CA 02314431 2000-06-14
WO 99/31280 PCT/US98/Z6945
BCREENINt3 A88AY8 FOR THE DETECTION AND
DIAGrNOBIB OF INFLOENSA VIR08
1. FIELD OF THE INVENTION
The present invention relates to screening assays and
kits, and methods of employing them for the detection and
diagnosis of influenza virus infection. In particular, the
present invention relates to screening assays for the
detection and diagnosis of influenza virus infections based
on rapid, specific assay systems for detecting influenza
neuraminidase. The present invention further encompasses
kits for the diagnosis of influenza viral infection based on
the species specific detection of influenza neuraminidase.
Furthermore, the present invention relates to rapid,
specific, high through-put assay systems to screen for agents
that interact with influenza virus neuraminidase and which
may have utility as antiviral agents.
2. HACR(~RODND OF TH8 INVENTION
2.1 INFLUENBA VIR08 INFECTION
Influenza virus infection is an important clinical
problem worldwide. Influenza has been known for centuries to
occur in recurrent epidemics that initiate abruptly, spread
rapidly, and are frequently worldwide. Indeed, influenza was
responsible for one of the most devastating plagues in
history; between 1917 and 1918 approximately 20 million
people were killed as a result of influenza infections.
Although epidemics occur periodically, outbreaks of influenza
occur annually. In the United States alone, up to 40 million
people develop influenza infections each year. Of those
individuals, approximately 150,000 are hospitalized, and
10,000 to 40,000 die from the flu or flu-related
complications (Welch, S., 1988, Gilead~s Oral Influenza Drug
Proves Positive in Phase III, BioWorld Today 9:1,3). In the
United States approximately $10 billion is spent annually for
doctor's visits, lost productivity, and wages as a result of
influenza virus infections.
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
Influenza is an acute respiratory disease associated
with constitutional symptoms. The disease results from the
destruction of cells lining the upper respiratory tract, the
trachea, and the bronchi due to influenza virus infection.
Influenza virus enters the nasopharynx and spreads to cells
which express specific mucoprotein receptors. Although the
virus must pass through respiratory secretions, which contain
mucoproteins that the viral particles can combine with,
infection is not blocked because the viral neuraminidase
hydrolyzes the mucoproteins, rendering them ineffective as
inhibitors.
Acute infection with influenza virus results in viral
replication, which is followed by necrosis of infected cells
and extensive desquamation of the respiratory epithelium.
This is directly responsible for the respiratory symptoms
associated with acute infection. The constitutional symptoms
associated with acute influenza virus infection include
fever, chills, generalized aching, headache, prostration, and
anorexia. Normally, the disease resulting from influenza
virus infection is self-limited and lasts 3 to 7 days.
Secondary bacterial infections (era., Staphylococcus aureus,
Hemophilus influenzae, and ~i-hemolytic streptococci) account
for most deaths from influenza. Rarely, does infection with
influenza alone result in death.
2.2 IIlFhUBN~A VIR08
Influenza viruses are enveloped viruses containing a
negative-sense segmented single-stranded RNA genome.
Influenza viruses are classified as members of the
Orthomyxoviridae family. On the basis of their nucleocapsid
and M protein antigens, influenza viruses have been further
classified into three types (genus), influenza A, B, and C.
New variants of influenza A and B types are continually
emerging and are classified into subtypes (species) based
upon the expression of immunologically distinct surface
antigens, the hemagglutinin (HA) and the neuraminidase (NA)
- 2 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98l26945
glycoproteins. The antigenic variations of these two surface
antigens is due to antigenic drift. There are two distinct
forms of antigenic drift: minor antigenic drift and major
antigenic drift. Minor antigenic drift reflects changes due
to mutations in the IAA and NA genes of the virus. Major
antigenic drift results from recombination (i.e., gene
reassortment) between human and animal strains of influenza
virus. Thus, viruses can reassort genes during mixed
infections and produce new virus species against which a
large proportion of the world population is immunologically
defenseless .
The influenza virions consist of an internal
ribonucleoprotein core (a helical nucleocapsid) containing
the single-stranded RNA genome, and an outer lipoprotein
envelope lined inside by a matrix protein (M). The segmented
genome of influenza A and B consists of eight molecules
(seven for influenza C) of linear, negative polarity, single-
stranded RNAs which encode ten polypeptides, including: the
RNA-directed RNA polymerase proteins (PB2, PB1 and PA) and
nucleoprotein (NP) which form the nucleocapsid; the matrix
proteins (Ml, M2); nuclear export protein (NEP) two surface
glycoproteins which project from the lipoprotein envelope:
hemagglutinin (I3A) and neuraminidase (NA); and a
nonstructural proteins (NS1). A summary of the genes of the
influenza virus and their protein products is shown in Table
I below.
- 3 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98lZb945
L8
INFLU$NZA VIRUS GBNONS RNA S$O~NTS AND CODING
ASSIGND18NTS'
Lengths Comments
Lengthe Encoded (Amino Molecules
Segment Polypeptide'Acids) Per Virion
(Nucleotides)
1 2341 PB2 759 30-60 RNA transcriptase
component; host
cell
RNA cap bfnding
2 2341 PB1 757 30-60 RNA tranacriptase
component; initiation
of transcription;
endonuclease activity?
3 2233 PA 716 30-60 RNA transcriptase
component; elongation
of mRNA chains?
4 1778 HA 566 500 Hemagglutinin;
trimer;
envelope glycoprotein;
mediates attachment
to
cells
1565 NP 498 1000 Nucleoprotein;
associated with
RNA;
structural component
of RNA tranacriptase
6 1413 NA 454 100 Neuraminidase;
tetramer; envelope
glycoprotein
7 1027 M1 252 3000 Matrix protein;
lines
inside of envelope
MZ 96 Structural protein
in
plasma membrane;
spliced mRNA
8 890 NS, 230 Nonstructural protein
NBP 121 Nuclear Export
Protein
Adapted from R.A. Reproducedfrom the Annual
Lamb and P. W. Review
Choppin (1983),
of Biochemistry, 52, 467-506.
Volume
For A/PR/8/34
strain
' Determined by l and approaches
biochemica genetic
Determined by sequence ncing
nucleotide analysis
and protein
seque
Iiemagglutinin (HA) and neuraminidase (NA) are two major
surface glycoproteins expressed by influenza viruses. HA
mediates attachment of the virion to the host cell, the first
step of viral infection, by binding to terminal sialic acid
residues in glycoconguates. In contrast to HA activity, NA
catalyzes removal of terminal sialic acids linked to
glycoproteins and glycolipids. The role of NA in the
infectious process is unclear. It has been postulated that
NA activity is required for the release of newly formed
- 4 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/Z6945
viruses from infected cells by digesting sialic acids in the
HA receptor. Furthermore, NA may promote viral movement
through respiratory tract mucus, thereby enhancing viral
infectivity.
For type A influenza strains, NA has been classified
into nine subtypes based on their serological properties.
Type B influenza virus does not have any subtypes. The NA of
influenza virus types A and B only share 30% amino acid
sequence homology (Kim, C.H. et al., 1997, Journal of the
American Chemical Society 119:681). However, the enzyme
activity of NA among the different strains is the same,
indicating the highly conserved nature of the active site of
the enzyme. NA molecules form tetrameric spikes consisting
of a slender stalk topped by a box-like head region. The X-
ray crystallographic structures of NA has been determined for
three influenza subtypes: A/Tokyo, A/Tern, and B/Beijing
(Varghese, J.H. and Coleman, P.M., 1991, Journal of Molecular
Biology 221:473; Bossart-Whitaker, P. et al., 1993, Journal
of Molecular Biology 232:1069; Burmeister, W.P. et al., 1992,
EMBO Journal 11:49). The structures indicated that NA
consists of a symmetrical folding pattern of six four-
stranded anti-parallel (3-sheets arranged like blades of a
propeller. The crystallographic studies have revealed that
the amino acids which line and surround the walls of the
binding pocket in the active site are highly conserved among
all examined influenza virus strains.
Although much work has been focused on the discovery of
inhibitors of influenza virus neuraminidase (von Itzstein, M.
et al., 1993, Nature 363:418-423; Kim, C.H. et al., 1997,
Journal of the American Chemical Society 119:681-690;
Bischofberger, N. et al., United States Patent Number
5,763,483; Kim, C. et al., United States Patent Number
5,512,596; Kim, C. et al., International Patent Application
Number WO 98/17647; Bischofberger, N. et al., International
Patent Number WO 96/26933; Colman, P. et al., International
Patent Application Number WO 92/06691; Luo, M. et al., United
States Patent Number 5,453,533), there is still not an
- 5 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
effective inhibitor of neuraminidase available for the
treatment of influenza. Tn fact, there is currently no
effective drug for the treatment of influenza. Presently,
the only available means for treating influenza viral
infection is prophylactically through vaccination. However,
developing an effective vaccine requires correctly predicting
the Strain of influenza that will be endemic the next "flu
season." Thus, there still exists a need for a drug which
will effectively inhibit influenza viral infection.
2.3 CURRENT MET$OD8 AVAILABLE BOR DIAC3NO8I8
OF INFLUENSA VIRUB INFBCTION
A variety of methods are available for the clinical
diagnosis of influenza virus infection. Traditionally,
influenza virus has been detected by inoculating cell
cultures with biological samples and assessing the presence
of virus using hemagglutinin inhibition, ELISA, or
immunofluorescence assays. Although this method is highly
sensitive and specific, the time required for culture,
isolation, and identification can range from 2 to 10 days.
Since influenza virus infection is normally self-limited,
this method is not useful for diagnosis.
