CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-1-
GROWTH DIFFERENTIATION FACTOR-8
BACKGROUND OF THE INVENTION
S 1. Field of the Invention
The invention relates generally to growth factors and specifically to a new
member of the
transforming growth factor beta (TGF-(3) superfamily, which is denoted, growth
differentiation factor-8 (GDF-8) and methods of use for modulating muscle,
bone, kidney
and adipose cell and tissue growth.
2. Description of Related Art
The transforming growth factor ~3 (TGF-Vii) superfamily encompasses a group of
structurally-related proteins which affect a wide range of differentiation
processes during
embryonic development. The family includes, Mullerian inhibiting substance
(MIS),
which is required for normal male sex development (Behringer, et al., Nature,
345:167,
1990), Drosophila decapentaplegic (DPP) gene product, which is required for
dorsal-ventral axis formation and morphogenesis of the imagina.I disks
(Padgett, et al.,
Nature, 325:81 -84, 1987), the Xenopus Vg-1 gene product, which localizes to
the
vegetal pole of eggs ((Weeks, et al., Cell, S 1:861-867, 1987), the activins
(Mason, et al.,
Biochem, Biophys. Res. Commun., 135:957-964, 1986), which can induce the
formation
of mesoderm and anterior structures in Xenopus embryos (Thomsen, et al., Cell,
63:485,
1990}, and the bone morphogenetic proteins (BMPs, osteogenin, OP-1) which can
induce
de novo cartilage and bone formation (Sampath, et al., J. Biol. Chem.,
265:13198, 1990).
The TGF-(3s can influence a variety of differentiation processes, including
adipogenesis,
myogenesis, chondrogenesis, hematopolesis, and epithelial cell differentiation
(for
review, see Massague, Cell 49:437, 1987).
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-2-
The proteins of the TGF-(i family are initially synthesized as a large
precursor protein
which subsequently undergoes proteolytic cleavage at a cluster of basic
residues
approximately 110-140 amino acids from the C-terminus. The C-terminal regions,
or
mature regions, of the proteins are all structurally related and the different
family
members can be classified into distinct subgroups based on the extent of their
homology.
Although the homologies within particular subgroups range from 70% to 90%
amino
acid sequence identity, the homologies between subgroups are significantly
lower,
generally ranging from only 20% to 50%. In each case, the active species
appears to be
a disulfide-linked dimer of C-terminal fragments. Studies have shown that when
the pro-
region of a member of the TGF-~3 family is coexpressed with a mature region of
another
member of the TGF-(3 family, intracellular dimerization and secretion of
biologically
active homodimers occur (Gray, A. et al., Science, 247:1328, 1990). Additional
studies
by Hammonds, et al., (Molec. Endocrin. 5:149, 1991) showed that the use of the
BMP-2
pro-region combined with the BMP-4 mature region led to dramatically improved
1 S expression of mature BMP-4. For most of the family members that have been
studied,
the homodimeric species has been found to be biologically active, but for
other family
members, like the inhibins (Zing, et al., Nature, 321 :779, 1986) and the TGF-
his
(Cheifetz, et al., Cell, 48:409, 1987), heterodimers have also been detected,
and these
appear to have different biological properties than the respective homodimers.
In addition it is desirable to produce livestock and game animals, such as
cows, sheep,
pigs, chicken and turkey, fish which are relatively high in musculature and
protein, and
low in fat content. Many drug and diet regimens exist which may help increase
muscle
and protein content and lower undesirably high fat and/or cholesterol levels,
but such
treatment is generally administered after the fact, and is begun only after
significant
damage has occurred to the vasculature. Accordingly, it would be desirable to
produce
animals which are genetically predisposed to having higher muscle and/or bone
content,
without any ancillary increase in fat levels.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-3-
The food industry has put much effort into increasing the amount of muscle and
protein
in foodstuffs. This quest is relatively simple in the manufacture of synthetic
foodstuffs,
but has been met with limited success in the preparation of animal foodstuffs.
Attempts
have been made, for example, to lower cholesterol levels in beef and poultry
products by
including cholesterol-lowering drugs in animal feed (see e.g. Elkin and
Rogler, J. Agric.
Food Chem. 1990, 38, 1635-1641 ). However, there remains a need for more
effective
methods of increasing muscle and reducing fat and cholesterol levels in animal
food
products.
SUMMARY OF THE INVENTION
The present invention provides a cell growth and differentiation factor, GDF-
8, a
polynucleotide sequence which encodes the factor, and antibodies which are
immunore-
active with the factor. This factor appears to relate to various cell
proliferative disorders,
especially those involving muscle, nerve, bone, kidney and adipose tissue
In one embodiment, the invention provides a method for detecting a cell
proliferative
disorder of muscle, nerve, bone, kidney or fat origin and which is associated
with GDF-8.
In another embodiment, the invention provides a method for treating a cell
proliferative
disorder by suppressing or enhancing GDF-8 activity.
In another embodiment, the subject invention provides non-human transgenic
animals
which are useful as a source of food products with high muscle, bone and
protein content,
and reduced fat and cholesterol content. The animals have been altered
chromosomally
in their germ cells and somatic cells so that the production of GDF-8 is
produced in
reduced amounts, or is completely disrupted, resulting in animals with
decreased levels
of GDF-8 in their system and higher than normal levels of muscle tissue and
bone tissue,
such as ribs, preferably without increased fat and/or cholesterol levels.
Accordingly, the
present invention also includes food products provided by the animals. Such
food
products have increased nutritional value because of the increase in muscle
tissue and
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-4-
bone content. The transgenic non-human animals of the invention include
bovine,
porcine, ovine and avian animals, for example.
The subject invention also provides a method of producing animal food products
having
increased bone content. The method includes modifying the genetic makeup of
the germ
cells of a pronuclear embryo of the animal, implanting the embryo into the
oviduct of a
pseudopregnant female thereby allowing the embryo to mature to full term
progeny,
testing the progeny for presence of the transgene to identify transgene-
positive progeny,
cross-breeding transgene-positive progeny to obtain further transgene-positive
progeny
and processing the progeny to obtain foodstuff. The modification of the germ
cell
comprises altering the genetic composition so as to disrupt or reduce the
expression of
the naturally occurring gene encoding for production of GDF-8 protein. In a
particular
embodiment, the transgene comprises antisense polynucleotide sequences to the
GDF-8
protein. Alternatively, the transgene may comprise a non-functional sequence
which
replaces or intervenes in the native GDF-8 gene.
The subject invention also provides a method of producing avian food products
having
improved muscle and/or bone content. The method includes modifying the genetic
makeup of the germ cells of a pronuclear embryo of the avian animal,
implanting the
embryo into the oviduct of a pseudopregnant female into an embryo of a
chicken,
culturing the embryo under conditions whereby progeny are hatched, testing the
progeny
for presence of the genetic alteration to identify transgene-positive progeny,
cross
breeding transgene-positive progeny and processing the progeny to obtain
foodstuff.
The invention also provides a method for treating a muscle, bone, kidney or
adipose
tissue disorder in a subject. The method includes administering a
therapeutically
effective amount of a GDF-8 agent to the subject, thereby inhibiting abnormal
growth
of muscle, bone or adipose tissue. The GDF-8 agent may include an antibody, a
GDF-8
antisense molecule or a dominant negative polypeptide, for example. In one
aspect, a
method for inhibiting the growth regulating actions of GDF-8 by contacting an
anti-
CA 02319703 2001-02-05
-5-
GDF-8 monoclonal antibody, a GDF-8 antisense molecule or a dominant negative
polypeptide (or polynucleotide encoding a dominant negative poiypeptide) with
fetal or
adult muscle cells, bone cells or progenitor cells is included. These agents
can be
administered to a patient suffering from a disorder such as muscle wasting
disease,
neuromuscular disorder, muscle atrophy, osteoporosis, bone degenerative
diseases,
obesity or other adipocyte cell disorders, and aging, for example. In another
aspect of
the invention, the agent may be an agonist of GDF-8 activity. In this
embodiment, the
agonist may be administered to promote kidney cell growth and differentiation
in kidney
tissue.
The invention also provides a method for identifying a compound that affects
GDF-8
activity or gene expression including incubating the compound with GDF-8
polypeptide,
or with a recombinant cell expressing GDF-8 under conditions sufficient to
allow the
compounds to interact and determining the effect of the compound on GDF-8
activity or
expression.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE Ia is aNorthern blot showing expression of GDF-8 mRNA in adult tissues.
The
probe was a partial murine GDF-8 clone.
FIGURE lb is a Southern blot showing GDF-8 genomic sequences identified in
mouse,
rat, human, monkey, rabbit, cow, pig, dog and chicken.
FIGURES 2a to 2d show partial nucleotide and predicted amino acid sequences of
murine GDF-
8(FIGURE 2a; SEQ ID NOS: 5 and 6, respectively), human GDF-8 (FIGURE 2b; SEQ
ID NOS:
7 and 8, respectively), rat GDF-8 (FIGURE 2c; SEQ ID NOS: 32 and 33,
respectively) and
chicken GDF-8 (FIGURE 2d; SEQ ID NOS:34 and 35, respectively). The putative
dibasic
processing sites in the murine sequence are boxed.
CA 02919703 2002-0~-14
-6-
FIGUR$3a shows the alig~nnne~t of the C-terminal sequences of GDF-8 (amino
acid residues
264-375 ~f SEQ ID NO: I4) with other members of the TGF-~ superfamily (SEQ ~
NOS:
36-49, respectively). The corses~wed cystsine residues are boxed. Dashes
denote gaps
introduced in order to maximize alignment.
FIGURE3bahowstl~aligrun~toftheC-ter'mit~alofGDF-8fmmhtunsn (SEQm
NO: 1~, murjne (SBQ ID N0:12), rat (SEQ 1D NO: 33), and chidceri (SBQ ID NO:
35)
sequences.
FIGURE 4 shows amino acid homologies among different membars of the TGF
superfanvly. Numbers t pert amino acid identities betv~e~ each pair
calculated from the first conserved eysttine to the bus. Boxes rmp~ent
homologies among highly-related members within particular ~b~rrnips.
FIGUR&S Sa ~ 5d show the sequ~ce of G1DF-8. Nucleodde sad amino $e~rCea of
nmalne
FIGURE Sa and Sb) (C#enBanlc accession numbaU840U5; SEQ ID NO:11 and 12,
respectively)
and human (FIGURE 5c and 5d; SEQ lIy N0:13 and 14, respectively) GDF-8 cDNA
clones are
shown. Nunibesa indicate nncieotide position relative to the 5' end. Consensus
N-linked
~Y~Y~ahaded. TheputativeRXXR(~QmN0:50)proteolYticc~avagesitea
are boned.
FIGURE 6 shows a hydropathicity profile of GDF-8. Average hydrophpbiaty values
for
mucine (FIGURE 6n) arid hurnati (FIGURE 6b) GDF-8 were calculated using tha
method
of Kyte and Doolittle (J Mol. Biol;, ,j~Z:IOS-132, 1982). Positive numbers
,indicate
increasing hydroghobicity. ~ .
FIGURE 7 shows a omnparison of marine and human GDF-8 amino acid seqiretices
(S11.Q ID NOS:12 and 14, respedlvely). The predicted nrurinesequence is shown
in the top liras
arid the p~redietad human sequence is shown in the bottom liriec. Numbers
indicate amino acid
position relative to the N-tsnninus. Identities between the two sequences are
denoted by a
vertical line.
CA 02319703 2001-02-05
FIGURE 8 shows the expression of GDF-8 in bacteria. BL21 (DE3) (pLysS} cells
carrying a pRSETIGDF-8 expression plasmid were induced with
isopropylthio-[i-galactoside, and the GDF-8 fusion protein was purified by
metal chelate
chromatography. Lanes: total=total cell Iysate; soluble=soluble protein
fraction;
insoluble=insoluble protein fraction (resuspended in 10 Mm Tris pH 8.0, 50 mM
sodium
phosphate, 8 M urea, and 10 mM [i-mercaptoethanol [buffer B]} loaded onto the
column,
pellet=insoluble protein fraction discarded betore ioaamg zne commas;
flowthrough=proteins not bound by the column; washes=washes carried out in
buffer B
at the indicated pH's. Positions of molecular weight standards are shown at
the right.
Arrow indicates the position of the GDF-8 fusion protein.
