal antibodies. In a preferred
method,
a preparation of HLF protein is prepared and purified to render it
substantially
free of natural contaminants. Such a preparation is then introduced into an
animal in order to produce polyclonal antisera of greater specific activity.
In the most preferred method, the antibodies of the present invention are
monoclonal antibodies (or HLF protein binding fragments thereof). Such
to monoclonal antibodies can be prepared using hybridoma technology (Kohler et
ul., Nature 256:495 ( 1975); Kohler et ul., Ear. J. Immunol. 6:5 I 1 ( 1976);
Kohler et al., Eur. 1. Immunol. 6:292 ( 1976); Hammerling et al., in:
Monoclonul Antibodies and T Cell Hybridomas, Elsevier, N.Y., ( 1981 ) pp.
563-681 ). In general, such procedures involve immunizing an animal
(preferably a mouse) with a HLF protein antigen or, more preferably, with a
HLF protein-expressing cell. Suitable cells can be recognized by their
capacity
to bind anti-HLF protein antibody. Such cells may be cultured in any suitable
tissue culture medium; however, it is preferable to culture cells in Earle's
modified Eagle's medium supplemented with 10% fetal bovine serum
(inactivated at about 56° C), and supplemented with about 10 g/1 of
nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 ~tg/ml of
streptomycin. The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be employed in
accordance with the present invention; however, it is preferable to employ the
parent myeloma cell line (SP20), available from the American Type Culture
Collection, Rockville, Maryland. After fusion, the resulting hybridoma cells
are
selectively maintained in HAT medium, and then cloned by limiting dilution as
described by Wands et al. (Gastroenterology 80:225-232 ( 1981 )}. The
hybridoma cells obtained through such a selection are then assayed to identify
3o clones which secrete antibodies capable of binding the HLF protein antigen.
Alternatively, additional antibodies capable of binding to the HLF
protein antigen may be produced in a two-step procedure through the use of
anti-idiotypic antibodies. Such a method makes use of the fact that antibodies
are themselves antigens, and that, therefore, it is possible to obtain an
antibody
which binds to a second antibody. In accordance with this method.
HLF-protein specific antibodies are used to immunize an animal, preferably a
mouse. The splenocytes of such an animal are then used to produce hybridoma
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
52
cells, and the hybridoma cells are screened to identify clones which produce
an
antibody whose ability to bind to the HLF protein-specific antibody can be
blocked by the HLF protein antigen. Such antibodies comprise anti-idiotypic
antibodies to the HLF protein-specific antibody and can be used to immunize an
animal to induce formation of further HLF protein-specific antibodies.
It will be appreciated that Fab and F{ab')2 and other fragments of the
antibodies of the present invention may be used according to the methods
disclosed herein. Such fragments are typically produced by proteolytic
cleavage. using enzymes such as papain (to produce Fab fragments) or pepsin
(to produce F(ab')2 fragments). Alternatively, HLF protein-binding fragments
can be produced through the application of recombinant DNA technology or
through synthetic chemistry.
For in vivo use of anti-HLF in humans, it may be preferable to use
"humanized" chimeric monoclonal antibodies. Such antibodies can be produced
using genetic constructs derived from hybridoma cells producing the
monoclonal antibodies described above. Methods for producing chimeric
antibodies are known in the art (Morrison, Science 229: I 202; 1985); Oi, et
al.,
BioTechniques 4:214; 1986; Cabilly, et al., U.S. Patent No. 4,816,567;
Taniguchi, et al., EP 171496; Morrison, et al., EP 173494; Neuberger, et al.,
2o WO 8601533; Robinson, et al., WO 8702671; Bouliannc, et al., Nature
312:643; 1984; Neuberger et al., Nature 314:268; 1985).
Disorders Related to the Regulation of Cell Growth
Diagnosis
The present inventors have discovered that HLF is apparently expressed
detectably only in the amygdala, whole brain, and primary breast culture
tissue.
For a number of disorders related to the regulation of cell growth,
substantially
altered (increased or decreased) levels of HLF gene expression can be detected
in tissues or other cells or bodily fluids (e.g., sera, plasma. urine,
synovial fluid
or spinal fluid) taken from an individual having such a disorder, relative to
a
"standard" HLF gene expression level, that is, the HLF expression level in
such
tissues or bodily fluids from an individual not having the disorder. Thus, the
invention provides a diagnostic method useful during diagnosis of a disorder
related to the regulation of cell growth, which involves measuring the
expression level of the gene encoding the HLF protein in such tissues or other
cells or bodily fluids from an individual and comparing the measured gene
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
53
expression level with a standard HLF gene expression level, whereby an
increase or decrease in the gene expression level compared to the standard is
indicative of a such a disorder.
In particular, it is believed that certain tissues in mammals with breast or
brain cancers express significantly enhanced levels of the HLF protein and
mRNA encoding the HLF protein when compared to a corresponding
"standard" level. Further, it is believed that enhanced levels of the HLF
protein
can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal
fluid) from mammals with such a cancer when compared to sera from mammals
to of the same species not having the cancer.
Thus, the invention provides a diagnostic method useful during
diagnosis of a disorder of the regulation of cell growth, including several
types
of cancers which involves measuring the expression level of the gene encoding
the HLF protein in tissues or other cells or bodily fluids from an individual
and
~ 5 comparing the measured gene expression level with a standard HLF gene
expression level, whereby an increase or decrease in the gene expression level
compared to the standard is indicative of such a disorder.
Where a diagnosis of a disorder of the regulation of cell growth,
including diagnosis of a tumor, has already been made according to
2o conventional methods, the present invention is useful as a prognostic
indicator,
whereby patients exhibiting enhanced HLF gene expression will experience a
worse clinical outcome relative to patients expressing the gene at a level
nearer
the standard level.
By "assaying the expression level of the gene encoding the HLF
25 protein" is intended qualitatively or quantitatively measuring or
estimating the
level of the HLF protein or the level of the mRNA encoding the HLF protein in
a first biological sample either directly (e.g., by determining or estimating
absolute protein level or mRNA level) or relatively (e.g., by comparing to the
HLF protein level or mRNA level in a second biological sample). Preferably,
3o the HLF protein level or mRNA level in the first biological sample is
measured
or estimated and compared to a standard HLF protein level or mRNA level, the
standard being taken from a second biological sample obtained from an
individual not having the disorder or being determined by averaging levels
from
a population of individuals not having a disorder of the regulation of cell
35 growth. As will be appreciated in the art, once a standard HLF protein
level or
mRNA level is known, it can be used repeatedly as a standard for comparison.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
54
By "biological sample" is intended any biological sample obtained from
an individual, body fluid, cell line, tissue culture, or other source which
contains HLF protein or mRNA. As indicated, biological samples include body
fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which
contain free HLF protein, or the extracellular or EGF domains of the HLF
protein, cancerous tissue, and other tissue sources found to express complete
HLF protein, or the extracellular or EGF domains of the HLF protein, or an
HLF receptor. Methods for obtaining tissue biopsies and body fluids from
mammals are well known in the art. Where the biological sample is to include
1 o mRNA, a tissue biopsy is the preferred source.
The present invention is useful for diagnosis or treatment of various
disorders of the regulation of cell growth in mammals, preferably humans.
Such disorders include breast cancer, brain cancers, including neuroblastomas
and glioblastomas, developmental disorders, ovarian cancer, endometrial
> > cancer, some types of colon cancers, and the like.
Total cellular RNA can be isolated from a biological sample using any
suitable technique such as the single-step guanidinium-thiocyanate-phenol-
chloroform method described by Chomczynski and Sacchi (Anal. Biochem.
162:156-159; 1987). Levels of mRNA encoding the HLF protein are then
?o assayed using any appropriate method. These include Northern blot analysis,
S 1 nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction (RT-PCR), and
reverse transcription in combination with the ligase chain reaction (RT-LCR).
Assaying HLF protein levels in a biological sample can occur using
25 antibody-based techniques. For example, HLF protein expression in tissues
can be studied with classical immunohistological methods (Jalkanen, M., et
al.,
J. Cell. Biol. 101: 976-985 ( 1985); Jalkanen, M., et al., J. Cell . Biol.
105:3087-3096 ( 1987)). Other antibody-based methods useful for detecting
HLF protein gene expression include immunoassays, such as the enzyme linked
30 imrrlunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable
antibody assay labels are known in the art and include enzyme labels, such as,
glucose oxidase, and radioisotopes, such as iodine ('ZSI, ''''I), carbon
('°C),
sulfur (;5S), tritium (~H), indium ("-In), and technetium (99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and biotin.
35 In addition to assaying HLF protein levels in a biological sample
obtained from an individual, HLF protein can also be detected in vivo by
imaging. Antibody labels or markers for in viva imaging of HLF protein
CA 02295317 1999-12-17
WO 98/57989
PCT/US98/12403
include those detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium, which emit
detectable radiation but are not overtly harmful to the subject. Suitable
markers
for NMR and ESR include those with a detectable characteristic spin, such as
deuterium, which may be incorporated into the antibody by labeling of
nutrients
for the relevant hybridoma.
A HLF protein-specific antibody or antibody fragment which has been
labeled with an appropriate detectable imaging moiety, such as a radioisotope
(for example, "'1, "'In, yy'"Tc), a radio-opaque substance, or a material
1o detectable by nuclear magnetic resonance, is introduced {for example,
parenterally, subcutaneously or intraperitoneally) into the mammal to be
examined for immune system disorder. It will be understood in the art that the
size of the subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of a
t 5 radioisotope moiety, for a human subject, the quantity of radioactivity
injected
will normally range from about 5 to 20 millicuries of 9y"'Tc. The labeled
antibody or antibody fragment will then preferentially accumulate at the
location
of cells which contain HLF protein. In vivo tumor imaging is described in
S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies
20 and Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. ( 1982)).
Treatment
?5 As noted above, HLF polynucleotides and polypeptides are useful for
diagnosis of conditions involving abnormally high or low expression of HLF
activities. Given the cells and tissues where HLF is expressed as well as the
activities modulated by HLF, it is readily apparent that a substantially
altered
(increased or decreased) level of expression of HLF in an individual compared
3o to the standard or "normal" level produces pathological conditions related
to the
bodily systems) in which HLF is expressed and/or is active.
It will also be appreciated by one of ordinary skill that, since the HLF
protein of the invention is a member of the EGF family the extracellular
domain
of the protein may be released in soluble form from the cells which express
the
35 HLF by proteolytic cleavage. Therefore, when HLF soluble extracellular
domain is added from an exogenous source to cells, tissues or the body of an
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
56
individual, the protein will exert its physiological activities on its target
cells of
that individual.
Therefore, it will be appreciated that conditions caused. by a decrease in
the standard or normal level of HLF activity in an individual, particularly
disorders of cellular growth regulation, can be treated by administration of
HLF
polypeptide (in the form of soluble extracellular domain or cells expressing
the
complete protein. Thus, the invention also provides a method of treatment of
an
individual in need of an increased level of HLF activity comprising
administering to such an individual a pharmaceutical composition comprising an
amount of an isolated HLF polypeptide of the invention, particularly an
extracellular form of the HLF protein of the invention, effective to increase
the
HLF activity level in such an individual.
An individual who is in need of increased HLF activity will not express
a sufficient amount of functional HLF protein, administration of recombinant
t 5 HLF protein, or more simply, of the active extracellular or the active EGF
domain, to such an individual will result in the presence of a sufficient
concentration of HLF activity in the bloodstream. In addition, an individual
who has an abnormally increased level of HLF activity, will require the use of
an HLF antibody or antagonist, as described in the present invention. The use
2o of such HLF antagonists will result in a therapeutic lowering of the
effective
level of HLF activity in the bloodstream. As a result of such treatment, the
affected individual will have an effective concentration of HLF activity which
is
much closer to that of what is deemed "normal". Those of skill in the wt will
recognize other indications where the ability to therapeutically adjust the
level of
25 effective HLF activity is desirable.
