Note: Descriptions are shown in the official language in which they were submitted.
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
REAGENTS AND METHODS USEFUL FOR DETECTING
DISEASES OF THE PANCREAS
S ack~round of the Invention
The invention relates generally to detecting diseases of the pancreas.
More particularly, the present invention relates to reagents such as
polynucieotide
sequences; polypeptide sequences encoded thereby, as well as methods which
utilize these sequences, all of which are useful for detecting, diagnosing,
staging,
monitoring, prognosticating, in vivo imaging, preventing or treating, or
determining predisposition to diseases or conditions of the pancreas such as
pancreatic cancer.
Pancreatic cancer has the fifth highest mortality among cancers in the U.S.
with a projected 28,900 deaths during 1998. The number of pancreatic cancer-
related deaths is about the same as the incidence of this disease which is
estimated
to be 29, 000 new cases during 1998. (American Cancer Society statistics).
Pancreatic cancer is, therefore, almost always fatal.
Improved procedures for detecting, diagnosing, staging, monitoring,
prognosticating, in vivo imaging, preventing or treating, or determining
predisposition to diseases or conditions of the pancreas, especially
pancreatic
cancer, are of critical importance to improving the outcome of the patient.
For
example, patients diagnosed with regional or distantly metastasized pancreatic
cancers have only 5% and 2% five year survival rates, respectively. (American
Cancer Society statistics). Greater than 80% of pancreatic cancers have
progressed beyond the pancreas at diagnosis and at least half of these involve
visceral metastases. M. F. Brennan, a al. In: Cancer: Principles and Practice
of
colo , fourth Edition, pp. 849-882, Philadelphia, PA: JB. Lippincott Co.
(1993). The inability to detect this cancer at an early stage is due to the
absence
of early symptoms and to the appearance of nonspecific symptoms when they do
occur resulting in delayed diagnosis. In addition, there are no simple
procedures
for accurately detecting early pancreatic cancer in an asymptomatic
population.
Currently, ultrasonography and computed tomography (CT) are most frequently
CA 02315263 2000-06-13
WO 99/31274 PCTNS98/26441
used for diagnosing pancreatic cancer in suspected cases. H. J. Wanebo, et
al.,
Seminars in Surgical Oncology 11: 168-180 (1995). New diagnostic methods
which are sensitive and specific for detecting early pancreatic cancer and
which
are simple to perform are clearly needed.
An important step in managing pancreatic cancer is to determine the stage
of the patient's disease. Such staging has potential prognostic value and
provides
criteria for designing optimal therapy. Currently, the clinical staging of
pancreatic
cancer depends on imaging modalities such as CT and endoscopic retrograde
cholangiopancreatography. If clinical staging indicates the tumor is
unresectable,
histologic confirmation should be obtained. M. F. Brennan, goal., supra.
Disadvantages of imaging methods include technical problems which can limit
the sensitivity of tumor detection, positioning and cooperation of the
patient, and
interpretation of the image by the radiologist. Histologic evaluation requires
invasive procedures and is also subjective in nature. Staging of pancreatic
cancer
could be improved by detecting new markers in serum or other bodily fluids
which could differentiate between different stages of invasion. Such markers
could be mRNA or protein markers expressed by cells originating from the
primary tumor in the pancreas but residing in blood, bone marrow or lymph
nodes
and could serve as sensitive indicators for metastasis to these distal organs.
In
colorectal cancer, for example, specific protein antigens and mRNA, associated
with colorectal epithelial cells, have been detected by immunohistochemical
techniques and RT-PCR, respectively, in bone marrow and lymph nodes of
colorectal cancer patients suggesting metastasis. K. Pantel, t~l., to i 18:
394-401 (1995).
Pancreatic cancer patients are monitored following initial therapy and
during adjuvant therapy to determine the patient's response, and to detect
persistent or recurrent disease, or early distant metastasis. One monitoring
method is the measurement of serum CA 19-9 which is an antigen found to be
elevated in the serum of patients having pancreatic cancer. Other serologic
markers have been evaluated for managing pancreatic cancer patients including
CEA, DU-PAN-2 and CA 50. None of these markers, however, are highly
specific for pancreatic cancer, as they can be elevated in various benign
conditions
2
CA 02315263 2000-06-13
WO 99131274 PCT/US98/26441
and other types of cancer. They also have poor sensitivity for early stage
pancreatic cancer. M.K. Schwartz. In: Cancer: Principles and Practice of
Oncology, Fourth Edition, pp. 531-542, Philadelphia, PA: JB. Lippincott Co.
(1993). M. F. Brennan, et al., su rya. Therefore, it would be clinically
beneficial to
find a pancreatic-associated marker which is more sensitive and specific in
detecting cancer recurrence.
Diagnosis of diseases of the pancreas could be improved by discovering
markers that appear in test samples obtained by minimally invasive procedures
such
as blood, plasma, serum, or urine, and are subsequently detected by
immunological
methods. Tests based on such markers would provide information to aid the
physician in managing the patient with disease of the pancreas at low cost to
the
patient. Markers such as prostate specific antigen (PSA) and human chorionic
gonadotropin (hCG) exist and are used clinically for screening patients for
prostate
cancer and testicular cancer, respectively. For example, PSA normally is
secreted by
the prostate at high levels into the seminal fluid, but is present in very low
levels in
the blood of men with normal prostates. Elevated levels of PSA protein in
serum are
used in the early detection of prostate cancer in asymptomatic men. G.E.
Hanks, et
al., In: Cancer: Principles and Practice of Oncology, Fourth Edition, pp. 1073-
1113,
Philadelphia, PA: J.B. Lippincott Co. 1993. M. K. Schwartz, gl,~l.,, sub
Likewise,
the management of diseases of the pancreas could be improved by the use of new
markers, normally expressed in the pancreas, but found in elevated amounts in
an
inappropriate body compartment as a result of disease of the pancreas.
It would be advantageous, therefore, to provide specific methods and
reagents useful for detecting, diagnosing, staging, monitoring,
prognosticating, in
vivo imaging, preventing or treating, or determining predisposition to
diseases or
conditions of the pancreas. Such methods would include assaying a test sample
for products of a gene which are overexpressed in diseases and conditions
associated with the pancreas, including cancer. Such methods may also include
assaying a test sample for products of a gene which have been altered by the
disease or condition associated with the pancreas, including cancer. Such
methods may further include assaying a test sample for products of a gene
whose
distribution among the various tissues and compartments of the body has been
3
CA 02315263 2000-06-13
W O 99/31274 PCT/US98/26441
altered by a pancreas-associated disease or condition, including cancer. Such
methods would comprise making cDNA from mRNA in the test sample,
amplifying, when necessary, portions of the cDNA corresponding to the gene or
a
fragment thereof, and detecting the cDNA product as an indication of the
presence
of the disease or condition, including cancer, or detecting translation
products of
the mRNAs comprising gene sequences as an indication of the presence of the
disease. Useful reagents include polynucleotide(s), or fragments) thereof,
which
may be used in diagnostic methods such as reverse transcriptase-polymerise
chain
reaction (RT-PCR), PCR, or hybridization assays of mRNA extracted from
biopsied tissue, blood or other test samples; or proteins which are the
translation
products of such mRNAs; or antibodies directed against these proteins. Such
assays would include, for example, methods for assaying a sample for products)
of the gene and detecting the products) as an indication of disease of the
pancreas. Drug treatment or gene therapy for diseases and conditions of the
1 S pancreas, including cancer, can be based on these identified gene
sequences or
their expressed proteins, and efficacy of any particular therapy can be
monitored.
Furthermore, it would be advantageous to have available alternative, non-
surgical
diagnostic methods capable of detecting early stage pancreatic disease such as
cancer.
Summary of the Invention
The present invention provides a method of detecting a target PA153
polynucleotide in a test sample which comprises contacting the test sample
with at
least one PA153-specific polynucleotide and detecting the presence of the
target
PA153 polynucleotide in the test sample. The PA153-specific polynucleotide has
at
least 80% identity with a polynucleotide selected from the group consisting of
SEQUENCE ID NO 1, SEQUENCE m NO 2, SEQUENCE ID NO 3, SEQUENCE
ID NO 4, SEQUENCE ID NO 5, SEQUENCE ID NO 6, SEQUENCE ID NO 7,
SEQUENCE ID NO 8, SEQUENCE ID NO 9, SEQUENCE ID NO 10, SEQUENCE
ID NO 11 (SEQUENCE ID NOS 1-11), and fragments or complements thereof.
Also, the PA153-specific polynucleotide may be attached to a solid phase prior
to
performing the method.
4
CA 02315263 2000-06-13
WO 99/31274 PC'T/US98/26441
The present invention also provides a method for detecting PA153 mRNA in a
test sample, which comprises performing reverse transcription (RT) with at
least one
primer in order to produce cDNA, amplifying the cDNA so obtained using PA153
oligonucleotides as sense and antisense primers to obtain PA153 amplicon, and
detecting the presence of the PA153 amplicon as an indication of the presence
of
PA153 mRNA in the test sample, wherein the PA153 oligonucleotides have at
least
80% identity with a sequence selected from the group consisting of SEQUENCE m
NOS 1-11, and fragments or complements thereof. Amplification can be performed
by the polymerase chain reaction. Also, the test sample can be reacted with a
solid
phase prior to performing the method, prior to amplification or prior to
detection.
This reaction can be a direct or an indirect reaction. Further, the detection
step can
comprise utilizing a detectable label capable of generating a measurable
signal. The
detectable label can be attached to a solid phase.
The present invention further provides a method of detecting a target PA153
polynucleotide in a test sample suspected of containing target PA153
polynucleotides,
which comprises (a) contacting the test sample with at least one PA1S3
oligonucleotide as a sense primer and at least one PA153 oligonucleotide as an
anti-
sense primer, and amplifying same to obtain a first stage reaction product;
(b)
contacting the first stage reaction product with at least one other PA1S3
oligonucleotide to obtain a second stage reaction product, with the proviso
that the
other PA153 oligonucleotide is located 3' to the PA153 oligonucleotides
utilized in
step (a) and is complementary to the first stage reaction product; and (c)
detecting the
second stage reaction product as an indication of the presence of a target
PA153
polynucleotide in the test sample. The PA153 oligonucleotides selected as
reagents in
the method have at least 80% identity with a sequence selected from the group
consisting of SEQUENCE iD NOS 1-11, and fragments or complements thereof.
Amplification may be performed by the polymerase chain reaction. The test
sample
can be reacted either directly or indirectly with a solid phase prior to
performing the
method, or prior to amplification, or prior to detection. The detection step
also
comprises utilizing a detectable label capable of generating a measurable
signal;
further, the detectable label can be attached to a solid phase.
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Test kits useful for detecting target PA153 polynucleotide in a test sample
are
also provided which comprise a container containing at least one PA153
specific
polynucleotide selected from the group consisting of SEQUENCE ID NOS 1-11, and
fragments or complements thereof. These test kits further comprise containers
with
tools useful for collecting test samples (such as, for example, blood, urine,
saliva and
stool). Such tools include lancets and absorbent paper or cloth for collecting
and
stabilizing blood; swabs for collecting and stabilizing saliva; and cups for
collecting
and stabilizing urine or stool samples. Collection materials, such as papers,
cloths,
swabs, cups, and the like, may optionally be treated to avoid denaturation or
irreversible adsorption of the sample. The collection materials also may be
treated
with or contain preservatives, stabilizers or antimicrobial agents to help
maintain the
integrity of the specimens.
The present invention also provides a purified polynucleotide or fragment
thereof derived from a PA153 gene. The purified polynucleotide is capable of
selectively hybridizing to the nucleic acid of the PA153 gene, or a complement
thereof. The polynucleotide has at least 80% identity with a polynucleotide
selected
from the group consisting of SEQUENCE ID NOS 1-11, and fragments or
complements thereof. Further, the purified polynucleotide can be produced by
recombinant and/or synthetic techniques. The purified recombinant
polynucleotide
can be contained within a recombinant vector. The invention further comprises
a host
cell transfected with the recombinant vector.
The present invention further provides a recombinant expression system
comprising a nucleic acid sequence that includes an open reading frame derived
from
PA153. The nucleic acid sequence has at least 80% identity with a sequence
selected
from the group consisting of SEQUENCE m NOS 1-11, and fragments or
complements thereof. The nucleic acid sequence is operably linked to a control
sequence compatible with a desired host. Also provided is a cell transfected
with this
recombinant expression system.
The present invention also provides a polypeptide encoded by PA153. The
polypeptide can be produced by recombinant technology, provided in purified
form,
or produced by synthetic techniques. The polypeptide comprises an amino acid
sequence which has at least 80% identity with an amino acid sequence selected
from
6
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
the group consisting of SEQUENCE ID NO 28, SEQUENCE ID NO 29,
SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof.
Also provided is a specific binding molecule, such as an antibody, which
specifically binds to at least one PA153 epitope. The antibody can be a
polyclonal or
monoclonal antibody. The epitope is derived from an amino acid sequence
selected
from the group consisting of SEQUENCE ID NO 28, SEQUENCE ID NO 29,
SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof. Assay kits for determining the presence of PA153 antigen or
anti-
PA153 antibody in a test sample are also included. In one embodiment, the
assay kits
comprise a container containing at least one PA153 polypeptide having at least
80%
identity with an amino acid sequence selected from the group consisting of
SEQUENCE ID NO 28, SEQUENCE ID NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, SEQUENCE ID NO 32, and fragments thereof. Further, the
test kit can comprise a container with tools useful for collecting test
samples (such as
blood, urine, saliva, and stool). Such tools include lancets and absorbent
paper or
cloth for collecting and stabilizing blood; swabs for collecting and
stabilizing saliva;
and cups for collecting and stabilizing urine or stool samples. Collection
materials
such as papers, cloths, swabs, cups, and the like, may optionally be treated
to avoid
denaturation or irreversible adsorption of the sample. These collection
materials also
may be treated with or contain preservatives, stabilizers or antimicrobial
agents to
help maintain the integrity of the specimens. Also, the polypeptide can be
attached to
a solid phase.
In another embodiment of the invention, antibodies or fragments thereof
against the PA153 antigen can be used to detect or image localization of the
antigen
in a patient for the purpose of detecting or diagnosing a disease or
condition. Such
antibodies can be polyclonal or monoclonal, or made by molecular biology
techniques, and can be labeled with a variety of detectable labels, including
but not
limited to radioisotopes and paramagnetic metals. Furthermore, antibodies or
fragments thereof, whether monoclonal, polyclonal, or made by molecular
biology
techniques, can be used as therapeutic agents for the treatment of diseases
characterized by expression of the PA153 antigen. In the case of therapeutic
7
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
applications, the antibody may be used without derivitization, or it may be
derivitized
with a cytotoxic agent such as a radioisotope, enzyme, toxin, drug, prodrug,
or the
like.
Another assay kit for determining the presence of PA153 antigen or anti-
PA153 antibody in a test sample comprises a container containing a specific
binding
molecule, such as an antibody, which specifically binds to a PA153 antigen,
wherein
the PA153 antigen comprises at least one PA153-encoded epitope. The PA153
antigen has at least about 80% sequence identity to a sequence of a PA153-
encoded
antigen selected from the group consisting of SEQUENCE ID NO 28, SEQUENCE
ID NO 29, SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32,
and fragments thereof. These test kits can further comprise containers with
tools
useful for collecting test samples (such as blood, urine, saliva, and stool).
Such tools
include lancets and absorbent paper or cloth for collecting and stabilizing
blood;
swabs for collecting and stabilizing saliva; cups for collecting and
stabilizing urine or
1 S stool samples. Collection materials, such as papers, cloths, swabs, cups
and the Like,
may optionally be treated to avoid denaturation or irreversible adsorption of
the
sample. These collection materials also may be treated with, or contain,
preservatives, stabilizers or antimicrobial agents to help maintain the
integrity of the
specimens. The antibody can be attached to a solid phase.
A method for producing a polypeptide which contains at least one epitope of
PA153 is provided, which method comprises incubating host cells transfected
with an
expression vector. This vector comprises a polynucleotide sequence encoding a
polypeptide, wherein the polypeptide comprises an amino acid sequence having
at
least 80% identity with a PA153 amino acid sequence selected from the group
consisting of SEQUENCE ID NO 28, SEQUENCE ID NO 29, SEQUENCE ID NO
30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and fragments thereof.
A method for detecting PA153 antigen in a test sample suspected of
containing PA153 antigen also is provided. The method comprises contacting the
test
sample with a specific binding molecule, such as an antibody or fragment
thereof,
which specifically binds to at least one epitope of PA153 antigen, for a time
and
under conditions sufficient for the formation of antibody/antigen complexes;
and
detecting the presence of such complexes containing the antibody as an
indication of
8
CA 02315263 2000-06-13
WO 99131274 PCT/US98I26441
the presence of PA153 antigen in the test sample. The antibody can be attached
to a
solid phase and may be either a monoclonal or polyclonal antibody.
Furthermore, the
specific binding molecule specifically binds to at least one PA153 antigen
selected
from the group consisting of SEQUENCE ID NO 28, SEQUENCE m NO 29,
SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE TD NO 32, and
fragments thereof.
Another method is provided which detects antibodies which specifically bind
to PA153 antigen in a test sample suspected of containing these antibodies.
The
method comprises contacting the test sample with a polypeptide which contains
at
least one PA153 epitope, wherein the PA153 epitope comprises an amino acid
sequence having at least 80% identity with an amino acid sequence encoded by a
PA153 polynucleotide, or a fragment thereof. Contacting is performed for a
time and
under conditions sufficient to allow antigen/antibody complexes to form. The
method
further entails detecting complexes which contain the polypeptide. The
polypeptide
can be attached to a solid phase. Further, the polypeptide can be a
recombinant
protein or a synthetic peptide having at least 80% identity with an amino acid
sequence selected from the group consisting of SEQUENCE ID NO 28, SEQUENCE
ID NO 29, SEQUENCE m NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32,
and fragments thereof.
The present invention provides a cell transfected with a PA153 nucleic acid
sequence that encodes at least one epitope of a PA153 antigen, or fragment
thereof.
The nucleic acid sequence is selected from the group consisting of SEQUENCE m
NOS 1-11, and fragments or complements thereof.
A method for producing antibodies to PA153 antigen also is provided, which
method comprises administering to an individual an isolated immunogenic
polypeptide or fragment thereof, wherein the isolated immunogenic polypeptide
comprises at least one PA153 epitope. The immunogenic polypeptide is
administered
in an amount sufficient to produce an immune response. The isolated,
immunogenic
polypeptide comprises an amino acid sequence selected from the group
consisting of
SEQUENCE ID NO 28, SEQUENCE m NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, SEQUENCE ID NO 32, and fragments thereof.
9
CA 02315263 2000-06-13
WO 99/312?4 PCT/US98126441
Another method for producing antibodies which specifically bind to PA153
antigen is disclosed, which method comprises administering to an individual a
plasmid comprising a nucleic acid sequence which encodes at least one PA153
epitope derived from an amino acid sequence selected from the group consisting
of
SEQUENCE ID NO 28, SEQUENCE ID NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, SEQUENCE ID NO 32, and fragments thereof. The plasmid
is administered in an amount such that the plasmid is taken up by cells in the
individual and expressed at levels sufficient to produce an immune response.
Also provided is a composition of matter that comprises a
PA153 polynucleotide of at least about 10-12 nucleotides having at least 80%
identity with a polynucleotide selected from the group consisting of SEQUENCE
ID
NOS 1-11, and fragments or complements thereof. The PA153 polynucleodde
encodes an amino acid sequence having at least one PA153 epitope. Another
composition of matter provided by the present invention comprises a
polypeptide with
at least one PA153 epitope of about 8-10 amino acids. The polypeptide
comprises an
amino acid sequence having at least 80% identity with an amino acid sequence
selected from the group consisting of SEQUENCE ID NO 28, SEQUENCE ID NO
29, SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof. Also provided is a gene, or fragment thereof, coding for a
PA153
polypeptide which has at least 80% identity with SEQUENCE ID NO 28, and a
gene,
or a fragment thereof comprising DNA having at least 80% identity with
SEQUENCE ID NO 10 or SEQUENCE ID NO 11.
Brief Descrivtion of the Drawings
Figures lA-1D show the nucleotide alignment of clones 2075919H1
(SEQUENCE ID NO 1), 2383634H1 (SEQUENCE ID NO 2), 5069724H1
(SEQUENCE ID NO 3), 5070712H1 (SEQUENCE ID NO 4), 2773816H1
(SEQUENCE ID NO S), 2374806H1 (SEQUENCE ID NO 6), 5071731H1
(SEQUENCE ff~ NO 7), 883484H1 (SEQUENCE ID NO 8), 887213H1
(SEQUENCE ID NO 9), the full-length sequence of clone 2075919 [designated as
2075919inh (SEQUENCE ID NO 10)], and the consensus sequence (SEQUENCE ID
NO 11 ) derived therefrom.
CA 02315263 2000-06-13
WO 99131274 PCT/US98/26441
Figure 2 shows the contig map depicting the formation of the consensus
nucleotide sequence (SEQUENCE ID NO 11) from the nucleotide alignment of
overlapping clones 2075919H1 (SEQUENCE ID NO 1), 2383634H1 (SEQUENCE
ID NO 2), 5069724H1 (SEQUENCE ID NO 3), 5070712H1 (SEQUENCE ID NO 4),
2773816H1 (SEQUENCE ID NO 5), 2374806H1 (SEQUENCE ID NO 6),
5071731H1 (SEQUENCE ID NO 7), 883484H1 (SEQUENCE ID NO 8), 887213H1
(SEQUENCE ID NO 9), and 2075919inh (SEQUENCE ID NO 10).
Figure 3 is a scan of a SYBR~ Green stained agarose gel of PA153 RNA
specific RT-PCR amplification products using various normal and cancer tissue
RNAs
as templates.
Figure 4 shows the results of the Western blot performed on a panel of tissue
protein extracts probed with antiserum against PA153 synthetic peptide
(SEQUENCE
ID NO 32).
I 5 Detailed Description of the Invention
The present invention provides a gene, or a fragment thereof, which codes for
a PA153 polypeptide having at least about 80% identity with SEQUENCE ID NO 28.
The present invention further encompasses a PA153 gene, or a fragment thereof,
comprising DNA which has at least about 80% identity with SEQUENCE ID NO 10
or SEQUENCE ID NO 11.
The present invention also provides methods for assaying a test sample for
products of a pancreatic tissue gene designated as PA153, which comprises
making
cDNA from mRNA in the test sample, and detecting the cDNA as an indication of
the
presence of pancreatic tissue gene PA153. The method may include an
amplification
step, wherein one or more portions of the mRNA from PA153 corresponding to the
gene or fragments thereof, is amplified. Methods also are provided for
assaying for
the translation products of PA153. Test samples which may be assayed by the
methods provided herein include tissues, cells, body fluids and secretions.
The
present invention also provides reagents such as oligonucleotide primers and
polypeptides which are useful in performing these methods.
Portions of the nucleic acid sequences disclosed herein are useful as primers
for the reverse transcription of RNA or for the amplification of cDNA; or as
probes to
11
CA 02315263 2000-06-13
WO 99/31274 PC'T/U898/26441
determine the presence of certain mRNA sequences in test samples. Also
disclosed
are nucleic acid sequences which permit the production of encoded polypeptide
sequences which are useful as standards or reagents in diagnostic
immunoassays, as
targets for pharmaceutical screening assays and/or as components or as target
sites for
various therapies. Monoclonal and polyclonal antibodies directed against at
least one
epitope contained within these polypeptide sequences are useful as delivery
agents for
therapeutic agents as well as for diagnostic tests and for screening for
diseases or
conditions associated with PA153, especially pancreatic cancer. Isolation of
sequences of other portions of the gene of interest can be accomplished
utilizing
probes or PCR primers derived from these nucleic acid sequences. This allows
additional probes of the mRNA or cDNA of interest to be established, as well
as
corresponding encoded polypeptide sequences. These additional molecules are
useful
in detecting, diagnosing, staging, monitoring, prognosticating, in v, ivo
imaging,
preventing or treating, or determining the predisposition to diseases and
conditions of
the pancreas, such as pancreatic cancer, characterized by PA153, as disclosed
herein.
The compositions and methods described herein will enable the identification
of certain markers as indicative of a pancreatic tissue disease or condition;
the
information obtained therefrom will aid in the detecting, diagnosing, staging,
monitoring, prognosticating, in vivo imaging, preventing or treating, or
determining
diseases or conditions associated with PA153, especially pancreatic cancer.
Test
methods include, for example, probe assays which utilize the sequences)
provided
herein and which also may utilize nucleic acid amplification methods such as
the
polymerase chain reaction {PCR), the ligase chain reaction (LCR), and
hybridization.
In addition, the nucleotide sequences provided herein contain open reading
fi-ames from which an immunogenic epitope may be found. This epitope is
believed
to be unique to the disease state or condition associated with PA153. It also
is
thought that the polynucleotides or polypeptides and protein encoded by the
PA153
gene are useful as a marker. This marker is either elevated in disease such as
pancreatic cancer, altered in disease such as pancreatic cancer, or present as
a normal
protein but appearing in an inappropriate body compartment. The uniqueness of
the
epitope may be determined by (i) its immunological reactivity and specificity
with
antibodies directed against proteins and polypeptides encoded by the PA153
gene,
12
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
and (ii) its nonreactivity with any other tissue markers. Methods for
determining
irnmunological reactivity are well-known and include, but are not limited to,
for
example, radioimmunoassay (RIA), enzyme-linked immunoabsorbent assay (ELISA),
hemagglutination (HA), fluorescence polarization immunoassay (FPIA),
chemiluminescent immunoassay (CLIA) and others. Several examples of suitable
methods are described herein.
Unless otherwise stated, the following terms shall have the following
meanings:
A polynucleotide "derived from" or "specific for" a designated sequence refers
to a polynucleotide sequence which comprises a contiguous sequence of
approximately at least about 6 nucleotides, preferably at least about 8
nucleotides,
more preferably at least about 10-12 nucleotides, and even more preferably at
least
about 15-20 nucleotides corresponding, i.e., identical or complementary to, a
region
of the designated nucleotide sequence. The sequence may be complementary or
identical to a sequence which is unique to a particular polynucleotide
sequence as
determined by techniques known in the art. Comparisons to sequences in
databanks,
for example, can be used as a method to determine the uniqueness of a
designated
sequence. Regions from which sequences may be derived, include but are not
limited
to, regions encoding specific epitopes, as well as non-translated and/or non-
transcribed regions.
The derived polynucleotide will not necessarily be derived physically from the
nucleotide sequence of interest under study, but may be generated in any
manner,
including, but not limited to, chemical synthesis, replication, reverse
transcription or
transcription, which is based on the information provided by the sequence of
bases in
the regions) from which the polynucleotide is derived. As such, it may
represent
either a sense or an antisense orientation of the original polynucleotide. In
addition,
combinations of regions corresponding to that of the designated sequence may
be
modified in ways known in the art to be consistent with the intended use.
A "fragment" of a specified polynucleotide refers to a polynucleotide
sequence which comprises a contiguous sequence of approximately at least about
6
nucleotides, preferably at least about 8 nucleotides, more preferably at least
about 10-
12 nucleotides, and even more preferably at least about 15-20 nucleotides
13
CA 02315263 2000-06-13
WO 99/312'14 PCT/US98/26441
corresponding, i.e., identical or complementary to, a region of the specified
nucleotide
sequence.
The term "primer" denotes a specific oligonucleotide sequence which is
complementary to a target nucleotide sequence and used to hybridize to the
target
nucleotide sequence. A primer serves as an initiation point for nucleotide
polymerization catalyzed by either DNA polymerise, RNA polymerise or reverse
transcriptase.
The term "probe" denotes a defined nucleic acid segment (or nucleotide
analog segment, e.g., PNA as defined hereinbelow) which can be used to
identify a
specific polynucleotide present in samples bearing the complementary sequence.
"Encoded by" refers to a nucleic acid sequence which codes for a polypeptide
sequence, wherein the polypeptide sequence or a portion thereof contains an
amino
acid sequence of at least 3 to 5 amino acids, more preferably at Ieast 8 to 10
amino
acids, and even more preferably at least 15 to 20 amino acids from a
polypeptide
encoded by the nucleic acid sequence. Also encompassed are polypeptide
sequences
which are immunologically identifiable with a polypeptide encoded by the
sequence.
Thus, a "polypeptide," "protein," or "amino acid" sequence has at least about
50%
identity, preferably about 60% identity, more preferably about 80-85%
identity, and
most preferably about 90-95% or more identity with a PA153 amino acid
sequence.
Further, the PA153 "polypeptide," "protein," or "amino acid" sequence may have
at
least about 60% similarity, preferably at least about 75% similarity, more
preferably
about 85% similarity, and most preferably about 95% or more similarity to a
polypeptide or amino acid sequence of PA153. This amino acid sequence can be
selected from the group consisting of SEQUENCE )Z? NO 28, SEQUENCE ID NO
29, SEQUENCE )D NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof.
A "recombinant polypeptide," "recombinant protein," or "a polypeptide
produced by recombinant techniques," which terms may be used interchangeably
herein, describes a polypeptide which by virtue of its origin or manipulation
is not
associated with all or a portion of the polypepdde with which it is associated
in nature
and/or is linked to a polypeptide other than that to which it is linked in
nature. A
recombinant or encoded polypeptide or protein is not necessarily translated
from a
14
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
designated nucleic acid sequence. It also may be generated in any manner,
including
chemical synthesis or expression of a recombinant expression system.