FIGURE 9 shows the expression of GDF-8 in mammalian cells. Chinese hamster
ovary
cells were transfected with pMSXNDIGDF-8 expression plasmids and selected in
6418.
Conditioned media from 6418-resistant cells (prepared from cells transfected
with
constructs in which GDF-8 was cloned in either the antisense or sense
orientation) were
concentrated, electrophoresed under reducing conditions, blotted, and probed
with
anti-GDF-8 antibodies and ['251]iodoproteinA. Arrow indicates the position of
the
processed GDF-8 protein.
FIGURES l0a and l Ob show the expression of GDF-8 mRNA. Poly A-selected RNA
(S~.g
each) prepared from adult tissues (FIGURE 10a) or placentas and embryos
(FIGURE l Ob) at
the indicated days of gestation was electrophoresed on formaldehyde gels,
blotted, and probed
with full length murine GDF-8.
FIGURE 11 shows chromosomal mapping of human GDF-8. DNA samples prepared
from human/rodent somatic cell hybrid lines were subjected to PCR,
electrophoresed on
agarose gels, blotted, and probed. The human chromosome contained in each of
the
hybrid cell lines is identified at the top of each of the first 24 lanes (1-
22, X, and Y). In
the lanes designated M, CHO, and H, the starting DNA template was total
genomic DNA
CA 02319703 2001-02-05
from mouse, hamster, and human sources, respectively. In the lane marked Bl,
no
template DNA was used. Numbers at left indicate the mobilities of DNA
standards.
Figure 12a shows a map of the GDF-8 locus (top line) and targeting construct
(second
line). The black and stippled boxes represent coding sequences for the pro-
and
C-terminal regions, respectively. The white boxes represent 5' and 3'
untranslated
sequences. A probe derived from the region downstream of the 3' homology
fragment
and upstream of the most distal HindIII site shown hybridizes to an 11.2 kb
HindIII
fragment in the GDF-8 gene and a 10.4 kb fragment in an homologously targeted
gene.
Abbreviations: H, HindIII; X, Xba I.
Figure 12b shows a Southern blot analysis of offspring derived from a mating
of
heterozygous mutant mice. The lanes are as follows: DNA prepared from wild
type 129
SV/J mice (lane 1), targeted embryonic stem cells (lane 2), F1 heterozygous
mice (lanes
3 and 4), and offspring derived from a mating of these mice (lanes 5-13).
FIGURES 13a and 13b show the muscle fiber size distribution in mutant wild
type littermates.
FIGURE 13a shows the smallest cross-sectional fiber widths measured for wild
type (n =1761)
and mutant (n =1052) tibialis cranial. FIGURE 13b shows wild type (n = 900)
and mutant (n
= 900) gastrocnernius muscles, and fiber sizes were plotted as a percent of
total fiber number.
Standard deviations were 9 and l Op,m, respectively, for wild type and mutant
tibialis cranial is
11 and 9p.m, respectively, for wild type and mutant gastrocnemius muscles.
Legend: o-o, wild
type; _, mutant.
Figure 14a shows the nucleotide and deduced amino acid sequence for baboon GDF-
8
(SEQ ID N0:18 and 19, respectively).
Figure 14b shows the nucleotide and deduced amino acid sequence for bovine GDF-
8
(SEQ ID NO: 20 and 21, respectively).
Figure I4c shows the nucleotide and deduced amino acid sequence for chicken
GDF-8
(SEQ TD N0:22 and 23, respectively).
CA 02319703 2001-02-05
_9_
Figure 14d shows the nucleotide and deduced amino acid sequence for rat GDF-8
(SEQ
ID N0:24 and 25, respectively).
Figure 14e shows the nucleotide and deduced amino acid sequence for turkey GDF-
8
(SEQ ID N0:26 and 27, respectively).
Figure 14f shows the nucleotide and deduced amino acid sequence for porcine
GDF-8
(SEQ ID N0:28 and 29, respectively).
Figure 14g shows the nucleotide and deduced amino acid sequence for ovine GDF-
8
(SEQ ID N0:30 and 31, respectively).
Figures 15a and 15b show an alignment between marine, rat, human, porcine,
ovine,
baboon, bovine, chicken, and turkey GDF-8 amino acid sequences {SEQ ID N0:12,
25,
14, 29, 31, 19, 21, 23 and 27, respectively).
Figure 16 shows the predicted amino acid sequences of marine (SEQ tD N0:52)
and
human (SEQ ID N0:53) GDF-11 aligned with marine (SEQ ID N0:12) '(McPherron et
al., 1997) and human (SEQ ID'NO:14) (McPherron and Lee, 1997) myostatin
(MSTN).
Shaded boxes represent amino acid homology with the marine and human GDF-11
sequences. Amino acids are numbered relative to the human GDF-11 sequence. The
predicted proteolytic processing sites are located at amino acids 295-298.
Figure 17 shows the construction of GDF-11 null mice by homologous targeting.
a) is
a map of the GDF-11 locus (top line) and targeting construct (second line).
The black
and stippled boxes represent coding sequences for the pro-and C-terminal
regions,
respectively. The targeting construct contains a total of 11 kb of homololry
with the
GDF-11 gene. A probe derived from the region upstream of the 3' homology
fragment
and downstream of the first EcoRI site shown hybridizes to a 6.5 kb EcoRl
fragment in
the GDF-11 gene and a 4.8 kb fragment in a homologously targeted gene.
Abbrevia-
tions: X, Xbal; E, EcoRl . b) Geneomic Southern of DNA prepared from Fl
heterozy-
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-10-
gous mutant mice (lanes 1 and 2) and offspring derived from a mating of these
mice
(lanes 3-12).
Figure 18 shows kidney abnormalities in GDF-11 knockout mice. Kidneys of
newborn
animals were examined and classified according to the number of normal sized
or small
kidneys as shown at the top. Numbers in the table indicate number of animals
falling
info each classification according to genotype.
Figure 19 shows homeotic transformations in GDF-11 mutant mice. a) Newborn
pups
with missing (first and second from left) and normal looking tails. b j)
Skeleton
preparations for newborn wild-type (b, e, h), heterozygous (c, f, I) and
homozygous (d,
g, j) mutant mice. Whole skeleton preparations (b-d), vertebral columns (e-g),
vertebrosternal ribs (h-j) showing transformations and defects in homozygous
and
heterozygous mutant mice. Numbers indicate thoracic segments.
Figure 20 is a table summarizing the anterior transformations in wild-type,
heterozygous
and homozygous GDF-11 mice.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a growth and differentiation factor, GDF-8 and
a
polynucleotide sequence encoding GDF-8. GDF-8 is expressed at highest levels
in
muscle and at lower levels in adipose tissue.
The animals contemplated for use in the practice of the subject invention are
those
animals generally regarded as useful for the processing of food stuffs, i. e.
avian such as
meat bred and egg laying chicken and turkey, ovine such as lamb, bovine such
as beef
cattle and milk cows, piscine and porcine. For purposes of the subject
invention, these
animals are referred to as "transgenic" when such animal has had a
heterologous DNA
sequence, or one or more additional DNA sequences normally endogenous to the
animal
(collectively referred to herein as "transgenes") chromosomally integrated
into the germ
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-11-
cells of the animal. The transgenic animal (including its progeny} will also
have the
transgene integrated into the chromosomes of somatic cells.
The TGF-~i superfamily consists of multifunctional polypeptides that control
prolifera-
tion, differentiation, and other functions in many cell types. Many of the
peptides have
regulatory, both positive and negative, effects on other peptide growth
factors. The
structural homology between the GDF-8 protein of this invention and the
members of the
TGF-~3 family, indicates that GDF-8 is a new member of the family of growth
and
differentiation factors. Based on the known activities of many of the other
members, it
can be expected that GDF-8 will also possess biological activities that will
make it useful
as a diagnostic and therapeutic reagent.
In particular, certain members of this superfamily have expression patterns or
possess
activities that relate to the function of the nervous system. For example, the
inhibins and
activins have been shown to be expressed in the brain (Meunier, et al., Proc.
Natl. Acad.
Sci., USA, 85:247,1988; Sawchenko, et al., Nature, 334:615, 1988), and activin
has been
shown to be capable of functioning as a nerve cell survival molecule
(Schubert, et al.,
Nature, 344:868, 1990). Another family member, namely, GDF-1, is nervous sys-
tem-specific in its expression pattern (Lee, S.J., Proc. Natl. Acad. Sci.,
USA, 88:4250,
1991), and certain other family members, such as Vgr-I (Lyons, et al., Proc.
Natl. Acad.
Sci., USA, 86:4554, 1989; 3ones, et al., Development, 111:531, 1991), OP-1
(Ozkaynak,
et al., J. Biol. Chem., 267:25220, 1992), and BMP-4 {Jones, et al.,
Development,
111:531, 1991), are also known to be expressed in the nervous system. Because
it is
known that skeletal muscle produces a factor or factors that promote the
survival of
motor neurons (Brown, Trends Neurosci., 7:10, 1984), the expression of GDF-8
in
muscle suggests that one activity of GDF-8 may be as a trophic factor for
neurons. In this
regard, GDF-8 may have applications in the treatment of neurodegenerative
diseases,
such as amyotrophic lateral sclerosis or muscular dystrophy, or in maintaining
cells or
tissues in culture prior to transplantation.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-12-
GDF-8 may also have applications in treating disease processes involving the
musculoskeletal system, such as in musculodegenerative diseases, osteoporosis
or in
tissue repair due to trauma. In this regard, many other members of the TGF-(3
family are
also important mediators of tissue repair. TGF-(3 has been shown to have
marked effects
on the formation of collagen and to cause a striking angiogenic response in
the newborn
mouse (Roberts, et al., Proc. Natl. Acad. Sci., USA 83:4167, 1986). TGF-(3 has
also been
shown to inhibit the differentiation of myoblasts in culture (Massague, et
al., Proc. Natl.
Acad. Sci., USA 83:8206, 1986). Moreover, because myoblast cells may be used
as a
vehicle for delivering genes to muscle for gene therapy, the properties of GDF-
8 could
be exploited for maintaining cells prior to transplantation or for enhancing
the efficiency
of the fusion. GDF-8 may also have applications in treating disease processes
involving
the kidney or in kidney repair due to trauma.
The expression of GDF-8 in adipose tissue also raises the possibility of
applications for
GDF-8 in the treatment of obesity or of disorders related to abnormal
proliferation of
adipocytes. In this regard, TGF-~i has been shown to be a potent inhibitor of
adipocyte
differentiation in vitro (Ignotz and Massague, Proc. Natl. Acad. Sci., USA
82:8530,
1985).
Polypeptides Polvnucleotides. Vectors and Host Cells
The invention provides substantially pure GDF-8 polypeptide and isolated
polynucleo-
tides that encode GDF-8. The term "substantially pure" as used herein refers
to GDF-8
which is substantially free of other proteins, lipids, carbohydrates or other
materials with
which it is naturally associated. One skilled in the art can purify GDF-8
using standard
techniques for protein purification. The substantially pure polypeptide will
yield a single
major band on a non-reducing polyacrylamide gel. The purity of the GDF-8
polypeptide
can also be determined by amino-terminal amino acid sequence analysis. GDF-8
polypeptide includes functional fragments of the polypeptide, as long as the
activity of
GDF-8 remains. Smaller peptides containing the biological activity of GDF-8
are
included in the invention.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-13-
The invention provides polynucleotides encoding the GDF-8 protein. These
polynucleo-
tides include DNA, cDNA and RNA sequences which encode GDF-8. It is understood
that all polynucleotides encoding all or a portion of GDF-8 are also included
herein, as
long as they encode a polypeptide with GDF-8 activity. Such polynucleotides
include
naturally occurring, synthetic, and intentionally manipulated polynucleotides.
For
example, GDF-8 polynucleotide may be subjected to site-directed mutagenesis.
The
polynucleotide sequence for GDF8 also includes antisense sequences. The
polynucleo-
tides of the invention include sequences that are degenerate as a result of
the genetic
code. There are 20 natural amino acids, most of which are specified by more
than one
codon: Therefore, all degenerate nucleotide sequences are included in the
invention as
long as the amino acid sequence of GDF-8 polypeptide encoded by the nucleotide
sequence is functionally unchanged.
