INHIBITORS OF PRENYL-PROTEIN TRANSFERASE

INHIBITEURS DE LA PRENYL-PROTEINE TRANSFERASE

English Abstract

The present invention is directed to compounds which inhibit prenyl-protein
transferase (FTase) and the prenylation of the oncogene protein Ras. The
invention is further directed to chemotherapeutic compositions containing the
compounds of this invention and methods for inhibiting prenyl-protein
transferase and the prenylation of the oncogene protein Ras.

French Abstract

L'invention porte sur des composés inhibiteurs de la prényl-protéine transférase (FTase), sur la prénylation de la protéine oncogène Ras, sur des compositions chimiothérapeutiques contenant les composés de l'invention, et sur des procédés d'inhibition de la prényl-protéine transférase et de prénylation de la protéine oncogène Ras.

Claims

WHAT IS CLAIMED IS:
1. A compound of the formula A:
<IMG>
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)- or
sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is a 5, 6 or 7 membered carbocyclic ring wherein from 0 to
3 carbon atoms are replaced by a heteroatom selected from
N, S and O, and wherein Y is attached to A3 through a
carbon atom;
R1 and R2 are independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
-126-

C2-C6 alkynyl, R10O-, R11S(O)m-, R10C(O)NR10-,
R11C(O)O-, (R10)2NC(O)-, R10 2N-C(NR10)-, CN, NO2,
R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected
from unsubstituted or substituted aryl, heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R10O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-,
R3, R4 and R5 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-, R11C(O)O-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
-127-

R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-, R11C(O)O-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, (R10)2NS(O)2-,
R11S(O)m NR10-, N3, -N(R10)2, or R110C(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
(R10)2NS(O)2-, R11S(O)m NR10-, R102N-C(NR10)-,
CN, R10C(O)-, N3, -N(R10)2, and R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R7 is selected from: H; C1-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C1-4 alkoxy,
b) aryl or heterocycle,
<IMG>
~SO2R11
e) N(R10)2 or
f) C1-4 perfluoroalkyl
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
perfluoroalkyl, F, Cl, Br, R10O-, R11S(O)m-,
-128-

R10C(O)NR10-, (R10)2NC(O)-, (R10)2NS(O)2-,
R11S(O)m NR10-, R10 2N-C(NR10)-, CN, NO2, R10C(O)-,
N3, -N(R10)2, or R11OC(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by aryl,
cyanophenyl, heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R10O-,
R11S(O)m-, R10C(O)NH-, (R10)2NC(O)-, (R10)2NS(O)2-,
R11S(O)m NR10-, R10 2N-C(NR10)-, CN, R10C(O)-, N3
-N(R10)2, or R10OC(O)NH-;
R9 is independently selected from:
a) hydrogen,
b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br,
R10O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2, or
R11OC(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl,
F, Cl, Br, R10O-, R11S(O)m-, R10C(O)NR10-,
(R10)2NC(O)-, R10 2N-C(NR10)-, CN, R10C(O)-, N3,
-N(R10)2, or R11OC(O)NR10-;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
-129-

R13 is selected from hydrogen, C1-C6 alkyl, cyano, C1-C6
alkylsulfonyl and C1-C6 acyl;
A1 and A2 are independently selected from: a bond, -CH=CH-,
-C~C(O)-, -C(O)NR10-, -NR10C(O)-, O-, -N(R10)-,
-S(O)2N(R10)-, -N(R10)s(O)2-, or S(O)m
A3 is selected from: -CH2-, -CH2CH2-, -C~C-, O, -N(R10)-, S(O)m,
_C(O)NR 10-, -NR10C(O)-, -CH2C(O)NR10-, -CH2NR10C(O)-,
-C(O)NR10CH2-, -NR10C(O)CH2-, -CH2O-, -CH2N(R10)-,
-CH2S(O)m-, -OCH2-, -N(R10)CH2- and -S(O)m CH2-;
V is selected from:
a) hydrogen,
b) heterocycle,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl,
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle;
X is a bond, -CH=CH-, O, -C(=O)-, -C(O)NR7-, -NR7C(O)-,
-C(O)O-, -OC(O)-, -C(O)NR7C(O)-, -NR7-,
-S(O)2N(R10)-, -N(R10)S(O)2-, or -S(=O)m-;
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is independently 0, 1, 2, 3 or 4;
q is 0, 1, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
-130-

t is 0 or 1;
or a pharmaceutically acceptable salt thereof.
2. The compound according to Claim 1 having the
formula A, wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)- or
sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is a 5, 6 or 7 membered carbocyclic ring wherein from 0 to
3 carbon atoms are replaced by a heteroatom selected from
N, S and O, and wherein Y is attached to A3 through a
carbon atom;
R1 and R2 are independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, R10O-, R11S(p)m-, R10C(O)NR10-,
R11C(O)O-, (R10)2NC(O)-, R102N-C(NR10)-, CN, NO2,
R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected
from unsubstituted or substituted aryl, heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-6 alkynyl,
R10O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R1O)2, and
R11OC(O)-NR10-;
R3, R4 and R5 are independently selected from:
-131-

a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-, R11C(O)O-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-, R11C(O)O-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, (R10)2NS(O)2-,
R11S(O)mNR10-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(p)NR10-, (R10)2NC(O)-,
(R10)2NS(O)2-, R11S(O)mNR10-, R102N-C(NR10)-;
CN, R10C(O)-, N3, -N(R10)2, and R11OC(O)-NR10-; or
-132-

any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R7 is selected from: H; C1-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C1-4 alkoxy,
b) aryl or heterocycle,
c) <IMG>
d) -SO2R11
e) N(R10)2 or
f) C1-4 perfluoroalkyl;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
perfluoroalkyl, F, Cl, Br, R 10O-, R11S(O)m-,
R10C(O)NR10-, (R10)2NC(O)-, (R10)2NS(O)2-,
R11S(O)mNR10-, R102N-C(NR10)-, CN, NO2,
R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by aryl,
cyanophenyl, heterocycle, C3-C10 cycloallcyl, C2-C6
alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R10O-,
R11S(O)m-, R10C(O)NH-, (R10)2NC(O)-, (R10)2NS(O)2-,
R11S(O)mNR10-, R102N-C(NR10)-, CN, R10C(O)-, N3,
-N(R10)2, or R10OC(O)NH-;
R9 is independently selected from:
a) hydrogen,
-133-

b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br,
R10O- R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl,
F, Cl, Br, R10O-, R11S(O)m-, R10C(O)NR10-,
(R10)2NC(O)-, R102N-C(NR10)-, CN, R10C(O)-,
N3, -N(R10)2, or R11OC(O)NR10-;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
R13 is selected from hydrogen, C1-C6 alkyl, cyano, C1-C6
alkylsulfonyl and C1-C6 acyl;
A1 and A2 are independently selected from: a bond, -CH=CH-, -C~C-,
-C(O)-, -C(O)NR10-, -NR10C(O)-, O, -N(R10)-,
-S(O)2N(R10)-, -N(R10)S(O)2-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)-, S(O)m,
-C(O)NR10-, -NR10C(O)-, - CH2C(O)NR10-, -CH2NR10C(O)-,
-C(O)NR10CH2-, -NR10C(O)CH2-, -CH2O-, -CH2N(R10)-,
-CH2S(O)m-, -OCH2-, -N(R10)CH2- and -S(O)mCH2-;
V is selected from:
-134-

a) hydrogen,
b) heterocycle,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl,
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle;
X is a bond, -CH=CH-, O, -C(=O)-, -C(O)NR7-, -NR7C(O)-,
-C(O)O-, -OC(O)-, -C(O)NR7C(O)-, -NR7-,
-S(O)2N(R10)-, -N(R10)S(O)2- or -S(=O)m-;
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is independently 0, 1, 2, 3 or 4;
q is 0, 1, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
t is 0 or 1;
or a pharmaceutically acceptable salt thereof.
3. The compound according to Claim 1 having the
formula A, wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl,
-C(=NR13)- or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
-135-

piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl, pyridyl, pyrimidinyl, pyrazinyl,
furyl, thiazolyl, isothiazolyl, tetrahydrofuryl, piperdinyl,
thiazolidinyl, piperazinyl and tetrahydrothienyl;
R1 is independently selected from: hydrogen, C3-C10 cycloalkyl,
R10O-, -N(R10)2, F or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C2-C6 alkenyl,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C10
cycloalkyl, C2-C6 alkenyl, R10O- and -N(R10)2;
R3, R4 and R5 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR 10)-, CN, NO2, R1OC(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl;
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
-136-

R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
(R10)2NS(O)2-, R11S(O)m NR10-, R10 2N-C(NR10)-, CN,
NO2, R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl;
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
(R10)2NC(O)-, (R10)2NS(O)2-, R11S(O)m NR10-,
R10)2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R7 is selected from: H; C1-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C1-4 alkoxy,
b) aryl or heterocycle,
-137-

<IMG>
d)~SO2R11~
e) N(R10)2 or
f) C1-4 perfluoroalkyl
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R10O-, R10C(O)NR10-,
(R10)2NC(O)-, CN, NO2, (R10)2N-C(NR10)-, R10C(O)-,
(R10)2NS(O)2-, R11S(O)m NR10-, -N(R10)2. or
R110C(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl,
R10O-, R10C(O)NR10-, (R10)2N-C(NR10)-,
R10C(O)-, -N(R10)2, or R110C(O)NR10-;
R9 is selected from:
a) hydrogen,
b) C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F,
Cl, R10O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
CN, NO2, (R10)2N-C(NR10)-, R10C(O)-,-N(R10)2, or
R11OC(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by
C1-C6 perfluoroalkyl, F, Cl, R10O-, R11S(O)m-,
R10C(O)NR10-, (R10)2NC(O)-, CN, (R10)2N-C(NR10)_,
R10C(O)-, -N(R10)2, or R11OC(O)NR10-;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
-138-

R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 and A2 are independently selected from: a bond, -CH=CH-, -C~C-,
-C(O)-, -C(O)NR10-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)-, S(O)m, -C(O)NR10-,
-NR10C(O)-, -CH2C(O)NR10-, -CH2NR10C(O)-, -C(O)NR10CH2-,
-NR10C(O)CH2-, -CH2O-, -CH2N(R10)-, -CH2S(O)m-, -OCH2-,
-N(R10)CH2- and -S(O)m CH2-;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl,
2-oxopiperidinyl, oxazolyl, indolyl, quinolinyl, isoquinolinyl,
triazolyl and thienyl,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, imidazolinyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, oxazolyl, indolyl,
quinolinyl, triazolyl or isoquinolinyl;
-139-

X is a bond, O, -C(=O)-, -CH=CH-, -C(O)NR7-, -NR7C(O)-, -NR7-,
-S(O)2N(R10)-, -N(R10)S(O)2- or -S(=O)m:
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is independently 0, l, 2, 3 or 4;
q is 0, 1, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
t is 0 or 1;
or a pharmaceutically acceptable salt thereof.
4. The compound according to Claim 1 having the
formula B:
<IMG>
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)- or
sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl and pyridyl;
-140-

R1 is selected from: hydrogen, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C2-C6 alkenyl,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C10
cycloalkyl, C2-C6 alkenyl, R10O- and -N(R10)2;
R3 and R4 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(p)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R120-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
-141-

C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12)O-,
R11S(O)m-, R10C6O)NR10-, (R10)2NC6O)-,
(R10)2NS(O)2-, R11S(O)m NR10-, R102N-C6NR10)-, CN,
NO2, R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R120-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
(R10)2NS(O)2-, R111S(O)m NR10-, R102N-C(NR10)-,
CN, R10C(O)-, N3, -N(R10)2, and R11 OC(O)-NR 10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R10O-, R10C(O)NR10-,
(R10)2NC(O)-, (R10)2NS(O)2-, R11S(O)m NR10-, CN,
NO2, (R10)2N-C(NR10)-, R10C(O)-, -N(R10)2, or
R110C(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R10O-,
R10C(O)NR10-, (R10)2N-C(NR10)-, (R10)2NS(O)2-,
R11S(O)m NR10-, R10C(O)-, -N(R10)2, or
R11OC(O)NR10-;
R9a and R9b are independently hydrogen, C1-C6 alkyl, trifluoromethyl
and halogen;
-142-

R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-, -C,C-,
-C6O)-, -C(O)NR10-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)-, - C(O)NR10-,
-C(O)NR10CH2-, -CH2C(O)NR10-, -CH2O-, -OCH2- or
S(O)m;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl,
2-oxopiperidinyl, oxazolyl, indolyl, quinolinyl,
isoquinolinyl, triazolyl and thienyl,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-;
-143-

m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4; and
r is 0 to 5, provided that r is 0 when V is hydrogen;
or a pharmaceutically acceptable salt thereof.
5. The compound according to Claim 1 having the
formula C:
<IMG>
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)-
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl, pyridyl, pyrimidinyl, pyrazinyl,
furyl, thiazolyl, isothiazolyl, tetrahydrofuryl, piperdinyl, thiazolidinyl,
piperazinyl and tetrahydrothiophenyl;
-144-

R 1 is selected from: hydrogen, C3-C10 cycloalkyl, R10O-, -N(R10)2,F
or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2,F
or C2-C6 alkenyl,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C10
cycloalkyl, C2-C6 alkenyl, R10O- and -N(R10)2;
R3 and R4 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-R11S(O)m-, R10C(O)NR10-, CN(R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R6a, R6b, R6c, R6d, and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
-145-

C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl, R12O-,
R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R11S(O)2NR10-, (R10)2NS(O)2-, R102N-C(NR10)-, CN,
NO2, R10C(O)-, N3, -N(R10)2, or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O- R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R11S(O)2NR10-, (R10)2NS(O)2-, R102N-C(NR10)-,
CN, R10C(O)-, N3,-N(R10)2, and R11 OC(O)-NR 10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R10O-, R10C(O)NR10-,
(R10)2NC(O)-, R11S(O)2NR10-, (R10)2NS(O)2-, CN,
NO2, (R10)2N-C(NR10)-, R10C(O)-, -N(R10)2, or
R11OC(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R10O-,
R10C(O)NR10-, (R10)2NC(O)-, R11S(O)2NR10-,
(R10)2NS(O)2-, (R10)2N-C(NR10)-, R10C(O)-,
-N(R10)2, or R11OC(O)NR10-;
R9a and R9b are independently hydrogen, C1-C6 alkyl, trifluoromethyl
and halogen;
-146-

R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 and A2 are independently selected from: a bond, -CH=CH-, -C~C-,
-C(O)-, -C(O)NR10-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl,
2-oxopiperidinyl, oxazolyl, indolyl, quinolinyl, isoquinolinyl,
triazolyl and thienyl,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C2p alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-;
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
-147-

p is 0, 1, 2, 3 or 4, provided that p is not 0 if X is a bond or O;
and
r is 0 to 5, provided that r is 0 when V is hydrogen;
or a pharmaceutically acceptable salt thereof.
6. The compound according to Claim 4 having the
formula D:
<IMG>
wherein:
Q is selected from
<IMG>
from 0-1 of f(s) are independently N, and the remaining f's are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
-148-

R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C2-C6 alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, R10O-, or
-N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroallcyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O- R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R4 is selected from H, halogen, C1-C6 alkyl and CF3;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O- R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
-149-

R102N-C(NR10)-, CN, NO2, R10C(O)- N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, an d
R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R10O-, R10C(O)NR10-,
(R10)2NC(O)-, CN, NO2, (R10)2N-C(NR10)-,
R10C(O)-, -N(R10)2, or R11OC(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R10O-,
R10C(O)NR10-, (R10)2NC(O)-, (R10)2N-C(NR10)-,
R10C(O)-, -N(R10)2, or R11OC(O)NR10-;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
-150-

R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 is selected from: a bond, -C(O)-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-,
n is 0 or 1; provided that n is not 0 if A1 is a bond, O,
-N(R10)- or S(O)m;
m is 0, 1 or 2;
p is 0, 1, 2, 3 or 4; and
r is 0, 1 or 2;
or a pharmaceutically acceptable salt thereof.
7. The compound according to Claim 5 having the
formula E:
<IMG>
wherein:
-151-

Q is selected from
<IMG>
from 0-1 of f(s) are independently N, and the remaining f's are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C2-C6 alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, R10O-, or
-N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(O)NR1O-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
-152-

c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R4 is selected from H, halogen, C 1-C6 alkyl and CF3;
R6a, R6b, Rbc, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12o-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, NO2, R10C(p)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O- R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
-153-

b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R10O-, R10C(O)NR10-,
(R10)2NC(O)-, CN, NO2, (R10)2N-C(NR10)-, R10C(O)-,
-N(R10)2, or R11OC(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R10O-,
R10C(O)NR10-, (R10)2NC(O)-, (R10)2N-C(NR10)-,
R10C(O)-, -N(R10)2, or R11OC(O)NR10-;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 is selected from: a bond, -C(O)-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-;
n is 0 or 1;
m is 0, 1 or 2;
p is 0, 1, 2, 3 or 4, provided that p is not 0 if X is a bond or O;
and
-154-

r is 0, 1 or 2;
or a pharmaceutically acceptable salt thereof.
8. The compound according to Claim 6 having the
formula F:
<IMG>
wherein:
from 0-1 of f(s) are independently N, and the remaining f's are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, R10O-, -N(R10)2
or F,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C10 cycloalkyl, R10O-, or -N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
-155-

R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R4 is selected from H, halogen, CH3 and CF3;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R1OC(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
-156-

R8 is independently selected from: -CN, Cl, -NO2, C1-C6 alkoxy, and
2,2,2-trifluoroethoxy;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-;
m is 0, 1 or 2; and
p is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt thereof.
9. The compound according to Claim 7 having the
formula G:
-157-

<IMG>
wherein:
from 0-1 of f(s) are independently N, and the remaining f's are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl, R10O-, -N(R10)2,
F or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle or C3-C10 cycloalkyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, R10O-, or
-N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
-158-

substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-;
R4 is selected from H, halogen, CH3 and CF3;
R6a, R6b, R6c, R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, NO2, R10C(O)-, N3, -N(R10)2,
or R11OC(O)NR10-,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
R12O-, R11S(O)m-, R10C(O)NR10-, (R10)2NC(O)-,
R10 2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)-NR10-; or
any two of R6a, R6b, R6c, R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from: -CN, Cl, -NO2, C1-C6 alkoxy, and
2,2,2-trifluoroethoxy;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
-159-

R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 is selected from: a bond, -C(O)-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
m is 0, 1 or 2; and
n is 0 or 1;
or a pharmaceutically acceptable salt thereof.
10. A compound which inhibits farnesyl-protein
transferase which is selected from:
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylthio)pyrid-5-ylmethyl)-
imidazole;
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylphenoxy)pyrid-5-
ylmethyl)imidazole;
5-(4'-Cyanobenzyl)-1-[2-(3"-chlorophenylthio) pyrid-5-ylmethyl)]-
imidazole;
5-(4'-Cyanobenzyl)-1-[2-(cyclohexylthio)pyrid-5-ylmethyl]imidazole;
-160-

5-(4'-Cyanobenzyl)-1-[2-(3''-methylphenylthio)pyrid-4-ylmethyl)]-
imidazole;
5-(4'-Cyanobenzyl)-1-[2-(cyclohexylamino)pyrid-5-
ylmethyl)]imidazole;
5-(4'-Cyanobenzyl)1-[2-(3"-chlorophenylthio)pyrid-5-ylmethyl]-
imidazole -S-oxide;
2-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl]-6-(3-
trifluoromethylphenoxy)pyridine;
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl]-6-(3-
trifluoromethylphenoxy)pyridine;
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl]-5-(3-
trifluoromethylphenoxy)pyridine;
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl]-5-(3-
trifluoromethylbenzyloxy)pyridine;
5-chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic
acid(2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl)-amide;
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic acid(2-
[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl)-amide;
1-(3-Trifluoromethylbenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic
acid(2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl)-amide;
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic acid (2-
[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl)-amide;
5-Chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic
acid(2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl)-amide;
-161-

6-[N-(3-Chlorobenzyl) carbamoyl]- 4-ethoxy-pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl)-ethyl)-amide;
6-[N-(3-Chlorophenyl) carbamoyl)- 4-ethoxy-pyridine-2-carboxylic acid
(2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl}-amide;
4-(3-Chlorobenzyloxy)- 6-methoxycarbonyl- pyridine-2-carboxylic acid
{2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl}-amide;
4-(5-{[6-(3-chloro-phenoxy)-pyridin-2-ylamino]-methyl}-imidazol-1-
ylmethyl)-benzonitrile;
4-(5-{[6-(phenylethynyl)-pyridin-2-ylamino)-methyl}-imidazol-1-
ylmethyl)-benzonitrile;
4-(5-{[6-(1,2,3,4-tetrahydronaphth-6-yloxy)-pyridin-2-ylamino]-
methyl}-imidazol-1-ylmethyl)-benzonitrile; and
4-(5-{[6-(2-phenylethyl)-pyridin-2-ylamino]-methyl}-imidazol-1-
ylmethyl)-benzonitrile
or pharmaceutically acceptable salts thereof.
11. The compound according to Claim 10 which is:
5-(4'-Cyanobenzyl)-1-[2-(3"-chlorophenylthio)pyrid-5-ylmethyl)]-
imidazole
<IMG>
-162-

or a pharmaceutically acceptable salt thereof.
12. The compound according to Claim 10 which is:
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylphenoxy) pyrid-5-
ylmethyl)imidazole
<IMG>
or a pharmaceutically acceptable salt thereof.
13. A pharmaceutical composition comprising a
pharmaceutical carrier, and dispersed therein, a therapeutically effective
amount of a compound of Claim 1.
14. A pharmaceutical composition comprising a
pharmaceutical carrier, and dispersed therein, a therapeutically effective
amount of a compound of Claim 4.
15. A pharmaceutical composition comprising a
pharmaceutical Garner, and dispersed therein, a therapeutically effective
amount of a compound of Claim 5.
16. A pharmaceutical composition comprising a
pharmaceutical carrier, and dispersed therein, a therapeutically effective
amount of a compound of Claim 10.
17. A method for inhibiting farnesyl-protein transferase
which comprises administering to a mammal in need thereof a
therapeutically effective amount of a composition of Claim 13.
-163-

18. A method for inhibiting farnesyl-protein transferase
which comprises administering to a mammal in need thereof a
therapeutically effective amount of a composition of Claim 14.
19. A method for inhibiting farnesyl-protein transferase
which comprises administering to a mammal in need thereof a
therapeutically effective amount of a composition of Claim 15.
20. A method for inhibiting farnesyl-protein transferase
which comprises administering to a mammal in need thereof a
therapeutically effective amount of a composition of Claim 16.
21. A method for treating cancer which comprises
administering to a mammal in need thereof a therapeutically effective
amount of a composition of Claim 13.
22. A method for treating cancer which comprises
administering to a mammal in need thereof a therapeutically effective
amount of a composition of Claim 14.
23. A method for treating cancer which comprises
administering to a mammal in need thereof a therapeutically effective
amount of a composition of Claim 15.
24. A method for treating cancer which comprises
administering to a mammal in need thereof a therapeutically effective
amount of a composition of Claim 16.
25. A method for treating neurofibromin benign
proliferative disorder which comprises administering to a mammal in
need thereof a therapeutically effective amount of a composition of
Claim 13.
-164-