It will be further appreciated by one of ordinary skill that HLF may be
used as an additive or supplement for the in vitro culture of certain types of
eukaryotic cells. Many cell types, including primary cell cultures, are highly
fastidious and require a complex mixture of additives to the standard culture
3o medium to result in successful culture and survival of the cells. A number
of
known growth factors and related molecules are currently used as supplements
to the medium of various cells. Such factors may include molecules as
epidermal growth factor (EGF), keratinocyte growth factor (KGF), acidic
fibroblast growth factor (aFGF), insulin-like growth factor (IGF)-I, nerve
35 growth factor (NGF), and many others. Despite the availability and use of
the
collection of growth factors listed above, a large number of cells and cell
types
remain unculturable. either at all or for an extended period of time. Since
CA 02295317 1999-12-17
WO 98/57989 PCT/U598/12403
57
expression of HLF appears to be limited to the amygdala, whole brain, and
primary breast culture tissue or to other neural cells and tissues, HLF is
useful
as an additive or growth factor in the culture of neural and a number of other
cells and cell types.
It will be further appreciated by the skilled artisan, that many cells and
cell types require the absence of a specific growth factor or related molecule
from the culture medium. In the case of culturing cells which require the
absence of HLF from the culture medium, antagonists or antibodies of HLF
described herein may be used to bind to and remove HLF from culture medium
1 o preparations thus resulting in "HLF-free" culture media.
Formulations
The HLF polypeptide composition will be formulated and dosed in a
fashion consistent with good medical practice, taking into account the
clinical
condition of the individual patient (especially the side effects of treatment
with
HLF polypeptide alone), the site of delivery of the HLF polypeptide
composition, the method of administration, the scheduling of administration,
and other factors known to practitioners. The "effective amount" of HLF
polypeptide for purposes herein is thus determined by such considerations.
2o As a general proposition, the total pharmaceutically effective amount of
HLF polypeptide administered parenterally per dose will be in the range of
about 1 pg/kg/day to 10 mg/kg/day of patient body weight, although, as noted
above, this will be subject to therapeutic discretion. More preferably, this
dose
is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day for the hormone. If given continuously, the HLF polypeptide
is typically administered at a dose rate of about I ~g/kg/hour to about 50
~g/kg/hour. either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also be employed. The length of treatment needed to observe changes and the
3o interval following treatment for responses to occur appears to vary
depending
on the desired effect.
Pharmaceutical compositions containing the HLF of the invention may
be administered orally, rectally, parenterally, intracistemally,
intravaginally,
intraperitoneally, topically (as by powders, ointments, drops or transdermal
patch), bucally, or as an oral or nasal spray. By "pharmaceutically acceptable
carrier" is meant a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The term
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
58
"parenteral" as used herein refers to modes of administration which include
intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and
intraarticular injection and infusion.
The HLF polypeptide is also suitably administered by sustained-release
systems. Suitable examples of sustained-release compositions include semi-
permeable polymer matrices in the form of shaped articles, e.g., films, or
mirocapsules. Sustained-release matrices include polylactides (U.S. Pat. No.
3,773,919, EP 58,481 ), copolymers of L-glutamic acid and gamma-ethyl-L-
glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2-
hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Re.s. 15:167-
277 ( 1981 ), and R. Langer, Chem. Tech. 12:98-105 ( 1982)), ethylene vinyl
acetate (R. Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP
133,988). Sustained-release HLF polypeptide compositions also include
liposomally entrapped HLF polypeptide. Liposomes containing HLF
~ 5 polypeptide are prepared by methods known per se: DE 3,218,121; Epstein et
al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 ( 1985); Hwang et al., Proc.
Natl. Acad. Sci. (USA) 77:4030-4034 ( 1980); EP 52,322; EP 36,676; EP
88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat.
Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes
2o are of the small (about 200-800 Angstroms) unilamellar type in which the
lipid
content is greater than about 30 mol. percent cholesterol, the selected
proportion
being adjusted for the optimal HLF polypeptide therapy.
For parenteral administration, in one embodiment, the HLF polypeptide
is formulated generally by mixing it at the desired degree of purity, in a
unit
25 dosage injectable form (solution, suspension, or emulsion), with a
pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients
at the
dosages and concentrations employed and is compatible with other ingredients
of the formulation. For example, the formulation preferably does not include
oxidizing agents and other compounds that are known to be deleterious to
3o polypeptides.
Generally, the formulations are prepared by contacting the HLF
polypeptide uniformly and intimately with liquid carriers or finely divided
solid
carriers or both. Then, if necessary, the product is shaped into the desired
formulation. Preferably the carrier is a parenteral carrier, more preferably a
35 solution that is isotonic with the blood of the recipient. Examples of such
carrier vehicles include water, saline, Ringer's solution, and dextrose
solution.
CA 02295317 1999-12-17
WO 98/57989 PCTNS98/12403
59
Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful
herein,
as well as liposomes.
The carrier suitably contains minor amounts of additives such as
substances that enhance isotonicity and chemical stability. Such materials are
non-toxic to recipients at the dosages and concentrations employed, and
include
buffers such as phosphate, citrate, succinate, acetic acid, and other organic
acids
or their salts; antioxidants such as ascorbic acid; low molecular weight (less
than
about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins,
such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers
such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid,
aspartic acid, or arginine; monosaccharides, disaccharides, and other
carbohydrates including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; counterions such as sodium; and/or nonionic surfactants such as
15 polysorbates, poloxamers, or PEG.
The HLF polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH
of about 3 to 8. It will be understood that the use of certain of the
foregoing
excipients, carriers, or stabilizers will result in the formation of HLF
2o polypeptide salts.
HLF polypeptide to be used for therapeutic administration must be
sterile. Sterility is readily accomplished by filtration through sterile
filtration
membranes (e.g., 0.2 micron membranes). Therapeutic HLF polypeptide
compositions generally are placed into a container having a sterile access
port,
25 for example, an intravenous solution bag or vial having a stopper
pierceable by
a hypodermic injection needle.
HLF polypeptide ordinarily will be stored in unit or mufti-dose
containers, for example, sealed ampoules or vials, as an aqueous solution or
as
a lyophilized formulation for reconstitution. As an example of a lyophilized
3o formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1 % (w/v)
aqueous
HLF polypeptide solution, and the resulting mixture is lyophilized. The
infusion solution is prepared by reconstituting the lyophilized HLF
polypeptide
using bacteriostatic Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising one
35 or more containers filled with one or more of the ingredients of the
pharmaceutical compositions of the invention. Associated with such containers)
can be a notice in the form prescribed by a governmental agency regulating the
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
manufacture, use or sale of pharmaceuticals or biological products, which
notice
reflects approval by the agency of manufacture, use or sale for human
administration. In addition, the polypeptides of the present invention may be
employed in conjunction with other therapeutic compounds.
Agonists and Antagonists - Assays and Molecules
The invention also provides a method of screening compounds to
identify those which enhance or block the action of HLF on cells, such as its
interaction with HLF-binding molecules such as receptor molecules. An agonist
t 0 is a compound which increases the natural biological functions of HLF or
which
functions in a manner similar to HLF, while antagonists decrease or eliminate
such functions.
In another aspect of this embodiment the invention provides a method
for identifying a receptor protein or other ligand-binding protein which binds
t 5 specifically to a HLF polypeptide. For example, a cellular compartment,
such
as a membrane or a preparation thereof, may be prepared from a cell that
expresses a molecule that binds HLF. The preparation is incubated with labeled
HLF. HLF and complexes of HLF bound to the receptor or other binding
protein are isolated and characterized according to routine methods known in
the
20 art. Alternatively, the HLF polypeptide may be bound to a solid support so
that
binding molecules solubilized from cells are bound to the column and then
eluted and characterized according to routine methods.
In the assay of the invention for agonists or antagonists, a cellular
compartment, such as a membrane or a preparation thereof, may be prepared
25 from a cell that expresses a molecule that binds HLF, such as a molecule of
a
signaling or regulatory pathway modulated by HLF. The preparation is
incubated with labeled HLF in the absence or the presence of a candidate
molecule which may be a HLF agonist or antagonist. The ability of the
candidate molecule to bind the binding molecule is reflected in decreased
3o binding of the labeled ligand. Molecules which bind gratuitously, i.e.,
without
inducing the effects of HLF on binding the HLF binding molecule, are most
likely to be good antagonists. Molecules that bind well and elicit effects
that are
the same as or closely related to HLF are agonists.
HLF-like effects of potential agonists and antagonists may by measured,
35 for instance, by determining activity of a second messenger system
following
interaction of the candidate molecule with a cell or appropriate cell
preparation,
and comparing the effect with that of HLF or molecules that elicit the same
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
61
effects as HLF. Second messenger systems that may be useful in this regard
include but are not limited to AMP guanylate cyclase, ion channel or
phosphoinositide hydrolysis second messenger systems.
Another example of an assay for HLF antagonists is a competitive assay
that combines HLF and a potential antagonist with membrane-bound HLF
receptor molecules or recombinant HLF receptor molecules under appropriate
conditions for a competitive inhibition assay. HLF can be labeled, such as by
radioactivity, such that the number of HLF molecules bound to a receptor
molecule can be determined accurately to assess the effectiveness of the
potential
antagonist.
Potential antagonists include small organic molecules, peptides,
polypeptides and antibodies that bind to a polypeptide of the invention and
thereby inhibit or extinguish its activity. Potential antagonists also may be
small
organic molecules, a peptide, a polypeptide such as a closely related protein
or
~ 5 antibody that binds the same sites on a binding molecule, such as a
receptor
molecule, without inducing HLF-induced activities, thereby preventing the
action of HLF by excluding HLF from binding.
Other potential antagonists include antisense molecules. Antisense
technology can be used to control gene expression through antisense DNA or
2o RNA or through triple-helix formation. Antisense techniques are discussed,
for
example, in Okano, J. Neacroclzenz 56: 560 ( 1991 ); "Oligodeoxynucleotides as
Antisense Inhibitors of Gene Expression." CRC Press, Boca Raton, FL ( 1988).
Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6: 3073 ( 1979); Cooney et al., Science 241: 456 ( 1988); and Dervan
25 et al., Science 251: 1360 ( 1991 ). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA. For example, the 5' coding
portion of a polynucleotide that encodes the mature polypeptide of the present
invention may be used to design an antisense RNA oligonucleotide of from
about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be
3o complementary to a region of the gene involved in transcription thereby
preventing transcription and the production of HLF. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the
mRNA molecule into HLF polypeptide. The oligonucleotides described above
can also be delivered to cells such that the antisense RNA or DNA may be
35 expressed in vivo to inhibit production of HLF protein.
The agonists and antagonists may be employed in a composition with a
pharmaceutically acceptable carrier. e.g., as described above. The antagonists
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
62
may be employed for instance to inhibit the binding to, and activation of,
cell
surface receptor molecules belonging to the erbB family, as well as other
known
or unknown cell surface receptor molecules. Consequently, inhibition of such
receptor binding will result in the indirect inhibition of stimulation of the
corresponding signal transduction pathways. Many of the corresponding signal
transduction pathways are involved in the regulation of cell division and
growth. The genesis or acceleration of many cancers resulting from other
related or unrelated mechanisms is linked to abnormally increased levels of
cell
surface receptor molecule stimulation. The activity of an HLF antagonist will
result in blocking an abnormally increased level of HLF activity, and, in
turn,
diminish an abnormally increased level of the stimulation of signal
transduction
pathways. This situation will ultimately result in a return to the normal
regulation of cell division and growth and a corresponding dimunition of the
corresponding oncogenic state. Thus, HLF antagonists of the present invention
may be employed to treat cancers. Any of the above antagonists may be
employed in a composition with a pharmaceutically acceptable carrier, e.g., as
hereinafter described.
Gene Mapping
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a particular location on an individual human chromosome.
Moreover, there is a current need for identifying particular sites on the
chromosome. Few chromosome marking reagents based on actual sequence
data (repeat polymorphisms) are presently available for marking chromosomal
location. The mapping of DNAs to chromosomes according to the present
invention is an important first step in correlating those sequences with genes
associated with disease.
In certain preferred embodiments in this regard, the cDNA herein
disclosed is used to clone genomic DNA of a HLF protein gene. This can be
accomplished using a variety of well known techniques and libraries, which
generally are available commercially. The genomic DNA then is used for in situ
chromosome mapping using well known techniques for this purpose.
In addition, in some cases, sequences can be mapped to chromosomes
by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer
analysis of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA, thus
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
63
complicating the amplification process. These primers are then used for PCR
screening of somatic cell hybrids containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase
chromosomal spread can be used to provide a precise chromosomal location in
s one step. This technique can be used with probes from the cDNA as short as
50
or 60 bp. For a review of this technique, see Verma et al., Human
Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York
( 1988).