Specifically disclosed herein is a genomic DNA sequence containing a portion
of the
GDF-8 gene. The sequence contains an open reading frame corresponding to the
predicted C-terminal region of the GDF-8 precursor protein. The encoded
polypeptide
is predicted to contain two potential proteolytic processing sites (KR and
RR). Cleavage
of the precursor at the downstream site would generate a mature biologically
active
C-terminal fragment of 109 and 103 amino acids for marine and human species,
respectively, with a predicted molecular weight of approximately 12,400. Also
disclosed
are full length marine and human GDF-8 cDNA sequences. The marine pre-pro-GDF-
8
protein is 376 amino acids in length, which is encoded by a 2676 base pair
nucleotide
sequence, beginning at nucleotide 104 and extending to a TGA stop codon at
nucleotide
1232. The human GDF-8 protein is 375 amino acids and is encoded by a 2743 base
pair
sequence, with the open reading frame beginning at nucleotide 59 and extending
to
nucleotide 1184. GDF-8 is also capable of forming dimers, or heterodimers,
with an
expected molecular weight of approximately 23-30KD (see Example 4). For
example,
GDF-8 may form heterodimers with other family members, such as GDF-11.
Also provided herein are the biologically active C-terminal fragments of
chicken (Figure
2c) and rat (Figure 2d) GDF-8. The full length nucleotide and deduced amino
acid
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
- 14-
sequences for baboon, bovine, chicken, rat, ovine, porcine, and turkey are
shown in
Figures 14a-g and human and marine are shown in Figure 5. As shown in Figure
3b,
alignment of the amino acid sequences of human, marine, rat and chicken GDF-8
indicate that the sequences are 100% identical in the C-terminal biologically
active
fragment. Figure 15 a and 15b also show the alignment of GDF-8 amino acid
sequences
for marine, rat, human, baboon, porcine, ovine, bovine, chicken and turkey.
Given the
extensive conservation of amino acid sequences between species, it would now
be
routine for one of skill in the art to obtain the GDF-8 nucleic acid and amino
acid
sequence for GDF-8 from any species, including those provided herein, as well
as
piscine, for example.
The C-terminal region of GDF-8 following the putative proteolytic processing
site shows
significant homology to the known members of the TGF-(3 superfamily. The GDF-8
sequence contains most of the residues that are highly conserved in other
family
members and in other species (see FIGURES 3a and 3b and 15 a and 15b). Like
the
TGF-(3s and inhibin his, GDF-8 contains an extra pair of cysteine residues in
addition to
the 7 cysteines found in virtually all other family members. Among the known
family
members, GDF-8 is most homologous to Vgr-1 (45% sequence identity) (see FIGURE
4).
Minor modifications of the recombinant GDF-8 primary amino acid sequence may
result
in proteins which have substantially equivalent activity as compared to the
GDF-8
polypeptide described herein. Such modifications may be deliberate, as by site-
directed
mutagenesis, or may be spontaneous. All of the polypeptides produced by these
modifications are included herein as long as the biological activity of GDF-8
still exists.
Further, deletion of one or more amino acids can also result in a modification
of the
structure of the resultant molecule without significantly altering its
biological activity.
This can lead to the development of a smaller active molecule which would have
broader
utility. For example, one can remove amino or carboxy terminal amino acids
which are
not required for GDF-8 biological activity.
CA 02319703 2000-08-03
WO 99/40181 PGT/US99/025I i
-15-
The nucleotide sequence encoding the GDF-8 polypeptide of the invention
includes the
disclosed sequence and conservative variations thereof. The term "conservative
variation" as used herein denotes the replacement of an amino acid residue by
another,
biologically similar residue. Examples of conservative variations include the
substitution
of one hydrophobic residue such as isoleucine, valine, leucine or methionine
for another,
or the substitution of one polar residue for another, such as the substitution
of arginine
for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the
like. The term
"conservative variation" also includes the use of a substituted amino acid in
place of an
unsubstituted parent amino acid provided that antibodies raised to the
substituted
polypeptide also immunoreact with the unsubstituted polypeptide.
DNA sequences of the invention can be obtained by several methods. For
example, the
DNA can be isolated using hybridization techniques which are well known in the
art.
These include, but are not limited to: 1 ) hybridization of genomic or cDNA
libraries with
probes to detect homologous nucleotide sequences, 2) polymerise chain reaction
(PCR)
on genomic DNA or cDNA using primers capable of annealing to the DNA sequence
of
interest, and 3) antibody screening of expression libraries to detect cloned
DNA
fragments with shared structural features.
Preferably the GDF-8 polynucleotide of the invention is derived from a
mammalian
organism, and most preferably from mouse, rat, cow, pig, or human. GDF-8
polynucleo-
tides from chicken, turkey, fish and other species are also included herein.
Screening
procedures which rely on nucleic acid hybridization make it possible to
isolate any gene
sequence from any organism, provided the appropriate probe is available. Given
the
extensive nucleotide and amino acid homology between species, it would be
routine for
one of skill in the art to obtain polynucleotides encoding GDF-8 from any
species. -
Oligonucleotide probes, which correspond to a part of the sequence encoding
the protein
in question, can be synthesized chemically. This requires that short,
oligopeptide
stretches of amino acid sequence must be known. The DNA sequence encoding the
protein can be deduced from the genetic code, however, the degeneracy of the
code must
be taken into account. It is possible to perform a mixed addition reaction
when the
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
- 16-
sequence is degenerate. This includes a heterogeneous mixture of denatured dou-
ble-stranded DNA. For such screening, hybridization is preferably performed on
either
single-stranded DNA or denatured double-stranded DNA. Hybridization is
particularly
useful in the detection of cDNA clones derived from sources where an extremely
low
amount of mRNA sequences relating to the polypeptide of interest are present.
In other
words, by using stringent hybridization conditions directed to avoid non-
specific binding,
it is possible, for example, to allow the autoradiographic visualization of a
specific cDNA
clone by the hybridization of the target DNA to that single probe in the
mixture which
is its complete complement (Wallace, et al., Nucl. Acid Res. _9:879, 1981).
The development of specific DNA sequences encoding GDF-8 can also be obtained
by:
1 ) isolation of double-stranded DNA sequences from the genomic DNA; 2)
chemical
manufacture of a DNA sequence to provide the necessary codons for the
polypeptide of
interest; and 3) in vitro synthesis of a doublestranded DNA sequence by
reverse
transcription of mRNA isolated from a eukaryotic donor cell. In the latter
case, a
double-stranded DNA complement of mRNA is eventually formed which is generally
referred to as cDNA.
Of the three above-noted methods for developing specific DNA sequences for use
in
recombinant procedures, the isolation of genomic DNA isolates is the least
common.
This is especially true when it is desirable to obtain the microbial
expression of
mammalian polypeptides due to the presence of introns.
The synthesis of DNA sequences is frequently the method of choice when the
entire
sequence of amino acid residues of the desired polypeptide product is known.
When the
entire sequence of amino acid residues of the desired polypeptide is not
known, the direct
synthesis of DNA sequences is not possible and the method of choice is the
synthesis of
cDNA sequences. Among the standard procedures for isolating cDNA sequences of
interest is the forniation of plasmid- or phage-carrying cDNA libraries which
are derived
from reverse transcription of mRNA which is abundant in donor cells that have
a high
level of genetic expression. When used in combination with polymerase chain
reaction
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
- 1'7 -
technology, even rare expression products can be cloned. In those cases where
significant
portions of the amino acid sequence of the polypeptide are known, the
production of
labeled single or double-stranded DNA or RNA probe sequences duplicating a
sequence
putatively present in the target cDNA may be employed in DNA/DNA hybridization
procedures which are carried out on cloned copies of the cDNA which have been
denatured into a single-stranded form (Jay, et al., Nucl. Acid Res., 11:2325,
1983).
A cDNA expression library, such as lambda gtl 1, can be screened indirectly
for GDF-8
peptides having at least one epitope, using antibodies specific for GDF-8.
Such
antibodies can be either polyclonally or monoclonally derived and used to
detect
expression product indicative of the presence of GDF-8 cDNA.
In nucleic acid hybridization reactions, the conditions used to achieve a
particular level
of stringency will vary, depending on the nature of the nucleic acids being
hybridized.
For example, the length, degree of complementarity, nucleotide sequence
composition
(e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the
hybridizing
1 S regions of the nucleic acids can be considered in selecting hybridization
conditions. An
additional consideration is whether one of the nucleic acids is immobilized,
for example,
on a filter.
An example of progressively higher stringency conditions is as follows: 2 x
SSC/0.1%
SDS at about mom temperature (hybridization conditions); 0.2 x SSC/0.1 % SDS
at about
room temperature (low stringency conditions); 0.2 x SSC/0.1% SDS at about
42°C
(moderate stringency conditions); and 0.1 x SSC at about 68°C (high
stringency
conditions). Washing can be carried out using only one of these conditions,
e.g., high
stringency conditions, or each of the conditions can be used, e.g., for 10-15
minutes each,
in the order listed above, repeating any or all of the steps listed. However,
as mentioned
above, optimal conditions will vary, depending on the particular hybridization
reaction
involved, and can be determined empirically.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-18-
DNA sequences encoding GDF-8 can be expressed in vitro by DNA transfer into a
suitable host cell. "Host cells" are cells in which a vector can be propagated
and its DNA
expressed. The term also includes any progeny of the subject host cell. It is
understood
that all progeny may not be identical to the parental cell since there may be
mutations
that occur during replication. However, such progeny are included when the
term "host
cell" is used. Methods of stable transfer, meaning that the foreign DNA is
continuously
maintained in the host, are known in the art.
In the present invention, the GDF-8 polynucleotide sequences may be inserted
into a
recombinant expression vector. The term "recombinant expression vector" refers
to a
plasmid, virus or other vehicle known in the art that has been manipulated by
insertion
or incorporation of the GDF-8 genetic sequences. Such expression vectors
contain a
promoter sequence which facilitates the efficient transcription of the
inserted genetic
sequence of the host. The expression vector typically contains an origin of
replication,
a promoter, as well as specific genes which allow phenotypic selection of the
trans-
formed cells. Vectors suitable for use in the present invention include, but
are not limited
to the T7-based expression vector for expression in bacteria (Rosenberg, et
al., Gene,
56:125, 1987), the pMSXND expression vector for expression in mammalian cells
(Lee
and Nathans, J. Biol. Chem., 263:3521, 1988) and baculovirus-derived vectors
for
expression in insect cells. The DNA segment can be present in the vector
operably linked
to regulatory elements, for example, a promoter (e.g., T7, metallothionein 1,
or
polyhedrin promoters).
Polynucleotide sequences encoding GDF-8 can be expressed in either prokaryotes
or
eukaryotes. Hosts can include microbial, yeast, insect and mammalian
organisms.
Methods of expressing DNA sequences having eukaryotic or viral sequences in
prokaryotes are well known in the art. Biologically functional viral and
plasmid DNA
vectors capable of expression and replication in a host are known in the art.
Such vectors
are used to incorporate DNA sequences of the invention. Preferably, the mature
C-terminal region of GDF-8 is expressed fram a cDNA clone containing the
entire
coding sequence of GDF-8. Alternatively, the C-terminal portion of GDF-8 can
be
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/OZ511
-19-
expressed as a fusion protein with the pro- region of another member of the
TGF-(3
family or co-expressed with another pro-region (see for example, Hammonds, et
al.,
Molec. Endocrin., 5:149,1991; Gray, A., and Mason, A., Science, 247:1328,
1990).
Transformation of a host cell with recombinant DNA may be carried out by
conventional
techniques as are well known to those skilled in the art. Where the host is
prokaryotic,
such as E coli, competent cells which are capable of DNA uptake can be
prepared from
cells harvested after exponential growth phase and subsequently treated by the
CaClz
method using procedures well known in the art. Alternatively, MgCl2 or RbCI
can be
used. Transformation can also be performed after forming a protoplast of the
host cell if
desired.
When the host is a eukaryote, such methods of transfection of DNA as calcium
phosphate
co-precipitates, conventional mechanical procedures such as microinjection,
electroporation, insertion of a plasmid encased in liposomes, or virus vectors
may be
used. Eukaryotic cells can also be cotransformed with DNA sequences encoding
the
GDF-8 of the invention, and a second foreign DNA molecule encoding a
selectable
phenotype, such as the herpes simplex thymidine kinase gene. Another method is
to use
a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma
virus, to
transiently infect or transform eukaryotic cells and express the protein. (see
for example,
Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).
Isolation and purification of microbial expressed polypeptide, or fragments
thereof,
provided by the invention, may be carried out by conventional means including
preparative chromatography and immunological separations involving monoclonal
or
polyclonal antibodies.