Influenza virus infection can be detected and diagnosed
by immunologic methods, which detect the presence of viral
specific antibodies or viral specific antigens. A variety of
immunologic techniques are available for detecting viral
specific antibodies and viral specific antigens, including
ELISAs (enzyme linked immunosorbent assays), solid-state
radioimmunoassays, and immunofluorescent assays. The
clinical diagnosis of influenza virus infection based upon
the detection of viral specific antibodies requires that an
increase in antibody titer is demonstrated since most
individuals already have antibodies against influenza viruses
at the time of infection. On the other hand, the detection
of viral specific antigens utilizing immunologic methods
depends on the use of antibodies that recognize an influenza
- 6 -
CA 02314431 2000-06-14
WO 99/31180 PCT/US98l26945
virus antigen and consequently, new strains of virus may not
be detected. Furthermore, immunologic methods for detecting
influenza virus require a laboratory and someone with
technical expertise to perform the assays.
Influenza virus infection can also be detected and
diagnosed based upon the enzymatic activity of neuraminidase.
Various assays utilizing these approaches have been described
in the literature (e. a., Santer, U.V. et al., 1978,
Biochimica et Biophysica 523:435-442; Potier, M. et al.,
1979, Analytical Biochemistry 94:287-296; Yolken, R.H. et
al., 1980, Journal of Infectious Diseases 142:516-523; von
Itzstein, M. et al., 1993, Nature 363:418-423; Turner, G. et
al., International Patent Application Number WO 91/09975;
Turner, G. et al., International Patent Application Number WO
91/09972; Turner, G. et al., International Patent Application
Number WO 91/10744; Turner, G. et al., International Patent
Application Number WO 91/09971; Reece, P. A. et al.,
International Patent Application Number WO 97/32214; Liav,
P.A. et al., United States Patent Number 5,719,020).
However, the utilization of the above-referenced
neuraminidase enzymatic activity dependent assays for the
diagnosis of influenza is questionable due to their lack of
sensitivity and/or specificity. Colorimetric and
fluorometric detection systems are not sensitive enough to
detect the low concentrations of neuraminidase found in some
biological samples. Although fluorometric detection systems
are more sensitive than colorimetric detection systems, the
fluorescence of biological materials is affected by high
protein levels, which quench the fluorescent signal.
Furthermore, a variety of organisms contain neuraminidase
including mammals, bacteria (Vibro Cholerae, Clostridium
perfringens, Streptococcus pneumoniae, and Arthrobacter
sialophilus) and viruses (parainfluenza virus, mumps virus,
Newcastle disease virus, fowl plaque virus and sendai virus)
and the currently available neuraminidase assays are not
sensitive enough to distinguish between these viruses.
_ 7
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
Clinical diagnosis by laboratory tests are generally too
costly for individual or sporadic cases. Additionally, the
tests utilized to diagnose influenza virus infection are time
consuming and require a laboratory in order to perform them.
Furthermore, there has been no reliable treatment available
to individuals suffering from influenza infection. Thus,
individuals suffering from influenza virus have had to rely
on the presumptive diagnosis made by physicians with little
reliable treatment available. Therefore, a need exists for a
simple, rapid, and accurate diagnostic kit for influenza
virus infection which can be performed in a physician's
office.
3. 80MMARY OF T8E INVLNTION
The present invention relates to assays that can be used
for the detection and diagnosis of influenza virus infection,
and for the identification of agents that have anti.-influenza
viral activity. The assays of the invention utilize
influenza viral neuraminidase (NA) as the target, and are
based, in part, on the Applicants' design of highly sensitive
and specific assay systems for the detection of influenza
virus NA, ligands or compounds that bind specifically to
influenza virus NA, and/or ligands or compounds that inhibit
influenza virus NA enzymatic activity. The assays can be
used in high throughput formats to screen large numbers of
compounds found in diversified combinatorial libraries to
identify candidate antiviral drugs or lead compounds, or to
generate an activity profile that can be used as a
fingerprint to detect influenza virus NA in clinical samples.
The assay systems can be formatted in kits which can be used
by the health practitioner at the point of care or the
patient.
In one embodiment, the presence of influenza virus NA or
the enzymatic activity of NA is used as a marker for the
detection of influenza virus in a clinical sample. To this
end, a detectable neuraminidase inhibitor (e. a., a labeled
_ g _
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
neuraminidase inhibitor) can be contacted with the clinical
sample -- binding of the detectable neuraminidase inhibitor
to the sample indicates the presence of NA, and therefore,
the influenza virus. Alternatively, the enzymatic activity
of NA can be detected using a labeled substrate for NA which
generates a detectable signal when enzymatically processed by
neuraminidase. At least two approaches can be employed: the
sample can be combined with a labeled substrate that is
specific for the influenza virus NA -- generation of a
detectable signal directly indicates the presence of
influenza NA, and therefore, the influenza virus .
Alternatively, a non-specific labeled substrate can be used
in the presence and absence of a NA specific inhibitor --
attenuation of a detectable signal in this assay indirectly
indicates the presence of influenza NA, and therefore, the
influenza virus .
In accordance with the methods of the present invention,
it is possible to evaluate the binding affinities of a
library of diverse molecules for the thousands of potential
binding sites present in a complex biological sample and
generate a pattern of binding affinities exhibited by the
sample which provide a unique fingerprint for that sample.
In one embodiment of the present invention, it is possible to
evaluate the binding affinities of a library of diverse
molecules comprising specific and non-specific substrates and
inhibitors of influenza neuraminidase which may be present
in a biological sample and generate a pattern of binding
affinities to identify a specific strain of influenza.
In another embodiment, the present invention relates to
rapid, specific, high through-put screening assays to
identify novel agents for their ability to interact with
neuraminidase or some other viral component. In one
embodiment, agents which interact with neuraminidase can be
detected by combining influenza virus neuraminidase with a
test agent and detecting the interaction of the test agent
using the combinatorial screening methods of the present
invention. In accordance with this embodiment, agents which
g _
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
modulate influenza virus neuraminidase activity can be
detected by combining a labeled specific or non-specific
substrate of influenza virus neuraminidase with influenza
virus neuraminidase and an agent. Those agents which
attenuate the enzymatic processing of the substrate will be
considered inhibitors of influenza virus neuraminidase
activity.
The invention further encompasses the novel agents
identified by the screening assays described herein. The
invention relates to therapeutic modalities and
pharmaceutical compositions for the treatment of viral
infections using neuraminidase as the target for
intervention. The present invention more particularly
relates to therapeutic modalities and pharmaceutical
compositions for the treatment of influenza virus infection
by targeting neuraminidase. The present invention also
relates to the use of antiviral agents identified by the
present invention in combinatorial therapies with other known
antiviral agents to inhibit viral replication.
The invention is based, in part, on the Applicants'
design of sensitive, rapid, homogenous assay systems that
permit detection of NA in samples, including but not limited
to complex biological samples. The homogenous assay systems
of the invention utilize robust detection systems that do not
require separation steps for detection of NA. The preferred
detection systems are fluorescence polarization and
chemiluminescence.
The present invention is described in terms of
neuraminidase by way of example and not by limitation, the
combinatorial screening assays of the present invention may
also be directed to detecting modulators or inhibitors of
other viral proteins including, hemagglutinin, nuclear export
protein, matrix proteins, nucleoprotein, and RNA directed RNA
polymerase proteins in order to identify potential inhibitors
of viral infection.
- 10 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
4. DETAILED DBBCRIPTION OF T8E INVENTION
The present invention relates to novel methods for
detecting and diagnosing viral infections based on the
combinatorial screening assays and detection methods of the
invention which encompass contacting highly diversified
libraries of compounds with biological samples which create
fingerprints to allow for the identification of specific
molecular differences existing between biological samples.
The successful application of the combinatorial screening
assay and detection method of the invention requires at least
three components: (1) a diverse ligand library (probes);
(2) a source of clinical samples (control and test samples);
and (3) a sensitive assay for detecting ligand/receptor
interactions. The combinatorial screening methods of the
present invention may be designed as highly sensitive assays
for diagnosis of viral infection. In another embodiment, the
combinatorial screening assays of the present invention are
used as sensitive high through-put screening tools to
identify novel agents which interact with neuraminidase, and
thus identify potential agents for the treatment of influenza
viral infection.
The present invention relates to rapid, specific assay
systems and kits for the diagnosis of influenza virus
infection on the basis of the detection of influenza virus
neuraminidase in clinical samples. In accordance with the
present invention, a labeled substrate which binds
specifically to influenza neuraminidase is combined with a
clinical sample, and a detectable signal is generated by the
enzymatic processing of the substrate by neuraminidase. This
assay directly indicates the presence of influenza virus
neuraminidase and therefore the virus. Alternatively, a
labeled non-specific substrate of influenza neuraminidase is
combined with a clinical sample, and a neuraminidase specific
inhibitor.
The attenuation of a detectable signal in this assay
indirectly indicates the presence of influenza virus
- 11 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
neuraminidase and therefore the virus. Another assay
determines the presence of influenza virus in a clinical
sample by detecting the interaction of a labeled
neuraminidase specific inhibitor with influenza virus
neuraminidase. In this assay a detectable signal will only
be generated if influenza virus neuraminidase is present in
the clinical sample.
The present invention further relates to rapid,
specific, high through-put screening assays to identify novel
agents such as drugs, ligands (natural or synthetic), ligand
antagonists, peptides, small organic molecules and the like,
for their ability to interact with neuraminidase or some
other viral component. The assay systems described provide
methods for the identification of agents that interact with
influenza virus neuramir~idase and agents that modulate
influenza virus neuraminidase activity. In the assay systems
of the present invention, a biological sample containing the
test sample is contacted with a library of probes, comprising
both known ligands, i-e., a diverse set of specific and non-
specific substrates and inhibitors, and unknown ligands,
i.e., test compounds, and comparing the binding activity of
the test compounds to the known compounds. Assay systems
which identify novel agents that modulate influenza virus
neuraminidase activity involve screening fc~r agents which
prevent influenza virus neuraminidase from interacting with
its substrate. In yet another embodiment of the present
invention, the high-throughput combinatorial screening
methods may be used to detect highly specific inhibitors of
neuraminidase enzymatic activity. Those agents which
attenuate a detectable signal by inhibiting the enzymatic
processing of the substrate will be considered inhibitors of
influenza virus neuraminidase activity and may be used in the
treatment of influenza virus infection.
