Note: Descriptions are shown in the official language in which they were submitted.
CA 02307128 2000-OS-25
' PT32 Sperm Protein, Sperm c-Yes, Oocyte Cytoplasmic
c-Yes, and Uses Thereof
Inventors: Richard Oko
Peter Sutovsky
Statement as to Rights to Inventions Made Under
Federally-Sponsored Research and Development
Part of the work performed during development of this invention utilized
U. S. Government funds, awarded by the National Institutes of Health (Grant
No.
R-21, RR14293-O1) and by the United States Department of Agriculture (New
Investigator Award #99-35203-7785). The U.S. Government has certain rights
in this invention.
Field of the Invention
The invention relates to proteins of the mammalian sperm and oocyte, and
uses thereof, e.g., in enhancing fertility and in contraception.
Background of the Invention
Oocyte activation in mammals encompasses the resumption of second
meiosis and the activation of anti-polyspermy defense, which are accompanied
by calcium oscillations periodically crossing oocyte cytoplasm (reviewed by
Schultz, R. M., and Kopf, G. S., "Molecular basis of mammalian egg
activation,"
in Current Topics in Developmental Biology, Pedersen, R. A., and Schatten, G.
P., (eds), Vol. 30, Academic Press Inc., San Diego, (1995) pp. 21-62). In
bovine
and other mammals, the fertilization-induced oocyte activation is also
accompanied by the assembly of nuclear pore complexes (NPC) into the
cytoplasmic annulate lamellae (AL), and by the insertion ofNPCs into a de novo-
formed nuclear envelope (NE) of the female and male pronuclei (Sutovsky et
al.,
J. Cell Sci. 111:2841-2854 ( 1998)). Three hypotheses were offered to explain
the
sperm-induced oocyte activation in mammals: The conduit, or calcium bomb
hypothesis (Jaffe, L. F., Ann. N. Y. Acad. Sci. 339:86-101 (1980)) implicates
the
direct, sperm-generated "injection" of Caz+ ions into oocyte cytoplasm at
CA 02307128 2000-OS-25
-2-
fertilization. The receptor hypothesis (e. g. Jones, K. T., and Whittingharn,
D. G.,
Dev. Biol.178:229-237 (1996); Swann, K.,Development 110:1295-1302 (1990))
maintains that the specific receptors on the sperm and oocyte plasma membranes
activate a signaling cascade leading to the release of Caz+ from internal
stores in
oocyte ER. Finally, the oscillogen hypothesis favors a soluble oscillogenic
factor, presumably a polypeptide, which is released from the sperm head into
the
oocyte cytoplasm at the time of gamete fusion (Kimura, Y., et al., Biol.
Reprod.
58:1407-1415 (1998); Parnngton, J., et al., Nature 379:364-368 (1996); Perry,
A. C. F., et al., Biol. Reprod. 60:747-755 (1999)). Although there is a
substantial
amount of data in favor of each of the above hypotheses, and each of them may
be relevant to certain animal taxa, recent studies seem to support the
validity of
the oscillogen hypothesis in mammals. The actual mechanism by which the
spermatozoon introduces the oscillogenic molecules into oocyte cytoplasm is
not
known.
Perinuclear theca (PT) is a cytoskeletal coat of the mammalian sperm
nucleus that is inserted between the nuclear envelope and the sperm plasma
membrane (Bellve, A. R., et al., Biol. Reprod. 47:451-465 (1992); Courtens, J.
L., et al., J. Ultrastruct. Res. 57:54-64 (1976); Lalli, M., and Clermont, Y.,
Am.
.l. Anat. 160:419-434 (1981); Oko, R., and Clermont, Y., Biol. Reprod. 39:673-
687 ( 1988)). During spermiogenesis, the PT attaches the acrosomal vesicle to
the
sperm nucleus and may be involved in shaping it (Oko, R., and Maravei, D.,
Biol.
Reprod. 50:1000-1014 (1994); Oko, R., and Maravei, D., Microsc. Res. Tech.
32:520-532 (1995); Oko, R., and Clermont, Y., "Spermiogenesis," in
Encyclopedia of Reproduction, Knobil, E. and Neil, J. D., (eds.), Vol. IV,
Academic Press Inc., San Diego (1998) pp. 602-609). At fertilization, the PT
is
removed from the sperm nucleus with the aid of oocyte's cortical microvilli
(Sutovsky et al., Dev. Biol. 188:75-84 (1997)). Otherwise, an intact PT would
constitute an unsurpassable hurdle preventing the access of the zygotic
cytoplasm
to the sperm nucleus, which at that time undergoes the remodeling into a male
pronucleus. Recent studies of infertile men suffering from globozoospermy
(Battaglia, D. E., et al., Fertil. Steril. 68:118-122 (1997); Edirisinghe, W.
R., et
al., Hum. Reprod. 13:3094-3098 (1998); Rybouchkin, A., et al.,. Hum. Reprod.
CA 02307128 2000-OS-25
-3-
11:2170-2175 ( 1996)), a rare spermatogenic disorder in which the absence of
PT
causes the round shape of the sperm nucleus (Escalier, D., Int. J. Dev. Biol.
34:287-297 (1990)), demonstrated that such spermatozoa fail to induce oocyte
activation after intracytoplasmic sperm injection (ICSI). Human and non-human
primate oocytes are activated by ICSI with normal spermatozoa (Hewitson, L.
C.,
et al., Biol. Reprod. 55:271-280 (1996); Palermo, G., et al., Lancet 340:17-18
(1992); Sutovsky, P., et al., Human Reprod. 14:2301-2312 (1996); Van
Steirteghern, A., et al., Hum. Reprod. 8:1061-1066 (1993)) and the
intracytoplasmic injection of crude (Swarm, K., Development 110:1295-1302
(1990)) or partially purified (Kimura, Y., et al., Biol. Reprod. 58:1407-1415
(1998); Perry, A. C. F., et al., Biol. Reprod. 60:747-755 (1999)) sperm
extracts
activates rodent oocytes.
Summary of the Invention
The present invention is derived, at least in part, from the observation
that, even though the PT is removed from the sperm nucleus at the egg surface,
it is incorporated completely into oocyte cytoplasm, where it dissolves
concomitantly with the progress of pronuclear development. This observation
conforms with the increased oocyte activation rates that are obtained after
intracytoplasmic injections ofpure PT extracts into bovine oocytes, as
compared
with sham-inj ected oocytes. The activated oocytes inj ected with PT-extracts,
but
not the control, sham-inj ected, oocytes, displayed the patterns of the
nuclear pore
complex (NPC) and annulate lamellae (AL) assembly typical of natural
fertilization. Furthermore, secondary spermatozoa prevented from entering the
oocyte cytoplasm by polyspermy block still show PT release from any part of
the
sperm head that has fused with the oolemma. Ultrastructural studies showed the
dissolution of PT in the oocyte cytoplasm during monospermic fertilization and
polyspermy. Taken together, these data support the view that sperm PT harbors
the oocyte activating-factors) and provide a mechanism for the release of
oscillogen(s) from the sperm head into oocyte cytoplasm at fertilization. As
discussed below, the sperm perinuclear theca protein PT32 is one such
oscillogen,
CA 02307128 2000-OS-25
-4-
which interacts with the protein tyrosine kinase c-Yes during spermatogenesis
and fertilization.
Accordingly, the invention features an isolated polypeptide that includes
(a) at least one of (i) the sequence PPPGY (SEQ ID NO: 1) and (ii) the
sequence
LPPAY (SEQ ID NO: 2) and (b) at least three domains (e.g., 4, 5, 6, 7, 8, 9,
10,
11, or 12 or more domains), each domain comprising the sequence YGXPPXG
(SEQ ID N0:3), wherein Y represents a Tyrosine residue, G represents a Glycine
residue, L represents a Leucine residue, A represents an Alanine residue, X
represents any amino acid residue, and P represents a Proline residue.
Optionally,
some or all of the YGXPPXG (SEQ ID N0:3) domains may include additional
amino acid residues (e.g., 1, 2, 3, 4, or S additional residues) flanking SEQ
ID
NO: 3. In various embodiments, the polypeptide has a molecular weight of about
32 kDa (e.g., about 28-33kDa); the polypeptide binds to tyrosine kinase c-Yes;
and/or the polypeptide induces oocyte activation. Included within the
invention
are fragments of the polypeptide that are (i) antigenic, (ii) biologically
active,
and/or (iii) able to bind to the protein tyrosine kinase c-Yes. An "antigenic"
fragment is a portion of the polypeptide which is capable of eliciting an
immune
response in a host and capable of interacting with antibodies or immune cells
in
vitro or in vivo. A "biologically active" fragment is a portion of the
polypeptide
which is capable of inducing oocyte activation alone or by interacting with
other
polypeptides, such as tyrosine kinase c-Yes or tyrosine kinase c-Yes adaptor
proteins. Typically, such a fragment contains at least 3 (typically, at least
10 or
all) of the YGXPPXG domains (SEQ ID N0:3), along with a PPPGY domain
(SEQ ID NO:1) or LPPAY domain (SEQ ID N0:2).
An exemplary polypeptide of the invention is PT32, which has the
sequence of SEQ ID NO:S, illustrated in Fig. 1, or conservative variants
thereof.
Peptidomimetics of the aforementioned polypeptides also are included
within the invention. In Morgan et al. ("Approaches to the discovery of
non-peptide ligands for peptide receptors and peptidases." Annual Reports in
Medicinal Chemistry. Ed. F.J. Vinick. San Diego: Academic Press, 1989, pp.
243-252), peptide mimetics are defined as "structures which serve as
appropriate
substitutes for peptides in interactions with receptors and enzymes. The
mimetic
CA 02307128 2000-OS-25
-5-
must possess not only affinity, but also efficacy and substrate function." For
purposes of this disclosure, the terms "peptidomimetic" and "peptide mimetic"
are used interchangeably according to the above-excerpted definition. That is,
a
peptidomimetic exhibits functions) of a peptide, without restriction of
structure.
Peptidomimetics of the present invention, i.e., analogues of biologically
active
fragments of PT32 or c-Yes, may include amino acid residues or other moieties
which provide the functional characteristics described herein.
The invention also features isolated polynucleotides encoding the
aforementioned polypeptides. As used herein, "polynucleotide" generally refers
to anypolyribonucleotide or polydeoxyribonucleotide, which may be unmodified
RNA or DNA, including cDNA, genomic DNA, and synthetic DNA, or modified
RNA or DNA. The DNA may be double-stranded or single-stranded, and if
single stranded may be the coding strand or non-coding (anti-sense) strand.
"Polynucleotides" include, without limitation, single- and double-stranded
DNA,
DNA that is a mixture of single- and double-stranded regions, single- and
double-
stranded RNA, and RNA that is mixture of single-and double-stranded regions,
hybrid molecules comprising DNA and RNA that may be single-stranded or,
more typically, double-stranded or a mixture of single- and double-stranded
regions. In addition, "polynucleotide" refers to triple-stranded regions
comprising
RNA or DNA or both RNA and DNA. The term polynucleotide also includes
DNAs or RNAs containing one or more modified bases and DNAs or RNAs with
backbones modified for stability or for other reasons. "Modified" bases
include,
for example, tritylated bases and unusual bases such as inosine. A variety of
modifications can be made to DNA and RNA; thus, "polynucleotide" embraces
chemically, enzymatically, or metabolically modified forms of the
polynucleotides typically found in nature, as well as the chemical forms of
DNA
and RNA characteristic of viruses and cells. "Polynucleotide" also embraces
relatively short polynucleotides, often referred to as oligonucleotides.
Fragments of the polynucleotides of the present invention may be used as
hybridization probes for a cDNA library to isolate the full length cDNA and to
isolate other cDNAs which have a high sequence similarity to the
polynucleotides
or similar function to the encoded polypeptides. Probes of this type
preferably
CA 02307128 2000-OS-25
-6-
have at least 15 bases, and may contain, for example, 18, 20, 25, 30, or 50 or
more bases. The probe may also be used to identify a cDNA clone corresponding
to a full length transcript and a genomic clone or clones that contain the
complete
gene including regulatory and promoter regions, exons, and introns. An example
of a screen comprises isolating the coding region of the gene by using the
known
DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides
having a sequence complementary to that of the gene of the present invention
are
used to screen a library of cDNA, genomic DNA or mRNA to determine to which
members of the library the probe hybridizes.
An exemplary polynucleotide of the invention includes the sequence of
SEQ ID NO: 4, illustrated in Fig.l, or degenerate variants thereof. In various
embodiments, the invention also includes: (i) a gene that includes such a
polynucleotide; (ii) a vector that includes such a polynucleotide or such a
gene;
and (iii) a host cell that contains such a vector. In addition, the invention
includes
a method of producing a polypeptide by maintaining the aforementioned host
cell
under conditions such that the polypeptide is expressed, then collecting the
polypeptide.
The term "gene" means the segment of DNA involved in producing a
polypeptide chain; it includes regions preceding and following the coding
region
(leader and trailer) as well as intervening sequences (introns) between
individual
coding segments (exons). It may further include regulatory elements, such as
promoters, enhancers, operators, and repressors, which are useful in
promoting,
regulating, and/or repressing expression of the gene.
The present invention further relates to variants of the herein described
polynucleotides which encode fragments, analogs and derivatives (including
semi-synthetic variants) of the polypeptides of the invention. "Variant," as
the
term is used herein, is a polynucleotide or polypeptide that differs from a
reference polynucleotide or polypeptide, respectively, but retains essential
properties. A typical variant of a polynucleotide differs in nucleotide
sequence
from another, reference polynucleotide. Changes in the nucleotide sequence of
the variant may or may not alter the amino acid sequence of a polypeptide
encoded by the reference polynucleotide. Nucleotide changes may result in
amino
CA 02307128 2000-OS-25
_7-
acid substitutions, additions, deletions, fusions and truncations in the
polypeptide
encoded by the reference sequence, as discussed below. A typical variant of a
polypeptide differs in amino acid sequence from another, reference
polypeptide.
Generally, differences are limited so that the sequences of the reference
polypeptide and the variant are closely similar overall and, in many regions,
identical. A variant and reference polypeptide may differ in amino acid
sequence
by one or more substitutions, additions, deletions in any combination. A
substituted or inserted amino acid residue may or may not be one encoded by
the
genetic code. A variant of a polynucleotide or polypeptide may be naturally
occurring, such as an allelic variant, or it may be a variant that is not
known to
occur naturally. Non-naturally occurring variants of polynucleotides and
polypeptides may be made by mutagenesis techniques or by direct synthesis.
Also included within the invention are antibodies that specifically bind
to the polypeptides of the inventions. Such antibodies can be polyclonal or
monoclonal. For example, antibodies that specifically bind to PT32 can be
raised
by immunizing mammals, e.g., rabbits, with fragments of PT32. For example,
antibodies can be raised against a polypeptide having the amino acid sequence
TSYRVVFVTSHLVNDPMLSFMMPF (SEQ ID N0:6) or
NEALPPAYEAPSAGNT (SEQ ID N0:7). Such antibodies can be used in
immunological assays, e.g., Western blotting, ELISAs, and in situ
immunofluorescent studies.
The aforementioned such antibodies can be formulated with a
pharmaceutically acceptable carrier to produce a pharmaceutical composition
for
use, for example, in immunocontraceptive methods. Other suitable
pharmaceutical compositions may include a pharmaceutically acceptable foam
and at least one of the following molecules: an antibody that specifically
binds
to PT32, an antibody that specifically binds to c-Yes, PT32 or a fragment
thereof,
c-Yes or a fragment thereof, an agonist or antagonist of PT32, and an agonist
or
antagonist of c-Yes. Such compositions can be used to modulate (enhance or
inhibit) oocyte activation in fertility-enhancing or contraceptive methods.
Various methods also are included within the invention. For example,
the invention features a method for inducing or enhancing oocyte activation,
the
CA 02307128 2000-OS-25
_$_
method comprising contacting an oocyte of a mammal (e.g., a human or cow)
with at least one o~ (1) an isolated polypeptide, such as PT32, that includes
(a)
at least one of (i) the sequence PPPGY (SEQ ID NO: 1) and (ii) the sequence
LPPAY (SEQ ID NO: 2) and (b) at least three domains (e.g., 4, S, 6, 7, 8, 9,
10,
11, or 12 or more domains), each domain comprising the sequence YGXPPXG
(SEQ ID N0:3), or a biologically active fragment thereof, or a peptidomimetic
thereof; (2) a c-Yes polypeptide or a biologically active fragment thereof;
and (3)
globozoospermic sperm, which optionally may be stripped. Oocyte activation
can be induced in vitro or in vivo. In a related method, an oocyte is
contacted
with a composition consisting essentially of PT32 and/or c-Yes, or a
biologically
active fragments) thereof.