The term "synthetic peptide" as used herein means a polymeric form of
amino acids of any length, which may be chemically synthesized by methods well-
s known to the routineer. These synthetic peptides are useful in various
applications.
The term "polynucleotide" as used herein means a polymeric form of
nucleotides of any length, either ribonucleotides or deoxyribonucleotides.
This term
refers only to the primary structure of the molecule. Thus, the term includes
double-
and single-stranded DNA, as well as double- and single-stranded RNA. It also
includes modifications, such as methylation or capping and unmodified forms of
the
polynucleotide. The terms "polynucleotide," "oligomer," "oligonucleotide," and
"oligo" are used interchangeably herein.
"A sequence corresponding to a cDNA" means that the sequence contains a
polynucleotide sequence that is identical or complementary to a sequence in
the
designated DNA. The degree (or "percent" ) of identity or complementarity to
the
cDNA will be approximately 50% or greater, preferably at least about 70% or
greater,
and more preferably at least about 80% or greater, and most preferably at
least about
90% or greater. The sequence that corresponds to the identified cDNA will be
at least
about 50 nucleotides in length, preferably at least about 60 nucleotides in
length, and
more preferably at least about 70 nucleotides in length. The correspondence
between
the gene or gene fi~agment of interest and the cDNA can be determined by
methods
known in the art and include, for example, a direct comparison of the
sequenced
material with the cDNAs described, or hybridization and digestion with single
strand
nucleases, followed by size determination of the digested fragments.
Techniques for determining amino acid sequence "similarity" are well-known
in the art. In general, " similarity" means the exact amino acid to amino acid
comparison of two or more polypeptides at the appropriate place, where amino
acids
are identical or possess similar chemical and/or physical properties such as
charge or
hydrophobicity. A so-termed "percent similarity" then can be determined
between
the compared polypeptide sequences. Techniques for determining nucleic acid
and
amino acid sequence identity also are well known in the art and include
determining
the nucleotide sequence of the mRNA for that gene (usually via a cDNA
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98I26441
intermediate) and deterniining the amino acid sequence encoded thereby, and
comparing this to a second amino acid sequence. In general, "identity" refers
to an
exact nucleotide to nucleotide or amino acid to amino acid correspondence of
two
polynucleotides or polypeptide sequences, respectively. Two or more
polynucleotide
sequences can be compared by determining their "percent identity." Two or more
amino acid sequences likewise can be compared by determining their "percent
identity." The percent identity of two sequences, whether nucleic acid or
peptide
sequences, is the number of exact matches between two aligned sequences
divided by
the length of the shorter sequences and multiplied by 100. An approximate
alignment
for nucleic acid sequences is provided by the local homology algorithm of
Smith and
Waterman, Advances in Apl?lied Mathematics 2:482-489 (1981). This algorithm
can
be extended to use with peptide sequences using the scoring matrix developed
by
Dayhoff, Atlas of Protein Seg".uences and Structure, M.O. Dayhoff ed., 5
suppl. 3:353-
358, National Biomedical Research Foundation, Washington, D.C., USA, and
normalized by Gribskov, Nucl. Acids Res. 14{6):6745-6763 ( 1986). An
implementation of this algorithm for nucleic acid and peptide sequences is
provided
by the Genetics Computer Group (Madison, WI) in their BestFit utility
application.
The default parameters for this method are described in the Wisconsin Sequence
Analysis Package Prosram Manual. Version 8 (1995) (available from Genetics
Computer Group, Madison, WI). Other equally suitable programs for calculating
the
percent identity or similarity between sequences are generally known in the
art.
"Purified polynucleotide" refers to a polynucleotide of interest or fragment
thereof which is essentially free, e.g., contains less than about 50%,
preferably less
than about 70%, and more preferably less than about 90%, of the protein with
which
the polynucleotide is naturally associated. Techniques for purifying
polynucleotides
of interest are well-known in the art and include, for example, disruption of
the cell
containing the polynucleotide with a chaotropic agent and separation of the
polynucleotide(s) and proteins by ion-exchange chromatography, affinity
chromatography and sedimentation according to density.
"Purified polypeptide" or "purified protein" means a polypeptide of interest
or fragment thereof which is essentially free of, e.g., contains less than
about 50%,
preferably less than about 70%, and more preferably less than about 90%,
cellular
16
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
components with which the polypeptide of interest is naturally associated.
Methods
for purifying polypeptides of interest are known in the art.
The term "isolated" means that the material is removed from its original
environment (e.g., the natural environment if it is naturally occurring). For
example,
a naturally-occurring polynucleotide or polypeptide present in a living animal
is not
isolated, but the same polynucleotide or DNA or polypeptide, which is
separated from
some or all of the coexisting materials in the natural system, is isolated.
Such
polynucleotide could be part of a vector and/or such polynucleotide or
polypeptide
could be part of a composition, and still be isolated in that the vector or
composition
is not part of its natural environment.
"Polypeptide" and "protein" are used interchangeably herein and indicate at
least one molecular chain of amino acids linked through covalent and/or non-
covalent
bonds. The terms do not refer to a specific length of the product. Thus
peptides,
oligopeptides and proteins are included within the definition of polypeptide.
The
terms include post-translational modifications of the polypeptide, for
example,
glycosylations, acetylations, phosphorylations and the like. In addition,
protein
fragments, analogs, mutated or variant proteins, fusion proteins and the like
are
included within the meaning of polypeptide.
A "fi~a.gment" of a specified polypeptide refers to an amino acid sequence
which comprises at least about 3-5 amino acids, more preferably at least about
8-10
amino acids, and even more preferably at least about 15-20 amino acids derived
from
the specified polypeptide.
"Recombinant host cells " "host cells " "cells " "cell lines " "cell cultures
"
> > >
and other such terms denoting microorganisms or higher eukaryotic cell lines
cultured
as unicellular entities refer to cells which can be, or have been, used as
recipients for
recombinant vector or other transferred DNA, and include the original progeny
of the
original cell which has been transfected.
As used herein "replicon" means any genetic element, such as a plasmid, a
chromosome or a virus, that behaves as an autonomous unit of polynucleotide
replication within a cell.
A "vector" is a replicon in which another poiynucleotide segment is attached,
such as to bring about the replication and/or expression of the attached
segment.
17
CA 02315263 2000-06-13
WO 99131274 PCT/US98/26441
The term "control sequence" refers to a polynucleotide sequence which is
necessary to effect the expression of a coding sequence to which it is
ligated. The
nature of such control sequences differs depending upon the host organism. In
prokaryotes, such control sequences generally include a promoter, a ribosomal
binding site and terminators; in eukaryotes, such control sequences generally
include
promoters, terminators and, in some instances, enhancers. The term " control
sequence" thus is intended to include at a minimum all components whose
presence
is necessary for expression, and also may include additional components whose
presence is advantageous, for example, leader sequences.
"Operably linked" refers to a situation wherein the components described are
in a relationship permitting them to function in their intended manner. Thus,
for
example, a control sequence "operably linked" to a coding sequence is ligated
in
such a manner that expression of the coding sequence is achieved under
conditions
compatible with the control sequence.
The term "open reading frame" or "ORF" refers to a region of a
polynucleotide sequence which encodes a polypeptide. This region may represent
a
portion of a coding sequence or a total coding sequence.
A "coding sequence" is a polynucleotide sequence which is transcribed into
mRNA and translated into a polypeptide when placed under the control of
appropriate
regulatory sequences. The boundaries of the coding sequence are determined by
a
translation start codon at the 5' -terminus and a translation stop codon at
the 3' -
terminus. A coding sequence can include, but is not limited to, mRNA, cDNA and
recombinant polynucleotide sequences.
The term "immunologically identifiable with/as" refers to the presence of
epitope(s) and polypeptide(s) which also are present in and are unique to the.
designated polypeptide{s). Immunological identity may be determined by
antibody
binding and/or competition in binding. These techniques are known to the
routineer
and also are described herein. The uniqueness of an epitope also can be
determined
by computer searches of known data banks, such as GenBank, for the
polynucleotide
sequence which encodes the epitope and by amino acid sequence comparisons with
other known proteins.
18
CA 02315263 2000-06-13
WO 99/31274 PCT/US98126441
As used herein, "epitope" means an antigenic determinant of a polypeptide or
protein. Conceivably, an epitope can comprise three amino acids in a spatial
conformation which is unique to the epitope. Generally, an epitope consists of
at
least five such amino acids and more usually, it consists of at least eight to
ten amino
acids. Methods of examining spatial conformation are known in the art and
include,
for example, x-ray crystallography and two-dimensional nuclear magnetic
resonance.
A "conformational epitope" is an epitope that is comprised of a specific
juxtaposition of amino acids in an immunologically recognizable structure,
such
amino acids being present on the same polypeptide in a contiguous or non-
contiguous
order or present on different polypeptides.
A polypeptide is "immunologically reactive" with an antibody when it binds
to an antibody due to antibody recognition of a specific epitope contained
within the
polypeptide. Immunological reactivity may be determined by antibody binding,
more
particularly, by the kinetics of antibody binding, andlor by competition in
binding
using as competitors) a known polypeptide(s} containing an epitope against
which
the antibody is directed. The methods for determining whether a polypeptide is
immunologically reactive with an antibody are known in the art.
As used herein, the term "immunogenic polypeptide containing an epitope of
interest" means naturally occurnng polypeptides of interest or fragments
thereof, as
well as polypeptides prepared by other means, for example, by chemical
synthesis or
the expression of the polypeptide in a recombinant organism.
The term "transfection" refers to the introduction of an exogenous
polynucleotide into a prokaryotic or eucaryotic host cell, irrespective of the
method
used for the introduction. The term "transfection" refers to both stable and
transient
introduction of the polynucleotide, and encompasses direct uptake of
polynucleotides,
transformation, transduction, and f mating. Once introduced into the host
cell, the
exogenous polynucleotide may be maintained as a non-integrated replicon, for
example, a plasmid, or alternatively, may be integrated into the host genome.
"Treatment" refers to prophylaxis and/or therapy.
The term "individual" as used herein refers to vertebrates, particularly
members of the mammalian species and includes, but is not limited to, domestic
19
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
animals, sports animals, primates and humans; more particularly, the term
refers to
humans.
The term "sense strand" or "plus strand" (or "+") as used herein denotes a
nucleic acid that contains the sequence that encodes the polypeptide. The term
"antisense strand" or "minus strand" (or "-") denotes a nucleic acid that
contains a
sequence that is complementary to that of the "plus" strand.
The term "test sample" refers to a component of an individual's body which is
the source of the analyte (such as antibodies of interest or antigens of
interest). These
components are well known in the art. A test sample is typically anything
suspected
of containing a target sequence. Test samples can be prepared using
methodologies
well known in the art such as by obtaining a specimen from an individual and,
if
necessary, disrupting any cells contained thereby to release target nucleic
acids.
These test samples include biological samples which can be tested by the
methods of
the present invention described herein and include human and animal body
fluids
such as whole blood, serum, plasma, cerebrospinal fluid, sputum, bronchial
washing,
bronchial aspirates, urine, lymph fluids, and various external secretions of
the
respiratory, intestinal and genitourinary tracts, tears, saliva, milk, white
blood cells,
myelomas and the like; biological fluids such as cell culture supernatants;
tissue
specimens which may be fixed; and cell specimens which may be fixed.
"Purified product" refers to a preparation of the product which has been
isolated from the cellular constituents with which the product is normally
associated
and from other types of cells which may be present in the sample of interest.
"PNA" denotes a "peptide nucleic acid analog" which may be utilized in a
procedure such as an assay described herein to determine the presence of a
target.
"MA" denotes a "morpholino anaiog" which may be utilized in a procedure such
as
an assay described herein to determine the presence of a target. See, for
example,
U.S. Patent No. 5,378,841. PNAs are neutrally charged moieties which can be
directed against RNA targets or DNA. PNA probes used in assays in place of,
for
example, the DNA probes of the present invention, offer advantages not
achievable
when DNA probes are used. These advantages include manufacturability, large
scale
labeling, reproducibility, stability, insensitivity to changes in ionic
strength and
resistance to enzymatic degradation which is present in methods utilizing DNA
or
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
RNA. These PNAs can be labeled with (" attached to" ) such signal generating
compounds as fluorescein, radionucleotides, chemiluminescent compounds and the
like. PNAs or other nucleic acid analogs such as MAs thus can be used in assay
methods in place of DNA or RNA. Although assays are described herein utilizing
DNA probes, it is within the scope of the routineer that PNAs or MAs can be
substituted for RNA or DNA with appropriate changes if and as needed in assay
reagents.
"Analyte," as used herein, is the substance to be detected which may be
present in the test sample. The analyte can be any substance for which there
exists a
naturally occurring specific binding member (such as an antibody), or for
which a
specific binding member can be prepared. Thus, an analyte is a substance that
can
bind to one or more specific binding members in an assay. "Analyte" also
includes
any antigenic substances, haptens, antibodies and combinations thereof. As a
member
of a specific binding pair, the analyte can be detected by means of naturally
occurring
specific binding partners (pairs) such as the use of intrinsic factor protein
as a member
of a specific binding pair for the determination of Vitamin B 12, the use of
folate-
binding protein to determine folic acid, or the use of a lectin as a member of
a specific
binding pair for the determination of a carbohydrate. The analyte can include
a
protein, a polypeptide, an amino acid, a nucleotide target and the like. The
analyte
can be soluble in a body fluid such as blood, blood plasma or serum, urine or
the like.
The analyte can be in a tissue, either on a cell surface or within a cell. The
analyte
can be on or in a cell dispersed in a body fluid such as blood or urine, or
obtained as a
biopsy sample.
The terms "diseases of the pancreas" or "pancreatic disease," or "condition
of the pancreas," as used herein, refers to any disease or condition of the
pancreas
including, but not limited to, diabetes, pancreatitis, and cancer.
"Pancreatic cancer," as used herein, refers to any malignant disease of the
pancreas including, but not limited to, pancreatic ductal adenocarcinoma,
ampullary
carcinoma, duodenal carcinoma, cystadenocarcinoma, islet cell carcinoma;
endocrine
tumors of the pancreas such as insulinoma, gastrinoma (Zollinger-Ellison
syndrome),
glucagonoma, and vipoma {Vemer-Mornson syndrome); and other pancreatic tumors
21
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/Z6441
such as somatostatinomas, carcinoids-islet cell tumors, and pancreatic
polypeptide-
producing tumors.
An "Expressed Sequence Tag" or "EST" refers to the partial sequence of a
cDNA insert which has been made by reverse transcription of mRNA extracted
from
a tissue followed by insertion into a vector.
A "transcript image" refers to a table or list giving the quantitative
distribution of ESTs in a library and represents the genes active in the
tissue from
which the library was made.
The present invention provides assays which utilize specific binding members.
A " specific binding member," as used herein, is a member of a specific
binding pair.
That is, two different molecules where one of the molecules, through chemical
or
physical means, specifically binds to the second molecule. Therefore, in
addition to
antigen and antibody specific binding pairs of common immunoassays, other
specific
binding pairs can include biotin and avidin, carbohydrates and lectins,
complementary
nucleotide sequences, effector and receptor molecules, cofactors and enzymes,
enzyme inhibitors, and enzymes and the like. Furthermore, specific binding
pairs can
include members that are analogs of the original specific binding members, for
example, an analyte-analog. Immunoreactive specific binding members include
antigens, antigen fragments, antibodies and antibody fragments, both
monoclonal and
polyclonal and complexes thereof, including those formed by recombinant DNA
molecules.
Specific binding members include "specific binding molecules." A "specific
binding molecule" intends any specific binding member, particularly an
immunoreactive specific binding member. As such, the term "specific binding
molecule" encompasses antibody molecules (obtained from both polyclonal and
monoclonal preparations), as well as, the following: hybrid (chimeric)
antibody
molecules (see, for example, Winter, et al., ature 349:293-299 (1991), and
U.S.
Patent No. 4,816,567); F(ab')2 and Flab) fragments; Fv molecules (non-covalent
heterodimers, see, for example, Inbar, et al., Proc. Natl. Acad. Sci. USA
69:2659-
2662 (1972), and Ehrlich, et al., i em. 19:4091-4096 (1980)); single chain Fv
molecules (sFv) (see, for example, Huston, et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988)); humanized antibody molecules (see, for example,
Riechmann,
22
CA 02315263 2000-06-13
WO 99131274 PCT/US98I26441
et al., a re 332:323-327 (1988), Verhoeyan, et al., Science 239:1534-1536
(1988),
and UK Patent Publication No. GB 2,276,169, published 21 September 1994); and,
any functional fragments obtained from such molecules, wherein such fragments
retain immunological binding properties of the parent antibody molecule.
The term "hapten," as used herein, refers to a partial antigen or non-protein
binding member which is capable of binding to an antibody, but which is not
capable
of eliciting antibody formation unless coupled to a carrier protein.
A "capture reagent," as used herein, refers to an unlabeled specific binding
member which is specific either for the analyte as in a sandwich assay, for
the
indicator reagent or analyte as in a competitive assay, or for an ancillary
specific
binding member, which itself is specific for the analyte, as in an indirect
assay. The
capture reagent can be directly or indirectly bound to a solid phase material
before the
performance of the assay or during the performance of the assay, thereby
enabling the
separation of immobilized complexes from the test sample.
The " indicator reagent" comprises a " signal-generating compound" (" label" )
which is capable of generating and generates a measurable signal detectable by
external means, conjugated (" attached" ) to a specific binding member. In
addition to
being an antibody member of a specific binding pair, the indicator reagent
also can be
a member of any specific binding pair, including either hapten-anti-hapten
systems
such as biotin or anti-biotin, avidin or biotin, a carbohydrate or a !actin, a
complementary nucleotide sequence, an effector or a receptor molecule, an
enzyme
cofactor and an enzyme, an enzyme inhibitor or an enzyme and the like. An
immunoreactive specific binding member can be an antibody, an antigen, or an
antibody/antigen complex that is capable of binding either to the polypeptide
of
interest as in a sandwich assay, to the capture reagent as in a competitive
assay, or to
the ancillary specific binding member as in an indirect assay. When describing
probes and probe assays, the term "reporter molecule" may be used. A reporter
molecule comprises a signal generating compound as described hereinabove
conjugated to a specific binding member of a specific binding pair, such as
carbazole
or adamantane.
The various "signal-generating compounds" (labels) contemplated include
chromagens, catalysts such as enzymes, luminescent compounds such as
fluorescein
23
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
and rhodamine, chemiluminescent compounds such as dioxetanes, acridiniums,
phenanthridiniums and luminol, radioactive elements and direct visual labels.
Examples of enzymes include alkaline phosphatase, horseradish peroxidase, beta-
galactosidase and the like. The selection of a particular label is not
critical, but it
must be capable of producing a signal either by itself or in conjunction with
one or
more additional substances.
" Solid phases" (" solid supports" ) are known to those in the art and include
the walls of wells of a reaction tray, test tubes, polystyrene beads, magnetic
or non-
magnetic beads, nitrocellulose strips, membranes, microparticles such as latex
particles, sheep (or other animal) red blood cells and Duracytes~ (red blood
cells
"fixed" by pyruvic aldehyde and formaldehyde, available from Abbott
Laboratories,
Abbott Park, IL) and others. The "solid phase" is not critical and can be
selected by
one skilled in the art. Thus, latex particles, microparticles, magnetic or non-
magnetic
beads, membranes, plastic tubes, walls of microtiter wells, glass or silicon
chips,
sheep {or other suitable animal's) red blood cells and Duracytes~ are all
suitable
examples. Suitable methods for immobilizing peptides on solid phases include
ionic,
hydrophobic, covalent interactions and the like: A "solid phase," as used
herein,
refers to any material which is insoluble, or can be made insoluble by a
subsequent
reaction. The solid phase can be chosen for its intrinsic ability to attract
and
immobilize the capture reagent. Alternatively, the solid phase can retain an
additional
receptor which has the ability to attract and immobilize the capture reagent.
The
additional receptor can include a charged substance that is oppositely charged
with
respect to the capture reagent itself or to a charged substance conjugated to
the
capture reagent. As yet another alternative, the receptor molecule can be any
specific
binding member which is immobilized upon (attached to) the solid phase and
which
has the ability to immobilize the capture reagent through a specific binding
reaction.
The receptor molecule enables the indirect binding of the capture reagent to a
solid
phase material before the performance of the assay or during the performance
of the
assay. The solid phase thus can be a plastic, derivaNzed plastic, magnetic or
non-
magnetic metal, glass or silicon surface of a test tube, microtiter well,
sheet, bead,
microparticle, chip, sheep (or other suitable animal's) red blood cells,
Duracytes~ and
other configurations known to those of ordinary skill in the art.
24
CA 02315263 2000-06-13
WO 99131274 PCT/US98/26441
It is contemplated and within the scope of the present invention that the
solid
phase also can comprise any suitable pomus material with sufficient porosity
to allow
access by detection antibodies and a suitable surface affinity to bind
antigens.
Microporous structures generally are preferred, but materials with a gel
structure in
the hydrated state may be used as well. Such useful solid supports include,
but are
not limited to, nitrocellulose and nylon. It is contemplated that such porous
solid
supports described herein preferably are in the form of sheets of thickness
from about
0.01 to 0.5 mm, preferably about 0.1 mm. The pore size may vary within wide
limits
and preferably is from about 0.025 to 15 micmns, especially from about 0.15 to
15
microns. The surface of such supports may be activated by chemical processes
which
cause covalent linkage of the antigen or antibody to the support. The
irreversible
binding of the antigen or antibody is obtained, however, in general, by
adsorption on
the porous material by poorly understood hydrophobic forces. Other suitable
solid
supports are known in the art.
ea
The present invention provides reagents such as polynucleotide sequences
derived from a pancreatic tissue of interest and designated as PA153,
polypeptides
encoded thereby and antibodies specific for these polypeptides. The present
invention
also provides reagents such as oligonucleotide fragments derived from the
disclosed
polynucleotides and nucleic acid sequences complementary to these
polynucleotides.
The polynucleotides, polypeptides, or antibodies of the present invention may
be used
to provide information leading to the detecting, diagnosing, staging,
monitoring,
prognosticating, in vivo imaging, preventing or treating of, or determining
the
predisposition to, diseases and conditions of the pancreas, such as pancreatic
cancer.
The sequences disclosed herein represent unique polynucleotides which can be
used
in assays or for producing a specific profile of gene transcription activity.
Such
assays are disclosed in European Patent Number 0373203B 1 and International
Publication No. WO 95111995.
Selected PA153-derived polynucleotides can be used in the methods described
herein for the detection of normal or altered gene expression. Such methods
may
employ PA153 polynucleotides or oligonucleotides, fragments or derivatives
thereof,
or nucleic acid sequences complementary thereto.
CA 02315263 2000-06-13
WO 99/31274 PCT/US98126441
The polynucleotides disclosed herein, their complementary sequences, or
fragments of either, can be used in assays to detect, amplify or quantify
genes, nucleic
acids, cDNAs or mRNAs relating to pancreatic tissue disease and conditions
associated therewith. They also can be used to identify an entire or partial
coding
region of a PA153 polypeptide. They fiuther can be provided in individual
containers
in the form of a kit for assays, or provided as individual compositions. If
provided in
a kit for assays, other suitable reagents such as buffers, conjugates and the
like may
be included.
The polynucleotide may be in the form of RNA or DNA. Polynucleotides in
the form of DNA, cDNA, genomic DNA, nucleic acid analogs and synthetic DNA are
within the scope of the present invention. The DNA may be double-stranded or
single-stranded, and if single stranded, may be the coding (sense) strand or
non-
coding (anti-sense) strand. The coding sequence which encodes the polypeptide
may
be identical to the coding sequence provided herein or may be a different
coding
sequence which coding sequence, as a result of the redundancy or degeneracy of
the
genetic code, encodes the same polypeptide as the DNA provided herein.
This polynucleotide may include only the coding sequence for the
polypeptide, or the coding sequence for the polypeptide and an additional
coding
sequence such as a leader or secretory sequence or a pmprotein sequence, or
the
coding sequence for the polypeptide (and optionally an additional coding
sequence)
and non-coding sequence, such as a non-coding sequence 5' and/or 3' of the
coding
sequence for the polypeptide.
In addition, the invention includes variant polynucleotides containing
modifications such as polynucleotide deletions, substitutions or additions;
and any
polypeptide modification resulting firm the variant polynucleotide sequence. A
polynucleotide of the present invention also may have a coding sequence which
is a
naturally occun~ing allelic variant of the coding sequence provided herein.
In addition, the coding sequence for the polypeptide may be fused in the same
reading fi~ame to a polynucleotide sequence which aids in expression and
secretion of
a polypeptide from a host cell, for example, a leader sequence which functions
as a
secretory sequence for controlling transport of a polypeptide finm the cell.
The
polypeptide having a leader sequence is a prepmtein and may have the leader
26
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
sequence cleaved by the host cell to form the polypeptide. The polynucleotides
may
also encode for a proprotein which is the protein plus additional 5' amino
acid
residues. A protein having a prosequence is a proprotein and may, in some
cases, be
an inactive form of the protein. Once the prosequence is cleaved, an active
protein
remains. Thus, the polynucleotide of the present invention may encode for a
protein,
or for a protein having a prosequence, or for a protein having both a
presequence
(leader sequence) and a prosequence.
The polynucleotides of the present invention may also have the coding
sequence fused in frame to a marker sequence which allows for purification of
the
polypeptide of the present invention. The marker sequence may be a hexa-
histidine
tag supplied by a pQE-9 vector to provide for purification of the polypeptide
fused to
the marker in the case of a bacterial host, or, for example, the marker
sequence may
be a hemagglutinin (HA) tag when a mammalian host, e.g. a COS-7 cell line, is
used.
The HA ta.g corresponds to an epitope derived from the influenza hemagglutinin
protein. See, for example, I. Wilson et al., ~l 37:767 (1984).
It is contemplated that polynucleotides will be considered to hybridize to the
sequences provided herein if there is at least 50%, preferably at least 70% to
80%, and
more preferably at least 90% identity between the polynucleotide and the
sequence.
The degree of sequence identity between two nucleic acid molecules greatly
affects the efficiency and strength of hybridization events between such
molecules. A
partially identical nucleic acid sequence is one that will at least partially
inhibit a
completely identical sequence from hybridizing to a target molecule.
Inhibition of
hybridization of the completely identical sequence can be assessed using
hybridization assays that are well known in the art (e.g., Southern blot,
Northern blot,
solution hybridization, in situ hybridization, or the like, see Sambrook, et
al.,
Molecular Clonin;~: A Laboratory Manual, Second Edition, (1989) Cold Spring
Harbor, N.Y.). Such assays can be conducted using varying degrees of
selectivity, for
example, using conditions varying from low to high stringency. If conditions
of low
stringency are employed, the absence of non-specific binding can be assessed
using a
secondary probe that lacks even a partial degree of sequence identity (for
example, a
probe having less than about 30% sequence identity with the target molecule),
such
27
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
that, in the absence of non-specific binding events, the secondary probe will
not
hybridize to the target.
When utilizing a hybridization-based detection system, a nucleic acid probe is
chosen that is complementary to a target nucleic acid sequence, and then by
selection
of appropriate conditions the probe and the target sequence " selectively
hybridize,"
or bind, to each other to form a hybrid molecule. In one embodiment of the
present
invention, a nucleic acid molecule is capable of hybridizing selectively to a
target
sequence under moderately stringent hybridization conditions. In the context
of the
present invention, moderately stringent hybridization conditions allow
detection of a
target nucleic acid sequence of at least 14 nucleotides in length having at
least
approximately 70% sequence identity with the sequence of the selected nucleic
acid
probe. In another embodiment, such selective hybridization is performed under
stringent hybridization conditions. Stringent hybridization conditions allow
detection
of target nucleic acid sequences of at least 14 nucleotides in length having a
sequence
identity of greater than 90% with the sequence of the selected nucleic acid
probe.
Hybridization conditions useful for probe/target hybridization where the probe
and
target have a specific degree of sequence identity, can be determined as is
known in
the art (see, for example, Nucleic Acid Hybridization: A Practical Ap roach,
editors
B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; IRL Press). Hybrid
molecules can be formed, for example, on a solid support, in solution, and in
tissue
sections. The formation of hybrids can be monitored by inclusion of a reporter
molecule, typically, in the probe. Such reporter molecules, or detectable
elements
include, but are not limited to, radioactive elements, fluorescent markers,
and
molecules to which an enzyme-conjugated ligand can bind.
With respect to stringency conditions for hybridization, it is well known in
the
art that numerous equivalent conditions can be employed to establish a
particular
stringency by varying, for example, the following factors: the length and
nature of
probe and target sequences, base composition of the various sequences,
concentrations of salts and other hybridization solution components, the
presence or
absence of blocking agents in the hybridization solutions (e.g., formamide,
dextran
sulfate, and polyethylene glycol), hybridization reaction temperature and time
parameters, as well as, varying wash conditions. The selection of a particular
set of
28
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98I26441
hybridization conditions is well within the skill of the mutineer in the art
(see, for
example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, (1989) Cold Spring Harbor, N.Y.).
The present invention also provides an antibody produced by using a purified
PA153 polypeptide of which at least a portion of the polypeptide is encoded by
a
PA153 polynucleotide selected from the polynucleotides provided herein. These
antibodies may be used in the methods provided herein for the detection of
PA153
antigen in test samples. The presence of PA153 antigen in the test samples is
indicative of the presence of a pancreatic disease or condition. The antibody
also may
be used for therapeutic purposes, for example, in neutralizing the activity of
PA153
polypeptide in conditions associated with altered or abnormal expression.