The invention encompasses pharmaceutical compositions
containing the novel agents identified by the screening
assays described herein. The invention relates to
therapeutic modalities and pharmaceutical compositions for
- 12 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98126945
the treatment of viral infections using neuraminidase or some
other viral component as the target for intervention. The
present invention also relates to the utilization of
antiviral agents identified in the present screening assays
in combination with other known antiviral agents which
inhibit viral multiplication.
4.1 LIGANDB~/pROHEB
In accordance with one embodiment of the present
invention, "fingerprints" are established when known
biological samples, such as sputum, blood, sera, tissue
samples, cells, viruses, microorganisms, or small organic
molecules including RNA, DNA, peptides and proteins, are
exposed to a battery of known reagents to generate a panel of
values which reflect a pattern of binding interactions. In
accordance with the neuraminidase-based assays of the present
invention, the diverse ligand library may, for example,
comprise: specific neuraminidase substrates, non-specific
neuraminidase substrates, specific neuraminidase inhibitors,
non-specific neuraminidase inhibitors, samples of
neuraminidase isolated from various species of viruses and
microorganisms, specific and non-specific antibodies to
neuraminidase, or any variation of the above.
The ligands or probes of the present invention include
any biological molecule, either natural or synthetic and may
consist of nucleic acids, including DNA or RNA, small organic
molecules, peptides, proteins, glycoproteins,
polysaccharides, saccharides or inorganic molecules.
Neuraminidase substrates that can be used as probes in
the assays include, but are not limited to, N-
acetylneuraminic acid (NANA), and derivatives thereof such as
4,7-dialkoxy-N-acetyl neuraminic acid derivatives, including
4,7-dialkoxy NeuSAc which is a specific substrate for
influenza A and B neuraminidase, but does not interact with
parainfluenza 1,2,3,4 virus, mumps, respiratory syncytial
virus, adenovirus or bacterial neuraminidase, and 4-alkoxy-
- 13 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
NeuSAc which is a non-specific substrate for influenza A and
B neuraminidase, as described in U.S. Patent No. 5,719,020,
incorporated herein by reference in its entirety; and
chromagenic derivatives of NANA including a 4-position
modified NANA as described in WO 91/09972 incorporated herein
by reference in its entirety; 9-position modified NANA as
described in WO 91/10744 incorporated herein by reference in
its entirety; 5-position modified NANA as described in WO
91/09971 incorporated herein by reference in its entirety;
and 7- or 8-position modified NANA WO 91/09945 incorporated
herein by reference its entirety. Neuraminidase substrates
to be used in accordance with the assays of the present
invention include trisaccharide derivatives of NANA and
fluorogenic derivatives of NANA such as 4-methylumbelliferyl-
NANA as described in U.S. Patent No. 5,453,533, incorporated
herein by reference in its entirety. The concentration of
substrate used in the assays will be based on the results
from titration experiments. The concentrations) of
substrate which results in the highest sensitivity for the
detection of influenza virus neuraminidase activity will be
used.
Known influenza virus NA specific and non-specific
inhibitors can be used as probes in the assay system
including but are not limited to, natural inhibitors,
including Staphylococcus aureus glycoliporproteins which
inhibit influenza Ao, A1, AZ neuraminidase as described in GB
2,238,049, incorporated herein by reference in its entirety;
non-carbohydrate inhibitors, such as inhibitors of influenza
A and B neuraminidase as described in U.S. Patent No.
5,453,533, incorporated herein by reference in its entirety;
piperidine compounds which inhibit viral and bacterial
neuraminidase as described in WO 98/17647, incorporated
herein by reference in its entirety; aromatic compounds which
inhibit viral and bacterial neuraminidase as described in US
Patent No. 5,512,596, incorporated herein by reference in its
entirety; carbocyclic based compounds, which inhibit viral
- 14 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98126945
and bacterial neuraminidase as described in US 5,763,483,
incorporated herein by reference in its entirety; 2-deoxy
compounds, which have anti-orthomyxovirus and anti-
paramyxovirus activity, as described in WO 92/06691,
incorporated herein by reference in its entirety; 2-deoxy-
2,3-didehydro-Na-cetylneuraminic acid derivatives and
analogs, as described in WO 91/16320, incorporated herein by
reference in its entirety; 6-carboxamidodihydropyran
derivatives as described in WO 96/36628, incorporated herein
by reference; and general class inhibitors such as piperidine
compounds which inhibit both viral and bacterial
neuraminidase, as described in WO 96/26933, incorporated
herein by reference in its entirety. The assays make use of
the fact that the specific nature of the binding of the
inhibitors to influenza virus neuraminidase are known. The
concentration of inhibitor used in the assays will be based
on the results from titration experiments. The
concentrations) of inhibitor which results in the highest
sensitivity for the detection of influenza virus
neuraminidase will be used in the assay system. Furthermore,
probes used in the assay system can consist of compounds that
can be substrates or inhibitors, such as analogs of
neuraminic acid having a 6-position spacer group, which have
a detectable label or surface-binding partner at the end of
the spacer for concentration on solid surface/detection as
described in WO 97/32214, incorporated herein by reference in
its entirety.
~l.1.1 ~.ABBLINa Ol~' LI(iANDB/PROB$8
Described herein are methods for detectably labeling
molecules capable of interacting with influenza virus
neuraminidase. The neuraminidase-interacting molecules,
neuraminidase substrates and inhibitors, that are used in the
assay systems described above can be labeled, tagged, or
conjugated such that a signal is generated when the molecule
interacts with neuraminidase. The labels, tags, or
- 15 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
conjugates include, but are not limited to, fluorescent
compounds, radioactive bases, and chemiluminescent compounds.
Probes/Ligands can be detectably conjugated to
fluorescent compounds, including but not limited to,
fluorescein (FL) 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-
diaza-s_-indacene-3-propionic acid (BO or BODIPY), 4-
methylumbelliferyl, fluorescein, isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde
and fluoroescamine. The interaction between neuraminidase and
fluorescently labeled neuraminidase-interacting agents can be
detected by a spectrofluorimeter or preferably, by analyzing
the mixture by fluorescence polarization.
Substrates for neuraminidase can be also conjugated to
chromagenic and fluorescent compounds, such as coumarin.
When these compounds are conjugated to the substrates they
are undetectable. The hydrolysis of the conjugated compound
by the influenza virus neuraminidase results in the
production of a visually detectable pigment or a fluorescent
compound which is detectable by a spectrofluor.imeter.
It is also possible to label a neuraminidase specific
inhibitor with a radioisotope such as 'ZP, '''SI, or 13SI. The
interaction between neuraminidase and the neuraminidase
specific inhibitor can be detected by such means as the use
of a gamma counter or a scintillation counter or
autoradiography.
Yn a preferred embodiment, a neuraminidase specific or
non-specific substrate is conjugated to a chemiluminescent
compound such as hydroxyphenyldioxetane. In this case the
enzymatic processing of the substrate by neuraminidase will
lead to the emission of a photon which can be detected by a
photomultipler tube or a charge coupled device (CCD) camera.
The binding interaction between a probe and a component
of a biological sample may also be detected by ELISA (enzyme
linked immunosorbent assay). The probe can be labeled or
conjugated to such molecules as biotin, streptavidin or
digoxigenin. Probes labeled with these molecules can be
- 16 -
CA 02314431 2000-06-14
WO 99/31280 . PCT/US98/26945
detected using enzyme conjugated antibodies specific for the
label. Alternatively, the probe can be labeled with an
antibody, which may or may not be conjugated to an enzyme.
An antibody not conjugated to an enzyme can be detected by a
secondary antibody that is conjugated to an enzyme. The
enzyme conjugated antibody will react with an appropriate
substrate in such a manner as to produce a chemical moiety
which can be detected, for example, by spectrophotometric,
fluorometric or by visual means. Enzymes which can be used
to detectably label an antibody include, but are not limited
to, malate dehydrogenase, staphylococcal nuclease, delta-5-
steroid isomerase, yeast alcohol dehydrogenase, alpha-
glycerophosphate, dehydrogenase, triose phosphate isomerase,
horseradish peroxidase, alkaline phosphatase, asparaginase,
glucose oxidase, beta-galactosidase, ribonuclease, urease,
catalase, glucose-6-phosphate dehydrogenase, glucoamylase,
and acetylcholinesterase.
4.1.2 8YNT8E8I8 OF LI(3AND LIBRARI>;8
The methods of the present invention may use ligand
libraries synthesized according to any techniques known to
those skilled in the art. Preferably, they are made using
conventional solution phase reactions or solid phase
bynthetic techniques. Organic molecules of interests, such
as biologically active compounds containing primary or
secondary amine group, or hydroxyl groups, or thiol groups,
or aldehydes or ketones, or carboxylic acids, can be labeled
directly with suitable fluorescent molecules (dyes) in
solution to give the corresponding fluorescent-labeled
ligands. These methods and dyes are described in Haugland,
R.P. Handbook of Fluorescent Probes and Research Chemicals,
6t" Ed., 1996. In a preferred embodiment of the invention,
the solution phase syntheses are carried out in a suitable
polar organic solvent or solvent mixture such as DMF, DMSO,
THF using a slightly excess of dyes to ensure complete
labeling. The resulting fluorescent-labeled ligands are
- 17 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
purified by standard techniques in organic synthesis such as
liquid-liquid extractions using acid or base,
crystallizations and chromatography (thin-layer or column).