26. A method for treating blindness related to retinal
vascularization which comprises administering to a mammal in need
thereof a therapeutically effective amount of a composition of Claim 13.
27. A method for treating infections from hepatitis delta
and related viruses which comprises administering to a mammal in need
thereof a therapeutically effective amount of a composition of Claim 13.
28. A method for preventing restenosis which comprises
administering to a mammal in need thereof a therapeutically effective
amount of a composition of Claim 13.
29. A method for treating polycystic kidney disease
which comprises administering to a mammal in need thereof a
therapeutically effective amount of a composition of Claim 13.
30. A pharmaceutical composition made by combining
the compound of Claim 1 and a pharmaceutically acceptable carrier.
31. A process for making a pharmaceutical composition
comprising combining a compound of Claim 1 and a pharmaceutically
acceptable carrier.
-165-

Description

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
TITLE OF THE INVENTION
INHIBITORS OF PRENYL-PROTEIN TRANSFERASE
BACKGROUND OF THE INVENTION
The Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-Ras)
are part of a signalling pathway that links cell surface growth factor
receptors to nuclear signals initiating cellular proliferation. Biological
and biochemical studies of Ras action indicate that Ras functions like
a G-regulatory protein. In the inactive state, Ras is bound to GDP.
Upon growth factor receptor activation Ras is induced to exchange
GDP for GTP and undergoes a conformational change. The GTP-
bound form of Ras propagates the growth stimulatory signal until the
signal is terminated by the intrinsic GTPase activity of Ras, which
returns the protein to its inactive GDP bound form (D.R. Lowy and
D.M. Willumsen, Ann. Rev. Biochem. 62:851-891 (1993)). Mutated
ras genes (Ha-ras, Ki4a-ras, Ki4b-ras and N-ras} are found in many
human cancers, including colorectal carcinoma, exocrine pancreatic
carcinoma, and myeloid leukemias. The protein products of these
genes are defective in their GTPase activity and constitutively
transmit a growth stimulatory signal.
Ras must be localized to the plasma membrane for
both normal and oncogenic functions. At least 3 post-translational
modifications are involved with Ras membrane localization, and all
3 modifications occur at the C-terminus of Ras. The Ras C-terminus
contains a sequence motif termed a "CAAX" or "Cys-Aaal-Aaa2-Xaa"
box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any
amino acid) (Willumsen et al., Nature 310:583-586 (1984)). Depend-
ing on the specific sequence, this motif serves as a signal sequence for
the enzymes farnesyl-protein transferase or geranylgeranyl-protein
transferase, which catalyze the alkylation of the cysteine residue of the
CAAX motif with a C15 or C2p isoprenoid, respectively. (S. Clarke.,
Ann. Rev. Biochem. 61:355-386 (i992); W.R. Schafer and J. Rine,
Ann. Rev. Genetics 30:209-237 (i992)). The Ras protein is one of
several proteins that are known to undergo post-translational farnesyla-
-1-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
tion. Other farnesylated proteins include the Ras-related GTP-binding
proteins such as Rho, fungal mating factors, the nuclear lamins, and the
gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182
(1994) have identified a peroxisome associated protein Pxf which is
also farnesylated. James, et al., have also suggested that there are
farnesylated proteins of unknown structure and function in addition
to those listed above.
Inhibition of farnesyl-protein transferase has been shown
to block the growth of Ras-transformed cells in soft agar and to modify
other aspects of their transformed phenotype. It has also been demon-
strated that certain inhibitors of farnesyl-protein transferase selectively
block the processing of the Ras oncoprotein intracellularly (N.E. Kohl
et al., Science, 260:1934-1937 (1993) and G.L. James et al., Science,
260:1937-1942 {1993). Recently, it has been shown that an inhibitor of
farnesyl-protein transferase blocks the growth of ras-dependent tumors
in nude mice (N.E. Kohl et al., Proc. Natl. Acad. Sci U.S.A., 91:9141-
9145 ( 1994) and induces regression of mammary and salivary
carcinomas in ras transgenic mice (N.E. Kohl et al., Nature Medicine,
1:792-797 ( 1995).
Indirect inhibition of farnesyl-protein transferase
in vivo has been demonstrated with lovastatin (Merck & Co., Rahway,
NJ) and compactin (Hancock et al., ibid; Casey et al., ibid; Schafer et
al., Science 245:379 (1989)). These drugs inhibit HMG-CoA reductase,
the rate limiting enzyme for the production of polyisoprenoids including
farnesyl pyrophosphate. Farnesyl-protein transferase utilizes farnesyl
pyrophosphate to covalently modify the Cys thiol group of the Ras
CAAX box with a farnesyl group (Reiss et al., Cell, 62:81-88 (1990);
Schaber et al., J. Biol. Chem., 265:14701-14704 (1990); Schafer et al.,
Science, 249:1133-1139 (1990); Manne et al., Proc. Natl. Acad Sci
USA, 87:7541-7545 (1990)). Inhibition of farnesyl pyrophosphate
biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane
localization in cultured cells. However, direct inhibition of farnesyl-
protein transferase would be more specific and attended by fewer side
effects than would occur with the required dose of a general inhibitor
-2-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
of isoprene biosynthesis.
Inhibitors of farnesyl-protein transferase {FPTase) have
been described in four general classes (S. Graham, Expert Opinion
Ther. Patents, (1995) 5:1269-1285). The first are analogs of farnesyl
diphosphate (FPP), while a second class of inhibitors is related to the
protein substrates (e.g., Ras) for the enzyme. Bisubstrate inhibitors and
inhibitors of farnesyl-protein transferase that are non-competitive with
the substrates have also been described. The peptide derived inhibitors
that have been described are generally cysteine containing molecules that
are related to the CAAX motif that is the signal for protein prenylation.
{Schaber et al., ibid; Reiss et. al., ibid; Reiss et al., PNAS, 88:732-736
(1991)). Such inhibitors may inhibit protein prenylation while serving
as alternate substrates for the farnesyl-protein transferase enzyme, or
may be purely competitive inhibitors (U.S. Patent 5,141,851, University
of Texas; N.E. Kohl et al., Science, 260:1934-1937 (1993); Graham,
et al., J. Med. Chem., 37, 725 (1994)). In general, deletion of the thiol
from a CAAX derivative has been shown to dramatically reduce the
inhibitory potency of the compound. However, the thiol group
potentially places limitations on the therapeutic application of FPTase
inhibitors with respect to pharmacokinetics, pharmacodynamics and
toxicity. Therefore, a functional replacement for the thiol is desirable.
Recently, certain tricyclic compounds which optionally
incorporate a piperidine moiety have been disclosed to be inhibitors of
FPTase (WO 95/10514, WO 95/10515 and WO 95/10516). Imidazole
containing compounds which are claimed to be inhibitors of farnesyl
protein transferase have also been disclosed (WO 95/09001 and EP 0
675 112 A1). WO 95/09001 discloses imidazolyl containing compounds
that are inhibitors of farnesyl protein transferase.
It has recently been reported that farnesyl-protein
transferase inhibitors are inhibitors of proliferation of vascular
smooth muscle cells and are therefore useful in the prevention and
therapy of arteriosclerosis and diabetic disturbance of blood vessels
(JP H7-112930).
It is, therefore, an object of this invention to develop
-3-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
low molecular weight compounds that will inhibit a prenyl-protein
transferase and thus, the post-translational prenylation of proteins.
It is a further object of this invention to develop chemotherapeutic
compositions containing the compounds of this invention and methods
for producing the compounds of this invention.
SUMMARY OF THE INVENTION
The present invention comprises bicyclic compounds
which inhibit a prenyl-protein transferase. Further contained in
this invention are chemotherapeutic compositions containing these
prenyl transferase inhibitors and methods for their production.
The compounds of this invention are illustrated by the
formula A:
Rsa-a
R3 A3 Y
8
~R )r
4
V ' A1UR~2)nA2~CR~2)n ' W ' UR22)p ' X '(CR22)p
Ra
A
DETAILED DESCRIPTION OF THE INVENTION
The compounds of this invention are useful in the inhibition
of prenyl-protein transferases and the prenylation of the oncogene
protein Ras. In a first embodiment of this invention, the inhibitors of
prenyl-protein transferase are illustrated by the formula A:
-4-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
R6a-a
R3 A3 Y
(Ra)r (Ra) Q
V - A1(CR~2)nA2(CR~2)n - W - (CR22)p ' X -(CR22)p I \R5
R4
A
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)_
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is a 5, 6 or 7 membered carbocyclic ring wherein from 0 to
3 carbon atoms are replaced by a heteroatom selected from
N, S and O, and wherein Y is attached to A3 through a
carbon atom;
R 1 and R2 are independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl,
C2_C6 ~ynyl~ RIOp_~ R11S(O)m-~ R10C(p)NR10_~
R11C(O)O_~ (R10)2NC(O)_~ R102N_C(NR10)-, CN, N02,
R10C(O)-~ N3~ -N(R10)2~ or R110C(O)NR10_~
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C( alkyl is selected
-5-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
from unsubstituted or substituted aryl, heterocyclic,
C3-C 1 p cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
R 100- R 11 S (O)m-~ R l OC(p)NR 10_~ (R 10)2NC(O)-
Rlp2N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)-NR 10_;
R3, R4 and RS are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-Clp cycloalkyl, C2-C6 alkenyl,
C2-C( alkynyl, halogen, C 1-C( perfluoroalkyl, R 120-,
R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~ R11C(O)O-
R102N-C(NR10)-, CN, N02, RlOC(O)_~ N3~ -N(R10)2~
or R110C(O)NR10_~
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C 1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 1 p cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
R 120-, R 11 S (O)m-, R 1 OC(O)NR 10_~ (R 10)2NC(O)-
R 1 p2N-C(NR 1 p)-, CN, R 1 OC(O)-, N3, -N(R 10)2, and
R1 lOC(O)-NR10_
R6a, R6b~ R6c~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-Clp cycloalkyl, C2-C( alkenyl,
C2-C( alkynyl, halogen, C 1-C6 perfluoroalkyl, R 120-,
R 11 S (O)m-~ R l OC(O)NR 10-~ (R 10)2NC(O)_~ R 11 C(O)O
R102N-C(NRlp)-, CN, N02, R10C(O)_, (R10)2NS(O)2_~
R11S(O)mNRlO_~ N3~ _N(R10)2~ or R110C(O)NR10_~
c) unsubstituted C 1-C( alkyl,
-6-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C( alkenyi, C2-C( alkynyl,
8120-, R11S(O)m-, R10C(O)NR10_~ (R10)2NC(O)_~
(R10)2NS(O)2_~ Rlls(O)mNRlO_~ R102N_C(NR10)-,
CN, R10C(O)-, N3, -N(R10)2, and R110C(O)-NR10_; or
any two of R6a, R6b, R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R~ is selected from: H; C1-q. alkyl, C3-6 cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C 1 _4 alkoxy,
b) aryl or heterocycle,
c)
O
- S~2R11
e) N(R 10)2 or
f) C1-4 perfluoroalkyl;
Rg is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C3-Clp cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
perfluoroalkyl, F, Cl, Br, 8100-, R11S(O)m-,
R10C(O)NR10_~ (R10)2NC(O)_~ (R10)2NS(O)2-
R11S(O)mNRlO_~ R102N_C(NR10)-, CN, N02, R10C(p)_~
N3, -N(R10)2, or R110C(O)NR10-, and

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
c) C1-C( alkyl unsubstituted or substituted by aryl,
cyanophenyl, heterocycle, C3-C 1 p cycloalkyl, C2-C(
alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, 8100-,
R11S(O)m-~ RIOC(p)NH_~ (R10)2NC(O)_~ (R10)2NS(O)2_~
R 11 S (O)mNR 10_~ R 102N_C(NR 10)-, CN, R 1 OC(O)-, N3
-N(R 10)2, or R 1 OOC(O)NH-;
R9 is independently selected from:
a) hydrogen,
b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br,
R 100- R 11 S(O)m-~ R 1 OC(O)NR 10_~ (R 10)2NC(p)_~
R102N-C(NR10)-, CN, N02, R10C(O)_~ N3~ -N(R10)2~ or
R 11 OC(O)NR 10-, and
c) C 1-C( alkyl unsubstituted or substituted by perfluoroalkyl,
F, Cl, Br, 8100-, R11S(O)m-, R10C(p)NR10_~
(R10)2NC(O)_, R102N_C(NR10)-, CN, R10C(O)-, N3,
-N(R10)2, or R110C(O)NR10_;
R 10 is independently selected from hydrogen, C 1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C( alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C( alkyl, C 1-C(
aralkyl, C 1-C( substituted aralkyl, C 1-C( heteroaralkyl,
C 1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C 1-C( perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
R13 is selected from hydrogen, C1-C( alkyl, cyano, C1-C6
alkylsulfonyl and C1-C6 acyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
_g_

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
_~C_, _C(O)_, _C(O}NR10_~ _NR10C(O)-~ O~ _N(R10)-
-S(O)2N(R10)_~ _N(R10)S(O)2_~ or S(O)m
A3 is selected from: -CH2-, -CH2CH2-, -C=C-, O, -N(R10)-, S(O)m,
-C(O)NR10_, _NR10C(p)_~ - CH2C(O)NR10_~ _ CH2NR10C(O}- ,
-C(O)NR10CH2-, -NR10C(O)CH2-, -CH20-, -CH2N(R10)-;
-CH2S(O)m-, -OCH2-, -N(R10)CH2- and -S(O)mCH2-;
V is selected from:
a) hydrogen,
b) heterocycle,
c) aryl,
d) C 1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl,
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle;
X is a bond, -CH=CH-, O, -C(=O)-, -C(O)NR~-, -NR~C(O)-,
-C(O)O-, -OC(O)-, -C(O)NR~C(O)-, -NR~-,
-S(O)2N(R10)_~ _N(R10)S(O)2_ or -S(=O)m-
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is independently 0, 1, 2, 3 or 4;
q is 0, l, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
t is 0 or 1;
or a pharmaceutically acceptable salt thereof.
-9-

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
In a preferred embodiment of this invention, the inhibitors
of prenyl-protein transferase are illustrated by the formula A:
Rsa-a
R3 A3 Y
(R8)r (Rs) Q
V - A~(CR12)nA2(CR12)n - W ' (CR22)p - X -(CR22)p I ERs
R4
A
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)_
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is a 5, 6 or 7 membered carbocyclic ring wherein from 0 to
3 carbon atoms are replaced by a heteroatom selected from
N, S and O, and wherein Y is attached to A3 through a
carbon atom;
R 1 and R2 are independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C( alkenyl,
- 10 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
C2_C6 ~ynyl~ R100_~ R1 is(O)m-~ R10C(O)NR10_~
R11C(O)O_~ (R10)2NC(O)_~ R102N_C(NR10)-, CN, N02,
R10C(O)-~ N3~ -N(R10)2~ or R110C(O)NR10_~
c) unsubstituted or substituted C1-C6 alkyl wherein the
S substituent on the substituted C1-C( alkyl is selected
from unsubstituted or substituted aryl, heterocyclic,
C3-C 10 cycloalkyl, C2-C( alkenyl, C2-C6 alkynyl,
8100-~ R11S(O)m-~ RlOC(O)NR10_~ (R10)2NC(p)_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)-NR 10_
R3, R4 and RS are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl,
C2-C6 alkynyl, halogen, C 1-C6 perfluoroalkyl, R 120-,
R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~ R11C(p)O_~
R102N-C(NR10)-, CN, N02, R10C(p)_, N3~ -N(R10)2,
or R110C(O)NR10_~
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C( alkenyl, C2-C6 alkynyl,
8120-, R11S(O)m-, R1OC(O)NR10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, R1OC(O)-, N3, -N(R10)2, and
R 11 OC(O)-NR 10_
R6a~ R6b~ R6c~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C1p cycloalkyl, C2-C( alkenyl,
C2-C( alkynyl, halogen, C 1-C6 perfluoroalkyl, R 120-,
- 11 -

CA 02305783 2000-03-31
WO 99/1$096 PCT/US98/20525
R 11 S{O)m-~ R l OC{O}NR 10_~ {R 10)2NC{p)_ ~ R 11 C(O)O_,
R102N-C(NR10)-, CN, N02, R10C(O)_~ (R10}2NS(p)2-
R11S{O)mNRlO_~ N3~ _N(R10)2~ or R110C(O}NR10_~
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloaikyl, C2-C6 alkenyl, C2-C6 alkynyl,
R120-> R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~
(R10)2NS(O)2-, Rlls(O)mNRlO_~ R102N_C(NR10)-,
CN, R 1 OC(O)-, N3, -N(R 10)2, and R 11 OC(O)-NR 10_; or
any two of R6a, R6b, R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R~ is selected from: H; C 1 _4 alkyl, C3_b cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C 1 _4 alkoxy,
b) aryl or heterocycle,
c)
O
d) -S02R11
e) N(R10)2 or
f) C 1 _q. perfluoroalkyl
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C3-C 10 cycloalkyl, C2-C( alkenyl, C2-C6 alkynyl,
perfluoroalkyl, F, Cl, Br, R 100-, R 11 S (O)m-,
- 12 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R10C(O)NR10_~ (R10)2NC(O)_~ (R10)2NS(O)2_~
R 11 S (O)mNR 10_, R 102N_C(NR 10)-, CN, N02, R 1 OC(O)_
N3, -N(R10)2, or R110C(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by aryl,
cyanophenyl, heterocycle, C3-C 10 cycloalkyl, C2-C(
alkenyl, C2-C( alkynyl, perfluoroalkyl, F, Cl, Br, 8100-,
R11S(O)m-, R10C(p)NH_~ (R10)2NC(p)_~ (R10)2NS(O)2_~
R11S(O)mNRIO_~ R102N_C(NR10)-, CN, R10C(O)-, N3~
-N(R 10)2, or R 100C(O)NH-;
R9 is independently selected from:
a) hydrogen,
b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br,
R 100-~ R 11 S (O)m-~ R l OC(O)NR 10_~ (R 10)2NC(p)_~
R102N-C(NR10)-, CN, N02, RIOC(O)_, N3~ -N(R10)2~ or
R110C(O)NR10_, and
c) C1-C( alkyl unsubstituted or substituted by perfluoroalkyl,
F, Cl, Br, 8100-, R11S(O)m-, R10C~0)NR10_~
(R10)2NC(O)_~ R102N_C(NR10)-, CN, R10C(O)-, N3,
-N(R 10)2, or R 11 OC(O)NR 10_;
R 10 is independently selected from hydrogen, C 1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C( alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C( alkyl, C 1-C(
aralkyl, C 1-C6 substituted aralkyl, C 1-C( heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C( perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
- 13 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R13 is selected from hydrogen, C1-C( alkyl, cyano, C1-C(
alkylsulfonyl and C1-C( acyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
_C=C-, -C(O)_, -C(O)NR10_~ -NR10C(O)_~ O, _N(R10)-
-S(O)2N(R10)_~ -N(R10)S(O)2_~ or S(O)m
A3 is selected from: -CH2-, O, -N(R10)-, S(O)m, -C(O)NR10_~
-NR10C(O)-, - CH2C(O)NR10_~ - CH2NR10C(O)- , -C(O)NR10CH2-,
-NR10C(O)CH2-, -CH20-, -CH2N(R10)-, CH2S(O)m-, -OCH2-,
-N(R10)CH2- and -S(O)mCH2-;
V is selected from:
a) hydrogen,
b) heterocycle,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C2p alkenyl,
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle;
X is a bond, -CH=CH-, O, -C(=O)-, -C(O)NR~-, -NR~C(O)-,
-C(O)O-, -OC(O)-, -C(O)NR~C(O)-, -NR~-,
-S(O)2N(R10)_~ -N(R10)S(O)2_ or -S(=O)m-
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is independently 0, 1, 2, 3 or 4;
q is 0, 1, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
- 14 -

CA 02305783 2000-03-31
WO 99/1809b PCTIUS98/20525
t 1S 0 Or 1;
or a pharmaceutically acceptable salt thereof.
Another preferred embodiment of the compounds of this
invention is illustrated by the following formula A:
Rsa-a
R3 A3 Y
(R8)f ~Rs) Q
V - A~(C%R~2)nA2(CR12)n - W - UR22)p - X -(CR22 p I ~R5
R4
A
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)_
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl, pyridyl, pyrimidinyl, pyrazinyl,
furyl, thiazolyl, isothiazolyl, tetrahydrofuryl, piperdinyl,
thiazolidinyl, piperazinyl and tetrahydrothienyl;
R 1 is independently selected from: hydrogen, C3-C 10 cycloalkyl, 8100-,
-N(R 10)2, F or C 1-C( alkyl;
- 15 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C 10 cycloalkyl, R 100-, -N(R10)2, F
or C2-C6 alkenyl,
c) unsubstituted or substituted Cl-C6 alkyl wherein the
substituent on the substituted C 1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C 10
cycloalkyl, C2-C6 alkenyl, R 100- and -N(R 10)2;
R3, R4 and R5 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
8120-, R11S(O)m-, R10C(O)NR10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, N02, R10C(O)_, N3~ -N(R10)2~
or R110C(O)NR10_~
c) unsubstituted C1-C6 alkyl;
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
8120-~ R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)-
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R1 lOC(O)-NR10_;
R6a~ R6b~ R6c~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-Clp cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C1-C( perfluoroalkyl,
R120-~ R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~
- 16 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
(R10)2Ng(O)2_~ Rlls(p)mNRIO_~ R102N_C(NR10)-, CN,
N02, R10C(p)_~ N3~ -N(R10)2~ or R110C(O)NR10_~
c) unsubstituted C 1-C( alkyl;
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C 1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,
8120-~ Rlls(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_,
(R10)2NC(p)_~ (R10)2NS(O)2_~ R11S(O)mNRIO_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)_NR 10_; or
any two of R6a, R6b, R6c~ R6d ~d R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R~ is selected from: H; C 1 _4 alkyl, C3_6 cycloalkyl, heterocycle, aryl,
aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or
substituted with:
a) C1-4 alkoxy,
b) aryl or heterocycle,
~R~~
c j[)
O
- Sp2R~ i
e) N(R 10)2 or
f) C1-4 perfluoroalkyl;
Rg is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C 1-C6 alkyl, C2-C6 alkenyl, C2-C( alkynyl, C 1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10_~
_ 17 _