The present invention further relates to a PA153 polypeptide which has the
deduced amino acid sequence as provided herein, as well as fragments, analogs
and
derivatives of such polypeptide. The polypeptide of the present invention may
be a
1 S recombinant polypeptide, a natural purified polypeptide or a synthetic
polypeptide.
The fragment, derivative or analog of the PA153 polypeptide may be one in
which
one or more of the amino acid residues is substituted with a conserved or non-
conserved amino acid residue (preferably a conserved amino acid residue) and
such
substituted amino acid residue may or may not be one encoded by the genetic
code; or
it may be one in which one or more of the amino acid residues includes a
substituent
group; or it may be one in which the polypeptide is fused with another
compound,
such as a compound to increase the half life of the polypeptide (for example,
polyethylene glycol); or it may be one in which the additional amino acids are
fused
to the polypeptide, such as a leader or secretory sequence or a sequence which
is
employed for purification of the polypeptide or a pmprotein sequence. Such
fragments, derivatives and analogs are within the scope of the present
invention. The
polypeptides and polynucleotides of the present invention are provided
preferably in
an isolated form and preferably purified.
Thus, a polypeptide of the present invention may have an amino acid sequence
that is identical to that of the naturally occurring polypeptide or that is
different by
minor variations due to one or more amino acid substitutions. The variation
may be a.
"conservative change" typically in the range of about 1 to 5 amino acids,
wherein the
29
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
substituted amino acid has similar structural or chemical properties, e.g.,
replacement
of leucine with isoleucine or threonine with serine. In contrast, variations
may
include nonconservative changes, e.g., replacement of a glycine with a
tryptophan.
Similar minor variations may also include amino acid deletions or insertions,
or both.
Guidance in determining which and how many amino acid residues may be
substituted, inserted or deleted without changing biological or immunological
activity
may be found using computer programs well known in the art, for example,
DNASTAR software (DNASTAR Inc., Madison WI).
Probes constructed according to the polynucleotide sequences of the present
invention can be used in various assay methods to provide various types of
analysis.
For example, such probes can be used in fluorescent 'fir sib ~bridization
(FISH)
technology to perform chromosomal analysis, and used to identify cancer-
specific
structural alterations in the chromosomes, such as deletions or translocations
that are
visible from chromosome spreads or detectable using PCR-generated and/or
allele
specific oligonucleotides probes, allele specific amplification or by direct
sequencing.
Probes also can be labeled with radioisotopes, directly- or indirectly-
detectable
haptens, or fluorescent molecules, and utilized for ' i a hybridization
studies to
evaluate the mRNA expression of the gene comprising the polynucleotide in
tissue
specimens or cells.
This invention also provides teachings as to the production of the
polynucleotides and polypeptides provided herein.
Probe Assay
The sequences provided herein may be used to produce probes which can be
used in assays for the detection of nucleic acids in test samples. The pmbes
may be
designed from conserved nucleotide regions of the polynucleotides of interest
or from
non-conserved nucleotide regions of the polynucleotide of interest. The design
of
such probes for optimization in assays is within the skill of the routineer.
Generally,
nucleic acid probes are developed from non-conserved or unique regions when
maximum specificity is desired, and nucleic acid probes are developed from
conserved regions when assaying for nucleotide regions that are closely
related to, for
example, different members of a mufti-gene family or in related species like
mouse
and man.
CA 02315263 2000-06-13
WO 99131274 PCT/US98I2b441
The polymerise chain reaction (PCR) is a technique for amplifying a desired
nucleic acid sequence (target) contained in a nucleic acid or mixture thereof.
In PCR,
a pair of primers are employed in excess to hybridize to the complementary
strands of
the target nucleic acid. The primers are each extended by a polymerise using
the
target nucleic acid as a template. The extension products become target
sequences
themselves, following dissociation from the original target strand. New
primers then
are hybridized and extended by a polymerise, and the cycle is repeated to
geometrically increase the number of target sequence molecules. PCR is
disclosed in
U.S. Patents 4,683,195 and 4,683,202.
The Ligase Chain Reaction (LCR) is an alternate method for nucleic acid
amplification. In LCR, probe pairs are used which include two primary (first
and
second) and two secondary (third and fourth) probes, all of which are employed
in
molar excess to target. The first probe hybridizes to a first segment of the
target
strand, and the second probe hybridizes to a second segment of the target
strand, the
1 S first and second segments being contiguous so that the primary probes abut
one
another in 5' phosphate-3' hydroxyl relationship, and so that a ligase can
covalently
fuse or ligate the two probes into a fused product. In addition, a third
(secondary)
probe can hybridize to a portion of the first probe and a fourth (secondary)
probe can
hybridize to a portion of the second probe in a similar abutting fashion. Of
course, if
the target is initially double stranded, the secondary pmbes also will
hybridize to the
target complement in the first instance. Once the ligated strand of primary
probes is
separated finm the target strand, it will hybridize with the third and fourth
probes
which can be ligated to form a complementary, secondary ligated product. It is
important to realize that the ligated products are functionally equivalent to
either the
target or its complement. By repeated cycles of hybridization and ligation,
amplification of the target sequence is achieved. This technique is described
more
completely in EP-A- 320 308 to K. Backman published June 16, 1989 and EP-A-439
182 to K. Backman et al., published July 31, 1991.
For amplification of mRNAs, it is within the scope of the present invention to
reverse transcribe mRNA into cDNA followed by polymerise chain reaction (RT-
PCR); or, to use a single enzyme for both steps as described in U.S. Patent
No.
5,322,770; or reverse transcribe mRNA into cDNA followed by asymmetric gap
31
CA 02315263 2000-06-13
WO 99/31274 PC'T/US98/26441
ligase chain reaction (RT-AGLCR) as described by R.L. Marshall et al.,
Methods and Ap~ications 4:80-84 ( 1994).
Other known amplification methods which can be utilized herein include but
are not limited to the so-called "NASBA" or "3SR" technique described by J.C.
Guatelli et al., Proc. Natl. Acad. Sci. USA 87:1874-1878 (1990) and also
described by
J. Compton, Nature 350 (No. 6313):91-92 (1991); Q-beta amplification as
described
in published European Patent Application (EPA) No. 4544610; strand
displacement
amplification (as described in G.T. Walker et al., Clin. Chem. 42:9-13 [1996])
and
European Patent Application No. 684315; and target mediated amplification, as
described in International Publication No. WO 93!22461.
Detection of PA153 may be accomplished using any suitable detection
method, including those detection methods which are currently well known in
the art,
as well as detection strategies which may evolve later. See, for example,
Caskey et
al., U.S. Patent No. 5,582,989, Gelfand et al., U.S. Patent No. 5,210,015.
Examples
of such detection methods include target amplification methods as well as
signal
amplification technologies. An example of presently known detection methods
would
include the nucleic acid amplification technologies referred to as PCR, LCR,
NASBA, SDA, RCR and TMA. See, for example, Caskey et al., U.S. Patent No.
5,582,989, Gelfand et al., U.S. Patent No. 5,210,015. Detection may also be
accomplished using signal amplification such as that disclosed in Snitman et
al., U.S.
Patent No. 5,273,882. While the amplification of target or signal is preferred
at
present, it is contemplated and within the scope of the present invention that
ultrasensitive detection methods which do not require amplification can be
utilized
herein.
Detection, both amplified and non-amplified, may be performed using a
variety of heterogeneous and homogeneous detection formats. Examples of
heterogeneous detection formats are disclosed in Snitman et al., U.S. Patent
No.
5,273,882, Albarella et al., in EP-84114441.9, Urdea et al., U.S. Patent No.
5,124,246, Unman et al. U.S. Patent No. 5,185,243 and Kourilsky et al., U.S.
Patent
No. 4,581,333. Examples of homogeneous detection formats are disclosed in,
Caskey
et al., U.S. Patent No. 5,582,989, Gelfand et al., U.S. Patent No. 5,210,015.
Also
contemplated and within the scope of the present invention is the use of
multiple
32
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
probes in the hybridization assay, which use improves sensitivity and
amplification of
the PA153 signal. See, for example, Caskey et al., U.S. Patent No. 5,582,989,
Gelfand et al., U.S. Patent No. 5,210,015.
In one embodiment, the present invention generally comprises the steps of
contacting a test sample suspected of containing a target polynucleotide
sequence
with amplification reaction reagents comprising an amplification primer, and a
detection probe that can hybridize with an internal region of the amplicon
sequences.
Probes and primers employed according to the method provided herein are
labeled
with capture and detection labels, wherein probes are labeled with one type of
label
and primers are labeled with another type of label. Additionally, the primers
and
probes are selected such that the probe sequence has a lower melt temperature
than
the primer sequences. The amplification reagents, detection reagents and test
sample
are placed under amplification conditions whereby, in the presence of target
sequence,
copies of the target sequence (an amplicon) are produced. In the usual case,
the
amplicon is double stranded because primers are provided to amplify a target
sequence and its complementary strand. The double stranded amplicon then is
thermally denatured to produce single stranded amplicon members. Upon
formation
of the single stranded amplicon members, the mixture is cooled to allow the
formation of complexes between the probes and single stranded amplicon
members.
As the single stranded amplicon sequences and probe sequences are cooled,
the probe sequences preferentially bind the single stranded amplicon members.
This
finding is counterintuitive given that the probe sequences generally are
selected to be
shorter than the primer sequences and therefore have a lower melt temperature
than
the primers. Accordingly, the melt temperature of the amplicon produced by the
primers should also have a higher melt temperature than the probes. Thus, as
the
mixture cools, the re-formation of the double stranded amplicon would be
expected.
As previously stated, however, this is not the case. The probes are found to
preferentially bind the single stranded amplicon members. Moreover, this
preference
of probe/single stranded amplicon binding exists even when the primer
sequences are
added in excess of the probes.
After the probe/single stranded amplicon member hybrids are formed, they are
detected. Standard heterogeneous assay formats are suitable for detecting the
hybrids
33
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
using the detection labels and capture labels present on the primers and
probes. The
hybrids can be bound to a solid phase reagent by virtue of the capture label
and
detected by virtue of the detection label. In cases where the detection label
is directly
detectable, the presence of the hybrids on the solid phase can be detected by
causing
the label to produce a detectable signal, if necessary, and detecting the
signal. In
cases where the label is not directly detectable, the captured hybrids can be
contacted
with a conjugate, which generally comprises a binding member attached to a
directly
detectable label. The conjugate becomes bound to the complexes and the
conjugate's
presence on the complexes can be detected with the directly detectable label.
Thus,
the presence of the hybrids on the solid phase reagent can be determined.
Those
skilled in the art will recognize that wash steps may be employed to wash away
unhybridized amplicon or probe as well as unbound conjugate.
In one embodiment, the heterogeneous assays can be conveniently performed
using a solid phase support that carnes an array of nucleic acid molecules.
Such
arrays are useful for high-throughput andlor multiplexed assay formats.
Various
methods for forming such arrays from pre-formed nucleic acid molecules, or
methods
for generating the array using in situ synthesis techniques, are generally
known in the
art. (See, for example, Dattagupta, et al., EP Publication No. 0 234, 726A3;
Southern,
U.S. Patent No. 5,700,637; Pimlng, et al., U.S. Patent No. 5,143,854; PCT
International Publication No. WO 92/10092; and, Fodor, et al., c' ce 251:767-
777
(1991)).
Although the target sequence. is described as single stranded, it also is
contemplated to include the case where the target sequence is actually double
stranded but is merely separated from its complement prior to hybridization
with the
amplification primer sequences. In the case where PCR is employed in this
method,
the ends of the target sequences are usually known. In cases where LCR or a
modification thereof is employed in the preferred method, the entire target
sequence
is usually known. Typically, the target sequence is a nucleic acid sequence
such as,
for example, RNA or DNA.
The method provided herein can be used in well-known amplification
reactions that include thermal cycle reaction mixtures, particularly in PCR
and gap
LCR (GLCR). Amplification reactions typically employ primers to repeatedly
34
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
generate copies of a target nucleic acid sequence, which target sequence is
usually a
small region of a much larger nucleic acid sequence. Primers are themselves
nucleic
acid sequences that are complementary to regions of a target sequence. Under
amplification conditions, these primers hybridize or bind to the complementary
regions of the target sequence. Copies of the target sequence typically are
generated
by the process of primer extension and/or ligation which utilizes enzymes with
polymerase or Iigase activity, separately or in combination, to add
nucleotides to the
hybridized primers and/or ligate adjacent probe pairs. The nucleotides that
are added
to the primers or probes, as monomers or preformed oligomers, are also
complementary to the target sequence. Once the primers or probes have been
suffciently extended and/or ligated, they are separated from the target
sequence, for
example, by heating the reaction mixture to a "melt temperature" which is one
in
which complementary nucleic acid strands dissociate. Thus, a sequence
complementary to the target sequence is formed.
A new amplification cycle then can take place to further amplify the number
of target sequences by separating any double stranded sequences, allowing
primers or
probes to hybridize to their respective targets, extending and/or ligating the
hybridized primers or probes and re-separating. The complementary sequences
that
are generated by amplification cycles can serve as templates for primer
extension or
filling the gap of two probes to further amplify the number of target
sequences.
Typically, a reaction mixture is cycled between 20 and 100 times, more
typically, a
reaction mixture is cycled between 25 and 50 times. The numbers of cycles can
be
determined by the routineer. In this manner, multiple copies of the target
sequence
and its complementary sequence are produced. Thus, primers initiate
amplification of
the target sequence when it is present under amplification conditions.
Generally, two primers which are complementary to a portion of a target
strand and its complement are employed in PCR. For LCR, four probes, two of
which are complementary to a target sequence and two of which are similarly
complementary to the target's complement, are generally employed. In addition
to
the primer sets and enzymes previously mentioned, a nucleic acid amplification
reaction mixture may also comprise other reagents which are well known and
include
but are not limited to: enzyme cofactors such as manganese; magnesium; salts;
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
nicotinamide adenine dinucleotide (NAD); and deoxynucleotide triphosphates
(dNTPs) such as, for example, deoxyadenine triphosphate, deoxyguanine
triphosphate, deoxycytosine triphosphate and deoxythymine triphosphate.
While the amplification primers initiate amplification of the target sequence,
the detection (or hybridization) probe is not involved in amplification.
Detection
probes are generally nucleic acid sequences or uncharged nucleic acid analogs
such
as, for example, peptide nucleic acids which are disclosed in International
Publication
No. WO 92/20702; morpholino analogs which are described in U.S. Patents Nos
5,185,444, 5,034,506 and 5,142,047; and the like. Depending upon the type of
label
carried by the probe, the probe is employed to capture or detect the amplicon
generated by the amplification reaction. The probe is not involved in
amplification of
the target sequence and therefore may have to be rendered "non-extendible" in
that
additional dNTPs cannot be added to the probe. In and of themselves, analogs
usually are non-extendible and nucleic acid probes can be rendered non-
extendible by
modifying the 3' end of the probe such that the hydroxyl group is no longer
capable of
participating in elongation. For example, the 3' end of the probe can be
functionalized with the capture or detection label to thereby consume or
otherwise
block the hydroxyl group. Alternatively, the 3' hydroxyl group simply can be
cleaved, replaced or modified. U.S. Patent Application Serial No. 07/049,061
filed
April 19, 1993 describes modifications which can be used to render a probe non-
extendible.
The ratio of primers to probes is not important. Thus, either the probes or
primers can be added to the reaction mixture in excess whereby the
concentration of
one would be greater than the concentration of the other. Alternatively,
primers and
probes can be employed in equivalent concentrations. Preferably, however, the
primers are added to the reaction mixture in excess of the probes. Thus,
primer to
probe ratios of, for example, S:1 and 20:1, are preferred.
While the length of the primers and probes can vary, the probe sequences are
selected such that they have a lower melt temperature than the primer
sequences.
Hence, the primer sequences are generally longer than the probe sequences.
Typically, the primer sequences are in the range of between 20 and 50
nucleotides
36
CA 02315263 2000-06-13
WO 99/31274 PCT/US98126441
long, more typically in the range of between 20 and 30 nucleotides long. The
typical
probe is in the range of between 10 and 25 nucleotides long.
Various methods for synthesizing primers and probes are well known in the
art. Similarly, methods for attaching labels to primers or probes are also
well known
in the art. For example, it is a matter of routine to synthesize desired
nucleic acid
primers or probes using conventional nucleotide phosphoramidite chemistry and
instruments available from Applied Biosystems, Inc., (Foster City, CA), DuPont
(Wilmington, DE), or Milligen (Bedford MA). Many methods have been described
for labeling oligonucleotides such as the primers or probes of the present
invention.
Enzo Biochemical (New York, NY) and Clontech (Palo Alto, CA) both have
described and commercialized probe labeling techniques. For example, a primary
amine can be attached to a 3' oligo terminus using 3'-Amine-ON CPGTM
(Clontech,
Palo Alto, CA). Similarly, a primary amine can be attached to a 5' oligo
terminus
using Aminomodifier II~ (Clontech). The amines can be reacted to various
haptens
using conventional activation and linking chemistries. In addition, copending
applications U.S. Serial Nos. 625,566, filed December 11, 1990 and 630,908,
filed
December 20, 1990, teach methods for labeling probes at their 5' and 3'
termini,
respectively. International Publication Nos WO 92110505, published 25 June
1992,
and WO 92/11388, published 9 July 1992, teach methods for labeling probes at
their
5' and 3' ends, respectively. According to one known method for labeling an
oligonucleotide, a label-phosphoramidite reagent is prepared and used to add
the label
to the oligonucleotide during its synthesis. See, for example, N.T. Thuong et
al., Tet.
Le er 29(46):5905-5908 (1988); or J.S. Cohen et al., published U.S. Patent
Application 07/246,688 (N'TIS ORDER No. PAT-APPL-7-246,688) (1989).
Preferably, probes are labeled at their 3' and 5' ends.
A capture label is attached to the primers or probes and can be a specific
binding member which forms a binding pair with the solid phase reagent's
specific
binding member. It will be understood that the primer or probe itself may
serve as the
capture label. For example, in the case where a solid phase reagent's binding
member
is a nucleic acid sequence, it may be selected such that it binds a
complementary
portion of the primer or probe to thereby immobilize the primer or probe to
the solid
phase. In cases where the probe itself serves as the binding member, those
skilled in
37
CA 02315263 2000-06-13
WO 99131274 PCTIUS98I26441
the art will recognize that the probe will contain a sequence or "tail" that
is not
complementary to the single stranded amplicon members. In the case where the
primer itself serves as the capture label, at least a portion of the primer
will be free to
hybridize with a nucleic acid on a solid phase because the probe is selected
such that
it is not fully complementary to the primer sequence.
Generally, probe/single stranded amplicon member complexes can be detected
using techniques commonly employed to perform heterogeneous immunoassays.
Preferably, in this embodiment, detection is performed according to the
protocols
used by the commercially available Abbott LCx~ instrumentation (Abbott
Laboratories, Abbott Park, IL).
The primers and probes disclosed herein are useful in typical PCR assays,
wherein the test sample is contacted with a pair of primers, amplification is
performed, the hybridization probe is added, and detection is performed.
Another method provided by the present invention comprises contacting a test
sample with a plurality of polynucleotides, wherein at least one
polynucleotide is a
PA153 molecule as described herein, hybridizing the test sample with the
plurality of
polynucleotides and detecting hybridization complexes. Hybridization complexes
are
identified and quantitated to compile a profile which is indicative of
pancreatic tissue
disease, such as pancreatic cancer. Expressed RNA sequences may further be
detected by reverse transcription and amplification of the DNA product by
procedures
well-known in the art, including polymerise chain reaction (PCR).
r ig Greening and Gene Therag~r.
The present invention also encompasses the use of gene therapy methods for
the introduction of anti-sense PA153 derived molecules, such as
polynucleotides or
oligonucleotides of the present invention, into patients with conditions
associated
with abnormal expression of polynucleotides related to a pancreatic tissue
disease or
condition especially pancreatic cancer. These molecules, including antisense
RNA
and DNA fragments and ribozymes, are designed to inhibit the translation of
PA153
mRNA, and may be used therapeutically in the treatment of conditions
associated
with altered or abnormal expression of PA153 polynucleotide.
38
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Alternatively, the oligonucleotides described above can be delivered to cells
by procedures known in the art such that the anti-sense RNA or DNA may be
expressed ice, vivo to inhibit production of a PA153 polypeptide in the manner
described above. Antisense constructs to a PA153 polynucleotide, therefore,
reverse
the action of PA153 transcripts and may be used for treating pancreatic tissue
disease
conditions, such as pancreatic cancer. These antisense constructs may also be
used to
treat tumor metastases.
The present invention also provides a method of screening a plurality of
compounds for specific binding to PA153 polypeptide(s), or any fragment
thereof, to
identify at least one compound which specifically binds the PA153 polypeptide.
Such
a method comprises the steps of providing at least one compound; combining the
PA153 polypeptide with each compound under suitable conditions for a time
sufficient to allow binding; and detecting the PA153 polypeptide binding to
each
compound.
The polypeptide or peptide fragment employed in such a test may either be
free in solution, affixed to a solid support, borne on a cell surface or
located
intracellularly. One method of screening utilizes eukaryotic or prokaryotic
host cells
which are stably transfected with recombinant nucleic acids which can express
the
polypeptide or peptide fragment. A drug, compound, or any other agent may be
screened against such transfected cells in competitive binding assays. For
example,
the formation of complexes between a polypeptide and the agent being tested
can be
measured in either viable or fixed cells.
The present invention thus provides methods of screening for drugs,
compounds, or any other agent which can be used to treat diseases associated
with
PA153. These methods comprise contacting the agent with a polypeptide or
fragment
thereof and assaying for either the presence of a complex between the agent
and the
polypeptide, or for the presence of a complex between the polypeptide and the
cell:
In competitive binding assays, the polypeptide typically is labeled. After
suitable
incubation, free (or uncornplexed) polypeptide or fragment thereof is
separated from
that present in bound form, and the amount of free or uncomplexed label is
used as a
measure of the ability of the particular agent to bind to the polypeptide or
to interfere
with the polypeptide/cell complex.
39
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
The present invention also encompasses the use of competitive screening
assays in which neutralizing antibodies capable of binding polypeptide
specifically
compete with a test agent for binding tv the polypeptide or fragment thereof.
In this
manner, the antibodies can be used to detect the presence of any polypeptide
in the
test sample which shares one or more antigenic determinants with a PA153
polypeptide as provided herein.
Another technique for screening provides high throughput screening for
compounds having suitable binding affinity to at least one polypeptide of
PA153
disclosed herein. Briefly, large numbers of different small peptide test
compounds
IO are synthesized on a solid phase, such as plastic pins or some other
surface. The
peptide test compounds are reacted with polypeptide and washed. Polypeptide
thus
bound to the solid phase is detected by methods well-known in the art.
Purified
polypeptide can also be coated directly onto plates for use in the screening
techniques
described herein. In addition, non-neutralizing antibodies can be used to
capture the
polypeptide and immobilize it on the solid support. See, for example, EP
84/03564,
published on September 13, 1984.
The goal of rational drug design is to produce structural analogs of
biologically active polypeptides of interest or of the small molecules
including
agonists, antagonists, or inhibitors with which they interact. Such structural
analogs
can be used to design drugs which are more active or stable forms of the
polypeptide
or which enhance or interfere with the function of a polypeptide j~ yiyo. J.
Hodgson,
Bio/Technolosv 9:19-21 (1991).
For example, in one approach, the three-dimensional structure of a
polypeptide, or of a polypeptide-inhibitor complex, is determined by x-ray
crystallography, by computer modeling or, most typically, by a combination of
the
two approaches. Both the shape and charges of the polypeptide must be
ascertained
to elucidate the structure and to determine active sites) of the molecule.
Less often,
useful information regarding the structure of a polypeptide may be gained by
modeling based on the structure of homologous proteins. In both cases,
relevant
structural information is used to design analogous polypeptide-like molecules
or to
identify efficient inhibitors
CA 02315263 2000-06-13
WO 99/31274 PCTNS98/26441
Useful examples of rational drug design may include molecules which have
improved activity or stability as shown by S. Braxton et al., Biochemistry
31:7796-
7801 (1992), or which act as inhibitors, agonists, or antagonists of native
peptides as
shown by S.B.P. Athauda et al., J Biochem. (Tokyo) 113 (6):742-746 (1993).
It also is possible to isolate a target-specific antibody selected by an assay
as
described hereinabove, and then to determine its crystal structure. In
principle this
approach yields a pharmacophore upon which subsequent drug design can be
based.
It further is possible to bypass protein crystallography altogether by
generating anti-
idiotypic antibodies {"anti-ids") to a functional, pharmacologically active
antibody.
As a mirror image of a mirror image, the binding site of the anti-id is an
analog of the
original receptor. The anti-id then can be used to identify and isolate
peptides from
banks of chemically or biologically produced peptides. The isolated peptides
then
can act as the pharmacophore (that is, a prototype pharmaceutical drug).
A sufficient amount of a recombinant polypeptide of the present invention
may be made available to perform analytical studies such as X-ray
crystallography.
In addition, knowledge of the polypeptide amino acid sequence which is
derivable
from the nucleic acid sequence provided herein will provide guidance to those
employing computer modeling techniques in place of, or in addition to, x-ray
crystallography.
Antibodies specific to a PA153 polypeptide (e.g., anti-PA153 antibodies)
further may be used to inhibit the biological action of the polypeptide by
binding to
the polypeptide. In this manner, the antibodies may be used in therapy, for
example,
to treat pancreatic tissue diseases including pancreatic cancer and its
metastases.
Further, such antibodies can detect the presence or absence of a PA153
polypeptide in a test sample and, therefore, are useful as diagnostic markers
for the
diagnosis of a pancreatic tissue disease or condition especially pancreatic
cancer.
Such antibodies may also function as a diagnostic marker for pancreatic tissue
disease
conditions, such as pancreatic cancer.
The present invention also is directed to antagonists and inhibitors of the
polypeptides of the present invention. The antagonists and inhibitors are
those which
inhibit or eliminate the function of the polypeptide. Thus, for example, an
antagonist
may bind to a polypeptide of the present invention and inhibit or eliminate
its
41
CA 02315263 2000-06-13
WO 99131274 PCTIUS98126441
function. The antagonist, for example, could be an antibody against the
polypeptide
which eliminates the activity of a PA153 polypeptide by binding a PA153
polypeptide, or in some cases the antagonist may be an oligonucleotide.
Examples of
small molecule inhibitors include, but are not limited to, small peptides or
peptide-
like molecules.
The antagonists and inhibitors may be employed as a composition with a
pharmaceutically acceptable carrier including, but not limited to, saline,
buffered
saline, dextrose, water, glycerol, ethanol and combinations thereof.
Administration of
PA153 polypeptide inhibitors is preferably systemic. The present invention
also
provides an antibody which inhibits the action of such a polypeptide.
Antisense technology can be used to reduce gene expression through triple-
helix formation or antisense DNA or RNA, both of which methods are based on
binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion
of
the polynucleotide sequence, which encodes for the polypeptide of the present
invention, is used to design an antisense RNA oligonucleotide of from 10 to 40
base
pairs in length. A DNA oligonucleotide is designed to be complementary to a
region
of the gene involved in transcription, thereby preventing transcription and
the
production of the PA153 polypeptide. For triple helix, see, for example, Lee
et al.,
Nuc. Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988); and
Dervan et
al., ci ce 251:1360 ( 1991 ) The antisense RNA oligonucleotide hybridizes to
the
mRNA ~n_ vivo and blocks translation of a mRNA molecule into the PA153
polypeptide. For antisense, see, for example, Okano, J. Neurochem. 56:560
(1991);
and ~~godeoxYnucleotides as Antisense Inhibitors of Gene Ex ression, CRC
Press,
Boca Raton, Fla. (1988). Antisense oligonucleotides act with greater efficacy
when
modified to contain artificial internucleotide linkages which render the
molecule
resistant to nucleolytic cleavage. Such artificial internucleotide linkages
include, but
are not limited to, methylphosphonate, phosphorothiolate and phosphoroamydate
internucleotide linkages.
Recombinant Technology.
The present invention provides host cells and expression vectors comprising
PA153 polynucleotides of the present invention and methods for the production
of the
polypeptide(s) they encode. Such methods comprise culturing the host cells
under
42
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/2644I
conditions suitable for the expression of the PA153 polynucleotide and
recovering the
PA153 polypeptide from the cell culture.
'The present invention also provides vectors which include PA153
polynucleotides of the present invention, host cells which are genetically
engineered
with vectors of the present invention and the production of polypeptides of
the present
invention by recombinant techniques.
Host cells are genetically engineered (transfected, transduced or transformed)
with the vectors of this invention which may be cloning vectors or expression
vectors.
The vector may be in the form of a plasmid, a viral particle, a phage, etc.