GDF 8 Antibodies and Methods of Use
The invention includes antibodies immunoreactive with GDF-8 polypeptide or
functional
fragments thereof. Antibody which consists essentially of pooled monoclonal
antibodies
with different epitopic specificities, as well as distinct monoclonal antibody
preparations
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-20-
are provided. Monoclonal antibodies are made from antigen containing fragments
of the
protein by methods well known to those skilled in the art (Kohler, et al.,
Nature,
256:495, 1975). The term antibody as used in this invention is meant to
include intact
molecules as well as fragments thereof, such as Fab and F(ab')2, Fv and SCA
fragments
which are capable of binding an epitopic determinant on GDF-8.
(1) An Fab fragment consists of a monovalent antigen-binding fragment of an
antibody
molecule, and can be produced by digestion of a whole antibody molecule with
the
enzyme papain, to yield a fragment consisting of an intact light chain and a
portion of a
heavy chain.
(2) An Fab' fragment of an antibody molecule can be obtained by treating a
whole
antibody molecule with pepsin, followed by reduction, to yield a molecule
consisting of
an intact light chain and a portion of a heavy chain. Two Fab' fragments are
obtained per
antibody molecule treated in this manner.
(3) An (Fab')2 fragment of an antibody can be obtained by treating a whole
antibody
1 S molecule with the enzyme pepsin, without subsequent reduction. A (Fab')2
fragment is
a dimer of two Fab' fragments, held together by two disulfide bonds.
(4) An Fv fragment is defined as a genetically engineered fragment containing
the
variable region of a light chain and the variable region of a heavy chain
expressed as two
chains.
(5) A single chain antibody ("SCA") is a genetically engineered single chain
molecule
containing the variable region of a light chain and the variable region of a
heavy chain,
linked by a suitable, flexible polypeptide linker.
As used in this invention, the term "epitope" refers to an antigenic
determinant on an
antigen, such as a GDF-8 polypeptide, to which the paratope of an antibody,
such as an
GDF-8-specific antibody, binds. Antigenic determinants usually consist of
chemically
CA 02319703 2000-08-03
WO 99/40181 PC'T/US99/02511
-21 -
active surface groupings of molecules, such as amino acids or sugar side
chains, and can
have specific three-dimensional structural characteristics, as well as
specific charge
characteristics.
As is mentioned above, antigens that can be used in producing GDF-8-specific
antibodies
include GDF-8 polypeptides or GDF-8 polypeptide fragments. The polypeptide or
peptide used to immunize an animal can be obtained by standard recombinant,
chemical
synthetic, or purification methods. As is well known in the art, in order to
increase
immunogenicity, an antigen can be conjugated to a carrier protein. Commonly
used
carriers include keyhole limpet hemocyanin (KLl-n, thyroglobulin, bovine serum
albumin
(BSA), and tetanus toxoid. The coupled peptide is then used to immunize the
animal
(e.g., a mouse, a rat, or a rabbit). In addition to such Garners, well known
adjuvants can
be administered with the antigen to facilitate induction of a strong immune
response.
The term "cell-proliferative disorder" denotes malignant as well as non-
malignant cell
populations which often appear to differ from the surrounding tissue both
morphologi-
cally and genotypically. Malignant cells (i. e. cancer) develop as a result of
a multistep
process. The GDF-8 polynucleotide that is an antisense molecule or that
encodes a
dominant negative GDF-8 is useful in treating malignancies of the various
organ systems,
particularly, for example, cells in muscle, bone, kidney or adipose tissue.
Essentially, any
disorder which is etiologically linked to altered expression of GDF-8 could be
considered
susceptible to treatment with a GDF-8 agent (e.g., a suppressing or enhancing
agent).
One such disorder is a malignant cell proliferative disorder, for example.
The invention provides a method for detecting a cell proliferative disorder of
muscle,
bone, kidney or adipose tissue which comprises contacting an anti-GDF-8
antibody with
a cell suspected of having a GDF-8 associated disorder and detecting binding
to the
antibody. The antibody reactive with GDF-8 is labeled with a compound which
allows
detection of binding to GDF-8. For purposes of the invention, an antibody
specific for
GDF-8 polypeptide may be used to detect the level of GDF-8 in biological
fluids and
tissues. Any specimen containing a detectable amount of antigen can be used.
Preferred
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/0251 I
-22-
samples of this invention include muscle, bone or kidney tissue. The level of
GDF-8 in
the suspect cell can be compared with the level in a normal cell to determine
whether the
subject has a GDF-8-associated cell proliferative disorder. Such methods of
detection
are also useful using nucleic acid hybridization to detect the level of GDF-8
mRNA in
a sample or to detect an altered GDF-8 gene. Preferably the subject is human.
The antibodies of the invention can be used in any subject in which it is
desirable to
administer in vitro or in vivo immunodiagnosis or immunotherapy. The
antibodies of the
invention are suited for use, for example, in immunoassays in which they can
be utilized
in liquid phase or bound to a solid phase Garner. In addition, the antibodies
in these
immunoassays can be detectably labeled in various ways. Examples of types of
immunoassays which can utilize antibodies of the invention are competitive and
non-competitive immunoassays in either a direct or indirect format. Examples
of such
immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric)
assay.
Detection of the antigens using the antibodies of the invention can be done
utilizing
immunoassays which are run in either the forward, reverse, or simultaneous
modes,
including immunohistochemical assays on physiological samples. Those of skill
in the
art will know, or can readily discern, other immunoassay formats without undue
experimentation.
The antibodies of the invention can be bound to many different carriers and
used to
detect the presence of an antigen comprising the polypeptide of the invention.
Examples
of well-known can~iers include glass, polystyrene, polypropylene,
polyethylene, dextran,
nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses
and
magnetite. The nature of the carrier can be either soluble or insoluble for
purposes of the
invention. Those skilled in the art will know of other suitable Garners for
binding
antibodies, or will be able to ascertain such, using routine experimentation.
There are many different labels and methods of labeling known to those of
ordinary skill
in the art. Examples of the types of labels which can be used in the present
invention
include enzymes, radioisotopes, fluorescent compounds, colloidal metals,
CA 02319703 2000-08-03
WO 99/40181 PGT/US99/02511
-23-
chemiluminescent compounds, phosphorescent compounds, and bioluminescent
compounds. 'Those of ordinary skill in the art will know of other suitable
labels for
binding to the antibody, or will be able to ascertain such, using routine
experimentation.
Another technique which may also result in greater sensitivity consists of
coupling the
antibodies to low molecular weight haptens. These haptens can then be
specifically
detected by means of a second reaction. For example, it is common to use such
haptens
as biotin, which reacts with avidin, or dinitrophenyi, puridoxal, and
fluorescein, which
can react with specific antihapten antibodies.
In using the monoclonal antibodies of the invention for the in vivo detection
of antigen,
the detestably labeled antibody is given a dose which is diagnostically
effective. The
term "diagnostically effective" means that the amount of detestably labeled
monoclonal
antibody is administered in sufficient quantity to enable detection of the
site having the
antigen comprising a polypeptide of the invention for which the monoclonal
antibodies
are specific.
15. The concentration of detestably labeled monoclonal antibody which is
administered
should be sufficient such that the binding to those cells having the
polypeptide is
detectable compared to the background. Further, it is desirable that the
detestably labeled
monoclonal antibody be rapidly cleared from the circulatory system in order to
give the
best target-to-background signal ratio.
As a rule, the dosage of detestably labeled monoclonal antibody for in vivo
diagnosis will
vary depending on such factors as age, sex, and extent of disease of the
individual. Such
dosages may vary, for example, depending on whether multiple injections are
given,
antigenic burden, and other factors known to those of skill in the art.
For in vivo diagnostic imaging, the type of detection instnunent available is
a major
factor in selecting a given radioisotope. The radioisotope chosen must have a
type of
decay which is detectable for a given type of instrument. Still another
important factor
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-24-
in selecting a radioisotope for in vivo diagnosis is that deleterious
radiation with respect
to the host is minimized. Ideally, a radioisotope used for in vivo imaging
will lack a
particle emission, but produce a large number of photons in the 140-250 keV
range,
which may readily be detected by conventional gamma cameras.
For in vivo diagnosis radioisotopes may be bound to immunoglobulin either
directly or
indirectly by using an intermediate functional group. intermediate functional
groups
which often are used to bind radioisotopes which exist as metallic ions to
irnmunoglobulins are the bifunctional chelating agents such as
diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid
(EDTA)
and similar molecules. Typical examples of metallic ions which can be bound to
the
monoclonal antibodies of the invention are "'In,9'Ru,b'Ga,6gGa,'zAs,89Zr and
2°'Tl.
The monoclonal antibodies of the invention can also be labeled with a
paramagnetic
isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging
(MRI) or
electron spin resonance (ESR). In general, any conventional method for
visualizing
1 S diagnostic imaging can be utilized. Usually gamma and positron emitting
radioisotopes
are used for camera imaging and paramagnetic isotopes for MRI. Elements which
are
particularly useful in such techniques include's'Gd,ssMn,'62Dy,szCr, and s6Fe.
The monoclonal antibodies of the invention can be used in vitro and in viva to
monitor
the course of amelioration of a GDF-8-associated disease in a subject. Thus,
for example,
by measuring the increase or decrease in the number of cells expressing
antigen
comprising a polypeptide of the invention or changes in the concentration of
such antigen
present in various body fluids, it would be possible to determine whether a
particular
therapeutic regimen aimed at ameliorating the GDF-8-associated disease is
effective. The
term "ameliorate" denotes a lessening of the detrimental effect of the GDF-8-
associated
disease in the subject receiving therapy.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-25-
Additional Methods of Treatment and Diagnosis
The present invention identifies a nucleotide sequence that can be expressed
in an altered
manner as compared to expression in a normal cell, therefore it is possible to
design
appropriate therapeutic or diagnostic techniques directed to this sequence.
Treatment
includes administration of a reagent which modulates activity. The term
"modulate"
envisions the suppression or expression of GDF-8 when it is over-expressed, or
augmentation of GDF-8 expression when it is underexpressed. When a muscle or
bone-
associated disorder is associated with GDF-8 overexpression, such suppressive
reagents
as antisense GDF-8 polynucleotide sequence, dominant negative sequences or GDF-
8
binding antibody can be introduced into a cell. In addition, an anti-idiotype
antibody
which binds to a monoclonal antibody which binds GDF-8 of the invention, or an
epitope
thereof, may also be used in the therapeutic method of the invention.
Alternatively, when
a cell proliferative disorder is associated with underexpression or expression
of a mutant
GDF-8 polypeptide, a sense polynucleotide sequence (the DNA coding strand) or
GDF-8
polypeptide can be introduced into the cell. Such muscle or bone-associated
disorders
include cancer, muscular dystrophy, spinal cord injury, traumatic injury,
congestive
obstructive pulmonary disease (COPD), AIDS or cachecia. In addition, the
method of
the invention can be used in the treatment of obesity or of disorders related
to abnormal
proliferation of adipocytes. One of skill in the art can determine whether or
not a
particular therapeutic course of treatment is successful by several methods
described
herein (e.g., muscle fiber analysis or biopsy; determination of fat content).
The present
examples demonstrate that the methods of the invention are useful for
decreasing fat
content, and therefore would be useful in the treatment of obesity and related
disorders
(e.g., diabetes}. Neurodegenerative disorders are also envisioned as treated
by the
method of the invention.
Thus, where a cell-proliferative disorder is associated with the expression of
GDF-8,
nucleic acid sequences that interfere with GDF-8 expression at the
translational level can
be used. This approach utilizes, for example, antisense nucleic acid and
ribozymes to
block translation of a specific GDF-8 mRNA, either by masking that mRNA with
an
antisense nucleic acid or by cleaving it with a ribozyme. Such disorders
include
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-26-
neurodegenerative diseases, for example. In addition, dominant-negative GDF-8
mutants
would be usefi~l to actively interfere with function of "normal" GDF-8.
Antisense nucleic acids are DNA or RNA molecules that are complementary to at
least
a portion of a specific mRNA molecule (Weintraub, Scientific American, 262:40,
1990).
In the cell, the antisense nucleic acids hybridize to the corresponding mRNA,
forming
a double-stranded molecule. The antisense nucleic acids interfere with the
translation of
the mRNA, since the cell will not translate a mRNA that is double-stranded.