Once a sequence has been mapped to a precise chromosomal location,
the physical position of the sequence on the chromosome can be correlated with
genetic map data. Such data are found, for example, in V. McKusick,
Mendelian Inheritance In Man, available on-line through Johns Hopkins
University, Welch Medical Library. The relationship between genes and
diseases that have been mapped to the same chromosomal region are then
~ 5 identified through linkage analysis {coinheritance of physically adjacent
genes).
Next, it is necessary to determine the differences in the cDNA or
genomic sequence between affected and unaffected individuals. If a mutation is
observed in some or all of the affected individuals but not in any normal
individuals, then the mutation is likely to be the causative agent of the
disease.
2o Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of illustration and are not intended as limiting.
Examples
Example 1 (a): Expression and Purification of "GST-tagged "
25 EGF-like Domain of HLF in E. coli
The bacterial expression vector pGEX-3X was used for bacterial
expression in this example (Pharmacia, Inc., Uppsala, Sweden). pGEX-3X
encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial
origin
of replication ("ori"), an IPTG inducible promoter, and a sequence that
encodes
3o an N-terminal, in frame, glutathione S-transferase (GST) tag that allows
affinity
purification using one of the GST Purification Modules, and several suitable
single restriction enzyme cleavage sites. These elements are arranged such
that
an inserted DNA fragment encoding a polypeptide expresses that polypeptide
with an N-terminal GST-fusion protein.
CA 02295317 1999-12-17
WO 98/57989 PCT/I3S98/12403
64
The DNA sequence encoding the desired portion of the HLF protein
comprising the EGF-like domain of the HLF amino acid sequence was
amplified from the deposited cDNA clone using PCR oligonucleotide primers
which annealed to the amino and carboxy terminal sequences of the desired
portion of the HLF protein. Additional nucleotides containing restriction
sites to
facilitate cloning in the pGEX-3X vector were added to the 5' and 3' primer
sequences, respectively. For cloning the EGF-like domain of the HLF protein,
the 5' primer had the sequence 5' GGCGGATCCCTCTTCTTCCTCCTCC 3'
(SEQ ID NO:S) containing the underlined Bam HI restriction site followed by
16 nucleotides of the amino terminal coding sequence of the EGF-like domain
of the HLF sequence in SEQ ID N0:2. The 3' primer had the sequence
5' G G CGAATTCTAAACTTC
TTCACTCTCCATGAATTCAATCCCC 3' (SEQ ID N0:6) containing the
underlined Eco RI restriction site followed by 33 nucleotides complementary to
the 3' end of the EGF-like domain of the HLF DNA sequence in Figure 1 A.
The amplified HLF DNA fragment and the vector pGEX-3X were
digested with Bam HI and Eco RI and the digested DNAs were then ligated
together. Insertion of the HLF DNA into the restricted pGEX-3X vector placed
the HLF protein coding region downstream from the IPTG-inducible promoter
2o and in frame with an initiating AUG and the N-terminal GST fusion tag.
The ligation mixture was transformed into competent E. coli cells using
standard procedures such as those described in Sambrook et al., Molecular
Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY (1989). Plasmid DNA was isolated from resistant
colonies and the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA sequencing.
Clones containing the desired constructs were grown overnight ("O/N")
in liquid culture in LB media supplemented with ampicillin ( 100 j..tg/ml).
The
O/N culture was used to inoculate a large culture, at a dilution of
approximately
0 1:25 to 1:250. The cells were grown to an optical density at 600 nm
("OD600")
of approximately 0.4. Isopropyl-~3-D-thiogalactopyranoside ("IPTG") was then
added to a final concentration of 0.1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacl repressor. Cells
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
subsequently were incubated further for 3 to 4 hours. Cells then were
harvested
by centrifugation, resuspended in IX PBS, and lysed by sonication.
The expressed GST-HLF(EGF domain) fusion protein was purified
using glutathione sepharose 4B essentially as described by the .manufacturer
5 (Pharmacia, Uppsala, Sweden). Briefly, cell lysates were combined with the
glutathione sepharose 4B. The mixture was pelleted by centrifugation and
washed. The GST fusion portion of the polypeptide was cleaved by the
addition of thrombin site-specific protease for 18 hours. Following cleavage,
thrombin was bound to p-Aminobenzmidine agarose beads. The
thrombin-p-Aminobenzmidine agarose bead complexes and the GST-glutathione
sepharose complexes were pelleted by centrifugation. The supernatant then
contained the purified EGF domain of the HLF protein. Purity of the protein
preparation was analyzed by SDS-PAGE. The purified protein was then stored
frozen at -20° C.
Example 2: Cloning and Expression of HLF protein in a
Baculovirus Expression System
In this illustrative example, the plasmid shuttle vector pA2GP is used to
insert the cloned DNA encoding the mature protein, lacking its naturally
2o associated secretory signal (leader) sequence, into a baculovirus to
express the
mature HLF protein, using a baculovirus leader and standard methods as
described in Summers et al., A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures, Texas Agricultural Experimental Station
Bulletin
No. I 555 ( I 987). This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV)
followed by the secretory signal peptide (leader) of the baculovirus gp67
protein
and convenient restriction sites such as Barn HI, Xba I and Asp 718. The
polyadenylation site of the simian virus 40 (SV40) is used for efficient
polyadenylation. For easy selection of recombinant virus, the plasmid contains
3o the beta-galactosidase gene from E coli under control of a weak Drosophila
promoter in the same orientation, followed by the polyadenylation signal of
the
polyhedrin gene. The inserted genes are flanked on both sides by viral
sequences for cell-mediated homologous recombination with wild-type viral
DNA to generate viable virus that expresses the cloned polynucleotide.
CA 02295317 1999-12-17
-__-WO 98/57989 PCT/US98/12403
66
Many other baculovirus vectors could be used in place of the vector
above, such as pAc373, pVL941 and pAcIMI, as one skilled in the art would
readily appreciate, as long as the construct provides appropriately located
signals for transcription, translation, secretion and the like, including a
signal
peptide and an in-frame AUG as required. Such vectors are described, for
instance, in Luckow et al., Virology 170:31-39 ( 1989).
The cDNA sequence encoding the mature HLF protein in the deposited
clone, lacking the AUG initiation codon and the naturally associated leader
sequence shown in SEQ ID N0:2, is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene. The 5' primer
has the sequence 5' GGCGGATCCCCTCTTCTTCCTCCTCC-3' (SEQ ID
N0:7) containing the underlined Barn HI restriction enzyme site followed by 16
nucleotides of the sequence of the mature HLF protein shown in SEQ ID N0:2,
beginning with the indicated N-terminus of the extracellular domain of the HLF
~ 5 protein. The 3' primer has the sequence 5 GGCGGTACCTAAACTTCTTCAC
TCTCCATGAATTCAATCCCC 3' (SEQ ID N0:8) containing the underlined
Asp 718 restriction site followed by 33 nucleotides complementary to the 3'
coding sequence in Figure 1 A.
The amplified fragment is isolated from a 1 % agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragment then is digested with Bam HI and Asp 718 and again is purified on a
1% agarose gel. This fragment is designated herein F1.
The plasmid is digested with the restriction enzymes Bam HI and Asp
718 and optionally, can be dephosphorylated using calf intestinal phosphatase,
using routine procedures known in the art. The DNA is then isolated from a 1 %
agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La
Jolla, Ca.). This vector DNA is designated herein "V 1 ".
Fragment Fl and the dephosphorylated plasmid V 1 are ligated together
with T4 DNA ligase. E. coli HB 101 or other suitable E. coli hosts such as XL-
1 Blue (Statagene Cloning Systems, La Jolla, CA) cells are transformed with
the ligation mixture and spread on culture plates. Bacteria are identified
that
contain the plasmid with the human HLF gene by digesting DNA from
individual colonies using Bam HI and Asp 718 and then analyzing the digestion
product by gel electrophoresis. The sequence of the cloned fragment is
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
67
confirmed by DNA sequencing. This plasmid is designated herein
pA2GPHLF.
Five p.g of the plasmid pA2GPHLF is co-transfected with 1.0 ~g of a
commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus
DNA", Pharmingen, San Diego, CA), using the lipofection method described
by Felgner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 ( 1987). One ~1g
of BaculoGoldTM virus DNA and 5 ~g of the plasmid pA2GPHLF are mixed in
a sterile well of a microtiter plate containing 50 ~l of serum-free Grace's
medium (Life Technologies Inc., Gaithersburg, MD). Afterwards, 10 pl
Lipofectin plus 90 ~tl Grace's medium are added, mixed and incubated for 15
minutes at room temperature. Then the transfection mixture is added drop-wise
to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with 1 ml Grace's medium without serum. The plate is then incubated for 5
hours at 27° C. The transfection solution is then removed from the
plate and 1
ml of Grace's insect medium supplemented with 10% fetal calf serum is added.
Cultivation is then continued at 27° C for four days.
After four days the supernatant is collected and a plaque assay is
performed, as described by Summers and Smith, supra. An agarose gel with
"Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy
2o identification and isolation of gal-expressing clones, which produce blue-
stained
plaques. (A detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and baculovirology
distributed
by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate
incubation, blue stained plaques are picked with the tip of a micropipettor
(e.g.,
25 Eppendorf). The agar containing the recombinant viruses is then resuspended
in a microcentrifuge tube containing 200 ~.1 of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect Sf9 cells
seeded in 35 mm dishes. Four days later the supernatants of these culture
dishes are harvested and then they are stored at 4° C. The recombinant
virus is
3o called V-HLF.
To verify the expression of the HLF gene Sf9 cells are grown in Grace's
medium supplemented with 10% heat-inactivated FBS. The cells are infected
with the recombinant baculovirus V-HLF at a multiplicity of infection ("MOI")
of about 2. If radiolabeled proteins are desired, 6 hours later the medium is
35 removed and is replaced with SF900 II medium minus methionine and cysteine
CA 02295317 1999-12-17
WO 98/57989 PCT,~US98/12403
68
(available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 pCi
of ;5S-methionine and 5 pCi ~'S-cysteine (available from Amersham) are added.
The cells are further incubated for 16 hours and then are harvested by
centrifugation. The proteins in the supernatant as well as the intracellular
proteins are analyzed by SDS-PAGE followed by autoradiography (if
radiolabeled).
Microsequencing of the amino acid sequence of the amino terminus of
purified protein may be used to determine the amino terminal sequence of the
extracellular domain of the HLF protein.
Example 3: Cloning and Expression of HI F in Mammalian Cells
A typical mammalian expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the termination of transcription and
polyadenylation of the transcript. Additional elements include enhancers,
Kozak sequences and intervening sequences flanked by donor and acceptor sites
for RNA splicing. Highly efficient transcription can be achieved with the
early
and late promoters from SV40, the long terminal repeats (LTRs) from
Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the
cytomegalovirus (CMV). However, cellular elements can also be used (e.g.,
p the human actin promoter). Suitable expression vectors for use in practicing
the
present invention include, for example, vectors such as pSVL and pMSG
(Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC
37146) and pBCI2MI (ATCC 67109). Mammalian host cells that could be
used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and
C127 cells. Cos l, Cos 7 and CVl, quail QC1-3 cells, mouse L cells and
Chinese hamster ovary (CHO) cells.
Alternatively, the gene can be expressed in stable cell lines that contain
the gene integrated into a chromosome. The co-transfection with a selectable
marker such as dhfr, gpt, neomycin, hygromycin allows the identification and
3o isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts of
the encoded protein. The DHFR (dihydrofolate reductase) marker is useful to
develop cell lines that carry several hundred or even several thousand copies
of
the gene of interest. Another useful selection marker is the enzyme glutamine
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
69
synthase (GS) (Murphy et al., Biochem J. 227:277-279 ( 1991 ); Bebbington et
al., BiolTechnology 10:169-175 ( 1992)). Using these markers, the mammalian
cells are grown in selective medium and the cells with the highest resistance
are
selected. These cell lines contain the amplified genes) integrated into a
chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for
the production of proteins.
The expression vectors pC 1 and pC4 contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology,
438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al.,
io Cel141:521-530 (1985)). Multiple cloning sites, e.g., with the restriction
enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the
gene of interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin gene.
Example 3(a): Cloning and Expression in COS Cells
The expression plasmid, pHLFHA, is made by cloning a portion of the
cDNA encoding the extracelluar domain of the HLF protein into the expression
vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen,
Inc.). To produce a soluble, secreted form of the polypeptide, the
extracellular
domain is fused to the secretory leader sequence of the human IL-6 gene.