The
engineered host cells can be cultured in conventional nutrient media modified
as
appropriate for activating promoters, selecting transfected cells, or
amplifying PA153
gene(s). The culture conditions, such as temperature, pH and the like, are
those
previously used with the host cell selected for expression, and will be
apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing
a polypeptide by recombinant techniques. Thus, the polynucleotide sequence may
be
included in any one of a variety of expression vehicles, in particular,
vectors or
plasmids for expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40;
bacterial
plasmids; phage DNA; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus
and pseudorabies. However, any other plasmid or vector may be used so long as
it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of
procedures. In general, the DNA sequence is inserted into appropriate
restriction
endonuclease sites by procedures known in the art. Such procedures and others
are
deemed to be within the scope of those skilled in the art. The DNA sequence in
the
expression vector is operatively linked to an appropriate expression control
sequences) (promoter) to direct mRNA synthesis. Representative examples of
such
promoters include, but are not limited to, the LTR or the SV40 promoter, the
E. co i
lac or trp, the phage lambda P sub L promoter and other promoters known to
control
expression of genes in prokaryotic or eukaryotic cells or their viruses. The
expression
43
CA 02315263 2000-06-13
WO 99131274 PCT/US98I26441
vector also contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate sequences
for
amplifying expression. In addition, the expression vectors preferably contain
a gene
to provide a phenotypic trait for selection of transfected host cells such as
S dihydrofolate reductase or neomycin resistance for eukaryotic cell culture,
or such as
tetracycline or ampicillin resistance in ~ coli.
The vector containing the appropriate DNA sequence as hereinabove
described, as well as an appropriate promoter or control sequence, may be
employed
to transfect an appropriate host to permit the host to express the protein. As
representative examples of appropriate hosts, there may be mentioned:
bacterial cells,
such as ~ c_cL,, Salmonella t~phimurium; S~tomvces ~; fimgal cells, such as
yeast; insect cells, such as Drosophila and Sf9; animal cells, such as CHO,
COS or
Bowes melanoma; plant cells, etc. The selection of an appropriate host is
deemed to
be within the scope of those skilled in the art from the teachings provided
herein.
More particularly, the present invention also includes recombinant constructs
comprising one or more of the sequences as broadly described above. The
constructs
comprise a vector, such as a plasmid or viral vector, into which a sequence of
the
invention has been inserted, in a forward or reverse orientation. In a
preferred aspect
of this embodiment, the construct fiuther comprises regulatory sequences
including,
for example, a promoter, operably linked to the sequence. Large numbers of
suitable
vectors and promoters are known to those of skill in the art and are
commercially
available. The following vectors are provided by way of example. Bacterial:
pINCY
{Incyte Pharmaceuticals Inc., Palo Alto, CA), pSPORTI (Life Technologies,
Gaithersburg, MD), pQE70, pQE60, pQE-9 (Qiagen) pBs, phagescript, psiX174,
pBluescript SK, pBsKS, pNHBa, pNHl6a, pNHl8a, pNH46a (Stratagene); pTrc99A,
pKK223-3, pKK233-3, pDR540, pRITS (Pharmacia); Eukaryotic: pWLneo, pSV2cat,
pOG44, pXTI, pSG {Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
However, any other plasmid or vector may be used as long as it is replicable
and
viable in the host.
Plasmid pINCY is generally identical to the plasmid pSPORTl (available
from Life Technologies, Gaithersburg, MD) with the exception that it has two
modifications in the polylinker (multiple cloning site). These modifications
are (1) it
44
CA 02315263 2000-06-13
'WO 99131274 PCT/US98/26441
lacks a HindIII restriction site and (2) its EcoRI restriction site lies at a
different
location. pINCY is created from pSPORTl by cleaving pSPORTl with both HindIII
and EcoRI and replacing the excised fragment of the polylinker with synthetic
DNA
fragments (SEQUENCE ID NO I2 and SEQUENCE ID NO 13). This replacement
may be made in any manner known to those of ordinary skill in the art. For
example,
the two nucleotide sequences, SEQUENCE ID NO 12 and SEQUENCE ID NO 13,
may be generated synthetically with 5' terminal phosphates, mixed together,
and then
ligated under standard conditions for performing staggered end ligations into
the
pSPORTl plasmid cut with HindIII and EcoRI. Suitable host cells (such as E.
~1_i
DHS~ cells) then are transfected with the ligated DNA and recombinant clones
are
selected for ampicillin resistance. Plasmid DNA then is prepared from
individual
clones and subjected to restriction enzyme analysis or DNA sequencing in order
to
confirm the presence of insert sequences in the proper orientation. Other
cloning
strategies known to the ordinary artisan also may be employed.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with selectable
markers. Two
appropriate vectors are pKK232-8 and pCM7. Particular named bacterial
promoters
include lacI, IacZ, T3, SP6, T7, gpt, lambda P sub R, P sub L and trp.
Eukaryotic
promoters include cytomegalovirus (CMV) immediate early, herpes simplex virus
(HSV) thymidine kinase, early and late SV40, LTRs from retroviruses and mouse
metallothionein-I. Selection of the appropriate vector and promoter is well
within the
level of ordinary skill in the art.
In a further embodiment, the present invention provides host cells containing
the above-described construct. The host cell can be a higher eukaryotic cell,
such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host
cell can be
a prokaryotic cell, such as a bacterial cell. Introduction of the construct
into the host
cell can be effected by calcium phosphate transfection, DEAF-Dextran mediated
transfection, or electroporation [L. Davis et al., Basic Methods in Molecular
Biology,
2nd edition, Appleton and Lang, Paramount Publishing, East Norwalk, CT
(1994)).
The constructs in host cells can be used in a conventional manner to produce
the gene product encoded by the recombinant sequence. Alternatively, the
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
polypeptides of the invention can be synthetically produced by conventional
peptide
synthesizers.
Recombinant proteins can be expressed in mammalian cells, yeast, bacteria, or
other cells, under the control of appropriate promoters. Cell-free translation
systems
can also be employed to produce such proteins using RNAs derived from the DNA
constructs of the present invention. Appropriate cloning and expression
vectors for
use with prokaryotic and eukaryotic hosts are described by Sambrook et al.,
Molecular Cloning: A Laboratoly Manual, Second Edition, (Cold Spring Harbor,
NY,
1989).
Transcription of a DNA encoding the polypeptide(s) of the present invention
by higher eukaryotes is increased by inserting an enhancer sequence into the
vector.
Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp,
that act
on a promoter to increase its transcription. Examples include the SV40
enhancer on
the late side of the replication origin (bp 100 to 270), a cytomegalovirus
early
1 S promoter enhancer, a polyoma enhancer on the late side of the replication
origin and
adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication
and selectable markers permitting transfection of the host cell, e.g., the
ampicillin
resistance gene of ~ ~ and ,~ cerevis~ae TRP 1 gene, and a promoter derived
from a
highly-expressed gene to direct transcription of a downstream structural
sequence.
Such promoters can be derived from operons encoding glycolytic enzymes such as
3-
phosphoglycerate kinase (PGK), alpha factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination sequences, and
preferably, a leader sequence capable of directing secretion of translated
protein into
the periplasmic space or extracellular medium. Optionally, the heterologous
sequence
can encode a fusion protein including an N-terminal identification peptide
imparting
desired characteristics, e.g., stabilization or simplified purification of
expressed
recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a
structural DNA sequence encoding a desired protein together with suitable
translation
initiation and termination signals in operable reading phase with a functional
46
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
promoter. The vector will comprise one or more phenotypic selectable markers
and
an origin of replication to ensure maintenance of the vector and to, if
desirable,
provide amplification within the host. Suitable prokaryotic hosts for
transfection
include ~ coli, B_ acillus su '1' , almonella twhimurium and various species
within
the genera Pseudomonas, Stre~tomyces and Staphylococcus, although others may
also be employed as a routine matter of choice.
Useful expression vectors for bacterial use comprise a selectable marker and
bacterial origin of replication derived from plasmids comprising genetic
elements of
the well-known cloning vector pBR322 (ATCC 37017). Other vectors include but
are
not limited to PKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, VV)7. These pBR322 "backbone" sections are combined
with an appropriate promoter and the structural sequence to be expressed.
Following transfection of a suitable host and growth of the host to an
appropriate cell density, the selected promoter is derepressed by appropriate
means
(e.g., temperature shift or chemical induction), and cells are cultured for an
additional
period. Cells are typically harvested by centrifugation, disrupted by physical
or
chemical means, and the resulting crude extract retained for further
purification.
Microbial cells employed in expression of proteins can be disrupted by any
convenient method including freeze-thaw cycling, sonication, mechanical
disruption,
or use of cell lysing agents. Such methods are well-known to the ordinary
artisan.
Various mammalian cell culture systems can also be employed to express
recombinant protein. Examples of mammalian expression systems include the COS-
7
lines of monkey kidney fibroblasts described by Gluzman, ~gl~ 23:175 (1981),
and
other cell lines capable of expressing a compatible vector, such as the C127,
HEK-
293, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will
comprise an origin of replication, a suitable promoter and enhancer and also
any
necessary ribosome binding sites, polyadenylation sites, splice donor and
acceptor
sites, transcriptional termination sequences and 5' flanking nontranscribed
sequences.
DNA sequences derived from the SV40 viral genome, for example, SV40 origin,
30. early promoter; enhancer, splice, and polyadenylation sites may be used to
provide
the required nontranscribed genetic elements. Representative, useful vectors
include
pRc/CMV and pcDNA3 (available from Invitrogen, San Diego, CA).
47
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
PA153 polypeptides are recovered and purified from recombinant cell cultures
by known methods including affinity chromatography, ammonium sulfate or
ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
hydroxyapatite chromatography or lectin chromatography. It is preferred to
have low
concentrations (approximately 0.1-5 mM) of calcium ion present during
purification
[Price, et al., ~. Biol. Chem. 244:917 (1969)]. Protein refolding steps can be
used, as
necessary, in completing configuration of the polypeptide. Finally, high
performance
liquid chromatography (HPLC) can be employed for final purification steps.
Thus, polypeptides of the present invention may be naturally purified products
expressed from a high expressing cell line, or a product of chemical synthetic
procedures, or produced by recombinant techniques from a prokaryotic or
eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and mammalian
cells in
culture). Depending upon the host employed in a recombinant production
procedure,
the polypeptides of the present invention may be glycosylated with mammalian
or
other eukaryotic carbohydrates or may be non-glycosylated. The polypeptides of
the
invention may also include an initial methionine amino acid residue.
The starting plasmids can be constructed from available plasmids in accord
with published, known procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to one of ordinary skill
in the art.
The following is the general procedure for the isolation and analysis of cDNA
clones. In a particular embodiment disclosed herein, mRNA is isolated from
pancreatic tissue and used to generate the cDNA library. Pancreatic tissue is
obtained
from patients by surgical resection and is classified as tumor or non-tumor
tissue by a
pathologist.
'~'he cDNA inserts from random isolates of the pancreatic tissue libraries are
sequenced in part, analyzed in detail as set forth in the Examples, and are
disclosed in
the Sequence Listing as SEQUENCE ID NOS 1-9. Also analyzed in detail as set
forth in the Examples, and disclosed in the Sequence Listing, is the full-
length
sequence of clone 2075919 [referred to herein as 2075919inh (SEQUENCE ID NO
10)]. The consensus sequence of these inserts is presented as SEQUENCE ID NO
11.
These polynucleotides may contain an entire open reading frame with or without
48
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
associated regulatory sequences for a particular gene, or they may encode only
a
portion of the gene of interest. This is attributed to the fact that many
genes are
several hundred and sometimes several thousand bases in length and, with
current
technology, cannot be cloned in their entirety because of vector limitations,
S incomplete reverse transcription of the first strand, or incomplete
replication of the
second strand. Contiguous, secondary clones containing additional nucleotide
sequences may be obtained using a variety of methods known to those of skill
in the
art.
Methods for DNA sequencing are well known in the art. Conventional
enzymatic methods employ DNA polymerase, Klenow fragment, Sequenase (US
Biochemical Corp, Cleveland, OH) or Taq polyrnerase to extend DNA chains from
an
oligonucleotide primer annealed to the DNA template of interest. Methods have
been
developed for the use of both single-stranded and double-stranded templates.
The
chain termination reaction products may be electrophoresed on
urea/polyacrylamide
gels and detected either by autoradiography (for radionucleotide labeled
precursors)
or by fluorescence {for fluorescent-labeled precursors}. Recent improvements
in
mechanized reaction preparation, sequencing and analysis using the fluorescent
detection method have permitted expansion in the number of sequences that can
be
determined per day using machines such as the Applied Biosystems 377 DNA
Sequencers (Applied Biosystems, Foster City, CA).
The reading frame of the nucleotide sequence can be ascertained by several
types of analyses. First, reading frames contained within the coding sequence
can be
analyzed for the presence of start codon ATG and stop codons TGA, TAA or TAG.
Typically, one reading frame will continue throughout the major portion of a
cDNA
sequence while other reading frames tend to contain numerous stop codons. In
such
cases, reading frame determination is straightforward. In other more difficult
cases,
further analysis is required.
Algorithms have been created to analyze the occurrence of individual
nucleotide bases at each putative codon triplet. See, for example J.W.
Fickett, Nuc.
Acids Res. 10:5303 ( 1982). Coding DNA for particular organisms (bacteria,
plants
and animals) tends to contain certain nucleotides within certain triplet
periodicities,
such as a significant preference for pyrimidines in the third codon position.
These
49
CA 02315263 2000-06-13
WO 99/31274 PCT/US98126441
preferences have been incorporated into widely available software which can be
used
to determine coding potential (and frame) of a given stretch of DNA. The
algorithm-
derived information combined with start/stop codon information can be used to
determine proper frame with a high degree of certainty. This, in turn, readily
permits
cloning of the sequence in the correct reading frame into appropriate
expression
vectors.
The nucleic acid sequences disclosed herein may be joined to a variety of
other polynucleotide sequences and vectors of interest by means of well-
established
recombinant DNA techniques. See J. Sambrook et al., supra. Vectors of interest
include cloning vectors, such as plasmids, cosmids, phage derivatives,
phagemids, as
well as sequencing, replication and expression vectors, and the like. In
general, such
vectors contain an origin of replication functional in at least one organism,
convenient
restriction endonuclease digestion sites and selectable markers appropriate
for
particular host cells. The vectors can be transferred by a variety of means
known to
those of skill in the art into suitable host cells which then produce the
desired DNA,
RNA or polypeptides.
occasionally, sequencing or random reverse transcription errors will mask the
presence of the appropriate open reading frame or regulatory element. In such
cases,
it is possible to determine the correct reading flame by attempting to express
the
polypeptide and determining the amino acid sequence by standard peptide
mapping
and sequencing techniques. See, F.M. Ausubel et al., Current Protocols in
Molecular
Biolo~v, John Wiley & Sons, New York, NY (1989). Additionally, the actual
reading
frame of a given nucleotide sequence may be determined by transfection of host
cells
with vectors containing all three potential reading frames. Only those cells
with the
nucleotide sequence in the correct reading frame will produce a peptide of the
predicted length.
The nucleotide sequences provided herein have been prepared by current,
state-of the-art, automated methods and, as such, may contain unidentif ed
nucleotides. These will not present a problem to those skilled in the art who
wish to
practice the invention. Several methods~employing standard recombinant
techniques,
described in J. Sambrook su ra or periodic updates thereof, may be used to
complete the missing sequence infonmation. The same techniques used for
obtaining
CA 02315263 2000-06-13
WO 99/31274 PCTNS98I26441
a full length sequence, as described herein, may be used to obtain nucleotide
sequences.
Expression of a particular cDNA may be accomplished by subcloning the
cDNA into an appropriate expression vector and transfecting this vector into
an
appropriate expression host. The cloning vector used for the generation of the
pancreatic tissue cDNA library can be used for transcribing mRNA of a
particular
cDNA and contains a promoter for beta-galactosidase, an amino-terminal met and
the
subsequent seven amino acid residues of beta-galactosidase. Immediately
following
these eight residues is an engineered bacteriophage promoter useful for
artificial
priming and transcription, as well as a number of unique restriction sites,
including
EcoRI, for cloning. The vector can be transfected into an appropriate host
strain of E.
coli.
Induction of the isolated bacterial strain with isopropylthiogalactoside
(IPTG)
using standard methods will produce a fusion protein which contains the first
seven
residues of beta-galactosidase, about 15 residues of linker and the peptide
encoded
within the cDNA. Since cDNA clone inserts are generated by an essentially
random
process, there is one chance in three that the included cDNA will lie in the
correct
frame for proper translation. If the cDNA is not in the proper reading frame,
the
correct frame can be obtained by deletion or insertion of an appropriate
number of
bases by well known methods including 'fir vitro mutagenesis, digestion with
exonuclease III or mung bean nuclease, or oligonucleotide linker inclusion.
The cDNA can be shuttled into other vectors known to be useful for
expression of protein in specific hosts. Oligonucleotide primers containing
cloning
sites and segments of DNA sufficient to hybridize to stretches at both ends of
the
target cDNA can be synthesized chemically by standard methods. These primers
can
then be used to amplify the desired gene segments by PCR. The resulting new
gene
segments can be digested with appropriate restriction enzymes under standard
conditions and isolated by gel electrophoresis. Alternately, similar gene
segments can
be produced by digestion of the cDNA with appropriate restriction enzymes and
filling in the missing gene segments with chemically synthesized
oligonucleotides.
Segments of the coding sequence from more than one gene can be ligated
together
and cloned in appropriate vectors to optimize expression of recombinant
sequence.
51
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Suitable expression hosts for such chimeric molecules include, but are not
limited to, mammalian cells, such as Chinese Hamster Ovary (CHO) and human
embryonic kidney (HEK) 293 cells, insect cells, such as Sf9 cells, yeast
cells, such as
Saccharomvces cerevisiae and bacteria, such as E. coli. For each of these cell
systems, a useful expression vector may also include an origin of replication
to allow
propagation in bacteria and a selectable marker such as the beta-lactamase
antibiotic
resistance gene to allow selection in bacteria. In addition, the vectors may
include a
second selectable marker, such as the neomycin phosphotransferase gene, to
allow
selection in transfected eukaryotic host cells. Vectors for use in eukaryotic
expression hosts may require the addition of 3' poly A tail if the sequence of
interest
lacks poly A.
Additionally, the vector may contain promoters or enhancers which increase
gene expression. Such promoters are host specific and include, but are not
limited to,
MMTV, SV40, or metallothionine promoters for CHO cells; trp, lac, tac or T7
promoters for bacterial hosts; or alpha factor, alcohol oxidase or PGH
promoters for
yeast. Adenoviral vectors with or without transcription enhancers, such as the
Raus
sarcoma virus (RSV) enhancer, may be used to drive protein expression in
mammalian cell lines. Once homogeneous cultures of recombinant cells are
obtained,
large quantities of recombinantly produced protein can be recovered from the
conditioned medium and analyzed using chromatographic methods well known in
the
art. An alternative method for the production of large amounts of secreted
protein
involves the transfection of mammalian embryos and the recovery of the
recombinant
protein from milk produced by transgenic cows, goats, sheep, etc. Polypeptides
and
closely related molecules may be expressed recombinantly in such a way as to
facilitate protein purification. One approach involves expression of a
chimeric
protein which includes one or more additional polypeptide domains not
naturally
present on human polypeptides. Such purification-facilitating domains include,
but
are not limited to, metal-chelating peptides such as histidine-tryptophan
domains that
allow purification on immobilized metals, protein A domains that allow
purification
on immobilized imlnunoglobulin and the domain utilized in the FLAGS
extension/affinity purification system (Immunex Corp, Seattle, WA). The
inclusion
of a cleavable linker sequence such as Factor XA or enterokinase from
Invitrogen
52
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
(San Diego, CA) between the polypeptide sequence and the purif cation domain
may
be useful for recovering the polypeptide.
Immunoassavs.
PA153 polypeptides, including fragments, derivatives, and analogs thereof, or
S cells expressing such polypeptides, can be utilized in a variety of assays,
many of
which are described herein, for the detection of antibodies to pancreatic
tissue. They
also can be used as immunogens to produce antibodies. These antibodies can be,
for
example, polyclonal or monoclonal antibodies, chimeric, single chain and
humanized
antibodies, as well as Fab fragments, or the product of an Fab expression
library.
Various procedures known in the art may be used for the production of such
antibodies and fragments.
For example, antibodies generated against a polypeptide comprising a
sequence of the present invention can be obtained by direct injection of the
polypeptide into an animal or by administering the polypeptide to an animal
such as a
mouse, rabbit, goat or human. A mouse, rabbit or goat is preferred. The
polypeptide
is selected from the group consisting of SEQUENCE ID NO 28, SEQUENCE ID NO
29, SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof. The antibody so obtained then will bind the polypeptide
itself. In
this manner, even a sequence encoding only a fragment of the polypeptide can
be
used to generate antibodies that bind the native polypeptide. Such antibodies
then can
be used to isolate the polypeptide from test samples such as tissue suspected
of
containing that polypeptide. For preparation of monoclonal antibodies, any
technique
which provides antibodies produced by continuous cell line cultures can be
used.
Examples include the hybridoma technique as described by Kohler and Milstein,
Nat~e 256:495-497 (1975), the trioma technique, the human B-cell hybridoma
technique as described by Kozbor et al., Immure. Todav 4:72 (1983) and the EBV-
hybridoma technique to produce human monoclonal antibodies as described by
Cole
et al., in Monoclonal Antibodies and Cancer Theranv, Alan R. Liss, Inc, New
York,
NY, pp. 77-96 (/985). Techniques described for the production of single chain
antibodies can be adapted to produce single chain.antibodies to immunogenic
polypeptide products of this invention. See, for example, U.S. Patent No.
4,946,778.
53
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Various assay formats may utilize the antibodies of the present invention,
including "sandwich" immunoassays and probe assays. For example, the
antibodies
of the present invention, or fragments thereof, can be employed in various
assay
systems to determine the presence, if any, of PA153 antigen in a test sample.
For
S example, in a first assay format, a polyclonal or monoclonal antibody or
fragment
thereof, or a combination of these antibodies, which has been coated on a
solid phase,
is contacted with a test sample, to form a first mixture. This first mixture
is incubated
for a time and under conditions sufficient to form antigen/antibody complexes.
Then,
an indicator reagent comprising a monoclonal or a polyclonal antibody or a
fragment
thereof, or a combination of these antibodies, to which a signal generating
compound
has been attached, is contacted with the antigen/antibody complexes to form a
second
mixture. This second mixture then is incubated for a time and under conditions
sufficient to form antibody/antigen/antibody complexes. The presence of PA153
antigen in the test sample and captured on the solid phase, if any, is
determined by
detecting the measurable signal generated by the signal generating compound.
The
amount of PA153 antigen present in the test sample is proportional to the
signal
generated.
In an alternative assay format, a mixture is formed by contacting: (1) a
polyclonal antibody, monoclonal antibody, or fragment thereof, which
specifically
binds to PA153 antigen, or a combination of such antibodies bound to a solid
support;
(2) the test sample; and (3) an indicator reagent comprising a monoclonal
antibody,
polyclonal antibody, or fragment thereof, which specifically binds to a
different
PA153 antigen (or a combination of these antibodies) to which a signal
generating
compound is attached. This mixture is incubated for a time and under
conditions
sufficient to form antibody/antigen/antibody complexes. The presence, if any,
of
PA153 antigen present in the test sample and captured on the solid phase is
determined by detecting the measurable signal generated by the signal
generating
compound. The amount of PAI53 antigen present in the test sample is
proportional
to the signal generated.
In another assay format, one or a combination of at least two monoclonal
antibodies of the invention can be employed as a competitive probe for the
detection
of antibodies to PAI53 antigen. For example, PAI53 polypeptides such as the
54
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
recombinant antigens disclosed herein, either alone or in combination, are
coated on a
solid phase. A test sample suspected of containing antibody to PA153 antigen
then is
incubated with an indicator reagent comprising a signal generating compound
and at
least one monoclonal antibody of the invention for a time and under conditions
sufficient to form antigen/antibody complexes of either the test sample and
indicator
reagent bound to the solid phase or the indicator reagent bound to the solid
phase.
The reduction in binding of the monoclonal antibody to the solid phase can be
quantitatively measured.
In yet another detection method, each of the monoclonal or polyclonal
antibodies of the present invention can be employed in the detection of PA153
antigens in tissue sections, as well as in cells, by immunohistochemical
analysis. The
tissue sections can be cut from either frozen or chemically fixed samples of
tissue. If
the antigens are to be detected in cells, the cells can be isolated from
blood, urine, or
other bodily fluids. The cells may be obtained by biopsy, either surgical or
by needle.
The cells can be isolated by centrifugation or magnetic attraction after
labeling with
magnetic particles or ferrofluids so as to enrich a particular fraction of
cells for
staining with the antibodies of the present invention. Cytochemical analysis
wherein
these antibodies are labeled directly (with, for example, fluorescein,
colloidal gold,
horseradish peroxidase, alkaline phosphatase, etc.) or are labeled by using
secondary
labeled anti-species antibodies (with various labels as exemplified herein) to
track the
histopathology of disease also are within the scope of the present invention.
In addition, these monoclonal antibodies can be bound to matrices similar to
CNBr-activated Sepharose and used for the affinity purification of specific
PA153
polypeptides from cell cultures or biological tissues such as to purify
recombinant and
native PA153 pmteins.
The monoclonal antibodies of the invention also can be used for the
generation of chimeric antibodies for therapeutic use, or other similar
applications.
The monoclonal antibodies or fragments thereof can be provided individually
to detect PA153 antigens. Combinations of the monoclonal antibodies (and
fragments thereof) provided herein also may be used together as components in
a
mixture or "cocktail" of at least one PA153 antibody of the invention, along
with
antibodies which specifically bind to other PA153 regions, each antibody
having
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
different binding specificities. Thus, this cocktail can include the
monoclonal
antibodies of the invention which are directed to PA153 polypeptides disclosed
herein
and other monoclonal antibodies specific to other antigenic determinants of
PA153
antigens or other related proteins.
The polyclonal antibody or fragment thereof which can be used in the assay
formats should specifically bind to a PA153 polypeptide or other PA153
polypeptides
additionally used in the assay. The polyclonal antibody used preferably is of
mammalian origin such as, human, goat, rabbit or sheep polyclonal antibody
which
binds PA153 polypeptide. Most preferably, the polyclonal antibody is of rabbit
origin. The polyclonal antibodies used in the assays can be used either alone
or as a
cocktail of polyclonal antibodies. Since the cocktails used in the assay
formats are
comprised of either monoclonal antibodies or polyclonal antibodies having
different
binding specificity to PA153 polypeptides, they are useful for the detecting,
diagnosing, staging, monitoring, prognosticating, in vivo imaging, preventing
or
treating, or determining the predisposition to, diseases and conditions of the
pancreas,
such as pancreatic cancer.
It is contemplated and within the scope of the present invention that PA153
antigen may be detectable in assays by use of a recombinant antigen as well as
by use
of a synthetic peptide or purified peptide, which peptide comprises an amino
acid
sequence of PA153. The amino acid sequence of such a polypeptide is selected
from
the group consisting of SEQUENCE 1D NO 28, SEQUENCE ID NO 29,
SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof. It also is within the scope of the present invention that
different
synthetic, recombinant or purified peptides, identifying different epitopes of
PA153,
can be used in combination in an assay for the detecting, diagnosing, staging,
monitoring, prognosticating, ~n vivo imaging, preventing or treating, or
determining
the predisposition to diseases and conditions of the pancreas, such as
pancreatic
cancer. In this case, all of these peptides can be coated onto one solid
phase; or each
separate peptide may be coated onto separate solid phases, such as
microparticles, and
then combined to form a mixture of peptides which can be later used in assays.
Furthermore, it is contemplated that multiple peptides which define epitopes
from
different antigens may be used for the detection, diagnosis, staging,
monitoring,
56
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
prognosis, prevention or treatment of, or determining the predisposition to,
diseases
and conditions of the pancreas, such as pancreatic cancer. Peptides coated on
solid
phases or labeled with detectable labels are then allowed to compete with
those
present in a patient sample (if any) for a limited amount of antibody. A
reduction in
binding of the synthetic, recombinant, or purified peptides to the antibody
(or
antibodies) is an indication of the presence of PA153 antigen in the patient
sample.
The presence of PA153 antigen indicates the presence of pancreatic tissue
disease,
especially pancreatic cancer, in the patient. Variations of assay formats are
known to
those of ordinary skill in the art and many are discussed herein below.
In another assay format, the presence of anti-PA153 antibody and/or PA153
antigen can be detected in a simultaneous assay, as follows. A test sample is
simultaneously contacted with a capture reagent of a first analyte, wherein
said
capture reagent comprises a first binding member specific for a first analyte
attached
to a solid phase and a capture reagent for a second analyte, wherein said
capture
reagent comprises a first binding member for a second analyte attached to a
second
solid phase, to thereby form a mixture. This mixture is incubated for a time
and
under conditions sufficient to farm capture reagent/first analyte and capture
reagent/second analyte complexes. These so-formed complexes then are contacted
with an indicator reagent comprising a member of a binding pair specific for
the first
analyte labeled with a signal generating compound and an indicator reagent
comprising a member of a binding pair specific for the second analyte labeled
with a
signal generating compound to form a second mixture. This second mixture is
incubated for a time and under conditions sufficient to form capture
reagent/first
analyte/indicator reagent complexes and capture reagentlsecond
analyte/indicator
reagent complexes. The presence of one or more analytes is determined by
detecting
a signal generated in connection with the complexes formed on either or both
solid
phases as an indication of the presence of one or more analytes in the test
sample. In
this assay format, recombinant antigens derived from the expression systems
disclosed herein may be utilized, as well as monoclonal antibodies produced
from the
proteins derived from the expression systems as disclosed herein. For example,
in
this assay system, PA153 antigen can be the first analyte. Such assay systems
are
described in greater detail in EP Publication No. 04730b5.