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
(R10)2NC(O)_~ CN, N02, (R10)2N_C(NR10)-~ R10C(O)-
(R10)2NS(O)2_~ R11S(O)mNRlO_~ _N(R10)2~ or
R110C(O)NR10_, and
c) C1-C( alkyl substituted by C1-C( perfluoroalkyl,
8100-, R10C(O)NR10_~ (R10)2N_C(NR10)-~ R10C(O)_~
-N(R10)2, or R110C(O)NR10_;
R9 is selected from:
a) hydrogen,
b) C2-C6 alkenyl, C2-C( alkynyl, C1-C6 perfluoroalkyl, F,
Cl, R 100-, R 11 S(O)m-, R 1 OC(O)NR 10-~ (R 10)2NC(O)-
CN, N02, (R10)2N-C(NR10)-, R10C(O)-, -N(R10)2, or
R110C(O)NR10_, and
c) C1-C6 alkyl unsubstituted or substituted by C1-C6
perfluoroalkyl, F, Cl, R 100-, R 11 S (O)m-, R 1 OC(O)NR 10_~
(R10)2NC(O)-~ CN, (R10)2N_C(NR10)-~ R10C(O)_,
-N(R 10)2, or R 11 OC(O)NR 10_;
R10 is independently selected from hydrogen, C1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C6 alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C(
aralkyl, C1-C( substituted aralkyl, C1-C6 heteroaralkyl,
C1-C( substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C 1-C( perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 and A2 are independently selected from: a bond, -CH=CH-, -C-C-,
-C(O)-, -C(O)NR10-~ O~ _N(R10)_~ or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)-, S(O)m, -C(O)NR10_,
- 18 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
-NR 1 OC(O)-, -CH2C(O)NR 10-, _CH2NR 1 OC(O)-, -C(O)NR 1 OCH2-,
-NR10C(O)CH2-, -CH20-, -CH2N(R10)-, -CH2S(O)m-, -OCH2-,
-N(R10)CH2- and -S(O)mCH2-;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl,
2-oxopiperidinyl, oxazolyl, indoiyl, quinolinyl,
isoquinolinyl, triazolyl and thienyl,
c) aryl,
d) C1-C2p alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, imidazolinyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, oxazolyl, indolyl,
quinolinyl, triazolyl or isoquinolinyl;
X is a bond, O, -C(=O)-, -CH=CH-, -C(O)NR~-, -NR~C(O)-, -NR~-,
-S(O)2N(R10)_, _N(R10)S(O)2_ or -S(=O)m-;
m is 0, 1 or 2;
n is independently 0, l, 2, 3 or 4;
p is independently 0, l, 2, 3 or 4;
q is 0, 1, 2 or 3;
r is 0 to 5, provided that r is 0 when V is hydrogen; and
t is 0 or 1;
or a pharmaceutically acceptable salt thereof.
A preferred embodiment of the compounds of this
invention are illustrated by the formula B:
- 19 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R6a-a
(R8)r R9a 3 3 Y ~
R A
V ' A~(CR~2)nA2(CR~2)n N. 'N
/v\J Q
R~
(CR22)P X Rs
Ra
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)_
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl and pyridyl;
R 1 is selected from: hydrogen, C3-C 10 cycloalkyl, R 100-, -N(R 10)2,
F or C 1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, 8100-, -N(R10)2,
F or C2-C6 alkenyl,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C10
cycloalkyl, C2-C6 alkenyl, 8100- and -N(R 10)2;
R3 and R4 are independently selected from:
- 20 -

CA 02305783 2000-03-31
WO 99/18096 PCT/tJS98/20525
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycioalkyl, C2-C(
alkenyl, C2-C( alkynyl, halogen, C1-C6 perfluoroalkyl,
8120-, R11S(O)m-, R10C(O)NR10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, N02, RlOC(O)_~ N3~ -N(R10)2~
or R110C(O)NR10_~
c) unsubstituted Cl-C6 alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C l0 cycloalkyl, C2-C( alkenyl, C2-C6 alkynyl,
R 120- R 11 S(O)m-~ R10C(p)NR 10_~ (R 10)2NC(O)_~
R102N-C(NR10)-, CN, RIOC(O)-, N3, -N(R10)2, and
R1 lOC(O)-NR10_
R6a~ R6b~ R6c~ R6d ~d R6e ~e independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl,
C2-C6 alkynyl, halogen, C 1-C6 perfluoroalkyl, R 120-,
R11S(O)m-~ R10C(p)NR10_~ (R10)2NC(O)_~
(Ri0)2NS(O)2_~ Rllg(O)mNRIO_~ R102N_C(NR10)-, CN,
N02, R10C(O)_~ N3~ -N(R10)2~ or R110C(O)NR10_~
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted Cl-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cYcloalkyl, C2-C6 alkenyl, C2-C( alkynyl, 8120-,
R11S(O)m-, RiOC(O)NR10_~ (R10)2NC(O)_~
(R10)2NS(O)2_~ R11S(O)mNRIO_~ R102N_C(NR10)-, CN,
R10C(O)_~ N3~ _N(R10)2~ and R110C(O)-NR10_; or
- 21 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
any two of R6a, R6b, R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
Rg is independently selected from:
a) hydrogen,
b} aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C( alkyl, C2-C( alkenyl, C2-C6 alkynyl, C1-C(
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10_~
(R10)2NC(O)-, (R10}2NS(O)2_~ R11S(O}mNRlO_, CN,
N02, (R10)2N_C(NR10)-~ R10C(O)_~ _N(R10}2~ or
R110C(O)NR10-, and
c) C 1-C6 alkyl substituted by C 1-C( perfluoroallcyl, R 100-,
RlOC(O)NR10_~ (R10)2N_C(NR10)_~ (R10)2NS(O)2_~
R11S(O)mNRIO_~ R10C(O)_~ _N(R10)2~ or
R 11 OC(O}NR 10-;
R9a and R9b are independently hydrogen; C1-C6 alkyl, trifluoromethyl
and halogen;
R 10 is independently selected from hydrogen, C 1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C( alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C( alkyl, C 1-C(
aralkyl, C1-C6 substituted araikyl, C1-C( heteroaralkyl,
C1-C( substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C( perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-, -C-C-,
-C{O)-, -C(O)NR10_~ O~ _N{R10)_~ or S(O)m;
- 22 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
A3 is selected from: -CH2-, O, -N(R10)-, - C(O)NR10_~
-C(O)NR10CH2-, -CH2C(O)NR10-, -CH20-, -OCH2- or S(O)m;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl, 2-
oxopiperidinyl, oxazolyl, indolyl, quinolinyl, isoquinolinyl,
triazolyl and thienyl,
c) aryl,
d) C 1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
X is a bond, -CH=CH-, -C(O)NR 10-, -NR 1 OC(O)-, -NR 10-, O or
-C(=O)-;
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4; and
r is 0 to 5, provided that r is 0 when V is hydrogen;
or a pharmaceutically acceptable salt thereof.
Another preferred embodiment of the compounds of this
invention are illustrated by the formula C:
- 23 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R6a-a
(Rg~r R3
~N R9a
V - A1UR12)nA2(CR~2)~_N Q
R9b (CR22~p ~ ~R5
Ra
wherein:
Q is a 6-membered heterocyclic ring which comprises a
nitrogen atom and 0-2 additional nitrogen atoms and having
the remaining atoms being carbon atoms, and which also
optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)_
or sulfonyl moiety adjacent to a nitrogen atom, provided
that Q is not piperazine, piperazinone, diketopiperazine,
piperidine, piperidinone, diketopiperidine or
triketopiperidine;
Y is selected from: phenyl, cyclohexyl, pyridyl, pyrimidinyl, pyrazinyl,
furyl, thiazolyl, isothiazolyl, tetrahydrofuryl, piperdinyl, thiazolidinyl,
piperazinyl and tetrahydrothiophenyl;
R1 is selected from: hydrogen, C3-C10 cycloalkyl, 8100-, -N(R10)2, F
or C 1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C l p cycloalkyl, 8100-, -N(R 10)2, F
or C2-C6 alkenyl,
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted Cl-C( alkyl is selected from
unsubstituted or substituted aryl, heterocycle, C3-C 10
cycloalkyl, C2-C6 alkenyl, 8100- and -N(R10)2;
- 24 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R3 and R4 are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C 1-C( perfluoroallcyl,
8120-~ Rlls(O)m-~ R10C(O)NR10_~ CN(R10)2NC(O)-,
R102N-C(NR10)-, CN, N02, R10C(p)-~ N3~ -N{R10)2~
or R110C(O)NR10_~
c) unsubstituted C 1-C( alkyl,
d) substituted C 1-C6 alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
8120-, R11S(O)m-, R10C(O)NR10_~ (R10)2NC(O)_~
R102N-C{NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)-NR 10-
R6a~ R6b~ R6c~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, halogen, C 1-C( perfluoroalkyl, R 120-,
R11S(O)m-~ RlOC(p)NR10_~ {R10)2NC(O)_~
R 11 S (O)2NR 10_, (R 10)2NS(O)2_~ R 102N_C{NR 10)-, CN,
N02, R10C{O)_~ N3~ -N{R10)2~ or R110C(O)NR10_~
c) unsubstituted C1-C( alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 1 p cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
- 25 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
8120-, RllS(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~
Rlls(O)2NR10_~ (R10)2NS(O)2_~ R102N_C(NR10)-, CN,
R10C(O)-, N3~ -N(R10)2~ and R110C(O)-NR10_; or
any two of R6a, R6b~ R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C 1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C 1-C6
perfluoroalkyl, F, Cl, R 100-, R 1 OC(O)NR 10_,
(R10)2NC(O)_, Rlls(O)2NR10_~ (R10)2NS(O)2_~ CN
NO2, (R10)2N_C(NR10)_, R10C(O)_, -N(R10)2> or
R110C(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl,
RlOp_, R10C(p)NR10_~ (R10)2NC(O)_~ Rlls(O)2NR10_~
(R10)2NS(O)2_~ (R10)2N_C(NR10)_~ R10C(p)_~
-N(R10)2, or R110C(O)NR10_;
R9a and R9b are independently hydrogen, C 1-C6 alkyl, trifluoromethyl
and halogen;
R 10 is independently selected from hydrogen, C 1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C6 alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C6
aralkyl, C 1-C6 substituted aralkyl, C 1-C6 heteroaralkyl,
C1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
- 26 -

CA 02305783 2000-03-31
WO 99/18096 PGT/US98/20525
2-aminoethyl and 2,2,2-trifluoroethyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-, -C=C-,
-C(O)-, -C(O)NR10_~ p~ _N(R10)-, or S(O)m'>
A3 is selected from: -CH2-, O, -N(R 10)- or S(O)m;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
imidazolinyl, pyridinyl, thiazolyl, pyridonyl,
2-oxopiperidinyl, oxazolyl, indolyl, quinolinyl,
isoquinolinyl, triazolyl and thienyl,
c) aryl,
d) C 1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C2p alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not hydrogen
if A1 is a bond, n is 0 and A2 is S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(-O)_;
m is 0, 1 or 2;
n is independently 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4, provided that p is not 0 if X is a bond or O;
and
r is 0 to 5, provided that r is 0 when V is hydrogen;
or a pharmaceutically acceptable salt thereof.
In a more preferred embodiment of this invention, the
inhibitors of prenyl-protein transferase are illustrated by the formula D:
- 27 -

CA 02305783 2000-03-31
WO 99/1$096 PCT/US98/20525
R9a f- f\, Rsa-a
~ R3 A3-~\ ,~f
' _ N f- f
A (CR 2)n N J ' Q
\,
\ R9b (CR22)p-X ~ ~R5
R4
(Rs)r D
wherein:
Q is selected from
\ / \ i \
O
_ w
N
N \ / and ~ \ N
0 NH
s o
from 0-1 of f(s) are independently N, and the remaining fs are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, 8100-, -N(R10)2, F
or C2-C6 alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl, R 100-, or
_N(R10)2~
- 28 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R3 is selected from:
a) hydrogen,
b) , unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl,
C2-C( alkynyl, halogen, C 1-C( perfluoroalkyl, R 120-,
R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~ R102N_
C(NR10)-, CN, N02, RIOC(O)_~ N3~ -N(R10)2~ or
R 11 OC(O)NR 10_~
c) unsubstituted C 1-C( alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C 1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C( alkenyl, C2-C( alkynyl,
R120-~ R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R110C(O)-NR10_;
R4 is selected from H, halogen, C1-C( alkyl and CF3;
R6a, R6b, R6c, R6d ~d R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C6
alkenyl, C2-C( alkynyl, halogen, C1-C( perfluoroalkyl,
8120-, R11S(O)m-, R10C(O)NR10_~ (R10)2NC(p)-
R102N-C(NR10)-, CN, N02, R10C(O)_~ N3~ -N(R10)2~
or R110C(O)NR10-
c) unsubstituted C1-C( alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-Clp cycloalkyl, C2-C( alkenyl, C2-C( alkynyl,
- 29 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R120-~ R11S(O)m-~ R10C(O)NR10-~ (R10)2NC(O)_,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11OC(O)_NR10_; or
any two of R6a, R6b, R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
R8 is independently selected from:
a) hydrogen,
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C( alkyl, C2-C6 alkenyl, C2-C( alkynyl, C1-C6
perfluoroalkyl, F, Cl, R 100-, R 1 OC(O)NR 10_~
(R10)2NC(O)-, CN, N02, (R10)2N-C(NR10)_~
R 1 OC(O)-, -N(R 10)2, or R 11 OC(O)NR 10_, and
c) C1-C( alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C(O)NR10-~ (R10)2NC(O)_~ (R10)2N_C(NR10)_,
R10C(O)-, -N(R10)2, or R110C(O)NR10-;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R 10 is independently selected from hydrogen, C 1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C6 alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C(
aralkyl, C1-C( substituted aralkyl, C1-C( heteroaralkyl,
C 1-C6 substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 is selected from: a bond, -C(O)-, O, -N(R10)-, or S(O)m;
- 30 -

CA 02305783 2000-03-31
wo ~uso96 rcr~s9snos2s
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR 10-, -NR 1 OC(O)-, -NR 10-, O or
-C(=O)-,
n is 0 or l; provided that n is not 0 if A1 is a bond, O,
_N(R10)- or S(O)m;
m is 0, 1 or 2;
p is 0, 1, 2, 3 or 4; and
r is 0, 1 or 2;
or a pharmaceutically acceptable salt thereof.
In another more preferred embodiment of this invention,
the inhibitors of prenyl-protein transferase are illustrated by the
formula E:
Rsa-a
f=f~~
3
Rga R ps--C~ ,~f
N,~ f- f
A1 CRi ~ N
C 2)n ~.~ ~
Rgb (CR22)p-x ~ \R5
R4
(Ra)r
wherein:
Q is selected from
- 31 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
-N ~_ _~ N _ N-~_
\ / \ i \
O
O
N
\ ~ \ / and -~ \ \N-~_
NH
O
from 0-1 of f(s) are independently N, and the remaining f s are
independently CH;
R 1 is selected from: hydrogen, C3-C 10 cycloalkyl, R 100-, -N(R 10)2,
F or C 1-C6 alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C 10 cycloalkyl, R 100-, -N(R 10)2, F
or C2-C( alkenyl,
c) C1-C( alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C 1 p cycioalkyl, C2-C( alkenyl, R 100-, or
_N(R10)2~
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C(
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
R120-~ Rlls(O)m-~ R10C(O)NR10_~ (R10)2NC(p)_,
R102N-C(NR10)-, CN, N02, R10C(O)_~ N3~ -N(R10)2~
or R110C(O)NR10_~
c) unsubstituted C1-C( alkyl,
- 32 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
R 120-, R 11 S(O)m-, R 1 OC(O)NR 10_~ (R 10)2NC(O)-,
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R1 lOC(O)-NR10_;
R4 is selected from H, halogen, C1-C6 alkyl and CF3;
R6a~ R6b~ R6c~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-C(
alkenyl, C2-C6 alkynyl, halogen, C1-C6 perfluoroalkyl,
8120-~ R11S(O)m-~ RIOC(O)NR10_, (R10)2NC(O)_~
R 102N-C(NR 10)-, CN, N02, R 1 OC(O)_, N3 ~ -N(R 10)2
or R110C(O)NR10_~
c) unsubstituted C1-C( alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 1 p cycloalkyl, C2-C( alkenyl, C2-C( alkynyl,
8120-~ R11S(O)m-~ R10C(O)NR10_~ (R10)2NC(p)_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)_NR 10-; or
any two of R6a, R6b, R6c~ R6d and R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
Rg is independently selected from:
a) hydrogen,
- 33 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C1-C6 alkyl, C2-C( alkenyl, C2-C( alkynyl, C1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10_~
(R10)2NC(p)_~ CN, N02, (R10}2N_C(NR10)_~ R10C(O)_~
-N(R 10)2, or R 11 OC(O)NR 10-, and
c) C 1-C( alkyl substituted by C 1-C( perfluoroalkyl, R 100-,
R10C(O}NR10_~ (R10)2NC(O)_~ (R10)2N_C(NR10)_~
R10C(O)-, -N(R10)2, or R110C(O)NR10_;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C( alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C(
aralkyl, C1-C( substituted aralkyl, C1-C( heteroaralkyl,
C 1-C( substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A 1 is selected from: a bond, -C(O)-, O, -N(R 10}-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C(O)-, -NR10-, O or
-C(=O)-;
n is 0 or l;
m is 0, 1 or 2;
p is 0, 1, 2, 3 or 4, provided that p is not 0 if X is a bond or O;
and
- 34 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
r is 0, 1 or 2;
or a pharmaceutically acceptable salt thereof.
In a further embodiment of this invention, the inhibitors of
prenyl-protein transferase are illustrated by the formula F:
9a f=f\
R R3 A3~ f
~_- N ~N ~~ Rsa-a
CR~2 N ~ Rib
R4
(CR22)p-
R8 R8 F
wherein:
from 0-1 of f(s) are independently N, and the remaining fs are
independently CH;
R1 is selected from: hydrogen, C3-C10 cycloalkyl or C1-C( alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, C3-C10 cycloalkyl, 8100-, -N(R10)2 or
F,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C10 cycloalkyl, 8100-, or -N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C(
alkenyl, C2-C( alkynyl, halogen, C 1-C( perfluoroalkyl,
R124-~ Rlls(~)m-~ R10C(p)NR10_~ (R10)2NC(p)_~
- 35 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
R102N-C(NR10)-, CN, N02, R10C(O}-~ N3~ -N(Rlp)2~
or R110C(O)NR10_,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-Clp cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
8120-~ Rlls(0)m-~ R10C(0}NR10_~ (R10)2NC(p)_~
R102N-C(NRlp)-, CN, R10C(O)-, N3, -N(Rlp)2, and
R1 lOC(O)-NR10_;
R4 is selected from H, halogen, CH3 and CF3;
R6a~ R6b~ R6c~ R6d ~d R6e ~e independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-Clp cycloalkyl, C2-C(
alkenyl, C2-C6 alkynyi, halogen, C1-C( perfluoroalkyl,
8120-, RIlS(0)m-~ R10C(O}NR10_~ (R10)2NC(O)_~
Rlp2N-C(NR10)-, CN, N02, R10C(0}_~ N3~ _N(R10)2~
or R110C(O)NR10_~
c) unsubstituted C 1-C( alkyl,
d} substituted C1-C( alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 1 p cycloalkyl, C2-C( alkenyl, C2-C( alkynyl,
R120-~ Rlls(0)m-~ R10C(0}NR10_~ (R10}2NC(0)_~
R 1 p2N-C(NR 10)-, CN, R 1 OC(O)-, N3, -N(R 1 p)2, and
RllpC(O)-NR10_~ or
any two of R6a, R6b, R6c~ R6d ~d R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)4- and -(CH2)3-;
- 36 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
Rg is independently selected from: -CN, Cl, -N02, C1-C6 alkoxy, and
2,2,2-trifluoroethoxy;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
R10 is independently selected from hydrogen, C1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C(
aralkyl, C1-C6 substituted aralkyl, C1-C6 heteroaralkyl,
C 1-C( substituted heteroaralkyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
X is a bond, -CH=CH-, -C(O)NR10-, -NR10C{O)-, -NR10-, O or
-C(=O)-;
m is 0, 1 or 2; and
p is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt thereof.
In a further embodiment of this invention, the inhibitors of
prenyl-protein transferase are illustrated by the formula G:
- 37 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
f=f
R
R9a . N , ' Rsa-a
g 9b
R R ~~ w
~Ra
R8 / ~ 2
A1(CR~2)n R2 R
G
wherein:
from 0-1 of f(s) are independently N, and the remaining fs are
independently CH;
R 1 is selected from: hydrogen, C3-C 1 p cycloalkyl, R 100-, -N(R 10)2,
F or C 1-C( alkyl;
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle or C3-C10 cycloalkyl,
c) C1-C( alkyl unsubstituted or substituted by aryl,
heterocycle, C3-Clp cycloalkyl, C2-C( alkenyl, 8100-,
or -N(R10)2;
R3 is selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C(
alkenyl, C2-C( alkynyl, halogen, C1-C6 perfluoroalkyl,
8120-~ Rlls(O)m-~ R10C(O)NR10_~ (R10)2NC(O)_~
R102N_C(NR10)-, CN, N02, R10C(p)_~ N3~ _N(R10)2~
or R110C(O)NR10_~
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
- 38 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C10 cycloalkyl, C2-C( alkenyl, C2-C( alkynyl,
8120-~ Rlls(O)m-~ R10C(O)NR10_~ (R10)2NC(p)_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R11 OC(O)-NR10_;
R4 is selected from H, halogen, CH3 and CF3;
R6a~ R6b~ Rtic~ R6d and R6e are independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C 10 cycloalkyl, C2-C(
alkenyl, C2-C6 alkynyl, halogen, C1-C( perfluoroalkyl,
8120-~ Rlls(O)m-~ R10C(p)NR10_~ (R10)ZNC(p)_~
R102N-C(NR10)-, CN, N02, RlOC(p)_~ N3~ -N(R10)2>
or R110C(O)NR10_~
c) unsubstituted C1-C( alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C( alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-C 10 cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl,
8120-~ Rlls(O)m-~ R10C(p)NR10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(p)_NR 10-; or
any two of R6a, R6b, R6c~ R6d ~d R6e on adjacent carbon atoms are
combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH2-, -(CH2)q.- and -(CH2)3-;
Rg is independently selected from: -CN, Cl, -N02, C1-C6 alkoxy, and
2,2,2-trifluoroethoxy;
R9a and R9b are independently hydrogen, ethyl, cyclopropyl or methyl;
- 39 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
R10 is independently selected from hydrogen, C1-C( alkyl, benzyl,
2,2,2-trifluoroethyl and aryl;
R 11 is independently selected from C 1-C6 alkyl and aryl;
R 12 is independently selected from hydrogen, C 1-C( alkyl, C 1-C(
aralkyl, C1-C( substituted aralkyl, C1-C6 heteroaralkyl,
C1-C( substituted heteroarallcyl, aryl, substituted aryl,
heteroaryl, substituted heteraryl, C 1-C6 perfluoroalkyl,
2-aminoethyl and 2,2,2-trifluoroethyl;
A1 is selected from: a bond, -C{O)-, O, -N(R10)-, or S(O)m;
A3 is selected from: -CH2-, O, -N(R10)- or S(O)m;
m is 0, 1 or 2; and
n is 0 or 1;
or a pharmaceutically acceptable salt thereof.
Specific examples of the compounds of the invention are:
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylthio)pyrid-5-ylmethyl)-
imidazole
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylphenoxy) pyrid-5-
ylmethyl)imidazole
5-(4'-Cyanobenzyl)-1-[2-(3"-chlorophenylthio) pyrid-5-ylmethyl)]-
imidazole
5-(4' -Cyanobenzyl)-1- [2-(cyclohexylthio)pyrid-5-ylmethyl] imidazole
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylthio)pyrid-4-ylmethyl)]-
imidazole
- 40 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
5-(4'-Cyanobenzyl)-1-[2-(cyclohexylamino)pyrid-5-ylmethyl)]imidazole
5-(4'-Cyanobenzyl) 1-[2-(3"-chlorophenylthio)pyrid-5-ylmethyl]-
imidazole -S~ oxide
2-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -6-(3-
trifluoromethylphenoxy)pyridine
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -6-{3-
trifluoromethylphenoxy)pyridine
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -5-(3-
trifluoromethylphenoxy)pyridine
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -5-(3-
trifluoromethylbenzyloxy)pyridine
5-chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic
acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic acid {2-
[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
1-(3-Trifluoromethylbenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic
acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic acid {2-
[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
5-Chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic
acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
6-[N-(3-Chlorobenzyl) carbamoyl]- 4-ethoxy-pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
- 41 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
6-[N-(3-Chlorophenyl) carbamoyl]- 4-ethoxy-pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
4-(3-Chlorobenzyloxy)- 6-methoxycarbonyl- pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
4-(5-{ [6-(3-chloro-phenoxy)-pyridin-2-ylamino)-methyl}-imidazol-1-
ylmethyl)-benzonitrile
4-(5- { [6-(phenylethynyl)-pyridin-2-ylamino]-methyl }-imidazol-1-
ylmethyl)-benzonitrile
4-(5-{ [6-(1,2,3,4-tetrahydronaphth-6-yloxy)-pyridin-2-ylamino]-
methyl }-imidazol-1-ylmethyl)-benzonitrile and
4-(5- { [6-(2-phenylethyl)-pyridin-2-ylamino]-methyl }-imidazol-1-
ylmethyl)-benzonitrile
or the pharmaceutically acceptable salts thereof.
Particular examples of the compounds of the instant
invention are:
5-{4'-Cyanobenzyl)-1-[2-{3"-chlorophenylthio) pyrid-5-ylmethyl))-
imidazole
NC /
CI
il
N NHS
5-(4'-Cyanobenzyl)-1-[2-{3"-methylphenylphenoxy) pyrid-5-
ylmethyl)imidazole
- 42 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
NC
CH3
w
N~ ~ i / I
N O \
5-chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic
acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
NC / I O
N /
N N I / \ I
N O CI CI
4-(3-Chlorobenzyloxy)- 6-methoxycarbonyl- pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide
/ CI
NC / I O I
N I N OCH3
N~ ~ O O
or the pharmaceutically acceptable salts thereof.
The compounds of the present invention may have
asymmetric centers and occur as racemates, racemic mixtures, and as
individual diastereomers, with all possible isomers, including optical
isomers, being included in the present invention. When any variable
(e.g. aryl, heterocycle, R1, R2 etc.) occurs more than one time in any
constituent, its definition on each occurence is independent at every
other occurence. Also, combinations of substituents/or variables are
permissible only if such combinations result in stable compounds.
As used herein, "alkyl" and the alkyl portion of aralkyl and
similar terms, is intended to include both branched and straight-chain
- 43 -