Alternative, purification methods, such as liquid-solid phase
extractions using polymer-bound scavengers to removal the
unreacted dyes followed by simple filtrations can also be
used as described in the following examples (See, Obrecht,
D and Villalgordo, J.M., Solid-Supported Combinatorial and
Parallel Synthesis of Small-Molecular-Weight Compound
Libraries, Pergamon, 1998, Chapter 3.)
Scheme I. Solution phase reactions (products were pu=ified
by scavenger resin)
In one embodiment of the present invention, the
libraries of this invention are made using conventional solid
phase techniques. See, e~g., Bodanszky, Principles of
peptide Synthesis (Springer-Verlag: 1984); Bodanszky, et al.,
The Practice of Peptide Synthesis (Springer-Verlag: 1984);
Barany and Merrifield The Peptides: Analysis, Synthesis and
30
- 18
SUBSTITUTE SHEET (RULE 2B)
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
N
N Z
Z
C
~Z
L
O °'
Z R Z
U m Z
2 ~ Z~ O
Z
O
O
U pn
Z , , O +
O
Z
O
Z
H
a
c
o p
z
z
N
O
+ O
Z
Z
U
_ 18/I _
SUBSTITUTE SHEET (RULE 26)
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
Biology Vol. 2, Chapter 1 (Academic Press: 1980); Atherton,
et al., Bioorg. Chem. Vol. 8 (1979). This is because solid
phase synthesis has several advantages over more traditional
synthetic methodologies. For example, large excesses of
reagents or starting materials can be used to drive
individual reactions to completion, and purification and
isolation'can be performed by simple filtration and washing
since the products are attached to solid supports.
Furthermore, the relative site isolation of resin-bound
species inhibits many types of intermolecular side reactions.
A solid phase synthetic method that has been found to be
particularly suitable for the synthesis of the libraries of
this invention is described below. Capable of quickly and
efficiently forming diverse libraries of fluorescent-labeled
ligands, this method comprises two general steps. In the
first, a fluorescent dye is covalently attached to a solid
support. In the second step, which may be repeated as many
times as necessary, the immobilized dye is reacted with a
compound or mixture of compounds to form the desired mixture
of ligands. The present invention encompasses assays using
libraries adhered to the solid supports upon which they were
made, or adhered to different solid supports. It is
preferred, however, that the mixture of ligands be cleaved
from the support in a third step. This optional third step
is included in the preferred embodiment of the synthetic
method of this invention shown in Scheme II:
- 19 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
X-D-Y + Resin-L-E ~A --~ Res~-L-D-Y
(a) (b) (c)
Resin-L-D-Y -~-i Resin-L-D-Y'
(c) (d) E~R~Gi [+(E~R~G~)'+
(E~R~G~)"+",]
Resin-L-D-Ri-Gi <p> Resin-L-D-Rn
+ ---r ~. _.~, +
Resin-L-D-R~'-G~' EzR2Gz ... EnRnGn Resin-L-D--Rri
+ [+ (EzRzGz)~ [+ (EnRnGn)~ +
Resin-L-D-R~"-G~ ° + (EzR2Gz)" + ...] + (EnRnGn)" + ...] Res~-L-D-
Rn"
+ +
(e) (~
Resin-L-D-Rn p-p-1~
+ +
Resin-L-D-Rri ~E> P-D-Rn'
l
+ .. +
Rese~-L-D-Rn" p--D-Rp'
+ +
... ...
Scheme II
wherein <A>, <B>, <C>, <D> and <E> represent reaction
conditions suitable for the formation of the desired products
or intermediates represented by Formulas (b) - (g), and
brackets (i.e., [ ]) represent optional parallel or
sequential reactions, reactants, and/or products.
According to Scheme II, a dye molecule of Formula (a) is
selected:
X-D-Y
Formula (a)
- 20 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
wherein D is a fluorescent moiety, and X and Y are functional
groups independently selected from the group consisting of
halogens, alcohols, nitros, thiols, ethers, esters,
carboxylic acids, a-halo carboxylic acid derivatives, amines,
amides, and protected and unprotected derivatives thereof.
Examples of dye molecules of Formula (a) include, but are not
limited to: fluorescein derivatives such as
dichlorotriazylaminofluorescein (DTAF),
dichlorosulfofluorescein (DCSF), and nitrofluorescein;
tryptophan derivatives; coumarin derivatives; napthyl
derivatives; bipyridine (bpy) derivatives; tripyridine
derivatives; cyanines; rhodamines and organometallic
complexes such as Ru(bpy)3 and derivatives thereof. The
selection of dye molecules depends on a number of factors
including, for example, size, solubility, immunity to
degradation under solid phase reaction conditions, absorption
and emission wavelengths, quantum yield, and quantum yield
and emission wavelength sensitivity to the surrounding
chemical environment. Many of these factors, and the
synthesis of these and other suitable compounds, are readily
determined from the literature. See, e.a., Haugland, R.P.,
Handbook of Fluorescent Probes and Research Chemicals (6'h
ed.; 1996).
Also according to Scheme IT, a reactive substrate of
Formula (b) is selected:
Resin-L-E
Formula (b)
wherein Resin represents any solid support suitable for solid
phase synthesis; L is a linker attached to the solid support;
and E is a leaving group bound to L. Suitable solid supports
include, for example, polystyrene-divinylbenzene (PS-DVB)
copolymer and polyethylene glycol-PEG-PS-DVB copolymer. Wang
(polymer-bound 4-benzyloxybenzyl alcohol) and Rink resins,
with and without suitable linkers attached, are available
- 21 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
from Aldrich Chemical Co., Milwaukee, WI; Novabiochem, San
Diego, CA; and Advanced Chemtech, Louisville, KY.
A linker L-E is selected so that its bond to the solid
support is readily cleaved under the reaction conditions
represented by <E> in Scheme II. Suitable linkers are known
to those skilled in the art and include, for example,
halogens, thiols, alcohols, ethers, esters, aldehydes,
ketones, carboxylic acids, nitros, amines, amides, silanes,
and protected and unprotected derivatives thereof. The
attachment of such linkers to solid supports may be
accomplished by methods well known to those skilled in the
art. See, e.a., Bunin, B.A., The Combinatorial Index,
Academic Press, 1998.
In addition to the criteria described above, the linker
L-E is selected so that it will form a covalent bond with the
fluorescent moiety D of the dye molecule of Formula (a) under
reaction conditions <A> to yield an immobilized dye of
Formula (c):
Resin-L-D-Y
Formula (c)
Suitable reaction conditions <A>, which depend upon Resin, L,
E and X, are well known to, or easily determined by, those
skilled in the art. Generally they .include the use of a
solvent that causes the resin to swell and react with X.
Suitable solvents include, for example, dimethylformamide
(DMF), 1-methyl-2-pyrrolidinone (NMP), tetrahydrofuran
(THF), CHZC12, and mixtures thereof. The reaction conditions
<A> also may include a base such as diisopropylethlamine
(DIPEA), triethylamine, dimethylaminopyridine (DMAP), or N-
methylmorphaline (NMM), to neutralize the acid generated
during the reaction.
The immobilized dye of Formula (c) serves as a
foundation upon which the ligands of the library (represented
by Formula (g) in Scheme II) are formed. If the reactive
- 22 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
moiety Y is protected, however, it must be deprotected prior
to additional reactions. This optional deprotection to form
the deprotected moiety Y' is performed under reaction
conditions represented by <B> in Scheme II. These
conditions, which vary depending upon the protecting group,
are well known to those skilled in the art. See, Greene,
T.W. and Wuts, P.G.M., Protective Groups in Organic Chemistry
(2nd ed. ; 1991) .
The immobilized dye is then reacted under reaction
conditions <C> with a compound of formula E1R1G1 to yield a
compound of Formula (d):
Res in-L-D-R1-G1
Formula (d)
wherein El and G1 may be the same or different, E, is a
leaving group or protecting group, G1 is either the terminal
end of R1 or a leaving group or protecting group, and R1
represents any chemical fragment which comprises at least one
protected or unprotected reactive moiety that enables the
addition of R1 to the fluorescent moiety D under suitable
catalytic and/or deprotecting conditions. Suitable reactive
moieties include, but are not limited to, halogens, thiols,
alcohols, ethers, esters, aldehydes, ketones, carboxylic
acids, nitros, amines, amides, silanes, and protected and
unprotected derivatives thereof. Suitable reaction
conditions <C> include those which have been developed for
solid phase combinatorial chemistry. See, era., Brown, R.,
Contemporary Organic Synthesis, 216 (1997); Felder, E.R., and
Poppinger, D., Adv. Drug Res., 30:111 (1997); Balkenhohl, F.,
et al., Angew. Chem. Int. Ed. Engl. 35:2288 (1996); Hermkens,
P.H.H., et al., Tetrahedron 52:4527 (1996); Hermkens, P.H.H.,
et al., Tetrahedron 5 3:5643 (1997); Thompson, L.A., et al.,
Chem. Rev. 96:555 (1996); and Chem. Rev. 97(2) (1997).
- 23 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/2b945
Exemplary addition reactions include that of a primary amine
with an aldehyde to form an imine, which in turn can react
with a variety of different moieties including, for example,
~i-lactams, pyrrolidines, thiozolidinones, and amides. Acid
groups are equally flexible, and be used, for example, with
aldehydes, amines and isonitriles under Ugi multicomponent
condensation conditions to form either small amides or
heterocyclic compounds.