Antisense oligomers of about 15 nucleotides are preferred, since they are
easily
synthesized and are less likely to cause problems than larger molecules when
introduced
into the target GDF-8-producing cell. The use of antisense methods to inhibit
the in vitro
translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem.,
172:289,
1988).
Ribozymes are RNA molecules possessing the ability to specifically cleave
other
single-stranded RNA in a manner analogous to DNA restriction endonucleases.
Through
the modification of nucleotide sequences which encode these RNAs, it is
possible to
engineer molecules that recognize specific nucleotide sequences in an RNA
molecule and
cleave it (Cech, J. Amer. Med. Assn., 260:3030, 1988). A major advantage of
this
approach is that, because they are sequence-specific, only mRNAs with
particular
sequences are inactivated.
There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff,
Nature,
334:585, 1988) and "hammerhead"-type. Tetrahymena-type ribozymes recognize
sequences which are four bases in length, while "hammerhead"-type ribozymes
recognize
base sequences 11-18 bases in length. The longer the recognition sequence, the
greater
the likelihood that the sequence will occur exclusively in the target mRNA
species.
Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type
ribozymes for inactivating a specific mRNA species and 18-based recognition
sequences
are preferable to shorter recognition sequences.
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-27-
In another embodiment of the present invention, a nucleotide sequence encoding
a GDF-
8 dominant negative protein is provided. For example, a genetic construct that
contain
such a dominant negative encoding gene may be operably linked to a promoter,
such as
a tissue-specific promoter. For example, a skeletal muscle specific promoter
(e.g.,
human skeletal muscle a-actin promoter) or developmentally specific promoter
(e.g.,
MyHC 3, which is restricted in skeletal muscle to the embryonic period of
development,
or an inducible promoter (e.g., the orphan nuclear receptor TIS 1 ).
Such constructs are useful in methods of modulating a subject's skeletal mass.
For
example, a method include transforming an organism, tissue, organ or cell with
a genetic
construct encoding a dominant negative GDF-8 protein and suitable promoter in
operable
linkage and expressing the dominant negative encoding GDF-8 gene, thereby
modulating
muscle and/or bone mass by interfering with wild-type GDF-8 activity.
GDF-8 most likely forms dimers, homodimers or heterodimers and may even form
heterodimers with other GDF family members, such as GDF-11 (see Example 4).
Hence,
while not wanting to be bound by a particular theory, the dominant negative
effect
described herein may involve the formation of non-functional homodimers or
heterodimers of dominant negative and wild-type GDF-8 monomers. More
specifically,
it is possible that any non-fixnctional homodimer or any heterodimer formed by
the
dimerization of wild-type and/or dominant negative GDF-8 monomers produces a
dominant effect by: 1 ) being synthesized but not processed or secreted; 2)
inhibiting the
secretion of wild type GDF-8; 3) preventing normal proteolytic cleavage of the
preprotein thereby producing a nonfunctional GDF-8 molecule; 4) altering the
affinity
of the non-functional dimer (e.g., homodimeric or heterodimeric GDF-8) to a
receptor
or generating an antagonistic form of GDF-8 that binds a receptor without
activating it;
or 5) inhibiting the intracellular processing or secretion of GDF-8 related or
TGF-13
family proteins.
Non-functional GDF-8 can function to inhibit the growth regulating actions of
GDF-8
on muscle and bone cells that include a dominant negative GDF-8 gene. Deletion
or
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-28-
missense dominant negative forms of GDF-8 that retain the ability to form
dimers with
wild- type GDF-8 protein but do not function as wild-type GDF-8 proteins may
be used
to inhibit the biological activity of endogenous wild- type GDF-8. For
example, in one
embodiment, the proteolytic processing site of GDF-8 may be altered (e.g.,
deleted)
resulting in a GDF-8 molecule able to undergo subsequent dimerization with
endogenous
wild-type GDF-8 but unable to undergo further processing into a mature GDF-8
form.
Alternatively, a non-functional GDF-8 can function as a monomeric species to
inhibit
the growth regulating actions of GDF-8 on muscle or bone cells.
Any genetic recombinant method in the art may be used, for example,
recombinant
viruses may be engineered to express a dominant negative form of GDF-8 which
may be
used to inhibit the activity of wild-type GDF-8. Such viruses may be used
therapeuti-
cally for treatment of diseases resulting from aberrant over-expression or
activity of
GDF-8 protein, such as in denervation hypertrophy or as a means of controlling
GDF-8
expression when treating disease conditions involving the musculoskeletal
system, such
as in musculodegenerative diseases, osteoporosis or in tissue repair due to
trauma or in
modulating GDF-8 expression in animal husbandry (e.g., transgenic animals for
agricultural purposes}.
The invention provides a method for treating a muscle, bone, kidney (chronic
or acute)
or adipose tissue disorder in a subject. The method includes administering a
therapeuti-
cally effective amount of a GDF-8 agent to the subject, thereby inhibiting
abnormal
growth of muscle, bone, kidney or adipose tissue. The GDF-8 agent may include
a GDF-
8 antisense molecule or a dominant negative polypeptide, for example. A
"therapeuti-
cally effective amount" of a GDF-8 agent is that amount that ameliorates
symptoms of
the disorder or inhibits GDF-8 induced growth of muscle or bone, for example,
as
compared with a normal subject.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-29-
Gene Theranv
The present invention also provides gene therapy for the treatment of cell
proliferative
or immunologic disorders which are mediated by GDF-8 protein. Such therapy
would
achieve its therapeutic effect by introduction of the GDF-8 antisense or
dominant
negative encoding polynucleotide into cells having the proliferative disorder.
Delivery
of antisense or dominant negative GDF-8 polynucleotide can be achieved using a
recombinant expression vector such as a chimeric virus or a colloidal
dispersion system.
Especially preferred for therapeutic delivery of antisense or dominant
negative sequences
is the use of targeted liposomes. In contrast, when it is desirable to enhance
GDF-8
production, a "sense" GDF-8 polynucleotide or functional equivalent (e.g., the
C-term
active region) is introduced into the appropriate cell(s).
Various viral vectors which can be utilized for gene therapy as taught herein
include
adenovirus, herpes virus, vaccinia, or, preferably, an RNA virus such as a
retrovirus.
Preferably, the retroviral vector is a derivative of a marine or avian
retrovirus. Examples
of retroviral vectors in which a single foreign gene can be inserted include,
but are not
limited to: Moloney marine leukemia virus (MoMuLV), Harvey marine sarcoma
virus
(HaMuSV), marine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
A number of additional retroviral vectors can incorporate multiple genes. All
of these
vectors can transfer or incorporate a gene for a selectable marker so that
transduced cells
can be identified and generated. By inserting a GDF-8 sequence of interest
into the viral
vector, along with another gene which encodes the ligand for a receptor on a
specific
target cell, for example, the vector is now target specific. Retroviral
vectors can be made
target specific by attaching, for example, a sugar, a glycolipid, or a
protein. Preferred
targeting is accomplished by using an antibody to target the retroviral
vector. Those of
skill in the art will know of, or can readily ascertain without undue
experimentation,
specific polynucleotide sequences which can be inserted into the retroviral
genome or
attached to a viral envelope to allow target specific delivery of the
retroviral vector
containing the GDF-8 antisense polynucleotide.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-30-
Since recombinant retroviruses are defective, they require assistance in order
to produce
infectious vector particles. This assistance can be provided, for example, by
using helper
cell lines that contain plasmids encoding all of the structural genes of the
retrovirus under
the control of regulatory sequences within the LTR. These plasmids are missing
a
nucleotide sequence which enables the packaging mechanism to recognize an RNA
transcript for encapsulation. Helper cell lines which have deletions of the
packaging
signal include, but are not limited to t~r2, PA317 and PA12, for example:
These cell lines
produce empty virions, since no genome is packaged. If a retroviral vector is
introduced
into such cells in which the packaging signal is intact, but the structural
genes are
replaced by other genes of interest, the vector can be packaged and vector
virion
produced.
Alternatively, NIH 3T3 or other tissue culture cells can be directly
transfected with
plasmids encoding the retroviral structural genes gag, pol and env, by
conventional
calcium phosphate transfection. These cells are then transfected with the
vector plasmid
containing the genes of interest. The resulting cells release the retroviral
vector into the
culture medium.
Another targeted delivery system for GDF-8 polynucleotides is a colloidal
dispersion
system. Colloidal dispersion systems include macromolecule complexes,
nanocapsules,
microspheres, beads, and lipid-based systems including oil-in-water emulsions,
micelles,
mixed micelles, and liposomes. The preferred colloidal system of this
invention is a
liposome. Liposomes are artificial membrane vesicles which are useful as
delivery
vehicles in vitro and in vivo. It has been shown that large unilamellar
vesicles (LUV),
which range in size from 0.2-4.0 pm can encapsulate a substantial percentage
of an
aqueous buffer containing large macromolecules. RNA, DNA and intact virions
can be
encapsulated within the aqueous interior and be delivered to cells in a
biologically active
form (Fraley, et al., Trends Biochem. Sci., 6:77, 1981). In addition to
mammalian cells,
Iiposomes have been used for delivery of polynucleotides in plant, yeast and
bacterial
cells. in order for a liposome to be an efficient gene transfer vehicle, the
following
characteristics should be present: (1) encapsulation of the genes of interest
at high
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-31-
efficiency while not compromising their biological activity; (2) preferential
and
substantial binding to a target cell in comparison to non-target cells; (3)
delivery of the
aqueous contents of the vesicle to the target cell cytoplasm at high
efficiency; and (4)
accurate and effective expression of genetic information (Manning, et al.,
Biotechnigues,
6:682, 1988).
The composition of the liposome is usually a combination of phospholipids,
particularly
high-phase-transition-temperature phospholipids, usually in combination with
steroids,
especially cholesterol. Other phospholipids or other lipids may also be used.
The physical
characteristics of liposomes depend on pH, ionic strength, and the presence of
divalent
cations.
Examples of lipids useful in liposome production include phosphatidyl
compounds, such
a s phosphatidyiglycerol, phosphatidylcholine, phosphatidylserine,
phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
Particularly
useful are diacylphosphatidylglycerols, where the lipid moiety contains from
14-18
carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
Illustrative
phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine
and
distearoylphosphatidylcholine.
The targeting of liposomes can be classified based on anatomical and
mechanistic
factors. Anatomical classification is based on the level of selectivity, for
example,
organ-specific, cell-specific, and organelle-specific. Mechanistic targeting
can be
distinguished based upon whether it is passive or active. Passive targeting
utilizes the
natural tendency of liposomes to distribute to cells of the reticulo-
endothelial system
(RES) in organs which contain sinusoidal capillaries. Active taxgeting, on the
other hand,
involves alteration of the liposome by coupling the liposome to a specific
ligand such as
a monoclonal antibody, sugar, glycolipid, or protein, or by changing the
composition or
size of the liposome in order to achieve targeting to organs and cell types
other than the
naturally occurring sites of localization.
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-32-
The surface of the targeted delivery system may be modified in a variety of
ways. In the
case of a liposomal targeted delivery system, lipid groups can be incorporated
into the
lipid bilayer of the liposome in order to maintain the targeting ligand in
stable association
with the liposomal bilayer. Various linking groups can be used for joining the
lipid
chains to the targeting ligand.
Due to the expression of GDF-8 in muscle, bone, kidney and adipose tissue,
there are a
variety of applications using the polypeptide, polynucleotide, and antibodies
of the
invention, related to these tissues. Such applications include treatment of
cell prolifera-
tive disorders involving these and other tissues, such as neural tissue. In
addition, GDF-8
may be useful in various gene therapy procedures. In embodiments where GDF-8
polypeptide is administered to a subject, the dosage range is about 0.1 ug/kg
to 100
mg/kg; more preferably from about 1 ug/kg to 75 mg/kg and most preferably from
about
10 mg/kg to 50 mg/kg.
Chromosomal Location~GDF-8
The data in Example 6 shows that the human GDF-8 gene is located on chromosome
2.
By comparing the chromosomal location of GDF-8 with the map positions of
various
human disorders, it should be possible to determine whether mutations in the
GDF-8
gene are involved in the etiology of human diseases. For example, an autosomal
recessive form of juvenile amyotrophic lateral sclerosis has been shown to map
to
chromosome 2 (Hentati, et al., Neurology, 42 [Suppl.3]:201, 1992). More
precise
mapping of GDF-8 and analysis of DNA from these patients may indicate that GDF-
8
is, in fact, the gene affected in this disease. In addition, GDF-8 is useful
for distinguish-
ing chromosome 2 from other chromosomes.