CA 02305783 2000-03-31
WO 99/1809b PCT/U598/20525
saturated aliphatic hydrocarbon groups having the specified number of
carbon atoms; "alkoxy" represents an alkyl group of indicated number
of carbon atoms attached through an oxygen bridge.
As used herein, "cycloalkyl" is intended to include non
5 aromatic cyclic hydrocarbon groups having the specified number of
carbon atoms. Examples of cycloalkyl groups include cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl and the like.
"Alkenyl" groups include those groups having the
specified number of carbon atoms and having one or several double
bonds. Examples of alkenyl groups include vinyl, allyl, isopropenyl,
pentenyl, hexenyl, heptenyl, cyclopropenyl, cyclobutenyl, cyclopentenyl,
cyclohexenyl, 1-propenyl, 2-butenyl, 2-methyl-2-butenyl, isoprenyl,
farnesyl, geranyl, geranylgeranyl and the like.
"Alkynyl" groups include those groups having the specified
number of carbon atoms and having one triple bond. Examples of
alkynyl groups include acetylene, 2-butynyl, 2-pentynyl, 3-pentynyl
and the like.
"Halogen" or "halo" as used herein means fluoro, chloro,
bromo and iodo.
20 As used herein, "carbocyclic ring" is intended to mean any
stable monocyclic carbon ring of the designated ring atoms, which can
either be aromatic or non-aromatic.
As used herein, "aryl," and the aryl portion of aroyl and
aralkyl, is intended to mean any stable monocyclic or bicyclic carbon
25 ring of up to 7 members in each ring, wherein at least one ring is
aromatic. Examples of such aryl elements include phenyl, naphthyl,
tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or
acenaphthyl.
The term heterocycle or heterocyclic, as used herein,
30 represents a stable 5- to 7-membered monocyclic or stable 8- to
11-membered bicyclic heterocyclic ring which is either saturated or
unsaturated, and which consists of carbon atoms and from one to four
heteroatoms selected from the group consisting of N, O, and S, and
including any bicyclic group in which any of the above-defined hetero-
- 44 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
cyclic rings is fused to a benzene ring. The heterocyclic ring may be
attached at any heteroatom or carbon atom which results in the creation
of a stable structure. Examples of such heterocyclic elements include,
but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl,
benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl,
benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl,
dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl,
dihydrobenzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl,
imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl,
isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl,
naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 2-oxopiperazinyl,
2-oxopiperdinyl, 2-oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl,
pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl,
pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl,
I S tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl,
thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl,
thienofuryl, thienothienyl, and thienyl.
As used herein, "heteroaryl" is intended to mean any stable
monocyclic or bicyclic carbon ring of up to 7 members in each ring,
wherein at least one ring is aromatic and wherein from one to four
carbon atoms are replaced by heteroatoms selected from the group
consisting of N, O, and S. Examples of such heterocyclic elements
include, but are not limited to, benzimidazolyl, benzisoxazolyl,
benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl,
benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl,
dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl,
dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl,
isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl,
oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl,
pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl,
tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl,
thienothienyl, and thienyl.
As used herein in the definition of R3, R4, RS and R6a-e~
the term "the substituted group" is intended to mean a substituted C I _g
- 45 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
alkyl, substituted C2-g alkenyl, substituted C2_g alkynyl, substituted aryl
or substituted heterocycle from which the substituent(s) R3, R4, RS and
R6a-a ~e selected.
As used herein in the definition of R~, the substituted C1-$
alkyl, substituted C3-6 cycloalkyl, substituted aroyl, substituted aryl,
substituted heteroaroyl, substituted arylsulfonyl, substituted hetero-
arylsulfonyl and substituted heterocycle include moieties containing
from 1 to 3 substituents in addition to the point of attachment to the
rest of the compound.
Lines drawn into the ring systems from substituents (such
as from R3, R4, Q etc.) means that the indicated bond may be attached
to any of the substitutable ring carbon or nitrogen atoms.
The substituent illustrated by the structure
~~J
represents a 6-membered heterocyclic ring which comprises a nitrogen
atom and 0-2 additional heteroatoms selected from N, S and O, and
which optionally comprises a carbonyl, thiocarbonyl, -C(=NR13)- or
sulfonyl moiety adjacent to the nitrogen atom and includes the following
ring systems:
- 46 -

CA 02305783 2000-03-31
WO 99/18096 PCTlUS98/20525
_N N '
v
\ ~ -~ \ ~N ~ \ ~ \ N
v
O
N~o
\ N_ - -~ \ ~N-~- \ N_ - - \ N_ _
NR~3
~O
O NRis
O H
_ N
_ _ _ ~N
\ N N N ~~ S
S~ Sw II~O
Sl lI~ O 101 O I I~ O O
O O
_ N. _ _ N~N_ _ . N_ - _ N_ _
N-Sw ~Sw \ N
I I~ O I I~ O S O
O O
Preferably, the structure
~~J
is selected from:
- 47 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
-N "
\.__ / - N N~ -~ \ N. _
\ i ~ \ /
O
_ ~_
\ \N-~- -~ \ \N-~- \ N. _
O NR~3 NRIa
Most preferably, Q is
N
It is understood that such rings may be substituted by R3, R4 and/or RS
as defined hereinabove.
The substituent illustrated by the structure
Y
represents a 5, 6 or 7 membered carbocyclic ring wherein from 0 to 3
carbon atoms are replaced by a heteroatom selected from N, S and O,
and wherein Y is attached to A3 through a carbon atom and includes the
following ring systems:
- 48 -

CA 02305783 2000-03-31
WO 99/18096 PCT/t1S98/20525
I \ N \ I N"~ ~ N
N1
I \ I I IN
., N -~ N' N '~ N
N \ ~ N NLN~ N~ N
.~'z,~ NJ ~ I J .~'z,~ IN .'~,,~ N
N
I O (O IS (O
.~
=~., :~., :~-z, N
H H
,
O I
I N I ~ N N
S
N . N
S S, O S
I ~~ I ~ N
'
,, N
NH HN
., -~ NH
Preferably Y is the moiety designated by the following structure
f~f1 f
~~ f~f
'
which represents an aromatic 6-membered ring and includes the
following ring systems:
- 49 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
N \ I N~ I ~ N
/ '~ /
N~
N~ I\ I
N, N ,~ ~ N
O
N~N N'N HN~NH
I / .~,.~~0
I\
,''~ /
wherein it is understood that one of the ring carbon atoms is substituted
with A3. Preferably, the Y is selected from phenyl and pyridyl.
The moiety described as
R6a-a
Y
where any two of R6a, R6b, R6c~ R6d ~d R6e on adjacent carbon atoms
are combined to form a diradical selected from -CH=CH-CH=CH-,
-CH=CH-CH-, -(CH2)4- and -(CH2)4- includes, but is not limited to, the
following structures:
\ \ \ \ \
I / / ,'~, I / / I /
/ /
/ \ I =
to
-so-

CA 02305783 2000-03-31
WO 99/18096 PCT1US98/20525
' Nw \ Nw \ ~ \
~'~) / / /
i i
N \ \
'~, I / /
It is understood that such fused ring moieties may be further substituted
by the remaining R6a, R6b, R6c~ R6d and/or R6e as defined
hereinabove.
Preferably, R 1 and R2 are independently selected from:
hydrogen, R11C(O)O-, -N(R10)2, R10C(O)NR10-, R100_ or
unsubstituted or substituted C1-C6 alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or substituted
phenyl, -N(R 10)2, R 100- and R 1 OC{O)NR 10_,
Preferably, R3 is selected from:
a) hydrogen,
b) C3-C 10 cycloalkyl, halogen, C 1-C( perfluoroalkyl, 8120-,
CN, N02, R10C(O)- or -N(R10)2,
c) unsubstituted C1-C6 alkyl,
d) substituted C1-C( alkyl wherein the substituent on the
substituted Cl-C6 alkyl is selected from unsubstituted or
substituted aryl, unsubstituted or substituted heterocyclic,
C3-Clp cycloalkyl, C2-C( alkenyl, C2-C6 alkynyl,
8120-, R11S{O)m-, RIOC(p)NR10_~ (R10)2NC(O)_~
R102N-C{NR10)-, CN, R10C(O)-, N3, -N(R10)2, and
R 11 OC(O)-NR 10-.
Preferably, R4 is selected from: hydrogen, halogen,
trifluoromethyl, trifluoromethoxy and C1-C( alkyl.
Preferably, RS is hydrogen.
Preferably, R6a, R6b, R6c~ R6d ~d R6e ~e independently
selected from:
- 51 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
a) hydrogen,
b) C3-C 10 cycloalkyl, halogen, C 1-C( perfluoroalkyl, R 120-,
R11S{O)m-~ CN~ N02, R10C(O)_ or -N(R10)2~
c) unsubstituted C1-C6 alkyl; and
d) substituted C1-C( alkyl wherein the substituent on the
substituted C1-C6 alkyl is selected from unsubstituted or
substituted aryl, C3-C 10 cycloalkyl, 8120-, R 11 S (O)m-,
R 1 OC(O)- or -N(R 10)2.
Preferably, R8 is independently selected from:
a) hydrogen, and
b) aryl, substituted aryl, heterocycle, substituted heterocycle,
C 1-C( perfluoroalkyl, C 1-C( alkoxy, C 1-C6
perfluoroalkoxy, 2,2,2-trifluoroethoxy, -CH2NHC(O)CH3,
-NHC{O)CH3 or CN.
Preferably, R9 is hydrogen, halogen or methyl.
Preferably, R 10 is selected from H, C 1-C6 alkyl and
benzyl.
Preferably, A 1 and A2 are independently selected from:
a bond, -C(O)NR10-, -NR10C(O)-, O, -N(R10)-, -S(O)2N(R10)- and
-N(R10)S(O)2-.
Preferably, A3 is selected from-CH2-, O, -N(R10)_
-C(O)NR10_~ _C{O)NR10CH2_, _ CH2C(O)NR10_, _CH20_~ -OCH2-
or S(O)m. Most preferably, A3 is selected from: -C(O)NR10_~
-C(O)NR10CH2-, -OCH2-, O or S(O)m.
Preferably, V is selected from hydrogen, heterocycle and
aryl. More preferably, V is phenyl.
Preferably, W is selected from imidazolinyl, imidazolyl,
oxazolyl, pyrazolyl, pyyrolidinyl, thiazolyl and pyridyl. More
preferably, W is selected from imidazolyl and pyridyl.
Preferably, n and r are independently 0, 1, or 2.
Preferably s is 0.
Preferably t is 1.
Preferably, the moiety
- 52 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
(R9)
V ' A1 UR12)rt~2UR~2)n ' W ' OR22)p ' X '(CR22)p
is selected from:
R9a Q9b
N N
N ~ R9b ~ R9a
~R8)~ and ~R
;H2-~.
It is intended that the definition of any substituent or
variable (e.g., R1, R2, R9, n, etc.) at a particular location in a molecule
be independent of its definitions elsewhere in that molecule. Thus,
-N{R10)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is understood
that substituents and substitution patterns on the compounds of the
instant invention can be selected by one of ordinary skill in the art
to provide compounds that are chemically stable and that can be
synthesized by techniques known in the art, as well as those methods
set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of
this invention include the conventional non-toxic salts of the compounds
of this invention as formed, e.g., from non-toxic inorganic or organic
acids. For example, such conventional non-toxic salts include those
derived from inorganic acids such as hydrochloric, hydrobromic,
sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared
from organic acids such as acetic, propionic, succinic, glycolic, stearic,
lactic, malic, tartaric, citric, ascorbic, palmoic, malefic, hydroxymaleic,
phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic,
fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic,
isethionic, trifluoroacetic and the like.
- 53 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
The pharmaceutically acceptable salts of the compounds of
this invention can be synthesized from the compounds of this invention
which contain a basic moiety by conventional chemical methods.
Generally, the salts are prepared either by ion exchange
chromatography or by reacting the free base with stoichiometric
amounts or with an excess of the desired salt-forming inorganic or
organic acid in a suitable solvent or various combinations of solvents.
Reactions used to generate the compounds of this
invention are prepared by employing reactions as shown in the
Schemes 1-19, in addition to other standard manipulations such
as ester hydrolysis, cleavage of protecting groups, etc., as may
be known in the literature or exemplified in the experimental
procedures. Substituents R3, R6 and Rg, as shown in the Schemes,
represent the substituents R3, R4, R5, R6a, R6b, R6c, R6d~ R6e
and R8; although only one such R3, R6 or Rg is present in the
intermediates and products of the schemes, it is understood that the
reactions shown are also applicable when such aryl or heterocyclic
moieties contain multiple substituents.
These reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Schemes. The reactions described in the
Schemes are illustrative only and are not meant to be limiting. Other
reactions useful in the preparation of heteroaryl moieties are
described in "Comprehensive Organic Chemistry, Volume 4:
Heterocyclic Compounds" ed. P.G. Sammes, Oxford (1979) and
references therein.
Synopsis of Schemes 1-19:
The requisite intermediates are in some cases
commercially available, or can be prepared according to literature
procedures. Schemes 1-9 illustrate synthesis of the instant bicyclic
compounds which incorporate a preferred benzylimidazolyl
sidechain. Thus, in Scheme 1, for example, a bicyclic intermediate
- 54 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
that is not commercially available may be synthesized by methods
known in the art. Thus, a suitably substituted halogenated picoline
1 may be converted to the dibromo intermediate 2. The dibromide
2 may be coupled to a suitably substituted benzylimidazolyl 3 to
provide, after deprotection, the intermediate 4. This intermediate
4 may then be coupled under vigorous conditions to a carbocyclic/
heterocyclic ring having a nucleophilic heteroatom to provide a
compound of the instant invention 5.
Scheme 2 illustrates an analogous synthesis of an
isomeric intermediate 8 starting from a suitably substituted picoline
6.
Synthesis of the instant compounds wherein ring Q
is a pyridinone moiety is illustrated in Scheme 3. Thus, a suitably
substituted pyridinonyl alcohol 10 may be synthesized starting from
the corresponding isonicotinate 9 according to procedures described
by Boekelhiede and Lehn (J. Org. Chem., 26:428-430 (1961)). The
alcohol is then protected and alkylated with a suitably substituted
benzyl halide, to provide the intermediate bicyclic alcohol. The
intermediate alcohol 3 may converted to the corresponding bromide
11. The bromide 11 may be coupled to a suitably substituted
benzylimidazolyl 3 to provide, after deprotection, the instant
compound 12.
Scheme 4 illustrates synthesis of an instant compound
wherein a non-hydrogen R9b is incorporated in the instant
compound. Thus, a readily available 4-substituted imidazole
13 may be selectively iodinated to provide the 5-iodoimidazole.
That imidazole may then be protected and coupled to a suitably
substituted benzyl moiety to provide intermediate 14. Intermediate
14 can then undergo the alkylation reactions that were described
hereinabove.
Scheme 5 illustrates synthesis of instant compounds that
incorporate a preferred imidazolyl moiety connected to the biscyclic
portion of the instant compounds via an alkyl amino, sulfonamide
- 55 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
or amide linker. Thus, the 4-aminoalkylimidazole 15, wherein the
primary amine is protected as the phthalimide, is selectively alkylated
then deprotected to provide the amine 16. The amine 16 may then
react under conditions well known in the art with various activated
arylheteroaryl moieties to provide the instant compounds shown.
Compounds of the instant invention wherein the
A 1 (CR 12)nA2(CR 12)n linker is oxygen may be synthesized by
methods known in the art, for example as shown in Scheme 6.
The suitably substituted phenol 17 may be reacted with methyl
N-(cyano)methanimidate to provide the 4-phenoxyimidazole 18.
After selective protection of one of the imidazolyl nitrogens, the
intermediate 19 can undergo alkylation reactions as described for
the benzylimidazoles hereinabove.
Compounds of the instant invention wherein the
A1(CR12)nA2(CR12)n linker is a substituted methylene may
be synthesized by the methods shown in Scheme 7. Thus, the
N-protected imidazolyl iodide 20 is reacted, under Grignard
conditions with a suitably protected benzaldehyde to provide the
alcohol 21. Acylation, followed by the alkylation and nucleophilic
displacement procedures illustrated in the Schemes above (in
particular, Scheme 1) provides the instant compound 22. If other
R 1 substituents are desired, the acetyl moiety can be manipulated
as illustrated in the Scheme.
Scheme 8 illustrates incorporation of an acetyl moiety
as the (CR22)pX(CR22)p linker of the instant compounds. Thus,
the suitably substituted acetyl pyridine 23 is brominated to provide
intermediate 24. Reaction with the imidazolyl reagent 5 provides,
after deprotection and further functionalization, the instant
compound 25.
Scheme 9 illustrates a synthetic route to the instant
compounds wherein the heterocyclic-linker-cyclic moiety is first
formed and then couple to the preferred imidazolyl moiety.
- 56 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 1
R3
CH3 NBS . ~ ~ Br
Br N benzoyl peroxide gr N
\ Try
T ~ j~ ZnBr N
N Rs
\ ~ N
N NiCl2(PPh3)2 / \ DMF/reflux
I /J
R8 3
Tr R3
' \~ Br
\1 + N
N ~ 55°C, CH30H
\
8 ~' R3
R Br
N
N ~ N
\
/~ 4
Re
- 57 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98I20525
SCHEME 1 (continued)
Rs
R3
N ~ ~~ H-A3 i f
N \ N
base/solvent
sealed tube
R H-A3 = OH, SH, NH2
R3 Rs
I \ N
A3 = O, NH, S
- 5$ -

CA 02305783 2000-03-31 ,
WO 99/18096 PCT/US98/20525
SCHEME 2
CH3 1 ) HBr CH3
2) Br2
H N I NJ R3 ~ J Rs
3) NaN02 Br N
4) NaOH
Br
R3
NBs
benzoyl peroxide Br N
7
Tr
N 1
N
DMF/reflux
Ra 3
Tr R3
~'~N
N1 + i
N ~ Br
8
- 59 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 3
COOMe COOMe
R ~ \ 30% H202 R3 i \ Ac20 / 160°C
3
~N H ~N
OAc / 0
9 O.
OH
COOMe
LiBH4 / THF \ TBDMSCI
Rs ~ ~ Rs
O H O imidazole /DMF
Br
OTBDMS
\1 Rs R3
\ / ~'~N /~ Rs
R ~N O \ O
H
OTBDMS
- 60 -