As indicted by Scheme TI, the immobilized dye molecules
of Formula (c) may also be reacted with a mixture of
compounds, each of which is different but is of the general
f Ormula E1R1G1; .i . a . , E1R1G1 + ( E1R1G1 )' + ( E1R1G1 ) " + ... +
(E,.R1G1) i, wherein i is the number of compounds in the mixture
and is an integer preferably less than about 50. In such a
case, a mixture of compounds of Formula (d) is produced, each
possessing a different R1G1 fragment; i.e., Resin-L-D-R1G1 +
Resin-L-D-(R1G1)' + Resin-L-D-(R,Gl)" + ~~~ + Resin-L-D-(R1G1)l.
It is preferred, however, that the compounds of Formula (c)
only be reacted with one compound of formula E1R.1G1.
Because many pharmacologically active compounds contain
reactive moieties such as amines and carboxylic acids, the
present invention contemplates that such compounds are
encompassed by the formula E1R1G1, in which case further
reaction may or may not be desired. If, however, the R,
fragment of the compounds) of Formula (d) is a reactive
moiety, n-1 subsequent addition reactions may be performed
under reaction conditions that are collectively referred to
in Scheme II by <D>, wherein n represents the number of
moieties bound to the fluorescent moiety D, and is an integer
of preferably less than about 100.
As above, each of these subsequent addition reactions
may employ both single compounds or mixtures of compounds of
formulas EkRkGk, wherein k is an integer between 2 and n-1, Rk
is the kt" moeity bound to the immobilized fluorescent moiety
D (via the k-1 moieties already bound to D), Ek and Gk are the
same or different, E~ is a leaving group or protecting group,
- 24 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/Z6945
Gk is the terminal end of Rk or a leaving group or protecting
group, and Rk represents any chemical fragment which comprises
at least one reactive moiety that enables the addition of Rk
to the immobilized compound(s). Suitable reaction conditions
<C> include the use of catalysts, deprotectants, and the like
which facilitate the addition of Rk to the immobilized
fluorescent compounds.
Completion of the reactions described above forms either
an immobilized compound of Formula (f):
Resin-L-D-Rn
Formula ( f )
or a mixture of immobilized compounds of Formula (f); i.e.,
Resin-L-D-(RlRzR3~~~R") + Resin-L-D-(R1RZR3~~~R")' + Resin-L-D-
(R,R2R3~~~R")" + ~~~ + Resin-L-D-(RzR~R3w~R~)'", wherein m has a
maximum value of about i*n when i is equal to the number of
compounds in the EkRkGk mixture having the largest number of
compounds. For the sake of simplicity, G,, is omitted from
Formula (f) because the terminal end of the ligand (e.g., Rn)
undergoes no further addition reactions.
In the final step of Scheme II, the dye-ligand compounds
are cleaved from the solid support under reaction conditions
<E> to yield a library of compounds of Formula (g):
P-D-Rn
Formula (g)
wherein it is to be understood that Formula (g) encompasses
all possible compounds and mixtures of compounds produced by
the reactions indicated in Scheme II. Suitable cleavage
conditions <E> are known to those skilled in the art, and
depend upon the bond between Resin and L. Cleavage may be
accomplished under acidic or basic conditions, or may be
photoinduced. Many suitable cleavage methods have been
reported in the literature. For example, some cleavage
- 25 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/2b945
reactions accomplished by treating the modified resin of
Formula (f) with trifluoroacetic acid (TFA) in methylene
chloride are shown in Scheme III:
Resins ~D~ T
O Rn H~O~D~Rn
O
Resm~ ~ .Ly ~D. ~A" .Ly
O N N Rn HN N Rn
(k)
O O
Resa~~ N~ ~Rn T~ N
O D HO ~D~Rn
i
(1)
<D>
--~ Resm~N~D~ TF~ Z;.
Rn HN~ ~Rci
(m)
O O
<D> TFA
Resm~N N\D~Rn ---~ H N~ N~D~Rn
2
(n)
<D> 'TFA
Resin~x~L~~D~Rn ---~. H\X.Lt\D~Rn
(o)
scneme III
wherein (j) is a Wang resin derivative; (k) is a Wang
carbamate resin derivative; (1) is a Wang amino acid resin
derivative; (m) is a Rink resin derivative; (n) is a Rink
- 26 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98116945
amino acid resin derivative; and (o) is a trityl or
chlorotrityl amine (i.e., X= NH) or alcohol (i.e., X=O) resin
derivative; and L1 represents any side chain or spacer stable
under solid phase reaction conditions. Examples of suitable
side chains include, but are not limited to, substituted and
unsubstituted alkyl, aryl and aralkyl groups.
After cleavage, the solvent is preferably removed to
isolate the fluorescent library. The library may then be
dissolved in a solvent such as dimethylsulfoxide (DMSO)
suitable for use in the assays of this invention.
Specific embodiments of the method of Scheme II are
shown in Schemes IV - VIII. For clarity, these schemes do
not show the reaction and formation of mixtures. It is to be
understood, however, that each of the individual reactions
shown represents the possibility of numerous parallel
reactions.
A particular simplified embodiment of the general
approach of Scheme II is shown in Scheme IV:
- 27 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98lZ6945
H
I
CI N CI
Resin-L~ N~N I C1
N''N
NIYH
Resin-L~-NH DIPE~
DMF
HZN-R~-NHZ DMF
H H H H H H
N N N, N N
P L ~ ~ ~ Ri ~ ~RZ Resin-L,~N~N~N'Ri NHZ
~w N' _, _ I IYN
I ) R2-NCO / THF
2) TFA / DCM
Scneme m
wherein L1 is any moiety that does not sterically hinder or
otherwise inhibit the coupling reaction under the reactions
conditions shown; P represents the end of L1 after it has been
cleaved from the solid support; and R1 and RZ are the same or
different and may be any moieties desired to provide a
library with preferred structural and reactive
characteristics. Examples of suitable moieties include, but
- 28 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
are not limited to, substituted and unsubstituted alkyl, aryl
and aralkyl.
According to Scheme IV, DTAF is immobilized upon a solid
support using diamino carbamate Wang resin or amino acid Rink
resin or diamino/amino alcohol trityl/chlorotrityl resin to
give monochlorotriazylaminofluorescein resin. This reaction
is preferably conducted at ambient temperature. DTAF is
dissolved in a suitable solvent such as DMF, NMP, THF,
methylene chloride, or mixtures thereof with between about
0.5 to about 3 equivalents of a base such as DIPEA,
triethylamine, DMAP, or N1~I. Substitution of the remaining
chloride on the triazine ring with an excess of symmetrical
diamine (preferably between about 2 to about 6 equivalents)
in, for example, DMF or NMP at ambient temperature provides a
new reactive group for further synthesis. This process is
repeated as many times, and with as many different reactants,
as desired, after which the resulting fluorescent compound or
mixture of compounds is cleaved from the reactive support.
Another embodiment of the general approach of Scheme II
is shown in Scheme V:
- 29 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
Resin
N
~L ,N
O
DIPEA
Resm~O~N ~Lt~NH D~ _
NHFmoc WRmNH DMF
O
~RZ Resin ~NH
N I t
Resin R~ N ~Lt.-N
N~ .N N Pyi3rOP
Lt
DMAP
DMF
H O
I
N
Fmocr OH
K2
~Ra
Piperidinel
DM 11IF
Res~
N I~~
~Li N N~L.N
t
'O or
SCI or
ZCI
5cneme v
wherein DCSF is attached to a solid support via substitution
of a chlorine atom by a secondary alkyl amine, and preferably
a cyclic secondary amine, bound to a resin. L1 thus forms
part of a cyclic diamine. Suitable cyclic diamines include,
for example, piperazine, homopiperazine, 4,4'-
- 30 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
trimethylenedipiperidine, and derivatives and isomers
thereof. As shown, Rz also forms part of a cyclic diamine,
although HNR1NH may be replaced by any compound having
suitable reactive groups. R2 and R3 represent any moieties
suitable for incorporation within the fluorescent ligands of
the libraries of this invention and include, for example, the
side chains of natural amino acids; substituted and
unsubstituted alkyl, aryl and aralkyl; and the like.
As shown in Scheme IV, an N-Fmoc protected amino acid is
attached to the fluorescent resin by the reaction of the free
amino group of the fluorescent compounds with the Fmoc amino
acid under standard amide formation conditions (i.e.,
PyBrOP/DMAP/DMF). After removal of the Fmoc group with
piperidine in DMF, the new amino group provided by the amino
acid can be derivatized with, for example, acid chlorides,
chloroformates or isocyanates to give a variety of
fluorescent labeled compounds. Non-limiting examples of
suitable isocyanide compounds are provided in Scheme VI:
NCO NCO O
/ ~ \ O~ / O/ /
'NCO
NCO
/ NCO
~O NCO I / NCO
0-6 ~ \ X
where X = F, CI, Br, or 1
/ NCO O NCO
/I
o'
~cneme vl
- 31 -
CA 02314431 2000-06-14
WO 99/31280 PCTNS9$/26945
As should be readily apparent to those skilled in the art,
numerous other moieties (i.e. , R9, R5, ~~~, Rn) comprising
reactive moieties such as amino acids, acid chlorides,
chloroformates, and isocyanates may be used to form the
ligands bound to DCSF. Similarly, the chemical fragments to
which the Rz and R3 groups of Scheme IV are attached may be
replaced by any others which will allow the growth of the
chain bound to the dye molecule provided that the reaction
conditions are altered in a suitable manner.
A final embodiment of the general approach of Scheme II
is shown in Scheme VII:
- 32 -
CA 02314431 2000-06-14
WO 99/31280 PCTNS98l26945
O H
~~\~ II I
I
O F
~~~N
I DIPEA
H L~
HN-R~-NH DMF
H
O N~
RZ
O H
O H R Resa~~N ~ _N_t~ a rrr.I
Resa~~N N ~N N
H
NH t I ) R2-NCO / THF
2) TFA / DCM
SCneme V11.
wherein DTAF is bound to a Rink amino acid resin, and then
subsequently derivatized by the methods described above. LI,
R, and RZ are deffined as above.