57
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
In yet other assay formats, the polypeptides disclosed herein may be utilized
to detect the presence of antibody against PA153 antigen in test samples. For
example, a test sample is incubated with a solid phase to which at least one
polypeptide such as a recombinant protein or synthetic peptide has been
attached.
The polypeptide is selected from the group consisting of SEQUENCE 117 NO 28,
SEQUENCE ID NO 29, SEQUENCE ID NO 30, SEQUENCE ID NO 31,
SEQUENCE ID NO 32, and fragments thereof. These are reacted for a time and
under conditions sufficient to form antigen/antibody complexes. Following
incubation, the antigen/antibody complex is detected. Indicator reagents may
be used
to facilitate detection, depending upon the assay system chosen. In another
assay
format, a test sample is contacted with a solid phase to which a recombinant
protein
produced as described herein is attached, and also is contacted with a
monoclonal or
polyclonal antibody specific for the protein, which preferably has been
labeled with
an indicator reagent. After incubation for a time and under conditions
sufficient for
1 S antibody/antigen complexes to form, the solid phase is separated from the
free phase,
and the label is detected in either the solid or free phase as an indication
of the
presence of antibody against PA153 antigen. Other assay formats utilizing the
recombinant antigens disclosed herein are contemplated. These include
contacting a
test sample with a solid phase to which at least one antigen from a first
source has
been attached, incubating the solid phase and test sample for a time and under
conditions sufficient to form antigen/antibody complexes, and then contacting
the
solid phase with a labeled antigen, which antigen is derived from a second
source
different from the first source. For example, a recombinant protein derived
from a
first source such as E. coli is used as a capture antigen on a solid phase, a
test sample
is added to the so-prepared solid phase, and following standard incubation and
washing steps as deemed or required, a recombinant protein derived from a
different
source (i.e., non-E. co i is utilized as a part of an indicator reagent which
subsequently is detected. Likewise, combinations of a recombinant antigen on a
solid
phase and synthetic peptide in the indicator phase also are possible. Any
assay format
which utilizes an antigen specific for PA153 produced or derived from a first
source
as the capture antigen and an antigen specific for PA153 from a different
second
source is contemplated. Thus, various combinations of recombinant antigens, as
well
58
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
as the use of synthetic peptides, purified proteins and the like, are within
the scope of
this invention. Assays such as this and others are described in U.S. Patent
No.
5,254,458.
Other embodiments which utilize various other solid phases also are
contemplated and are within the scope of this invention. For example, ion
capture
procedures for immobilizing an immobilizable reaction complex with a
negatively
charged polymer (described in EP publication 0326100 and EP publication No.
0406473), can be employed according to the present invention to effect a fast
solution-phase immunochemical reaction. An immobilizable immune complex is
separated from the rest of the reaction mixture by ionic interactions between
the
negatively charged poly-anion/immune complex and the previously treated,
positively
charged porous matrix and detected by using various signal generating systems
previously described, including those described in chemiluminescent signal
measurements as described in EPO Publication No. 0 273,115.
Also, the methods of the present invention can be adapted for use in systems
which utilize microparticle technology including automated and semi-automated
systems wherein the solid phase comprises a microparticle (magnetic or non-
magnetic). Such systems include those described in, for example, published EPO
applications Nos. EP 0 425 633 and EP 0 424 634, respectively.
The use of scanning probe microscopy (SPM) for immunoassays also is a
technology to which the monoclonal antibodies of the present invention are
easily
adaptable. In scanning probe microscopy, particularly in atomic force
microscopy,
the capture phase, for example, at least one of the monoclonal antibodies of
the
invention, is adhered to a solid phase and a scanning probe microscope is
utilized to
detect antigen/antibody complexes which may be present on the surface of the
solid
phase. The use of scanning tunneling microscopy eliminates the need for labels
which normally must be utilized in many immunoassay systems to detect
antigen/antibody complexes. The use of SPM to monitor specific binding
reactions
can occur in many ways. In one embodiment, one member of a specific binding
partner (analyte specific substance which is the monoclonal antibody of the
invention)
is attached to a surface suitable for scanning. The attachment of the analyte
specific
substance may be by adsorption to a test piece which comprises a solid phase
of a
59
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
plastic or metal surface, following methods known to those of ordinary skill
in the art.
Or, covalent attachment of a specific binding partner (analyte specific
substance) to a
test piece which test piece comprises a solid phase of derivatized plastic,
metal,
silicon, or glass may be utilized. Covalent attachment methods are known to
those
skilled in the art and include a variety of means to irreversibly link
specific binding
partners to the test piece. If the test piece is silicon or glass, the surface
must be
activated prior to attaching the specific binding partner. Also,
polyelectrolyte
interactions may be used to immobilize a specific binding partner on a surface
of a
test piece by using techniques and chemistries. The preferred method of
attachment is
by covalent means. Following attachment of a specific binding member, the
surface
may be further treated with materials such as serum, proteins, or other
blocking
agents to minimize non-specific binding. The surface also may be scanned
either at
the site of manufacture or point of use to verify its suitability for assay
purposes. The
scanning process is not anticipated to alter the specific binding properties
of the test
piece.
While the present invention discloses the preference for the use of solid
phases, it is contemplated that the reagents such as antibodies, proteins and
peptides
of the present invention can be utilized in non-solid phase assay systems.
These assay
systems are known to those skilled in the art, and are considered to be within
the
scope of the present invention.
It is contemplated that the reagent employed for the assay can be provided in
the form of a test kit with one or more containers such as vials or bottles,
with each
container containing a separate reagent such as a probe, primer, monoclonal
antibody
or a cocktail of monoclonal antibodies, or a polypeptide (e.g. recombinantly,
synthetically produced or purified) employed in the assay. The polypeptide is
selected from the group consisting of SEQUENCE ID NO 28, SEQUENCE ID NO
29, SEQUENCE ID NO 30, SEQUENCE ID NO 31, SEQUENCE ID NO 32, and
fragments thereof. Other components such as buffers, controls and the like,
known to
those of ordinary skill in art, may be included in such test kits. It also is
contemplated
to provide test kits which have means for collecting test samples comprising
accessible body fluids, e.g., blood, urine, saliva and stool. Such tools
useful for
collection (" collection materials" ) include lancets and absorbent paper or
cloth for
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
collecting and stabilizing blood; swabs for collecting and stabilizing saliva;
cups for
collecting and stabilizing urine or stool samples. Collection materials,
papers, cloths,
swabs, cups and the like, may optionally be treated to avoid denaturation or
irreversible adsorption of the sample. The collection materials also may be
treated
with or contain preservatives, stabilizers or antimicrobial agents to help
maintain the
integrity of the specimens. Test kits designed for the collection,
stabilization and
preservation of test specimens obtained by surgery or needle biopsy are also
useful. I
is contemplated that all kits may be configured in two components which can be
provided separately; one component for collection and transport of the
specimen and
10 the other component for the analysis of the specimen. The collection
component, for
example, can be provided to the open market user while the components for
analysis
can be provided to others such as laboratory personnel for determination of
the
presence, absence or amount of analyte. Further, kits for the collection,
stabilization
and preservation of test specimens may be configured for use by untrained
personnel
1 ~ 15 and may be available in the open market for use at home with subsequent
transportation to a laboratory for analysis of the test sample.
In Vivo Antibody Use.
2C 20 Antibodies of the present invention can be used 'fin vivo; that is, they
can be
injected into patients suspected of having or having diseases of the pancreas
for
diagnostic or therapeutic uses. The use of antibodies for in vivo diagnosis is
well
known in the art. Sumerdon et al., Nucl. Med. Biol 17:247-254 (1990) have
described an optimized antibody-chelator for the radioimmunoscintographic
imaging
2-'' 25 of carcinoembryonic antigen (CEA) expressing tumors using Indium-111
as the label.
Crriffin et al., ~Clin Onc 9:631-640 (1991) have described the use of this
agent in
detecting tumors in patients suspected of having recurrent colorectal cancer.
The use
of similar agents with paramagnetic ions as labels for magnetic resonance
imaging is
know in the art (R. B. Lauffer, Magnetic Resonance in Medicinle 22:339-342
(1991).
30 It is anticipated that antibodies directed against PA153 antigen can be
injected into
patients suspected of having a disease of the pancreas such as pancreatic
cancer for
the purpose of diagnosing or staging the disease status of the patient. The
label used
61
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
will depend on the imaging modality chosen. Radioactive labels such as Indium-
111,
Technetium-99m, or Iodine-131 can be used for planar scans or single photon
emission computed tomography (SPECT). Positron emitting labels such as
Fluorine-
19 can also be used for positron emission tomography (PET). For MRI,
paramagnetic
ions such as Gadolinium (III) or Manganese (II) can be used. Localization of
the
label within the pancreas or external to the pancreas may allow determination
of
spread of the disease. The amount of label within the pancreas may allow
determination of the presence or absence of cancer of the pancreas.
For patients known to have a disease of the pancreas, injection of an antibody
directed against PA153 antigen may have therapeutic benefit. The antibody may
exert its effect without the use of attached agents by binding to PA153
antigen
expressed on or in the tissue or organ. Alternatively; the antibody may be
conjugated
to cytotoxic agents such as drugs, toxins, or radionuclides to enhance its
therapeutic
effect. Garnett and Baldwin, Cancer Research 46:2407-2412 (1986) have
described
the preparation of a drug-monoclonal antibody conjugate. Pastan et al., Cell
47:641-
648 (1986) have reviewed the use oftoxins conjugated to monoclonal antibodies
for
the therapy of various cancers. Goodwin and Meares, Cancer Supplement 80:2675-
2680 (1997) have described the use of Yittrium-90 labeled monoclonal
antibodies in
various strategies to maximize the dose to tumor while limiting normal tissue
toxicity.
Other known cytotoxic radionuclides include Copper-67, Iodine-131, and Rhenium-
186 all of which can be used to label monoclonal antibodies directed against
PA153
antigen for the treatment of cancer of the pancreas.
E. coli bacteria {clone 2075919) was deposited on March 9, 1998 with the
American Type Culture Collection (A.T.C.C.), 10801 University Blvd.,
Mantissas,
VA. The deposit was made under the terms of the Budapest Treaty and will be
maintained for a period of thirty (30) years from the date of deposit, or for
five (5)
years after the last request for the deposit, or for the enforceable period of
the U.S.
patent, whichever is longer. The deposit and any other deposited material
described
herein are provided for convenience only, and are not required to practice the
present
invention in view of the teachings provided herein. The cDNA sequence in all
of the
deposited material is incorporated herein by reference. Clone 2075919 was
accorded
A.T.C.C. Deposit No. 98681.
62
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
The present invention will now be described by way of examples, which are
meant to illustrate, but not to limit, the scope of the present invention.
EXAMPLE
Example 1 ~ Identification of Pancreatic Tissue Library PA153 Gene-~ecific
Clones
A Library Comparison of Expressed Seauence Tag_s,~EST's1 or Transcript
Imaggs_. Partial sequences of cDNA clone inserts, so-called "expressed
sequence
tags" (EST's), were derived from cDNA libraries made from pancreatic tumor
tissues, pancreatic non-tumor tissues and numerous other tissues, both tumor
and non-
tumor and entered into a database (LIFESEQTM database, available from Incyte
Pharmaceuticals, Palo Alto, CA) as gene transcript images. See International
Publication No. WO 95/20681. (A transcript image is a listing of the number of
EST's for each of the represented genes in a given tissue library. EST's
sharing
regions of mutual sequence overlap are classified into clusters. A cluster is
assigned a
clone number from a representative 5' EST. Often, a cluster of interest can be
extended by comparing its consensus sequence with sequences of other EST's
which
did not meet the criteria for automated clustering. The alignment of all
available
clusters and single EST's represent a contig from which a consensus sequence
is
derived.) The transcript images then were evaluated to identify EST sequences
that
were representative primarily of the pancreatic tissue libraries. These target
clones
then were ranked according to their abundance (occurrence) in the target
libraries and
their absence from background libraries. Higher abundance clones with low
background occurrence were given higher study priority. EST's corresponding to
the
consensus sequence of PA153 were found in 55.0% (11 of 20) of pancreatic
tissue
libraries. EST's corresponding to the consensus sequence SEQUENCE ID NO 11 (or
fragments thereof) were found in less than 0.40% (3 of 758) of the other, non-
pancreatic, libraries of the data base. Therefore, the consensus sequence or
fragment
thereof was found more than 138 times more often in pancreatic than non-
pancreatic
tissues. Overlapping clones 2075919H1 (SEQUENCE ID NO 1), 2383634H1
(SEQUENCE ID NO 2), 5069724H1 (SEQUENCE ID NO 3), 5070712H1
(SEQUENCE ID NO 4), 2773816H1 (SEQUENCE ID NO 5), 2374806H1
63
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
(SEQUENCE ID NO 6), 5071731H1 (SEQUENCE ID NO 7), 883484H1
(SEQUENCE ID NO 8), 887213H1 (SEQUENCE ID NO 9), respectively, were
identified for further study. These represented the minimum number of clones
that
(along with the full-length sequence of clone 2075919 [designated as
207S919inh
S (SEQUENCE ID NO 10)] were needed to form the contig and from which the
consensus sequence provided herein (SEQUENCE ID NO 11) was derived.
$ Generation of a Consensus Seauence The nucleotide sequences of clones
207S919H1 (SEQUENCE ID NO 1), 2383634H1 (SEQUENCE ID NO 2),
5069724H1 (SEQUENCE ID NO 3), 5070712H1 (SEQUENCE ID NO 4),
2773816H1 (SEQUENCE ID NO S), 2374806H1 (SEQUENCE ID NO 6),
5071731H1 (SEQUENCE ID NO 7), 883484H1 (SEQUENCE ID NO 8), 887213H1
(SEQUENCE 1D NO 9), and the full-length sequence of clone 2075919 [designated
as 207S919inh (SEQUENCE ID NO 10)) were entered in the SequencherTM Program
(available from Gene Codes Corporation, Ann Arbor, MI) in order to generate a
nucleotide alignment (contig map) and then generate their consensus sequence
(SEQUENCE ID NO 11). Figures lA-1D show the nucleotide sequence alignment of
these clones and their resultant nucleotide consensus sequence (SEQUENCE ID NO
11). Figure 2 presents the contig map depicting the clones 207S919H1 (SEQUENCE
ID NO 1), 2383634H1 (SEQUENCE ID NO 2), 5069724H1 {SEQUENCE ID NO 3),
5070712H1 {SEQUENCE ID NO 4), 2773816H1 (SEQUENCE ID NO S),
2374806H1 (SEQUENCE ID NO 6), 5071731H1 (SEQUENCE ID NO 7), 883484H1
(SEQUENCE ID NO 8), 887213H1 (SEQUENCE ID NO 9), and the full-length
sequence of clone 2075919 [designated as 207S919inh (SEQUENCE ID NO 10)]
which form overlapping regions of the PAIS3 gene and the resultant consensus
2S nucleotide sequence (SEQUENCE m NO I 1) of these clones in a graphic
display.
Following this, a three-frame translation was performed on the consensus
sequence
(SEQUENCE ID NO 11). The third forward frame was found to have an open
reading frame encoding a 607 residue amino acid sequence which is presented as
SEQUENCE ID NO 28. The open reading frame corresponds to nucleotides 6 to
1826 of SEQUENCE ID NO 11.
The 607 residue amino acid sequence depicted in SEQUENCE >Z7 NO 28 was
compared with published sequences using soilware and techniques known to those
64
CA 02315263 2000-06-13
WO 99/31274 PCT/US98~26441
skilled in the art. The amino acid sequence of a marine protein precursor was
identified as having partial homology with the PA153 polypeptide of SEQUENCE
ID
NO 28. The sequence for this marine protein precursor is deposited with
GenBank
under Accession No. U69699. The polypeptide of SEQUENCE ID NO 28 also
displayed partial homology to rat Ebnerin, a protein secreted from the von
Ebner's
gland of rat and described in International Publication No. WO 96/39513.
E~ple 2' Sequencing of PA153 EST-Specific Clones
The DNA sequence of clone 2075919inh of the PA153 gene contig was
determined (SEQUENCE ID NO 10) using dideoxy termination sequencing with dye
terminators following known methods [F. Sanger et al., PNAS U.S.A. 74:5463
(1977)].
Because vectors such as pSPORTI (Life Technologies, Gaithersburg, MD)
and pINCY (available from Incyte Pharmaceuticals, Inc., Palo Alto, CA) contain
universal priming sites just adjacent to the 3' and 5' ligation junctions of
the inserts,
the inserts were sequenced in both directions using universal primers,
SEQUENCE
ID NO 14 and SEQUENCE ID NO 15, respectively ( New England Biolabs, Beverly,
MA and Applied Biosystems Inc, Foster City, CA). The sequencing reactions were
run on a polyacrylamide denaturing gel, and the sequences were determined by
an
Applied Biosystems 377 Sequencer (available from Applied Biosystems, Foster
City,
CA). Additional sequencing primers, SEQUENCE ID NOS 16 -25, were designed
from sequence information of the consensus sequence, SEQUENCE ID NO 11.
These primers then were used to determine the remaining DNA sequence of the
cloned insert from each DNA strand, as previously described.
Example 3: Nucleic Acid
A. RNA Extraction from Tissue. Total RNA was isolated from pancreatic
tissues and from non-pancreatic tissues. Various methods were utilized,
including but
not limited to the lithium chloride/urea technique, known in the art and
described by
Kato et al., . Virol. 61:2182-2191, 1987), and TRIzoITM (Gibco-BRL, Grand
Island,
NY).
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Briefly, tissue was placed in a sterile conical tube on ice and 10-15 volumes
of
3 M LiCI, 6 M urea., 5 mM EDTA, 0.1 M /3-mercaptoethanol, 50 mM Tris-HCl (pH
7.5), O.I% sarcosyl were added. The tissue was homogenized with an Omni TH
homogenizes (Omni International, Inc., Warrenton, VA) for 30-50 sec on ice.
The
solution was transferred to a I5 ml plastic centrifuge tube and placed
overnight at -
20°C. The tube was centrifuged for 90 min at 9,000 x g at 0-4°C
and the supernatant
was immediately decanted. Ten ml of 3 M LiCI were added and the tube was
vortexed for 5 sec. The tube was centrifuged for 45 min at 9,000 x g at 0-
4°C. The
decanting, resuspension in LiCI, and centrifugation was repeated and the final
pellet
was air dried and suspended in 2 ml of I mM EDTA, 0.5% SDS, 10 mM Tris (pH
7.5). One-tenth volume (0.22-0.25 ml) of 3 M NaCI was added and the solution
was
vortexed before transfer into another pre-cooled tube containing 2 ml of
phenol/chloroform/isoamyl alcohol (PCI) supplemented with 0.1 % (w/v) 8-
hydroxyquinoline. The tube was vortexed for 1-3 sec and centrifuged for 20 min
at
3,000 x g at 10°C. The PCI extraction was repeated and followed by two
similar
extractions with chloroform/isoamyl alcohol (CI). The final aqueous solution
was
transferred to a prechilled 15 ml Corex glass tube containing 6.5 ml of 95%
ethanol,
the tube was covered with parafilin, and placed at -20°C overnight. The
tube was
centrifuged for 30 min at 10,000 x g at 0-4°C and the ethanol
supernatant was
decanted immediately. The RNA pellet was washed four times with 10 ml of 75%
ice-cold ethanol and the final pellet was air dried for 15 min at room
temperature.
The RNA was suspended in O.lml deionized formamide (FORMAzoI ~, Molecular
Research Products, Cincinnati, OH) and its concentration was determined
spectrophotometrically. RNA samples were aliquoted and stored at -70°C
in 100%
FORMAzoI ~.
The quality of the RNA was determined by denaturing agarose gel
electrophoresis (see Example 5, Northern Blot Analysis); samples were
visualized by
the inclusion of 1 ul of 1 mg/ml ethidium bromide solution in the sample
before
loading on the gel. RNA samples that did not contain intact rRNAs were
excluded
from the study.
For RT-PCR analysis, RNA samples were aliquoted and stored at -
70°C as
ethanol precipitates. The sample was centrifuged at 12,000 x g for 30 min at
4°C, and
66
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
the supernatant discarded. The remaining pellet was washed twice with cold 75%
ethanol, resuspended by vortexing, and the resuspended material was then
pelleted by
centrifugation at 12,000 x g for 1Q min at 4°C. Finally, the RNA pellet
was dried in a
Speedvac (Savant, Farmingdale, NY) for 5 min and reconstituted in RNase-free
water.
B RNA Extraction from Blood Mononuclear ells. Mononuclear cells are
isolated from blood samples from patients by centrifugation using Ficoll-
Hypaque as
follows. A 10 ml volume of whole blood is mixed with an equal volume of RPMI
Medium (Gibco-BRL, Grand Island, N~. This mixture is then underlayed with 10
ml of Ficoll-Hypaque (Pharmacia, Piscataway, NJ) and centrifuged for 30
minutes at
200 x g. The huffy coat containing the mononuclear cells is removed, diluted
to 50
ml with Dulbecco's PBS (Gibco-BRL, Grand Island, NI~ and the mixture
centrifuged
for 10 minutes at 200 x g. After two washes, the resulting pellet is
resuspended in
Dulbecco's PBS to a final volume of 1 ml.
RNA is prepared from the isolated mononuclear cells as described by N. Kato
et al., . Virol bl: 2182-2191 (1987). Briefly, the pelleted mononuclear cells
are
brought to a final volume of 1 ml and then are resuspended in 250 pL of PBS
and
mixed with 2.5 ml of 3M LiCI, 6M urea, 5mM EDTA, O.1M 2-mercaptoethanol,
50mM Tris-HCl (pH 7.5). The resulting mixture is homogenized and incubated at -
20°C overnight. The homogenate is centrifuged at 8,000 RPM in a Beckman
J2-21M
rotor for 90 minutes at 0-4°C. The pellet is resuspended in 10 mI of 3M
LiCI by
vortexing and then centrifuged at 10,000 RPM in a Beckman J2-21M rotor
centrifuge
for 45 minutes at 0-4°C. The resuspending and pelleting steps then are
repeated. The
pellet is resuspended in 2 mI of 1 mM EDTA, 0.5% SDS, 10 mM Tris (pH 7.5) and
400 p.g Proteinase K with vortexing and then it is incubated at 37°C
for 30 minutes
with shaking. One-tenth volume of 3M NaCI then is added and the mixture is
vortexed. Proteins are removed by two cycles of extraction with phenol/
chloroform/
isoamyl alcohol (PCl7 followed by one extraction with chloroform/ isoamyl
alcohol
(CI). RNA is precipitated by the addition of 6 ml of absolute ethanol followed
by
overnight incubation at -20°C. After the precipitated RNA is collected
by
centrifugation, the pellet is washed 4 times in 75% ethanol. The pelleted RNA
is then
dissolved in solution containing 1mM EDTA, lOmM Tris-HCl (pH 7.5).
67
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Non-pancreatic tissues are used as negative controls. The mRNA can be
further purified from total RNA by using commercially available kits such as
oligo dT
cellulose spin columns (RediColTM from Phannacia, Uppsala, Sweden) for the
isolation of poly-adenylated RNA. Total RNA or mRNA can be dissolved in lysis
buffer (SM guanidine thiocyanate, O.1M EDTA, pH 7.0) for analysis in the
ribonuclease protection assay.
C. RNA Extraction from Polysomes. Tissue is minced in saline at
4°C and
mixed with 2.5 volumes of 0.8 M sucrose in a TK,S°IVI (150 mM KCI, 5 mM
MgCl2,
50 mM Tris-HCI, pH 7.4) solution containing 6 mM 2-mercaptoethanol. The tissue
is
homogenized in a Teflon-glass Potter homogenizer with five strokes at 100-200
rpm
followed by six strokes in a Dounce homogenizer, as described by B. Mechler,
Methods in Enzvmology 152:241-248 (1987). The homogenate then is centrifuged
at
12,000 x g for 15 min at 4°C to sediment the nuclei. The polysomes are
isolated by
mixing 2 ml of the supernatant with 6 ml of 2.5 M sucrose in TK,S°IVI
and layering
this mixture over 4 ml of 2.5 M sucrose in TK,s°1VI in a 38 ml
polyallomer tube. Two
additional sucrose TK,s°IVI solutions are successively layered onto the
extract fraction;
a first layer of 13 ml 2.05 M sucrose followed by a second layer of 6 ml of
1.3 M
sucrose. The polysomes are isolated by centrifuging the gradient at 90,000 x g
for 5
hr at 4°C. The fraction then is taken from the 1.3 M sucrose/2.05 M
sucrose interface
with a siliconized pasteur pipette and diluted in an equal volume of TE (10 mM
Tris-
HCI, pH 7.4, 1 mM EDTA). An equal volume of 90°C SDS buffer (1 %
SDS, 200
mM NaCI, 20 mM Tris-HCI, pH 7.4) is added and the solution is incubated in a
boiling water bath for 2 min. Proteins next are digested with a Proteinase K
digestion
(50 mg/ml) for 15 min at 37°C. The mRNA is purified with 3 equal
volumes of
phenol-chloroform extractions followed by precipitation with 0.1 volume of 2 M
sodium acetate (pH 5.2) and 2 volumes of 100% ethanol at -20°C
overnight. The
precipitated RNA is recovered by centrifugation at 12,000 x g for 10 min at
4°C. The
RNA is dried and resuspended in TE (pH 7.4) or distilled water. The
resuspended
RNA then can be used in a slot blot or dot blot hybridization assay to check
for the
presence of PA153 mRNA (see Example 6).
The quality of nucleic acid and proteins is dependent on the method of
preparation used. Each sample may require a different preparation technique to
68
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
maximize isolation efficiency of the target molecule. These preparation
techniques
are within the skill of the ordinary artisan.
Example 4: Ribonuclease Protection Assay
A. Svnthesis of Labeled Complementary RNA (cRNAI Hybridization Probe
and Unlabeled Sense Strand. Labeled antisense and unlabeled sense riboprobes
are
transcribed from the PA153 gene cDNA sequence which contains a S' RNA
polymerase promoter such as SP6 or T7. The sequence may be from a vector
containing the appropriate PA153 cDNA insert, or from a PCR-generated product
of
the insert using PCR primers which incorporate a 5' RNA polymerase promoter
sequence. For example, the described plasmid, clone 2075919 or another
comparable
clone, containing the PA153 gene cDNA sequence, flanked by opposed SP6 and T7
or other RNA polymerase promoters, is purified using a Qiagen Plasmid
Purification
Kit (Qiagen, Chatsworth, CA). Then 10 pg of the plasmid DNA are linearized by
cutting with an appropriate restriction enzyme such as Dde I for 1 hr at
37°C. The
linearized plasmid DNA is purified using the QIAprep Kit (Qiagen, Chatsworth,
CA)
and used for the synthesis of antisense transcript from the appropriate
promoter using
the Riboprobe~ in vitro Transcription System (Promega Corporation, Madison,
WI),
as described by the supplier's instructions, incorporating either (alpha'2P)
CTP
(Amersham Life Sciences, Inc. Arlington Heights, IL) or biotinylated CTP as a
label.
To generate the sense strand, 10 pg of the purified plasmid DNA are cut with
restriction enzymes, such as Xba I and Not I, and transcribed as above from
the
appropriate promoter. Both sense and antisense strands are isolated by spin
column
chromatography. Unlabeled sense strand is quantitated by UV absorption at 260
nm.
B-Hybridization of Labeled Probe to Target. Frozen tissue is pulverized to
powder under liquid nitrogen and 100-500 mg are dissolved in 1 ml of lysis
buffer,
available as a component of the Direct Protect''' Lysate RNase Protection Kit
{Ambion, Inc., Austin, TX). Further dissolution can be achieved using a tissue
homogenizer. In addition, a dilution series of a known amount of sense strand
in
mouse liver lysate is made for use as a positive control. Finally, 45 gl of
solubilized
tissue or diluted sense strand is mixed directly with either ; 1) 1 x105 cpm
of
radioactively labeled probe, or 2) 250 pg of non-isotopically labeled probe in
S pl of
69
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
lysis buffer. Hybridization is allowed to proceed overnight at 37°C.
See, T.
Kaabache et al., Anal. Biochem. 232:225-230 (1995).
C. RNase Di eg soon. RNA that is not hybridized to probe is removed from
the reaction as per the Direct Protects protocol using a solution of RNase A
and
RNase T1 for 30 min at 37°C, followed by removal of RNase by
Proteinase K
digestion in the presence of sodium sarcosyl. Hybridized fragments protected
from
digestion are then precipitated by the addition of an equal volume of
isopropanol and
placed at -70°C for 3 hr. The precipitates are collected by
centrifugation at 12,000 x g
for 20 min.
D. Fragment A.na~sis. The precipitates are dissolved in denaturing gel
loading dye (80% formamide, 10 mM EDTA (gH 8.0), 1 mg/ml xylene cyanol, 1
mg/ml bromophenol blue), heat denatured, and electrophoresed in 6%
polyacrylamide
TBE, 8 M urea denaturing gels. The gels are imaged and analyzed using the
STORMT"'' storage phosphor autoradiography system (Molecular Dynamics,
Sunnyvale, CA). Quantitation of protected fragment bands, expressed in
femtograms
(fg), is achieved by comparing the peak areas obtained from the test samples
to those
from the known dilutions of the positive control sense strand (see Section B,
su ra .
The results are expressed in molecules of PA153 RNA/cell and as an image
rating
score. In cases where non-isotopic labels are used, hybrids are transferred
from the
gels to membranes (nylon or nitrocellulose) by blotting and then analyzed
using
detection systems that employ streptavidin alkaline phosphatase conjugates and
chemiluminesence or chemifluoresence reagents.