CA 02305783 2000-03-31
WO 99!18096 PCT/US98/20525
SCHEME 3~continued~
TBAF R3 Rs
.~N / i Rs CBr4/Ph3P , %~N/ /~ s
- R
' ~ \
THF \ O ~ CH2CI2 O
11
OH Br
Try
N
\ CH3CN/reflux
Re 3
Tr R3
1 s
N~ '\~N / ~ R
\ N+ \ ~ ~ 55°C, CH30H
O
Rs
R ~.~N / i Rs
J \ \ i
O
12
R8
- 61 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 4
H H
,
R9b N1 Nal, NaHC03, 12 R9b N1 TrCI, NEt
~N ~ N
13 I
Tr
T~ N
R9b \ ~ NiCl2(PPh3)2 .. N
N ~ \
I ~~ ZnBr
R8
R
R3
~~Br
Tr i.
N~ Br ~ N
N 2
CH3CN/reflux
ii. MeOH, reflux
14
R
R3
,~ Br
N
R~
N '~. N
s
- 62 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
SCHEME 5
01 R8--.~ v
' Br
i.
O ~N I O 55°C.CH3CN ,
N N \ii. EtOH,80°C, NH2NH2
15 O
N
N NH2
R8~ ~
1s
N o
acylation, sulfonylation
- .i
or alkylation R8' ~ N H ~ ~ ~ i Rs
Rs
~N ~ O., .O
,S
N N , O
Rs' ~ H ~ ~ ~ Rs
~~N \
N Rs
O
N N
Rs~ ~ H ~~~~ i Rs
~~N \
R
- 63 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
i, Na, MeOH
\ OH
NC / ~ ii. 120°C
17 HsC- ~ /-=N
N
H Try
N1 TrCI, NEt3
\ N N
\ o ~ \ o
NC ~ NC
19
Tr' R3 Br
N~ .~ i. CH3CN/reflux
\ N + ~ N ii. MeOH reflux
O Br 2
NC .,-
19
Br
N~ ~-~ I
\ N ~ N
O
NC
- 64 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
Tr
EtMgBr N
N ~ ~ ~O ~ \ OH
21
R
20 R
R3
~~ Br
Tr
1. \ N
N 2
Br
Ac20, py
CH3CN/reflux
Ac
2. MeOH
,Tr
R3
Br H_As
/ - Rs
N \
vc
Rs As
.~ / i Rs
\ N \
R LiOH
,c
22
- 65 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 7 (continued
R3
-~A3 / i Rs
N ~ N
SOC12
/J off
R8
R3
N~ .~As / ~ Rs
N ~,, N
NH3, MeOH
/J CI
R8
R3
'~As / ~ s
=R
N ~ N
H2
R3
3
N~ .~A /
Rs
N ~ i
OMe
R$
- 66 -

CA 02305783 2000-03-31
WO 99118096 PCT/US98/20525
Ra Rs
%~N Br~/CHCl3 -''~N
I
H3C ~ Br Br Br
O 2g O 24
Try
N
1 ) \ Rs
\'N
/,
Re 5 N v ~ Br
O
CH CN/reflux NJ
3
2) refIux/MeOH
Rs
1 Rs ~N ~ i Rs
H_As ~ I As
N
NJ o
- 67 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 9
Rs
..
R3 ~ /1 R3 Rs
Br , ~ H_p3 ~ f Br
-- ~ ~ ~~ ,f
3
N Br base/soivent N A
sealed tube
H-A3 = OH, SH, NH2
1. nBu-Li, -78° OH R3 Rs
THF
N (CH2)n ~ ~ ~ f
2. (CH2)"CHO ~ ~ N As
N
Tr
N
Tr
R3 Rs
1. catalytic (CH2)n
hydrogenation
N ~ ~ ~ if
N As ~
N
Tr
- 68 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 9~continuedl
3
R Rs 1 ) Ar CH2X, CH3CN
(CH2)n
N ~ i f 2) CF3C02H, CH2CI2
N A3 (C2Hs)sSiH
N
Tr
R3 Rs
~~1
Ark (CH2)n
N ~ ( if
N As
N
Schemes 10-18 illustrate reactions wherein the moiety
(R8)~ (R9)
4
V - A1(CR12)nA2(CR12)n W - (CR12)p X'
t
incorporated in the compounds of the instant invention is represented
by other than the substituted imidazole-containing group illustrated
in the previous Schemes.
Thus, the intermediates whose synthesis are illustrated
in the above Schemes, and other pyridinonecarbocyclic and
pyridinone-heterocyclic intermediates obtained commercially or
readily synthesized, can be coupled with a variety of aldehydes. The
aldehydes can be prepared by standard procedures, such as that
described by O. P. Goel, U. Krolls, M. Stier and S. Kesten in
Organic Syntheses, 1988, 67, 69-75, from the appropriate amino
- 69 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
acid. Thus, as shown in Scheme 10, a suitably substituted
bromopyridine is lithiated and is reacted with an aldehyde to provide
the C-alkylated instant compound 27. Compound 27 can be
deoxygenated by methods known in the art, such as a catalytic
hydrogention, then deprotected with trifluoroacetic acid in methylene
chloride to give the final compound 28. The compound 28 may
be isolated in the salt form, for example, as a trifluoroacetate,
hydrochloride or acetate salt, among others. The product diamine
28 can further be selectively protected to obtain 29, which can
subsequently be reductively alkylated with a second aldehyde to
obtain compound 30. Removal of the protecting group, and
conversion to cyclized products such as the dihydroimidazole 31
can be accomplished by literature procedures.
If the bromopyridine reagent is reacted with an aldehyde
which also has a protected hydroxyl group, such as 32 in Scheme 11,
the protecting groups can be subsequently removed to unmask the
hydroxyl group (Schemes 11, 12). The alcohol can be oxidized
under standard conditions to e.g. an aldehyde, which can then be
reacted with a variety of organometallic reagents such as alkyl
lithium reagents, to obtain secondary alcohols such as 34. In
addition, the fully deprotected amino alcohol 35 can be reductively
alkylated (under conditions described previously) with a variety of
aldehydes to obtain secondary amines, such as 36 (Scheme 12), or
tertiary amines.
The Boc protected amino alcohol 33 can also be utilized
to synthesize 2-aziridinylmethylarylheteroaryl such as 37 (Scheme
13). Treating 33 with 1,1'-sulfonyldiimidazole and sodium hydride
in a solvent such as dimethylformamide led to the formation of
aziridine 37. The aziridine is reacted with a nucleophile, such as a
thiol, in the presence of base to yield the ring-opened product 38.
In addition, the arylpyridinone reagent can be reacted
with aldehydes derived from amino acids such as O-alkylated
tyrosines, according to standard procedures, to obtain compounds
such as 40, as shown in Scheme 14. When R' is an aryl group, 40
- 70 -

CA 02305783 2000-03-31
WO 99/18096 PCT/I3S98/20525
can first be hydrogenated to unmask the phenol, and the amine group
deprotected with acid to produce 41. Alternatively, the amine
protecting group in 40 can be removed, and O-alkylated phenolic
amines such as 42 produced.
Schemes 15-18 illustrate syntheses of suitably substituted
aldehydes useful in the syntheses of the instant compounds wherein
the variable W is present as a pyridyl moiety. Similar synthetic
strategies for preparing alkanols that incorporate other heterocyclic
moieties for variable W are also well known in the art.
Scheme 19 illustrates preparation of substituted
aldehydes which incorporate the benzylimidazolyl sidechain. As set
forth in Scheme 19, these aldehydes can be reductively aminated with
various amines to give the instant compounds.
- 71 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 10
R3 1. nBu-Li, 78°C
Br
Boc NH
N A3 V 2.
Boc NH CHO
26
1. catalytic
OH R3 hydrogenation
2. CF3C02H
Boc NH ' . / CH2CI2
N A3 v
NHBoc
27
R3
- - BOC2O
NH2 ~ N CH2C12
NH2 28
- 72 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 10 (continued
R3 ~ \
l ~ CHO
BocNH \ ~A3 ~
'-N
NH2 NaBH(OAc)3
29 Et3N , CICH2CH2CI
R3 ~ \
BocNH \ // A3 CF3CO2H, CH2C12;
'--N
NH NaHC03
/ \ / 30
R3
NH ~-A3 ~ NC
2 \ /
N
NH AgCN
/ \ /
R3
A3
I \ N ~--N
~N 31
- 73 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98I20525
SCHEME 11
R3 1. nBu-Li, 78°C
Br
Bn0
N As
BocNH CHO
32
R3 / \
HO -I- 20% Pd(OH)2 H
Bn0 \ ~Aa
'-N CH30H
NHBoc CH3C02H
R3 ~ \
HO I r CICOCOCI
\ ~A3
~-N DMSO CH2CI2
NHBoc 33 (C2H5)3N
R3 / \ R3 / \
__
O ~--As _ _
\ N HO \ ~--As
R MgX ~N
H NHBoc R,
NHBoc
34
- 74 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 12
R3
HO ~ ~A3
~N CH2CI2
NHBoc
33
R3
- - R'CHO
HO ~ ~~--As
'--N NaBH(OAc)3
NH2 35 CICH2CH2CI
R3
__
HO
'-N
NH
R'CH2 36
- 75 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 13
H H
R3 ~ ~ N=1 r N
~N~S~N~
__
HO ~ ~As 0
N NaH, DMF 0°C
NHBoc
R"SH
A3
~C2Hs)sN 0
CH30H
N
H 37
R3
R"S
'-N
NH2 38
- 76 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 14
HO
1 ) BOC20, K2CO3
THF-H20
C02H 2) CH2N2, EtOAc
BocNH C02CH3
HO
LiAIH4
R CH2X
THF Cs2C03
0-20°C BocNH CH20H DMF
R"'CH20 R"'CH20
pyridine ~ SO~
DMSO
(C2H5)3N BocNH CHO
BocNH CH20H 20°C
_ 77 _

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 14 (continued)
R"'CH20 Rs
. _l_
Li ~ -~--As
N
BocNH CHO 26
3g R"' not aryl
1. Et20
Et20
2. 20% Pd(OH)2, H2
CH30H, CH3C02H
Rs ~ ~ 3. HCI, EtOAc
OH -
R"'CH O ~ '' A3
2 ~N
NHBoc
40
2. 20% Pd(OH)2, H2 R3
CH30H, CH3C02H
2) HCI, EtOAc R~"CH O
~-N
NH2
_ R3 ~ ~ 42
__
HO ~ ~A3
'- N
NH2
41
_ 78 _

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
SCHEME 15
CH3 1 ) HN02,Br2 / C02CH3
2) KMn04 J
3 MeOH H+ ~N~
H2N N ) ~ Br
R8
MgCI Ra
C02CH3
~N~
ZnCl2,NiCl2(Ph3P)2
R8
NaBH4 (excess) ~~ / CH20H
Re
S03~Py, Et3N ~~ ~ / ( CHO
DMSO \ \N~
- 79 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 16
1. Et0(CO)CI Rs
s
2. R\
~ Br
CO2CH3 ~ CO2CH3
Zn, CuCN
N 3. S, xylene, heat
Rs Ra
NaBH4 S03~Py, Et3N
(excess) DMSO CHO
N
Rs Rs
MgCI
Br , C02CH3
.J
N ZnCl2, NiCl2(Ph3P)2
R~
NaBH4 S03~Py, Et3N CHO
(excess) DMSO
- 80 -

CA 02305783 2000-03-31
WO 99/1809b PCT/US98/20525
SCHEME 17
C02CH3
/ 1. LDA, C02 gr /
~N~ +
2. MeOH, H N
R8
R8
'-.
MgCI
/ C02CH3
_ /
ZnCl2, NiCl2(Ph3P)2
N
R8
NaBH4 (excess) / CH20H S03~Py, Et3N
DMSO
N
R8
'
CHO
N
- $1 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 18
CO2CH3
1. LDA, C02 / I Br
N ~ Br ~ N
2. (CH3)3SiCHN2
R8 i ~ ~ Br R8-
~/
C02CH3
Zn, NiCl2(Ph3P)2
R~
excess NaBH4 S03~Py, Et~N
DMSO
Re-
CHO
- 82 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SCHEME 19
CH20H DMF CH20H
Et3
~CsHs)sCCI N
Tr
O
N O' \ 1 )
pyridine ~ \ Rg
acetic anhydride N EtOAc, 60°C
Tr
2) MeOH, 60°C
O
LiOH \ CH20H
N O'
R ~ < \ 0°C /J /\
s N HX THF/H O R8 'N
2
Et3N I ~ N CHO
S03-pyridine complex / ~
DMSO R8 N
N- N ~ R
I 8
1 ) H2N ~
R ~ N N
/J < \ H
titanium isopropoxide Rs N
THF
2) NaCNBH4, ethanol
- 83 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
In a preferred embodiment of the instant invention the
compounds of the invention are selective inhibitors of farnesyl-protein
transferase. A compound is considered a selective inhibitor of farnesyl-
protein transferase, for example, when its in vitro farnesyl-protein
transferase inhibitory activity, as assessed by the assay described in
Example 17, is at least 100 times greater than the in vitro activity of
the same compound against geranylgeranyl-protein transferase-type I
in the assay described in Example 19. Preferably, a selective compound
exhibits at least 1000 times greater activity against one of the enzymatic
activities when comparing geranylgeranyl-protein transferase-type I
inhibition and farnesyl-protein transferase inhibition.
In another preferred embodiment of the instant invention
the compounds of the invention are dual inhibitors of farnesyl-protein
transferase and geranylgeranyl-protein transferase type I. Such a dual
inhibitor will exhibit certain characteristics when assessed in in vitro
assays, which are dependent on the type of assay employed.
In a SEAP assay, such as described in Examples 21, it is
preferred that the dual inhibitor compound has an in vitro inhibitory
activity (IC50) that is less than about l2p.M against K4B-Ras dependent
activation of MAP kinases in cells. More preferably, the dual inhibitor
compound has an in vitro inhibitory activity (IC50) against K4B-Ras
dependent activation of MAP kinases in cells which is more than about
5 times lower than the inhibitory activity (IC50) against Myr-Ras
dependent activation of MAP kinases in cells. Also more preferably,
in a SEAP assay, the dual inhibitor compound has an inhibitory activity
(IC50) that is less than about 10 nM against H-Ras dependent activation
of MAP kinases in cells.
In a GGTase plus anion assay, such as described in Example
19, it is preferred that the dual inhibitor compound has an in vitro
inhibitory activity (IC50) that is less than about 5 ~M against transfer of
a geranylgeranyl residue to a protein or peptide substrate comprising a
CAAXG motif by geranylgeranyl-protein transferase type I in the
presence of a modulating anion. More preferably, the dual inhibitor
- 84 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
compound has an in vitro inhibitory activity (ICSp) that is less than
about 1 ~.M against transfer of a geranylgeranyl residue to a protein or
peptide substrate comprising a CAAXG motif by geranylgeranyl-protein
transferase type I in the presence of a modulating anion. Preferably, the
dual inhibitor compound has an in vitro inhibitory activity (IC50) in the
in vitro assay as described in Example 17 that is less than about 1 ~.M
against transfer of a farnesyl residue to a protein or peptide substrate,
comprising a CAAXF motif, by farnesyl-protein transferase. More
preferably, the dual inhibitor compound has an in vitro inhibitory
activity (IC50) that is less than about 100nM against transfer of a
farnesyl residue to a protein or peptide substrate, comprising a CAAXF
motif, by farnesyl-protein transferase. Also preferably, the dual
inhibitor compound has an in vitro inhibitory activity (IC50) in the in
vitro assay as described in Example 20, that is less than about 100 nM
against the anchorage independent growth of H-ras-transformed
mammalian fibroblasts.
The protein or peptide substrate utilized in the instant
assay may incorporate any CAAX motif that is geranylgeranylated
by GGTase-I. The term "CAAXG" will refer to such motifs that
may be geranylgeranylated by GGTase-I. It is understood that some
of the "CAAXG" containing protein or peptide substrates may also
be farnesylated by farnesyl-protein transferase. In particular such
"CAAXG" motifs include (the corresponding human protein is in
parentheses): CVIM (K4B-Ras) (SEQ.ID.NO.: 1), CVLL (mutated H-
Ras) (SEQ.ID.NO.: 2), CVVM (N-Ras) (SEQ.ID.NO.: 3), CIIM (K4A-
Ras) (SEQ.ID.NO.: 4), CLLL (Rap-IA) (SEQ.ID.NO.: 5), CQLL (Rap-
IB) (SEQ.ID.NO.: 6), CSIM (SEQ.ID.NO.: 7), CAIM (SEQ.ID.NO.: 8),
CKVL (SEQ.ID.NO.: 9) and CLIM (PFX) (SEQ.ID.NO.: 10).
Preferably, the CAAX motif is CVIM.
As used herein, the term "CAAXF" is used to designate
a protein or peptide substrate that incorporates four amino acid
C-terminus motif that is farnesylated by farnesyl-protein transferase. It
is understood that certain of the "CAAXF" containing protein or peptide
substrates may also be geranylgeranylated by GGTase-I. In particular
- 85 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
such "CAAXF" motifs include (the corresponding human protein is in
parentheses): CVLS (H-ras) (SEQ.ID.NO.: 11), CVIM (K4B-Ras)
(SEQ.ID.NO.: 1) and CVVM (N-Ras) (SEQ.ID.NO.: 3).
The instant compounds are useful as pharmaceutical agents
for mammals, especially for humans. These compounds may be
administered to patients for use in the treatment of cancer. Examples
of the type of cancer which may be treated with the compounds of this
invention include, but are not limited to, colorectal carcinoma, exocrine
pancreatic carcinoma, myeloid leukemias and neurological tumors.
Such tumors may arise by mutations in the ras genes themselves,
mutations in the proteins that can regulate Ras activity (i.e.,
neurofibromin (NF-1 ), neu, src, ab 1, lck, fyn) or by other mechanisms.
The compounds of the instant invention inhibit prenyl
protein transferase and the prenylation of the oncogene protein Ras.
The instant compounds may also inhibit tumor angiogenesis, thereby
affecting the growth of tumors (J. Rak et al. Cancer Research, 55:
4575-4580 ( 1995)). Such anti-angiogenesis properties of the instant
compounds may also be useful in the treatment of certain forms of
vision deficit related to retinal vascularization.
The compounds of this invention are also useful for
inhibiting other proliferative diseases, both benign and malignant,
wherein Ras proteins are aberrantly activated as a result of oncogenic
mutation in other genes (i.e., the Ras gene itself is not activated by
mutation to an oncogenic form) with said inhibition being accomplished
by the administration of an effective amount of the compounds of the
invention to a mammal in need of such treatment. For example, a
component of NF-1 is a benign proliferative disorder.
The instant compounds may also be useful in the treatment
of certain viral infections, in particular in the treatment of hepatitis
delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333
( 1992).
The compounds of the instant invention are also useful in
the prevention of restenosis after percutaneous transluminal coronary
- 86 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature
medicine, 1:541-545(1995).
The instant compounds may also be useful in the treatment
and prevention of polycystic kidney disease (D.L. Schaffner et al.
American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley,
Jr. et aI.FASEB Journal, 2:A3160 ( 1988)).
The instant compounds may also be useful for the treatment
of fungal infections.
The instant compounds may also be useful as inhibitors of
proliferation of vascular smooth muscle cells and therefore useful in the
prevention and therapy of arteriosclerosis and diabetic vascular
pathologies.
The compounds of this invention may be administered
to mammals, preferably humans, either alone or, preferably, in
combination with pharmaceutically acceptable carriers, excipients or
diluents, in a pharmaceutical composition, according to standard
pharmaceutical practice. The compounds can be administered orally
or parenterally, including the intravenous, intramuscular,
intraperitoneal, subcutaneous, rectal and topical routes of
administration.
The pharmaceutical compositions containing the active
ingredient may be in a form suitable for oral use, for example, as
tablets, troches, lozenges, aqueous or oily suspensions, dispersible
powders or granules, emulsions, hard or soft capsules, or syrups or
elixirs. Compositions intended for oral use may be prepared according
to any method known to the art for the manufacture of pharmaceutical
compositions and such compositions may contain one or more agents
selected from the group consisting of sweetening agents, flavoring
agents, coloring agents and preserving agents in order to provide
pharmaceutically elegant and palatable preparations. Tablets contain the
active ingredient in admixture with non-toxic pharmaceutically
acceptable excipients which are suitable for the manufacture of tablets.
These excipients may be for example, inert diluents, such as calcium
carbonate, sodium carbonate, lactose, calcium phosphate or sodium
_ 87 _

CA 02305783 2000-03-31
WO 99/18096 PCT/US98I20525
phosphate; granulating and disintegrating agents, for example,
microcrystalline cellulose, sodium crosscarmellose, corn starch, or
alginic acid; binding agents, for example starch, gelatin, polyvinyl-
pyrrolidone or acacia, and lubricating agents, for example, magnesium
stearate, stearic acid or talc. The tablets may be uncoated or they may
be coated by known techniques to mask the unpleasant taste of the drug
or delay disintegration and absorption in the gastrointestinal tract and
thereby provide a sustained action over a longer period. For example,
a water soluble taste masking material such as hydroxypropylmethyl-
cellulose or hydroxypropylcellulose, or a time delay material such as
ethyl cellulose, cellulose acetate butyrate may be employed.
Formulations for oral use may also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an inert
solid diluent, for example, calcium carbonate, calcium phosphate or
kaolin, or as soft gelatin capsules wherein the active ingredient is mixed
with water soluble carrier such as polyethyleneglycol or an oil medium,
for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active material in
admixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example sodium
carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-
cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and
gum acacia; dispersing or wetting agents may be a naturally-occurring
phosphatide, for example lecithin, or condensation products of an
alkylene oxide with fatty acids, for example polyoxyethylene stearate,
or condensation products of ethylene oxide with long chain aliphatic
alcohols, for example heptadecaethylene-oxycetanol, or condensation
products of ethylene oxide with partial esters derived from fatty acids
and a hexitol such as polyoxyethylene sorbitol monooleate, or
condensation products of ethylene oxide with partial esters derived from
fatty acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions may also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one
_ 88 _