In addition to the above methods, fluorescent-labeled
ligand libraries are also made by general solid-phase
synthesis techniques (Obrecht, D. and Villalgordo, J.M.,
Solid-Supported Combinatorial and Parallel Synthesis of
Small-Molecular-Weight Compound Libraries, Pergamon, 1998;
- 33 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
and Bunin, B.A., The Combinatorial Index, Academic Press,
1998). In a preferred embodiment of the present invention,
the desired compounds are synthesized on the solid supports
according the methods described in the literature. Before
cleavage from the solid supports, the compounds on the solid
supports are treated with suitable dyes to give the
fluorescent-labeled ligands on resins. The ligands are then
cleaved from the resins to give the fluorescent-labeled
ligands.
In one approach, the ligands are synthesized in a linear
fashion by reaction of a solid supported reactive block with
different reactive blocks step by step. The dye is then
added in the last step before cleavage to give the labeled
ligands as shown in Scheme VIII. In this scheme,
fluorescent-labeled N-hydroxyquinzolinones are prepared.
Quinzalinones are one of the most common bioactive nitrogen
containing heterocycles (See, Sinha, S. and Srivastava, M.
in Progress in Drug Research, 1994, vol. 43, 143-238). They
display a broad spectrum of biological and pharmacological
activities in human and animals. They have been used as
anticonvulsant, antibacterial and antidiabetic agents.
Therefore, fluorescent-labeled quinzolines would be useful
for diagnostic applications and for drug discovery.
- 34 -
CA 02314431 2000-06-14
WO 99/31280 PCTNS981Z6945
U
O
U.
_C
N 'C
7 ~ Z ~ ~.L
O u. = O
O = ~~ O
,Z = z O
O Z -' O Z Z
~a v
\
N
a
.~
H
V H
LL ~i (L H
o ~ ~,~, g ~
v~ z a ~ c~ U
a
0
O v
O
O
a/P'J Z ~lh
H
Z
A O Z ~N U~ L!J IL Z N .O
O~O OZ ~ c
c O --~ O Z
cEu ~ 'r 'o
O L c
J
- 35
SUBSTITUTE SHEET (RULE 26)
CA 02314431 2000-06-14
WO 99/31I80 PGT/US98/26945
In another approach, the ligands are prepared in a
convergent manner using multicomponent condensation reactions
such as the Ugi condensation (Tempest, P.A., et al. Angew.
Chem. Int. Ed. Engl. 1996, vol. 35, 640-642). Using this
approach, the amine component is immobilized on the solid
support as Rink amine resin and the aldehydes, Fmoc-protected
amino acids, and isocyanides are added in excess to the resin
swelled in mixture of MeOH/DCM (1:2 v/v)(Scheme IX). By
combinatorial uses of different aldhydes, acids and
isocyanides, a large number of ligands may be synthesized.
- 35/I -
SUBSTITUTE SHEET (RULE 28)
CA 02314431 2000-06-14
WO 99/31280 PCT/US98l26945
c
I
Q a~
v
w ,
~N o =-Z o ~ x'Z a ~ =-z
o Q p~ o
z_= v
z ~a z /
O~ U
1 O~ .._~ O~ ~ 'N tn
~N
+ = z
J
I_
i
G
i
c
a
- 36 -
SUBSTITUTE SHEET (RULE 2E)
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
4.2 BIOLOGICAL SAMPLES
The present invention provides methods for
"fingerprinting" complex biological mixtures or samples
containing viral neuraminidase which may be obtained from a
wide variety of sources. Neuraminidase may be obtained from
a patient sample, cells infected with a virus which expresses
neuraminidase, recombinantly expressed neuraminidase or
purified neuraminidase obtained by using standard molecular
biology and protein purification techniques. The methods of
the present invention may be utilized to identify specific
phenotypical differences which exist between normal and
abnormal, e-Q., noninfected or infected cells and/or tissues.
The methods of the present invention may also be applied to
36/I _
suesTrrurE sHeEr ~RU~ zs~
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
identify or distinguish between species of microorganisms,
viruses, bacteria, fungi or parasites.
The methods of the present invention detect all types of
ligand/receptor interactions, whereby the neuraminidase
receptor could be a purified protein, nucleic acids encoding
NA or NA regulatory elements, or any molecules a shape that
is capable of representing neuraminidase, i.e., interacting
with neuraminidase specific probes or ligands. As used
herein, the target receptor--neuraminidase may be referred to
as-- "biological receptor", "receptor", "biological target",
"target" and "component of a biological sample".
Accordingly, one aspect of the present invention is a
method for characterizing an influenza viral infection, said
method comprising identifying a pattern of binding
interactions between neuraminidase receptors or targets
present in biological samples and a library of ligands or
probes, wherein the pattern of binding interactions provides
a unique fingerprint for the pathology.
In accordance with the present invention, a "receptor"
or "target" is a biological molecule which represents or
mimics neuraminidase binding affinities or enzymatic
activities including, but are not limited to, proteins,
including enzymes, antigens, antibodies, lipids, nucleic
acids including DNA and RNA, carbohydrates including lectins,
cell surface proteins or receptors, etc.
The biological samples utilized in the method can be any
sample that is a source of biological molecules, including
but not limited to, biological materials such as blood sera,
tissue samples, cell extracts, products from in vitro
transcription and translation systems (obtained, for example
by the method of U.S. Patent No. 5,654,150 issued to King et
a1.), and the like. Moreover, extracts derived from or
fluids containing pathogenic organisms such as bacteria,
yeast, fungi, viruses, protozoa, and the like may also be
used. In these instances, ligands exhibiting high affinity
and specificity for a protein or other receptor in the
- 37 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
pathogen may reveal new targets and can be tested for
inhibitory effect against the pathogen.
The biological samples which may be screened in
accordance with the methods of the present invention may be
obtained from a wide variety of sources. By way of example,
but not by limitation, biological samples or mixtures may be
obtained from patients and include bodily fluids, blood,
serum, mucous, including oral, rectal or intestinal mucosa,
urine, feces, etc. In addition biological samples may
include tissue samples, biopsy tissue, cell samples,
including bone marrow cells, lymphocytes, immune cells,
mucosal cells obtained from oral, rectal or intestinal
mucosal linings, etc. In yet another embodiment, the
biological samples or mixtures may encompass cell lysates or
portions thereof, carbohydrates including lectins; proteins
including glycoproteins, cell surface receptors, peptides;
nucleic acids including DNA or RNA etc. In yet another
embodiment the biological sample may be or may be derived
from a virus, bacteria, microorganism or parasite or fluids
containing such biological samples, e~cr., testing water
supplies for microorganism content.
The biological samples of the present invention may be
obtained from individuals inflicted with a disease, disorder,
or pathology infected with a virus, bacteria or other
microorganism. In yet another embodiment, the biological
samples may be generated by exposing a tissue, cells in
culture, cell extracts etc. to a toxin or pathogenic agent,
or by genetically engineering the genome of a cell in culture
to encode a mutation or protein or peptide known to be
associated with any given pathology or disorder.
Collections of biological materials as sources for
clinical samples may be obtained from hospitals or national
research facilities.
- 38 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/2b945
4.3 BCREENINC~i A88AYS TO DETBCT INFL08NSA
VIR08 NEQRAMINIDABE IN CLINICAL BAMPL88
Recognizing that clinical materials are often available
in only a limited supply for any given pathology, the third
element of the invention, the sensitive assay systems, must
be capable of detecting binding interactions occurring in
only microliters of sample and in addition, must be capable
of detecting binding interactions of less than optimal
affinity. The assay systems of the present invention must
also be capable of eliminating or greatly reducing
nonspecific binding of ligands to receptors present in the
sample. Recognizing these factors, the combinatorial assay
systems and detection methods of the present invention
improve upon existing systems such as fluorescence
polarization, scintillation proximity assays (SPA), and
enzyme-linked immunosorbent assays (ELISA).
The present invention provides rapid, specific assays
for detecting and diagnosing influenza virus. More
specifically the present invention provides methods for
detecting influenza virus neuraminidase (NA).
There are at least three approaches which can be
utilized to detect influenza virus infection on the basis of
NA. One approach is to utilize a labeled specific substrate
for influenza virus neuraminidase which would give rise to a
detectable signal upon enzymatic processing. This approach
provides a direct indication of the presence of the
neuraminidase and therefore the virus. Another approach is
to a utilize a labeled non-specific substrate for influenza
virus NA which would give rise to a detectable signal upon
enzymatic processing, except in the presence of a specific
inhibitor of influenza virus NA. The signal can be
attenuated in the presence of a specific inhibitor of
influenza virus NA. This approach provides an indirect
indication of the presence of the neuraminidase and therefore
the virus. A third approach is to utilize a labeled specific
inhibitor of viral NA which would give rise to a detectable
- 39 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
signal upon interaction with NA. This approach provides a
direct indication of the presence of neuraminidase and
therefore the virus.
4.3.1 DIAaNO8I8 OF INFLUENBA VIRUS INFECTION
Individuals can be diagnosed with influenza infection by
obtaining a nasal (or throat) swab or aspirate from them.
This can then be mixed in a small volume of carrier fluid.