The invention also includes a method for enhancing fertility in a mammal
by expressing a biologically active polypeptide of the invention in a germ
cell of
the mammal (e.g., human, bovine, pig, sheep, goat, monkey, or horse). More
particularly, the invention includes a method for treating globozoospermy by
expressing in spermatoza an isolated polypeptide that includes (a) at least
one of
(i) the sequence PPPGY (SEQ ID NO: 1) and (ii) the sequence LPPAY (SEQ ID
NO: 2) and (b) at least three domains (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12
or more
domains), each domain comprising the sequence YGXPPXG (SEQ ID N0:3),
Preferably, the polypeptide is a biologically active polypeptide of the
invention.
In a related aspect, the invention features a method for enhancing fertility
and/or activating an oocyte in a mammal by contacting an oocyte with (e.g.,
introducing into the oocyte) tyrosine kinase c-Yes, or a biologically active
fragment thereof. A biologically active tyrosine kinase c-Yes polypeptide or
fragment thereof is capable of phosphorylating a target protein.
Methods for identifying modulators (i.e., enhancers or inhibitors) of
oocyte activation also are included within the invention. In an exemplary
method, a test compound is contacted with an oocyte, and the oocyte is treated
with a biologically active polypeptide of the invention under conditions
sufficient
to induce oocyte activation in the absence of the test compound. Modulation of
oocyte induction then is detected as an indication that the test compound is
an
modulator of oocyte activation.
CA 02307128 2000-OS-25
-9-
A related method for identifying a modulator ofoocyte activation includes
(A) contacting a test compound with (I) a polypeptide, such as PT32, that
includes (a) at least one of (i) the sequence PPPGY (SEQ ID NO: 1) and (ii)
the
sequence LPPAY (SEQ ID NO: 2) and (b) at least three domains, each domain
comprising the sequence YGXPPXG (SEQ ID N0:3), or a tyrosine kinase c-Yes-
binding fragment thereof, and (II) tyrosine kinase c-Yes or a PT32-binding
fragment thereof, under conditions sufficient to permit in the absence of the
test
compound binding of the polypeptide or fragment thereof to tyrosine kinase c-
Yes or the fragment thereof, and (B) detecting modulation (i.e., enhancement
or
inhibition) of binding of the polypeptide or the fragment thereof to the
tyrosine
kinase c-Yes or the fragment thereof as an indication that the test compound
is
an modulator of oocyte activation.
The invention also provides methods for modulating (i.e, enhancing or
inhibiting) fertilization. For example, the invention includes a method for
inhibiting fertilization of a mammalian oocyte by inhibiting the interaction
of
PT32 with tyrosine kinase c-Yes in the oocyte. Such inhibition can include
contacting the oocyte with at least one of (a) an antibody that specifically
binds
to PT32 and (b) an antibody that specifically binds to tyrosine kinase c-Yes.
In an exemplary immunocontraceptive method, a polypeptide that
includes (a) at least one of (i) the sequence PPPGY (SEQ ID NO: 1) and (ii)
the
sequence LPPAY (SEQ ID NO: 2) and (b) at least three domains, each domain
comprising the sequence YGXPPXG (SEQ ID N0:3), or an antigenic fragment
of such a polypeptide, is introduced into a mammal (typically a male), such
that
an immune response is elicited. For example, PT32 can be used in such a
method. The polypeptide, or antigenic fragment thereof, elicits an immune
response in the mammal, and the biological activity of PT32 endogenous to the
mammal is inhibited, thereby inhibiting fertilization.
Optionally, the polypeptide or antigenic fragment thereof is produced as
a fusion protein that includes the polypeptide (or antigenic fragment)
covalently
linked to a second polypeptide. The second polypeptide can be a conventional
carrier protein, which preferably is foreign to the host (e.g., ovalbumin or
keyhole
limpet hemocyanin (KLH)) to facilitate the elicitation of an immune response.
CA 02307128 2000-OS-25
-10-
Such fusion polypeptides (or, alternatively, antigenic, non-fusion
polypeptides
of the invention) can be formulated with a conventional adjuvant to produce a
vaccine for administration to a mammal (e.g., human or bovine) in a
immunocontraceptive method. Alternatively, the second polypeptide of a fusion
polypeptide can be a marker sequence that facilitates detection or
purification of
the polypeptide of the invention. For example, the marker sequence can be a
hexahistidine tag, e.g., supplied by a pQE-9 vector, to provide for
purification of
a recombinant polypeptide from a prokaryotic (bacterial) host cell.
Alternatively,
the marker sequence can be a hemagglutinin (HA) tag (i.e., an epitope of an
influenza hemagglutinin protein) to facilitate purification from a eukaryotic,
e.g.,
mammalian, host cell (e.g., COS-7) cells. In another example, a green
fluorescent protein (GFP) is fused to a polypeptide of the invention to
facilitate
protein detection using fluorescent methods. A variety of other art-known
marker
polypeptides can be fused to the polypeptides of the invention to produce
fusion
proteins.
As an alternative to introducing a polypeptide vaccine into a mammal, a
DNA vaccine can be used to elicit an immune response in the mammal. For
example, a polynucleotide encoding a polypeptide (e.g., PT32) that includes
(a)
at least one of (i) the sequence PPPGY (SEQ ID NO: 1) and (ii) the sequence
LPPAY (SEQ ID NO: 2) and (b) at least three domains, each domain comprising
the sequence YGXPPXG (SEQ ID N0:3), can be administered to the mammal
under conditions that permit expression of the polypeptide in the mammal,
thereby eliciting an immune response against the polypeptide. Preferably, the
polypeptide is not biologically active. Optionally, a DNA vaccine can include
a
polynucleotide encoding a carrier protein fused to the polypeptide.
The invention also includes several diagnostic methods. For example, the
invention includes a method for diagnosing diminished fertility in a mammal by
measuring in a germ cell (spermatoza or oocyte) of the mammal the level of (A)
tyrosine kinase c-Yes and/or (B) a polypeptide (e.g., PT32) that includes (a)
at
least one of (i) the sequence PPPGY (SEQ ID NO: 1 ) and (ii) the sequence
LPPAY (SEQ ID N0:2) and (b) at least three domains, each domain comprising
the sequence YGXPPXG (SEQ ID N0:3). A diminution in the levels of c-Yes
CA 02307128 2000-OS-25
-11-
and/or the polypeptide in the germ cell (e.g., by 10%, 25%, 50% or even more)
indicates that the mammal suffers from (or is at risk for) diminished
fertility.
In a related aspect, the invention provides a method for diagnosing
abnormal spermiogenesis in a mammal. The method includes comparing ( 1 ) the
pattern of the distribution of a polypeptide that includes (a) at least one of
(i) the
sequence PPPGY (SEQ ID NO: 1) and (ii) the sequence LPPAY (SEQ ID NO:
2) and (b) at least three domains, each domain comprising the sequence
YGXPPXG (SEQ ID N0:3) (e.g., PT32), throughout mature spermatoza of the
mammal with (2) the pattern of the distribution of the polypeptide throughout
healthy, mature spermatoza, wherein an abnormal distribution pattern is an
indication that spermiogenesis in the mammal is abnormal. For example, the
failure of PT32 to be localized (i) between the acrosome and the nucleus of
the
spermatoza and/or (ii) on the post-acrosomal portion of the head of the
spermatoza is an indication that spermiogenesis is abnormal in the mammal.
A related method for diagnosing spermiogenesis in a mammal involves
comparing (i) the pattern of the distribution of tyrosine kinase c-Yes
throughout
mature spermatoza of the mammal with (ii) the pattern of the distribution of
tyrosine kinase c-Yes throughout healthy, mature spermatoza, wherein an
abnormal distribution pattern is an indication that spermiogenesis in the
mammal
is abnormal.
The invention also features a transgenic non-human mammal whose germ
cells contain a disruption in the endogenous gene encoding PT32, e.g., by
insertion of a selectable marker sequence at the PT32 locus, and the
disruption
results in the lack of expression or function of PT32. Preferably, the non-
human
mammal is murine or a monkey. Optionally, the animal may be bovine. Such
an animal can be used as an animal model for studying human fertility and
reproductive biology, as sperm produced from such animals can be expected to
be defective (e.g., globozoospermic), and such animals can be expected to have
diminished fertility.
Additionally, such an animal can be used as an animal model for
screening compounds to identify modulators of oocyte activation. For example,
such an method can include contacting an oocyte with (i) sperm produced by the
CA 02307128 2000-08-15
-12-
transgenic non-human mammal, and (ii) a test compound, and detecting an
inhibition or enhancement of oocyte activation as an indicator that the test
compound is a modulator of oocyte activation. If desired, the transgenic non-
human animals of the invention can be used as negative control animals for
comparison to wild-I:ype animals.
Also included within the invention is a transgenic non-human mammal
whose germ cells contain a disruption in the endogenous gene encoding tyrosine
kinase c-Yes, wherein the disruption comprises the insertion of a selectable
marker sequence, and wherein the disruption results in the lack of expression
or
function of the tyrosine kinase c-Yes. Such animals (e.g., mice, monkeys, etc)
can be used as animal models in studies of human fertility and reproductive
biology.
In a related ;aspect, the invention includes a method for identifying a
modulator of oocyte activation, the method comprising contacting an oocyte of
the above-described transgenic non-human mammal having a disrupted c-Yes
gene with (i) a test compound and (ii) spermatoza, and detecting inhibition or
enhancement of ooc;yte activation as an indicator that the test compound is a
modulator of oocyte activation.
These and otlher aspects of the present invention should be apparent to
those skilled in the art from the teachings herein.
~'rief Description of the Figures
Fig. 1 is a li.aing of the amino acid (SEQ ID NO: 5) and nucleic acid
(SEQ ID NO: 4) sequences of an exemplary PT32 polypeptide of the invention.
Fig. 2(A) Diagrammatic representation of a mid-sagittal section through
the head of a bull spermatozoon showing the three parts of the Perinuclear
Theca,
i.e., the subacrosoma~l layer, the postacrosomal sheath and outer
periacrosomal
layer (OPL). Fig. 2B illustrates the polypeptide SDS-PAGE profile of
Perinuclear Theca (PT) extract. All of the major proteins shown have been
immunolocalized to the PT and the identity of most of the proteins shown is
known.
CA 02307128 2000-OS-25
-13-
Fig. 3. Incorporation and dissolution of the sperm perinuclear theca in the
cytoplasm of bovine oocytes at fertilization. Bovine oocytes were fertilized
with
the MitoTracker Green FM-tagged spermatozoa (white; sperm taff mitochondria)
and processed for indirect immunofluorescence with a PT-specific antibody pAb
427 (red), the nuclear pore complex-specific antibody mAb 414 (green), and the
DNA stain DAPI (blue). (A) An unfertilized, metaphase-H-arrested oocyte shows
no labeling with either antibody. (B-D) Removal of the sperm PT (arrows) from
the surface of the sperm nucleus during its incorporation into the oocyte
cytoplasm. Concomitantly with this process, the female chromosomes (~
complete the second meiosis. (E) An early stage male pronucleus with a
continuous ring of nuclear pores marking the presence of a newly-reconstituted
nuclear envelope, and a clump ofPT-derived material in the adjacent cytoplasm
(arrow). Note a small stretch of PT (arrowhead) still attached to the male
pronucleus, and the nascent female pronucleus (~ that is still devoid of
nuclear
pores. (F) Reconstitution of the nuclear envelope, complete with nuclear pore
complexes, on the surface of a developing male pronucleus. This pronucleus
overlaps with a clump of PT-derived material in the cytoplasm (arrow). Female
chromatin having completed second meiosis marked by the presence of the
second polar body (f, bottom) and a small nascent female pronucleus (f, top).
(G-
H) Dissolution of the PT (arrows) in the cytoplasm of fertilized bovine
oocytes.
Similar to their male counterparts, the female pronuclei (f) acquire the
nuclear
envelope and nuclear pore complexes at this stage of pronuclear development.
The PT is not detectable in the zygotes containing large, non-apposed (J-K) or
apposed (LM) male (m) and female (~ pronuclei. Note the abundance of the NPC
containing annulate lamellae (green) in the cytoplasm of these zygotes. (N) A
spontaneous parthenogenote displaying aberrant assembly of NPCs and AL on
its nucleus and in its cytoplasm, respectively. Scale bar = 10 ,um.
Fig. 4. Intracytoplasmic injection of a single intact spermatozoon (A-F),
sperm PT-extracts (G-J), and the calcium-free culture medium (K-M) into bovine
oocytes further cultured for 20 hours and processed for indirect
immunofluorescence with the anti-PT antibody pAb 427 (red), the NPC-specific
antibody mAb 414 (green) and the DNA stain DAPI (blue). (A-C) An intact PT
CA 02307128 2000-OS-25
-14-
(arrows) is seen on the surface of the injected sperm nuclei in the non-
activated
oocytes containing metaphase-II plate of maternal chromosomes (fj. (D) Signs
of the female chromosome (f) decondensation coincided with the dispersal of
sperm PT (arrows) in this oocyte. (E) Progression of oocyte meiosis in an
oocyte
S containing a decondensed sperm nucleus with the remnants of PT (arrows) on
its
surface. (F) A large female pronucleus (f) with regular ring of nuclear pores
in
an oocyte containing single spermatozoon with an intact equatorial segment of
PT (arrow), and a completely dissolved subacrosomal PT. (G, H) Oocytes
activated by the injection of isolated PT-extracts contain one (G) or two (H)
parthenogenetic female pronuclei with a ring of NPCs and the abundant
cytoplasmic annulate lamellae (green dots in cytoplasm). (I) An oocyte that
failed to activate after the PT-extract injection displays no NPCs or annulate
lamellae. (J) An oocyte activated by the injection of boiled PT-extract. (K) A
sham-injected inactivated oocyte. (L, M) Sham-injected oocytes, that developed
female pronuclei with NPCS, lack the cytoplasmic annulate lamellae typical for
the oocytes fertilized by a spermatozoon or activated by the PT-extract. Large
cytoplasmic sheets labeled with mAb 414 are often seen in the cytoplasm of
such
oocytes (M). Scale bar = 10 ~cm.
Fig. 5. Composition of bull PT extracts used in microinjection
experiments. A: SDS-PAGE of bull sperm PT extract showing major PT
polypeptides stained with Coomassie blue (lane 2) and compared to molecular
mass standards (lane 1). Note the predominant bands of 15-, 25-, 28-, 32-, and
60- kDa. B: Preparative western blot strips of electrophoresis-separated PT
extract reacted with three immunization boosts of PT-specific antibody pAb
427,
Immune serum from the first boost (lane 3) stains predominantly PT 15 and PT
28, second boost (lane 4) displays high affinity to PT 32 and third boost
(lane 5)
stains strongly, amongst other bands, PT 36. Lane I shows the molecular mass
standards and lane 2 Coomassie blue-staining of the transferred PT extracts.
Fig. 6. Ultrastructural aspects of sperm PT-oocyte interactions during in
vitro fertilization in bovine. A: Sperm oolemma binding demonstrated on a
cross-section of the acrosomal part of an acrosome-reacted bull sperm head.
Several oocyte microvilli (arrows) are bound to the subacrosomal layer of PT
CA 02307128 2000-OS-25
-1$-
(arrowheads). Continuous inner acrosomal plasma membrane is not discernible
in this micrograph. B: Detail of a sperm head shown in Fig. A. The lateral
edge
of the sperm nucleus appears to be engulfed by two oocyte microvilli (arrows),
thus creating a closed space in which the subacrosomal PT (full arrowheads)
may
$ mingle with oocyte cytoplasm. Note the remnants of inner acrosomal membrane
(empty arrowheads) on the lateral face of this sperm head. C: Removal of the
sperm PT during sperm incorporation into oocyte cytoplasm. Note the distinct
layers of PT (arrows) peeling off the equatorial segment of this sperm
nucleus,
and the oocyte microvilli (arrowheads) bound to the innermost PT layer. The
outer PT layers have a fuzzy appearance, likely reflecting their progressive
dissolution in the cytoplasm. D: Sperm incorporation block caused by the
oocyte's anti-polyspermy defense. The acrosomal region and the equatorial
segment of this spermatozoon are engulfed by oocyte cytoplasm, whereas a part
ofthe postacrosomal sheath and the axoneme emanate into the perivitelline
space.
Note the intact PT (arrows) on the non-incorporated part of the nucleus, which
contrasts with the absence of PT, decondensation of the sperm chromatin, and
formation of the new nuclear envelope (arrowheads) around the incorporated
part
of the nucleus. E: Detail of Fig. D., showing the persistence of PT on the
unincorporated portion of the post-acrosomal sheath (bars). F: Detail of Fig.