Transgenic Animals and Methods of Making the same
Various methods to make the transgenic animals of the subject invention can be
employed. Generally speaking, three such methods may be employed. In one such
method, an embryo at the pronuclear stage (a "one cell embryo") is harvested
from a
female and the transgene is microinjected into the embryo, in which case the
transgene
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-33-
will be chromosomally integrated into both the germ cells and somatic cells of
the
resulting mature animal. In another such method, embryonic stem cells are
isolated and
the transgene incorporated therein by electroporation, plasmid transfection or
microinjection, followed by reintroduction of the stem cells into the embryo
where they
colonize and contribute to the germ line. Methods for microinjection of
mammalian
species is described in United States Patent No. 4,873,191. In yet another
such method,
embryonic cells are infected with a retrovirus containing the transgene
whereby the germ
cells of the embryo have the transgene chromosomally integrated therein. When
the
animals to be made transgenic are avian, because avian fertilized ova
generally go
through cell division for the first twenty hours in the oviduct,
microinjection into the
pronucleus of the fertilized egg is problematic due to the inaccessibility of
the
pronucleus. Therefore, of the methods to make transgenic animals described
generally
above, retrovirus infection is preferred for avian species, for example as
described in U.S.
5,162,215. If microinjection is to be used with avian species, however, a
recently
published procedure by Love et al., (Biotechnology, 12, Jan 1994) can be
utilized
whereby the embryo is obtained from a sacrificed hen approximately two and one-
half
hours after the laying of the previous laid egg, the transgene is
microinjected into the
cytoplasm of the germinal disc and the embryo is cultured in a host shell
until maturity.
When the animals to be made transgenic are bovine or porcine, microinjection
can be
hampered by the opacity of the ova thereby making the nuclei difficult to
identify by
traditional differential interference-contrast microscopy. To overcome this
problem, the
ova can first be centrifuged to segregate the pronuclei for better
visualization.
The "non-human animals" of the invention bovine, porcine, ovine and avian
animals
(e.g., cow, pig, sheep, chicken, turkey). The "transgenic non-human animals"
of the
invention are produced by introducing "transgenes" into the germline of the
non-human
animal. Embryonal target cells at various developmental stages can be used to
introduce
transgenes. Different methods are used depending on the stage of development
of the
embryonal target cell. The zygote is the best target for micro-injection. The
use of
zygotes as a target for gene transfer has a major advantage in that in most
cases the
injected DNA will be incorporated into the host gene before the first cleavage
(Brinster
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-34-
et al., Proc. Natl. Acad. Sci. USA 82:4438-4442, 1985). As a consequence, all
cells of the
transgenic non-human animal will carry the incorporated transgene. This will
in general
also be reflected in the efficient transmission of the transgene to offspring
of the founder
since 50% of the germ cells will harbor the transgene.
The term "transgenic" is used to describe an animal which includes exogenous
genetic
material within all of its cells. A "transgenic" animal can be produced by
cross-breeding
two chimeric animals which include exogenous genetic material within cells
used in
reproduction. Twenty-five percent of the resulting offspring will be
transgenic i. e.,
animals which include the exogenous genetic material within all of their cells
in both
alleles. 50% of the resulting animals will include the exogenous genetic
material within
one allele and 25% will include no exogenous genetic material.
In the microinjection method useful in the practice of the subject invention,
the transgene
is digested and purified free from any vector DNA e.g. by gel electrophoresis.
It is
preferred that the transgene include an operatively associated promoter which
interacts
1 S with cellular proteins involved in transcription, ultimately resulting in
constitutive
expression. Promoters useful in this regard include those from cytomegalovirus
(CMV),
Moloney leukemia virus (MLV), and herpes virus, as well a.s those from the
genes
encoding metallothionin, skeletal actin, P-enolpyruvate carboxylase {PEPCK),
phosphoglycerate (PGK), DHFR, and thymidine kinase. Promoters for viral long
terminal repeats (LTRs) such as Rous Sarcoma Virus can also be employed. When
the
animals to be made transgenic are avian, preferred promoters include those for
the
chicken ~i-globin gene, chicken lysozyme gene, and avian leukosis virus.
Constructs
useful in plasmid transfection of embryonic stem cells will employ additional
regulatory
elements well known in the art such as enhancer elements to stimulate
transcription,
splice acceptors, termination and polyadenylation signals, and ribosome
binding sites to
permit translation.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-35-
Retroviral infection can also be used to introduce transgene into a non-human
animal, as
described above. The developing non-human embryo can be cultwed in vitro to
the
blastocyst stage. During this time, the blastomeres can be targets for retro
viral infection
(Jaenich, R., Proc. Natl. Acad. Sci USA 73:1260-1264, 1976). Efficient
infection of the
blastomeres is obtained by enzymatic treatment to remove the zona pellucida
(Hogan, et
al. ( 1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory
Press,
Cold Spring Harbor, N.Y.). The viral vector system used to introduce the
transgene is
typically a replication-defective retro virus carrying the transgene (Jahner,
et al., Proc.
Natl. Acad. Sci. USA 82:6927-6931, 1985; Van der Putten, et al., Proc. Natl.
Acad. Sci
USA 82:6148-6152, 1985). Transfection is easily and efficiently obtained by
culturing
the blastomeres on a monolayer of virus-producing cells (Van der Putten,
supra; Stewart,
et al., EMBO J. 6:383-388, 1987). Alternatively, infection can be performed at
a later
stage. Virus or virus-producing cells can be injected into the blastocoele (D.
Jahner et al.,
Nature 298:623-628, 1982). Most of the founders will be mosaic for the
transgene since
incorporation occurs only in a subset of the cells which formed the transgenic
nonhwnan
animal. Further, the founder may contain various retro viral insertions of the
transgene
at different positions in the genome which generally will segregate in the
offspring. In
addition, it is also possible to introduce transgenes into the germ line,
albeit with low
efficiency, by intrauterine retroviral infection of the midgestation embryo
(D. Jahner et
al., supra).
A third type of target cell for transgene introduction is the embryonal stem
cell (ES). ES
cells are obtained from pre-implantation embryos cultwed in vitro and fused
with
embryos (M. J. Evans et al. Nature 292:154-156, 1981; M.O. Bradley et al.,
Nature 309:
255-258, 1984; Gossler, et al., Proc. Natl. Acad. Sci USA 83: 9065-9069, 1986;
and
Robertson et al., Nature 322:445-448, 1986). Transgenes can be efficiently
introduced
into the ES cells by DNA transfection or by retro virus-mediated transduction.
Such
transformed ES cells can thereafter be combined with blastocysts from a
nonhuman
animal. The ES cells thereafter colonize the embryo and contribute to the germ
line of
the resulting chimeric animal. (For review see Jaenisch, R., Science 240: 1468-
1474,
1988).
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-36-
"Transformed" means a cell into which (or into an ancestor of which) has been
introduced, by means of recombinant nucleic acid techniques, a heterologous
nucleic acid
molecule. "Heterologous" refers to a nucleic acid sequence that either
originates from
another species or is modified from either its original form or the form
primarily
expressed in the cell.
"Transgene" means any piece of DNA which is inserted by artifice into a cell,
and
becomes part of the genome of the organism (i.e., either stably integrated or
as a stable
extrachromosomal element) which develops from that cell. Such a transgene may
include a gene which is partly or entirely heterologous (i.e., foreign) to the
transgenic
organism, or may represent a gene homologous to an endogenous gene of the
organism.
Included within this definition is a transgene created by the providing of an
RNA
sequence which is transcribed into DNA and then incorporated into the genome.
The
transgenes of the invention include DNA sequences which encode GDF-8, and
include
GDF-sense, antisense, dominant negative encoding polynucleotides, which may be
expressed in a transgenic non-human animal. The term "transgenic" as used
herein
additionally includes any organism whose genome has been altered by in vitro
manipulation of the early embryo or fertilized egg or by any transgenic
technology to
induce a specific gene knockout. The term "gene knockout" as used herein,
refers to the
targeted disruption of a gene in vivo with complete loss of function that has
been
achieved by any transgenic technology familiar to those in the art. In one
embodiment,
transgenic animals having gene knockouts are those in which the target gene
has been
rendered nonfunctional by an insertion targeted to the gene to be rendered non-
functional
by homologous recombination. As used herein, the term "transgenic" includes
any
transgenic technology familiar to those in the art which can produce an
organism
carrying an introduced transgene or one in which an endogenous gene has been
rendered
non-functional or "knocked out " An example of a transgene used to "knockout"
GDF-8
function in the present Examples is described in Example 8 and FIGURE 12a.
Thus, in
another embodiment, the invention provides a transgene wherein the entire
mature C-
terminal region of GDF-8 is deleted.
CA 02319703 2002-05-14
-37-
The transgene to be used in the practice of the subject invention is a DNA
sequaice
oo~np~ a modified GDF-8 coding sequon~. 1n a preferred embodiment, the GDF-8
gene is disrupted by homologous targeting is embryonic stem ells. For example,
the
entire mature C-terminal region of the GDF-8 gene may be deleted as described
in the
examples below. Optionally,. the GDF-8 disruption or deletion may be
accompanied by
insertion of or raplaceme~t with other DNA s~:qt~es, such as a non-functional
GDF-8
sequence. In other embodiments, the transgene comprises DNA antisense to the
coding
sequence for GDF-8. In another eanbodiment, the ttansgcne comprises DNA
encoding
an a~'body or rZ peptide soq~oe which is able to bind to l3DF-8. The DNA and
_ peptide eoqtrarces of GDF-8 are known in the art, the sequences,
localization aad activity
have been disclosed in W4 94121681. Where appropriate, DNA sequences that
encode proteins having GDF 8 activity but differ in nucleic acid sequence due
to the
degeneracy of the genetic code may also be used herein, as may truncated
forms,
allelic variants and interspecies homologues.
The invention also includes animals having heteroaygous mutations in GDF-8 or
partial
inhibition of GDF-8 function or exptessioa A hctarozygote v~ould exhibit an
intermediate increase in murscle and/or bone mass as compared to the
hornozygote as
shown in Table 4 below. In other words, partial loss of function loads to a
partial
increase in muscle and bone mass. One of skill in the art would readily be
able to
detennuue if a psrticu>at mutation or if an antisense molecele was able to
poly inhibit
GDF-8: For example, ~e vitro testing may be desirable initially by comparison
with wild-
type or untreated C~DF-8 (e.g., comparison of northern blots to examine a
decrease in
expression).
Ails an anbryo has boon microinjabed, colonized with transfected embryonic
stem cells
or infected with a retrovirus containing the transgene (except for practice of
the sabject
invartion in avian species which is addressed elsewhere herein) the embryo is
implanted
into the oviduct of a pseudopregnant female. The consequent progeny are tested
for
CA 02319703 2000-08-03
WO 99/40181 PGT/US99/02511
-38-
incorporation of the transgene by Southern blot analysis of blood samples
using
transgene specific probes. PCR is particularly useful in this regard. Positive
progeny
(GO) are crossbred to produce offspring (G1) which are analyzed for transgene
expression by Northern blot analysis of tissue samples. To be able to
distinguish
expression of like-species transgenes from expression of the animals
endogenous GDF-8
gene(s), a marker gene fragment can be included in the construct in the 3'
untranslated
region of the transgene and the Northern probe designed to probe for the
marker gene
fragment. The serum levels of GDF-8 can also be measured in the transgenic
animal to
establish appropriate expression. Expression of the GDF-8 transgenes, thereby
decreasing the GDF-8 in the tissue and serum levels of the transgenic animals
and
consequently increasing the muscle tissue or bone tissue content results in
the foodstuffs
from these animals (i.e. eggs, beef, pork, poultry meat, milk, etc.) having
markedly
increased muscle and/or bone content, such as ribs, and preferably without
increased, and
more preferably, reduced levels of fat and cholesterol. By practice of the
subject
1 S invention, a statistically significant increase in muscle content,
preferably at least a 2%
increase in muscle content (e.g., in chickens), more preferably a 25% increase
in muscle
content as a percentage of body weight, more preferably greater than 40%
increase in
muscle content in these foodstuffs can be obtained. Similarly the subject
invention may
provide a significant increase in bone content, such as ribs, in these
foodstuffs.