In a preferred embodiment, the swab or aspirate can be
diluted in approximately 0.5m1 of carrier fluid. A labeled
specific or non-specific substrate for NA can be added to or
contained in the carrier fluid. The combination of a NA
substrate and a clinical sample will give rise to a
detectable signal upon enzymatic processing by influenza
virus NA. To ensure that the enzymatic activity detected
when using a non-specific substrate is due to influenza virus
neuraminidase, a specific inhibitor of influenza virus
neuraminidase should be added to the reaction mixture. The
addition of a specific inhibitor of influenza virus
neuraminidase to a mixture containing a non-specific
substrate for influenza virus NA and a clinical sample will
attenuate a detectable signal. These two approaches in the
diagnosis of influenza virus infection take advantage of the
enzymatic activity of influenza neuraminidase.
Another approach in the diagnosis of influenza virus
infection is to obtain a nasal swab or aspirate from an
individual and to mix it in carrier fluid with a labeled
neuraminidase specific inhibitor. The combination of a
neuraminidase specific inhibitor and a clinical sample will
give rise to a detectable signal if neuraminidase is present
in the clinical sample. Detection of a signal in this assay
will indicate the presence influenza virus.
In a preferred embodiment, these assays can be performed
in a physician's office to diagnosis influenza virus
infection. The assay systems described will provide the
physician with a rapid, specific, and accurate method of
- 40 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
diagnosing influenza virus infection. In another preferred
embodiment, the method of detection of neuraminidase is
sensitive enough to allow approximately 100 particles or less
to be detected.
4.4 HIGH THROUGB-PUT SCREENING ASSAYS TO IDENTIFY NOVEL
AGENTS WBICH MODULATE NEURAMINIDASE ACTIVITY
In another embodiment, novel agents that modulate
neuraminidase activity can be identified by high through-put
assay systems. These novel agents can include, but are not
limited to, drugs, ligands (natural or synthetic), ligand
antagonists, peptides, small organic molecules and the like.
One approach used to identify novel agents that modulate
neuraminidase activity consists of mixing an agent in carrier
fluid containing influenza virus or influenza neuraminidase
and a substrate for influenza NA. A detectable signal will
be generated if an agent does not inhibit influenza virus NA
activity. Whereas, agents that inhibit neuraminidase
activity will be detected by their ability to attenuate the
signal generated by the enzymatic processing of a non-
specific or specific influenza virus NA substrate by
influenza virus NA.
4.5 HIGH TBROUGB-PUT 8CRE8NING ASSAYS TO IDBNTIBY
NOVEL AG8NT8 WSICB INTERACT WITH NEURAMINIDABE
In another embodiment, novel agents that interact with
neuraminidase can be identified by rapid, specific, high
through-put assay systems. These novel agents can include,
but are not limited to, drugs, ligands (natural or
synthetic), ligand antagonists, peptides, small organic
molecules and the like. One approach to identify novel
agents that interact with influenza virus neuraminidase
consists of labeling agents and screening for those agents
that interact with neuraminidase. Another approach consists
of labeling neuraminidase and screening for agents that
interact with neuraminidase: A number of different assay
- 41 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
systems can be utilized to detect the interaction between an
agent and neuraminidase including, but not limited to
scintillation proximity assays (SPA), DNA obstruction assays,
fluorescence polarization assays.
4.5.1 SCINTILLATION PRO$IMITY A88AY
In SPA assays neuraminidase or agents can be bound to a
scintillant loaded bead. In standard a SPA assay, the
neuraminidase can be tagged with a scintillant-loaded bead
and screened against radiolabelled agents in solution.
However, the reverse of this arrangement in which the agent
is attached to the beads and the neuraminidase is
radiolabelled is possible. Multiple agents can be
synthesized on a bead. In such a system, beads loaded with
scintillant and coated with an agent are immersed in a fluid
phase containing radiolabelled neuraminidase. If the labeled
neuraminidase has affinity for a tagged agent and the two
become bound, the resulting proximity of the radiolabelled
neuraminidase and the scintillant in the beads leads to
activation of the scintillant and the emission of light. If
the labeled influenza virus neuraminidase has little or no
affinity for an agent, the radiolabel will not accumulate
sufficiently close to the scintillant to allow for enexgy
transfer following radioactive decay. Because SPA does not
require a washing step, it allows for the detection of
relatively low affinity agent/neuraminidase binding
interactions. In a preferred embodiment, beads are blocked
with blocking agents such as albumen, detergent or powdered
milk to block sites responsible for non-specific adsorption.
A modification of the SPA assay can be used in
competitive-type screening procedures where the neuraminidase
is immobilized to a scintillant-loaded bead and then placed
in a solution containing a radiolabelled agent which is known
to interact with neuraminidase. Agents with unknown affinity
for neuraminidase are then added to the mixture and any
substrate that successfully competes with the known agent for
- 42 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
the immobilized receptor will attenuate the amount of light
emitted. The use of SPA in a high through-put screen is
described in Wang, P., Target Identification, Assay
Development and High Throughput Screening in Drug Discovery,
in Sino-American Pharmaceutical Professionals Association
(SAPA), The 5th Regional Symposium on Drug Discovery and
Development, 1997, Kenilworth, NJ.
4.5.2 DNA OBBTROCTION A88AYS
The principles of this system are based upon the
presence or absence of restriction enzyme activity upon a DNA
construct that has been synthesized to include a single
restriction site and an agent-reporter system. When the
construct is contacted with neuraminidase,
agent/neuraminidase interactions will block the restriction
enzyme's access to its restriction site and prevent
hydrolysis of the construct at the site. Constructs that
remain intact can be isolated and the agent/neuraminidase
interaction identified.
The following is a description of a DNA restriction site
assay system. A single-stranded DNA oligonucleotide
containing biotin at the 5' end and digoxigenin at the 3' end
is annealed to a complementary oligonucleotide such that the
annealed double-stranded oligonucleotide contains a single
centrally located restriction endonuclease site. The
complementary oligonucleotide is modified to contain a linker
having a terminal amino group. The location of the amino
group, in this case between the 5th A and the 6th T from the
5' end, is such that it does not interfere with the activity
of the restriction enzyme toward the double stranded
oligonucleotide. The resulting construct, wherein the
GGATCC
sequence CCTAGG (SEQ ID. No. )is a restriction site, is
shown below:
- 43 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98l2b945
~2
5~
ATATATGGATCCATATATAT
biotin - UTATATACCTAGGTATATATAU - digoxigenin
3~ 5~
(SEQ ID. No. )
The amino group can be derivatized with agents of a
diverse library to form the construct shown below:
N - Agent
5' ~ 3'
ATATATGGATCCATATATAT
biotin - UTATATACCTAGGTATATATAU - digoxigenin
3~ 5~
(SEQ ID. No. )
The derivatization of the amino group can be
accomplished during synthesis of the single stranded oligomer
while it is still attached to the CPG bead, and alkaline
cleavage then used to release the oligomer from the bead
where it can then be annealed to the complementary biotin-
digoxigenin oligomer. As an alternative method of attaching
the agents, derivatized bases may be incorporated during the
synthesis of the complementary oligonucleotide.
When incubated With the restriction enzyme specific for
the restriction site according to procedures well known in
the art, the derivatized construct is hydrolyzed at the
restriction site to provide two sections as shown below:
N - AGENT
ATATATG GATCCATATATAT
biotin - UTATATACCTAG ' GTATATATAT - digoxigenin
(SEQ ID. No. )
Reaction of the hydrolyzed mixture with a streptavidin
or avidin coated surface results in the immobilization of the
biotin labeled section and the digoxigenin labeled section is
- 44 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
eliminated by washing. Reaction of the immobilized mixture
with anti-digoxigenin-peroxidaze antibody provides a negative
result because the digoxigenin labeled section has been
eliminated from the mixture by hydrolysis by the restriction
enzyme and subsequent washing.
When the intact agent-derivatized construct is mixed
with influenza virus neuraminidase, those agents with high
affinity for neuraminidase will bind to it. After an
incubation period, the reaction mixture is diluted with an
appropriate buffer and treated with restriction enzyme and
then incubated with a streptavidin coated surface to
immobilize the biotin molecules. The interaction between an
agent and neuraminidase will block th.e access of the
restriction enzyme to its recognition site and prevent
hydrolysis of the DNA scaffold.
N-AGENT-NEURAMINIDASE
5~ ~ 3'
ATATATGGATCCATATATAT
biotin - UTATATACCTAGGTATATATAU - digoxigenin
3i 5~
(SEQ ID. No. )
In the absence of an interaction between an agent and
neuraminidase, the restriction enzyme will hydrolyze the DNA
scaffold and free the digoxigenin-labeled portion of the
scaffold. A standard enzyme-linked immunosorbent assay
(ELISA) with anti-digoxigenin antibody can be used to detect
the presence of digoxigenin on the streptavidin surface. A
detectable signal indicates that the interaction between an
agent and neuraminidase blocked the access of the restriction
enzyme to its restriction site.
This assay can be modified in several ways. First,
neuraminidase instead of agents may be attached to the DNA
scaffold. Secondly, a deletion of a base can be inserted in
one of the strands of the double-stranded DNA scaffold and an
- 45 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
endonuclease can be utilized instead of a restriction enzyme.
Similar to the previous example, the interaction of an agent
and neuraminidase will block an endonuclease (i.e., mung bean
nuclease or SI nuclease) from accessing the gap and thus,
will prevent the hydrolysis of the DNA scaffold. Another way
the assay can be modified is to label the 3' end of the DNA
scaffold with radioactive bases instead of digoxigenin.
Furthermore, the DNA scaffold can be replaced with a backbone
composed of peptides or peptoids or any polymer with a
centrally located bond that can be cleaved by a particular
enzyme or other mechanism wherein the cleaving can be blocked
by the interaction of neuraminidase with an agent.