D,
showing the new nuclear envelope (arrows) and the decondensing sperm
chromatin in the incorporated portion of this sperm nucleus. (G-I) Binding of
the
oocyte microvilli (arrows) to the perinuclear theca (arrowheads) of the
lysolecithin-demembranated spermatozoa. Note the unusually high number of
oocyte microvilli bound to these sperm heads, as compared to the spermatozoa
with intact plasma membrane in Figs. A, B. Insert (H) shows multiple
demembranated spermatozoa bound to a single, zona-free oocyte, as visualized
by DAPI labeling. Scale bars: A=$00 nm, B=200 nm.
Fig. 7. Schematic interpretation of the release of PT-anchored oscillogens
into oocyte cytoplasm at fertilization. A: Acrosome reaction causes that the
inner
acrosomal membrane, equatorial segment and the postacrosomal sheath of the
sperm head become accessible to the oocyte rnicrovilli once the spermatozoon
reaches the perivitelline space. B: Oocyte microvilli fuse with the sperm
plasma
CA 02307128 2000-08-15
-16-
membrane at equatorial segment and in the subacrosomal part of PT, effectively
exposing the perinuclear theca to oocyte cytoplasm. C: During normal
fertilization, the ooc;~te microvilli drag the perinuclear theca and sperm
nucleus
into the cytoplasm, and the PT starts to detach from the nuclear surface and
slowly dissolves in t:he cytoplasm (see also Fig. 3C). Cytoplasmic factors
such
as glutathione (Perre.ault, S. D., et al., Dev. Biol. 101:160-167 (1984);
Sutovsky,
P., and Schatten, G.., Biol. Reprod. 56:1503-1512 (1997)) may facilitate the
dissolution and dispersion of sperm PT. D: Sperm-incorporation arrest induced
by polyspermy block or by microfilament disruption nevertheless results in
oocyte activation, as the oocyte microvilli retain their ability to fuse with
the
sperm plasma membrane, effectively exposing the sperm PT to oocyte cytoplasm
(see also Fig. 3D-F). PT from those parts of the sperm head engulfed by the
oocyte is then released into oocyte cytoplasm, thus explaining the ability of
bull
spermatozoa to activate the oocytes in the absence of complete sperm
incorporation after c.~tochalasin B-treatment (Sutovsky, P., et al., Biol.
Reprod.
55:1195-1205 (1996b)). ES=equatorial segment, IAM=inner acrosomal
membrane, NE=nuclear envelope, OAM=outer acrosomal membrane,
PM=plasmamembra~ne, PS=postacrosomal sheath, SL=subacrosomal layerofPT.
Adapted with publisher's permission from Yanagimachi,1994, after Bedford and
Cooper, 1978.
Figs. 8 A and B illustrate the effects of injection of PT32, perinuclear
theca extracts, and bovine serum albumin into oocytes.
Figs. 9 A-H :illustrate that PT32 and perinuclear theca extracts induce
clustering of c-Yes in oocytes.
Figs. 10 A-F illustrate the pattern of expression of c-Yes and PT32 in
sperm and spermatids of bull.
Fig. 11 is a listing of the amino acid sequence of an exemplary c-Yes
protein (SEQ ID NO: 8). The sequence of this protein also can be found in the
SWISSPROT database under accession number P09324.
CA 02307128 2000-OS-25
-17-
Detailed Description of the Preferred Embodiments
"Identity" is a measure of the identity of nucleotide sequences or amino
acid sequences. In general, the sequences are aligned so that the highest
order
match is obtained. "Identity" per se has an art-recognized meaning and can be
calculated using published techniques. See, e.g.: (COMPUTATIONAL
MOLECULAR BIOLOGY, Lesk, A.M., ed., Oxford University Press, New
York,1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS,
Smith, D. W., ed., Academic Press, New York,1993; COMPUTER ANALYSIS
OF SEQUENCE DATA, PART I, Griffin, A.M., and Griffin, H.G., eds., Humana
Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR
BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE
ANALYSIS PRIMER, Gribskov, M. and Devereaux, J., eds., M Stockton Press,
New York, 1991 ). While there exist a number of methods to measure identity
between two polynucleotide or polypeptide sequences, the term "identity" is
well
known to skilled artisans (Carillo, H., and Lipton, D., SIAM J Applied Math
(1988) 48:1073). Methods commonly employed to determine identity or
similarity between two sequences include, but are not limited to, those
disclosed
in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego,
1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073.
Methods to determine identity and similarity are provided by computer
programs.
Preferred computer program methods to determine identity and similarity
between two sequences include, but are not limited to, GCS program package
(Devereux, J., et al., Nucleic Acids Research (1984) 12(1):387), BLASTP,
BLASTN, FASTA (Altschul, S.F. et al., J. Molec. Biol. (1990) 215:403).
As an illustration, by a polynucleotide having a nucleotide sequence
having at least, for example, 95% "identity" to a reference nucleotide
sequence,
is intended that the nucleotide sequence of the polynucleotide is identical to
the
reference sequence except that the polynucleotide sequence may include up to
five point mutations per each 100 nucleotides of the reference nucleotide
sequence. In other words, to obtain a polynucleotide having a nucleotide
sequence at least 95% identical to a reference nucleotide sequence, up to 5%
of
CA 02307128 2000-OS-25
-18-
the nucleotides in the reference sequence may be deleted or substituted with
another nucleotide, or a number of nucleotides up to 5% of the total
nucleotides
in the reference sequence may be inserted into the reference sequence. These
mutations of the reference sequence may occur at the 5' or 3' terminal
positions
of the reference nucleotide sequence or anywhere between those terminal
positions, interspersed either individually among nucleotides in the reference
sequence or m one or more contiguous groups within the reference sequence.
Similarly, by a polypeptide having an amino acid sequence having at
least, for example, 95% "identity" to a reference amino acid sequence, is
intended
that the amino acid sequence of the polypeptide is identical to the reference
sequence except that the polypeptide sequence may include up to five amino
acid
alterations per each 100 amino acids of the reference amino acid. In other
words,
to obtain a polypeptide having an amino acid sequence at least 95% identical
to
a reference amino acid sequence, up to 5% of the amino acid residues in the
reference sequence may be deleted or substituted with another amino acid, or a
number of amino acids up to 5% of the total amino acid residues in the
reference
sequence may be inserted into the reference sequence. These alterations of the
reference sequence may occur at the amino or carboxyl terminal positions of
the
reference amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference sequence or
in
one or more contiguous groups within the reference sequence.
The present invention further relates to polynucleotides which hybridize
to PT32 as set forth in SEQ ID N0:4 if there is at least 75%, preferably at
least
90%, and more preferably at least 95% identity between the sequences. The
present invention particularly relates to polynucleotides which hybridize
under
stringent conditions to PT32 as set forth in SEQ ID N0:4. As herein used, the
term "stringent conditions" means hybridization will occur only if there is at
least
95% and preferably at least 97% identity between the sequences. Exemplary
stringent conditions include hybridization in 6X sodium chloride/sodium
citrate
(SSC) at about 45 °C, followed by one or more washes in 0.2 X SSC, 0.1
% SDS
at 50-65°C. The polynucleotides which hybridize to the polynucleotides
described herein (e.g., to SEQ ID N0:4), in a preferred embodiment, encode
CA 02307128 2000-OS-25
-19-
polypeptides which retain substantially the same function as the PT32
polypeptides of the invention (e.g., binding to c-Yes and/or activation of
oocyte
induction).
Alternatively, the polynucleotide may have at least 20 bases, preferably
30 bases, and more preferably at least 50 bases which hybridize to a PT32
polynucleotide under stringent conditions, as set forth in SEQ ID N0:4, and
which has an identity thereto, as herein described, and which may or may not
retain activity. For example, such polynucleotides may be employed as probes
for
the polynucleotides described herein, for example, for recovery of the
polynucleotide or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least
75% identity, e.g., at least 90% identity, and preferably at least a 95%
identity,
to a polynucleotide which encodes PT32, e.g., the polypeptide of SEQ ID NO:
S (which can be encoded by the polynucleotide of SEQ ID N0:4), as well as
fragments thereof, which fragments have at least 20 bases, and preferably at
least
30 or SO bases, and to polypeptides encoded by such polynucleotides.
The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are genetically
engineered with vectors of the invention, and the production of polypeptides
of
the invention by recombinant techniques. Cell-free translation systems can
also
be employed to produce such proteins using RNAs derived from the DNA
constructs of the present invention.
Host cells are genetically engineered (e.g., transduced, transformed, or
transfected) with the vectors of this invention which may be, for example, a
cloning vector or an expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The engineered host cells
can be
cultured in conventional nutrient media modified as appropriate for activating
promoters, selecting transformants, or amplifying the genes of the present
invention. The culture conditions, such as temperature, pH and the like, are
those
previously used with the host cell selected for expression, and will be
apparent
to the ordinarily skilled artisan.
CA 02307128 2000-OS-25
-20-
The polynucleotides of the present invention may be employed for
producing polypeptides by recombinant techniques. Thus, for example, the
polynucleotide may be included in any one of a variety of expression vectors
for
expressing a polypeptide. Such vectors include chromosomal, non-chromosomal
and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids;
phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and pseudorabies. However, any other vector may be used as long as it
is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a
variety of procedures. In general, the DNA sequence is inserted into an
appropriate restriction endonuclease sites) by procedures known in the art.
Such
procedures and others are deemed to be within the scope of those skilled in
the
art, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY
MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1989)(the disclosure of which is hereby incorporated by reference).
The DNA sequence in the expression vector is operatively linked to an
appropriate expression control sequences) (promoter) to direct mRNA synthesis.
As representative examples of such promoters, there may be mentioned: an LTR
or S V40 promoter, the E. coli lac or trp promoters, the phage lambda PL
promoter
and other promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also contains a
ribosome
binding site for translation initiation and a transcription terminator. The
vector
may also include appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more
selectable marker genes to provide a phenotypic trait for selection of
transformed
host cells such as dihydrofolate reductase or neomycin resistance for
eukaryotic
cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as described herein,
as well as an appropriate promoter or control sequence(s), may be employed to
transform an appropriate host to permit the host to express the protein.
Introduction of polynucleotides into host cells can be effected by methods
CA 02307128 2000-OS-25
-21-
described in many standard laboratory manuals, such as Davis et al., BASIC
METHODS IN MOLECULAR BIOLOGY ( 1986) and Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) such as
calcium phosphate transfection, DEAF-dextran mediated transfection,
transvection, microinjection, cationic lipid-mediated transfection,
electroporation,
transduction, scrape loading, ballistic introduction, or infection.
Examples of appropriate hosts include, without limitation, bacterial cells,
such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus
subtilis;
fungal cells, such as yeast cells and Aspergillus cells; insect cells such as
Drosophila S2 and Spodoptera Sf~ or Sf21 cells; and animal cells such as CHO,
COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells. Animal
cells, particularly human or bovine cells, are preferred. Such host cells can
be
somatic cells or germ cells; artisans of ordinary skill can readily select a
cell type
suitable to artisan's purpose.
A variety of expression systems can be used to produce the polypeptides
of the invention. Such systems include, inter alia, chromosomal, episomal and
virus-derived systems, e.g., vectors derived from bacterial plasmids, from
bacteriophage, from transposons, from yeast episomes, from insertion elements,
from yeast chromosomal elements, from viruses such as baculoviruses, papova
viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors derived from combinations
thereof, such as those derived from plasmid and bacteriophage genetic
elements,
such as cosmids and phagemids. The expression systems may contain control
regions that regulate as well as engender expression. Generally, any system or
vector suitable to maintain, propagate or express polynucleotides to produce a
polypeptide in a host may be used. The appropriate nucleotide sequence may be
inserted into an expression system by any of a variety of well-known and
routine
techniques, such as, for example, those set forth in Sambrook et al.,
MOLECULAR CLONING, A LABORATORY MANUAL (supra).
More particularly, the present invention also includes recombinant
constructs comprising one or more of the sequences as broadly described above.
CA 02307128 2000-OS-25
-22-
The constructs include a vector, such as a plasmid or viral vector, into which
a
polynucleotide sequence of the invention has been inserted, in a forward or
reverse orientation. In a preferred aspect of this embodiment, the construct
also
includes regulatory sequences, e.g., a promoter operably linked to the
polynucleotide sequence of the invention. Suitable vectors and promoters are
known to those of skill in the art, and are commercially available. The
following
vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9
(Qiagen), pBS, pDlO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A,
pNHl6a, pNHl8A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3,
pDR540, pRITS (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTI,
pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with selectable
markers.
Two appropriate vectors are PKK232-8 and PCM7. Exemplary bacterial
promoters include lack lacZ, T3, T7, gpt, lambda PR, PL and trp. Exemplary
eukaryotic promoters include CMV immediate early, HSV thymidine kinase,
early and late SV40, LTRs from retroviruses, and mouse metallothionein-I
promoters. Selection of the appropriate vector and promoter is well within the
level of ordinary skill in the art.
For secretion of the translated protein into the lumen of the endoplasmic
reticulum, into the periplasmic space or into the extracellular environment,
appropriate secretion signals may be incorporated into the desired
polypeptide.
These signal sequences may be heterologous to the polypeptides ofthe
invention.
In a further embodiment, the present invention relates to host cells
containing the above-described constructs. The host cell can be a higher
eukaryotic cell, such as a mammalian cell (e.g., a germ cell or a somatic
cell), or
a lower eukaryotic cell, such as a yeast cell, or the host cell can be a
prokaryotic
cell, such as a bacterial cell. Introduction of the construct into the host
cell can be
effected any of a variety of art-known methods, such as microinjection,
calcium
phosphate transfection, DEAE-Dextran mediated transfection, or electroporation
(Davis, L., Dibner, M., Battey, L, Basic Methods in Molecular Biology,
(1986)).
The constructs in host cells can be used in a conventional manner to
CA 02307128 2000-OS-25
-23-
produce the gene product encoded by the recombinant sequence. Alternatively,
the polypeptides of the invention can be synthetically produced by
conventional
peptide synthesizers.
As used herein, the term "polypeptide" refers to any peptide or protein
comprising two or more amino acids joined to each other by peptide bonds or
modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both
short
chains, commonly referred to as peptides, oligopeptides or oligomers, and to
longer chains, generally referred to as proteins. Polypeptides may contain
amino
acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino
acid sequences modified either by natural processes, such as posttranslational
processing, or by chemical modification techniques which are well known in the
art. Such modifications are well described in basic texts and in more detailed
monographs, as well as in a voluminous research literature. Modifications can
occur anywhere in a polypeptide, including the peptide backbone, the amino
acid
side-chains and the amino or carboxyl termini. It will be appreciated that the
same type of modification may be present in the same or varying degrees at
several sites in a given polypeptide. Also, a given polypeptide may contain
many
types of modifications. Polypeptides may be branched as a result of
ubiquitination, and they may be cyclic, with or without branching. Cyclic,
branched and branched cyclic polypeptides may result from posttranslational
natural processes or may be made by synthetic methods. Modifications include
acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of
flavin, covalent attachment of a heme moiety, covalent attachment of a
nucleotide
or nucleotide derivative, covalent attachment of a lipid or lipid derivative,
covalent attachment ofphosphotidylinositol, cross-linking, cyclization,
disulfide
bond formation, demethylation, formation of covalent crosslinks, formation of
cystine, formation of pyroglutamate, formylation, gamma-carboxylation,
glycosylation, GPI anchor formation, hydroxylation, iodination, methylation,
myristoylation, oxidation, proteolytic processing, phosphorylation,
prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated addition of
amino
acids to proteins such as arginylation, and ubiquitination. See, for instance,
PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.
CA 02307128 2000-OS-25
-24-
E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F.,
Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12
in
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B.
C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al., "Analysis for
protein modifications and non-protein cofactors," Meth Enzymol ( 1990) 182:626-
646 and Rattan et al., "Protein Synthesis: Posttranslational Modifications and
Aging", Ann NYAcad Sci (1992) 663:48-62.
The terms "fragment," "derivative," and "analog" when refernng to the
polypeptides of the invention mean a polypeptide which either retains
substantially the same function as a reference polypeptide, e.g., retains the
ability
to bind to c-Yes or PT32, or which retains a biological activity of the
reference
polypeptide, e.g., retains the ability to induce oocyte activation.