2o The expression vector pcDNAIlamp contains: ( 1 j an E. coli origin of
replication effective for propagation in E. coli and other prokaryotic cells;
(2) an
ampicillin resistance gene for selection of plasmid-containing prokaryotic
cells;
(3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a
CMV
promoter, a polylinker, an SV40 intron; (5) several codons encoding a
hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed
by
a termination codon and polyadenylation signal arranged so that a cDNA can be
conveniently placed under expression control of the CMV promoter and
operably linked to the SV40 intron and the polyadenylation signal by means of
restriction sites in the polylinker. The HA tag corresponds to an epitope
derived
3o from the influenza hemagglutinin protein described by Wilson et al., Cell
37:767 ( 1984). The fusion of the HA tag to the target protein allows easy
detection and recovery of the recombinant protein with an antibody that
recognizes the HA epitope. pcDNAIII contains, in addition, the selectable
neomycin marker.
CA 02295317 1999-12-17
WO 98/57989 PCT/tlS98/12403
A DNA fragment encoding the extracellular domain of the HLF
polypeptide is cloned into the polylinker region of the vector so that
recombinant
protein expression is directed by the CMV promoter. The plasmid construction
strategy is as follows. The HLF cDNA of the deposited clone is amplified
5 using primers that contain convenient restriction sites, much as described
above
for construction of vectors for expression of HLF in E. coli. Suitable primers
include the following, which are used in this example. The S' primer,
containing the underlined Bum HI site, a Kozak sequence, an AUG start codon,
a sequence encoding the secretory leader peptide from the human IL-6 gene, and
16 nucleotides of the 5' coding region of the extracellular domain of the HLF
polypeptide, has the following sequence:
5' GCCGGATCCGCCACCATGAAC
TCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCT
GCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTCTCTTCTTCCTC
t5 CTCC 3' (SEQ ID N0:9). The 3' primer, containing the underlined Xba I and
33 of nucleotides complementary to the 3' coding sequence immediately before
the stop codon, has the following sequence:
5' GGCTCTAGATAAACTTCTTCAC
TCTCCATGAATTCAATCCCC 3' (SEQ ID NO:10).
2o The PCR amplified DNA fragment and the vector, pcDNA1/Amp, are
digested with Bam HI and Xba I and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the
transformed culture is plated on ampicillin media plates which then are
incubated
25 to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated
from
resistant colonies and examined by restriction analysis or other means for the
presence of the fragment encoding the extracellular domain of the HLF
polypeptide
For expression of recombinant HLF, COS cells are transfected with an
p expression vector, as described above, using DEAE-DEXTRAN, as described,
for instance, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold
Spring Laboratory Press, Cold Spring Harbor, New York ( 1989). Cells are
incubated under conditions for expression of HLF by the vector.
Expression of the HLF-HA fusion protein is detected by radiolabeling
~5 and immunoprecipitation, using methods described in. for example Harlow et
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
71
al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York ( 1988). To this end, two days after
transfection, the cells are labeled by incubation in media containing ;SS-
cysteine
for 8 hours. The cells and the media are collected, and the cells are washed
and
the lysed with detergent-containing RIPA buffer: 150 mM NaCI, 1 % NP-40,
0.1 % SDS, 1 % NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by
Wilson et al. cited above. Proteins are precipitated from the cell lysate and
from
the culture media using an HA-specific monoclonal antibody. The precipitated
proteins then are analyzed by SDS-PAGE arid autoradiography. An expression
product of the expected size is seen in the cell lysate, which is not seen in
negative controls.
Example 3(b): Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of HLF polypeptide. Plasmid
pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146).
To produce a soluble, secreted form of the polypeptide, the extracellular
domain
is fused to the secretory leader sequence of the human IL-6 gene. The plasmid
contains the mouse DHFR gene under control of the SV40 early promoter.
Chinese hamster ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the cells in a
20 selective medium (alpha minus MEM, Life Technologies) supplemented with
the chemotherapeutic agent methotrexate. The amplification of the DHFR genes
in cells resistant to methotrexate (MTX) has been well documented (see, e.g.,
Alt, F. W., Kellems, R. M., Bertino, J. R., and Schimke, R. T., 1978, J.
Biol. Cheat. 253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et
25 BioplZyS. Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-68). Cells grown in increasing concentrations of MTX
develop resistance to the drug by overproducing the target enzyme, DHFR, as a
result of amplification of the DHFR gene. If a second gene is linked to the
DHFR gene, it is usually co-amplified and over-expressed. It is known in the
3o art that this approach may be used to develop cell lines carrying more than
1,000
copies of the amplified gene(s). Subsequently, when the methotrexate is
withdrawn, cell lines are obtained which contain the amplified gene integrated
into one or more chromosomes) of the host cell.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
72
Plasmid pC4 contains for expressing the gene of interest the strong
promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus
(Cullen, et al., Molecular and Cellular Biolng~y. March 1985:438-447) plus a
fragment isolated from the enhancer of the immediate early gene of human
cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530 ( 1985)). Downstream
of the promoter are the following single restriction enzyme cleavage sites
that
allow the integration of the genes: BamHI, Xba I, and Asp718. Behind these
cloning sites the plasmid contains the 3' intron and polyadenylation site of
the
rat preproinsulin gene. Other high efficiency promoters can also be used for
the
o expression, e.g., the human f3-actin promoter, the SV40 early or late
promoters
or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
Clontech's Tet-Off and Tet-On gene expression systems and similar systems
can be used to express the HLF polypeptide in a regulated way in mammalian
cells (Gossen, M., & Bujard, H. 1992, Proc. Natl. Acud. Sci. USA 89:5547-
5551 ). For the polyadenylation of the mRNA other signals, e.g., from the
human growth hormone or globin genes can be used as well. Stable cell lines
carrying a gene of interest integrated into the chromosomes can also be
selected
upon co-transfection with a selectable marker such as gpt, 6418 or
hygromycin. It is advantageous to use more than one selectable marker in the
2o beginning. e.g., G4 i 8 plus methotrexate.
The plasmid pC4 is digested with the restriction enzymes Barn HI and
Asp 718 and then dephosphorylated using calf intestinal phosphates by
procedures known in the art. The vector is then isolated from a 1 °lo
agarose gel.
The DNA sequence encoding the extracellular domain of the HLF
~5 polypeptide is amplified using PCR oligonucleotide primers corresponding to
the 5' and 3' sequences of the desired portion of the gene. The 5' primer
containing the underlined Bum HI site, a Kozak sequence, an AUG start codon,
a sequence encoding the secretory leader peptide from the human IL,-6 gene,
and 16 nucleotides of the 5' coding region of the extracellular domain of the
3o HLF polypeptide, has the following sequence (where Kozak is in italics):
5'GCCGGATCCGCCACCATGAACTCCTTCTCCACAAGCGCCTTCGGT
CCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTT
CCCTGCCCCAGTCTCTTCTTCCTCCTCC 3' (SEQ ID N0:9). The 3'
primer, containing the underlined Asp 718 restriction site and 33 nucleotides
35 complementary to the 3' coding sequence immediately before the stop codon
as
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
73
shown in Figure lA (SEQ ID NO: l ), has the following sequence:
5' GGCGGTACCTAAACTTCTTCACTCTCCATGAATTCAATCCCC 3'
(SEQ ID N0:8).
The amplified fragment is digested with the endonucleases Bam HI and
Asp 718 and then purified again on a I % agarose gel. The isolated fragment
and the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli
HB 101 or XL-1 Blue cells are then transformed and bacteria are identified
that
contain the fragment inserted into plasmid pC4 using, for instance,
restriction
enzyme analysis.
Chinese hamster ovary cells lacking an active DHFR gene are used for
transfection. Five ~tg of the expression plasmid pC4 is cotransfected with 0.5
ug of the plasmid pSVneo using lipofectin (Felgner et al., supra). The plasmid
pSV2-neo contains a dominant selectable marker, the neo gene from Tn5
encoding an enzyme that confers resistance to a group of antibiotics including
6418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml
6418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning
plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or
SO ng/ml of metothrexate plus 1 mg/tnl 6418. After about 10-14 days single
clones are trypsinized and then seeded in b-well petri dishes or 10 ml flasks
2o using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400
nM, 800 nM). Clones growing at the highest concentrations of methotrexate are
then transferred to new 6-well plates containing even higher concentrations of
methotrexate ( 1 pM, 2 p.M, 5 ~tM, 10 mM, 20 mM). The same procedure is
repeated until clones are obtained which grow at a concentration of 100 - 200
l~M. Expression of the desired gene product is analyzed, for instance, by SDS-
PAGE and Western blot or by reversed phase HPLC analysis.
Example 4: Tissue distribution of HI F mRNA expression
Northern blot analysis is carried out to examine HLF gene expression in
human tissues, using methods described by, among others, Sambrook et al.,
3o cited above. A cDNA probe containing the entire nucleotide sequence of the
HLF protein (SEQ ID NO: I ) is labeled with 3'-P using the rediprimeTM DNA
labeling system (Amersham Life Science), according to manufacturer's
instructions. After labeling, the probe is purified using a CHROMA
SPIN-100T"' column (Clontech Laboratories, Inc.), according to manufacturer's
CA 02295317 1999-12-17
WO 98/57989 PCT/US98112403
~a
protocol number PT1200-1. The purified labeled probe is then used to examine
various human tissues for HLF mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or human immune system tissues (IM) are obtained from Clontech and are
examined with the labeled probe using ExpressHybTM hybridization solution
(Clontech) according to manufacturer's protocol number PT1190-1. Following
hybridization and washing, the blots are mounted and exposed to film at -
70° C
overnight, and films developed according to standard procedures.
1o Example 5: Analysis of erbB Receptor Family Activation:
To test for the ability of recombinant EGF domain of the HLF protein
(as produced in Example 1) to activate erbB family members, a tyrosine kinase
activation assay was used as follows. In this analysis, a human breast cancer
cell line (MCF-7) was allowed to become quiescent by extended culture in low
serum medium. Exogenous recombinant EGF domain of the HLF protein ( 10
mg.mL) or recombinant heregulin (0.1 mg.mL) were added to the growth
medium, and cell culture was continued in the presence or absence of
exogenous protein for 30 minutes. Cells were harvested and lysed by the
addition of SDS-containing sample buffer ( 1 % SDS, O.15M Tris, pH 8.6, 5%
2o BME, and 1 mM sodium ortho-vanadate).
Cell lysates were then subject to SDS-PAGE on 16-20% Tris-glycine
gradient gels {Novex). Subsequently, electrophoretically separated proteins
were transferred to a Hybond ECL nitrocellulose membrane (Amersham).
Tyrosine phosphate containing proteins were identified by immunoblotting
using anti-phosphotyrosine antibodies.
As shown in Figure 4, there is a clear increase in the tyrosine
phosphorylation of proteins in the size range of approximately 185 kDa in
samples prepared from cultures which were grown in medium which contained
the recombinant EGF domain of the HLF protein. The erbB family of cell
3o surface receptor molecules consists of at least four members, all of which
are
roughly the molecular mass of the proteins observed to increase in tyrosine
phosphorylation in this analysis. Furthermore, treatment of MCF-7 cells with
recombinant heregulin in this analysis produced a similar result with regard
to a
change in the tyrosine phosphorylation state of cellular proteins.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
These results strongly suggest that recombinant EGF domain of the
HLF protein was able to activate phosphorylation of at least one of the
members
of the erbB family of cell surface receptors expressed in these cells.
5 Example 6: HLF in Breast Cancer Cells, Activation of Multiple
erbB Proteins:
INTRODUCTION
Increased activity of members of the erbB family has been implicated in
the development of cancer. Different molecular mechanisms of activation have
1o been identified. The ligands of the EGF/Heregulin family are
inappropriately
expressed in breast cancers. EGF, a-TGF, amphiregulin and heregulin are
expressed in breast cancers containing appropriate receptors thus leading to
autocrine growth stimulation. The importance of autocrine growth stimulation
is required for the transformation of NIH/3T3 cells with high levels of EGF
15 receptor, since full morphological transformation requires the co-
expression of
a-TGF. The causative role of autocrine growth stimulation by a-TGF in breast
cancer is demonstrated in experiments using transgenic animals where the
expression of a-TGF acts synergistically to produce frequent breast cancers.