CA 02305783 2000-03-31
WO 99/18096 PC'T/US98/20525
or more coloring agents, one or more flavoring agents, and one or
more sweetening agents, such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the
active ingredient in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The
oily suspensions may contain a thickening agent, for example beeswax,
hard paraffin or cetyl alcohol. Sweetening agents such as those set forth
above, and flavoring agents may be added to provide a palatable oral
preparation. These compositions may be preserved by the addition of
an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
Dispersible powders and granules suitable for preparation
of an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent, suspending
agent and one or more preservatives. Suitable dispersing or wetting
agents and suspending agents are exemplified by those already
mentioned above. Additional excipients, for example sweetening,
flavoring and coloring agents, may also be present. These compositions
may be preserved by the addition of an anti-oxidant such as ascorbic
acid.
The pharmaceutical compositions of the invention may also
be in the form of an oil-in-water emulsions. The oily phase may be a
vegetable oil, for example olive oil or arachis oil, or a mineral oil, for
example liquid paraffin or mixtures of these. Suitable emulsifying
agents may be naturally-occurring phosphatides, for example soy bean
lecithin, and esters or partial esters derived from fatty acids and hexitol
anhydrides, for example sorbitan monooleate, and condensation
products of the said partial esters with ethylene oxide, for example
polyoxyethylene sorbitan monooleate. The emulsions may also contain
sweetening, flavouring agents, preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening
agents, for example glycerol, propylene glycol, sorbitol or sucrose.
Such formulations may also contain a demulcent, a preservative,
flavoring and coloring agents and antioxidant.
- 89 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
The pharmaceutical compositions may be in the form of a
sterile injectable aqueous solutions. Among the acceptable vehicles and
solvents that may be employed are water, Ringer's solution and isotonic
sodium chloride solution.
The sterile injectable preparation may also be a sterile
injectable oil-in-water microemulsion where the active ingredient is
dissolved in the oily phase. For example, the active ingredient may be
first dissolved in a mixture of soybean oil and lecithin. The oil solution
then introduced into a water and glycerol mixture and processed to
form a microemulation.
The injectable solutions or microemulsions may be
introduced into a patient's blood-stream by local bolus injection.
Alternatively, it may be advantageous to administer the solution or
microemulsion in such a way as to maintain a constant circulating
concentration of the instant compound. In order to maintain such a
constant concentration, a continuous intravenous delivery device may be
utilized. An example of such a device is the Deltec CADD-PLUSTM
model 5400 intravenous pump.
The pharmaceutical compositions may be in the form of a
sterile injectable aqueous or oleagenous suspension for intramuscular
and subcutaneous administration. This suspension may be formulated
according to the known art using those suitable dispersing or wetting
agents and suspending agents which have been mentioned above. The
sterile injectable preparation may also be a sterile injectable solution or
suspension in a non-toxic parenterally-acceptable diluent or solvent, for
example as a solution in 1,3-butane diol. In addition, sterile, fixed oils
are conventionally employed as a solvent or suspending medium. For
this purpose any bland fixed oil may be employed including synthetic
mono- or diglycerides. In addition, fatty acids such as oleic acid find
use in the preparation of injectables.
Compounds of Formula A may also be administered in the
form of a suppositories for rectal administration of the drug. These
compositions can be prepared by mixing the drug with a suitable non-
irritating excipient which is solid at ordinary temperatures but liquid at
- 90 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
the rectal temperature and will therefore melt in the rectum to release
the drug. Such materials include cocoa butter, glycerinated gelatin,
hydrogenated vegetable oils, mixtures of polyethylene glycols of various
molecular weights and fatty acid esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions or
suspensions, etc., containing the compound of Formula A are employed.
(For purposes of this application, topical application shall include mouth
washes and gargles.)
The compounds for the present invention can be
administered in intranasal form via topical use of suitable intranasal
vehicles and delivery devices, or via transdermal routes, using those
forms of transdermal skin patches well known to those of ordinary skill
in the art. To be administered in the form of a transdermal delivery
system, the dosage administration will, of course, be continuous rather
than intermittent throughout the dosage regimen.
As used herein, the term "composition" is intended to
encompass a product comprising the specified ingredients in the specific
amounts, as well as any product which results, directly or indirectly,
from combination of the specific ingredients in the specified amounts.
When a compound according to this invention is
administered into a human subject, the daily dosage will normally be
determined by the prescribing physician with the dosage generally
varying according to the age, weight, sex and response of the individual
patient, as well as the severity of the patient's symptoms.
In one exemplary application, a suitable amount of
compound is administered to a mammal undergoing treatment for
cancer. Administration occurs in an amount between about 0.1 mg/kg
of body weight to about 60 mg/kg of body weight per day, preferably of
between 0.5 mg/kg of body weight to about 40 mg/kg of body weight
per day.
The compounds of the instant invention may also be
co-administered with other well known therapeutic agents that are
selected for their particular usefulness against the condition that is
- 91 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
being treated. For example, the compounds of the instant invention
may also be co-administered with other well known cancer
therapeutic agents that are selected for their particular usefulness
against the condition that is being treated. Included in such
combinations of therapeutic agents are combinations of the instant
farnesyl-protein transferase inhibitors and an antineoplastic agent. It
is also understood that such a combination of antineoplastic agent and
inhibitor of farnesyl-protein transferase may be used in conjunction
with other methods of treating cancer and/or tumors, including
radiation therapy and surgery.
Examples of an antineoplastic agent include, in general,
microtubule-stabilizing agents ( such as paclitaxel (also known as
Taxol~), docetaxel (also known as Taxotere~), epothilone A,
epothilone B, desoxyepothilone A, desoxyepothilone B or their
derivatives); microtubule-disruptor agents; alkylating agents, anti-
metabolites; epidophyllotoxin; an antineoplastic enzyme; a
topoisomerase inhibitor; procarbazine; mitoxantrone; platinum
coordination complexes; biological response modifiers and growth
inhibitors; hormonal/anti-hormonal therapeutic agents and
haematopoietic growth factors.
Example classes of antineoplastic agents include, for
example, the anthracycline family of drugs, the vinca drugs, the
mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes,
the epothilones, discodermolide, the pteridine family of drugs, diynenes
and the podophyllotoxins. Particularly useful members of those classes
include, for example, doxorubicin, carminomycin, daunorubicin,
aminopterin, methotrexate, methopterin, dichloro-methotrexate,
mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine,
gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin
derivatives such as etoposide, etoposide phosphate or teniposide,
melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine,
paclitaxel and the like. Other useful antineoplastic agents include
estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin,
tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa,
- 92 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/Z0525
cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase,
camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide,
leuprolide, pyridobenzoindole derivatives, interferons and interleukins.
The preferred class of antineoplastic agents is the
taxanes and the preferred antineoplastic agent is paclitaxel.
Radiation therapy, including x-rays or gamma rays which
are delivered from either an externally applied beam or by implantation
of tiny radioactive sources, may also be used in combination with the
instant inhibitor of farnesyl-protein transferase alone to treat cancer.
Additionally, compounds of the instant invention may also
be useful as radiation sensitizers, as described in WO 97/38697,
published on October 23, 1997, and herein incorporated by reference.
The instant compounds may also be useful in combination
with other inhibitors of parts of the signaling pathway that links cell
surface growth factor receptors to nuclear signals initiating cellular
proliferation. Thus, the instant compounds may be utilized in
combination with farnesyl pyrophosphate competitive inhibitors of the
activity of farnesyl-protein transferase or in combination with a
compound which has Raf antagonist activity. The instant compounds
may also be co-administered with compounds that are selective
inhibitors of geranylgeranyl protein transferase or farnesyl-protein
transferase.
In particular, the compounds disclosed in the following
patents and publications may be useful as farnesyl pyrophosphate-
competitive inhibitor component of the instant composition: U.S. Ser.
Nos. 08/254,228 and 08/435,047. Those patents and publications are
incorporated herein by reference.
In practicing methods of this invention, which comprise
administering, simultaneously or sequentially or in any order, two or
more of a protein substrate-competitive inhibitor and a farnesyl
pyrophosphate-competitive inhibitor, such administration can be orally
or parenterally, including intravenous, intramuscular, intraperitoneal,
subcutaneous, rectal and topical routes of administration. It is preferred
that such administration be orally. It is more preferred that such
- 93 -

CA 02305783 2000-03-31
WO 99/18096 PCTIUS98/20525
administration be orally and simultaneously. When the protein
substrate-competitive inhibitor and farnesyl pyrophosphate-competitive
inhibitor are administered sequentially, the administration of each can
be by the same method or by different methods.
The instant compounds may also be useful in combination
with an integrin antagonist for the treatment of cancer, as described in
U.S. Ser. No. 09/055,487, filed April 6, 1998, which is incorporated
herein by reference.
As used herein the term an integrin antagonist refers to
compounds which selectively antagonize, inhibit or counteract binding
of a physiological ligand to an integrin(s) that is involved in the
regulation of angiogenisis, or in the growth and invasiveness of tumor
cells. In particular, the term refers to compounds which selectively
antagonize, inhibit or counteract binding of a physiological ligand to the
av~i3 integrin, which selectively antagonize, inhibit or counteract
binding of a physiological ligand to the av~35 integrin, which
antagonize, inhibit or counteract binding of a physiological ligand to
both the avj33 integrin and the av~i5 integrin, or which antagonize,
inhibit or counteract the activity of the particular integrin(s) expressed
on capillary endothelial cells. The term also refers to antagonists of the
av~i6, av~i8, al(31, a2(31, a5(31, a6(31 and a6~i4 integrins. The term
also refers to antagonists of any combination of av~i3, av(35, av~i6,
av~i8, al(31, a2(31, a5~31, a6~31 and a6[34 integrins. The instant
compounds may also be useful with other agents that inhibit angiogenisis
and thereby inhibit the growth and invasiveness of tumor cells,
including, but not limited to angiostatin and endostatin.
Similarly, the instant compounds may be useful in
combination with agents that are effective in the treatment and
prevention of NF-1, restenosis, polycystic kidney disease, infections
of hepatitis delta and related viruses and fungal infections.
If formulated as a fixed dose, such combination products
employ the combinations of this invention within the dosage range
described below and the other pharmaceutically active agents) within
- 94 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
its approved dosage range. Combinations of the instant invention may
alternatively be used sequentially with known pharmaceutically
acceptable agents) when a multiple combination formulation is
inappropriate.
The compounds of the instant invention are also useful
as a component in an assay to rapidly determine the presence and
quantity of farnesyl-protein transferase (FPTase) in a composition.
Thus the composition to be tested may be divided and the two
portions contacted with mixtures which comprise a known substrate
of FPTase (for example a tetrapeptide having a cysteine at the amine
terminus) and farnesyl pyrophosphate and, in one of the mixtures,
a compound of the instant invention. After the assay mixtures are
incubated for an sufficient period of time, well known in the art, to
allow the FPTase to farnesylate the substrate, the chemical content
of the assay mixtures may be determined by well known immuno-
logical, radiochemical or chromatographic techniques. Because the
compounds of the instant invention are inhibitors of FPTase, absence
or quantitative reduction of the amount of substrate in the assay
mixture without the compound of the instant invention relative to the
presence of the unchanged substrate in the assay containing the
instant compound is indicative of the presence of FPTase in the
composition to be tested.
It would be readily apparent to one of ordinary skill in the
art that such an assay as described above would be useful in identifying
tissue samples which contain farnesyl-protein transferase and quantitat-
ing the enzyme. Thus, potent inhibitor compounds of the instant
invention may be used in an active site titration assay to determine the
quantity of enzyme in the sample. A series of samples composed of
aliquots of a tissue extract containing an unknown amount of farnesyl-
protein transferase, an excess amount of a known substrate of FPTase
(for example a tetrapeptide having a cysteine at the amine terminus) and
farnesyl pyrophosphate are incubated for an appropriate period of time
in the presence of varying concentrations of a compound of the instant
invention. The concentration of a sufficiently potent inhibitor {i.e., one
- 95 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
that has a Ki substantially smaller than the concentration of enzyme in
the assay vessel) required to inhibit the enzymatic activity of the sample
by 50°lo is approximately equal to half of the concentration of the
enzyme in that particular sample.
(EXAMPLES
Examples provided are intended to assist in a further
understanding of the invention. Particular materials employed, species
and conditions are intended to be further illustrative of the invention
and not limitative of the reasonable scope thereof.
EXAMPLE 1
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylthio)pyrid-5-ylmethyl)-
imidazole
to 1: 1-Trityl-4-(,4-cyanobenz,~)imidazole
To an oven dried 500 ml flask was added Zn (92mmo1,
5.96g) and then 45 mL of distilled THF via syringe. To this well stirred
mixture was added 1,2-dibromoethane ( 9.2 mmol, 1.72g) via pipet.
This mixture was stirred at ambient temperature for 3 hr and then a
solution of p-cyanobenzylbromide (59.5 mmol, 11.68g) in THF (SOmL)
was added via addition funnel over 20 minutes. The resulting mixture
was stirred at ambient temperature for 6 hr. Then a mixture of
1-trityl-4-iodoimidazole (45.8mmol, 20g) and bis-triphenylphosphine-
dichloronickel (4.6 mmol, 3.Og) was added. This was stirred at ambient
temperature for 36 hr. A saturated ammonium chloride solution
( 125mL) was added. Stirring was continued for 3 hr and then 1 L
of chloroform was added to this mixture. The chloroform layer was
drawn off, washed with dilute sodium bicarbonate then saturated sodium
chloride. Dried with sodium sulfate and evaporated to a thick oil.
Purified on a silica gel column eluted with chloroform to provide the
- 96 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
title compound. 1H-NMR {CDC13): 4.Oppm (s, 2H); 7.1-7.6ppm (20H);
6.6ppm(s, 1H).
Ste~_2: 2-bromo-5-bromometh,~pyridine
To a flask was charged 2-bromo-5-methylpyridine
(34.9mmol, 6.Og), N-bromosuccinimide (38.4 mmol, 6.83g), benzoyl
peroxide (3.49mmo1, 0.85g) and carbon tetrachloride (60mL). This
solution was refluxed for 6 hr, cooled to ambient temperature and
purified on a silica gel column. Eluted with ethyl acetate: hexane ( 1:9)
to provide the title compound. FAB MS: calc: 250.9 found: 251.9.
1H-NMR (CDC13): 4.4ppm (s, 2H); 7.5ppm (d, 1H); 7.6ppm (d, 1H);
8.4ppm (s, 1H).
Step 3_: 5-(4-Cyanobenzyl)-~2-bromog~rid-5-, l~th"~limidazole
To a flask was charged 1-trityl -4-p-cyanobenzyl imidazole
(2.77mmo1, 1.18g) from Step 1 and 2-bromo-5-bromomethyl pyridine
{2.77mmo1, 0.67g) from Step 2 in DMF (IOmL) and the mixture heated
at 100°C for 6 hr. The DMF was then removed in vacuo and the residue
was triturated with ethyl ether. The ethyl ether was then decanted off
and replaced with methanol (20mL).This solution was then refluxed for
4 hr, cooled to ambient temperature and purified on a Clg preperative
hplc column to provide the title compound. High resolution FAB-MS:
calc; 353.040183 found; 353.040183. 1H-NMR (CD30D): 4.2ppm (s,
2H); 5.4ppm (s, 2H); 7.2 and 7.6ppm (d, 2H); 8.lppm (s, 1H); 9.lppm
{s, 1H).
Step 4: 5-(4'-cyanobenzyl)-1-[2-(3"methylphenylthio)pyrid-5-
ylmethyl)imidazole
The compound from Step 3 (0.28 mmol, 0.164g), 3-methyl
thiophenol (0.85 mmol, 0.106g) and triethylamine (3.59mmo1, 0.36g)
were placed in an N2 purged sealed tube. This was heated at 105°C for
15 hr. The residue was dissolved in methanol and purified on a C1 g
preperative hplc column. Lyophilized from dioxane/HCl to provide
- 97 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
the title compound. FAB-MS: calc: 396.4 found: 397.2 1H-NMR
(CD30D): 2.4ppm (s, 3H); 4.2ppm (s, 2H); 5.4ppm (s, 2H); 7.2-7.6ppm
(lOH); 8.lppm (s, 1H); 9.lppm (s, 1H).
EXAMPLE 2
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylphenoxy}-pyrid-5-
ylmethy 1)imidazole
The compound from Example 1 Step 3 (0.llg 0.20mmo1),
m-cresol (0.064g, 0.59mmol) and sodium hydride (60% dispersion in
oil, 4.0 equiv, 0.032g) were suspended in DMF (0.5mL) in an N2
purged sealed tube and heated at 110°C for 24hr. The residue was
dissolved in methanol and purified on a C 1 g preperative hplc column.
Lyophilized from dioxane/HCl to provide the title compound. FAB-MS:
calc: 380.4 found: 381Ø 2 1H-NMR (CD30D): 2.4ppm (s, 3H);
4.2ppm (s, 2H); 5.4ppm (s, 2H); 6.8-7.6ppm (11H); 7.9 ppm (s, 1H);
9.lppm (s,lH).
EXAMPLE 3
5-(4'-Cyanobenzyl)-1-(2-(3"-chlorophenylthio) pyrid-5-ylmethyl)]-
imidazole
The compound from Example 1 Step 3 (0.26 mmol,
0.090g), 3-chloro phenol (0.76 mmol, 0.11 g) and triethylamine
(0.726g) were placed in an N2 purged sealed tube. This was heated
at 105°C for 4 hr. The residue was dissolved in methanol and purified
on a Clg preperative hplc column. Lyophilized from dioxane/HCl to
~rovide the title compound. FAB-MS: calc: 416.9 found:417.1. 2
H-NMR (CD30D): 4.2ppm (s, 2H); 5.4ppm (s, 2H); 6.9ppm (d, 1H);
7.2-7.6ppm (m, lOH); 8.lppm (s, 1H); 9.lppm (s, 1H).
- 98 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
EXAMPLE 4
~~4'-cvanobenz l~)-1-~2-(cvclohex ly_thio)p n~'d-5- lY meth_vllimidazole
The compound from Example l, Step 3 (0.16g 0.45mmo1),
cyclohexyl mercaptan (0.168, 1.35.mmo1) and sodium hydride (60%
dispersion in oil, 4.0 equiv, 0.032g) were suspended in DMF (0.5mL) in
an N2 purged sealed tube and heated at 1 IO°C for 4hr. The residue was
dissolved in methanol and purified on a C18 preperative hplc column.
Lyophilized from dioxane/HCl to provide the title compound. FAB-MS:
calc: 389 found: 389. ~H-NMR (CD30D): 1.4-2.lppm (lOH); 3.8ppm
(1H); 4.2ppm (2H); 5.45ppm (2H); 7.2-7.6ppm (7H); 8.2ppm (1H);
9.lppm (1H).
EXAMPLE 5
5-(4'-Cyanobenzyl)-1-[2-(3"-methylphenylthio)pyrid-4-ylmethyl)]
imidazole
to 1: 2-Bromo-4-bromomethyl_~pvridine
Following the procedure of Adams et.al. (J. Am. Chem.
Soc., 76, 3168 (1954)) 2-bromo-4-methylpyridine was obtained from
2-amino-4-methylpyridine. 1H-NMR (CDC13): 2.3ppm (s, 3H); 7.05ppm
(d, 1H); 7.3ppm (s, 1H); 8.2ppm (s, 1H).
to 2: 5-(4'-Cvanobenzyl)-1-y2-bromo-4-per, l~eth~)imidazole
Following the procedure in Example 1, Step 2 the product
was obtained from 2-bromo-4-methylpyridine. FAB-MS: calc: 249
found: 250. 1H-NMR (CDC13): 4.4ppm (s, 2H); 7.2ppm (d, 1H); 7.5ppm
(s, 1H); 8.4ppm (d, 1H).
Ste : ~4'-cyanobenzyl)-1-f2-bromop, riY d-4-ylmeth r~lllimidazole
Following the procedure in Example 1, Step 3 1-trityl-4-
p-cyanobenzyl imidazole and 2-bromo-4-bromomethyl pyridine were
reacted to give the product as a free base solid after washing the
preparative hplc purified material with Na2C03. FAB-MS: calc: 353
- 99 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
found:353. 1H-NMR (CDC13): 3.8ppm (s, 2H); 4.9ppm (s, 2H); 6.8ppm
(d, 1H); 6.9-7.6 (7H); 8.3ppm {d, 1H).
to 4: 5-(4'-cyanobenzyl)-1-[2-(3"methylphenylthio)4-
p,~, l~yl)limidazQle
Following the procedure in Example 1, Step 4, 5-(4'-
cyanophenyl)-1-[2-bromopyrid-4-ylmethyl)]imidazole and 3-methyl
thiophenol were reacted and the product was obtained. FAB-MS: calc:
396.5 found: 397.1. 1H-NMR (CD30D): 2.4ppm (s, 3H); 4.OSppm(s,
2H); S.Sppm (s, 2H); 6.3ppm (s, 1H); 7.Oppm (d,lH); 7.2-7.6ppm (9H);
8.35ppm (d, 1H); 9.02ppm (s, 1H).
EXAMPLE 6
5-(4'-Cyanobenzyl)-1-[2-(cyclohexylamino)pyrid-5-ylmethyl)]imidazole
hvdrochloride
to 1: 2- cyclohexylamino-5 ~xridin~ carboxylic acid
2-Chloro-5-pyridinecarboxylicacid ethylester ( g"5.0
mMol) was treated with 10 mMol cyclohexylamine and the mixture
heated for 6 hours at 100° in a sealed tube. Preparative HPLC of the
crude product gave the title compound along with equal amounts of the
N-cyclohexylamide of the starting ester.
Step 2: (2- cyclohexvlamino-~pvrid,~)methanol
The product from Step 1 was reduced with 3 equivalents of
LiAIH~ in THF for 4 hours at room temperature. Lithium salts were
precipitatedwith water and aqueous NaOH. The THF layer was filtered
through FILTER -AID and the filtrate conc in vac to give 2-
cyclohexylamino-5-pyridine methanol.
Step 3: 5-(4'-cyanobenzyl)-1-[2-(cyclohexylamino)pyrid-5-yl-
meth~r_1)limidazole hxdrochloride
The product from Step 2 was treated with 1.1 equivalent of
triphenylphosphine in refluxing CBr. The crude 2-cyclohexylamino-5-
- 100 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
pyridylmethyl bromide was purified by silica gel chromatography and
reacted with 1-trityl-4-(4-cyanobenzyl)imidazole from Example 1, Step
1 for 12 hours at 60° in dry acetonitrile. The mixture was concentrated
and the residue boiled 12 hours in methanol The methanol was
concentrated andthe residue purified by preparative HPLC to give the
trifluoroacetic salt of the title compound, This was converted to the HCl
salt by lyophilization: from dioxane containing 1 equivalent of HCI.
EXAMPLE 7
5-(4'-Cyanobenzyl) 1-[2-(3"-chlorophenylthio)pyrid-5-ylmethyl]-
imidazole -S-oxide hydrochloride.
The product of Example 1 was oxidized with I.1 equivalent
of 3-chloroperbenzoic acid in THF at -60° to room temperature.
Preparative HPLC followed by lyophilization from dioxane HCl gave
pure title compound.
EXAMPLE 8
Preparation of 2-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-S-
l~ethyl)carbamoyl] -6-(3-trifluoromethylnhenoxX)nvr~ idine
to A: 4-Cyanobenzyl histamine
Nr-Pivaloyloxymethyl-Na-phthaloylhistamine (4.55 g,
12.8 mmol) prepared as previously described (J. C. Emmett, F. H.
Holloway, and J. L. Turner, J. Chem. Soc., Perkin Trans. 1, 1341,
( 1979)) and a-Bromo-p-tolunitriie (3.77 g, 19.2 mmol) were dissolved
in acetonitrile (70 mL) and heated at SSoC for 4 h, cooled to room
temperature, and filtered to remove the white solid. The acetonitrile
(30 mL) was concentrated to 1/2 its volume under reduced pressure and
the solution was heated at SSoC overnight. The solution was cooled and
filtered to give a white solid. The solids were combined, dried, and
used without further purification.
1-Pivaloyloxymethyl-3-(4-cyanobenzyl)-4-(2-
phthalimidoethyl) imidazolium bromide ( 1.00 g, 1.81 mmol) was
- 101 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
dissolved in ethanol (50 mL), treated with hydrazine (0.287 mL, 9.06
mmol), and heated at reflux for 16 h. Dimethyl phthalate (2.22 mL,
13.57 mmol) was added and reflux was continued for 6 h. The reaction
mixture was cooled in an ice-H20 bath, the solid precipitate filtered off,
the filtrate concentrated to dryness, and the residue chromatographed
(Si02, CH2C12(NH40H): 3 -8% CH30H) to give the title compound.
1 H NMR (CD30D) 8 7.76 (s, 1 H), 7.74 (d, 2H, J = 8 Hz), 7.27 (d, 2H,
J = 8 Hz), 6.88 (s, 1H), 5.35 (s, 2H), 2.76 (t, 2H, J = 6 Hz), 2.60 (t, 2 H,
J = 6 Hz).
S tee B : 2- [N-( 1-(4' -Cyanobenzyl )-1 H-imidazol-5-
ylethvl)carbamoyll -6-(3-trifluoromethylphenoxy),p~ridine
6-(3-Trifluoromethylphenoxy)pyridine-2-carboxylic
acid (0.05 g, 0.146 mmol) was dissolved in DMF (2 mL) and treated
with EDC (0.0338 g, 0.176 mmol), HOBT (0.0238 g, 0.176 mmol),
4-cyanobenzyl histamine (0.0399 g, 0.176 mmol) and N-
methylmorpholine (0.048 mL, 0.438 mmol) and stirred at ambient
temperature for 18 hr. Purification of the crude reaction by
preparative RP HPLC on a Vydac column gave the title compound.
Anal. calcd for C26H20N502F3 ~ 1.35 CF3C02H ~0.5 H20:
C, 52.67; H, 3.44; N, 10.70;
Found: C, 52.67; H, 3.42; N, 10.76.
FAB MS 492 (M+1 ).
Using the procedure described above, but substituting the requisite acids
in Step B, the following compounds were prepared:
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -6-(3-
trifluorometh~,phenoxy)p ridine
Anal. calcd for C26H20N502F3 ~ 0.3 H20:
C, 62.84; H, 4.18; N, 14.10;
Found: C, 62.80; H, 4.09; N, 13.97.
FAB MS 492 (M+1 ).
- 102 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
3-[N-( 1-(4' -Cyanobenzyl)-1 H-imidazol-5-ylethyl)carbamoyl] -5-(3-
t_rifluoromethvlnhenoxy,~pyridine
Anal. calcd for C26H20N502F3 ~ 0.15 CH2Cl2:
C, 62.29; H, 4.06; N, 13.89;
Found: C, 62.68; H, 4.44; N, 13.51.
FAB MS 492 (M+1).
3-[N-(1-(4'-Cyanobenzyl)-1H-imidazol-5-ylethyl)carbamoyl] -5-(3-
trifluorometh, l~,yloxy)pvridine
Anal. calcd for C27H22N502F3 ~ 0.20 H20:
C, 63.69; H, 4.44; N, 13.76;
Found: C, 63.70; H, 4.48; N, 13.67.
FAB MS 506 (M+1).
EXAMPLE 9
Preparation of 5-chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-
pyridine-3-carboxylic acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-
ethvl 1-amide
5-Chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-
3-carboxylic acid (0.10 g, 0.335 mmol) was dissolved in DMF (10 mL)
and treated with EDC (0.077 g, 0.402 mmol), HOBT (0.054 g, 0.402
mmol), 4-cyanobenzyl histamine (0.079 g, 0.352 mmol) and NMM
(0.11 mL, 1.00 mmol) and stirred at ambient temperature for 18 hr.
The reaction mixture was concentrated to remove the DMF, then
partitioned between EtOAc and aq saturated NaHC03 solution, the
organic layer separated, washed with brine and dried (MgS04). The
title compound was obtained upon purification by RP HPLC on a
PrepPak column eluting with an acetonitrile/H20lTFA gradient followed
by neutralization with NaHC03 and extraction.
Anal. calcd for C26H21 N502C12 ~ 0.20 H2O:
C, 61.23; H, 4.23; N, 13.73;
Found: C, 61.19; H, 4.20; N, 13.59.
FAB MS 506 (M+1).
- 103 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
Using the procedure described above, but substituting the requisite
acids, the following compounds were prepared:
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-3-carboxylic acid
12-f3-(4-cvanobenzvl)-3H-imidazol-4- 1~~J~-amide
Anal. calcd for C26H22N5~2C1 ~ 0.45 H20:
C, 65.05; H, 4.81; N, 14.59;
Found: C, 65.12; H, 4.84; N, 14.35.
FAB MS 472 (M+1).
1-(3-Trifluoromethylbenzyl)-2-oxo-1,2-dihydro-pyridine-S-carboxylic
acid 12-f3-(4-cyanobenzyl)-3H-imidazol-4-yll-ethyl-amide
Anal. calcd for C27H22N502F3 ~ 0.40 H20:
C, 63.25; H, 4.48; N, 13.66;
Found: C, 63.30; H, 4.26; N, 13.32.
FAB MS 506 (M+1).
1-(3-Chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic acid {2-
f 3-(4-cvanobenzvl)-3H-imidazol-4-yll-ethyl 1-amide
Anal. calcd for C26H22N5~2C1 ~ 0.30H20:
C, 65.41; H, 4.77; N, 14.67;
Found: C, 65.42; H, 4.64; N, 14.42.
FAB MS 472 (M+1).
5-Chloro-1-(3-chlorobenzyl)-2-oxo-1,2-dihydro-pyridine-5-carboxylic
acid ( 2-f 3-(4-cyanobenz~l-3H-imidazol-4-vll-ethyl }-amide
Anal. calcd for C26H21N5~2C12~ 0.75 H20:
C, 60.06; H, 4.36; N, 13.47;
Found: C, 60.08; H, 4.11; N, 13.32.
FAB MS 506 (M+1).
- 104 -