The polypeptide of the present invention may be a recombinant
polypeptide, a natural polypeptide, a synthetic polypeptide, or a semi-
synthetic
polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of the invention
may be, without limitation, (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, (ii) one in which
one
or more of the amino acid residues includes a substituent group, (iii) one in
which
the polypeptide is fused with another compound, such as a compound to increase
the half life of the polypeptide (for example, polyethylene glycol), (iv) one
in
which additional amino acids are fused to the polypeptide, e.g., employed for
purification of the polypeptide, (v) one which contains a proprotein sequence,
or
(vi) one in which a signal sequence is fused to the polypeptide. Such
fragments,
derivatives, and analogs are deemed to be within the scope of those skilled in
the
art from the teachings herein.
The polypeptides of the present invention include the sequence set forth
herein as SEQ ID NO: 5, as illustrated in Fig.l, as well as polypeptides that
have
at least 75% similarity (preferably at least 75% identity), preferably at
least 90%
similarity (more preferably at least 90% identity), to such polypeptides, and
still
CA 02307128 2000-OS-25
-25-
more preferably at least 95% similarity (still more preferably at least 95%
identity) to such polypeptides. As known in the art, "similarity" between two
polypeptides is determined by comparing the amino acid sequence and its
conserved amino acid substitutes of one polypeptide to the sequence of a
second
polypeptide.
Also included are portions of such polypeptides, including antigenic
portions of the polypeptide, which generally contain at least 8 amino acids
and
more preferably at least 10 amino acids. Biologically active portions of such
polypeptides are included, which generally contain at least 5 domains
(preferably
6, 7, 8, 9, 10, 11, 12, or more domains) that include the amino acid sequence
YGXPPXG (SEQ ID N0:3). Preferably, such portions also contain the amino
acid sequence PPPGY (SEQ ID NO:1 ). Such portions of the polypeptide also are
expected to be c-Yes binding portions. If desired, the biological activity of
a
given polypeptide can be measured by measuring the ability of the polypeptide
to activate oocyte induction, e.g., using method described herein. The ability
of
a particular polypeptide to bind to c-Yes can be measured, if desired, in a
conventional assay of protein-protein interactions, e.g., in a co-
immunoprecipitation assay, in a two-hybrid assay, or in an in situ immunoassay
(e.g., as described herein).
Fragments or portions of the polypeptides of the present invention may
be employed for producing the corresponding full-length polypeptide by peptide
synthesis; therefore, the fragments may be employed as intermediates for
producing the full-length polypeptides. Similarly, fragments or portions of
the
polynucleotides of the present invention may be used to synthesize full-length
polynucleotides ofthe present invention. Preferred fragments ofthe
polypeptides
of the present invention or fragments of the nucleotide sequence coding
therefor,
include, for example, truncation polypeptides having the amino acid sequence
of
a PT32 polypeptide, except for deletion of a continuous series of residues
that
includes the amino terminus, or a continuous series of residues that includes
the
carboxyl terminus, or deletion of two continuous series of residues, one
including
the amino terminus and one including the carboxyl terminus. Also preferred are
fragments characterized by structural or functional attributes, such as
fragments
CA 02307128 2000-OS-25
-26-
that comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-
sheet-forming regions, turn and turn-forming regions, coil and coil-forming
regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions,
beta amphipathic regions, flexible regions, surface-forming regions, substrate
binding region, and high antigenic index regions. Other preferred fragments
are
antigenic fragments, biologically active fragments (including those with a
similar
activity, or an improved activity, or with a decreased undesirable activity),
fragments that are immunogenic in an animal (especially in a human or bull),
and
fragments that bind to tyrosine kinase c-Yes. A given fragment may have more
than one of the aforementioned properties. For example, a given fragment may
be both biologically active and antigenic.
The polypeptides of the invention can be expressed in mammalian cells,
yeast, bacteria, or other cells under the control of appropriate promoters.
Cell-free
translation systems can also be employed to produce such proteins using RNAs
derived from the DNA constructs of the present invention. Appropriate cloning
and expression vectors for use with prokaryotic and eukaryotic hosts are
described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989).
Transcription of the DNA encoding the polypeptides of the present
invention by higher eukaryotes is increased by inserting an enhancer sequence
into the vector. Enhancers are cis-acting elements of DNA, usually about from
10 to 300 by that act on a promoter to increase its transcription. Examples
including the SV40 enhancer on the late side of the replication origin by 100
to
270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the
late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of
replication and selectable markers permitting transformation ofthe host cell,
e.g.,
the ampicillin resistance gene of E. coli or the S. cerevisiae TRP1 gene, and
a
promoter derived from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from operons
encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor,
acid phosphatase, or heat shock proteins, among others. The heterologous
CA 02307128 2000-OS-25
-27-
structural sequence is assembled in an appropriate phase with translation
initiation and termination sequences, and, preferably, a leader sequence
capable
of directing secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can encode a
fusion
protein, such as a protein that includes an identification peptide (e.g., a
hexahistidine tag) imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a
DNA sequence encoding a desired protein together with suitable translation
initiation and termination signals in operable reading phase with a functional
promoter. The vector will comprise one or more phenotypic selectable markers
and an origin of replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable prokaryotic hosts
for
transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and
various species within the genera Pseudomonas, Streptomyces, and
Staphylococcus, although others may also be employed as a matter of choice.
As a representative but non-limiting example, useful expression vectors
for bacterial use can comprise a selectable marker and bacterial origin of
replication derived from commercially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC 37017). Such
commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotech, Madison, Wis., USA). These
pBR322 "backbone" sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and growth of the host
strain to an appropriate cell density, the selected promoter is induced by
appropriate means (e.g., temperature shift or chemical induction) and cells
are
cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or
chemical means, and the resulting crude extract retained for further
purification.
Microbial cells employed in expression of proteins can be disrupted by any
convenient method, including freeze-thaw cycling, sonication, mechanical
CA 02307128 2000-OS-25
-28-
disruption, or use of cell lysing agents, such methods are well know to those
skilled in the art. If desired, the polypeptides of the invention may be
solubilized
from plasma membranes in digitonin using conventional techniques.
Various mammalian cell culture systems can also be employed to express
recombinant protein. Examples of mammalian expression systems include the
COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175
(1981), and other cell lines capable of expressing a compatible vector, for
example, the C 127, 3T3, CHO, HeLa, HEK and BHK cell lines. Mammalian
expression vectors may comprise an origin of replication, a suitable promoter
and
enhancer, and also any necessary ribosome binding sites, polyadenylation site,
splice donor and acceptor sites, transcriptional termination sequences, and 5'
flanking non-transcribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the required non-
transcribed genetic elements.
The polypeptides of the invention can be recovered and purified from
recombinant cell cultures by methods such as those including ammonium sulfate
or ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite chromatography,
metal affinity chromatography (e.g., Ni-NTA), and lectin chromatography.
Optionally, high performance liquid chromatography (HPLC) can be employed
in the purification steps. Protein refolding steps can be used, as necessary,
in
completing configuration of the polypeptide.
The present invention also relates to the use of the polynucleotides
described herein (e.g., a polynucleotide encoding PT32) for use as diagnostic
reagents. For example, detection of a mutated form of PT32 provides a
diagnostic tool that can add to, or define, a diagnosis of a disease or
susceptibility
to a disease which results from under-expression, over-expression or altered
expression of PT32. For example, mutations in the PT32 gene can result in
alterations in the shape or spermatoza and/or cause (or contribute to)
diminished
fertility in a mammal. Mutations in the PT32 gene may be detected at the DNA
level by a variety of conventional techniques.
CA 02307128 2000-OS-25
-29-
Nucleic acids for diagnosis may be obtained from a subject's cells or
bodily fluids, such as from spermatoza, blood, urine, saliva, tissue biopsy,
or
autopsy material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR or other amplification techniques
prior
to analysis. RNA or cDNA may also be used in similar fashion. Deletions and
insertions can be detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be identified by
hybridizing amplified DNA to labeled PT32 nucleotide sequences or fragments
thereof. Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase digestion or by differences in melting temperatures. DNA
sequence differences may also be detected by alterations in electrophoretic
mobility of DNA fragments in gels, with or without denaturing agents, or by
direct DNA sequencing. See, e.g., Myers et al., Science (1985) 230:1242.
Sequence changes at specific locations may also be revealed by nuclease
protection assays, such as RNase and S 1 protection or the chemical cleavage
method. See Cotton et al., Proc Natl Acad Sci USA (1985) 85: 4397-4401. In
another embodiment, an array of oligonucleotide probes comprising PT32
nucleotide sequences or fragments thereofcan be constructed to conduct
efficient
screening of, e.g., genetic mutations. Array technology methods are well known
and have general applicability and can be used to address a variety of
questions
in molecular genetics including gene expression, genetic linkage, and genetic
variability. (See for example M. Chee et al., Science 274:610-613 (1996)).
The invention also provides a method for assessing the quality of
spermatoza. The method involves measuring the level of PT32 expression in the
sperm of a mammal (e.g., a human or cattle), and comparing the level of PT32
expression with the level of PT32 expression found in normal mammals of the
same species. A depreciation in the level of PT32 expression in the mammal
(e.g., a 15%, 25% 50% depreciation or more) indicates that the mammal's sperm
are of diminished quality. Mammals having diminished levels of PT32
expression are impaired in their ability to induce oocyte activation. Thus,
the
invention provides a method for determining whether a mammal has an impaired
CA 02307128 2000-OS-25
-30-
ability to induce oocyte activation. Such impairment may result in infertility
of
the mammal.
Biologically active polypeptides of the invention (e.g., PT32 and/ore c
Yes) can be used in various assisted reproductive techniques (ART), including,
but not limited to, intracytoplasmic sperm injection (ICSI) of impaired sperm
(e.g., globozoospermic sperm) or of immature sperm; round spermatid injection
(ROSI); and nuclear transfer (i.e., cloning) methods using somatic, embryonic,
or germ cells. Such methods are well known in the art, as described, for
examples in U.S. Patent Nos. 6,050,935; 5,935,800; 5,908,380; 5,897,988;
5,882,928; 5,770,363; 5,691,194; 5,627,066; 6,066,725; 6,013,857; 6,011,197;
5,994,619; 5,952,222; 5,945,577; 5,942,435; 5,907,080; 5,863,528; 5,858,963;
5,849,991; 5,843,754; 5,817,453; and 5,741,957, and Eyestone and Campbell, J.
Reprod. Fert. Supp. 54:489-497 ( 1999), each of which is incorporated herein
by
reference. See also Shiga et al. Theriogenology 52(3):527-35 (1999); Nour et
al., Theriogenology Feb;51(3):661-6 (1999); Booth et al. Theriogenology
51(5):999-1006 (1999); Trounson et al. Reprod Fertil Dev. 10(7-8):645-50
(1998); Karnikova et al. Reprod Nutr Dev. 38(6):665-70 (1998); Wolf et al.
Biol
Reprod. Feb;60(2):199-204 (1999); Wolf et al., JBiotechnol.65(2-3):99-110
(1998); Peura et al., Mol Reprod Dev. 50(2):185-91 (1998); Zakhartchenko et
al.
Mol Reprod Dev. 1997 Nov;48(3):332-8.; Wells et al., Biol Reprod. 1997
Aug;57(2):385-93; Taniguchi et al. J Vet Med Sci. 1996 Ju1;58(7):635-40;
Ouhibi et al. Reprod Nutr Dev. 1996;36(6):661-6; Prochazka and Fiser Reprod
Nutr Dev. 1995;35(6):695-701;Yang et al. Mol Reprod Dev. 1993
May;35(1):29-36; First and Prather, J Reprod Fertil Suppl. 1991;43:245-54; and
Czolowska et al. J Cell Sci. 1986 Aug;84:129-38, each of which is incorporated
herein by reference..
The use of recombinant proteins, such as recombinant PT32 and/or
recombinant c-Yes, in ART offers advantages not provided by conventional
methods for artificial activation of oocytes. Oocyte activation with crude
sperm
extracts may introduce into the oocyte sperm components that normally are
removed before the sperm enters the egg, and which may be detrimental to
embryonic development (e.g., the acrosome). In addition, sperm can carry
CA 02307128 2000-OS-25
-31-
viruses such as HIV and SIV, which may be propagated by using crude sperm
extracts. Furthermore, ethical concerns are raised by the use of sperm
extracts
from male donors (i.e., "cytoplasmic fathers") in carrying out ICSI or ROSI.
Such concerns can be avoided by using a recombinant protein, e.g., PT32 and/or
c-Yes, to activate an oocyte.
The PT32 and c-Yes proteins also are useful in the field of contraception.
Specifically, the PT32 and/or c-Yes protein can be used as targets in
conventional
immunocontraception methods. A variety of such methods have been described,
and can readily be modified for use with the PT32 and c-Yes polypeptides
described herein. Examples of conventional immunocontraceptive methods are
disclosed in U.S. Patent Nos. 6,045,799; 6,027,737; 6,013,770; 5,989,550;
5,989,549; 5,916,768; 5,753,231; and 5,672,488, each of which is incorporated
herein by reference. Generally, an immunocontraceptively effective dose of the
PT32 or c-Yes protein (or an antigenic fragment thereof) is administered to
the
mammal (e.g., human) to be treated. Preferably, a chimeric protein containing
all or an antigenic portion of PT32 or c-Yes is administered to the mammal in
a
contraceptively effective dosage. The chimeric protein includes a Garner
protein
or fragment thereof, such as ovalbumin or KLH. The proteins) of the present
invention may be administered with a suitable diluent, adjuvant, carrier or in
a
depot (slow release) formulation to allow prolonged exposure of the protein to
the host mammal's immune system. A contraceptively effective dosage is a
dosage sufficient to elicit the production of an immune response (e.g.,
antibody
or immune cell production) in the mammal.
The polypeptides of the invention, e.g., PT32, can also be used to identify
test compounds (e.g., agonists and antagonists, such as small molecules and
polypeptides) that bind to the polypeptides of the invention, or to measure
the
ability of test compounds to bind to the polypeptides. Such assays can be
carned
out, for example, in cells or in cell-free preparations. The test compound can
be
a natural, synthetic, or semi-synthetic substance, e.g., a structural or
functional
mimetic. See Coligan et al., Current Protocols in Immunology 1 (2): Chapter 5
( 1991 ). In a preferred embodiment, the invention includes a method for
identifying test compounds that are agonists or antagonists (i.e., that
promote or
CA 02307128 2000-OS-25
-32-
inhibit) the binding of PT32 to c-Yes. Such test compounds can be identified
with conventional methods. For example, conventional two-hybrid methods for
identifying compounds that affect protein-protein interactions are well known
in
the art and can be used in the invention, as described, for example, in U.S.
Patent
Nos. 5,965,368; 5,955,280; and 6,004,746, each of which is incorporated herein
by reference.
An exemplary potential antagonist is an antisense construct prepared
through the use of antisense technology. Antisense technology can be used to
control gene expression through triple-helix formation or antisense DNA or
RNA,
both of which methods are based on binding of a polynucleotide to DNA or
RNA. For example, the 5' coding portion of the polynucleotide sequence, which
encodes the polypeptides of the present invention, is used to design an
antisense
RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved
in transcription (triple helix - see Lee et al., Nucl. Acids Res. 6:3073
(1979);
Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1360
(1991)), thereby preventing transcription and the production of the targeted
polypeptide (e.g., PT32). The antisense RNA oligonucleotide hybridizes to the
mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide
(antisense --Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as
Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
The oligonucleotides described above can also be delivered to cells such that
the
antisense RNA or DNA may be expressed in vivo to inhibit production of a
polypeptide of the invention.
The polypeptides, antibodies, or test compounds (e.g., antagonists or
agonists) of the invention may be employed in combination with a suitable
pharmaceutical carrier or device. Such compositions comprise a therapeutically
effective amount of the polypeptide or test compound, and a pharmaceutically
acceptable carrier or excipient. Examples of such carriers and excipients
include,
but are not limited to, saline, buffered saline, dextrose, water, glycerol,
ethanol,
and combinations thereof. Optionally, the polypeptide, antibodies, or test
compounds can be formulated with a Garner and/or device conventionally used
CA 02307128 2000-OS-25
-33-
for delivering contraceptive or fertility-enhancing agents. For example,
conventional foams, gels, sponges, suppositories, creams, tablets, controlled
delivery devices, vaginal-soluble waffles, ointments, lotions, sprays,
jellies,
patches, and lubricants (e.g., for condoms, diaphragms, cervical caps), and
the
like can be used in conjunction with the molecules of the invention. Suitable
. carriers and devices that can be modified to contain the molecules of the
invention are well known in the art. Without limitation, examples are
described
in U.S. Patent Nos. 5,725,870; 5,527,534; 4,795,761; 6,063,395; and 6,056,966,
all of which are incorporated by reference herein. Such foams, creams, and the
like can be administered, e.g., intravaginally, to a mammal to provide a
contraceptive (e.g., a contraceptive barrier) in a contraceptive method (e.g.,
to
inhibit fertilization), or to provide a fertility-enhancing agent in a method
for
enhancing fertility. As desired, the formulation can be optimized to suit the
mode
of administration. Polypeptides and other molecules of the present invention
may
be employed alone or in conjunction with other compounds, such as therapeutic
or contraceptive compounds.