These findings indicate that the co-incident expression of erbB receptor
proteins
2o with their ligands can result in aberrant cell growth. Moreover, in 20% of
breast cancers amplification of the erbB2 gene results in overexpression of
p185erba-=. In these cancers activation of signalling has been thought to be
independent of ligand activation. Overexpression of p185erbB-' is an oncogenic
event in experimental systems. To date no ligand has been isolated that binds
25 only to erbB2. However, recent studies show that erbB2 can form part of a
receptor for heregulin. Overexpression of the erbB 1 (EGFR) protein is
common, although gene amplification is infrequent in breast cancer.
The erbB receptors bind their ligands as dimers - formed from two
identical erbB proteins (homodimers) or from two different proteins
30 (heterodimers). EGF can bind homodimers of erbB 1 (EGFR) or heterodimers
of erbB 1 and erbB2. Similarly, Heregulin lh can bind homodimers of erbB4 or
heterodimers of erbB2 and erbB3. Other ligands of the EGF/Heregulin family
have receptors formed by homo and heterodimers of erbB proteins. Ligand
binding and dimer formation leads to increased autophosphorylation of the
35 receptor proteins and substrates activating intracellular signalling
pathways.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
76
The cellular consequences of receptor stimulation by members of the
EGF/Heregulin family vary with the iigand and cellular context. EGF and
a-TGF can stimulate the growth of many cells in culture, but in cases of
breast
cancers that overexpress the EGF Receptor, EGF can be growth inhibitory at
concentrations above approximately 10 nM. In a similar way, heregulin can
both stimulate growth of some human cancer cells as well as inhibit those that
overexpress erbB2. The display of erbB proteins on breast cancer cells is not
uniform. Many cells lack one or more of the family and others greatly
overexpress erbBl or erbB2. Heregulin clearly has effects on cell morphology
as evidenced by changes in the actin cytoskeleton. Heregulin seems to play a
number of specialized roles in appropriate regulation the neuro-muscular
junction, between neuronal and glial cells and in Schwann cell development. In
prenatal development heregulin and erbB2 and erbB4 control in morphogenesis
of brain and heart. These findings indicate that members of the EGF/Heregulin
family can have differing effects on cell phenotype.
In this study we characterize a new ligand for the EGF/Heregulin family
of growth factors. Our results indicate that HLF binds and activates multiple
members of the erbB family of receptors. We demonstrate that HLF is
expressed in a human breast cancer cell line and can alter the growth of human
breast cancer cell lines. These results indicate that HLF may have in vivo
effects on the growth of the normal and malignant breast epithelial cells.
RESULTS
HLF contains an EGF like domain.
The ligands of the EGF/Heregulin family have a well-defined sequence
similarity which we used to identify HLF. Figure 5 shows a compilation of
known ligands of the EGF/Heregulin family; all contain 6 cysteines. Between
the fourth and sixth cysteine is the common EGF-like folding motif containing
a
conserved hydrophobic amino acid (Y37 (Tyr-68 of SEQ ID N0:2)) and a
3o conserved glycine (G39 (Gly-70 of SEQ ID N0:2)). This region apparently
forms a very stable core structure that is used in many extracellular
proteins.
Sequence similarity among the ligands is not limited to this folding motif.
There
is an exactly conserved arginine (R41 (Arg-72 of SEQ ID N0:2)) and
hydrophobic amino acids at positions 14 and 16 (Asn-45 and Asp-46 of SEQ ID
N0:2). A hydrophobic amino acid that is required for binding activity is found
at position 46 or 47 (Leu-77 or Pro-78 of SEQ ID N0:2). The number of
amino acids between cysteines is similar among the ligands with the notable
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
77
exception of loop B and loop C. Heregulins have a loop C which is three amino
acids longer than the EGF-like ligands. The overall sequence similarity among
the EGF/Heregulin family members is 19-42% (except between Hrgla and
Hrg 1 b which are derived from the same gene). Recently, NRG2 has been
identified in rat brain. NRG2 is most closely related to Hrglh with sequence
identity of 42°lo in the EGF like domain.
Using a consensus sequence derived from EGF and Heregulin
sequences we screened the HGS database of over 800,000 sequences. As
shown in Figure 5, one cDNA encoded the HLF sequence which has 34-38%
I o similarity to EGF and Heregulin Family within the EGF-like domain.
Importantly, in the HLF sequence, all of the conserved cysteine residues, the
R41, and the G39 (Gly-70 and Arg-72 of SEQ ID N0:2, respectively) are
exactly conserved. There is additional sequence conservation in NRG-3,
notably hydrophobic amino acids at positions 13, 15, 37 and 46-47 (Leu-44,
Asp-46, Tyr-68, and Leu-77-Pro-78 of SEQ ID N0:2, respectively). The
length of the B and C loops are more similar to heregulin than EGF. Within the
coding frame defined by our current cDNA clone there is a sequence of
hydrophobic amino acids that is consistent with a transmembrane domain C-
terminal to the EGF-like domain. This structure is similar to the
transmembrane
2o domains found in a-TGF, EGF, heregulin and other ligand precursor proteins
(not shown in Figure 5). The sequence attributes of the HLF eDNA make it a
strong candidate as encoding a novel growth factor binding one or several of
the
erbB family of receptors. NGR-2 is 36% identical to HLF in the highly
conserved EGF-like domain therefore they are products of distinct genes. Don-
1 has also been recently and independently identified by sequence similarity
to
EGF/Heregulin and is apparently the product of the same gene as NRG-2.
Demonstration that HLF activates erb8 family proteins.
In order to obtain an initial estimation for the action of HLF as a ligand
3o for erbB family of receptors we generated recombinant protein in E. coli
using a
GST fusion system (see also Example 1}. The EGF-like domain of HLF was
released and purified from the GST by thrombin cleavage. The resulting protein
contained a single polypeptide when analyzed by SDS-PAGE.
To test for the ability of recombinant HLF to activate receptors of the erbB
family we used a tyrosine kinase activation assay. Tyrosine phosphate
containing proteins were then identified by immunoblotting using
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
78
anti-phosphotyrosine antibodies. We found a clear increase in the tyrosine
phosphorylation at ~p185 when recombinant HLF is applied to MCF-7. In
MCF-7 cells recombinant heregulin- I h results in a large increase in tyrosine
phosphorylated proteins at about this size. These results indicate that
recombinant HLF is able to activate phosphorylation of at least one of the
members of the erbB family expressed in MCF-7 cells.
HLF Activates multiple erbB proteins.
In order to begin the analysis of the HLF receptor we used an
1o experimental system where the display of erbB proteins can be controlled.
The
32D cell is a murine myeloid cell line which is devoid of expression of genes
of
the erbB family. Growth of 32D cells is dependent on the IL-3 present in
WEHI conditioned media. When expression constructs encoding an erbB
protein are introduced into 32D cells the resulting cell can survive in the
absence
s of IL-3 if an appropriate EGF/Heregulin family member is present. For
example, the introduction of EGF Receptor expression leads to growth of 32D
cells in the presence of EGF or aTGF and introduction of erbB4 allows growth
in heregulin. Similar experimental systems have been used to examine the
receptor specificity of the newly discovered NRG-2. We also show that growth
20 of 32D cells in the presence of HLF occurs only when EGF Receptor or erbB4
are present singly or when erbB2 and erbB3 are present in combination. The
expression of erbB2 or erbB3 alone does not lead to HLF induced growth. To
confirm that this growth stimulation was the result of receptor activation we
determined whether HLF induces the tyrosine phosphorylation of EGF
25 Receptor, erbB4 or erbB2 and erbB3 when expressed together. We show the
appearance of an appropriate sized band when cell lysates of these 32D cells
are
probed by antiphosphotyrosine antibodies. These results are strong evidence
that HLF can activate erbBl homodimers (the EGF receptor), erbB4
homodimers, and erbB2 + erbB3 heterodimers.
30 The results of 32D experiments indicate that the receptor binding pattern
of HLF is complex. In order to confirm that HLF activates proteins other than
erbB4 in MCF-7 cells we immunoprecipitated erbB3 and determined the level of
tyrosine phosphorylation by immunoblot. We also observed that erbB3 is
phosphorylated on tyrosine as a consequence of HLF stimulation.
Biological Activity of HLF.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
79
The effects of the EGF/Heregulin family vary significantly. Differing
cellular phenotypes. can be induced by different ligands in the same cell
system
and the same ligand can cause differing effects among different cells.
Mitogenic
activity of HLF has been detected in 32D cell experiments. The MCF-7 cell is
dependent on estrogens in the media either in the form of phenol red or
present
in the fetal bovine serum. Little proliferation is seen in phenol red free
media
containing serum treated with charcoal to remove steroids. Heregulin is able
to
promote growth in the absence of estrogen. When HLF is added there is also a
clear growth stimulation. Growth inhibitory effects have also been observed.
to HLF inhibits the growth of the breast cancer cell line MDA-MB-468. These
cells overexpress the EGF receptor and can be stimulated by EGF at low
concentrations (< 10 nM) and growth inhibited at higher concentrations (> 10
nM). HLF was found to inhibit growth of MDA-MB-468 under conditions
similar to those producing growth stimulation of 32D cells containing EGF
~ 5 Receptor. No growth suppression or stimulation are seen when HLF is
applied
to MCF-7 cells when they are grown in media containing agonists for the
estrogen receptor.
HLF MRNA expression in breast cancer.
2o Preliminary experiments using northern blotting methods showed a
weak signal for HLF mRNA in adult brain with a size of approximately 2 kD
(data not shown). Similar northern blot results are reported in the recent HLF
study. Because of the weakness of this signal we have used RT-PCR to detect
HLF mRNA. We have confirmed expression in the brain and detect equivalent
25 signals in samples of normal and breast cancer tissue. RT-PCR employed two
primer sets. The two primer sets generated concordant results. This indicates
that the bands observed by RT-PCR were due to actual HLF mRNA. In
addition all assays included control reactions lacking reverse transcriptase
in
order to detect the presence of contaminating DNA. The observed band at 340
3o by corresponds to the predicted size based on the HLF cDNA. It was cloned
sequenced and shown to contain HLF coding information. Bands at 500 by and
I20 by were also sequenced. These do do not contain HLF coding information
and thus likely represent mispriming by the RT-PCR oligonucleotides on
unrelated mRNAs. These results are strong evidence that HLF can be
35 expressed in human breast cancer cell lines.
CA 02295317 1999-12-17
WO 98/57989 PCT/US98l12403
DISCUSSION
Our results suggest that HLF can bind and activate erbB 1 and
heterodimers of erbB2 + erbB3. Taken together the available data suggests that
the precise receptor binding and activation profile of HLF is complex. Our
5 results demonstrate that erbB3 can be phosphorylated as a consequence of HLF
binding. The HLF induced increases in tyrosine phosphorylation on erbB3
suggests that the erbB3 protein can be part of an HLF receptor. Our studies of
32D cells supports this conclusion where erbB2 is the other member of the
heterodimeric receptor with erbB3. Still to be determined is whether HLF can
1 o bind to erbB 1 + erbB3 heterodimers or erbB3 + erbB4 heterodimers or erbB2
+
erbB4 heterodimers. Our preliminary data does conclusively demonstrate that
HLF is a new ligand for the erbB family of receptors. These results suggest
that HLF may have a receptor specificity somewhat analogous to b-cellulin.
In adult tissue expression levels of HLF are low but detectable using
t 5 sensitive methods such as RT-PCR. HLF is expressed at the highest levels
in
brain where it is likely to play a critical role in morphogenesis.
Interestingly,
we identify HLF expression a breast cancer cell line, MCF-7, that clearly has
receptors that can be activated by HLF. Our results also show that HLF can
cause alteration of growth of MCF-7 cancer cells in vitro. The ability to
cause
2o growth of MCF-7 cells in the absence of estrogen is similar to that
previously
reported for heregulin. Our results suggest that effects on cell phenotype by
HLF may depend on the cell line. MDA-MB-468 which has high levels of
EGFR are growth inhibited by HLF in vitro.
The results in this paper together with those recently reported earlier
25 identify HLF as a new ligand for the erbB family of growth factor receptors
and
suggest a role for HLF in the growth regulation of normal and malignant breast
epithelial cells.