Detection of a product comprising a sequence selected from the group
consisting of SEQUENCE 1D NOS 1-I 1, and fragments or complements thereof, is
indicative of the presence of PA153 mRNA(s), suggesting a diagnosis of a
pancreatic
tissue disease or condition, such as pancreatic cancer.
Ex~~ple 5: Northern Blotting
The Northern blot technique is used to identify a specific size RNA fragment
from a complex population of RNA using gel electrophoresis and nucleic acid
hybridization. Northern blotting is well-known technique in the art. Briefly,
5-10 ~,g
of total RNA (see Example 3) are incubated in 15 pl of a solution containing
40 mM
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
rnolpholinopropanesulfonic acid (MOPS) (pH 7.0), 10 mM sodium acetate, 1 mM
EDTA, 2.2 M formaldehyde, 50% v/v formamide for 15 min at 65°C. The
denatured
RNA is mixed with 2 ~,I of loading buffer (50% glycerol, I mM EDTA, 0.4%
bromophenol blue, 0.4% xylene cyanol) and loaded into a denaturing I .0%
agarose
gel containing 40 mM MOPS (pH 7.0), 10 mM sodium acetate, 1 mM EDTA and 2.2
M formaldehyde. The gel is electrophoresed at 60 V for 1.5 hr and rinsed in
RNAse
free water. RNA is transferred from the gel onto nylon membranes (Brightstar-
Plus,
Ambion, Inc., Austin, TX) for 1.5 hours using the downward alkaline capillary
transfer method {Chomczynski, Anal. Biochem. 201:134-139, 1992). The filter is
rinsed with 1X SSC, and RNA is crosslinked to the filter using a Stratalinker~
(Stratagene, Inc., La Jolla, CA) on the autocrosslinking mode and dried for 15
min.
The membrane is then placed into a hybridization tube containing 20 ml of
preheated
prehybridization solution (SX SSC, 50% formamide, 5X Denhardt's solution, 100
~g/ml denatured salmon sperm DNA) and incubated in a 42°C hybridization
oven for
at least 3 hr. While the blot is prehybridizing, a 32P-labeled random-primed
probe is
generated using the PA153 insert fragment (obtained by digesting clone 2075919
or
another comparable clone with XbaI and NotI) using Random Primer DNA Labeling
System (Life Technologies, Inc., Gaithersburg, MD) according to the
manufacturer's
instructions. Half of the probe is boiled for 10 min, quick chilled on ice and
added to
the hybridization tube. Hybridization is carried out at 42°C for at
least 12 hr. The
hybridization solution is discarded and the filter is washed in 30 ml of 3X
SSC, 0.1%
SDS at 42°C for 15 min, followed by 30 ml of 3X SSC, 0.1 % SDS at
42°C for 15
min. The filter is wrapped in Saran Wrap, exposed to Kodak XAR-Omat film for 8-
96 hr, and the film is developed for analysis. High level of expression of
mRNA
corresponding to a sequence selected from the group consisting of SEQUENCE ID
NOS 1-11, and fragments or complements thereof, is an indication of the
presence of
PA153 mRNA, suggesting a diagnosis of a pancreatic tissue disease or
condition,
such as pancreatic cancer.
Example 6: Dot Blot/Slot Blot
Dot and slot blot assays are quick methods to evaluate the presence of a
specific nucleic acid sequence in a complex mix of nucleic acid. To perform
such
71
CA 02315263 2000-06-13
WO 99/31274 PCT/US98J26441
assays, up to SO ~g of RNA are mixed in 50 ~,1 of SO% formamide, 7%
formaldehyde,
1X SSC, incubated 15 min at 68°C, and then cooled on ice. Then, 100 ~,1
of 20X SSC
are added to the RNA mixture and loaded under vacuum onto a manifold apparatus
that has a prepared nitrocellulose or nylon membrane. The membrane is soaked
in
water, 20X SSC for 1 hour, placed on two sheets of 20X SSC prewet Whatman #3
filter paper, and loaded into a slot blot or dot blot vacuum manifold
apparatus. The
slot blot is analyzed with probes prepared and labeled as described in Example
4,
su ra. Detection of mRNA corresponding to a sequence selected from the group
consisting of SEQI1ENCE ID NOS 1-11, and fragments or complements thereof, is
an indication of the presence of PA153, suggesting a diagnosis of a pancreatic
tissue
disease or condition, such as pancreatic cancer.
Other methods and buffers which can be utilized in the methods described in
Examples S and 6, but not specifically detailed herein, are known in the art
and are
described in J. Sambrook et al., supra.
Example 7: In Situ Hybridization
This method is useful to directly detect specific target nucleic acid
sequences
in cells using detectable nucleic acid hybridization probes.
Tissues are prepared with cross-linking fixative agents such as
paraformaldehyde or glutaraldehyde for maximum cellular RNA retention. See, L.
Angerer et al., Methods in Cell,Biol. 35:37-71 (1991). Briefly, the tissue is
placed in
greater than 5 volumes of 1 % glutaraldehyde in 50 mM sodium phosphate, pH 7.5
at
4°C for 30 min. The solution is changed with fresh glutaraldehyde
solution (1%
glutaraldehyde in SOmM sodium phosphate, pH 7.5) for a fiu-ther 30 min fixing.
The
fixing solution should have an osmolality of approximately 0.375% NaCI. The
tissue
is washed once in isotonic NaCI to remove the phosphate.
The fixed tissues then are embedded in paraffin as follows. The tissue is
dehydrated though a series of increasing ethanol concentrations for 15 min
each: 50%
(twice), 70% (twice}, 85%, 90% and then 100% (twice). Next, the tissue is
soaked in
two changes of xylene for 20 min each at room temperature. The tissue is then
soaked in two changes of a 1:1 mixture of xylene and paraffin for 20 min each
at
60°C; and then in three final changes of paraffin for 15 min each.
72
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Next, the tissue is cut in S gm sections using a standard microtome and placed
on a slide previously treated with a tissue adhesive such as 3-
aminopropyltriethoxysilane.
Paraffin is removed from the tissue by two 10 min xylene soaks and
rehydrated in a series of decreasing ethanol concentrations: 99% twice, 95%,
85%,
70%, 50%, 30%, and then distilled water twice. The sections are pre-treated
with 0.2
M HCl far 10 min and permeabilized with 2 pg/ml Proteinase K at 37°C
for 15 min.
Labeled riboprobes transcribed from the PA153 gene plasmid (see Example 4)
are hybridized to the prepared tissue sections and incubated overnight at
56°C in 3X
standard saline extract and 50% formamide. Excess probe is removed by washing
in
2X standard saline citrate and 50% formamide followed by digestion with 100
~,g/ml
RNase A at 37°C for 30 min. Fluorescence probe is visualized by
illumination with
ultraviolet (I1V) light under a microscope. Fluorescence in the cytoplasm is
indicative of PA153 mRNA. Alternatively, the sections can be visualized by
autoradiography.
Example 8: Reverse Transcription PCR
A. One Sten RT-PCR Assay. Target-specific primers are designed to detect
the above-described target sequences by reverse transcription PCR using
methods
known in the art. One step RT-PCR is a sequential procedure that performs both
RT
and PCR in a single reaction mixture. The procedure is performed in a 200 ~,1
reaction mixture containing 50 mM (N,N; bis[2-Hydroxyethyl]glycine), pH 8.15,
81.7 mM KOAc, 33.33 mM KOH, 0.01 mg/ml bovine serum albumin, 0.1 mM
ethylene diaminetetraacetic acid, 0.02 mg/ml NaN,, 8% w/v glycerol, 150 gM
each of
dNTP, 0.25 uM each primer, SU rZ'th polymerise, 3.25 mM Mn(OAc)2 and 5 pl of
target RNA (see Example 3). Since RNA and the rTth polymerise enzyme are
unstable in the presence of Mn(OAc)Z, the Mn(OAc)2 should be added just before
target addition. Optimal conditions for cDNA synthesis and thermal cycling
readily
can be determined by those skilled in the art. The reaction is incubated in a
Perkin-
Elmer Thermal Cycler 480. Conditions which may be found useful include cDNA
synthesis at 60°-70°C for 15-45 min and 30-45 amplification
cycles at 94°C, 1 min;
55°-70°C, 1 min; 72°C, 2 min. One step RT-PCR also may be
performed by using a
73
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
dual enzyme procedure with Taq polymerise and a reverse transcriptase enzyme,
such
as MMLV (Moloney marine leukemia virus) or AMV (avian myeloblastosis virus)
RT (reverse transcriptase) enzymes.
B. Traditional RT-PCR. A traditional two-step RT-PCR reaction was
performed, as described by K.Q. Hu et al., Virology 181:721-726 (/991).
Briefly, 0.5
pg of extracted mRNA (see Example 3) was reverse transcribed in a 20 p,l
reaction
mixture containing 1X PCR II buffer (Perkin-Elmer), S mM MgCl2, 1 mM each
dNTP, 20 U RNasin, 2.5 uM random hexamers, and 50 U MMLV RT. Reverse
transcription was performed at room temperature for 10 min, 42°C for 30
min in a
PE-480 thermal cycler (Perkin-Elmer), followed by further incubation at
95°C for 5
min to inactivate the RT. PCR was performed using 2 ~,1 of the cDNA reaction
in a
final PCR reaction volume of 50 wl containing 1X PCR II buffer (Perkin-Elmer),
50
mM KCI, 1.5 mM MgCl2, 200 pM dNTPs, 0.5 pM of each sense and antisense
primer, SEQUENCE ID NO 26 and SEQUENCE ID NO 27, respectively, and 2.5 U
of Taq Gold polymerise. The reaction was incubated in a PE-480 thermal cycler
(Perkin-Eliner), as follows: 35 cycles of amplification (94°C, 45 sec;
58°C, 45 sec;
70°C, 2 min.); a final extension (72°C, 7 min); and a soak at
4°C.
C. PCR Fragment Analysis. The correct products were verified by size
determination using 1 % gel electrophoresis with a SYBR~ Green I nucleic acid
gel
stain (Molecular Probes, Eugene, OR). Gels were stained with SYBR~ Green I at
a
1:10,000 dilution in 1X TBE for 45 min. and then were imaged using a STORMTM
imaging system {Molecular Dynamics, Sunnyvale, CA). Figure 3 shows intensely
staining 1019 by RNA-specific PCR amplification products in 1 of 1 normal
pancreatic samples (lane 3) and 1 (lane 6) of 3 pancreatic cancer samples
tested (lanes
4-6), indicating that high levels of PA153 mRNA were present in 2 of 4
pancreatic
samples tested. Also observed in Figure 3 were faintly staining 1019 by RNA-
specific PCR amplification products in samples from normal lung (lane 7),
normal
colon (lane 10), colon cancer (lane 11), prostatic cancer (lanes 14 and 15),
normal
ovary, ovarian cancer (lanes 17 and 19), breast cancer (lane 20), and bladder
cancer
(lanes 23 and 25).
Detection of high levels of a product comprising a sequence selected from the
group consisting of SEQUENCE ID NOS 1-11, and fragments or complements
thereof,
74
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
is indicative of the presence of PA153 mRNA(s), suggesting a diagnosis of a
pancreatic
tissue disease or condition, such as pancreatic cancer.
Example 9: OH-PCR
A. Probe selection and Labeling. Target-specific primers and probes are
designed to detect the above-described target sequences by oligonucleotide
hybridization PCR. International Publication Nos WO 92/10505, published June
25,
1992, and WO 92/11388, published July 9, 1992, teach methods for labeling
oligonucleotides at their 5' and 3' ends, respectively. According to one known
method for labeling an oligonucleotide; a label-phosphoramidite reagent is
prepared
and used to add the label to the oligonucleotide during its synthesis. For
example, age
N. T. Thuong et al., Tet. Letters 29(46):5905-5908 (1988); or J. S. Cohen et
al.,
published U.S. Patent Application 07/246,688 (NTIS ORDER No. PAT-APPL-
7-246,688) (1989). Preferably, probes are labeled at their 3' end to prevent
participation in PCR and the formation of undesired extension products. For
one step
OH-PCR, the probe should have a TM at least 15°C below the TM of the
primers.
The primers and probes are utilized as specific binding members, with or
without
detectable labels, using standard phosphoramidite chemistry and/or post-
synthetic
labeling methods which are well-known to one skilled in the art.
B. One Step Oligo ~vbridization PCR. OH-PCR is performed on a 200 ~,l
reaction containing 50 mM (N,N; bis[2-Hydroxyethyl]glycine), pH 8.I5, 81.7 mM
KOAc, 33.33 mM KOH, 0.01 mglml bovine serum albumin, 0.1 mM ethylene
diaminetetraacetic acid, 0.02 mg/ml NaN3~ 8% w1v glycerol, 150 ~,M each of
dNTP,
0.25 pM each primer, 3.75 nM pmbe, SU >'Tth polymerise, 3.25 mM Mn(OAc)Z and 5
p.l blood equivalents of target (see Example 3). Since RNA and the rTth
polymerise
enzyme are unstable in the presence of Mn(OAc)Z, the Mn(OAc)2 should be added
just before target addition. The reaction is incubated in a Perkin-Elmer
Thermal
Cycler 480. Optimal conditions for cDNA synthesis and thermal cycling can be
readily determined by those skilled in the art. Conditions which may be found
useful
include cDNA synthesis (60°C, 30 min), 30-45 amplification cycles
(94°C, 40 sec;
55-70°C, 60 sec), oligo-hybridization (97°C, 5 min; 15°C,
5 min; 15°C soak). The
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
correct reaction product contains at least one of the strands of the PCR
product and an
internally hybridized probe.
C. O~I-PCR Product Analysis. Amplified reaction products are detected on
an LCx~ Analyzer system (available from Abbott Laboratories, Abbott Park, IL).
Briefly, the correct reaction product is captured by an antibody labeled
microparticle
at a capturable site on either the PCR product strand or the hybridization
probe, and
the complex is detected by binding of a detectable antibody conjugate to
either a
detectable site on the probe or the PCR strand. Only a complex containing a
PCR
strand hybridized with the internal probe is detectable. The detection of this
complex
then is indicative of the presence of PA153 mRNA, suggesting a diagnosis of a
pancreatic disease or condition, such as pancreatic cancer.
Many other detection formats exist which can be used and/or modified by
those skilled in the art to detect the presence of amplified or non-amplified
PA153
derived nucleic acid sequences including, but not limited to, ligase chain
reaction
1 S (LCR, Abbott Laboratories, Abbott Park, IL); Q-beta replicase (Gene-
TrakTM,
Naperville, Illinois), branched chain reaction (Chiron, Emeryville, CA) and
strand
displacement assays (Becton Dickinson, Research Triangle Park, NC).
Example 10' ,~vnthetic Pentide Production
Synthetic peptides were modeled and then prepared based upon the predicted
amino acid sequence of the PA153 polypeptide consensus sequence (see Example
1).
In particular, a number of PA153 peptides derived from SEQUENCE ID NO 28 were
prepared, including the peptides of SEQUENCE ID NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, and SEQUENCE LD NO 32. All peptides were synthesized
on a Symphony Peptide Synthesizer (available from Rainin Instrument Co,
Emeryville, CA) using FMOC chemistry, standard cycles and in-situ HBTU
activation. Cleavage and deprotection conditions were as follows: a volume of
2.5
ml of cleavage reagent (77.5% vlv trifluoroacetic acid, 15% v/v ethanedithiol,
2.5%
v/v water, S% v/v thioanisole, 1-2% w/v phenol) were added to the resin, and
agitated
at room temperature for 2-4 hours. The filtrate was then removed and the
peptide was
precipitated from the cleavage reagent with cold diethyl ether. Each peptide
was
76
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
filtered, purified via reverse-phase preparative HPLC using a
water/acetonitrile/0.1%
TFA gradient, and lyophilized. The product was confirmed by mass spectrometry.
The purified peptides were used to immunize animals (see Example 14).
Example 11 a' Expression of Protein in a Cell Line Usina Plasmid 577
A. Construction of a PA153 Expression Plasmid. Plasmid 577, described in
U.S. patent application Serial No. 08/478,073, filed June 7, 1995, has been
constructed for the expression of secreted antigens in a permanent cell line.
This
plasmid contains the following DNA segments: (a) a 2.3 kb fragment of pBR322
containing bacterial beta-lactamase and origin of DNA replication; (b) a 1.8
kb
cassette directing expression of a neomycin resistance gene under control of
HSV-1
thymidine kinase promoter and poly-A addition signals; (c) a 1.9 kb cassette
directing
expression of a dihydrofolate reductase gene under the control of an Simian
Virus 40
(SV40) promoter and poly-A addition signals; (d) a 3.5 kb cassette directing
expression of a rabbit immunoglobulin heavy chain signal sequence fused to a
modified hepatitis C virus (HCV) E2 protein under the control of the Simian
Virus 40
T-Ag promoter and transcription enhancer, the hepatitis B virus surface
antigen
(HBsAg) enhancer I followed by a fragment of Herpes Simplex Virus-1 (HSV-1)
genome providing poly-A addition signals; and (e) a residual 0.7 kb fragment
of
SV40 genome late region of no function in this plasmid. All of the segments of
the
vector were assembled by standard methods known to those skilled in the art of
molecular biology.
Plasmids for the expression of secretable PA153 proteins are constructed by
replacing the hepatitis C virus E2 protein coding sequence in plasmid 577 with
that of
a PA153 polynucleotide sequence selected from the group consisting of SEQUENCE
ID NOS 1-11, and fragments or complements thereof, as follows. Digestion of
plasmid 577 with XbaI releases the hepatitis C virus E2 gene fragment. The
resulting
plasmid backbone allows insertion of the PA153 cDNA insert downstream of the
rabbit immunoglobulin heavy chain signal sequence which directs the expressed
proteins into the secretory pathway of the cell. The PA153 cDNA fragment is
generated by PCR using standard procedures. Encoded in the sense PCR primer
sequence is an XbaI site, immediately followed by a 12 nucleotide sequence
that
77
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
encodes the amino acid sequence Ser-Asn-Glu-Leu (" SNEL" ) to promote signal
protease processing, efficient secretion and final product stability in
culture fluids.
Immediately following this 12 nucleotide sequence the primer contains
nucleotides
complementary to template sequences encoding amino acids ofthe PA153 gene .
The
antisense primer incorporates a sequence encoding the following eight amino
acids
just before the stop codons: Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (SEQUENCE ID
NO 33). Within this sequence is incorporated a recognition site to aid in
analysis and
purification of the PA153 protein product. A recognition site (termed "FLAG")
that
is recognized by a commercially available monoclonal antibody designated anti-
FLAG M2 (Eastman Kodak, Co., New Haven, CT) can be utilized, as well as other
comparable sequences and their corresponding antibodies. For example, PCR is
performed using GeneAmp~ reagents obtained from Perkin-Elmer-Cetus, as
directed
by the supplier's instructions. PCR primers are used at a final concentration
of 0.5
pM. PCR is performed on the PA153 plasmid template in a 100 ~.1 reaction for
35
1 S cycles (94°C, 30 seconds; 55°C, 30 seconds; 72°C, 90
seconds) followed by an
extension cycle of 72°C for 10 min.
B. Transfection of Dil3vdrofolate Reductase Deficient Chinese Hamster
Ovarv Cells. The plasmid described supra is transfected into CHO/dhfr- cells
[DXB-
11 l, Uriacio et al., Proc. Natl. Acad. Sci. USA 77:4451-4466 (1980)]. These
cells
are available from the A.T.C.C., 12301 Parklawn Drive, Rockville, MD 20852,
under
Accession No. CRL 9096. Transfection is carried out using the cationic
liposome-
mediated procedure described by P. L. Felgner et al., Proc. Natl. Acad. Sci.
USA
84:7413-7417 (1987). Particularly, CHO/dhfr- cells are cultured in Ham's F-12
media supplemented with 10% fetal calf serum, L-glutamine (1 mM) and freshly
seeded into a flask at a density of 5 - 8 x 105 cells per flask. The cells are
grown to a
confluency of between 60 and 80% for transfection. Twenty micrograms (20p,g)
of
plasmid DNA are added to 1.5 ml of Opti-MEM I medium and 100 ~1 of Lipofectin
Reagent (Gibco-BRL; Grand Island, N~ are added to a second 1.5 ml portion of
Opti-MEM I media. The two solutions are mixed and incubated at room
temperature
for 20 min. After the culture medium is removed from the cells, the cells are
rinsed 3
times with 5 ml of Opti-MEM I medium. The 4pti-MEM I-Lipofection-plasmid
DNA solution then is overlaid onto the cells. The cells are incubated for 3 hr
at 37°C,
78
CA 02315263 2000-06-13
WO 99/31274 PCT/US98I26441
after which time the Opti-MEM I-Lipofectin-DNA solution is replaced with
culture
medium for an additional 24 hr prior to selection.
C. Selection and Amplification. One day after transfection, cells are passaged
1:3 and incubated with dhfr/G418 selection medium (hereafter, "F-12 minus
medium
S G"). Selection medium is Ham's F-I2 with L-glutamine and without
hypoxanthine,
thymidine and glycine (JRH Biosciences, Lenexa, Kansas) and 300 ~,g per ml
6418
(Gibco-BRL; Grand Island, N~. Media volume-to-surface area ratios of 5 ml per
25
cm2 are maintained. After approximately two weeks, DHFR/G418 cells are
expanded to allow passage and continuous maintenance in F-12 minus medium G.
Amplification of each of the transfected PA153 cDNA sequences is achieved
by stepwise selection of DHFR+, 6418+ cells with methotrexate (reviewed by R.
Schimke, dell 37:705-713 [1984)). Cells are incubated with F-12 minus medium G
containing 150 nM methotrexate (MTX) (Sigma, St. Louis, MO) for approximately
two weeks until resistant colonies appear. Further gene amplification is
achieved by
selection of 150 nM adapted cells with 5 pM MTX.
D. Antigen Production. F-12 minus medium G supplemented with 5 uM
MTX is overlaid onto just confluent monolayers for 12 to 24 hr at 37°C
in 5% C02.
The growth medium is removed and the cells are rinsed 3 times with Dulbecco's
phosphate buffered saline (PBS) (with calcium and magnesium) (Gibco-BRL; Grand
Island, NI~ to remove the remaining media/serum which may be present. Cells
then
are incubated with VAS custom medium (VAS custom formulation with L-glutamine
with HEPES without phenol red, available from JRH Bioscience; Lenexa, KS,
product number 52-08678P), for 1 hr at 37°C in 5% C02. Cells then are
overlaid with
VAS for production at 5 ml per T flask. Medium is removed after seven days of
incubation, retained, and then frozen to await purification with harvests 2, 3
and 4.
The monolayers are overlaid with VAS for 3 more seven day harvests.
E Analysis of Pancreatic Tissue Gene PA153 Anti en Ex ression. Aliquots
of VAS supernatants from the cells expressing the PA153 protein construct are
analyzed, either by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using
standard methods and reagents known in the art (Laemmli discontinuous gels),
or by
mass spectrometry.
79
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
F. Purification. Purification of the PA153 protein containing the FLAG
sequence is performed by immunoaffinity chromatography using an affinity
matrix
comprising anti-FLAG M2 monoclonal antibody covalently attached to agarose by
hydrazide linkage (Eastman Kodak Co., New Haven, CT). Prior to affinity
purification, protein in pooled VAS medium harvests from roller bottles is
exchanged
into 50 mM Tris-HCl (pH 7.5), 150 mM NaCI buffer using a Sephadex G-25
(Pharmacia Biotech Inc., Uppsala, Sweden) column. Protein in this buffer is
applied
to the anti-FLAG M2 antibody affinity column. Non-binding protein is eluted by
washing the column with 50 mM Tris-HCl (pH 7.5), 150 mM NaCI buffer. Bound
protein is eluted using an excess of FLAG peptide in 50 mM Tris-HCl {pH 7.5),
150
mM NaCI. The excess FLAG peptide.can be removed from the purified PA153
protein by gel electrophoresis or HPLC.
Although pla.smid 577 is utilized in this example, it is known to those
skilled
in the art that other comparable expression systems, such as CMV, can be
utilized
herein with appropriate modifications in reagent and/or techniques and are
within the
skill of the ordinary artisan.
The largest cloned insert containing the coding region of the PA153 gene is
then sub-cloned into either (i) a eukaryotic expression vector which may
contain, for
example, a cytomegalovirus (CMV) promoter andlor protein fusible sequences
which
aid in protein expression and detection, or (ii) a bacterial expression vector
containing
a superoxide-dismutase (SOD) and CMP-KDO synthetase (CKS) or other protein
fusion gene for expression of the protein sequence. Methods and vectors which
are
useful for the production of polypeptides which contain fusion sequences of
SOD are
described in EPO 0196056, published October 1, 1986 and those containing
fusion
sequences of CKS are described in EPO Publication No. 0331961, published
September 13, 1989. This so purified protein can be used in a variety of
techniques,
including, but not limited to animal immunization studies, solid phase
immunoassays,
etc.
Example l lb~ Expression of Protein in a Cell Line Usin~pcDNA3 1/Mvc His
A. Construction of a PA153 Expression Plasmid. Plasmid pcDNA3.I/Myc-
His (Cat.# V855-20, Invitrogen, Carlsbad, CA) has been constructed, in the
past, for
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
the expression of secreted antigens by most mammalian cell lines. Expressed
protein
inserts are fused to a myc-his peptide tag. The myc-his tag (SEQUENCE ID NO
34}
comprises a c-myc oncoprotein epitope and a polyhistidine sequence which are
useful
for the purification of an expressed fusion protein by using either anti-myc
or anti-his
affinity columns, or metalloprotein binding columns.
Plasnuds for the expression of secretable PA153 proteins are constructed by
inserting a PAI53 polynucleotide sequence selected from the group consisting
of
SEQUENCE ID NOS 1-1 l, and fragments or complements thereof. Prior to
construction of a PA153 expression plasmid, the PAI53 cDNA sequence is first
cloned into a pCR~-Blunt vector as follows:
The PA153 cDNA fragment is generated by PCR using standard procedures.
For example, PCR is performed procedures and reagents from Stratagene~, Inc.
(La
Jolla, CA), as directed by the manufacturer. PCR primers are used at a final
concentration of 0.5 pM. PCR using 5 U of pfu polymerase (Stratagene, La
Jolla,
CA) is performed on the PA153 plasmid template (see Example 2) in a 50 p,l
reaction
for 30 cycles (94°C, 1 min; 65°C, 1.5 min; 72°C, 3 min)
followed by an extension
cycle of 72°C for 8 min. (The sense PCR primer sequence comprises
nucleotides
which are either complementary to the pINCY vector directly upstream of the
PA153
gene insert or which incorporate a 5' EcoRI restriction site, an adjacent
downstream
protein translation consensus initiator, and a 3' nucleic acid sequence which
is the
same sense as the 5'-most end of the PA153 cDNA insert. The antisense PCR
primer
incorporates a 5' NotI restriction sequence and a sequence complementary to
the 3'
end of the PA153 cDNA insert just upstream of the 3'-most, in-frame stop
codon.)
Five microliters (5 pl) of the resulting blunted-ended PCR product are ligated
into 25
ng of linearized pCR~-Blunt vector (Invitrogen, Carlsbad, CA) interrupting the
lethal
ccdB gene of the vector. The resulting ligated vector is transformed into
TOP10 ~
~i (Invitrogen, Carlsbad, CA) using a One Shof""' Transformation Kit
(Invitrogen,
Carlsbad, CA) following manufacturer's instructions. The transformed cells are
grown on LB-Kan (50 p,g/ml kanamycin) selection plates at 37°C. Only
cells
containing a plasmid with an interrupted ccdB gene will grow after
transformation
[Grant, S.G.N., Proc. Natl. Acad. Sci. USA 87:4645-4649 (1990)]. Transformed
colonies are picked and grown up in 3 ml of LB-Kan broth at 37°C.
Plasmid DNA is
81
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
isolated by using a QIAprep~ (Qiagen Inc., Santa Clarita, CA) procedure, as
directed
by the manufacturer. The DNA is cut with EcoRI or SnaBI, and NotI restriction
enzymes to release the PA153 insert fragment. The fragment is run on 1%
Seakem~
LE agarose/0.5 ~g/ml ethidium bromide/TE gel, visualized by UV irradiation,
excised
S and purified using QIAquick'~"'' (Qiagen Inc., Santa Clarita, CA)
procedures, as
directed by the supplier's instructions.
The pcDNA3.1/Myc-His plasmid DNA is linearized by digestion with EcoRI
or SnaBI, and NotI in the polylinker region of the plasmid DNA. The resulting
plasmid DNA backbone allows insertion of the PA153 purified cDNA fragment,
supra, downstream of a CMV promoter which directs expression of the proteins
in
mammalian cells. The ligated plasmid is transformed into DHS alphaT"' cells
(GibcoBRL Grand Island, NY), as directed by the manufacturer. Briefly, 10 ng
of
pcDNA3.1/Myc-His containing a PA153 insert are added to 50 pl of competent DHS
alpha cells, and the contents are mixed gently. The mixture is incubated on
ice for 30
min, heat shocked for 20 sec at 37°C, and placed on ice for an
additional 2 min.
Upon addition of 0.95 ml of LB medium, the mixture is incubated for 1 hr at
37°C
while shaking at 225 rpm. The transformed cells then are plated onto 100 mm
LB/Amp (SOpg/ml ampicillin) plates and grown at 37°C. Colonies are
picked and
grown in 3 ml of LB/Amp broth. Plasmid DNA is purified using a QIAprep Kit.