The invention also provides a pharmaceutical pack or kit comprising one
or more containers filled with one or more of the ingredients of the
pharmaceutical compositions of the invention. Associated with such containers)
can be a notice in the form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products, which
notice
reflects approval by the agency of manufacture, use or sale for human
administration. In addition, the compounds of the present invention may be
employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient
manner such as by topical, intravenous, intraperitoneal, intramuscular,
subcutaneous, intranasal or intradermal routes. The pharmaceutical
compositions
are administered in an amount which is effective for treating and/or
prophylaxis
ofthe specific indication. In general, the various pharmaceutical agents
described
herein will be administered in an amount of at least about 10 ug/kg body
weight
and in most cases they will be administered in an amount not in excess of
about
8 mg/Kg body weight per day. In most cases, the dosage is from about 10 pg/kg
CA 02307128 2000-OS-25
-34-
to about 1 mg/kg body weight daily, taking into account the routes of
administration, symptoms, etc.
The polypeptides of the invention, and antagonists or agonists that are
polypeptides, may be employed in accordance with the present invention by
expression of such polypeptides in vivo, which is often referred to as "gene
therapy." For an overview of gene therapy, see Chapter 20, "Gene Therapy and
Other Molecular Genetic-based Therapeutic Approaches," (and references cited
therein) in Human Molecular Genetics, T. Strachan and A P Read, BIOS
Scientific Publishers Ltd (1996).
Thus, for example, cells (particularly spermatoza) may be engineered in
vivo for expression of a polypeptide in vivo by, for example, procedures known
in the art. As known in the art, a producer cell for producing a retroviral
particle
containing RNA encoding the polypeptide of the present invention may be
administered to a mammal (e.g., a human or a bovine mammal) for engineering
cells in vivo and expression of the polypeptide in vivo. These and other
methods
for administering a polypeptide of the present invention by such method should
be apparent to those skilled in the art from the teachings of the present
invention.
For example, the expression vehicle for engineering cells may be other than a
retroviruses, for example, an adenovirus which may be used to engineer cells
in
vivo after combination with a suitable delivery vehicle.
Retroviruses from which the retroviral vectors may be derived include,
but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis
virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus,
Myeloproliferative Sarcoma Virus, and mammary tumor virus. In one
embodiment, the retroviral vector is derived from Moloney Murine Leukemia
Virus.
The vector includes one or more promoters. Suitable promoters which
may be employed include, but are not limited to, the retroviral LTR; the SV40
promoter; and the human cytomegalovirus (CMV) promoter described in Miller,
et al., Biotechniques 7(9):980-990 (1989), or any other promoter (e.g.,
cellular
promoters such as eukaryotic cellular promoters including, but not limited to,
the
CA 02307128 2000-OS-25
-35-
histone, pol III, and ~3-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters (e.g., an
adenoviral major late promoter), thymidine kinase (TK) promoters (e.g., a
Herpes
Simplex Virus thymidine kinase promoter), B19 parvovirus promoters, a
respiratory syncytial virus (RSV) promoter; inducible promoters, such as the
MMT promoter, the metallothionein promoter; heat shock promoters; the albumin
promoter; the ApoAI promoter; human globin promoters; and human growth
hormone promoters. The promoter also may be the native promoter which
controls the genes encoding the polypeptides. Preferably, the promoter is a
testis-
or sperm-specific promoter to facilitate selective expression of the
polypeptide
in germ cells of the mammal. The selection of a suitable promoter will be
apparent to those skilled in the art from the teachings contained herein.
The retroviral vector is employed to transduce packaging cell lines to
form producer cell lines. Examples of packaging cells that may be transfected
include, but are not limited to, the PE501, PA317, ~r-2, ~r-AM, PA12, T19-14X,
VT-19-17-H2, ~rCRE, ~rCRIP, GP+E-86, GP+envAml2, and DAN cell lines as
described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is
incorporated herein by reference in its entirety. The vector may transduce the
packaging cells through any means known in the art. Such means include, but
are
not limited to, electroporation, the use of liposomes, and Ca.P04
precipitation. In
one alternative, the retroviral vector may be encapsulated into a liposome, or
coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral particles that include
the nucleic acid sequences) encoding the polypeptides. Such retroviral
particles
then may be employed to transduce eukaryotic cells, either in vitro or in
vivo.
The transduced eukaryotic cells will express the nucleic acid sequences)
encoding the polypeptide. Eukaryotic cells which may be transduced include,
but
are not limited to, embryonic stem cells, embryonic carcinoma cells, as well
as
hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells. Preferably, the cell is a
testicular
cell, to facilitate expression of the polypeptide in germ cells of the mammal.
CA 02307128 2000-OS-25
-36-
The present invention also provides a method for identifying polypeptides
related to the polypeptides (e.g., PT32) of the present invention. These
related
polypeptides may be identified by homology to a polypeptide of the present
invention, by low stringency cross hybridization, or by identifying
polypeptides
that interact with related natural or synthetic binding partners (e.g., c-Yes)
and/or
elicit physiological effects as the polypeptides of the present invention
(e.g.,
induction of oocyte activation). The detection of a specific DNA sequence may
be achieved by methods such as hybridization, RNase protection, chemical
cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g.,
Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of
genomic DNA.
The sequences ofthe present invention are also valuable for chromosome
identification. The sequence is specifically targeted to, and can hybridize
with,
a particular location on an individual mammalian chromosome. Moreover, there
is a current need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data (repeat
polymorphisms) are presently available for marking chromosomal location.
Briefly, sequences can be mapped to chromosomes by preparing PCR
primers (preferably 1 S-25 bp) from the cDNA encoding polypeptide of the
invention (e.g., PT32). Computer analysis of the cDNA typically is used to
rapidly select primers that do not span more than one exon in the genomic DNA.
These primers are then used for PCR screening of somatic cell hybrids
containing
individual human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning
a particular DNA to a particular chromosome. Using the present invention with
the same oligonucleotide primers, sublocalization can be achieved with panels
of
fragments from specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be used to map
to
its chromosome include in situ hybridization, prescreening with labeled flow-
sorted chromosomes and preselection by hybridization to construct chromosome
specific-cDNA libraries.
CA 02307128 2000-OS-25
-37-
Fluorescence in situ hybridization (FISH) of a cDNA clone to a
metaphase chromosomal spread can be used to provide a precise chromosomal
location in one step. This technique can be used with cDNA as short as 50 or
60
bases. For a review of this technique, see Verma et al., Human Chromosomes: a
Manual ofBasic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
genetic map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance in Man (available on line through Johns Hopkins University Welch
Medical Library). The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis (co-inheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence between affected and unaffected subjects. If a mutation is observed
in
some or all of the affected subjects, but not in any normal subjects, the
mutation
is likely to be the causative agent of the disorder (e.g., infertility or
abnormal
spermiogenesis).
The polypeptides of the invention, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an immunogen to
produce antibodies thereto. These antibodies can be, for example, polyclonal
or
monoclonal antibodies. The present invention also includes chimeric, single
chain, and humanized antibodies, as well as Fab fragments, or the product of
an
Fab expression library. Various procedures known in the art may be used for
the
production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a
sequence of the present invention can be obtained by introducing the
polypeptides
into an animal, e.g., a non-human mammal, such as a rabbit or mouse. The
antibody so obtained will then bind the polypeptides of the invention. In this
manner, even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides, as
described
further herein. For preparation of monoclonal antibodies, any technique
that provides antibodies produced by continuous cell line cultures can be
used.
CA 02307128 2000-OS-25
-38-
Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature
256:495-497), the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma
technique to produce human monoclonal antibodies (Cole, et al., 1985, in
Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (e.g.,
U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies
to
immunogenic polypeptides of the invention. Also, transgenic animals (e.g.,
mice) may be used to express humanized antibodies to immunogenic
polypeptides of the invention.
The above-described antibodies may be employed, for example, to isolate
or to identify cells expressing the polypeptide, or to purify the polypeptide
by
affinity chromatography. Alternatively, such antibodies can be used in
immunoassays (e.g., in situ immunofluorescence studies or immunoprecipitation
methods), or in passive immunocontraceptive methods.
The present invention also includes transgenic non-human mammals,
particularly murine and bovine mammals, that have been altered to contain a
sequence which confers a deficiency in the normal expression of PT32 and/or c-
Yes. Similarly, non-human transgenic mammals that overexpress PT32 and/or c-
Yes are included within the invention. The mammals of the present invention
can
be heterozygous or homozygous for the desired trait, provided that the mammals
contain the altered PT32 coding sequence.
As used herein, a mammal is said to be altered to contain a sequence
which conveys a deficiency in the normal expression of PT32 if recombinant
techniques are utilized to insert, delete or replace sequences encoding for,
or
directing the expression of, PT32. The insertion, deletion or replacement
within
such sequences has the effect of altering the normal level of expression of
the
given sequence or altering the activity of the protein which is expressed.
Mammals can be altered such that the mammal expresses a lower level of
the protein when compared to a non-altered mammal (in some cases a mammal
"deficient" in expressing normal levels of a protein will be incapable of
expressing detectable levels of the given protein). In some instances, where a
CA 02307128 2000-OS-25
-3 9-
mammal is altered such that a target gene is deleted or a large insertion is
generated within the target sequence, the mammal will not produce detectable
levels of the given protein. However, in some instances it may be possible for
extremely low quantities of the protein to be produced, although such product
may, in itself, be inoperative, or not functional in its usual physiological
actions.
As used herein, "normal expression" is defined as the level of expression
which is present in a wild-type or non-altered animal. A variety of techniques
known in the art can be used to quantitate the level at which a given protein
is
expressed. These include, but are not limited to immunological techniques such
as an ELISA, RIA, or western blot, or quantitative analytical techniques such
as
spectroscopy or flame chromatography.
Alternatively the mammals of the present invention can be altered so as
to express an altered form of the given protein. Mammals can be altered such
that
a specific mutation is introduced into a given region of a PT32 protein.
The mammals of the present invention are preferably obtained by methods
known in the art as homologous recombination (HR). This method has long been
known in lower eukaryotes (e.g., yeast), and has also been described for the
mouse (for review, see Capecchi, TIG 5(3):70-76 (1989) and also see Smithies
et al., Nature 317:230 (1985); Zijlstra et al., Nature 342:435 (1989);
Schwartzberg et al., Science 246:799 (1989); DeChiara et al., Nature 345:78
( 1990)).
Homologous recombination essentially comprises isolating genomic
sequences containing the target gene, employing known genetic engineering
techniques to mutate or otherwise disable or modify the gene, and then
reintroducing the gene into the relevant species. This is achieved by
preparing a
culture of pluripotent, or totipotent, cells, typically taken from embryos (ES
cells). The advantage of these cells is that they can be successfully cultured
for
a large number of generations under conditions in which they will not
differentiate and can be reintroduced into recipient embryos.
Typically the technique of electroporation, is used to render the ES cells
capable of taking up exogenous DNA. The modified gene is then introduced, in
a suitable manner, to these cells. Once taken up, recombination may occur,
CA 02307128 2000-OS-25
-40-
although this may be by random integration as well as by homologous
recombination.
To select cells in which a recombination event has taken place, a
selectable marker sequence may be used. For example, it is well known to
employ the bacterial Neo gene to confer resistance to neomycin, or an analogue
thereof, such as 6418. The marker gene may be inserted in the gene to be
modified, thereby disabling the target gene, while providing a positive
selectable
marker. Clones which are Neo+ have integrated the vector.
To further select homologous recombinants, the ends of the modified gene
may have other markers inserted, such as the Herpes Simplex Virus thymidine
kinase (HSVTK) gene. In a HR event, the HSVTK genes will not be recombined,
and the marker will not be transferred. Therefore, the desired recombinant
will
be resistant to, for example, Gancyclovir, which is converted into a toxic
metabolite when the HSVTK gene product is present (after a non-homologous
recombination event).
Correct clones may be identified by the technique of PCR or by genomic
Southern blotting. Subsequently, when a suitable clone has been identified,
the
ES cells may be inj ected into early-stage embryos, (blastocysts), and
reintroduced
into a pseudopregnant female. Chimeric animals will generally result from at
least some of these embryos, their tissues deriving in part from the selected
clone.
Thus, the germ-line may also be chimeric, spermatozoa or ova containing the
modified gene. Progeny deriving from such germ cells will be heterozygous for
the gene. The heterozygous progeny can be cross-bred to yield homozygous
animals. Confirmation of the allelic structure of the mammals can be
ascertained
by Southern blotting, for example.
The present invention also envisages cell lines suitable for generating
mammals, particularly mice ,of the invention, and techniques for generating
such
lines and mice. Thus, to obtain mice according to the present invention, one
skilled in the art can use the strategy of homologous recombination (HR) in
embryonic stem cells (ES cells) to replace the wild-type sequences encoding
PT32 with an altered sequence.
CA 02307128 2000-OS-25
-41-
The absence of PT32 in a cell line or animal allows one skilled in the art
to screen for genes and agents which can restore the altered mice to a wild-
type
phenotype, as well as to screen for agents which act as agonists or
antagonists of
PT32. Such animals are particularly useful as a source of abnormal spermatoza
that can be used, for example, in studies of oocyte activation. In addition,
such
non-human mammals can be used as animal models in methods for treating
humans. Additionally, the mammals of the present invention allow the
investigation, at the cellular level as well as at the in vivo level, of a
system which
lacks PT32. This will allow researchers further to establish the importance of
PT32. The animals and cells lines of the present invention may also be
deficient
in the expression of other genes, such as tyrosine kinase c-Yes, and thus
provide
the opportunity to study the interactions of PT32 and/or c-Yes with other
proteins. Thus, it will be appreciated that there are many uses to which the
mammals and cell lines of the present invention may be put. Artisans of
ordinary
skill will recognize that methods similar to the foregoing methods can be used
to
produce transgenic animals that are deficient in c-Yes expression, or to
produce
transgenic animals that overexpress PT32 and/or c-Yes.
The present invention will be further described with reference to the
following examples; however, it is to be understood that the present invention
is
not limited to such examples. All parts or amounts, unless otherwise
specified,
are by weight.
In order to facilitate understanding of the following examples, certain
methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by
capital letters and/or numbers. The starting plasmids herein are either
commercially available, publicly available on an unrestricted basis, or can be
constructed from available plasmids in accordance with conventional
procedures.
In addition, equivalent plasmids to those described are known in the art and
will
be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a
restriction enzyme that acts only at certain sequences in the DNA. The various
restriction enzymes used herein are commercially available, and their reaction
CA 02307128 2000-OS-25
-42-
conditions, cofactors and other requirements were used as would be known to
the
ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid
or
DNA fragment is used with about 2 units of enzyme in about 20 ~.l of buffer
solution. For the purpose of isolating DNA fragments for plasmid construction,
S typically 5 to 50 ~g of DNA are digested with 20 to 250 units of enzyme in a
larger volume. Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation times of
about
1 hour at 37 ° C are ordinarily used, but may vary in accordance with
the supplier's
instructions. After digestion the reaction may electrophoresed directly on a
gel
to isolate the desired fragment.
"Oligonucleotides" refers to either a single stranded
polydeoxyribonucleotide or two complementary polydeoxyribonucleotide
strands, which may be chemically synthesized. Such synthetic oligonucleotides
have no S' phosphate and thus will not ligate to another oligonucleotide
without
adding a phosphate, e.g., with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between
two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p.
146).
Unless otherwise provided, ligation may be accomplished using known buffers
and conditions with 10 units of T4 DNA ligase per 0.5 pg of approximately
equimolar amounts of the DNA fragments to be ligated.
"Oocyte activation" means the initiation of the resumption of second
meiosis by an oocyte. Typically, oocyte activation is accompanied by induction
of anti-polyspermy defense and pronuclear development. Oocyte activation
begins with the cyclic release of calcium ions from the oocyte's endoplasmic
reticulum (i.e., "calcium oscillations"). Thus, oocyte activation can be
detected
by detecting the release of calcium ions, e.g., using a conventional assay.
Ultimately, oocyte activation typically leads to the first embryonic cleavage.
See,
e.g., Perry et al., Developmental Biol. 217:386-393 (2000), incorporated
herein
by reference.