CA 02305783 2000-03-31
WO 99/1809b PCT/US98/20525
EXAMPLE 10
Preparation of 6-[N-(3-Chlorobenzyl) carbamoyl]- 4-ethoxy-pyridine-2-
carboxvlic acid ~( 2-j3~- 4-c~ranobenz,~ 1)-3H-imidazol-4~r11-ethyl }-amide
Step A: Diethyl 4-h,~drox, -~Rvridine dicarbox,
Chelidamic acid ( 15.1 g, 0.825 mol), abs EtOH (48 mL)
and concd H2S04 (0.9 mL) were combined and heated at reflux for 8 hr.
The reaction mixture was concentrated to remove the EtOH, and
partitioned between EtOAc and H20. After numerous extractions,
concentration of the organic layer, the title compound was obtained
after RP HPLC.
to B: Mono methyl ester of 4-ethox, -~~vridine dicarbox,
The diethyl ester ( 0.300 g, 1.12 mmol) was dissolved
in THF (4 mL) and treated with LiOH (0.052 g, 1.23 mmol) in
H20/CH30H (24 mL) and stirred overnight at ambient temperature.
The title compound was obtained after preparative RP HPLC. FAB
MS 226 (M+1).
to : 4-Ethoxy-6-methoxycarbonyl-pyridine-2-carboxylic acid
{ 2-j3-(4-cyanobenzyl)-3H-imidazol-4-yl]-eth r~l )~-amide
The mono methyl ester of 4-ethoxy-2,6-pyridine
dicarboxylate (0.098 g, 0.435 mmol) was dissolved in DMF ( 1 mL)
and treated with EDC (0.108 g, 0.503 mmol), HOBT (0.062 g, 0.456
mmol), 4-cyanobenzylhistamine (0.098 g, 0.435 mmol) and the pH
adjusted to 7.5 with NMM. After stirring overnight at ambient
temperature, the reaction mixture was concentrated to remove the DMF,
then chromatographed on RP HPLC to give the title compound as the
TFA salt. FAB MS 434 (M+1).
- 105 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
Ste : 4-Ethoxy-6-carboxyl-pyridine-2-carboxylic acid { 2-[3-(4-
cyanobenzyl~ ~H-imidazol-4-yll-ethyl 1-amide
4-Ethoxy-6-methoxycarbonyl-pyridine-2-carboxylic acid
{ 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide (0.249 g, 0.376
mmol) was dissolved in THF ( 2 mL) and treated with LiOH (0.052 g,
1.24 mmol) in CH30H (4 mL)- H20 (2 mL) with stirring at ambient
temperature for 5 hr. The reaction mixture was concentrated to dryness
and used in the next step.
Step E: 6-[N-(3-Chlorobenzyl) carbamoyl]- 4-ethoxy-pyridine-2-
carboxylic acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-
eth,~}-amide
4-Ethoxy-6-carboxyl-pyridine-2-carboxylic acid { 2-[3-(4-
cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide (0.120 g, 0.185 mmol)
was dissolved in DMF ( 2mL) and treated with EDC (0.043 g, 0.222
mmol), HOBT (0.024 g, 0.176 mmol), 3-chlorobenzylamine (0.113 mL,
0.925 mmol) and the pH adjusted to 7.5 with NMM. After stirring
overnight at ambient temperature, the reaction mixture was
concentrated to remove the DMF, the residue partitioned between
EtOAc and aq saturated NaHC03 solution, the organic layer separated,
washed with brine and dried (MgS04). Filtration and concentration
gave the crude product which was chromatographed on RP HPLC to
give the title compound as the TFA salt.
Anal. calcd for C29H27N6O3C1 ~ 2.5 CF3C02H ~ 1.15 H20:
C, 48.11; H, 3.78; N, 9.90;
Found: C, 48.10; H, 3.79; N, 9.69.
FAB MS 543 (M+1).
- 106 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
EXAMPLE 11
Preparation of 6-[N-(3-Chlorophenyl) carbamoyl]- 4-ethoxy-pyridine-
2-carboxylic acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-
amide
4-Ethoxy-6-carboxyl-pyridine-2-carboxylic acid { 2-[3-(4-
cyanobenzyl)-3H-imidazol-4-yl]-ethyl }-amide (0.124 g, 0.191 mmol)
was dissolved in DMF (2 mL), treated with Bop reagent (0.093 g, 0.210
mmol) and NMM (0.083 mL, 0.764 mmol) and stirred overnight at
ambient temperature. The solvent was removed in vacuo and the
residue partitioned between EtOAc and aq saturated NaHC03 solution.
The organic layer was separated, washed with brine and dried (MgS04).
Filtration and concentration gave the title compound after
chromatography (CH2Cl2 with 1% CH30H then 4.5% CH30H/0.5%
NH40H).
Anal. calcd for C28H25N6O3C1 ~0.70 CF3C02H ~ 1.15 H20:
C, 56.09; H, 4.48; N, 13.35;
Found: C, 56.10; H, 4.52; N, 13.31.
FAB MS 529 (M+1).
EXAMPLE 12
Preparation of 4-(3-Chlorobenzyloxy)- 6-methoxycarbonyl- pyridine-2-
carboxvlic acid ~(2-[3-~4-cyanobenzyl)-3H-imidazol-4-, 1~1-eth_,~}-amide
t A: 4-(3-Chlorobenz,~,~pyridine-2.6- dicarboxylic acid
Chelidamic acid (10.0 g, 0.055 mol) was dissolved in
CH30H (300 mL), treated with concd H2S04 (1.$ mL) and heated at
reflux for 6 hr, then cooled and concentrated to give an amber oil.
to B: Dimethyl 4-(3-Chlorobenzyloxy) - pyridine-2,6-
dicarboxylate
4-(3-Chlorobenzyloxy)- pyridine-2,6- dicarboxylic acid
{2.00 g, 9.47 mmol) was dissolved in DMF (19 mL) and treated with
- 107 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
K2C03 (3.93 g, 28.4 mmol) and 3-chlorobenzylbromide ( 1.24 mL, 9.47
mmol). After stirring overnight at ambient temperature, the solvent
was removed in vacuo and the residue partitioned between EtOAc and
aq saturated NaHC03 solution. The organic layer was separated, washed
with brine and dried (Na2S04}. Filtration and concentration gave the
title compound.
Step C: Mono methyl ester of 4-(3-Chlorobenzyloxy)- pyridine-
2.6- dicarboxvlic acid
The dimethyl ester ( 3.18 g, 9.46 mmol) was dissolved
in THF ( I 0 mL) and treated with LiOH (0.4372 g, 10.41 mmol)
in H20/CH30H:I/3 (200 mL) and stirred overnight at ambient
temperature. The title compound was obtained after preparative
RP HPLC.
t D: 4-(3-Chlorobenzyloxy)- 6-methoxycarbonyl- pyridine-2-
carboxylic acid { 2-[3-(4-cyanobenzyl)-3H-imidazol-4-yl]-
ethyl }-amide
The mono methyl ester of 4-(3-chlorobenzyloxy)- pyridine-
2,6 =dicarboxylic acid (0.236 g, 0.622 mmol) was dissolved in DMF
(2mL) and treated with EDC (0.125 g, 0.653 mmol), HOBT (0.080 g,
0.59 mmol), 4-cyanobenzylhistamine (0.141 g, 0.622 mmol) and the pH
adjusted to 7.5 with NMM. After stirring overnight at ambient
temperature, the reaction mixture was concentrated to remove the DMF,
the residue partitioned between EtOAc and aq saturated NaHC03
solution, the organic layer separated, washed with brine and dried
(MgS04). Filtration and concentration gave the crude product which
was chromatographed on RP HPLC to give the title compound which
was isolated as the HCl salt.
Anal. calcd for C28H24N504C1 ~ HCl ~ 0.55 H20:
C, 58.35; H, 4.56; N, 12.15;
Found: C, 58.33; H, 4.73; N, 11.87.
FAB MS 530 (M+1).
- 108 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
EXAMPLE 13
Preparation of 4-(S-{ [6-(3-chloro-phenoxy)-pyridin-2-ylamino]-
methyl l -imidazol-1-ylmethyl)-benzonitrile
S
t A: 1-Triphen, l~yl-4-~hvdrox,~methyl)-imidazole
To a solution of 4-(hydroxymethyl)imidazole
hydrochloride (35.0 g, 260 mmol) in 2S0 mL of dry DMF at room
temperature was added triethylamine (90.6 mL, 6S0 mmol). A white
solid precipitated from the solution. Chlorotriphenylmethane (76.1
g, 273 mmol) in S00 mL of DMF was added dropwise. The reaction
mixture was stirred for 20 hours, poured over ice, filtered, and
washed with ice water. The resulting product was slurried with cold
1 S dioxane, filtered, and dried in vacuo to provide the titled product as
a white solid which was sufficiently pure for use in the next step.
to B: 1-Triphen lmeth~(acetox methyl)-imidazole
Alcohol from Step A (260 mmol, prepared above) was
suspended in S00 mL of pyridine. Acetic anhydride (74 mL, 780
mmol) was added dropwise, and the reaction was stirred for 48
hours during which it became homogeneous. The solution was
poured into 2 L of EtOAc, washed with water (3 x 1 L), S% aq. HCl
2S soin. (2 x 1 L), sat. aq. NaHC03, and brine, then dried (Na2S04),
filtered, and concentrated in vacuo to provide the crude product.
The acetate was isolated as a white powder which was sufficiently
pure for use in the next reaction.
Step C: 1-(4-Cyanobenzyl)-S-(acetoxymethyl)-imidazole
hydrobromide
A solution of the product from Step B (85.8 g, 22S
mmol) and a-bromo-p-tolunitrile (50.1 g, 232 mmol) in S00 mL of
3S EtOAc was stirred at 60°C for 20 hours, during which a pale yellow
- 109 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
precipitate formed. The reaction was cooled to room temperature
and filtered to provide the solid imidazolium bromide salt. The
filtrate was concentrated in vacuo to a volume 200 mL, reheated at
60°C for two hours, cooled to room temperature, and filtered again.
The filtrate was concentrated in vacuo to a volume 100 mL, reheated
at 60°C for another two hours, cooled to room temperature, and
concentrated in vacuo to provide a pale yellow solid. All of the solid
material was combined, dissolved in 500 mL of methanol, and
warmed to 60°C. After two hours, the solution was reconcentrated
in vacuo to provide a white solid which was triturated with hexane to
remove soluble materials. Removal of residual solvents in vacuo
provided the titled product hydrobromide as a white solid which was
used in the next step without further purification.
to D: 1-(4-Cyanoben~rl)-5-(hydroxymethvl)-imidazole
To a solution of the acetate from Step C (50.4 g, 150
mmol) in 1.5 L of 3:1 THF/water at 0°C was added lithium
hydroxide monohydrate ( 18.9 g, 450 mmol). After one hour, the
reaction was concentrated in vacuo, diluted with EtOAc (3 L), and
washed with water, sat. aq. NaHC03 and brine. The solution was
then dried (Na2S04), filtered, and concentrated in vacuo to provide
the crude product as a pale yellow fluffy solid which was sufficiently
pure for use in the next step without further purification.
to : 1-(4-Cvanobenzyl~-5-imidazolecarboxaldeh,~~de
To a solution of the alcohol from Step D (21.5 g, 101
mmol) in 500 mL of DMSO at room temperature was added
triethylamine (56 mL, 402 mmol), then S03-pyridine complex (40.5
g, 254 mmol). After 45 minutes, the reaction was poured into 2.5 L
of EtOAc, washed with water (4 x 1 L) and brine, dried (Na2S04),
filtered, and concentrated in vacuo to provide the aldehyde as a white
- 110 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
powder which was sufficiently pure for use in the next step without
further purification.
to F: 2-Amino-6~3-chlorophenox3r),=pyridine
A mixture of 2-acetylamino-6-bromopyridine (200 mg,
0.93 mmol), 3-chlorophenol (240 mg, 1.86 mmol), CsC03 (606 mg,
1.86 mmol), copper (II) triflate benzene complex ( 10 mg, 0.02
mmol), 1-naphthoic acid (321 mg, 1.86 mmol), ethyl acetate (5 mg,
00.5 mmol), and freshly activated powdered 4-angstrom mol, sieves
(250 mg) in 2 mL dry toluene was heated with stirnng at 110°C in a
sealed tube for 72 hours. The mixture was cooled and filtered
through a Celite pad, and the filtrate concentrated in vacuo. The
crude oil was redissolved in ethyl acetate and was washed twice with
20% aq. NaOH solution. The organic layer was dried over
anhydrous MgS04 and was filtered and concentrated to give a yellow
oil. The oil was purified by gravity column chromatography over
silica gel with 4:1 hexanes/ethyl acetate. Suspected product fractions
were combined and concentrated in vacuo to give the product as a
yellow oil. The oil was dissolved in 2 mL of 10% aq. sulfuric acid,
and the solution heated at 100°C for 18 hours. The reaction was
cooled and basified to pH 11 with concentrated NH40H solution, and
extracted twice with ethyl acetate. The combined ethyl acetate
extracts were washed with brine, dried over anhydrous MgS04,
filtered and concentrated to give the title product as an oil. 400 Mhz
H1 NMR (CDC13): 4.44(br s, 2H), 6.15(d, 1H), 6.21(d, 1H), 7.02(d,
1H), 7.11(m, 2H), 7.28(m, 1H), 7.42(t, 1H).
Ste : 1-(4-Cyanobenzyl)imidazole-5-[6-(3
chlorophenoxylpvridin-2-~rl]methanamid~
A mixture of 1-(4-cyanobenzyl)imidazole-5-
carboxaldehyde (79 mg, 0.37 mmol) from Step E, 2-amino-6-(3-
chlorophenoxy)-pyridine (81 mg, 0.37 mmol) from Step F, and titanium
isopropoxide (131 mg, 0.46 mmol) in 0.50 mL of anhydrous THF was
stirred vigorously at room temperature in an argon atmosphere for 1
- 111 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
hour. The reaction was diluted with 0.50 mL of anhydrous ethanol and
was treated with sodium cyanoborohydride (23 mg, 0.37 mmol). The
resulting mixture was stirred at room temperature for 18 hours. The
reaction was concentrated in vacuo, and the residue partitioned between
ethyl acetate and water. The aqueous layer was reextracted twice with
ethyl acetate, and combined extracts washed with brine and dried over
anhydrous MgS04. Filtration and concentration provided the product as
a yellow oil. The crude product was purified by reverse phase
preparatory LC to give the pure desired product as a tacky white
amorphous powder after lyophilization from water. 400 Mhz H1 NMR
(CDCl3): 4.37(s, 2H), 5.31(s, 2H), 6.18(d, 1H), 6.25(d, 1H), 6.94(d,
1 H), 7.09(s, 1 H), 7.18(d, 2H), 7.19(d, 1 H), 7.21 (s, 1 H), 7.30(m, 1 H),
7.42(t, 1H), 7.64(d, 2H), 8.46(s, 1H). High res. FAB MS: then. _
416.1273, obs. = 416.1286. Elemental analysis for C23H18NSOCl
0.60 water ~ 1.15TFA: C(54.47 calc., 54.44 obs.); H (3.68 calc., 3.72
obs.); N(12.56 calc., 1.54 obs.).
EXAMPLE 14
Preparation of 4-(5-{ [6-(phenylethynyl)-pyridin-2-ylamino]-methyl }-
imidazol-1- lv methyl)-benzonitrile
to A: 2-Amino-6-ll-phen, ly ethyn-2-,~)p, rid dine
A solution of 2-amino-6-bromopyridine (200 mg, 1.16
mmol), 1-phenylacetylene (142 mg, 1.39 mmol), bis-
(triphenylphosphine) palladium (II) chloride ( 14 mg, 0.02 mmol), and
CuI (2 mg, 0.01 mmol) in 2 mL triethylamine was stirred at 60°C in
a
sealed tube for 18 hours. The reaction was cooled and concentrated in
vacuo to a dark oil. The oil was purified by gravity column
chromatography over silica gel with 2% methanol/chloroform to give
the desired product as a brown oil. 400 Mhz H1 NMR (CDC13):
4.57(br s, 2H), 6.49(d, 1H), 6.93(d, 1H), 7.38(m, 3H), 7.41(t, 1H),
7.58(d, 1H).
to B: 1-(4-Cyanobenzyl)imidazole-5-[6-(1-phenylethyn-2-
yl)pyridin-2-yllmethanamine
Via a procedure identical to that described above in
Example 13, Step G, from 100 mg (0.47 mmol) of aldehyde (from
- 112 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US9$/20525
Example 13, Step E) and 92 mg (0.47 mmol) of 2-amino-6-(1-
phenylethyn-2-yl)pyridine (from Step A) the desired' product was
obtained as an amorphous tacky light yellow powder. 400 Mhz Hl
NMR (CDC13): 4.50(s, 2H), 5.61(s, 2H), 6.71(d, 1H), 6.89(d, 1H),
7.23(d, 2H), 7.38-7.48(complex, 4H), 7.62(d, 2H), 7.65-7.73(complex,
4H), 7.78(t, 1H), 8.58(s, 1H), 10.90(br s, 1H). High res. FAB MS: theo
= 390.3713, obs. = 390.1728. Elemental analysis for C25H19Ns ~ 1.00
water ~ 2.5TFA: C(calc. 43.36, obs. 43.63); H(calc. 3.42, obs. 3.61);
N(calc. 10.11, obs. 9.85).
FXA,~ViPLE 15
Preparation of 4-(5-{ [6-(1,2,3,4-tetrahydronaphth-6-yloxy)-pyridin-2-
vlaminol-methyl } -imidazol-1-ylmethyl)-benzonitrile
Step A: 2-Amino-6-ll 2 3 4-tetrah dronaphthyloxv-6-yl)p ridine
Via an identical procedure to that described in Example 13,
Step F, from 200 mg (0.93 mmol) of 2-acetylamino-6-bromopyridine
and 276 mg (1.86 mmol) of 6-hydroxy-(1,2,3,4-tetrah~ydro)naphthylene
was obtained the title compound as an oil. 400 Mhz H NMR (CDC13):
1.79{d, 4H), 2.77(d, 4H), 6.56(d, 1H), 6.81(d, 1H), 7.04(d, 1H), 7.65(t,
1H), 7.84(d, 1H), 8.12(s, 1H).
to : 1-(4-Cyanobenzyl)imidazole-5-[6-(1,2,3,4-
tetrahydronanhthyloxv-6-yl),pvridin-2-, l~lmethanamine
Via a procedure identical to that described in Example 13,
Step G from 132 mg (0.62 mmol) of aldehyde (from Example 13, Step
E) and 148 mg (0.62 mmol) of 2-amino-6-{1,2,3,4-
tetrahydronaphthyloxy-6-yl)pyridine (from Step A) was obtained the
desired product as a clear oil. 400 Mhz H1 NMR (CDC13): 1.81(m,
4H), 2.77(m, 4H), 4.43(s, 2H), 5.53(s, 2H), 6.03(d, 1H), 6.18(m, 1H),
6.85{s, 1H), 7.14(d, 1H), 7.25(d, 2H), 7.46(s, 1H), 7.56(t, 1H), 7.66(d,
2H), 8.61(s, 1H). High res. FAB MS: theo. = 436.2132, obs. _
436.2143.
- 113 -