The
presence of the insert is confirmed using techniques known to those skilled in
the art,
including, but not limited to restriction digestion and gel analysis. (J.
Sambrook et
al., supra.)
B. Transfection of Human Embryonic Kidney Cell 293 Cells. The PA153
expression plasmid described in section A, sub, is retransformed into DHS
alpha
cells, plated onto LB/ampicillin agar, and grown up in 10 ml of LB/ampicillin
bmth,
as described hereinabove. The plasmid is purified using a QIAfilter~ Maxi Kit
(Qiagen, Chatsworth, CA) and is transfected into HEK293 cells [F.L. Graham et
al., ~
Gen. Vir. 36:59-72 (1977)]. These cells are available from the A.T.C.C., 12301
Parklawn Drive, Rockville, MD 20852, under Accession No. CRL 1573.
Transfection is carried out using the cationic lipofectamine-mediated
procedure
described by P. Hawley-Nelson et al., Focus 15.73 (1993). Particularly, HEK293
82
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
cells are cultured in 10 ml DMEM media supplemented with 10% fetal bovine
serum
(FBS), L-glutamine (2 mM) and freshly seeded into 100 mm culture plates at a
density of 9 x 106 cells per plate. The cells are grown at 37 °C to a
confluency of
between 70% and 80% for transfection. Eight micrograms (8 fig) of plasmid DNA
are added to 800 pl of Opti-MEM I~ medium (Gibco-BRL, Grand Island, NIA, and
48-96 pl of Lipofectamine'~"'' Reagent (Gibco-BRL, Grand Island, NY) are added
to a
second 800 ~.1 portion of Opti-MEM I media. The two solutions are mixed and
incubated at room temperature for 15-30 min. After the culture medium is
removed
from the cells, the cells are washed once with 10 ml of serum-free DMEM. The
Opti-
MEM I-Lipofectamine-plasmid DNA solution is diluted with 6.4 ml of serum-free
DMEM and then overlaid onto the cells. The cells are incubated for 5 hr at
37°C,
after which time, an additional 8 ml of DMEM with 20% FBS are added. After 18-
24
hr, the old medium is aspirated, and the cells are overlaid with 5 ml of fresh
DMEM
with 5% FBS. Supernatants and cell extracts are analyzed for PA153 gene
activity 72
hr after transfection.
Analysis of Pancreatic Tissue Gene PA153 Antt,;gen Expressnon. The
culture supernatant, supra. is transferred to cryotubes and stored on ice.
IiEK293
cells are harvested by washing twice with 10 ml of cold Dulbecco's PBS and
lysing
by addition of I.5 ml of CAT lysis buffer (Boehringer Mannheim, Indianapolis,
INJ,
followed by incubation for 30 min at room temperature. Lysate is transferred
to 1.7
ml polypropylene micmfuge tubes and centrifuged at 1000 x g for 10 min: The
supernatant is transferred to new cryotubes and stored on ice. Aliquots of
supernatants from the cells and the lysate of the cells expressing the PA153
protein
construct are analyzed for the presence of PA153 recombinant protein. The
aliquots
can be run on SDS-poiyacrylamide gel electrophoresis (SDS-PAGE) using standard
methods and reagents known in the art. (J. Sambrook et al., su . These gels
can
then be blotted onto a solid medium such as nitrocellulose, nytran, etc., and
the
PA153 protein band can be visualized using Western blotting techniques with
anti-
myc epitope or anti-histidine monoclonal antibodies (Invitrogen, Carlsbad, CA)
or
anti-PA153 polyclonal serum (see Example 14). Alternatively, the expressed
PA153
recombinant protein can be analyzed by mass spectrometry (see Example 12).
83
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
D. Purification. PuriFcation of the PA153 recombinant protein containing the
myc-his sequence is performed using the Xpress~ affinity chromatography system
(Invitrogen, Carlsbad, CA) containing a nickel-charged agarose resin which
specifically binds polyhistidine residues. Supernatants from 10 x 100 mm
plates,
prepared as described supra, are pooled and passed over the nickel-charged
column.
Non-binding protein is eluted by washing the column with SO mM Tris-HCl (pH
7.5)/150 mM NaCI buffer, leaving only the myc-his fusion proteins. Bound PA153
recombinant protein then is eluted from the column using either an excess of
imidazole or histidine, or a low pH buffer. Alternatively, the recombinant
protein can
also be purified by binding at the myc-his sequence to an affinity column
consisting
of either anti-myc or anti-histidine monoclonal antibodies conjugated through
a
hydrazide or other linkage to an agarose resin and eluting with an excess of
myc
peptide or histidine, respectively.
The purified recombinant protein can then be covaIently cross-linked to a
solid phase, such as N-hydroxysuccinimide-activated sepharose columns
(Pharmacia
Biotech, Piscataway, NJ), as directed by supplier's instructions. These
columns
containing covalently linked PA153 recombinant protein, can then be used to
purify
anti-PA153 antibodies from rabbit or mouse sera (see Examples 13 and 14).
E Coating Microtiter Plates with PA153 ~xnressed Proteins Supernatant
from a 100 mm plate, as described su,~ is diluted in an appropriate volume of
PBS.
Then, 100 ~,1 of the resulting mixture is placed into each well of a Reacti-
BindT"'
metal chelate microtiter plate (Pierce, Rockford, IL), incubated at mom
temperature
while shaking, and followed by three washes with 200 ~.1 each of PBS with
0.05%
Tween~ 20. The prepared microtiter plate can then be used to screen polyclonal
antisera for the presence of PA153 antibodies (see Example 17).
Although pcDNA3.1/Myc-His is utilized in this example, it is known to those
skilled in the art that other comparable expression systems can be utilized
herein with
appropriate modifications in reagent and/or techniques and are within the
skill of one
of ordinary skill in the art. The largest cloned insert containing the coding
region of
the PA153 gene is sub-cloned into either (i) a eukaryotic expression vector
which
$4
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
may contain, for example, a cytomegalovirus (CMV) promoter and/or protein
fusible
sequences which aid in protein expression and detection, or (ii) a bacterial
expression
vector containing a superoxide-dismutase (SOD) and CMP-KDO synthetase (CKS) or
other protein fusion gene for expression of the protein sequence. Methods and
vectors which are useful for the production of polypeptides which contain
fusion
sequences of SOD are described in published EPO application No. EP 0 196 056,
published October 1, 1986, and vectors containing fusion sequences of CKS are
described in published EPO application No. EP 0 331 961, published September
13,
1989. The purified protein can be used in a variety of techniques, including,
but not
limited to animal immunization studies, solid phase immunoassays, etc.
Example 12 ~ Chemical Analysis of Pancreatic Tissue Proteins
Analysis of Try tic Peptide Fraanents Usin~M,~. Sera from patients with
pancreatic disease, such as pancreatic cancer, sera from patients with no
pancreatic
1 S disease, extracts of pancreatic tissues or cells from patients with
pancreatic disease,
such as pancreatic cancer, extracts of pancreatic tissues or cells from
patients with no
pancreatic disease, and extracts of tissues or cells from other non-diseased
or diseased
organs of patients are run on a polyacrylamide gel using standard procedures
and
stained with Coomassie Blue. Sections of the gel suspected of containing the
unknown polypeptide are excised and subjected to an in-geI reduction,
acetamidation
and trypdc digestion. P. Jeno et al., An . 'o. 224:451-455 (1995) and J.
Rosenfeld
et al., An 1. io. 203:173-179 (1992). The gel sections are washed with 100
n~lVt
NH4HCO, and acetonitrile. The shrunken gel pieces are swollen in digestion
buffer
(50 mM NH,HC03, 5 mM CaCl2 and 12.5 ug/ml trypsin) at 4°C for 45 min.
The
supernatant is aspirated and replaced with 5 to 10 ~1 of digestion buffer
without
trypsin and allowed to incubate overnight at 37°C. Peptides are
extracted with 3
changes of 5% formic acid and acetonitrile and evaporated to dryness. The
peptides
are adsorbed to approximately 0.1 g,l of POROS R2 sorbent (Perseptive
Biosystems,
Framingham, Massachusetts) trapped in the tip of a drawn gas chromatography
capillary tube by dissolving them in 10 ~,1 of 5% formic acid and passing it
through
the capillary. The adsorbed peptides are washed with water and eluted with S%
formic acid in 60% methanol. The eluant is passed directly into the spraying
capillary
CA 02315263 2000-06-13
WO 99/31274 PCTNS98/26441
of an API III mass spectrometer (Perkin-Elmer Sciex, Thornhill, Ontario,
Canada) for
analysis by nano-electrospray mass spectrometry. M. Wilm et al., Int. J. Mass
Spectrom. Ion Process 136:167-180 (1994) and M. Wilm et al., Anal. Chem. 66:1-
8
(1994). The masses of the tryptic peptides are determined from the mass
spectrum
obtained off the first quadrupole. Masses corresponding to predicted peptides
can be
further analyzed in MS/MS mode to give the amino acid sequence of the peptide.
B Peptide Fragment Analysis Using C S. The presence of polypeptides
predicted from mRNA sequences found in hyperplastic disease tissues also can
be
confirmed using liquid chromatography/tandem mass spectrometry (LC/MS/MS). D.
Hess et al., METHODS A Companion to Methods in Enz~rrnoloQV 6:227-238 (1994).
The serum specimen or tumor extract from the patient is denatured with SDS and
reduced with dithiothreitol {1.5 mg/ml) for 30 min at 90°C followed by
alkylation
with iodoacetamide (4 mg/ml) for 15 min at 25°C. Following acrylamide
electrophoresis, the polypeptides are electroblotted to a cationic membrane
and
stained with Coomassie Blue. Following staining, the membranes are washed and
sections thought to contain the unknown polypeptides are cut out and dissected
into
small pieces. The membranes are placed in 500 p.l microcentrifuge tubes and
immersed in 10 to 20 ~,1 of proteolytic digestion buffer (100 mM Tris-HCI, pH
8.2,
containing 0.1 M NaCI, 10% acetonitrile, 2 mM CaCl2 and 5 ~,g/ml trypsin)
(Sigma,
St. Louis, MO). After 15 hr at 37°C, 3 ltl of saturated urea and 1 pl
of 100 pg/ml
trypsin are added and incubated for an additional 5 hr at 37°C. The
digestion mixture
is acidified with 3 ~,1 of 10% trifluoroacetic acid and centrifuged to
separate
supernatant from membrane. The supernatant is injected directly onto a
microbore,
reverse phase HPLC column and eluted with a linear gradient of acetonitrile in
0.05%
trifluoroacetic acid. The eluate is fed directly into an electrospray mass
spectrometer,
after passing though a stream splitter if necessary to adjust the volume of
material.
The data is analyzed following the procedures set forth in Example 12, Section
A.
Example 13~ Gene Im_muni~a 'on Protocol
A. In Vivo Antigen Expression. Gene immunization circumvents protein
purification steps by directly expressing an antigen in vivo after inoculation
of the
appropriate expression vector. Also, production of antigen by this method may
allow
86
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
correct protein folding and glycosylation since the protein is produced in
mammalian
tissue. The method utilizes insertion of the gene sequence into a plasmid
which
contains a CMV promoter, expansion acid purification of the plasmid and
injection of
the plasmid DNA into the muscle tissue of an animal. Preferred animals include
mice
and rabbits. See, for example, H. Davis et al., ~Iuman Molecular Genetics
2:1847-
1851 (1993}. After one or two booster immunizations, the animal can then be
bled,
ascites fluid collected, or the animal's spleen can be harvested for
production of
hybridomas.
B Plasmid Preparation and Purification. PA153 cDNA sequences are
generated from the PA153 cDNA-containing vector using appropriate PCR primers
containing suitable 5' restriction sites following the procedures described in
Example
11. The PCR product is cut with appropriate restriction enzymes and inserted
into a
vector which contains the CMV promoter (for example, pRc/CMV or pcDNA3
vectors from Invitrogen, San Diego, CA). This plasmid then is expanded in the
appropriate bacterial strain and purified from the cell Iysate using a CsC1
gradient or a
Qiagen plasmid DNA purification column. All these techniques are familiar to
one of
ordinary skill in the art of molecular biology.
C. Immunization Protocol. Anesthetized animals are immunized
intramuscularly with 0.1-100 pg of the purified plasmid diluted in PBS or
other DNA
uptake enhancers (Cardiotoxin, 25% sucrose). See, for example, H. Davis et
al.,
Human Gene Thera~,Y 4:733-740 (1993); and P. W. Wolff et al., Biotechnigues
11:474-485 (1991). One to two booster injections are given at monthly
intervals.
D. Testing and Use of Antiserum. Animals are bled and the resultant sera
tested for antibody using peptides synthesized from the known gene sequence
(see
Example 16) using techniques known in the art, such as Western blotting or EIA
techniques. Antisera produced by this method can then be used to detect the
presence
of the antigen in a patient's tissue or cell extract or in a patient's serum
by ELISA or
Western blotting techniques, such as those described in Examples 15 through
18.
Exaunnle 14: Production of Antibodies Against PA153
A. Production of Polvclonal Antisera Antiserum against PA153 was prepared
by injecting rabbits with peptides whose sequences were derived from that of
the
87
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
predicted amino acid sequence of the PA153 consensus nucleotide sequence
(SEQUENCE ID NO 11). The synthesis of peptides (SEQUENCE ID NO 29,
SEQUENCE 11? NO 30, SEQUENCE ID NO 31, and SEQUENCE ID NO 32) is
described in Example 10. Peptides used as immunogens were not conjugated to a
carrier such as keyhole limpet hemocyanine, KI,H, (i.e., they were
unconjugated.).
Animal Immunization. Female white New Zealand rabbits weighing 2 kg or
more were used for raising polyclonal antiserum. One animal was immunized per
unconjugated peptide (SEQUENCE ID NO 29, SEQUENCE ID NO 30, SEQUENCE
ID NO 31, and SEQUENCE ID NO 32). One week prior to the first immunization, 5
to 10 ml of blood were obtained from the animal to serve as a non-immune
prebleed
sample.
Unconjugated peptides, SEQUENCE ID NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, and SEQUENCE ID NO 32, were used to prepare the
primary immunogen by emulsifying 0.5 ml of the peptide at a concentration of 2
mg/ml in PBS (pH 7.2) which contained 0.5 ml of complete Freund's adjuvant
(CFA)
(Difco, Detroit, MI). The immunogen was injected into several sites of the
animal via
subcutaneous, intraperitoneal, and intramuscular routes of administration.
Four
weeks following the primary immunization, a booster immunization was
administered. The immunogen used for the booster immunization dose was
prepared
by emulsifying 0.5 ml of the same unconjugated peptide used for the primary
immunogen, except that the peptide now was diluted to 1 mg/ml with 0.5 ml of
incomplete Freund's adjuvant (IFA) (Difco, Detroit, MI). Again, the booster
dose
was administered into several sites via subcutaneous, intraperitoneal and
intramuscular types of injections. The animals were bled (5 ml) two weeks
after the
booster immunizations and each serum was tested for immunoreactivity to the
peptide
as described below. The booster and bleed schedule was repeated at 4 week
intervals
until an adequate titer was obtained. The titer or concentration of antiserum
was
determined by using unconjugated peptides in a microtiter EIA as described in
Example 17, below. An antibody titer of 1:500 or greater was considered an
adequate
titer for further use and study.
88
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
Table 1. Titer of rabbit anti-PA153 peptide antisera (11 week bleed
Peptide Immunogen Titer
SEQUENCE ID NO 29 8,800
SEQUENCE ID NO 31 52,000
SEQUENCE ID NO 32 51,000
B. Production of Monoclonal Antibody
S 1. Immunization Protocol. Mice are immunized using peptides which can
either be conjugated to a carrier such as KLH [prepared as described
hereinbelow, or
unconjugated (i.e., not conjugated to a carrier such as KLH)] except that the
amount
of the unconjugated or conjugated peptide for monoclonal antibody production
in
mice is one-tenth the amount used to produce polyclonal antisera in rabbits.
Thus, the
primary immunogen consists of 100 ~.g of unconjugated or conjugated peptide in
0.1
ml of CFA emulsion while the immunogen used for booster immunizations consists
of 50 ~.g of unconjugated or conjugated peptide in 0.1 ml of IFA. Hybridomas
for the
generation of monoclonal antibodies are prepared and screened using standard
techniques. The methods used for monoclonal antibody development follow
procedures known in the art such as those detailed in Kohler and Milstein,
Nature
256:494 (I975) and reviewed in J.G.R. Hurrel, ed., Monoclonal Hvbridoma
Antibodies Techniques and Applications CRC Press, Inc., Boca Raton, FL (1982).
Another method of monoclonal antibody development which is based on the Kohler
and Milstein method is that of L.T. Mimms et al., Virology 176:604-619 (1990).
The immunization regimen (per mouse) consists of a primary immunization
with additional booster immunizations. The primary immunogen used for the
primary immunization consists of 100 pg of unconjugated or conjugated peptide
in SO
pl of PBS (pH 7.2) previously emulsified in SO ~1 of CFA. Booster
immunizations
perfonmed at approximately two weeks and four weeks post primary immunization
consist of SO pg of unconjugated or conjugated peptide in 50 ~,l of PBS (pH
7.2)
emulsified with 50 p,l IFA. A total of 100 ~,1 of this immunogen are
inoculated
intraperitoneally and subcutaneously into each mouse. Individual mice are
screened
for immune response by microtiter plate enzyme immunoassay (EIA) as described
in
89
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/Z6441
Example 17 approximately four weeks after the third immunization. Mice are
inoculated either intravenously, intrasplenically or intraperitoneally with 50
~,g of
unconjugated or conjugated peptide in PBS (pH 7.2) approximately fifteen weeks
after the third immunization.
Three days after this intravenous boost, splenocytes are fused with, for
example, Sp2/0-Agl4 myeloma cells (Milstein Laboratories, England) using the
polyethylene glycol (PEG) method. The fusions are cultured in Iscove's
Modified
Dulbecco's Medium (IMDM) containing 10% fetal calf serum (FCS), plus 1
hypoxanthine, aminopterin and thymidine (HAT). Bulk cultures were screened by
microtiter plate EIA following the protocol in Example 17. Clones reactive
with the
peptide used an immunogen and non-reactive with other peptides (i.e., peptides
of
PA153 not used as the immunogen) are selected for final expansion. Clones thus
selected are expanded, aliquoted and frozen in IIVVIDM containing 10% FCS and
10%
dimethyl sulfoxide, (DMSO).
2. Peptide Conjugation. Peptide is conjugated to maleimide activated KLH
(commercially available as Imject~, available from Pierce Chemical Company,
Rockford, IL). Imject~ contains about 250 moles of reactive maleimide groups
per
mole of hemocyanine. The activated KLH is dissolved in phosphate buffered
saline
(PBS, pH 8.4) at a concentration of about 7.7 mg/ml. The peptide is conjugated
through cysteines occurring in the peptide sequence, or to a cysteine
previously added
to the synthesized peptide in order to provide a point of attachment. The
peptide is
dissolved in DMSO (Sigma Chemical Company, St. Louis, MO) and reacted with the
activated KLH at a mole ratio of about 1.5 moles of peptide per mole of
reactive
maleimide attached to the KLH: A procedure for the conjugation of peptide is
provided hereinbelow. it is known to the ordinary artisan that the amounts,
times and
conditions of such a procedure can be varied to optimize peptide conjugation.
The conjugation reaction described hereinbelow is based on obtaining 3 mg of
KLH peptide conjugate (" conjugated peptide" ), which contains about 0.77
p,moles of
reactive maleimide groups. This quantity of peptide conjugate usually is
adequate for
one primary injection and four booster injections for production of polyclonal
antisera
in a rabbit. Briefly, peptide is dissolved in DMSO at a concentration of 1.16
pmoles/100 p.l of DMSO. One hundred microliters (100 ~,1) of the DMSO solution
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
are added to 380 ~,l of the activated KLH solution prepared as described
hereinabove,
and 20 pl of PBS (pH 8.4) are added to bring the volume to 500 ~.1. The
reaction is
incubated overnight at room temperature with stirring. The extent of reaction
is
determined by measuring the amount of unreacted thiol in the reaction mixture.
The
difference between the starting concentration of thiol and the final
concentration is
assumed to be the concentration of peptide which has coupled to the activated
KLH.
The amount of remaining thiol is measured using Ellman's reagent (5,5'-
dithiobis(2-
nitrobenzoic acid), Pierce Chemical Company, Rockford, IL). Cysteine standards
are
made at a concentration of 0, 0. l, 0.5, 2, 5 and 20 mM by dissolving 35 mg of
cysteine HCl (Pierce Chemical Company, Rockford, IL) in 10 ml of PBS (pH 7.2)
and diluting the stock solution to the desired concentration(s). The
photometric
determination of the concentration of thiol is accomplished by placing 200 ~.1
of PBS
(pH 8.4) in each well of an Immulon 2~ microwell plate (Dynex Technologies,
Chantilly, VA). Next, 10 ul of standard or reaction mixture are added to each
well.
Finally, 20 pl of Ellman's reagent at a concentration of 1 mg/ml in PBS (pH
8.4) are
added to each well. The wells are incubated for 10 minutes at room
temperature, and
the absorbance of all wells is read at 415 nm with a microplate reader (such
as the
BioRad Model 3550, BioRad, Richmond, CA). The absorbance of the standards is
used to construct a standard curve and the thiol concentration of the reaction
mixture
is determined from the standard curve. A decrease in the concentration of free
thiol is
indicative of a successful conjugation reaction. Unreacted peptide is removed
by
dialysis against PBS (pH 7.2) at room temperature for 6 hours. The conjugate
is
stored at 2-8°C if it is to be used immediately; otherwise, it is
stored at -20°C or
colder.
3. Production of Ascites Fluid Containing Monoclonal Antibodies. Frozen
hybridoma cells prepared as described hereinabove are thawed and placed into
expansion culture. Viable hybridoma cells are inoculated intraperitoneally
into
Pristane treated mice. Ascitic fluid is removed from the mice, pooled,
filtered
through a 0.2 w filter and subjected to an immunoglobuhn class G (IgG)
analysis to
determine the volume of the Protein A column required for the purification.
4. Purification of Monoclonal Antibodies from Ascites Fluid. Briefly, filtered
and thawed ascites fluid is mixed with an equal volume of Protein A sepharose
91
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
binding buffer (1.5 M glycine, 3.0 M NaCI, pH 8.9) and refiltered through a
0.2 p
filter. The volume of the Protein A column is determined by the quantity of
IgG
present in the ascites fluid. The eluate then is dialyzed against PBS (pH 7.2)
overnight at 2-8°C. The dialyzed monoclonal antibody is sterile
filtered and
dispensed in aliquots. The immunoreactivity of the purified monoclonal
antibody is
confirmed by determining its ability to specifically bind to the peptide used
as the
immunogen by use of the EIA microtiter plate assay procedure of Example 17.
The
specificity of the purified monoclonal antibody is confirmed by determining
its lack
of binding to irrelevant peptides such as peptides of PA153 not used as the
immunogen. The purified anti-PA153 monoclonal thus prepared and characterized
is
placed at either 2-8°C for short term storage or at -80°C for
long term storage.
5. Further Characterization of Monoclonal Antibody. The isotype and
subtype of the monoclonal antibody produced as described hereinabove can be
determined using commercially available kits (available from Amersham. Inc.,
Arlington Heights, IL). Stability testing also can be performed on the
monoclonal
antibody by placing an aliquot of the monoclonal antibody in continuous
storage at 2-
8°C and assaying optical density (OD) readings throughout the course of
a given
period of time.
C. Use of Recombi ant Proteins as I unog.~s It is within the scope of the
present invention that recombinant proteins made as described herein can be
utilized
as immunogens in the production of polyclonal and monoclonal antibodies, with
corresponding changes in reagents and techniques known to those skilled in the
art.
Example 15: Purification of Senmri Antibodies Which , ~ callv
Bind to PA153 Pentide~
Immune sera, obtained as described hereinabove in Examples 13 and/or 14, is
affinity purified using immobilized synthetic peptides prepared as described
in
Example I0, or recombinant proteins prepared as described in Example 11. An
IgG
fraction of the antiserum is obtained by passing the diluted, crude antiserum
over a
Protein A column (Affi-Gel protein A, Bio-Rad, Hercules, CA). Elution with a
buffer
(Binding Buffer, supplied by the manufacturer) removes substantially all
proteins that
are not immunoglobulins. Elution with O.1M buffered glycine (pH 3) gives an
92
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
immunoglobulin preparation that is substantially free of albumin and other
serum
proteins.
Immunoaffinity chromatography is performed to obtain a preparation with a
higher fraction of specific antigen-binding antibody. The peptide used to
raise the
antiserum is immobilized on a chromatography resin, and the specific
antibodies
directed against its epitopes are adsorbed to the resin. After washing away
non-
binding components, the specific antibodies are eluted with 0.1 M glycine
buffer, pH
2.3. Antibody fractions are immediately neutralized with 1.OM Tris buffer (pH
8.0)
to preserve immunoreactivity. The chromatography resin chosen depends on the
reactive groups present in the peptide. If the peptide has an amino group, a
resin such
as Affi-Gel 10 or Affi-Gel 15 is used (Bio-Rad, Hercules, CA). If coupling
through a
carboxy group on the peptide is desired, Affi-Gel 102 can be used (Bio-Rad,
Hercules, CA). If the peptide has a free sulfhydryl group, an organomercurial
resin
such as Affi-Gel SO1 can be used (Bio-Rad, Hercules, CA).
Alternatively, spleens can be harvested and used in the production of
hybridomas to produce monoclonal antibodies following routine methods known in
the art as described hereinabove.
Examule 16: Western Blotting of Tissue Sam lies
Protein extracts were prepared by homogenizing tissue samples in a solution
containing O.1M Tris-HCl (pH 7.5), 15% (w/v) glycerol, 0.2 mM EDTA, 1.0 mM 1,4-
dithiothreitol, 10 pg/ml leupeptin, 1.0 mM phenylmethylsulfonylfluoride and
0.1%
Triton X-100 (S. R. Kain et al., Biotechnigues 17:982 (1994). Following
homogenization, the homogenates were centrifuged at 4°C for 5 minutes
to separate
supernatant from debris. For protein quantitation, 3-10 pl of supernatant were
added
to 1.5 ml of bicinchoninic acid reagent (Sigma, St. Louis, MO), and the
resulting
absorbance at 562 nm was measured.
For SDS-PAGE, samples were adjusted to desired protein concentration with
Tricine Buffer {Novex, San Diego, CA), mixed with an equal volume of 2X
Tricine
sample buffer (Novex, San Diego, CA), and heated for 5 minutes at 100°C
in a
thermal cycler. Samples were then applied to a Novex 10-20% Precast Tricine
Gel for
electrophoresis. Following electrophoresis samples were transferred from the
gels to
93
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
nitrocellulose membranes in Novex Tris-Glycine Transfer buffer. Membranes were
then probed with specific anti-peptide antibodies using the reagents and
procedures
provided in the Western Lights Plus or Western Lights (Tropix, Bedford, MA)
chemiluminesence detection kits. The hands were visualized directly on the
membranes by the addition and development of chromogenic substrate 5-bromo-4-
chloro-3-indolyl phosphate (BCIP). This chromogenic solution contains 0.016%
BCIP in a solution containing 100 mM NaCI, S mM MgCl2 and 100 mM Tris-HCI,
pH 9.5. The filter was incubated in this solution at room temperature until
the bands
developed to the desired intensity. Molecular mass determination was made
based
upon the mobility of pre-stained molecular weight standards (Novex, San Diego,
CA)
and biotinylated molecular weight standards (Tropix, Bedford, MA).
Figure 4 shows the results of the Western blot performed on a panel of tissue
extracts using antiserum against synthetic peptide, SEQUENCE ID NO 32 (see
Example 14). Each lane of Figure 4 represents a different tissue protein
extract: 1,
1 S lung cancer; 2, ovarian cancer; 3, normal bladder; 4, normal colon; 5,
breast cancer; 6,
normal pancreas; 7, pancreatic cancer, 8 and 9, normal pancreas; 10, molecular
weight markers (kD). Broad, high molecular weight bands between 116 kD and 200
kD were observed with the pancreatic cancer protein extract (arrows, lane 7).
These
high molecular weight bands were not observed with any of the other tissue
protein
extracts (lanes 1-6, 8-9).
Example 17: EIA MicroNter plate Assav
The immunoreactivity of antiserum preferably obtained from rabbits as
described in Example 14 was determined by means of a microtiter plate EIA, as
follows. Briefly, synthetic peptides, SEQUENCE ID NO 29, SEQUENCE ID NO 30,
SEQUENCE ID NO 31, and SEQUENCE ID NO 32, prepared as described in
Example 10, were dissolved in carbonate buffer (50 mM, pH 9.6) to a final
concentration of 2 ~.g/ml. Next, 100 ~,1 of the peptide or protein solution
were placed
in each well of an Immulon 2~ microtiter plate (Dynex Technologies, Chantilly,
VA).
The plate was incubated overnight at room temperature and then washed four
times
with deionized water. The wells were blocked by adding 125 ~,1 of a suitable
protein
blocking agent, such as Superblock~ (Pierce Chemical Company, Rockford, IL),
to
94
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
each well and then immediately discarding the solution. This blocking
procedure was
performed three times. Antiserum obtained from immunized rabbits or mice,
prepared as previously described, was diluted in a protein blocking agent
(e.g., a 3%
Superblock~ solution) in FBS containing 0.05% Tween-20~ (monolaurate
polyoxyethylene ether) (Sigma Chemical Company, St. Louis, MO) and 0.05%
sodium azide at dilutions of 1:100, 1:500, 1:2500, 1:12,500, and 1:62,500 and
placed
in each well of the coated microtiter plate. The wells then were incubated for
three
hours at room temperature. Each well was washed four times with deionized
water.