Generally, techniques described herein can be performed essentially as
described in Sambrook et al., MOLECULAR CLONING: A LABORATORY
CA 02307128 2000-OS-25
-43-
MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1989).
The following examples illustrate the present invention and the
advantages thereof. These examples are set forth to illustrate the invention,
not
limit the scope of the invention.
Examples
Gamete Preparation and In Vitro Fertilization of Bovine Oocytes with
MitoTracker-tagged Sperm
Straws of frozen bull sperm (ABS, DeForest, WI) were thawed and
centrifuged for 10 minutes at 700 x g through a two-layer (45 and 90%) Percoll
gradient, then resuspended and incubated for 10 minutes at 37°C in a
modified
Tyrode's medium (Sperm-TL; Parnsh, J. J., et al., Theriogenology 25:591-600
(1986); 100 mM NaCI, 3.1 mM KCI, 25 mM NaHC03, 29 mM NaH2P04, 21.6
mM Na-lactate, 2 mM CaClz, 4 mM MgCl2, 10 mM HEPES, 6 mg/ml bovine
serum albumin, 25 ~cg/ml gentamicin, 1 mM pyruvate), supplemented with 400
nM MitoTracker Green FM (Molecular Probes Inc., Eugene, OR), a vital, fixable
mitochondria) dye with high affinity to sperm mitochondria) membranes
(Sutovsky, P., et al., Biol. Reprod. 55:1195-1205 (1996)). MitoTracker-tagged
sperm were washed by centrifugation in Sperm-TL.
Oocytes were isolated by aspiration from the ovaries obtained from a local
abattoir (Walt's Meats Inc., Woodland, WA) and matured in vitro for 24 hours
(metaphase II) in TC 199 medium (Gibco) supplemented with 10% fetal calf
serum, 0.2 U/ml FSH-P (Schering-Plough, Kenilworth, NJ), 0.2 M pyruvate and
,ug/ml gentamicin. Fertilization was performed according to the protocol of
25 Parnsh et al., (1986). Briefly, the MitoTracker-tagged sperm were
resuspended
in fertilization medium (TL; modified Tyrode-lactate medium: 114 mM NaCI, 3.2
mM KCI, 2 mM CaCl2, 0.5 mM MgCl2, 25 mM NaHC03, 0.4 mM NaHzP04, 10
mM Na-lactate, 6.5 i.u. penicillin, 25 ,ug/ml gentamicin, 6 mg/ml fatty acid-
free
bovine serum albumin and 0.2 mM pyruvate) supplemented with 0.25-5 ~g/ml
CA 02307128 2000-OS-25
-44-
heparin, and pipetted into 50 ,ul drops of fertilization medium with 10-15
mature
oocytes/drop, to give a final concentration of 1 x 106 sperm/ml. Petri dishes
with
fertilization drops were incubated at 39°C in a humid atmosphere of 5%
CO2.
Immunofluorescence
The modified protocol of Sutovsky et al. (Biol. Reprod. 55:1195-1205
(1996)) was used to visualize sperm PT, nuclear pores, DNA and sperm tail
mitochondria inside the zygotes. Fertilized oocytes were removed from the
fertilization drops at various time points ranging from 8 hours (sperm
incorporation) to 24 hours (first mitosis) after insemination and stripped of
zonae
pellucidae by 0.5% pronase in a serum-free TL-HEPES containing 0.5%
polyvinyl-pyrolidone (PVP; Sigma), then attached to the poly-L-lysine coated
microscopy coverslips in warm (37°C) 0.1 M phosphate-buffered saline
(PBS;
pH 7.2). Formaldehyde was added to the dishes with oocytes to a final
concentration of 2% and fixed for 40 minutes at room temperature (RT). Zygotes
were permeabilized overnight in 0.1 % Triton-X-100 (TX-100; Sigma) in 0.1 M
PBS, blocked for 25 minutes with 5% normal goat serum (NGS; Sigma) in 0.1
M PBS with 0.1 % TX-100 and incubated for 40 minutes at RT with a mixture of
the perinuclear theca-specific rabbit polyclonal antibody pAb 427 (Oko, R.,
and
Maravei, D., Biol. Reprod. 50:1000-1014 (1994); diluted (dil.) 1/200) and a
nuclear pore-specific mouse monoclonal antibody mAb 414 (BabCo, Berkeley,
CA; Davis, L. L, and Blobel, G., Proc. Natl. Acad. Sci. USA 84:7552-7556
(1987); Sutovsky, P., et al., J. Cell Sci. 111:2841-2854 (1998); dil., 1/200),
or
other antibodies, such as anti-PT32 antibodies, or anti-c-Yes antibodies
(Santa
Cruz Biotechnology), followed by a 40 minutes incubation with the red
fluorescent, TRITC-conjugated goat anti-rabbit IgG and a far-red emitting, Cy5-
conjugated goat anti mouse IgG (both from Zymed Labs, South San Francisco,
CA; both dil. 1 /40). DNA was stained by 4', 6'-diamidino-2-phenylindole
(DAPI;
Molecular Probes, Eugene, OR) added at S ,ug/ml to the secondary antibody
solution 10 minutes before the end of incubation. All antibodies were diluted,
and the zygotes were washed between and after the antibodies in 0.1 M PBS
CA 02307128 2000-OS-25
-45-
containing 0.1 % TX-100, 1 % NGS and 0.05 NaN3. The coverslips with zygotes
were mounted on microscopy slides in a VectaShield mounting medium (Vector
Labs, Burlingame, CA) and examined on a Zeiss Axiophot epifluorescence
microscope equipped with an RTE/CCD 1217 camera (Princeton Instruments,
Inc., Trenton, NJ), operated by MetaMorph software. Images were recorded onto
Iomega Jazz cartridges (Iomega Corp., Roy, UT) and archived on recordable
CDS. Due to its stability after formaldehyde cross-linking, the fluorescence
of
the Mitotracker-labeled sperm tail mitochondria was retained after such
processing and allowed the discrimination between the male, sperm-tail tagged
pronuclei, and female, tail-free pronuclei. Final images were created by
pseudo-
coloring and superimposing the parfocal single channel images using Adobe
Photoshop 4.0 software (Adobe Systems Inc., Mountain View, CA). Final
composite images (PT=red, NPC=green, DNA=blue, sperm mitochondria=white)
were contrast-enhanced, edited and printed on Sony UP-D-8800 color video
printer using Adobe Photoshop 4Ø Two hundred and fifty zygotes and 50
oocytes were processed with the above antibodies and 50 zygotes were processed
with preimmune rabbit serum as a negative control.
Preparation of the Perinuclear Theca Extracts
Isolated bull sperm heads were exposed to three successive extractions,
consisting of incubations in 0.2% Triton X-100, 1M NaCI and 100mM NaOH.
The first and second extractions solubilize the acrosome, head membranes, and
hydrophobic and ionically bound proteins, leaving essentially a shell of
insoluble
perinuclear theca surrounding the condensed nucleus (Oko, R., and Maravei, D.,
Biol. Reprod. 50:1000-1014 (1994)). Subsequent extraction with NaOH
solubilizes the PT but leaves the nucleus in its condensed form. The
supernatant
recovered in this last extraction step (PT extract) was neutralized, dialyzed
and
lyophilized for use in SDS-PAGE analysis and western blotting as described
previously by Oko and Maravei (1994) and, for microinjection into the egg. All
the antibodies raised against this PT extract (see above reference), whether
raised
against the whole extract (pAB 427) or against each of its major proteins,
CA 02307128 2000-OS-25
-46-
exclusively immunolocalized to the PT of the sperm head, providing the
confidence for the specificity of this extraction technique.
Intracytoplasmic Injection of Perinuclear Theca Extracts
Mature oocytes, selected for micro injection, were placed in a 100 ml
Ca2+-free TALP-HEPES medium, under oil, on the stage of a Nikon Diaphot
inverted microscope. Each oocyte was immobilized using a Narishigi holding
pipette with the polar body at 12 o'clock. A calibrated injection pipette
attached
to an Eppendorf motorized manipulator was used to deliver 20 pl PT extract
into
each oocyte. Control oocytes were injected with the same volume of Ca2+-free
TALP-HEPES medium. Inj ected oocytes were cultured in fertilization medium
until fixation at 12 hours post injection.
SDS-PAGE and Western Blotting
Lyophilized PT extracts were solubilized in 2% SDS, 5% (3
mercaptoethanol by boiling for 5 minutes and then run on linear gradient (8-
18%
polyacrylamide gels according to the SDS-discontinuous system originally
described by Laemmli, U. K., Nature 2 77:680-685 ( 1970). Preparative gels
were
eletrophoretically transferred to nitrocellulose (Schleicher and Schuell Inc.,
Keene, NU) utilizing a Hoefer Wet Transphor apparatus according to the
technique of Towbin, H., and Gordon, J., J. Immunol. Meth. 72:313-340 (1984).
The immuno-reactivity of western blotted proteins to pAB 427 was detected by
developing the phosphatase color reaction on the secondary antibody
phosphatase
conjugate (alkaline phosphatase conjugated F(ab)2 goat anti-rabbit IgG; Cappel-
Cooper Biomedical Inc.,Malvern, PA) according to McGadey, J., Histochemie
23:180-184 (1970).
Transmission ElectroH Microscopy
CA 02307128 2000-OS-25
-47-
Fertilized oocytes were fixed in formaldehyde-glutaraldehyde fixative of
Ito, S., and Karnovsky, M. J., J. Cell Biol. 89:168a (1968), containing 5% 2-4-
6
trinitrophenol (picric acid; Sigma), post-fixed in 1% osmium tetroxide,
dehydrated by an ascending ethanol series (30-100%), perfused with the
solution
of acetone and Epon 812, and embedded in Epon 812 resin. Tissue sections were
cut using a Sorvall MT 5000 ultramicrotome, transferred onto 100 MESH Cu-
grids, stained with uranyl acetate and lead citrate, and examined and
photographed on a Philips 300 electron microscope. Negatives were scanned by
an Umax Power Look 3000 scanner and printed using Adobe Photoshop 4.0
software.
Perinuclear Theca-Oolemma Binding Assay
Bull sperm were processed as described above and deprived of their
plasma membranes by a 20 minutes incubation at 37°C in 0.05%
lysophosphatidyl-choline (Lysolecithin; Sigma) diluted in the KNIT medium
(100 mM KC1,2 mM MgCl2, 10 mM Tris-HCI; pH 7.0). Mature, metaphase-II-
arrested live oocytes were deprived of zonae pellucidae as described for
immunofluorescence and transferred into drops of fertilization medium. One
million demembranated sperm/ml were mixed with zona free oocytes, cultured
for 4 hours, and fixed for immunofluorescence (pAb 427/DAPI, or DAPI only)
or electron microscopy as described above.
Results
Incorporation of the Sperm Perinuclear Theca Into Oocyte Cytoplasm During
Natural Fertilization
Labeling of the fertilized oocytes with the PT-specific antibody pAb 427
was combined with the NPC-specific antibody mAb 414 and the DNA stain
DAPI, and with the use of MitoTracker-tagged spermatozoa, in order to monitor
the removal and incorporation of sperm PT at fertilization. With the exception
of DAPI-stained maternal chromosomes, the unfertilized, metaphase II-arrested
CA 02307128 2000-OS-25
-48-
oocytes displayed neither of the above immunofluorescent labelings (Fig. 3A).
The intact PT was found on the surface of the oocyte-bound spermatozoa at an
early stage of fertilization (Figs. 3B, C), and the PT-labeling acquired fuzzy
appearance in the spermatozoa undergoing the incorporation into oocyte
cytoplasm (Fig. 3D). Clumps of the PT-derived material were found next to the
incorporated sperm nuclei when the new nuclear envelope, delineated by the mAb
414-positive NPCs, reformed on their surface (Fig. 3E). Such clumps of PT-
material were seen near the male pronucleus throughout the initial stages of
pronuclear development, during which the female chromatin completed second
meiotic division and the oocytes extruded the second polar bodies (Fig. 3F-H).
Remnants of the PT were last seen in the zygotes in which the developing male
and female pronuclei entered the process of pronuclear apposition (Fig. 3I).
No
PT-derived material was detected in the zygotes reaching full pronuelear size
(Fig. 3J, K) and apposition (Fig. 3L, M), and in the spontaneously activated
parthenogenetic oocytes (Fig. 3N). Such spontaneous parthenogenotes also
displayed aberrant patterns of NPC assembly (Fig. 3N).
Oocyte Activation Induced by the Intracytoplasmic Microinjection of Purified
Perinuclear Theca-Extracts
The hypothesis that the material released from sperm PT induces the
activation of bovine oocytes was initially tested using ICSI of the intact
spermatozoa. In bovine, this method yields very moderate activation and
pronuclear development rates, thus requiring artificial activation (e.g., Rho,
G.-
J., et al., Biol. Reprod. 59:918-924 (1998)). In our experiments, which did
not
include chemical activation, 24 out of 27 sperm-injected oocytes remained in
metaphase-II 20 hours after ICSI, and the intact spermatozoa in their
cytoplasm
displayed intense labeling with pAb 427 in the subacrosomal region (Fig. 4A,
B)
and on the equatorial segment (Fig. 4C). Three out of 27 oocytes displayed
certain signs of activation after ICSI. In one case, the PT-derived material
was
released from the sperm head into surrounding cytoplasm and the maternal
chromatin displayed signs of decondensation (Fig. 4D). Decondensation of both
the paternal and the maternal chromatin was seen in an oocyte in which the
sperm
CA 02307128 2000-OS-25
-49-
nucleus contained two separate clumps of PT material (Fig. 4E). Finally, one
oocyte developed a normal female pronucleus surrounded by the NPC-containing
nuclear envelope (Fig. 4F). In this oocyte, the sperm PT was still detectable
on
the equatorial segment of the sperm nucleus, but completely absent from the
subacrosornal region (Fig. 4F).
Injection of PT extracts induced oocyte activation, accompanied by the
formation of one (Fig. 4G) or two (Fig. 4H) female pronuclei, in 27.7% of
oocytes. These oocytes displayed typical dot-like pattern of AL/NPC assembly
in the cytoplasm (Sutovsky, P., et al., J. Cell Sci. 111:2841-2854 (1998)),
and a
fing of NPCs on their nucleus (Fig. 4G, H). Those oocytes that failed to
activate
after the injection of PT extracts, displayed a metaphase-like arrangement of
female chromosomes and their cytoplasm was free of AL (Fig. 4I). The boiling
of the extracts lowered the rate of oocyte activation to a level seen in the
sham-
injected group. Two out of 14 (12.5%) of oocytes in one experiment became
activated after the micro inj ection ofboiled PT-extracts (Fig. 4J). Sham inj
ection
of a calcium-free culture medium failed to activate 88.6% of the injected
oocytes
(Fig. 4 K). One or two pronuclei were formed in the oocytes that became
activated after sham-injection (11.4%), yet those oocytes did not support the
cytoplasmic assembly of NPCs into AL and displayed the aberrant formation of
pronuclear NPCs (Fig. 4L, M).
Protein Composition of Perinuclear Theca-Extracts Used for Micro injection
Into Oocyte Cytoplasm
Perinuclear theca. extracts used in the above micro injection experiments
were composed of five major proteins of 15-, 25-, 28-, 32-, and 60- kDa as
(Fig.
SA), all of which were previously immuno-localized to the PT (Oko, R., and
Maravei, D., Biol. Reprod. 50:1000-1014 (1994)). These proteins were
transferred onto nitrocellulose and probed with rabbit polyclonal antibody pAb
427 that only labels the PT in sperm prepared for immunocytochemistry (Oko,
R., and Maravei, D., Biol. Reprod. 50:1000-1014 (1994); Sutovsky, P., et al.,
Dev. Biol. 188:75-84 (1997a)). Depending on which boost of this immune serum
was used, the transferred proteins immuno-reacted with varying intensities.
With
CA 02307128 2000-OS-25
-5 0-
the first, second and third boosts the 15- and 28-, 32-, and 36-kDa bands,
respectively, were the most reactive of the major PT proteins (Fig. SB). These
proteins, which are designated with a prefix PT to reflect their origin in
perinuclear theca (e.g., PT 15, PT 32).