4.5.3 ~'LQORE8CBNC8 POhARIZATION
Another assay system that can be used to identify agents
with affinity for influenza virus neuraminidase is
fluorescent polarization. A fluorescence polarization assay
is designed to measure the binding of a fluorescent-labeled
compound to an unlabeled biomolecule. A fluorescence
polarization-based assay can utilize fluorescence labeled
compounds up to a molecular weight of approximately 10,000 to
detect interactions with the influenza virus neuraminidase.
The type of fluorescent labeled compounds that can be used
include, but are not limited to, small organic molecules,
peptides, small proteins, nucleic acids; lipids, and
polysaccharides. Fluorescent molecules when excited with
plan polarized light will emit light in a fixed plane only if
they do not rotate during the period between excitation and
emission. The extent of depolarization of the emitted light
will depend upon the amount of rotation of the molecules,
which is dependent upon the size of the molecule. Small
molecules rotate more than larger molecules between the time
they are excited and the time they emit fluorescent light.
The optimum conditions of this assay will exist when the
labeled compound is much smaller than the unlabeled
neuraminidase to which it binds. An unbound small
- 46 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
fluorescent-labeled compound rotates rapidly and the emitted
light is depolarized. The interaction between influenza
virus neuraminidase and a fluorescent-labeled compound will
increase the effective size of the fluorescent-labeled
compound and thus, decrease the rotation of the compound,
which will result in the emitted light remaining polarized.
The intensity of emitted, polarized light can be measured by
inserting a moveable polarizing filter in front of the
detector. The intensities are measured in planes 90° apart
and are many times designated the horizontal and vertical
intensities. In some instruments the excitation filter is
moveable while the emission filter is fixed. In certain
other machines the horizontal and vertical intensities are
measured simultaneously via fiber optics. Three companies,
Pan Vera, BMG Lab Technologies, and LJL Biosystems, market
research grade fluorescence polarization instruments and
Abott provides clinical laboratory instrumentation. The
value of fluorescence polarization is determined by the
following equation:
polarization= intensity,.P=t~~~:~.-intensitvh°rsZ°~~al
intensity.erit~a,+~ntensityh°riz~ntal
Fluorescence polarization values are most often divided by
1000 and expressed as millipolarization units (mP).
5. NRAMpLEB
5.1 DIAQrN08I8 OF INFLOENBA VIRDB INFECTION
5.1.1 NBURAMINIDABE ACTIVITY A88AY8
FOR DIAf3NOBINCi INFhOENBA
An individual suffering from influenza-like symptoms can
be diagnosed in their physician's office. The physician
swabs the individual's nasal passages and inoculates the swab
in carrier solution containing N-acetylneuraminic acid, non-
specific substrate for influenza virus neuraminidase. The
- 47 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/~6945
presence of neuraminidase in the clinical sample will result
in the hydrolysis of the conjugated substrate. To ensure
that the hydrolysis of the conjugated non-specific substrate
was due to the presence of influenza virus, a specific
inhibitor of influenza virus neuraminidase will be added to
the mixture. The addition of a specific inhibitor of
influenza virus neuraminidase, such as GR 217029 or GS4104,
to the carrier solution containing the conjugated N-
acetylneuraminic acid and the clinical sample will prevent
neuraminidase from hydrolyzing of the substrate and no light
will be detected. Thus, the specific presence of influenza
virus in the clinical sample will be indicated by the
attenuation of the detectable signal upon the addition of the
specific neuraminidase inhibitor.
Alternatively, the presence of influenza virus
neuraminidase in a clinical sample can be diagnosed by using
a specific substrate of influenza virus neuraminidase. In
this case, the glyceryl side chain of the N-acetylneuraminic
acid can be altered to provide the specificity. The presence
of influenza virus neuraminidase in the clinical sample will
result in the hydrolysis of the specific substrate and a
detectable signal will be generated.
A specific or non-specific substrate of neuraminidase
cam be conjugated to a chemiluminescent compound, such ds
hydroxyphenyldioxetane. Hydroxyphenyldioxetene conjugated N-
acetylneuraminic acid in the presence of neuraminidase
activity in the clinical sample will cleave the N-
acetylneuraminic acid oxygen bond of the
hydroxyphenyldioxetane, which destabilizes the dioxetane and
leads to the emission of a photon (Scheme 10). The photons
released can be detected by a photomultipler tube (a
luminometer) or a charge coupled device (CCD) camera.
To ensure that the enzymatic activity detected is due to
influenza virus neuraminidase, a specific inhibitor of
influenza virus neuraminidase can be added to the reaction
mixture. The addition of a specific inhibitor of influenza
- 48 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/26945
virus neuraminidase will prevent the cleavage of the N-
acetylneuraminic oxygen bond of the hydroxylphenyldioxetane
and will attenuate the signal generated (Scheme X).
OH OH
CO~ OH OH
O ~ ~...,, H O ~ .O
~~~ +
HN specific bH
O~ inhibition HN
CH~O ~H O OH
\_ CH~O
no light
O
.O'
,~ i
Iight "i. I +
.'
~~~3
8aheme $
- 49 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98/Z6945
5.1.2 A88AY8 FOR DIAGN08ING INFLUENZA
BA88D UPON THE PRE88NCE OF
INFLUENZA NEURAMINIDABE
An individual suffering from influenza-like symptoms can
be diagnosed in their physician's office. The physician
swabs the individual's nasal passages and inoculates the swab
in carrier solution containing a fluorescent labeled specific
inhibitor, such as GR 217029 or GS4104. The sample is
incubated with the labeled specific inhibitor for a
predetermined period of time. The interaction between the
inhibitor and influenza virus neuraminidase will affect the
polarization of the light detected in the fluorescence
polarization assay.
The value of the fluorescence polarization detected for
the clinical sample will need to be determined in order to
assess the significance of the polarization. The value of
the polarization for the clinical sample will be compared to
a positive control, consisting of influenza virus
neuraminidase and the fluorescent labeled specific inhibitor,
and a negative control, consisting of the coumarin labeled
specific inhibitor. A fluorescence polarization value close
to the positive control will indicate that the individual is
infected with influenza virus.
5.2 HIGH THROUGH-PUT A88AY FOR THE
IDENTIFICATION OF NOVEL AGENTS
5.2.1 AB8AY8 FOR THE IDENTIFICATION OF NOVEL AGENT
THAT MODULATE INFLUENZA VIRU8 NBURAMIIN'IDABE
Novel agents that modulate influenza virus
neuraminidase activity can be identified by combining agents
with influenza virus neuraminidase and labeled substrates for
neuraminidase. The substrates used may be non-specific
(i.e., N-acetylneuraminic acid) or specific for influenza
virus neuraminidase. The absence of an agent that modulates
influenza virus neuraminidase will result in the hydrolysis
of the conjugated substrate. Whereas, an agent that
- 50 -
CA 02314431 2000-06-14
WO 99/31280 PCT/US98IZ6945
modulates neuraminidase activity will prevent neuraminidase
from hydrolyzing of the substrate and a detectable signal
will be detected.
A specific or non-specific substrate of neuraminidase
can be conjugated to a chemiluminescent compound, such as
hydroxyphenyldioxetane. Hydroxyphenyldioxetane conjugated N-
acetylneuraminic acid in the presence of influenza virus
neuraminidase activity will cleave the N-acetyl neuraminic
acid oxygen bond of the hydroxyphenyldioxetane, which
destabilizes the dioxetane and leads to the emission of a
photon. The photons released can be detected by a
photomultipler tube (a luminometer) or a charge coupled
device (CCD) camera. An agent that interacts with the active
site of influenza virus neuraminidase or interacts non-
competitively with influenza virus neuraminidase will prevent
the cleavage of the N-acetylneuraminic acid oxygen bond of
hydroxylphenyldioxetane and will result in the attenuation of
the signal.
5.2.2 ABBAYS FOR T8S IDENTIFICATION OF
NOVBh AaENTB TBAT INTERACT WITH
INFLO$N8A VIROS NEDRAMINIDABE
Novel agents that interact with influenza virus
neuraminidase can be identified by combining fluorescently
conjugated influenza virus neuraminidase with agents. The
agents are incubated with the fluorescently labeled
neuraminidase for a predetermined period of time. The
interaction between the agents and influenza virus
neuraminidase will affect the polarization of the light
detected in the fluorescence polarization assay.
The value of the fluorescence polarization detected for
the agent will need to be determined in order to assess the
significance of the polarization. The value of the
polarization for the agents will be compared to a positive
control, consisting of fluorescently labeled influenza virus
neuraminidase and a known agent that interacts with
- 51 -
CA 02314431 2000-06-14
WO 99!31280 PCT/US98/26945
neuraminidase, and a negative control, consisting of the
fluorescently labeled influenza virus neuraminidase. A
fluorescence polarization value close to the positive control
will indicate that the agent interacts with influenza virus
neuraminidase. This assay can also be performed with the
agents conjugated to a fluorescent dye, as opposed to
influenza virus neuraminidase conjugated to a fluorescent
dye.
Other assay systems, such as a DNA scaffold obstruction
assay, can be utilized to determine the interaction between
influenza virus neuraminidase and an agent. Furthermore, in
these assay systems the agents or influenza virus
neuraminidase can be conjugated with a radioactive base or a
chemiluminescent compound. The interaction between influenza
virus neuraminidase and an agent can be detected by a gamma
counter or scintillation counter when one or the other is
conjugated to a radioactive base. Moreover, the interaction
between an agent and neuraminidase can be detected with a
luminometer when one or the other is labeled with a
chemiluminescent compound.
The present invention is not to be limited in scope by
the specific embodiments described which are intended as
single illustrations of individual aspects of the invention.
Indeed, various modifications of the invention in addition to
those shown and described herein will become apparent to
those skilled in the art from the foregoing description and
accompanying drawings. Such modifications are intended to
fall within the scope of the invention.
All references cited herein are incorporated herein by
reference in the entirety for all purposes
- 52 -