MATERIALS AND METHODS
30 Preparation of Recombinant HLF. Preparation of recombinant HLF is
also described in Example 1. In the case of the protein produced in this
Example, the coding segment containing the EGF-like domain of HLF
(nucleotide 79 to 279 of HGS38) were amplified by PCR and inserted into the
pGEX3 plasmid for expression as a fusion protein with bacterial glutathione S
35 transferase. Protein was prepared using standard methods. Bacteria were
cultured to an OD6~, of approximately 0.4 and induced to express recombinant
protein by addition of 0.1 mM IPTG. Bacteria were collected by centrifugation
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
81
resuspended in 1X PBS and lysed by sonication. Recombinant protein was
collected by incubation with glutathione beads. After washing the recombinant
HLF protein was cleaved from the GST bound to the beads by thrombin
cleavage for 18 hours. Thrombin was removed by incubation with
p-Aminobenzamidine agarose beads. Refolding followed the methods used for
the preparation of recombinant antibody fragments. Briefly, recombinant HLF
was denatured in 6 M guanidine HCL containing 65 mM DTE. This was
rapidly diluted 100 fold to a final protein concentration of 100 ~g/ml into
0.4 M
Arginine, 0.1 M Tris pH 8.0, 0.9mM oxidized glutathione 2.0 mM EDTA.
to Refolding was allowed to proceed for 24 hours at 4°C. Refolded
protein was
extensively dialyzed against PBS using 3000 ILDa cutoff membranes. Protein
preparations were stored at -20°C.
Detection of receptor activation by phosphotyrosirte immunoblot
Cells were starved (24 hours for MCF-7, 4 hours for 32D derived cell
lines) before addition of the indicated amounts of growth factors. Total cell
lysates were prepared by addition of SDS PAGE sample buffer ( 1 % SDS,
O.15M Tris pH 8.6, 5% BME and 1 mM Sodium OrthoVanadate) directly to
cells. Cell lysates and were run on 8-16% Tris-Glycine gradient gels (Novex).
Proteins were transferred onto Hybond ECL nitrocellulose membranes
(Amersham) and were immunoblotted with anti-phosphotyrosine MAb.
32D cell e.~periments.
32D cells containing expression constructs for erbBl, erbB2, erbB3,
erbB4 and erbB2 and erbB3 together were grown in IL-3 containing (WEHI
conditioned media) or Hrg-lb prior to the experiment. Expression of the erbB
proteins was verified by FACS analysis using erbB-specific antisera. Cells (
104
per well) were plated in 24 well dishes in the absence of IL-3 containing
media
(DMEM, 10% FCS) or in the presence of the indicated growth factors,
3o heregulin-1 b ( 100 ng/ml), EGF ( 100 ng/ml), and HLF ( 10 ~g/ml). Cells
were
allowed to grow for 3 days and viable cells counted using a hemocytometer.
Inunmzoprecipitation and Immunoblot of erbB3.
Cells were plated in 80 cm'- dishes (DMEM + 10% FCS) for until 80%
confluent. Cells were then allowed to become quiescent in serum free media
(DMEM) for 24 hours. Cells were then stimulated with the indicated growth
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
82
factors. heregulin-Ib ( 1 ~g/ml). and HLF ( 10 ug/ml) for 15 minutes. Cells
were lysed in 1 % Triton X 100 in PBS containing 1 mM Sodium orthovanadate.
Nuclei were removed by centrifugation. erbB3 proteins were immuno
recipitated (2 hours at 40°C) using monoclonal anti-erbB3 antibodies
(Neomarkers) and collected on protein A sepharose. Proteins were released by
incubation in 1 % SDS containing PAGE sample buffer at 100°C and
electrophoresed on 8-16% gels (Novagen). Proteins were transferred to
nitrocellulose. Proteins containing pTyr were detected using monoclonal
anti-phosphotyrosine antibodies (~ncogene Science) and the ECL detection
I o system (Amersham).
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
83
Growth Assays.
Cells were plated in IMEM+ i0% FBS at 3000 cells per well in 96 well
dishes. Cells were allowed to become quiescent in serum free IMEM for 24
hours and growth factors EGF (2 ng/ml) and HLF ( 10 ~g/ml) were added to the
media. Growth of cells at l, 3, and 5 days was monitored using the XTT assay
method. XTT was added at 10 ~g/ml in IMEM and PMS ( 1.5 mg/ml in PBS) to
25% of volume of well for 4 hours at 37°C. OD monitored at 540 nm.
Detection of HLF ntRNA.
I o Total RNA was extracted from cultured cells using the RNazolB method
(Tel-Test. CS-104). The final RNA pellet was resuspended in 135 ul DEPC
treated H,O. DNase treatment was performed using the SNAP RNA isolation
kit (lnvitrogen, K1950-O1). Briefly, IOX DNase buffer and RNase free DNase
I was added to each sample and incubated for 20 min at 37°C. RNA
purification was performed as indicated in the kit. Concentration of each
sample
was determined, samples were dried and resuspended to give a final
concentration of 2 ~g/ul.
RT-PCR was performed using 2 ~g of total RNA in the Gene Amp RNA
PCR Core kit (Perkin Elmer, N808-0143). cDNA was synthesized using the
2o downstream primer 5'-CCA CGA TGA CAA TTC CAA AG-3' (SEQ ID
N0:20). Samples were reverse transcribed 1 h at 37°C. RT was heat
inactivated 5 min at 99°C, samples were cooled on ice. PCR was
performed
with the entire RT reaction using the upstream primer 5'-TAC CAC CAC CAC
ACC AGA AA-3' (SEQ ID N0:21 ). The reaction was performed for 40 cycles,
1 nun at 94°C, 1 min 30 sec at 58°C, 2 min at 72°C
followed by an extension
for 8 min at 72°C. Samples were elctrophoresed on an agarose gei and
visualized with ethidium bromide staining.
Confirmation of the sequence of the bands was performed by purifying
the bands from agarose gel slices (Wizard PCR preps DNA purification system,
3o Promeoa, A7170) and cloning into a TA vector (Invitrogen, K2000-JIO) for
automated sequencing. Bands of unknown identity present in the reaction
products were cloned and sequenced in a similar fashion.
CA 02295317 1999-12-17
WO 98!57989 PCT/US98/12403
84
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples. Numerous
modifications and variations of the present invention are possible in light of
the
above teachings and, therefore, are within the scope of the appended claims.
The entire disclosure of all publications (including patents, patent
applications, journal articles, manuscripts, laboratory manuals, books, or
other
documents) cited herein are hereby incorporated by reference.
CA 02295317 1999-12-17
WO 98157989 PCT/US98/12403
SEQUENCE LISTING
(1) GENERAL INFORMATIODI:
(=) APPLICANT: Young, Paul
King, C. Richter
Hijazi, Mai
Ruben, Steve
(ii) TITLE OF INVENTION: Hereguiin-Like Factor
(ii.) NUMB?R OF SEQUENCES: 22
(i~.) CORRESPONDENCE ADDRESS:
(A) ADDRESSES: Human Genome Sciences, Inc.
(B) STREET: 9410 Key West Avenue
(C) CITY: Rockville
(D) STATE: MD
(E; COUNTRY: US
(_) Z_TP: 20850
!-;! COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Versicn #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/049,942
(B) FILING DATE: 17-JUN-1997
(viii) ATTORNEY/AGE,.T'INFORM.~TiON:
(ANAME: Hoover, Kenley K.
(B) REGISTRATION DIUMBER: 40,302
(C) REFERENCE/DOCKET NUMBER: PF383
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 301-3098509
(B) TELEFAX: 301-309-8439
( 2 ) I~IF ORMATION FOR SEQ ID N0: 1
(i) SEQUENCE CHARACTERISTICS:
(A; LENGTH: 2199 base pairs
(B) TYPE: nucleic acid
(C; S=RANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECUJE TYPE: DNA (genomic)
(ix; FE:~'_"URE:
( Ai NA_'~IE/KEY: CDS
(B) LOCATION: 2..475
CA 02295317 1999-12-17
WO 98/57989 PCT/US98112403
86
(xi) SEQUENCE DESCRIPTION:
SEQ ID N0:1:
C TCT TCT TCC TCC TCC GCT 4c
ACC ACC ACC ACA CCA GP.A
ACT AGC ACC
Ser Ser Ser Ser Ser Ala
'T'hr Thr Thr Thr Pro
G'_u Thr Sar Thr
1 5 10 15
AGC CCC AAA TTT CAT ACG T:'.'.' GAG CGA TC~~ GAG 9y
P.CG ACA TCC ACA CAC
Ser Pro Lys P:ne His Thr Tyr Ser Glu Arg Ser Glu His
T'nr Thr Thr
20 25 30
TTC AAA CCC TGC CGA GAC CTT GCA TGT CTC AAT GAT GGC 142
PAG GAC TAC
Phe Lys Prc Cys Arg Asp Leu Ala Cys Leu Asn Asp Gly
Lys Asp Tyr
35 4C 45
GAG TGC TTT G T G AT~~ ACC GGA CAT AArz CAC TGT 19C
GA.~1 ACC CTG TCC CGG
Glu Cys Phe Val Ile Glu Thr Gly His Lys His Cys Arg
Thr Leu Se_-
SO 55 CO
TGC AAA GA.~. GGC TAC CAA C~~ TG'_" CAA '~"'"' CTG CCG 23
GGA GTC GAT AAA
Cys Lys G1 a Gly Tyr Gln =. , Cys G~.~r. P he Leu Pro
G~.y '~'ai Asp Lys
65 ?0 ?5
ACT GAT TCC ATC TTA TCG F~C CAi_ GGG A"_'T GAA TTC 28C
GAT CCA TTG ATG
Thr Asp Ser Ile Leu Ser Asn His Gly Iie Glu Phe Met
Asp Pro Leu
80 85 90 95
GAG AGT GAP. GAA GTT TAT C=.G GTG TCA ATT TCP_ TGT ~3
CAA AGG CTG ATC
Glu Ser Glu Glu Val Tyr Gln Val Ser Ile Ser Cys Ile
Gln Arg Leu
100 105 110
ATC TTT GGA ATT GTC ATC A"'G TTC GCA GCA TTC TAC TTC 382
GTG GGC TGT
Ile Phe Gly Ile Vai Ile N!et Phe Ala Ala Phe Tyr Phe
Val Gly Cys
115 120 125
AAA AGC AAA AGG AAT ATT AAT TCT TCT GAG GAA AGA TGG 93~
ACA GCA GTG
Lys Ser Lys Arg Asn Ile Asn Ser Ser Glu Glu Arg Trp
Thr Ala Val
130 135 i40
AAG GGT CTG CCT TCC CAG AA :' CTG CA.~ GAC P.F y TAA 4
GAG CCC CAA ~
5
Lys Gly Leu Pro Ser Gln Asn Leu Gln P_sp Lys
Glu Pro G1n
195 150 155
TGCCTAACAA TGGATTAATG ATGTCTACTAT'='CTGCAACTTACATCTCAT TTCTTTCTAA535
TGCATTGGAC CAGAGAAATT TAAAACTCAAA~_'GAP_CTGTAP,AGTTTCCAC ACTGACACTG595
TTGGGCTAAT AGTATTCCCA TGTGCAAGGCATGCATCTTTTCTTCCCCAG AGCAATGCCT655
CTCATGAGAG AGCTAATGGT ATTGCAATCAGCTGCTGATTGTTTTCT~TG TTCCCATTTT7i5
CTGGGTGAAG GA.=~GAAAGAG TGTGCTTGTGAGAGAGGAGG GF.TGGTAGATi
CA~-'1AAAAG'_"C ,
5
AGGCAGAGGC AGGCTCAGF~ TGGA.~1GGACCACGTATCTTGGA_~TATTr.C'_" P~-:GT~CAGGAC835
TTGP.GTGA=iA AAAGACTAP.A 1'TATP ~'1TT T rlGG?? ~_~ 8
GGTAAGCP A %. ~AAGG C~GCAG T CCGG 95
TATTGGATAT TGCTTPAAGA AAATTCCCTiATAAGTTTATACTTCCP.a-:GA CTCTGA_nTTG955
GATTACTC~.A P_?CATCATT=. F.'"TTAa~TCCCATGAuAGTP.A 'a'GGanTCCTT1015
AG'='G"""TCT=.