Additional Methods of Use
Thus, the present invention includes methods for increasing muscle and bone
mass in
domesticated animals, characterized by inactivation or deletion of the gene
encoding
growth and differentiation factor-8 (GDF-8). The domesticated animal is
preferably
selected from the group consisting of ovine, bovine, porcine, piscine and
avian. The
animal may be treated with an isolated polynucleotide sequence encoding growth
and
differentiation factor-8 which polynucleotide sequence is also from a
domesticated
animal selected from the group consisting of ovine, bovine, porcine, piscine
and avian.
The present invention includes methods for increasing the muscle and/or bone
mass in
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-39-
domesticated animals characterized by administering to a domesticated animal
monoclonal antibodies directed to the GDF-8 polypeptide. The antibody may be
an anti-
GDF-8, and may be either a monoclonal antibody or a polyclonal antibody.
The invention includes methods comprising using an anti-GDF-8 monoclonal
antibody,
antisense, or dominant negative mutants as a therapeutic agent to inhibit the
growth
regulating actions of GDF-8 on muscle and bone cells. Muscle and bone cells
are
defined to include fetal or adult muscle cells, as well as progenitor cells
which are
capable of differentiation into muscle or bone. The monoclonal antibody may be
a
humanized (e.g., either fully or a chimeric) monoclonal antibody, of any
species origin,
such as marine, ovine, bovine, porcine or avian. Methods of producing antibody
molecules with various combinations of "humanized" antibodies are well known
in the
art and include combining marine variable regions with human constant regions
(Cabily,
et al. Proc.Natl.Acad.Sci. USA, 81:3273, 1984), or by grafting the marine-
antibody
complementary determining regions (CDRs) onto the human framework (Richmann,
et
1 S al., Nature 332:323, 1988). Other general references which teach methods
for creating
humanized antibodies include Morrison, et al., Science, 229:1202, 1985; Jones,
et al.,
Nature, 321:522,1986; Monroe, et al., Nature 312:779, 1985; Oi, et al.,
BioTechniques,
4:214,1986; European Patent Application No. 302,620; and U.S. Patent No.
5,024,834.
Therefore, by humanizing the monoclonal antibodies of the invention for in
vivo use, an
immune response to the antibodies would be greatly reduced.
The monoclonal antibody, GDF-8 polypeptide, or GDF-8 polynucleotide (all "GDF-
8
agents") may have the effect of increasing the development of skeletal muscles
and
bones, such as ribs. In preferred embodiments of the claimed methods, the GDF-
8
monoclonal antibody, polypeptide, or polynucleotide is administered to a
patient
suffering from a disorder selected from the group consisting of muscle wasting
disease,
neuromuscular disorder, muscle atrophy, bone degenerative diseases,
osteoporosis, renal
disease or aging. The GDF-8 agent may also be administered to a patient
suffering from
a disorder selected from the group consisting of muscular dystrophy, spinal
cord injury,
traumatic injury, congestive obstructive pulmonary disease (COPD), AIDS or
cachechia.
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-40-
In a preferred embodiment, the GDF-8 agent is administered to a patient
suffereing from
any of these diseases by intravenous, intramuscular or subcutaneous injection;
preferably,
a monoclonal antibody is administered within a dose range between about 0.1
mg/kg to
about 100 mg/kg; more preferably between about 1 ug/kg to 75 mg/kg; most
preferably
S from about 10 mg/kg to 50 mg/kg. The antibody may be administered, for
example, by
bolus injunction or by slow infusion. Slow infusion over a period of 30
minutes to 2
hours is preferred. The GDF-8 agent may be formulated in a formulation
suitable for
administration to a patient. Such formulations are known in the art.
The dosage regimen will be determined by the attending physician considering
various
factors which modify the action of the GDF-8 protein, e.g. amount of tissue
desired to
be formed, the site of tissue damage, the condition of the damaged tissue, the
size of a
wound, type of damaged tissue, the patient's age, sex, and diet, the severity
of any
infection, time of administration and other clinical factors. The dosage may
vary with
the type of matrix used in the reconstitution and the types of agent, such as
anti-GDF-8
antibodies, to be used in the composition. Generally, systemic or injectable
administra-
tion, such as intravenous (IV), intramuscular (IIVI~ or subcutaneous (Sub-Q)
injection.
Administration will generally be initiated at a dose which is minimally
effective, and the
dose will be increased over a preselected time course until a positive effect
is observed.
Subsequently, incremental increases in dosage will be made limiting such
incremental
increases to such levels that produce a corresponding increase in effect,
while taking into
account any adverse affects that may appear. The addition of other known
growth
factors, such as IGF I (insulin like growth factor I), human, bovine, or
chicken growth
hormone which may aid in increasing muscle and bone mass, to the final
composition,
may also affect the dosage. In the embodiment where an anti-GDF-8 antibody is
administered, the anti-GDF-8 antibody is generally administered within a dose
range of
about 0.1 ug/kg to about 100 mg/kg.; more preferably between about 10 mg/kg to
50
mg/kg.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-41-
Progress can be monitored by periodic assessment of tissue growth and/or
repair. The
progress can be monitored, for example, x-rays, histomorphometric
determinations and
tetracycline labeling.
Screening for GDF-8 Modulatine Compounds
In another embodiment, the invention provides a method for identifying a
compound or
molecule that modulates GDF-8 protein activity yr gene expression. The method
includes incubating components comprising the compound, GDF-8 polypeptide or
with
a recombinant cell expressing GDF-8 polypeptide, under conditions sufficient
to allow
the components to interact and determining the effect of the compound on GDF-8
activity or expression. The effect of the compound on GDF-8 activity can be
measured
by a number of assays, and may include measurements before and after
incubating in the
presence of the compound. Compounds that affect GDF-8 activity or gene
expression
include peptides, peptidomimetics, polypeptides, chemical compounds and
biologic
agents. Assays include Northern blot analysis of GDF-8 mRNA (for gene
expression),
Western blot analysis (for protein level) and muscle fiber analysis {for
protein activity).
The above screening assays may be used for detecting the compounds or
molecules that
bind to the GDF-8 receptor or GDF-8 polypeptide, in isolating molecules that
bind to the
GDF-8 gene, for measuring the amount of GDF-8 in a sample, either polypeptide
or RNA
(mRNA), for identifying molecules that may act as agonists or antagonists, and
the like.
For example, GDF-8 antagonists are useful for treatment of muscular and
adipose tissue
disorders (e.g., obesity).
Incubating includes conditions which allow contact between the test compound
and
GDF-8 polypeptide or with a recombinant cell expressing GDF-8 polypeptide.
Contacting includes in solution and in solid phase, or in a cell. The test
compound may
optionally be a combinatorial library for screening a plurality of compounds.
Com-
pounds identified in the method of the invention can be further evaluated,
detected,
cloned, sequenced, and the like, either in solution or after binding to a
solid support, by
any method usually applied to the detection of a specific DNA sequence such as
PCR,
CA 02319703 2002-05-14
-42-
oligomer nstridion (Saiki, et al., BiuITecimolagy, x:1008-1012, 1985),
allele~pecific
oligonucleotida (ASO) probe aaelysis (Corner, et al., 'roc. Natl. Aced Sci.
USA,
$Q2?8,1983 oligonuGleotide Landegren, et al., Science, x:1077,1988), and the
like.
Mol~ tochniqucs for DNA am~lysis have boon reviewed. (i.aadegra~, et a~,
~'cierxe,
x:229-237,1988).
The followicg examples ere iatcnd~ to illu~shate but not limit the inveMioa.
While they
are typical of those that might be used, other procedures known to those
skilled in the art
may alteFnati~ly be used.
~e:~ ~:>-
IDFNTIFICATIflN AND ISOLATION OF A NOyEL
TGF-B FAMILY MEM1~ER
To ide~if~r a new member of the TGF-(3 super~mily, deg~ate oligonucleotides
were
designed which corresponded to two conserved regions among the known family
members: one region ~nnmg the two tryptdphan residues conserved in all family
members except MIS end the other region spanning the im~iant cysteine residues
near
the C-terminus. These primers was us«1 for polymerase chain reactions on mouse
genomic DNA followed by subcloning the PCR products usiag restriction sites
placed
at the 5' ends of the primers, piclun~ individual E. coli colonies canying
these subcloned
inserts, and using a combination of ranc~nn sequencing and hybridization
analysis to
eliminate known members of the superfamily.
GDF-8 was identified from a mixture of PCR products obtained with the primers
SJL141: 5'-CCGGAATTCGGTTGiG(GLCIA~r(G/Aff/CxA/G)A(TlC)TGG(A!G)Ti
(A/G)TI(TIG~ICC-3' (SF.Q ID NO:1 )
SJL147:
5'-CCGGAATTC(G/A)CAI(GIC~(GIA~A(Ci/A)CT(GIA/T/C)
TCIACI(G/AX'f/C)CAT-3' (SFrQ ID N0:2)
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
- 43 -
PCR using these primers was carried out with 2 ~.g mouse genomic DNA at
94°C for 1
min, 50°C for 2 min, and 72°C for 2 min for 40 cycles.
PCR products of approximately 280 by were gel-purified, digested with Eco Rl,
gel-purified again, and subcloned in the Bluescript vector (Stratagene, San
Diego, CA).
Bacterial colonies carrying individual subclones were picked into 96 well
microtiter
plates, and multiple replicas were prepared by plating the cells onto
nitrocellulose. The
replicate filters were hybridized to probes representing known members of the
family,
and DNA was prepared from nonhybridizing colonies for sequence analysis.
The primer combination of SJL141 and SJL147, encoding the amino acid sequences
GW(H/Q/N/K/D/E)(D/N)W(V/I/N~(V/I/M)(A/S)P (SEQ ID N0:9) and
M(V/1/MfT/A)V(D/E)SC(G/A)C (SEQ 1D NO:10), respectively, yielded four
previously
identified sequences (BMP-4, inhibin,~iB, GDF-3 and GDF-5) and one novel
sequence,
which was designated GDF-8, among 110 subclones analyzed.
Human GDF-8 was isolated using the primers:
ACM13: 5'-CGCGGATCCAGAGTCAAGGTGACAGACACAC-3' (SEQ ID N0:3); and
ACM14: 5'-CGCGGATCCTCCTCATGAGCACCCACAGCGGTC-3' (SEQ IT? N0:4)
PCR using these primers was carried out with one ~.g human genomic DNA at 94
°C for
1 min, 58°C fort min, and 72°C for 2 min for 30 cycles. The PCR
product was digested
with Bam Hl, gel-purified, and subcloned in the Bluescript vector (Stratagene,
San
Francisco, CA).
EXAMPLE 2
EXPRESSION PATTERN AND SE UENCE OF GDF-8
To determine the expression pattern of GDF-8, RNA samples prepared from a
variety of
adult tissues were screened by Northern analysis. RNA isolation and Northern
analysis
were carned out as described previously (Lee, S.J., Mol. Endocrinol., 4:1034,
1990)
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
except that hybridization was carried out in SX SSPE, 10% dextran sulfate, 50%
formamide, l % SDS, 200 ~g/ml salmon DNA, and 0.1 % each of bovine serum
albumin,
ficoll, and polyvinylpyrrolidone. Five micrograms of twice poly A-selected RNA
prepared from each tissue (except for muscle, for which only 2 pg RNA was
used) were
electrophoresed on formaldehyde gels, blotted, and probed with GDF-8. As shown
in
FIGURE 1, the GDF-8 probe detected a single mRNA species expressed at highest
levels
in muscle and at significantly lower levels in adipose tissue.
To obtain a larger segment of the GDF-8 gene, a mouse genomic library was
screened
with a probe derived from the GDF-8 PCR product. The partial sequence of a GDF-
8
genomic clone is shown in FIGURE 2a. The sequence contains an open reading
frame
corresponding to the predicted C-terminal region of the GDF-8 precursor
protein. The
predicted GDF-8 sequence contains two potential proteolytic processing sites,
which are
boxed. Cleavage of the precursor at the second of these sites would generate a
mature C
terminal fragment 109 amino acids in length with a predicted molecular weight
of
12,400. The partial sequence of human GDF-8 is shown in FIGURE 2b. Assuming no
PCR-induced errors during the isolation of the human clone, the human and
mouse amino
acid sequences in this region are 100% identical.
The C-terminal region of GDF-8 following the putative proteolytic processing
site shows
significant homology to the known members of the TGF-(3; superfamily {FIGURE
3).