CA 02305783 2000-03-31
WO 99/18096 PCTNS98/20525
EXAMPLE 16
Preparation of 4-(5-{ [6-(2-phenylethyl)-pyridin-2-ylamino]-methyl }-
imidazol-1-vlmethyl)-benzonitrile
A solution of 1-(4-cyanobenzyl)imidazole-5-[6-( 1-
phenylethyn-2-yl)-2-pyridyl]methanamine ~ 2.STFA (85 mg, 0.13
mmol) from Example 14, Step B in 10 mL of absolute EtOH over 10%
Pd on C catalyst (20 mg) was hydrogenated for 18 hours at atmospheric
pressure (balloon). The catalyst was removed by filtration, and the
filtrate was concentrated in vacuo to give an oil. The crude oil was
purified via reversed phase lpreparatory LC to give the desired product
as an oil/foam. 400 Mhz H NMR (CDCl3): 2.98(dd, 2H), 3.02(dd,
2H), 4.38(d, 2H), 5.49(d, 2H), 6.59(d, 2H), 7.16-7.37(complex, 7H),
7.62(complex, 3H), 7.76(t, 1 H), 8.52(s, 1 H). FAB MS: M+ = 390.
EXAMPLE 17
In vitro inhibition of ras farnes,~ ansferase
Assays of farnesyl protein transferase. Partially purified
bovine FPTase and Ras peptides (Ras-CVLS (SEQ.ID.NO.: I 1), Ras-
CVIM (SEQ.ID.NO.: 1) and Ras-CAIL (SEQ.ID.NO.: 12)) were
prepared as described by Schaber e~ 1, ~. Biol. Chem. 265:14701-
14704 (1990), Pompliano, gl ~1., BiochemistrX 31:3800 (1992) and
Gibbs et al., PNAS U.S.A. 86:6630-6634 ( 1989), respectively. Bovine
FPTase was assayed in a volume of 100 p,l containing 100 mM N-(2-
~hydroxy ethyl) piperazine-N'-(2-ethane sulfonic acid) (HEPES), pH 7.4,
5 mM MgCl2, 5 mM dithiothreitol (DTT), 100 mM [3H]-farnesyl
diphosphate ([3H]-FPP; 740 CBq/mmol, New England Nuclear), 650 nM
Ras-CVLS and 10 ~,g/ml FPTase at 31 °C for 60 min. Reactions were
initiated with FPTase and stopped with 1 ml of 1.0 M HCL in ethanol.
Precipitates were collected onto filter-mats using a TomTec Mach II cell
harvestor, washed with 100% ethanol, dried and counted in an LKB (3-
plate counter. The assay was linear with respect to both substrates,
FPTase levels and time; less than 10% of the [3H]-FPP was utilized
during the reaction period. Purified compounds were dissolved in
- 114 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
100% dimethyl sulfoxide (DMSO) and were diluted 20-fold into the
assay. Percentage inhibition is measured by the amount of
incorporation of radioactivity in the presence of the test compound
when compared to the amount of incorporation in the absence of the test
compound.
Human FPTase was prepared as described by Omer et al. ,
Biochemistry 32:5167-5176 (1993). Human FPTase activity was
assayed as described above with the exception that 0.1 % (w/v)
polyethylene glycol 20,000, 10 ~,M ZnCl2 and 100 nNt Ras-CVIM were
added to the reaction mixture. Reactions were performed for 30 min.,
stopped with 100 ~.l of 30% (v/v) trichloroacetic acid (TCA) in ethanol
and processed as described above for the bovine enzyme.
The compounds of the instant invention described in the
above Examples 1-16 were tested for inhibitory activity against human
FPTase by the assay described above and were found to have IC50 of
<50 ~M.
EXAMPLE 18
In vivo ras farnesylation assax
The cell line used in this assay is a v-ras line derived
from either Ratl or NIH3T3 cells, which expressed viral Ha-ras p21.
The assay is performed essentially as described in DeClue, J.E. et al.,
Cancer Research 51:712-717, ( 1991 ). Cells in 10 cm dishes at 50-75%
confluency are treated with the test compound (final concentration of
solvent, methanol or dimethyl sulfoxide, is 0.1 %). After 4 hours at
37°C, the cells are labelled in 3 ml methionine-free DMEM supple-
meted with 10% regular DMEM, 2% fetal bovine serum and 400
mCi[35S]methionine (1000 Ci/mmol). After an additional 20 hours, the
cells are lysed in 1 ml lysis buffer ( 1 % NP40/20 mM HEPES, pH 7.5/5
mM MgCl2/1mM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml
antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at
100,000 x g for 45 min. Aliquots of lysates containing equal numbers
of acid-precipitable counts are bought to 1 ml with IP buffer (lysis
- 115 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
buffer lacking DTT) and immunoprecipitated with the ras-specific
monoclonal antibody Y13-259 (Furth, M.E. et ~1., J. Virol. 43:294-304,
(1982)). Following a 2 hour antibody incubation at 4°C, 200 ml of a
25% suspension of protein A-Sepharose coated with rabbit anti rat IgG
is added for 45 min. The immunoprecipitates are washed four times
with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/I % Triton X-
100Ø5% deoxycholate/0.1%/SDS/0.1 M NaCI) boiled in SDS-PAGE
sample buffer and loaded on 13% acrylamide gels. When the dye front
reached the bottom, the gel is fixed, soaked in Enlightening, dried and
autoradiographed. The intensities of the bands corresponding to
farnesylated and nonfarnesylated ras proteins are compared to
determine the percent inhibition of farnesyl transfer to protein.
EXAMPLE 19
Modified in vitro GGTase inhibition asssay
The modified geranylgeranyl-protein transferase inhibition
assay is carried out at room temperature. A typical reaction contains (in
a final volume of 50 ~,L): [3H]geranylgeranyl diphosphate, biotinylated
Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example
10 mM glycerophosphate or SmM ATP), 5 mM MgCl2, 10 ~,M ZnCl2,
0.1 % PEG ( 15-20,000), 2 mM dithiothreitol, and geranylgeranyl-
protein transferase type I(GGTase). The GGTase-type I enzyme
employed in the assay is prepared as described in U.S. Pat. No.
5,470,832, incorporated by reference. The Ras peptide is derived
from the K4B-Ras protein and has the following sequence: biotinyl-
GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 13).
Reactions are initiated by the addition of GGTase and stopped at timed
intervals (typically 15 min) by the addition of 200 ~,L of a 3 mg/mL
suspension of streptavidin SPA beads (Scintillation Proximity Assay
beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM
EDTA, and 0.5% BSA. The quenched reactions are allowed to stand
for 2 hours before analysis on a Packard TopCount scintillation counter.
- 116 -

CA 02305783 2000-03-31
WO 99/18096 PCT/LJS98/20525
For inhibition studies, assays are run as described above,
except inhibitors are prepared as concentrated solutions in 100%
dimethyl sulfoxide and then diluted 25-fold into the enzyme assay
mixture. ICSO values are determined with Ras peptide near KM
concentrations. Enzyme and nonsaturating substrate conditions for
inhibitor ICso determinations are as follows: 75 pM GGTase-I, 1.6
~,M Ras peptide, 100 nM geranylgeranyl diphosphate.
EXAMPLE 20
Cell-based in vitro growth inhibition assay
To determine the biological consequences of FPTase
inhibition, the effect of the compounds of the instant invention on the
anchorage-independent growth of Ratl cells transformed with either a
v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf
and v-Mos maybe included in the analysis to evaluate the specificity of
instant compounds for Ras-induced cell transformation.
Rat 1 cells transformed with either v-ras, v-raf, or v-mos
are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in
a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's
medium supplemented with 10% fetal bovine serum) over a bottom
agarose layer (0.6%). Both layers contain 0.1 % methanol or an
appropriate concentration of the instant compound {dissolved in
methanol at 1000 times the final concentration used in the assay). The
cells are fed twice weekly with 0.5 ml of medium A containing 0.1 %
methanol or the concentration of the instant compound.
Photomicrographs are taken 16 days after the cultures are seeded and
comparisons are made.
- 117 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
EXAMPLE 21
Construction of SEAP reporter plasmid ~pDSE100
The SEAP reporter plasmid, pDSE100 was
constructed by ligating a restriction fragment containing the SEAP
coding sequence into the plasmid pCMV-RE-AKI. The SEAP gene
is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
The plasmid pCMV-RE-AKI was constructed by Deborah Jones (Merck)
and contains 5 sequential copies of the 'dyad symmetry response
element' cloned upstream of a 'CAT-TATA' sequence derived from the
cytomegalovirus immediate early promoter. The plasmid also contains
a bovine growth hormone poly-A sequence.
The plasmid, pDSE100 was constructed as follows.
A restriction fragment encoding the SEAP coding sequence was cut out
of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and
HpaI. The ends of the linear DNA fragments were filled in with the
Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA
containing the SEAP gene was isolated by electrophoresing the digest in
an agarose gel and cutting out the 1694 base pair fragment. The vector
plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-
II and the ends filled in with Klenow DNA Polymerase I. The SEAP
DNA fragment was blunt end ligated into the pCMV-RE-AKI vector
and the ligation products were transformed into DHS-alpha E. coli cells
(Gibco-BRL j. Transformants were screened for the proper insert and
then mapped for restriction fragment orientation. Properly oriented
recombinant constructs were sequenced across the cloning junctions to
verify the correct sequence. The resulting plasmid contains the SEAP
coding sequence downstream of the DSE and CAT-TATA promoter
elements and upstream of the BGH poly-A sequence.
Clonin og f a Myrist3rlated viral-H-ras expression ,plasmid
A DNA fragment containing viral-H-ras can be PCRed from plasmid
"H-1" (Ellis R. et al. J. Virol. 36, 408, 19$0) using the following oligos.
- 118 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
Sense strand:
5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAA
GGACCCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTG
G 3'. (SEQ.ID.NO.: 14)
Andsense:
5' CACATCTAGATCAGGACAGCACAGACTTGCAGC 3' .
(SEQ.ID.NO.: 1 S)
A sequence encoding the first 15 aminoacids of the v-src gene,
containing a myristylation site, is incorporated into the sense strand
oligo. The sense strand oligo also optimizes the 'Kozak' translation
initiation sequence immediately 5' to the ATG start site.To prevent
prenylation at the viral-ras C-terminus, cysteine 186 would be mutated
to a serine by substituting a G residue for a C residue in the C-terminal
antisense oligo. The PCR primer oligos introduce an XhoI site at the 5'
end and a Xbal site at the 3' end. The XhoI-XbaI fragment can be ligated
into the mammalian expression plasmid pCI {Promega) cut with XhoI
and XbaI. This results in a plasmid in which the recombinant myr-
viral-H-ras gene is constitutively transcribed from the CMV promoter
of the pCI vector.
Clonin~iral-H-ras-CVLL expression plasmid
A viral-H-ras clone with a C-terminal sequence encoding the amino
acids CVLL can be cloned from the plasmid "H-1" (Ellis R. et al. J.
Virol. 36, 408, 1980) by PCR using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-
3' (SEQ.ID.NO.: 16)
- 119 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
Antisense strand:
5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3'
(SEQ.ID.NO.: 17)
The sense strand oligo optimizes the 'Kozak' sequence and adds an XhoI
site. The antisense strand mutates serine 189 to leucine and adds an
XbaI site. The PCR fragment can be trimmed with XhoI and XbaI and
ligated into the XhoI-XbaI cut vector pCI (Promega). This results in a
plasmid in which the mutated viral-H-ras-CVLL gene is constitutively
transcribed from the CMV promoter of the pCI vector.
Cloning of c-H-ras-Leu61 expression ~lasmid
The human c-H-ras gene can be PCRed from a human cerebral cortex
cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5' -GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3'
(SEQ.ID.NO.: 18)
Antisense strand:
5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3'
(SEQ.ID.NO.: 19)
The primers will amplify a c-H-ras encoding DNA fragment with the
primers contributing an optimized 'Kozak' translation start sequence,
an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
After trimming the ends of the PCR product with EcoRI and Sal I, the
c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut
mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to
a leucine can be accomplished using the manufacturer's protocols and
the following oligonucleotide:
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.N0.:20)
- 120 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
After selection and sequencing for the correct nucleotide substitution,
the mutated c-H-ras-Leu61 can be excised from the pAlter-1 vector,
using EcoRI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with EcoRI and Sal I. The new
recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from
the CMV promoter of the pCI vector.
Cloning of a c-N-ras-Val-12 exnre~ ssion plasmid
The human c-N-ras gene can be PCRed from a human cerebral cortex
cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
S'-GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3'
(SEQ.ID.NO.: 21)
Antisense strand:
5' -GAGAGTCGACTTGTTACATCACCACACATGGC-3'
(SEQ.ID.N0.:22)
The primers will amplify a c-N-ras encoding DNA fragment with the
primers contributing an optimized 'Kozak' translation start sequence,
an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
After trimming the ends of the PCR product with EcoRI and Sal I, the
c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis
vector pAlter-1 (Promega). Mutation of glycine-12 to a valine can be
accomplished using the manufacturer's protocols and the following
oligonucleotide:
5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.N0.:23)
After selection and sequencing for the correct nucleotide substitution,
the mutated c-N-ras-Val-12 can be excised from the pAlter-1 vector,
- 121 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
using EcoRI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with EcoRI and Sal I. The new
recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from
the CMV promoter of the pCI vector.
Cloning of a c-K-ras-Val-I2 expression plasmid
The human c-K-ras gene can be PCRed from a human cerebral cortex
cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3'
(SEQ.ID.NO.: 24)
Antisense strand:
5' -CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3'
(SEQ.ID.NO.: 25)
The primers will amplify a c-K-ras encoding DNA fragment with the
primers contributing an optimized 'Kozak' translation start sequence, a
KpnI site at the N-terminus and a Sal I stite at the C-terminal end. After
trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras
fragment can be ligated into a Kpnl -Sal I cut mut~genesis vector
pAlter-1 (Promega). Mutation of cysteine-12 to a valine can be
accomplished using the manufacturer's protocols and the following
oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.N0.:26)
After selection and sequencing for the correct nucleotide substitution,
the mutated c-K-ras-Val-12 can be excised from the pAlter-1 vector,
using KpnI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with KpnI and Sal I. The new
- 122 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from
the CMV promoter of the pCI vector.
SEAP assaX
Human C33A cells (human epitheial carcenoma - ATTC
collection) are seeded in lOcm tissue culture plates in DMEM + 10%
fetal calf serum + 1X Pen/Strep + 1X glutamine + 1X NEAA. Cells are
grown at 37oC in a 5% C02 atmosphere until they reach 50 -80% of
conflunecy.
The transient transfection is performed by the CaP04
method (Sambrook et al., 1989). Thus, expression plasmids for H-ras,
N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the
DSE-SEAP reporter construct. For l Ocm plates 600,1 of CaCl2 -DNA
solution is added dropwise while vortexing to 600,1 of 2X HBS buffer
to give 1.2m1 of precipitate solution (see recipes below}. This is
allowed to sit at room temperature for 20 to 30 minutes. While the
precipitate is forming, the media on the C33A cells is replaced with
DMEM (minus phenol red; Gibco cat. # 31053-028)+ 0.5% charcoal
stripped calf serum + 1 X (Pen/Strep, Glutamine and nonessential
aminoacids). The CaP04-DNA precipitate is added dropwise to the
cells and the plate rocked gently to distribute. DNA uptake is allowed
to proceed for 5-6 hrs at 37oC under a 5% C02 atmosphere.
Following the DNA incubation period, the cells are washed
with PBS and trypsinized with lml of 0.05% trypsin. The 1 ml of
trypsinized cells is diluted into lOml of phenol red free DMEM + 0.2%
charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and NEAA ).
Transfected cells are plated in a 96 well microtiter plate ( 100p.1/well) to
which drug, diluted in media, has already been added in a volume of
100,1. The final volume per well is 200,1 with each drug concentration
repeated in triplicate over a range of half-log steps.
Incubation of cells and drugs is for 36 hrs at 37o under
C02. At the end of the incubation period, cells are examined
microscopically for evidence of cell distress. Next, 100.1 of media
containing the secreted alkaline phosphatase is removed from each well
- 123 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
and transferred to a microtube array for heat treatment at 65oC for 1 hr
to inactivate endogenous alkaline phosphatases (but not the heat stable
secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase
by a luminescence assay using the luminescence reagent CSPD~
(Tropix, Bedford, Mass.). A volume of 50 ~,1 media is combinRased
with 200 ~1 of CSPD cocktail and incubated for 60 minutes at room
temperature. Luminesence is monitored using an ML2200 microplate
luminometer (Dynatech). Luminescence reflects the level of activation
of the fos reporter construct stimulated by the transiently expressed
protein.
DNA-CaPOg precipitate for lOcm plate of cells
Ras expression plasmid ( 1 ~.g/~1) 101
DSE-SEAP Plasmid ( 1 ~,g/~,l) 2~,1
Sheared Calf Thymus DNA (l~,g/~.l) 8~.1
2M CaCl2 74,1
506,1
2X HBS Buffer
280mM NaCI
lOmM KCl
l.SmM Na2HP04 2H20
l2mM dextrose
50mM HEPES
Final pH = 7.05
Luminesence Buffer (26m1)
Assay Buffer 20m1
Emerald ReagentTM (Tropix) 2.5m1
100mM homoarginine 2.5m1
- 124 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
CSPD Reagent~ (Tropix) l.Oml
Assay Buffer
Add O.OSM Na2C03 to O.OSM NaHC03 to obtain pH 9.5. Make 1mM in
MgCl2
EXAMPLE 22
In vivo growth inhibition assay
To determine the biological consequences of FPTase
inhibition, the effect of the compounds of the instant invention on the
anchorage-independent growth of Rat 1 cells transformed with either a
v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf
and v-Mos maybe included in the analysis to evaluate the specificity of
instant compounds for Ras-induced cell transformation.
Rat 1 cells transformed with either v-ras, v-raf, or v-mos
are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in
a 0.3 % top agarose layer in medium A (Dulbecco's modified Eagle's
medium supplemented with 10% fetal bovine serum) over a bottom
agarose layer (0.6%). Both layers contain 0.1 % methanol or an
appropriate concentration of the instant compound (dissolved in
methanol at 1000 times the final concentration used in the assay). The
cells are fed twice weekly with 0.5 ml of medium A containing 0.1 %
methanol or the concentration of the instant compound.
Photomicrographs are taken 16 days after the cultures are seeded and
comparisons are made.
- 125 -

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
SEQUENCE LISTING
<110> Merck & Co., Inc.
deSolms, S. Jane
Lumma, William C.
Shaw, Anthony W.
Sisko, John T.
Tucker, Thomas J.
<120> INHIBITORS OF PRENYL-PROTEIN TRANSFERASE
<130> 20025Y
<150> 60/060,871
<151> 1997-10-02
<160> 26
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4
<212> PRT
<213> Homo sapiens
<400> 1
Cys Val Ile Met
1
<210> 2
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 2
Cys Val Leu Leu
1
<210> 3
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 3
Cys Val Val Met
1
1

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
<210> 4
<211> 4
<212> PRT
<213> Homo sapiens
<400> 4
Cys Ile Ile Met
1
<210> 5
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 5
Cys Leu Leu Leu
1
<210> 6
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 6
Cys Gln Leu Leu
1
<210> 7
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 7
Cys Ser Ile Met
1
<210> 8
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 8
Cys Ala Ile Met
1
<210> 9
<211> 4
2

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
<212> PRT
<213> Homo Sapiens
<400> 9
Cys Lys Val Leu
1
<210> 10
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 10
Cys Leu Ile Met
1
<210> 11
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 11
Cys Val Leu Ser
1
<210> 12
<211> 4
<212> PRT
<213> Homo Sapiens
<400> 12
Cys Ala Iie Leu
1
<210> 13
<211> 15
<212> PRT
<213> Homo Sapiens
<400> 13
Gly Lys Lys Lys Lys Lys Lys Ser Lys Thr Lys Cys Val Ile Met
1 5 10 15
<210> 14
<211> 86
<212> DNA
<213> Artificial Sequence
3

CA 02305783 2000-03-31
WO 99/I8096 PCT1US98/20525
<400> 14
tctcctcgag gccaccatgg ggagtagcaa gagcaagcct aaggacccca gccagcgccg 60
gatgacagaa tacaagcttg tggtgg g6
<210> 15
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 15
cacatctaga tcaggacagc acagacttgc agc 33
<210> 16
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 16
tctcctcgag gccaccatga cagaatacaa gcttgtggtg g 41
<210> 17
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 17
cactctagac tggtgtcaga gcagcacaca cttgcagc 38
<210> 18
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 18
gagagaattc gccaccatga cggaatataa gctggtgg 38
<210> 19
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 19
gagagtcgac gcgtcaggag agcacacact tgc 33
<210> 20
<211> 22
<212> DNA
<213> Artificial Sequence
4

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
<400> 20
ccgccggcct ggaggagtac ag 22
<2I0> 21
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 21
gagagaattc gccaccatga ctgagtacaa actggtgg 38
<210> 22
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 22
gagagtcgac ttgttacatc accacacatg gc 32
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 23
gttggagcag ttggtgttgg g 21
<210> 24
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 24
gagaggtacc gccaccatga ctgaatataa acttgtgg 38
<210> 25
<211> 36
<212> DNA
<213> Artificial Sequence
<400> 25
ctctgtcgac gtatttacat aattacacac tttgtc 36
<210> 26
<211> 24
<212> DNA
<213> Artificial Sequence

CA 02305783 2000-03-31
WO 99/18096 PCT/US98/20525
<400> 26
gtagttggag ctgttggcgt aggc 24