GC"_'CTGAGr'~C A=G~~ACTCTTGATGATTTACCAGACTAGAA CCTCCTGATTiC~S
iyCT'_"'"T':CAG
i
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
e7
TCCCCTTTTTTGTGTGTGTGAATGAACCCCTGATAAAATCTTGTGGCTGTAACATGCTCC 1135
TTAAAATGCTGATATGATAGATTTATTTTTAACAATAGGCTATAGATTAGCTGTTAGGAA 1195
GCAAATAGATTATTACAACAGGATTAAAGCAACTAAGAGTGCTAGAGA'='AAAAGTCTCCC 1255
AAATAATTGGAAAGATAAAAGAAATATCTTAAAAAACAGAGCTACATCACACTGATATTG 1315
TP.AATTCAAAATGGGTAATGAAGCTCAAAGCCTCCAAAGCTTGCAGCP.AGTGCTGGTGAA 1375
TTGCTTGGGAAGATGCAACTAGTGTAATC1'TTTACCTTTGGGTCAATGTTCTGATTCTTT 1435
TGCAGCTTCTGCTCACAAGACTGAGCTTGCTTGATGGTATCGGGAAAGATATGAACATTT 1495
TGCGTGTGCCTCCACATGCAGCCACCACAGTGTCCGTGGAAGATAGCTTTTATGAACTTC 1555
ATTTACAGAGGAGGAAATGGAGGCTCAACAAGTTTAGGAAATTATTAGGGTAGCAAAACT 1615
AGTGGGTAGCAGAGTGGGATTCAAATCCCAGTCCCT_GTGATACAATAAGCCACGCTCTGT 1675
AGGGTGCTACT.GACTGGAGAAGCTCATTGCTAAGACCGGCCATGTGCTCCACTGACGGCA 1735
CTATCTTTGTCAGAGACGTTGGAAGACAGGCAAAATTCAAGGGCATGP_TTCTACTGGGAA 1795
AGTTGTCAGAATCAAAATGGAGTCATTTGTGTTAAAAACCCTGACAAATAGAGCCGGAGA 1855
AGGACATGAAGGGAGCAGTCACGTAGGCAAATGCCTGATTACAAGA.~CTATCACAAAAGT 1915
CTGTGAAAACCGCAGCTTTGCATGAAGACTATTGCAGCCTTACACGCACGAAAATAGTTC 1975
TGCAAGGACATATGCCCAGCAACTTCCTGTCCACCCTTGGACTGGCTC~TCCTTTCTTGG 2035
GATCCTTGCAGCCAAGGATAGTGACCTCAAATCAGTTGTGTACCTAACGTTTCCTGTCTT 2095
CCTAGTGATAAAACATAGTTTCCTATATCGTGTGTATTCCCATTGCAACACTTATTTCCA 2155
P.ATAAATATTTTCTTTTAGAGTCTCAA.~~AP,~~~AAAAAAAAAAA 2199
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 158 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Ser Ser Ser Ser Ser Ala ThY Thr Thr Thr Pro Glu Thr Ser Thr Ser
1 5 10 15
Pro Lys Phe His Thr Thr Thr Tyr Ser Thr Glu Arg Ser Glu His Phe
20 25 30
Lys Pro Cys Arg Asp Lys Asp Leu P_la Tyr Cys Leu Asn Asp Gly G1u
35 40 45
Cys Phe Vai Ile Glu Thr Leu Thr Gly Ser His Lys ~-its Cys Arg Cys
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
ss
50 55 60
Lys Glu Gly Tyr Gln Gly Val Arg Cys Asp Gln Phe Leu Pro Lys Thr
65 70 75 80
Aso_ Ser Iie Leu Ser Asp Pro Asn His Leu Gly Ile Glu Phe Met Glu
85 90 95
Ser Glu Glu Val Tyr Gln Arg Gln Val Leu Ser Ile Ser Cys Ile Ile
lO0 lO5 11O
Phe Gly Ile Val Ile Val Gly Met Phe Cys Ala Ala Phe Tyr Phe Lys
115 120 125
Ser Lys Arg Asn Ile Thr Ala P.sn Ser Val Ser Glu Glu Arg Trp Lys
130 135 140
Gly Leu Pro Ser Gln Glu Pro Asn Leu Gln G1n Asp Lys
145 150 155
(2) INrORMATI0D1 FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 645 amino acids
(Bj TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iiMOLECULE TYPE: protein
(xi', SEQUENCE DESCRIPTIOTi: SEQ ID N0:3:
Met Ser Glu Arg Lys Glu Giy Arg Giy Lys Gly Lys Gly Lys Lys Lys
i 5 10 15
Giu Arg Gly Ser Giy Lys Lys Pro Glu Ser Ala Ala Gly Ser Gln Ser
20 25 30
Pro Ala Leu Pro Pro Gln Leu Lys Glu Met Lys Ser Gln Glu Ser Ala
35 40 45
Ala Gly Ser Lys Leu Val Leu Arg Cys Glu Thr Ser Ser Glu Tyr Ser
50 55 60
Ser Leu Arg Phe Lys Trp Phe Lys Asn Gly Asn Glu Leu Asn Arg Lys
65 70 75 80
As,~. Lys Pro Gln Asn Ile Lys Ile Gln Lys Lys Pro G'~y Lys Ser Glu
85 90 95
Leu Arg _Tle Asn Lys Ala Ser Leu Ala Asp Ser Gly Glu Tyr Met Cys
100 105 110
Lys Va- Ile Ser Lys Leu Gly As.~. Asp Ser Ala Ser Ala As.; Tle Thr
115 120 125
Ile Val Glu Ser Asn Glu Ile Ile Thr Gly Met Pro Aia Ser T::r Glu
13C 135 14G
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
89
Gly Ala Tyr Val Ser Ser Glu Ser Pro Iie Arg Ile Ser Val Ser Thr
145 150 155 160
Glu Gly Ala Asn Thr Ser Ser Ser Thr Ser Thr Ser Thr Thr Gly Thr
165 170 175
Ser His Leu Val Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val Asn
180 185 190
Gly Gly G'_u Cys Phe Met Val Lys Asp Leu Ser Asn Pro Ser Arg Tyr
195 200 205
Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys Gln Asn Tyr
210 215 220
Val Met Ala Ser Phe Tyr Lys His Leu Gly Ile Glu Phe Met Glu Ala
225 230 235 240
Glu Glu Leu Tyr Gln Lys Arg Val Leu Thr Ile Thr Gly Ile Cys Ile
245 250 255
Ala Leu Leu.Val Val Gly Ile Met Cys Val Vai Ala Tyr Cys Lys Thr
260 265 270
Lys Lys Gln Arg Lys Lys Leu His Asp Arg Leu Arg Gln Ser Leu Arg
275 280 285
Ser Glu Arg Asn Asn Met Met Asn Ile Ala Asn Gly Pro His His Pro
290 295 300
Asn Pro Pro Pro Glu Asn Val Gln Leu Val Asn Gln Tyr Val Ser Lys
305 310 315 320
Asn Val Ile Ser Ser Glu His Ile Val Glu Arg Glu Ala Glu Thr Ser
325 330 335
Phe Ser Thr Ser His Tyr Thr Ser Thr Ala His His Ser Thr Thr Val
390 - 345 350
Thr Gln Thr Pro Ser His Ser Trp Ser Asn Gly His Thr Glu Ser Ile
355 360 365
Leu Ser Glu Ser His Ser Val Ile Val Met Ser Ser Vai Glu Asn Ser
370 375 380
Arg His Ser Ser Pro Thr Gly Gly Pro Arg G1y Arg Leu Asn Gly Thr
385 390 395 400
Gly Gly Pro Arg Glu Cys Asn Ser Phe Leu Arg His AIa Arg Glu Thr
405 410 415
Pro Asp Ser Tyr Arg Asp Ser Pro His Ser Glu Arg Tyr Val Ser Ala
420 425 430
Met Thr Thr Pro Ala Arg Met Ser Pro Val Asp Phe His Thr Pro Ser
435 440 445
Ser Pro Lys Ser Pro Pro Ser Glu Met Ser Pro Fro Val Ser Ser Met
450 455 460
T!-:r Val Ser Met Pro Sei Met Ala Vol Ser Pro Phe Met Glu Glu Glu
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
465 470 475 480
Arg Pro Leu Leu Leu Val Thr Pro Pro Arg Leu Arg Glu Lys Lys Phe
485 490 495
Asp His !'.is Pro Gin Gln Phe Ser Ser Phe His His Asn Pro Ala His
500 505 510
Asp Ser Asn Ser Leu Pro Ala Ser Pro Leu Arg Ile Val Glu Asp Glu
515 520 525
Glu Tyr Glu Thr Thr Gln Glu Tyr Glu Pro Ala Gln Glu Pro Val Lys
530 535 540
Lvs Leu Ala Asn Ser Arg Arg A1a Lys Arg Thr Lys Pro Asn G1y His
545 550 555 560
Iie Ala Asn Arg L2u Glu Val Asp Ser Asn Thr Ser Ser Gln Ser Ser
565 570 575
Asn Ser Glu Ser Glu Thr Glu Asp Glu Arg Val Gly Glu Asp Thr Pro
580 585 590
Phe Leu Gly Ile Gln Asn Pro Leu Ala Ala Ser Leu Glu Ala Thr Pro
595 600 605
Ala Phe Arg Leu Aia Asp Ser Arg Thr Asn Pro Ala Gly Arg Phe Ser
610 615 620
Thr Glr_ Glu Glu Ile Gln Ala Arg Leu Ser S2r Val Ile Ala Asn Gl.n
625 630 635 640
Asp Pro Ile Ala Val
645
( 2 ) INFORM.~1TION FOR SEQ I D NO : 4
(i) SEQUENCE CHARACTERISTICS:
(A) LEDIGTH: 536 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (g2nomic)
(Yi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
GGCACAGCTC "_'~CTTCCTCC TCCGCTACCA CCACCACACC AGAAACTAGC ACCAGCCCCA 6C
AATTTCATAC GACGACATAT TCCACAGAGC GATCCGAGCA CTTCAAACCC TGCCGAGACA 120
AGGACCTTGG CATACTGTCT CAATGATGGC GAGTGCTTTG TGATCGP~AC CCTGACCGGA 180
TCCCATTAAA C_CTGTCGGT GCAAAGAAGG CTACCP.AGGA GTCCGTTGTG ATCAATTTCT 2z0
GCCGAAAACT GATTCCATCT TATCGGATCC AAACCACTTG GGGATTGGAA.TTCATGGGAG 300
AGTGAAGAAG 'r'='TTNNCCA_T~ AGGGCAGGTG NTGTNCAATT '='CCAAGTC~?~.d CA_~CTTTGGG
360
', i
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
91
GATTGGTNCN TCGTGGGGGC NTGTTTNNGG TGGCAGCATT TCNTAACT>'iC CAAAA.~1GCCA 42
AAAAGGGATT TTTNACCGGC AAATTTCCGT GNTCTGAAGG GAAP.ATTGGG AAGGGTCTTG 4S~
CCCTTTCCCC AGGAGGCCCA ATTNGGNCAA CAAGGCCAAT NATGGCNTAA CAAGGG 5~
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(C; TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(x,~.) SEQL:ENCE DESCRIPTION: SEQ ID N0:5:
GGCGGATCCC TCTTCTTCCT CCTCC "'
(2) INFORMATT_ON FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A; LENGTH: 42 base pairs
(B; TYPE: nucleic acid
{C; STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQT:~NCE DESCRIPTION: SEQ ID N0:6:
GGCGAATTCT A?-~.CTTCTTC ACTCTCCATG AATTCAATCC CC 42
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A', LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
GGCGGATCCC CTCTTCTTCC TCCTCC 2~
(2) INFORMAT=ON FOR SEQ IC N0:$:
(i) SEQUENCE CHARACTERISTICS:
{A; LENGTH: 42 base pairs
(B; TYPE: nucleic acid
STRANDEDNLSS: sin:~ie
t~; TO:OLOG':': 1 inear
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
92
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SFQ ID N0:8: ,
GGCGGTACCT AAACTTCTTC ACTCTCCATG AATTCAATCC CC c?