Ultrastructure of the Interactions Between Sperm Perinuclear Theca and
Oocyte Cortex
Despite the fact that the process of sperm incorporation occurs rapidly and
is seldom documented by electron microscopy, we succeeded in observing the
interactions between sperm PT and the oocyte cortex/cytoplasm in several
specimens. During sperm-oolemma binding, the oocyte microvilli seemed to fuse
with sperm plasma membrane and this new zygotic membrane remained attached
to the sperm PT (Fig. 6A, B). Such binding of PT to oolemma was also observed
during sperm incorporation into oocyte cytoplasm, when the oocyte microvilli
remained attached to the innermost leaf of PT, while the outer layers of PT
became detached from the sperm nucleus and partially dissolved in the
cytoplasm
(Fig. 6C). The dissolution of the sperm PT in the oocyte cytoplasm was also
found in a partially incorporated spermatozoon, the complete incorporation of
which was prevented by polyspermy block (Fig. SD-F). The cytoplasm of this
oocyte contained one female and one sperm tail-tagged male pronucleus with no
signs of PT (not shown). The post-acrosomal sheath of the head of second
spermatozoon, protruding into the perivitelline space, contained an intact PT
(Fig.
6D-F). In contrast, the incorporated apical segment of this sperm head
contained
no PT and displayed partially decondensed chromatin surrounded by a newly
formed nuclear envelope (Fig. 6D-F). To support the observations on PT-
oolemma binding, bull spermatozoa were demembranated with 0.05%
lysolecithin to expose their PT and co-cultured for 16 hours with zona-free
oocytes. This treatment resulted in a strong binding of oocyte microvilli to
the
PT of such spermatozoa (Fig. 6G-I).
These experiments indicate that the perinuclear theca of mammalian
spermatozoa contains factors) capable of triggering oocyte activation at
fertilization. Supportive of such a role for PT are the studies in the
CA 02307128 2000-OS-25
-51-
globozoospermic infertility patients, whose spermatozoa lack PT and fail to
induce oocyte activation after ICSI (Battaglia, D. E., et al., Fertil. Steril.
68:118-
122 (1997); Rybouchkin, A., et al.,. Hum. Reprod. 11:2170-2175 (1996);
Rybouchkin, A. V., et al., Fertil. Steril. 68:1144-1147 (1997)). Furthermore,
crude whole sperm extracts (Swarm, K., Development 110:1295-1302 ( 1990)) and
those prepared from the isolated sperm heads (Kimura, Y., et al., Biol.
Reprod.
58:1407-1415 (1998); Perry, A. C. F., et al., Biol. Reprod. 60:747-755 (1999))
induced oocyte activation after extract micro injection in rodents. We have
used
a three step extraction of isolated sperm heads to obtain pure extracts of the
bull
sperm PT. By carefully checking the outcome of each step by electron
microscopy, we visually eliminated the possibility that proteins of other
sperm
head components would contaminate such extracts. In addition, all antibodies
raised against whole PT extracts, including pAB427, exclusively label the PT
of
sperm prepared for immunocytochemistry (Oko, R., and Maravei, D., Biol.
Reprod. 50:1000-1014 (1994)) confirming the purity of the preparation. When
the PT extracts prepared for this study were subjected to electrophoresis and
Western blotting, the Coomassie blue-stained bands overlapped with those cross-
reacting with the PT-specific polyclonal antibody pAb 427, with the exception
of the non-reactive maj or 60 kDa band which we have previously identified as
PT
60 (Oko, R., and Maravei, D., Biol. Reprod. 50:1000-1014 (1994)).
Use of PT32 in Mammalian Oocyte Activation
Our further efforts have focused on the isolation and characterization of
individual PT proteins with oscillogenic activity, particularly the 32 kDa
polypeptide (PT32), which is found in the PT of sperm of several mammalian
species including bovine, mouse, and human. A polyclonal anti-PT32 antibody
was used to screen a bull testicular cDNA expression library, and 5 positive
cDNA clones having similar sequence identity were isolated. The longest
sequence obtained was 1413 nt in length, and included an open reading from of
939 nt, encoding a protein of 313 amino acids. The nucleic acid and amino acid
sequences of an exemplary PT32 protein are set forth in Fig. 1. This PT32
CA 02307128 2000-OS-25
-52-
protein has a calculated molecular weight of 31,964 Da (i.e., about 32kDa).
The
deduced amino acid sequence shares 58% homology with WW domain Binding
protein 2 (WBP2). PT32 shares N-terminal sequence similarity and proline rich
motifs with the WBP2, which binds to the WW domain of Yes-associated protein
in the src family tyrosine kinase cascade (Chen, H. L, and Sudol, M., Proc.
Natl.
Acad. Sci. USA 92:7819-7823 (1995); Sudol, M., et al., FEBS Lett. 369:67-71
(1995); Sudol, I. M., Oncogene 17:1469-1474 (1998)).
The assembly of cytoplasmic annulate lamellae and nuclear pore
complexes are two typical indicators of sperm-induced oocyte activation in
mammals (Sutovsky, P., et al., J. Cell Sci.111:2841-2854 (1998)). We observed
these events in the oocytes activated by micro injection of PT extracts, but
not in
those activated spontaneously or after the sham-injection of culture medium.
Abnormal patterns of NPC and AL assembly were also seen in bovine oocytes
activated by the combination of actinomycin and 6-dimethyl-amino-purine, a
treatment most commonly used for artificial activation in animal ART
protocols.
In addition to the cortical reaction and the onset of calcium oscillations,
oocyte
activation in mammals apparently typically encompasses the rearrangement of
cytoplasmic organelles and membranes. Various artificial activation stimuli
may
induce these changes to various degrees. A natural stimulus, such as the
release
of oscillogenic factors) from the isolated sperm PT, or treatment with a
recombinant PT32 protein, and, optionally, recombinant c-Yes, is thus a
preferred
means of oocyte activation in both human and animal ART protocols.
The experiments disclosed herein demonstrates that, after being detached
from the sperm nucleus, the PT is incorporated into oocyte cytoplasm and
completely dissolved in it before the pronuclei reach their full size and
become
apposed. Furthermore, the segments of the sperm PT exposed to oocyte
cytoplasm dissolve in it even if the complete entry of the sperm head into the
oocyte cytoplasm is prevented by a polyspermy block (as described above). The
PT-mediated introduction of the sperm head-anchored oscillogens into oocyte
cytoplasm (see Fig. 7) helps explain the sperm-induced oocyte activation in
mammals without the need for hypothetic large, activation-permissive pores in
the oolemma (Jones, K. T., et al., Development 125:4627-4635 (1998)).
CA 02307128 2000-OS-25
-53-
The foregoing examples demonstrate that the sperm perinuclear theca,
after being detached from the sperm nucleus, becomes incorporated into oocyte
cytoplasm and completely dissolved prior to the completion of pronuclear
development and apposition. Injection of isolated PT extracts into the
unfertilized oocytes induces their activation, accompanied by the cytoplasmic
and
nuclear events that mirror natural fertilization. We conclude that sperm PT
anchors the oocyte activating factors) and the PT's partial or complete
incorporation into oocyte cytoplasm is the natural mechanism by which the
fertilizing spermatozoon activates the oocyte.
Involvement of PT32 and Tyrosine Kinase c-Yes in the Activation of
Mammalian Oocytes
The experiments set forth below demonstrate that the sperm perinuclear
theca protein PT32 interacts with tyrosine kinase c-Yes and induces activation
of
mammalian oocytes. As illustrated in Fig. 1, the amino acid sequence of PT32
contains 12 repeats of an unique protein binding domain and a consensus site
for
binding to the WW-module of the Yes-binding protein in the signaling cascade
of the Src-family, non-receptor tyrosine kinase c-Yes. An isoform of c-Yes is
present in the oocyte cytoplasm, and in sperm PT starting with the elongated
spermatid, a stage at which spermatids acquire the ability to induce oocyte
activation. As demonstrated below, the injection of the recombinant PT32
(rPT32) into bovine oocytes causes the clustering of c-Yes in the oocyte
cytoplasm, and causes oocyte activation at rates comparable to those of
oocytes
inj ected with detergent-insoluble PT-extracts. These data are consistent with
the
interaction of sperm PT32 and c-Yes, and the oocyte cytoplasmic c-Yes, in
oocyte activation.
Oocyte activation typically encompasses the resumption of second
meiosis by the oocyte, induction of anti-polyspermy-defense, and pronuclear
development. These events begin with the cyclic release of Ca2+ ions from
oocyte's endoplasmic reticulum (ER), also referred to as calcium oscillations,
and ultimately lead to the first embryonic cleavage. The data presented herein
CA 02307128 2000-OS-25
-S 4-
provide evidence for the involvement of the major PT protein, PT32, and the
PT-sequestrated isoform of Src family protein tyrosine kinase c-Yes (Summy et
al., 2000) in oocyte activation. PT32 contains a consensus binding site for
the Yes
kinase-binding protein. In contrast to previous studies using crude, soluble
sperm
extracts generated by repeated freezing/thawing procedures (Swarm, 1996),
sometimes complemented with DTT-solubilized sperm head factors (Perry et al.,
2000), recombinant PT 32 (rPT32) and purified PT extracts obtained by alkaline
extraction (Oko and Maravei, 1994; 1995) were used for the microinjection
experiments described herein.
Antibodies used in the experiments described below were raised against
portions of PT32, which were designated oligopeptide regions 1 and 2 and shown
in bold in Fig.l. These oligopeptides included the amino acid sequences
TSYRVVFVTSHLVNDPMLSFMMPF (SEQ ID N0:6) and
NEALPPAYEAPSAGNT (SEQ ID N0:7).
In a control experiment, using a fertilization medium (FM) that supports
early zygotic, but not embryonic bovine development, rPT 32, perinuclear theca
extract (PTX) and bovine serum albumin (B SA-V; control protein) were inj
ected,
separately, into the cytoplasm of the metaphase-II arrested oocytes, which was
cultured for 40 hours after injection (Fig. 8A). Only a slight increase in
cleavage
rates was observed in rPT32-injected oocytes, as compared with the BSA-V
group, while the total rate of activation, including pronuclear development
rates,
was not significantly different among individual groups, probably due to the
spontaneous pronuclear development after prolonged culture in FM. This can
probably be attributed to the effect of egg plasma membrane damage by the
injection alone, and to the spontaneous cessation of protein kinase activity,
necessary to maintain metaphase-II arrest, during egg aging in culture medium
(Eyestone and Campbell, 1999).
To demonstrate the ability of rPT32 to induce oocyte activation, rPT 32,
perinuclear theca extracts (PTX), and bovine serum albumin (BSA-V; control
protein) were inj ected, separately, into the cytoplasm of the metaphase-II
arrested
oocytes under enhanced culture conditions. Inj ected oocytes were cultured in
FM
for 24 hours and further cultured in the medium CR-1, which supports embryonic
CA 02307128 2000-OS-25
-55-
development (Fig. 8B). Both pronuclear development and cleavage rates are
significantly higher in groups injected with rPT32 or PTX, as opposed to
oocytes
that were sham-injected with BSA-V or oocytes cultured for 40 hours under
identical conditions but without inj ection. Heat treatment (boiling for 20
minutes) did not substantially affect the ability of PT extracts (PTX boiled)
to
activate the oocytes, and actually increased the cleavage rate.
To demonstrate the interaction of rPT32 with c-Yes, rPT32 or PT extracts
were inj ected into oocytes. PT32 induced the clustering of intrinsic c-Yes
kinase
in the oocyte cytoplasm at rates comparable to those of oocytes injected with
whole PT extracts (Figs. 9A-4F). Oocytes were fixed at metaphase-II prior to
microinjection (Fig. 9A), 20 hours after injection of rPT 32 (Fig. 9B), crude
PT
extracts (Fig. 9C), BSA-V (Fig. 9D), or after 20 hours of culture in
fertilization
medium, without injection (Fig. 9E). Figs. 9F and 9G illustrate the partial
overlap of c-Yes speckles (red) with endoplasmic reticulum marker a-PDI
(green). Fig. 9H illustrates the occurrence of c-Yes-positive speckles in the
cytoplasm of oocytes inj ected as described above, as demonstrated by subj
ective
evaluation after immunofluorescence labeling. Representative images of oocytes
with low, medium, and high clustering of c-Yes are shown in Figs. 9A, B and C,
respectively. In Fig. 9B, the left oocyte displays medium clustering, and the
right
oocyte displays high clustering of c-Yes. Spindle and midbody microtubules
(green in Figs. 9 A, B) were labeled with the anti-~3-tubulin antibody E7, DNA
(blue in Figs. 9 A-F) was stained with DAPI. Thus, these experiments provide
evidence that PT32 interacts (directly or indirectly) with c-Yes.
Figs. l0A-SF illustrate the pattern of expression of c-Yes (Figs. l0A and
lOB), PT15, which is a histone-like PT protein without known signaling
motifs(Fig. l OC) and PT 32 (Figs. l OD-F) in sperm and spermatids of bull.
PT32
was detected using the peptide-specific antibodies raised against oligopeptide
regions 1 and 2, as described above. Note that c-Yes (Fig. SA), but not PT 15
(Fig. 10B) and PT32 (Fig. 1 OC) is absent from round spermatids (arrows in
Figs.
10A, l OC, and l OD), and becomes inserted into PT during spermatid
elongation.
Note the diminished cross-reactivity of anti-c-Yes antibody in ejaculated
sperm
CA 02307128 2000-OS-25
-56-
(Fig. 1 OB). All PT proteins are shown in green; DNA was stained with DAPI and
is shown in blue.
In summary, the foregoing examples illustrate that PT32 interacts with
tyrosine kinase c-Yes and induces activation of mammalian oocytes.
References
Exemplary references that may be relevant to the invention are listed
below, certain of which are referred to above.
Almeida, E.A., et al., Cell 81:1095-1104 (1995)
Battaglia, D.E., et al., Fertil. Steril. 68:118-122 (1997)
Bedford, J.M., and Cooper, G.W., "Membrane Fusion Events in Fertilization of
Vertebrate Eggs," in Membrane Surface Reviews (Membrane Fusion), Yol. 5,
Poste and Nicolson, eds. (1978), pp. 65-125
Bellve, A.R., et al., Biol. Reprod. 47:451-465 (1992)
Bronson, R.A. and Fusi, F., Biol. Reprod. 43:1019-1025 (1990)
Carroll, D.J., et al., Dev. Biol. 206:232-247 (1999)
Carroll et al., JCell Biol. 138,1303-1311.
Chen, H.I. and Sudol, M., Proc. Natl. Acad. Sci. USA 92:7819-7823 (1995)
Cho, C., et al., Science 281:1857-1859 (1998)
Courtens, J.L., et al., J. Ultrastruct. Res. 57:54-64 (1976)
David, L.I. and Blobel, G., Proc. Natl. Acad. Sci. USA 84:7552-7556 (1987)
Dupont et al. Biochem J. 316, 583-591.