One hundred microliters of alkaline phosphatase-conjugated goat anti-rabbit
IgG or
goat anti-mouse IgG antiserum (Southern Biotech, Birmingham, AB) diluted
1:2000
in 3% Superblock~ solution in phosphate buffered saline containing 0.05% Tween
20~ and 0.05% sodium azide, were added to each well. The wells were incubated
for
two hours at room temperature. Next, each well was washed four times with
deionized water. One hundred microliters of paranitrophenyl phosphate
substrate
(Kirkegaard and Perry Laboratories, Gaithersburg, MD) then were added to each
well.
The wells were incubated for thirty minutes at room temperature. The
absorbance at
405 nm was read in each well. Positive reactions were identified by an
increase in
absorbance at 405 nm in the test well above that absorbance given by a non-
immune
serum (negative control). A positive reaction was indicative of the presence
of
detectable anti-PA153 antibodies. Titers of the anti-peptide antisera were
calculated
fibm the previously described dilutions of antisera and defined as the
calculated
dilution, where A4p5~~.5 OD.
Example 18' Coating of Snl~d Phase Particles
A Coating of Microparticles with Antibodies Which , ecificallv Bind to
PA153 Antig~. Affinity purified antibodies which specifically bind to PA153
protein (see Example I S) are coated onto microparticles of polystyrene,
carboxylated
polystyrene, polymethylacrylate or similar particles having a radius in the
range of
about 0.1 to 20 lcm. Microparticles may be either passively or actively
coated. One
coating method comprises coating EDAC (1-(3-dimethylaminopropyl)-3-
ethylcarbodiimide hydrochloride (Aldrich Chemical Co., Milwaukee, WI)
activated
carboxylated latex microparticles with antibodies which specifically bind to
PA153
CA 02315263 2000-06-13
WO 99/31274 PCT/US98126441
protein, as follows. Briefly, a final 0.375% solid suspension of resin washed
carboxylated latex microparticles (available from Bangs Laboratories, Carmel,
IN or
Serodyn, Indianapolis, IN) are mixed in a solution containing SO mM MES
buffer, pH
4.0 and 150 mg/1 of affinity purified anti-PA153 antibody (see Example 14) for
15
min in an appropriate container. EDAC coupling agent is added to a final
concentration of 5.5 ~,g/mI to the mixture and mixed for 2.5 hr at room
temperature.
The microparticles then are washed with 8 volumes of a Tween 20~/sodium
phosphate wash buffer (pH 7.2) by tangential flow filtration using a 0.2 pm
Microgon
Filtration module. Washed microparticles are stored in an appropriate buffer
which
usually contains a dilute surfactant and irrelevant protein as a blocking
agent, until
needed.
B Coating of 1/4 Inch Beads. Antibodies which specifically bind to PA153-
antigen also may be coated on the surface of 1/4 inch polystyrene beads by
routine
methods known in the art (Snitman et al., US Patent 5,273,882) and used in
1 S competitive binding or EIA sandwich assays.
Polystyrene beads first are cleaned by ultrasonicating them for about 15
seconds in 10 mM NaHC03 buffer at pH 8Ø The beads then are washed in
deionized water until all fines are removed. Beads then are immersed in an
antibody
solution in 10 mM carbonate buffer, pH 8 to 9.5. The antibody solution can be
as
dilute as 1 pg/ml in the case of high affinity monoclonal antibodies or as
concentrated
as about 500 pg/ml for polyclonal antibodies which have not been affinity
purified.
Beads are coated for at least 12 hours at room temperature, and then they are
washed
with deionized water. Beads may be air dried or stored wet (in PBS, pH 7.4).
They
also may be overcoated with protein stabilizers (such as sucrose) or protein
blocking
agents used as non-specific binding Mockers (such as irrelevant proteins,
Carnation
skim milk, Superblock~, or the like).
Example 19' Microparticle Eye Immunoassay" EIA)
PA153 antigens are detected in patient test samples by performing a standard
antigen competition EIA or antibody sandwich EIA and utilizing a solid phase
such as
microparticles (MEIA). The assay can be performed on an automated analyzer
such
as the IMx~ Analyzer (Abbott Laboratories, Abbott Park, IL).
9b
CA 02315263 2000-06-13
WO 99/31274 PCTIUS98/26441
A. Antibody Sandwich EIA. Briefly, samples suspected of containing
PA153 antigen are incubated in the presence of anti-PA153 antibody-coated
microparticles (prepared as described in Example 17) in order to form
antigen/antibody complexes. The microparticles then are washed and an
indicator
reagent comprising an antibody conjugated to a signal generating compound
(i.e.,
enzymes such as alkaline phosphatase or horseradish peroxide) is added to the
antigen/antibody complexes or the microparticles and incubated. The
microparticles
are washed and the bound antibody/antigen/antibody complexes are detected by
adding a substrate (e.g., 4-methyl umbelliferyl phosphate (MUP), or
OPDlperoxide,
respectively), that reacts with the signal generating compound to generate a
measurable signal. An elevated signal in the test sample, compared to the
signal
generated by a negative control, detects the presence of PA153 antigen. The
presence
of PA153 antigen in the test sample is indicative of a diagnosis of a
pancreatic disease
or condition, such as pancreatic cancer.
B. Competitive Bindin Assay The competitive binding assay uses a peptide
or protein that generates a measurable signal when the labeled peptide is
contacted
with an anti-peptide antibody coated microparticle. This assay can be
performed on
the IMx~ Analyzer (available from Abbott Laboratories, Abbott Park, IL). The
labeled peptide is added to the PA153 antibody-coated rnicroparticles
(prepared as
described in Example 17) in the presence of a test sample suspected of
containing
PA153 antigen, and incubated for a time and under conditions sufficient to
form
labeled PA153 peptide (or labeled protein) / bound antibody complexes and/or
patient
PA153 antigen / bound antibody complexes. The PA153 antigen in the test sample
competes with the labeled PA153 peptide (or PA153 protein) for binding sites
on the
microparticle. PA153 antigen in the test sample results in a lowered binding
of
labeled peptide and antibody coated microparticles in the assay since antigen
in the
test sample and the PA153 peptide or PA153 protein compete for antibody
binding
sites. A lowered signal (compared to a control) indicates the presence of
PA153
antigen in the test sample. The presence of PA153 antigen suggests the
diagnosis of a
pancreatic disease or condition, such as pancreatic cancer.
The PA153 polynucleotides and the proteins encoded thereby which are
provided and discussed hereinabove are useful as markers of pancreatic tissue
disease,
97
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
especially pancreatic cancer. Tests based upon the appearance of this marker
in a test
sample such as blood, plasma or serum can provide low cost, non-invasive,
diagnostic
information to aid the physician to make a diagnosis of cancer, to help select
a
therapy protocol, or to monitor the success of a chosen therapy. This marker
may
appear in readily accessible body fluids such as blood, urine or stool as
antigens
derived from the diseased tissue which are detectable by ixnmunological
methods.
This marker may be elevated in a disease state, altered in a disease state, or
be a
normal protein of the pancreatic which appears in an inappropriate body
compartment.
Example 20: Immunohistochemical Detection of PA153 Protein
Antiserum against a PA153 synthetic peptide derived from the consensus
peptide sequence (SEQUENCE II? NO 28) described in Example 14, above, is used
to immunohistochemically stain a variety of normal and diseased tissues using
standard proceedures. Briefly, frozen blocks of tissue are cut into 6 micron
sections,
and placed on microscope slides. After fixation in cold acetone, the sections
are dried
at room temperature, then washed with phosphate buffered saline and blocked.
The
slides are incubated with the antiserum against a synthetic peptide derived
from the
consensus PAI53 peptide sequence (SEQUENCE ID NO 28) at a dilution of 1:500,
washed, incubated with biotinylated goat anti-rabbit antibody, washed again,
and
incubated with avidin labeled with horseradish peroxidase. After a final wash,
the
slides are incubated with 3-amino-9-ethylcarbazole substrate which gives a red
stain.
The slides are counterstained with hematoxylin, mounted, and examined under a
microscope by a pathologist.
98
CA 02315263 2000-06-13
WO 99/31274 PCf/US98126441
Sequence Listing
<110> Abbott Laboratories
<120> Reagents and Methods Useful for Detecting Diseases of the
Pancreas
<130> 6239.PC.01
<150> US 08/990,568
<151> 1997-12-15
<160> 34
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 265
<212> DNA
<213> Homo sapiens
<220>
<221> base_polymorphism
<222> 21
<223> /note = "' n' represents an g or t polymorphismat
a or or c
this position
<220>
<221> base~olyrnorphism
<222> 65
<223> /note = "' n' represents an g or t polymorphismat
a or or c
this position
<400> 1
ccaaaatgga gcttgtaaganggctcatgc cattgaccctcttaattctctcctgtttgg 60
cggantgaca atggcggaggctgaaggcaa tgcaagctgcacagtcagtctagggggtgc 120
caatatggca gagacccacaaagccatgat cctgcaactcaatcccagtgagaactgcac 180
ctggacaata gaaagaccagaaaacaaaag catcagaattatcttttcctatgtccagct 240
tgatccagat ggaagctgtgaaagt 265
<210> 2
<211> 222
<212> DNA
<213> Homo sapiens
<400> 2
gcttgatcca gatggaagct gtgaaagtga aaacattaaa gtctttgacg gaacctccag 60
caatgggcct ctgctagggc aagtctgcag taaaaacgac tatgttcctg tatttgaatc 120
atcatccagt acattgacgt ttcaaatagt tactgactca gcaagaattc aaagaactgt 180
ctttgtcttc tactacttct tctctcctaa catctctatt cc 222
<210> 3
<211> 287
<212> DNA
<213> Homo sapiens
1
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
<400> 3
caaagaactgtctttgtcttctactacttcttctctcctaacatctctattccaaactgt 60
ggcggttacctggataccttggaaggatccttcaccagccccaattacccaaagccgcat 120
cctgagctggcttattgtgtgtggcacatacaagtggagaaagattacaagataaaacta 180
aacttcaaagagattttcctagaaatagacaaacagtgcaaatttgattttcttgccatc 240
tatgatggcccctccaccaactctggcctgattggacaagtctgtgg 287
<210> 4
<211> 287
<212> DNA
<213> Homo sapiens
<400> 4
gattttcctagaaatagacaaacagtgcaaatttgattttcttgccatctatgatggccc 60
ctccaccaactctggcctgattggacaagtctgtggccgtgtgactcccaccttcgaatc 120
gtcatcaaactctctgactgtcgtgttgtctacagattatgccaattcttaccggggatt 180
ttctgcttcctacacctcaatttatgcagaaaacatcaacactacatctttaacttgctc 240
ttctgacaggatgagagttattataagcaaatcctacctagaggctt 287
<210> 5
<211> 253
<212> DNA
<213> Homo sapiens
<400> 5
ggcttttaactctaatgggaataacttgcaactaaaagacccaacttgcagaccaaaatt 60
atcaaatgttgtggaattttctgtccctcttaatggatgtggtacaatcagaaaggtaga 120
agatcagtcaattacttacaccaatataatcaccttttctgcatcctcaacttctgaagt 180
gatcacccgtcagaaacaactccagattattgtgaagtgtgaaatgggacataattctac 240
agtggagataata
253
<210> 6
<211> 234
<212> DNA
<213> Homo sapiens
<400> 6
attctacagt ggagataata tacataacag aagatgatgt aatacaaagt caaaatgcac 60
tgggcaaata taacaccagc atggctcttt ttgaatccaa ttcatttgaa aagactatac 120
ttgaatcacc atattatgtg gatttgaacc aaactctttt tgttcaagtt agtctgcaca 180
cctcagatcc aaatttggtg gtgtttcttg atacctgtag agcctctccc acct 234
<210> 7
<211> 269
<212> DNA
<213> Homo sapiens
<400>
7
gcacacctcagatccaaatttggtggtgtttcttgatacctgtagagcctctcccacctc 60
tgactttgcatctccaacctacgacctaatcaagagtggatgtagtcgagatgaaacttg 120
taaggtgtatcccttatttggacactatgggagattccagtttaatgcctttaaattctt 180
gagaagtatgagctctgtgtatctgcagtgtaaagttttgatatgtgatagcagtgacca 240
ccagtctcgctgcaatcaaggttgtgtct 269
<210> 8
<211> 258
<212> DNA
<213> Homo sapiens
<400>
B
tgtgtctccagaagcaaacgagacatttcttcatataaatggaaaacagattccatcata 60
ggacccattcgtctgaaaagggatcgaagtgcaagtggcaattcaggatttcagcatgaa 120
acacatgcggaagaaactccaaaccagcctttcaacagtgtgcatctgttttccttcatg 180
gttctagctctgaatgtggtgactgtagcgacaatcacagtgaggcattttgtaaatcaa 240
cgggcagactacaaatac
258
<210> 9
2
CA 02315263 2000-06-13
WO 99131274 PCT1US98/26441
<211> 257
<212> DNA
<213> Homo sapiens
<400>
9
accagcctttcaacagtgtgcatctgttttccttcatggttctagctctgaatgtggtga 60
ctgtagcgacaatcacagtgaggcattttgtaaatcaacgggcagactacaaataccaga 120
agctgcagaactattaactaacaggtccaaccctaagtgagacatgtttctccaggatgc 180
caaaggaaatgctacctcgtggctacacatattatgaataaatgaggaagggcctgaaag 240
tgacacacaggcctgca
257
<210> 10
<211> 1949
<212> DNA
<213> Homo sapiens
<400>
ccaaaatggagcttgtaagaaggctcatgccattgaccctcttaattctctcctgtttgg 60
cggagctgacaatggcggaggctgaaggcaatgcaagctgcacagtcagtctagggggtg 120
ccaatatggcagagacccacaaagccatgatcctgcaactcaatcccagtgagaactgca 180
cctggacaatagaaagaccagaaaacaaaagcatcagaattatcttttcctatgtccagc 240
ttgatccagatggaagctgtgaaagtgaaaacattaaagtctttgacggaacctccagca 300
atgggcctctgctagggcaagtctgcagtaaaaacgactatgttcctgtatttgaatcat 360
catccagtacattgacgtttcaaatagttactgactcagcaagaattcaaagaactgtct 420
ttgtcttctactacttcttctctcctaacatctctattccaaactgtggcggttacctgg 480
ataccttggaaggatccttcaccagccccaattacccaaagccgcatcctgagctggctt 540
attgtgtgtggcacatacaagtggagaaagattacaagataaaactaaacttcaaagaga 600
ttttcctagaaatagacaaacagtgcaaatttgattttcttgccatctatgatggcccct 660
ccaccaactctggcctgattggacaagtctgtggccgtgtgactcccaccttcgaatcgt 720
catcaaactctctgactgtcgtgttgtctacagattatgccaattcttaccggggatttt 780
ctgcttcctacacctcaatttatgcagaaaacatcaacactacatctttaacttgctctt 840
ctgacaggatgagagttattataagcaaatcctacctagaggcttttaactctaatggga 900
ataacttgcaactaaaagacccaacttgcagaccaaaattatcaaatgttgtggaatttt 960
ctgtccctcttaatggatgtggtacaatcagaaaggtagaagatcagtcaattacttaca 1020
ccaatataatcaccttttctgcatcctcaacttctgaagtgatcacccgtcagaaacaac 1080
tccagattattgtgaagtgtgaaatgggacataattctacagtggagataatatacataa 1140
cagaagatgatgtaatacaaagtcaaaatgcactgggcaaatataacaccagcatggctc 1200
tttttgaatccaattcatttgaaaagactatacttgaatcaccatattatgtggatttga 1260
accaaactctttttgttcaagttagtctgcacacctcagatccaaatttggtggtgtttc 1320
ttgatacctgtagagcctctcccacctctgactttgcatctccaacctacgacctaatca 1380
agagtggatgtagtcgagatgaaacttgtaaggtgtatcccttatttggacactatggga 1440
gattccagtttaatgcctttaaattcttgagaagtatgagctctgtgtatctgcagtgta 1500
aagttttgatatgtgatagcagtgaccaccagtctcgctgcaatcaaggttgtgtctcca 1560
gaagcaaacgagacatttcttcatataaatggaaaacagattccatcataggacccattc 1620
gtctgaaaagggatcgaagtgcaagtggcaattcaggatttcagcatgaaacacatgcgg 1680
aagaaactccaaaccagcctttcaacagtgtgcatctgttttccttcatggttctagctc 1740
tgaatgtggtgactgtagcgacaatcacagtgaggcattttgtaaatcaacgggcagact 1800
acaaataccagaagctgcagaactattaactaacaggtccaaccctaagtgagacatgtt 1860
tctccaggatgccaaaggaaatgctacctcgtggctacacatattatgaataaatgagga 1920
agggcctgaaagtgacacacaggcctgca
1949
<210> 11
<211> 1949
<212> DNA
<213> Homo sapiens
<400>
11
ccaaaatggagcttgtaagaaggctcatgccattgaccctcttaattctctcctgtttgg 60
cggagctgacaatggcggaggctgaaggcaatgcaagctgcacagtcagtctagggggtg 120
ccaatatggcagagacccacaaagccatgatcctgcaactcaatcccagtgagaactgca 180
cctggacaatagaaagaccagaaaacaaaagcatcagaattatcttttcctatgtccagc 240
ttgatccagatggaagctgtgaaagtgaaaacattaaagtctttgacggaacctccagca 300
atgggcctctgctagggcaagtctgcagtaaaaacgactatgttcctgtatttgaatcat 360
catccagtacattgacgtttcaaatagttactgactcagcaagaattcaaagaactgtct 420
ttgtcttctactacttcttctctcctaacatctctattccaaactgtggcggttacctgg 480
ataccttggaaggatccttcaccagccccaattacccaaagccgcatcctgagctggctt 540
attgtgtgtggcacatacaagtggagaaagattacaagataaaactaaacttcaaagaga 600
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
ttttcctagaaatagacaaacagtgcaaatttgattttcttgccatctatgatggcccct 660
ccaccaactctggcctgattggacaagtctgtggccgtgtgactcccaccttcgaatcgt 720
catcaaactctctgactgtcgtgttgtctacagattatgccaattcttaccggggatttt 780
ctgcttcctacacctcaatttatgcagaaaacatcaacactacatctttaacttgctctt 840
ctgacaggatgagagttattataagcaaatcctacctagaggcttttaactctaatggga 900
ataacttgcaactaaaagacccaacttgcagaccaaaattatcaaatgttgtggaatttt 960
ctgtccctcttaatggatgtggtacaatcagaaaggtagaagatcagtcaattacttaca 1020
ccaatataatcaccttttctgcatcctcaacttctgaagtgatcacccgtcagaaacaac 1080
tccagattattgtgaagtgtgaaatgggacataattctacagtggagataatatacataa 1140
cagaagatgatgtaatacaaagtcaaaatgcactgggcaaatataacaccagcatggctc 1200
tttttgaatccaattcatttgaaaagactatacttgaatcaccatattatgtggatttga 1260
accaaactctttttgttcaagttagtctgcacacctcagatccaaatttggtggtgtttc 1320
ttgatacctgtagagcctctcccacctctgactttgcatctccaacctacgacctaatca 1380
agagtggatgtagtcgagatgaaacttgtaaggtgtatcccttatttggacactatggga 1440
gattccagtttaatgcctttaaattcttgagaagtatgagctctgtgtatctgcagtgta 1500
aagttttgatatgtgatagcagtgaccaccagtctcgctgcaatcaaggttgtgtctcca 1560
gaagcaaacgagacatttcttcatataaatggaaaacagattccatcataggacccattc 1620
gtctgaaaagggatcgaagtgcaagtggcaattcaggatttcagcatgaaacacatgcgg 1680
aagaaactccaaaccagcctttcaacagtgtgcatctgttttccttcatggttctagctc 1740
tgaatgtggtgactgtagcgacaatcacagtgaggcattttgtaaatcaacgggcagact 1800
acaaataccagaagctgcagaactattaactaacaggtccaaccctaagtgagacatgtt 1860
tctccaggatgccaaaggaaatgctacctcgtggctacacatattatgaataaatgagga 1920
agggcctgaaagtgacacacaggcctgca
1949
<210> 12
<211> 6B
<212> DNA
<213> Artificial Sequence
<220>
<223> Restriction site
<400> 12
agctcggaat tccgagcttg gatcctctag agcggccgcc gactagtgag ctcgtcgacc 60
cgggaatt 68
<210> 13
<211> 68
<212> DNA
<213> Artificial Sequence
<400> 13
aattaattcc cgggtcgacg agctcactag tcggcggccg ctctagagga tccaagctcg 60
gaattccg
68
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Universal primer
<400> 14
agcggataac aatttcacac agga 24
<210> 15
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 15
tgtaaaacga cggccagt
18
<210> 16
<211> 20
<212> DNA
4
CA 02315263 2000-06-13
WO 99/31274
PCT/US98/26441
<213> Homo Sapiens
<400> 16
cggttacctg gataccttgg
20
<210> 17
<211> 22
<212> DNA
<213> Homo sapiens
<400> 17
tgcaactaaa agacccaact tg
22
<210> 18
<211> 20
<212> DNA
<213> Homo sapiens
<400> 18
ctttgcatct ccaacctacg
20
<210> 19
<211> 20
<212> DNA
<213> Homo sapiens
<400> 19
ccatcatagg acccattcgt
20
<210> 20
<211> 20
<212> DNA
<213> Homo sapiens
<400> 20
tggtatttgt agtctgcccg
20
<210> 21
<211> 20
<212> DNA
<213> Homo sapiens
<400> 21
acaaccttga ttgcagcgag
20
<210> 22
<211> 20
<212> DNA
<213> Homo sapiens
<400> 22
tggagttgtt tctgacgggt
20
<210> 23
<211> 20
<212> DNA
<213> Homo sapiens
<400> 23
taggaagcag aaaatccccg
20
<210> 24
<211> 20
<212> DNA
<213> Homo sapiens
<400> 24
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/26441
ccaaggtatc caggtaaccg 20
<210> 25
<211> 26
<212> DNA
<213> Homo sapiens
<400> 25
tttttttttt tttttttttt tttttg 26
<210> 26
<211> 24
<212> DNA
<213> Homo sapiens
<400> 26
aatggcggag gctgaaggca atgc 24
<210> 27
<211> 22
<212> DNA
<213> Homo sapiens
<400> 27
ctggagttgt ttctgacggg tg
22
<210> 28
<211> 607
<212> PRT
<213> Homo sapiens
<400> 28
Mit Glu Leu Val Asg Arg Leu Met Pro Leu Thr Leu Leu Ile Leu Ser
15
Cys Leu Ala Glu Leu Thr Met Ala Glu Ala Glu Gly Asn Ala Ser Cys
25 30
Thr Val Ser Leu Gly Gly Ala Asn Met Ala Glu Thr His Lys Ala Met
35 40 45
Ile Leu Gln Leu Asn Pro Ser Glu Asn Cys Thr Trp Thr Ile Glu Arg
50 55 60
Pro Glu Asn Lys Ser Ile Arg Ile Ile Phe Ser Tyr Val Gln Leu Asp
65 70 75 80
Pro Asp Gly Ser Cye Glu Ser Glu Asn Ile Lys Val Phe Asp Gly Thr
85 90 95
Ser Ser Asn Gly Pro Leu Leu Gly Gln Val Cys Ser Lys Asn Asp Tyr
100 105 110
Val Pro Val Phe Glu Ser Ser Ser Ser Thr Leu Thr Phe Gln Ile Val
125
Thr Asp Ser Ala Arg Ile Gln Arg Thr Val Phe Val Phe r
Ty Tyr Phe
130 135 140
Phe Ser Pro Asn Ile Ser Ile Pro Asn Cys Gly Gly Tyr Leu Asp Thr
145 150 155 160
Leu Glu Gly Ser Phe Thr Ser Pro Asn Tyr Pro Lye Pro His Pro Glu
165 170 175
Leu Ala Tyr Cys Val Trp His Ile Gln Val Glu Lys Asp Tyr Lys Ile
180 185 190
Lys Leu Asn Phe Lys Glu Ile Phe Leu Glu Ile Asp Lys Gln Cys Lys
195 200 205
Phe Asp Phe Leu Ala Ile Tyr Asp Gly Pro Ser Thr Asn Ser Gly Leu
210 215 220
Ile Gly Gln Val Cys Gly Arg Val Thr Pro Thr Phe Glu Ser Ser Ser
225 230 235 240
Asn Ser Leu Thr Val Val Leu Ser Thr Asp Tyr Ala Asn Ser Tyr Arg
245 250 255
Gly Phe Ser Ala Ser Tyr Thr Ser Ile Tyr Ala Glu Asn Ile Asn Thr
260 265 270
6
CA 02315263 2000-06-13
WO 99/31274 PCT/US98/Z6441
Thr Ser Leu Thr Cys Ser Ser Asp Arg Met Arg Val Ile Ile Ser Lys
275 280 285
Ser Tyr Leu Glu Ala Phe Asn Ser Asn Gly Asn Asn Leu Gln Leu Lys
290 295 300
Asp Pro Thr Cys Arg Pro Lys Leu Ser Asn Val Val Glu Phe Ser Val
305 310 315 320
Pro Leu Asn Gly Cys Gly Thr Ile Arg Lys Val Glu Asp Gln Ser Ile
325 330 335
Thr Tyr Thr Asn Ile Ile Thr Phe Ser Ala Ser Ser Thr Ser Glu Val
340 345 350
Ile Thr Arg Gln Lys Gln Leu Gln Ile Ile Val Lys Cys Glu Met Gly
355 360 365
His Asn Ser Thr Val Glu Ile Ile Tyr Ile Thr Glu Asp Asp Val Ile
370 375 380
Gln Ser Gln Asn Ala Leu Gly Lys Tyr Asn Thr Ser Met Ala Leu Phe
385 390 395 400
Glu Ser Asn Ser Phe Glu Lys Thr Ile Leu Glu Ser Pro Tyr Tyr Val
405 410 415
Asp Leu Asn Gln Thr Leu Phe Val Gln Val Ser Leu His Thr Ser Asp
420 425 430
Pro Asn Leu Val Val Phe Leu Asp Thr Cys Arg Ala Ser Pro Thr Ser
435 440 445
Asp Phe Ala Ser Pro Thr Tyr Asp Leu Ile Lye Ser Gly Cys Ser Arg
450 455 460
Asp Glu Thr Cys Lys Val Tyr Pro Leu Phe Gly His Tyr Gly Arg Phe
465 470 475 480
Gln Phe Asn Ala Phe Lys Phe Leu Arg Ser Met Ser Ser Val Tyr Leu
485 490 495
Gln Cys Lys Val Leu Ile Cys Asp Ser Ser Asp His Gln Ser Arg Cys
500 505 510
Asn Gln Gly Cys Val Ser Arg Ser Lys Arg Asp Ile Ser Ser Tyr Lys
515 520 525
Trp Lys Thr Asp Ser Ile Ile Gly Pro Ile Arg Leu Lys Arg Asp Arg
530 535 540
Ser Ala Ser Gly Asn Ser Gly Phe Gln His Glu Thr His Ala Glu Glu
545 550 555 560
Thr Pro Asn Gln Pro Phe Asn Ser Val His Leu Phe Ser Phe Met Val
565 570 575
Leu Ala Leu Asn Val Val Thr Val Ala Thr Ile Thr Val Arg His Phe
580 585 590
Val Asn Gln Arg Ala Asp Tyr Lys Tyr Gln Lys Leu Gln Asn Tyr
595 600 605
<210> 29
<211> 25
<212> PRT
<213> Homo sapiens
<400> 29
Thr Ser Asp Phe Ala Ser Pro Thr Tyr Asp Leu Ile Lys Ser Gly Cys
1 5 10 15
Ser Arg Asp Glu Thr Cys Lys Val Tyr
20 25
<210> 30
<211> 30
<212> PRT
<213> Homo sapiens
<400> 30
Asp Ser Ser Asp His Gln Ser Arg Cys Asn Gln Gly Cys Val Ser Arg
1 5 10 15
Ser Lys Arg Asp Ile Ser Ser Tyr Lys Trp Lys Thr Asp Ser
20 25 30
<210> 31
<211> 29
7
CA 02315263 2000-06-13
WO 99131274 PCT/US98/26441
<212> PRT
<213> Homo sapiens
<400> 31
Arg Leu Lys Arg Asp Arg Ser Ala Ser Gly Asn Ser Gly Phe Gln His
1 5 10 15
Glu Thr His Ala Glu Glu Thr Pro Asn Gln Pro Phe Asn
20 25
<210> 32
<211> 20
<212> PRT
<213> Homo sapiens
<400> 32
Thr Val Arg His Phe Val Asn Gln Arg Ala Asp Tyr Lys Tyr Gln Lys
1 5 10 15
Leu Gln Asn Tyr
<210> 33
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Affinity purification system recognition site
<400> 33
Asp Tyr Lys Aep Asp Asp Asp Lys
1 5
<210> 34
<211> 21
<212> PRT
<213> Artificial Sequence
<220>
<223> Affinity purification system recognition site
<400> 34
Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Met His Thr Glu His
1 5 10 15
His His His His His
8