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 120 base pairs
(B' TYPE: nucleic acid
(C) STRANDEDNESS: single
(C) TOPOLOGY: linear
(i~.) MOLECGLE TYPE: DDiA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
GCCGGATCCG CCP.CCATGA.~ CTCCTTCTCC ACAAGCGCCT TCGC~TCCP.GT TGCCTTCTCC 6=
CTGGGGCTGC TCCTGGTGTT GCCTGCTGCC TTCCCTGCCC CAGTCTCTTC TTCCTCCTCC le0
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iv) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCF.IPTION: SEQ ID N0:10:
GGCTCTAGAT AAACTTCTTC ACTCTCCATG AATTCAATCC CC 42
(2) INFORMATION FOR SEQ ID NO:11:
(--) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 amino acids
(~) TYPE: amino acid
(C) STRANDEDNESS: single
(D; TOPOLOGY: linear
(ii) NIOLJCULE TYPE: protein
(::i) SEQU~r~C~ DESCRIPTION: SEQ ID NO:il:
Ser :~is Phe P.sn Asp Cys Pro Asp Ser !-lis T'.~.r Gin Phe Cys Phe Iiis
i 5 10 15
i
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
93
Gly Thr Cys Arg Phe Leu Val Gln Glu Asp Lys Pro Ala Cys Val Cys
20 25 30
His Ser Gly Tyr Val Gly Ala Arg Cys Glu His Ala Asp Leu Leu Ala
35 40 45
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(~li) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Arg Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu
10 15
His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr Ala Cys
20 25 30
Asn Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Gln Tyr Arg Asp Leu
35 40 45
Lys Trp
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi)SEQUENCEDESCRIPTION: N0:13:
SEQ
ID
Gly Lys ArgAspProCys Arg Lys Lys PheCys
Lys Leu Tyr Asp Ile
1 5 10 15
His Gly CysLysTyrVal Glu Leu Ala SerCys
Glu Lys Arg Pro Ile
20 25 30
Cys H=s GlyTyrGlyGly Arg Cys Gly SerLeu
Pro Glu His Leu Pro
35 40 45
(2) INFORMATION FOR SEQ ID N0:14:
(_) SEQUENCE CHARACTERIS'~ICS:
(A) LE~iGTH: 49 amine acids
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
94
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D} TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi)SEQUENCEDESCRIPTION: N0:14:
SEQ
ID
ArgLys Lys LysAsn Cys AlaGlu Phe G1n PheCys
Pro Asn Asn Ile
1 5 10 15
HisGly Glu CysLys I1e HisLeu Glu Ala ThrCys
Tyr G'_u Val Lys
20 25 30
CvsGln Gin GluTyr Gly ArgCys Gly G'~u SerMet
Phe Glu Lrs Lys
35 40 45
Thr
(2) INFORMATION FOR SEQ ID NO:iS
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: S9 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
Lys Gly His Phe Ser Arg Cys Pro Lys Gln Tyr Lys His Tyr C;rs Ile
1 5 - 10 15
Lys Giy Arg Cys Arg Phe Val Val Ala Glu Gln Thr Pro Ser Cys Val
20 25 30
Cys Asp G'~u Gly Tyr Ile Gly Ala Arg Cys Glu Arg Val Asp Leu Phe
35 40 45
Tvr
( 2 ) INFORMATIODi FOR SEQ ID N0: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 52 amino acids
(B' TYPE: amino acid
(C} STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii} MOLECULE TYPE: protein
(xi} cEQ:.:;;CE, 'JESCRIPTI~.Ci: SP.:~ ID :iO:iS:
', i
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
Thr Ser His Leu Ile Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val
1 5 10 15
Asn Gly Gly G1u Cys Phe Thr Val Lys Asp Leu Ser Asn Pro Ser Arg
20 25 30
Tyr Leu Cys Lys Cys Pro Gly Phe Thr G1y Ala Arg Cys Thr Glu Asn
35 90 45
Val Pro Met Lys
(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
Thr Ser His Leu Val Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val
1 5 10 15
Asn Gly Gly Glu Cys Phe Met Val Lys Asp Leu Ser Asn Pro Ser Arg
20 25 30
Tyr Leu Cys Lys Cys Gln Pro Gly Phe Thr Gly Ala Arg Cys Thr Glu
35 40 95
Asn Val Pro Met Lys
(2) i:IFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(Dl TOPOLOGY: linear
(ii) MOLECULE. TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
Thr Ser His Leu Vai Lys Cys P_'_a Glu Lys Glu Lys Thr Phe Cys Val
1 5 10 15
Asn G1y Gly Glu Cys Phe Met Vai Lys Asp Leu Ser Asn Pro Ser Arg
20 25 30
Tvr Leu Cvs Lys Cys Pro P,sn G1u Phe Thr Gly Asp Arg Cys Gln Asn
~= 90 45
Asn Cys Val Val Gly Tyr Ile Gly Glu
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
96
Tyr Val Met Ala Ser
(2) INFORMATION FOR SEQ ID NO: i9:
(i) SEQUENCE CHAR~.CTERISTICS:
(A) LENGTH: 50 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: S~Q ID N0:19:
Ser Gly i:is Aia Arg Lys Cys Asn Glu Thr A1a Lys Ser Tyr Cys Val
1 5 10 15
Asn Gly G1y Va1 Cys Tyr Tyr Iie Glu Gly Ile Asn Gln Leu Ser Cys
20 25 30
Lys Cys Pro Val Gly Tyr Thr Gly Asp Arg Cys Gln Gln Phe Ala Met
35 40 45
Val Asn
(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(Bi TYPE: nucleic acid
(C) STRANDEDNESS: single
(p) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
CCACGATGAC AATTCCAAAG
(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
{xi) SEQUENCE DESCRIPTION: Sc.Q ID N0:21:
TACCACCACC P.CAC~AGA.~A
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
97
(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 720 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
Met Ser Glu Gly Ala Ala Ala Aia Ser Pro Pro Gly Ala Ala Ser Ala
1 5 10 15
Ala Aia Ala Ser Ala Glu Glu Gly Thr Ala Ala Ala Ala Ala Aia Ala
20 25 30
Ala Ala G':.y.Gly Gly Pro Asp Gly Gly Gly Glu Gly Ala Ala Glu Pro
35 40 45
Pro Arg Glu Leu Arg Cys Ser Asp Cys Ile Val Trp Asn Arg Gln Gln
50 55 60
Thr Trp Leu Cys Val Val Pro Leu Phe Ile Gly Phe Ile Gly Leu Gly
65 70 75 80
Leu Ser Leu Met Leu Leu Lys Trp Ile Val Val Gly Ser Val Lys Glu
85 90 95
Tyr Val Pro Thr Asp Leu Val Asp Ser Lys Gly Met Gly Gln Asp Pro
100 105 110
Phe Phe Leu Ser Lys Pro Ser Ser Phe Pro Lys Ala Met Glu Thr Thr
~15 120 125
Thr Thr Thr Thr Ser Thr Thr Ser Pro Ala Thr Pro Ser Ala Gly Gly
130 135 140
Ala Ala Ser Ser Arg Thr Pro Asn Arg Ile Ser Thr Arg Leu Thr Thr
145 150 155 160
Ile Thr Arg Ala Pro Thr Arg Phe Pro Gly His Arg Val Pro Ile Arg
165 170 175
Ala Ser Pro Arg Ser Thr Thr Ala Arg Asn Thr Ala Ala Pro Ala Thr
180 185 190
Val Pro Ser Thr Thr Ala Pro Phe Phe Ser Ser Ser Thr Leu Gly Ser
195 200 2G5
Arg P-o aro Va1 Pro Gly Th= Pro Ser T::r G1n Ala Met Pro Ser Trp
210 215 22C
Pro Thr Ala Ala Tyr Ala The Ser Ser Tyr Leu His Asp Ser Thr P-o
225 230 235 240
Ser T T'r!r Leu Ser Pro Phe Gin Asa Ala Ala Ser Ser Se= Ser Ser
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
98
245 250 255
Ser Ser Ser Ser Ser Thr Thr Thr Thr pro G'_u Thr Ser Thr Ser Pro
260 265 270
Lys Phe His Thr Thr Thr Tyr Ser Thr Glu Arg Ser Glu His Phe Lys
275 280 285
Pr:: Cys Arg Asp Lys Asp Leu Ala Tyr Cys Leu Asn Asp Gly Glu Cys
290 295 300
Phe Val ile Glu Thr Leu Thr Gly Ser His Lys His Cys Arg Cys Lys
3C5 310 315 32C
Glu Gly Tyr Gin Giy Val Arc Cys Asp Gln Phe Leu pro Lys Thr As_
325 330 335
Ser Iie Leu Ser Asp Pro Ti:r A sp liis Leu G'_y Ile Glu phe Met G'~u
340 345 350
Ser G'_u Glu Va1 Tyr G'~n Arg Gln Val Leu Ser Ile Ser Cys Ile Ile
355 360 365
Phe G1y Iie Val I1e Val Gly Met Phe Cys F?~~a Ala Phe Tyr Phe Lys
370 375 380
Ser Lys Lys Gln Ala Lys G1n Ile Gln Glu Gln Leu Lys Val Pro G1~.
385 390 395 900
Asn Gly Lys Ser Tyr Ser Leu Lys Ala Ser Ser Thr Met Ala Lys Ser
405 410 415
Glu F.sn Leu Val Lys Ser His Val Gln Leu Gln Asn Tyr Ser Lys Val
420 925 430
Glu Arg His Pro Val Thr Ala Leu Glu Lys Me~ Met G1u Ser Ser Phe
435 440 445
Val Gly Pro Gln Ser Pre Pro Glu Va'_ Pro Ser Pro :-~.sp Arg Giy Ser
450 955 460
Gln Ser Val Lys His His Arg Ser Leu Ser Ser Cys Cys Ser Pro Gly
465 470 475 480
G'_n Arg Ser Gly Met Leu His Arg Asn Ala Phe Arg F:rg Thr Prc Pro
485 490 995
Ser Pro Arg Ser Arg Leu Gly Gly ile Val G1y Prc Ala Tyr Gln Gln
500 505 510
Leu Glu Giu Ser Arg Ile Prc Aso G1n Asp T.~:r Iie °ro Cys Gln Gly
515 520 525
~ls Val Arg Lys Thr Ile Ser His Leu Pro Ile Gln Leu Trp Cys
530 535 590
Val Glu Arg Pro Leu Asp Leu Ly:s Tyr Ser Se- Se. Gly Leu Lys Thr
545 550 555 560
G-.~n Arg Asn Thr Ser I1e Asr_ '~°t Gln Leu Pro Se- Arg Glu Thr
Asn
565 "v 570 575
i I
CA 02295317 1999-12-17
WO 98/57989 PCT/US98/12403
99
Pro Tyr Phe Asn Ser L,eu GAu Gln Lys Asp Leu Val Gly Tyr Ser Ser
580 585 590
T~:r Arg Ala Ser Ser Val Prc Iie Ile Pro Ser Val Gly Leu Glu G1u
595 600 605
Ti:r Cys Leu Gin Met Pro Gly Iie Ser Glu Val Lys Ser Ile Lys Trp
610 615 620
Cys Lys Asn Ser Tyr Ser Ala Asp Val Val Asn Val Ser Ile Pro Val
625 630 635 640
Ser Asp Cys Leu Iie Ala Glu Gln Gln Glu Vai Lys Ile Leu Leu Glu
645 650 655
T:-:r Val Gin Glu Gln Ile Arg Ile Leu Thr Asp a:la Arg Arg Ser Glu
660 665 670
Asp Tyr Glu Leu Ala Ser ''al Glu Thr Glu Asp Ser Ala Ser Glu Asn
675 680 685
T::r Ala Pha Leu Pro Leu Ser Fro Thr P:la Lys Ser Glu Avg Glu Aia
690 695 70C
Gln Phe Val Leu Arg Asn Glu Ile Gln Arg Asp Ser Ala Leu Thr Lys
705 710 715 720
CA 02295317 1999-12-17
W O 98/57989
100
PCT/US98/12403
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis)
A. The indications made below relate to the microorganism referred to in the
description
on page , line
8. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional
sheet
Name of depositary institution
American Type Culture Collection
Address of depositary institution (including postal code and country)
10801 University Boulevard
Manassas, Virginia 201 10-2209
United States of America
Date of deposit June 19, 1997 ~ Accession Number 209123
C. ADDITIONAL INDICATIONS (leave blank irnor applicable) This information is
continued on an additional sheet
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (ijdre indications are not
jor all designated States)
E. SEPARATE FURNISHING OF INDICATIONS /leave blank ijnot applicable)
T4,P indiratinnc licted helow wVl be submitted to the lnternaUOna1 Bureau
later (specrfy the general nature ofrhe rndrcauons a g Accessron
Number ojDeposit'~
For receiving Office use only For International Bureau use only ~~-.
This sheet was received with the international application ~ This sheet was
received by the International Bureau on:
Aut irized ofl- er Authorized officer
tL I
t