Ecklund, P.S. and Levine, L., J Cell Biol. 66:251-262 (1975)
Edirisinghe W.R., et al., Hum. Reprod. 131:3094-3098 (1998)
Escalier, D., Int. J. Dev. Biol. 34:287-297 (1990)
Evans, J.P., et al., J. Cell. Sci. 108:3267-3278 (1995)
Eyestone et al. J. Reprod. Fert. Suppl. 54, 489-497
Glahn, D., et al., Dev. Biol. 205:171-180 (1999)
Gong, J., et al., Mol. Biol. Cell 8:220a (1997)
Goto, K., Mol. Reprod. Dev. 36:288-290 (1990)
Giusti et al. JBiol Chem. 274, 29318-29322
Hewitson, L.C., et al., Biol. Reprod. 55:271-280 (1996)
CA 02307128 2000-OS-25
-57-
Ito, S. and Karnovsky, M.J., J. Cell Biol. 89:168a (1968)
Jaffe, L.F., Ann. N. Y. Acad. Sci. 339:86-101 (1980)
Jones, K.T. and Whittingham, D.G., Dev. Biol. 178:229-237 (1996)
Jones, K.T., et al., Development 125:4627-4635 (1998)
McGadey, J., Histochemie 231:180-184 (1970)
Kimura, Y., et al., Biol. Reprod. 58:1407-1415 (1998)
Kinsey, W.H., Biochem Biophys Res Commun 240:519-522 (1997)
Kopecny, V. and Pavlok, A., Histochemistry 45:341-345 (1975)
Laemmli U.K., Nature 277:680-685 (1970)
Lalli, M. and Clermont, Y., Am. J. Anat. 160:419-434 (1981)
Longo, F.J., et al., J. Cell Biol. 105:1105-1120 (1987)
Mchlmann, L.M., et al., Dev. Biol. 203:221-232 (1998)
Oko, R. and Clermont, Y., Biol. Reprod. 39:673-687 (1988)
Oko, R. and Clermont, Y., "Spermiogenesis," in Encylopedia of Reproduction
Vol. IV, Knobil and Neil, eds., Academic Press Inc., San Diego (1998), pp. 602
609
Oko, R. and Maravei, D., Biol. Reprod. 50:1000-1014 (1994)
Oko, R. and Maravei, D., Microsc. Res. Tech. 32:520-532 (1995)
Olson, G.E. and Winfrey, V.P., Gamete Res. 20:329-342 (1988)
Palermo, G., et al., Lancet 340:17-18 (1992)
Paranko, J., et al., Differentiation 38:21-27 (1988)
Parrington, J., et al., Nature 379:364-368 (1996)
Parnsh, J.J., et al., Theriogenology 25:591-600 (1986)
Perreault, S.D., et al., Dev. Biol. 101:160-167 (1984)
Perreault, S.D., et al., Biol. Reprod. 39:157-169 (1988)
Perry, A.C.F., et al., Biol. Reprod. 60:747-755 (1999)
Perry et al., Dev Biol. 2000 217, 386-393
Poccia, D. and Collas, P., "Transforming Sperm Nuclei Into Male Pronuclei In
Vivo and In Vitro," in Current Topics in Developmental Biology Vol. 34,
Pedersen and Schatten, eds., Academic Press Inc., San Diego (1996), pp. 25-88
Rho, G.-J., et al., Biol. Reprod 59:918-924 (1998)
Rybouchkin, A., et al., Hum. Reprod. 11:2170-2175 (1996)
CA 02307128 2000-OS-25
-$ 8-
Rybouchkin, A., et al., Fertil. Steril. 68:1144-1147 (1997)
Schultz, R.M. and Kopf, G.S., "MolecularBasis ofMammalian Egg Activation,"
in Current Topics in Developmental Biology Yol. 30, Pedersen and Schatten,
eds.,
Academic Press Inc., San Diego (1995), pp. 21-62
Sette, C., et al., Development 124:2267-2274 (1997)
Sette, C., et al., J. Cell. Biol. 142:1063-1074 (1998)
Sudol, LM., Oncogene 17:1469-1474 (1998)
Sudol, M., et al., FEBSLett 369:67-71 (1995)
Summy et al., Oncogene. Jan 6;19(1):155-60 (2000)
Sutovsky, P., et al., Biol. Reprod. 56:1503-1512 (1997)
Sutovsky, P. and Schatten, G., Int Rev. Cytol., 195:1-65 (1999)
Sutovsky, P., et al., Hum. Reprod. 11:1703-1712 (1996a)
Sutovsky, P., et al., Biol. Reprod. 55:1195-1205 (1996b)
Sutovsky, P., et al., Dev. Biol. 188:75-84 (1997a)
Sutovsky, P., et al., Mol. Reprod. Dev. 47:79-86 (1997b)
Sutovsky, P., et al., J. Cell. Sci. 111:2841-2854 (1998)
Sutovsky, P. et al.. Human Reprod., 14, 2301-2312 (1998)
Swarm, K., Development 110:1295-1302 (1990)
Swarm, K., Rev. Reprod. l, 33-39 (1996)
Talmor, A., et al., Dev. Biol. 194:38-46 (1998)
Towbin, H. and Gordon, J., J. Immunol. Methods 72:313-340 (1984)
Tsai, W.B., et al., Mol. Bil. Cell 9:440a, Abstract No. 2552 (1998)
Usui, N., Mol. Reprod, Dev. 44:132-140 (1996)
Usui, N. and Yanagimachi, R., J. Ultrastruct. Res. 57:276-288 (1976)
Usui, N., et al., Zygote 5:35-46 (1997)
Van Steirteghem, A., et al., Hum. Reprod. 8:1061-1066 (1993)
Wolny, Y.M., et al., Mol. Reprod. Dev. 52:277-287 (1999)
Wolosker, H., et al., FASEB J. 12:91-9 (1998)
Yanagimachi, R., "Mammalian Fertilization," in The Physiology ofReproduction.
CA 02307128 2000-10-17
SEQUENCE LISTING
<110> APPLICANTS: Queen's University at Kingston
Oregon Health Sciences University
<120> TITLE OF INVENTION: PT32 Sperm Protein, Oocyte Cytoplasmic
C-Yes, and Uses Thereof
<130> PATENT AGENT REFERENCE NUMBER: 1998-010-02CA
<140> APPLICATION NUMBER: 2,30'7,128
<141> FILING DATE: 2000-05-25
<160> NUMBER OF SEQUENCES: 8
<170> SOFTWARE: ASCII DOS Text
<210> INFORMATION FOR SEQ ID NO.: 1
<211> LENGTH: 5
<212> TYPE: PRT
<213> ORGANISM: Unknown
<400> SEQUENCE DESCRIPTION: 1
Pro Pro Pro Gly Tyr
1 5
<210> INFORMATION FOR SEQ ID NO.: 2
<211> LENGTH: 5
<212> TYPE: PRT
<213> ORGANISM: Unknown
<400> SEQUENCE DESCRIPTION: 2
Leu Pro Pro Ala Tyr
1 5
<210> INFORMATION FOR SEQ ID NO.: 3
<211> LENGTH: 7
<212> TYPE: PRT
<213> ORGANISM: Unknown
<220>
<221> NAME/KEY: PEPTIDE
<222> LOCATION: (3)
<223> OTHER INFORMATION: May be any amino acid.
<220>
<221> NAME/KEY: PEPTIDE
<222> LOCATION: (6)
<223> OTHER INFORMATION: May be any amino acid.
<400> SEQUENCE DESCRIPTION: 3
Tyr Gly Xaa Pro Pro Xaa Gly
1 5
<210> INFORMATION FOR SEQ ID NO.: 4
<211> LENGTH: 1411
<212> TYPE: DNA
58a
CA 02307128 2000-10-17
<213> ORGANISM: Bovine
<220>
<223> OTHER INFORMATION: Nucleic acid sequence of exemplary
PT32.
<400>
SEQUENCE
DESCRIPTION:
4
gcacgaggggcggcaggagggggcctgggcaggatggcagtgaaccagagccacaccgag
60
agccgtcgtggggccctcatcccctctggcgaaagtgtcttgaagcagtgtgaggatgtg
120
gacctctgcttcctacagaaaccagtggaatcctatct.ctttaatggcacaaagaaagga
180
acgttgtttctcacttcataccgggtggtcttcgtgacttcacacttagtcaatgacccc
240
atgctttcttttatgatgccgtttggcctgatgagtgactgcaccattgaacaaccaatt
300
tttgcccccaactacattaaaggaaccattcaggcagctccaggtggtggctgggaagga
360
caagctgtttttaagttatccttcaggaaaggaggtgccatcgaatttgcccaactgatg
420
gtaaaagctgcctctgctgctgccagaggaattccacttggaagtgtaaattactggttc
480
gacacttcaggactgtacataattactgtcccaggggctgcagtgtgctcctcacagaca
540
ccttgtccagcatatccaattgtgatctatggacccccaccaccaggatatacagtccaa
600
ccaggggaatatggaactccaccagaaggatatggagcccaaccagggggatatggagcc
660
ccacctatgggatatggagccccgcctgtgggatatggagtcccacctgggggatatgga
720
gtcccacctgggggatatggagtcccacctgggggatatggagccccacctgggggatat
780
ggagtcccacctgggggatatggtgccccacctgggggatatggagccccacctgcagga
840
tatggagccccaccagctggaaatgaagccctaccccctgcatatgaagctccatctgct
900
ggaaatacagctgcctctcacagatctatgacagctcagcaggagacttctcttcccact
960
acctcatcttcttaggtccatttaccaccttctcagagttaaaccttgaagactcaccaa
1020
gcaaagggcaccctaaaactgaagtcacagtaagaaggaagacccaggtgcccagtggta
1080
ggaggtgttcgtgtgcacgcagtggtctgatcttctccacacacctgtgaggtcctgtgc
1140
ctcaaaacagatgaaggtgagaagacgactcctgttctcaaggaaggaagatgcttgaaa
acagactgca agccaactag agagagagag atgtgaagtg gcacataaaa cagcttgggg
1200
1260
atggagactg actctcttta gaaaacaggc cttctccctg cctctgacct gagcagaaaa
1320
gagaaatcgc tggaaccaaa gagctagggt caccctgctt agacgccctc gattaaagcc
tgcttgctgt tgcataaaaa aaaaaaaaaa a
<210> INFORMATION FOR SEQ ID NO.: 5
<211> LENGTH: 324
<212> TYPE: PRT
<213> ORGANISM: Bovine
1380
1411
58b
CA 02307128 2000-10-17
<220>
<223> OTHER INFORMATION: Amino acid sequence of exemplary PT32.
<400> SEQUENCE DESCRIF~TION: 5
Ala Arg Gly Ala Ala Gly Gly Gly Leu Gly Arg Met Ala Val Asn Gln
1 5 10 15
Ser His Thr Glu Ser Arg Arg Gly Ala Leu Ile Pro Ser Gly Glu Ser
20 25 30
Val Leu Lys Gln Cys Glu Asp Val Asp Leu Cys Phe Leu Gln Lys Pro
35 40 45
Val Glu Ser Tyr Leu Phe Asn Gly Thr Lys Lys Gly Thr Leu Phe Leu
50 55 60
Thr Ser Tyr Arg Val Val Phe Val Thr Ser His Leu Val Asn Asp Pro
65 70 75 80
Met Leu Ser Phe Met Met Pro Phe Gly Leu Met Ser Asp Cys Thr Ile
85 90 95
Glu Gln Pro Ile Phe Ala Pro Asn Tyr Ile Lys Gly Thr Ile Gln Ala
100 105 110
Ala Pro Gly Gly Gly Trp Glu Gly Gln Ala Val Phe Lys Leu Ser Phe
115 120 125
Arg Lys Gly Gly Ala Ile Glu Phe Ala Gln Leu Met Val Lys Ala Ala
130 135 140
Ser Ala Ala Ala Arg Gly Ile Pro Leu Gly Ser Val Asn Tyr Trp Phe
145 150 155 160
Asp Thr Ser Gly Leu Tyr Ile Ile Thr Val Pro Gly Ala Ala Val Cys
165 170 175
Ser Ser Gln Thr Pro Cys Pro Ala Tyr Pro Ile Val Ile Tyr Gly Pro
180 185 190
Pro Pro Pro Gly Tyr Thr Val Gln Pro Gly Glu Tyr Gly Thr Pro Pro
195 200 205
Glu Gly Tyr Gly Ala Gln Pro Gly Gly Tyr Gly Ala Pro Pro Met Gly
210 215 220
Tyr Gly Ala Pro Pro Val Gly Tyr Gly Val Pro Pro Gly Gly Tyr Gly
225 230 235 240
Val Pro Pro Gly Gly Tyr Gly Val Pro Pro Gly Gly Tyr Gly Ala Pro
245 250 255
Pro Gly Gly Tyr Gly Val Pro Pro Gly Gly Tyr Gly Ala Pro Pro Gly
260 265 270
Gly Tyr Gly Ala Pro Pro Ala Gly Tyr Gly Ala Pro Pro Ala Gly Asn
275 280 285
Glu Ala Leu Pro Pro Ala Tyr Glu Ala Pro Ser Ala Gly Asn Thr Ala
290 295 300
58c
CA 02307128 2000-10-17
Ala Ser His Arg Ser Met Thr Ala Gln Gln Glu Thr Ser Leu Pro Thr
305 310 315 320
Thr Ser Ser Ser
<210> INFORMATION FOR SEQ ID NO.: 6
<211> LENGTH: 24
<212> TYPE: PRT
<213> ORGANISM: Unknown
<400> SEQUENCE DESCRIPTION: 6
Thr Ser Tyr Arg Val Val Phe Val Thr Ser His Leu Val Asn Asp Pro
1 5 10 15
Met Leu Ser Phe Met Met Pro Phe
<210> INFORMATION FOR SEQ ID NO.: 7
<211> LENGTH: 16
<212> TYPE: PRT
<213> ORGANISM: Unknown
<400> SEQUENCE DESCRIPTION: 7
Asn Glu Ala Leu Pro Pro Ala Tyr Glu Ala Pro Ser Ala Gly Asn Thr
1 5 10 15
<210> INFORMATION FOR SEQ ID NO.: 8
<211> LENGTH: 541
<212> TYPE: PRT
<213> ORGANISM: Gallus gallus
<220>
<223> OTHER INFORMATI0~1: Exemplary C-Yes protein. Swissprot
database accession no. P09324.
<400> DESCRIPTION: 8
SEQUENCE
MetGlyCys IleLys SerLysGlu AspLysGly ProAlaMet LysTyr
1 5 10 15
ArgThrAsp AsnThr ProGluPro IleSerSer HisValSer HisTyr
20 25 30
GlySerAsp SerSer GlnAlaThr GlnSerPro AlaIleLys GlySer
35 40 45
AlaValAsn PheAsn Se.rHisSer MetThrPro PheGlyGly ProSer
50 55 60
GlyMetThr ProPhe GlyGlyAla SerSerSer PheSerAla ValPro
65 70 75 80
SerProTyr ProSer ThrLeuThr GlyGlyVal ThrValPhe ValAla
85 90 95
LeuTyrAsp TyrGlu AlaArgThr ThrAspAsp LeuSerPhe LysLys
100 105 110
58d
CA 02307128 2000-10-17
Gly Glu Arg Phe Gln Il.e Ile Asn Asn Thr Glu Gly Asp Trp Trp Glu
115 120 125
Ala Arg Ser Ile Ala Thr Gly Lys Thr Gly Tyr Ile Pro Ser Asn Tyr
130 135 140
Val Ala Pro Ala Asp Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys
145 150 155 160
Met Gly Arg Lys Asp Ala Glu Arg Leu Leu Leu Asn Pro Gly Asn Gln
165 170 175
Arg Gly Ile Phe Leu Val Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr
180 185 190
Ser Leu Ser Ile Arg Asp Trp Asp Glu Val Arg Gly Asp Asn Val Lys
195 200 205
His Tyr Lys Ile Arg Lys Leu Asp Asn Gly Gly Tyr Tyr Ile Thr Thr
210 215 220
Arg Ala Gln Phe Glu Ser Leu Gln Lys Leu Val Lys His Tyr Arg Glu
225 230 235 240
His Ala Asp Gly Leu Cys His Lys Leu Thr Thr Val Cys Pro Thr Val
245 250 255
Lys Pro Gln Thr Gln Gly Leu Ala Lys Asp Ala Trp Glu Ile Pro Arg
260 265 270
Glu Ser Leu Arg Leu Glu Val Lys Leu Gly Gln Gly Cys Phe Gly Glu
275 280 285
Val Trp Met Gly Thr Trp Asn Gly Thr Thr Lys Val Ala Ile Lys Thr
290 295 300
Leu Lys Pro Gly Thr Met Met Pro Glu Ala Phe Leu Gln Glu Ala Gln
305 310 315 320
Ile Met Lys Lys Leu Arg His Asp Lys Leu Va.l Pro Leu Tyr Ala Val
325 330 335
Val Ser Glu Glu Pro Ile Tyr Ile Val Thr Glu Phe Met Thr Lys Gly
340 345 350
Ser Leu Leu Asp Phe Leu Lys Glu Gly Glu Gly Lys Phe Leu Lys Leu
355 360 365
Pro Gln Leu Val Asp Met Ala Ala Gln Ile Ala Asp Gly Met Ala Tyr
370 375 380
Ile Glu Arg Met Asn Tyr Ile His Arg Asp Leu Arg Ala Ala Asn Ile
385 390 395 400
Leu Val Gly Asp Asn Le~u Val Cys Lys Ile Ala Asp Phe Gly Leu Ala
405 410 415
Arg Leu Ile Glu Asp Asn Glu Tyr Thr Ala Arg Gln Gly Ala Lys Phe
420 425 430
Pro Ile Lys Trp Thr Ala Pro Glu Ala Ala Leu Tyr Gly Arg Phe Thr
58e
CA 02307128 2000-10-17
435 440 445
Ile Lys Ser Asp Val Trp Ser Phe Gly Ile Leu Leu Thr Glu Leu Val
450 455 460
Thr Lys Gly Arg Val Pro Tyr Pro Gly Met Val Asn Arg Glu Val Leu
465 470 475 480
Glu Gln Val Glu Arg Gly Tyr Arg Met Pro Cys Pro Gln Gly Cys Pro
485 490 495
Glu Ser Leu His Glu Leu Met Lys Leu Cys T'rp Lys Lys Asp Pro Asp
500 505 510
Glu Arg Pro Thr Phe Glu Tyr Ile Gln Ser Phe Leu Glu Asp Tyr Phe
515 520 525
Thr Ala Thr Glu Pro Gln Tyr Gln Pro Gly Asp Asn Leu
530 535 540
58f