FIGURE 3 shows the alignment of the C-terminal sequences of GDF-8 with the
corresponding regions of human GDF-1 (L.ee, Proc. Natl. Acad. Sci. USA,
88:4250-4254,
1991), human BMP-2 and 4 {Wozney, et al., Science, 242:1528-1534, 1988), human
Vgr-1 {Celeste, et al. Proc. Nat1 Acad. Sci. USA, 87:9843-9847, 1990), human
OP-1
(Ozkaynak, et al., EMBO J., 9_:2085-2093, 1990), human BMP-5 (Celeste, et al.,
Proc.
Natl. Acad. Sci. USA, 87:9843-9847, 1990), human BMP-3 (Wozney, et al.,
Science,
242:1528-1534, 1988), human MiS (Cate, et al. Cell, 45:685-698,1986), human
inhibin
alpha, ~iA, and ~3B (Mason, et al., Biochem, Biophys. Res. Commun., 135:957-
964, 1986),
human TGF-(31 (Derynck, et al., Nature, 316:701 -705, 1985), humanTGF-R2
(deMartin,
et al., EMBO J., 6:3673-3677, 1987), and human TGF-(33 (ten Dijke, et al.,
Proc. Natl.
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-45-
Acad. Sci. USA, 85:4715-4719, 1988). The conserved cysteine residues are
boxed.
Dashes denote gaps introduced in order to maximize the alignment.
GDF-8 contains most of the residues that are highly conserved in other family
members,
including the seven cysteine residues with their characteristic spacing. Like
the TGF-his
and inhibin his, GDF-8 also contains two additional cysteine residues. In the
case of
TGF-(32, these two additional cysteine residues are known to form an
intramolecular
disulfide bond (Daopin, et al., Science, 257:369, 1992; Schlunegger and
Grutter, Nature,
358:430, 1992).
FIGURE 4 shows the amino acid homologies among the different members of the
TGF-~3
superfamily. Numbers represent percent amino acid identities between each pair
calculated from the first conserved cysteine to the C terminus. Boxes
represent
homologies among highly-related members within particular subgroups. In this
region,
GDF-8 is most homologous to Vgr-1 (45% sequence identity).
EXAMPLE 3
ISOLATION OF cDNA CLONES ENCODING MURINE AND HUMAN GDF-8
In order to isolate full-length cDNA clones encoding marine and human GDF-8,
cDNA
libraries were prepared in the lambda ZAP II vector (Stratagene) using RNA
prepared
from skeletal muscle. From 5 ~Cg of twice poly A-selected RNA prepared from
marine
and human muscle, cDNA libraries consisting of 4.4 million and 1.9 million
recombinant
phage, respectively, were constructed according to the instructions provided
by
Stratagene. These libraries were screened without amplification. Library
screening and
characterization of cDNA inserts were carried out as described previously
(Lee, Mol.
Endocrinol., 4:1034-1040).
From 2.4 x 106 recombinant phage screened from the marine muscle cDNA library,
greater than 280 positive phage were identified using a marine GDF-8 probe
derived
finm a genomic clone, as described in Example 1. The entire nucleotide
sequence of the
CA 02319703 2001-02-05
-46-
longest cDNA insert analyzed is shown in FIGURE Sa and Sb and SEQ ID NO:l 1.
The
2676 base pair sequence contains a single long open reading frame beginning
with a
methionine codon at nucleotide 104 and extending to a TGA stop codon at
nucleotide
1232. Upstream of the putative initiating methionine codon is an in-frame stop
codon at
nucleotide 23. The predicted pre-pro-GDF-8 protein is 76 amino acids in
length. The
sequence contains a core of hydrophobic amino acids at the N-terminus
suggestive of a
signal peptide for secretion (FIGURE 6a), one potential N-glycosylation site
at
asparagine 72, a putative RXXR (SEQ ID NO. 50) proteolytic cleavage site at
amino acids 264-
267, and a C-terminal region showing significant homology to the known members
of the TGF-(3
superfamily. Cleavage of the precursor protein at the putative RXXR (SEQ ID
NO. 50) site
would generate a mature C-terminal GDF-8 fragment 109 amino acids in length
with a predicted
molecular weight of approximately 12,400.
From 1.9 x 106 recombinant phage screened from the human muscle cDNA library,
4
positive phage were identified using a human GDF-8 probe derived by polymerise
chain
reaction on human genomic DNA. The entire nucleotide sequence of the longest
cDNA
insert is shown in FIGURE Sc and 5d and SEQ ID N0:13. The 2743 base pair
sequence
contains a single long open reading frame beginning with a methionine codon at
nucleotide 59 and extending to a TGA stop codon at nucleotide 1184. The
predicted
pre-pro-GDF-8 protein is 375 amino acids in length. T'he sequence contains a
core of
hydrophobic amino acids at the N-terminus suggestive of a signal peptide for
secretion
(FIGURE 6b), one potential N-glycosylation site at asparagine 71, anda
putative RXXR (SEQ ID
NO: 50) proteolytic cleavage site at amino acids 263-266. FIGURE 7 shows a
comparison of the
predicted murine (top)and human (bottom) GDF-8 amino acid sequences. Numbers
indicate
amino acid position relative to the N-terminus. Identities between the two
sequences are denoted
by a vertical line. Murine and human GDF-8 are approximately 94% identical in
the predicted pro-
regions and 100% identical following the predicted RXXR (SEQ ID NO: 50)
cleavage sites.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-47-
EXAMPLE 4
DIMERIZATION OF GDF-8
To determine whether the processing signals in the GDF-8 sequence are
functional and
whether GDF-8 forms dimers like other members of the TGF-13 superfamily, the
GDF-8
cDNA was stably expressed in CHO cells. The GDF-8 coding sequence was cloned
into
the pMSXND expression vector (Lee and Nathans, J. Biol. Chem., 263:3521,(1988)
and
transfected into CHO cells. Following 6418 selection, the cells were selected
in 0.2 ,uM
methotrexate, and conditioned medium from resistant cells was concentrated and
electrophoresed on SDS gels. Conditioned medium was prepared by Cell Trends,
Inc.
(Middletown, MD). For preparation of anti-GDF-8 serum, the C-terminal region
of
GDF-8 (amino acids 268 to 376) was expressed in bacteria using the RSET vector
(Invitrogen, San Diego, CA), purified using a pickle chelate column, and
injected into
rabbits. All immunizations were carried out by Spring Valley Labs (Woodbine,
MD).
Western analysis using ['ZSI]iodoprotein A was carried out as described
(Burnette, W.N.,
Anal. Biochem.,112:195,1981). Western analysis of conditioned medium prepared
from
these cells using an antiserum raised against a bacterially-expressed C-
terminal fragment
of GDF-8 detected two protein species with apparent molecular weights of
approximately
52K and 15K under reducing conditions, consistent with unprocessed and
processed
forms of GDF-8, respectively. No bands were obtained either with preimmune
serum or
with conditioned medium from CHO cells transfected with an antisense
construct. Under
non-reducing conditions, the GDF-8 antiserum detected two predominant protein
species
with apparent molecular weights of approximately 101 K and 25K, consistent
with
dimeric forms of unprocessed and processed GDF-8, respectively. Hence, like
other
TGF-B family members, GDF-8 appears to be secreted and proteolytically
processed, and
the C-terminal region appears to be capable of forming a disulfide-linked
dimer.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-48-
EXAMPLE 5
PREPARATION OF ANTIBODIES AGAINST GDF-8 AND
EXPRESSION OF GDF-8 IN MAMMALIAN CELLS
In order to prepare antibodies against GDF-8, GDF-8 antigen was expressed as a
fusion
S protein in bacteria. A portion of marine GDF-8 cDNA spanning amino acids 268-
376
(mature region) was inserted into the pRSET vector (Invitrogen) such that the
GDF-8
coding sequence was placed in frame with the initiating methionine codon
present in the
vector; the resulting construct created an open reading frame encoding a
fusion protein
with a molecular weight of approximately 16,600. The fusion construct was
transformed
into BL21 (DE3) (pLysS} cells, and expression of the fusion protein was
induced by
treatment with isopropylthio-(3-galactoside as described (Rosenberg, et al.,
Gene,
56:125-135). The fusion protein was then purified by metal chelate
chromatography
according to the instructions provided by Invitrogen. A Coomassie blue-stained
geI of
unpurified and purified fusion proteins is shown in FIGURE 8.
The purified fusion protein was used to immunize both rabbits and chickens.
Immuniza-
tion of rabbits was carried out by Spring Valley Labs (Sykesville, MD), and
immuniza-
tion of chickens was carned out by HRP, Inc. (Denver, PA). Western analysis of
sera
both from immunized rabbits and from immunized chickens demonstrated the
presence
of antibodies directed against the fusion protein.
To express GDF-8 in mammalian cells, the marine GDF-8 cDNA sequence from
nucleotides 48-1303 was cloned in both orientations downstream of the
metallothionein
I promoter in the pMSXND expression vector; this vector contains processing
signals
derived from SV40, a dihydrofolate reductase gene, and a gene conferring
resistance to
the antibiotic 6418 (Lee and Nathans, J. Biol. Chem., 263:3521-3527). The
resulting
constructs were transfected into Chinese hamster ovary cells, and stable
tranfectants were
selected in the presence of 6418. Two milliliters of conditioned media
prepared from the
6418-resistant cells were dialyzed, lyophilized, electrophoresed under
denaturing,
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-49-
reducing conditions, transferred to nitrocellulose, and incubated with anti-
GDF-8
antibodies (described above) and ['ZSl]iodoproteinA.
As shown in FIGURE 9, the rabbit GDF-8 antibodies (at a 1:500 dilution)
detected a
protein of approximately the predicted molecular weight for the mature C-
terminal
fragment of GDF-8 in the conditioned media of cells transfected with a
construct in
which GDF-8 had been cloned in the correct (sense) orientation with respect to
the
metallothionein promoter (lane 2); this band was not detected in a similar
sample
prepared from cells transfected with a control antisense construct (lane 1 ).
Similar results
were obtained using antibodies prepared in chickens. Hence, GDF-8 is secreted
and
proteolytically processed by these transfected mammalian cells.
EXAMPLE 6
EXPRESSION PATTERN OF GDF-8
To determine the pattern of GDF-8, 5 ~,g of twice poly A-selected RNA prepared
from
a variety of marine tissue sources were subjected to Northern analysis. As
shown in
FIGURE 10a (and as shown previously in Example 2), the GDF-8 probe detected a
single
mRNA species present almost exclusively in skeletal muscle among a large
number of
adult tissues surveyed. On longer exposures of the same blot, significantly
lower but
detectable levels of GDF-8 mRNA were seen in fat, brain, thymus, heart, and
lung.
Hence, these results confirm the high degree of specificity of GDF-8
expression in
skeletal muscle. GDF-8 mRNA was also detected in mouse embryos at both
gestational
ages (day 12.5 and day 18.5 post-coital) examined but not in placentas at
various stages
of development (FIGURE l Ob).
To further analyze the expression pattern of GDF-8, in situ hybridization was
performed
on mouse embryos isolated at various stages of development.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
- 50 -
For all in situ hybridization experiments, probes corresponding to the C-
terminal region
of GDF-8 were excluded in order to avoid possible cross-reactivity with other
members
of the superfamily. Whole mount in situ hybridization analysis was carried out
as
described (Wilkinson, D.G., In Situ Hybridization, A Practical Approach, pp.
75-83,
IRL. Press, Oxford, 1992) except that blocking and antibody incubation steps
were
carried out as in Knecht et al. (Knecht, et al., Development, 121:1927, 1955).
Alkaline
phosphatase reactions were carried out for 3 hours for day 10.5 embryos and
overnight
for day 9.5 embryos. Hybridization was carried out using digoxigenin-labelled
probes
spanning nucleotides 8-811 and 1298-2676, which correspond to the pro-region
and 3'
untranslated regions, respectively. In situ hybridization to sections was
carried out as
described (Wilkinson, et al., Cell, 50:79, 1987) using 'SS-labelled probes
ranging from
approximately 100-650 bases in length and spanning nucleotides 8-793 and 1566-
2595.
Following hybridization and washing, slides were dipped in NTB-3 photographic
emulsion, exposed for 16-19 days, developed and stained with either
hematoxylin and
eosin or toluidine blue. RNA isolation, poly A selection, and Northern
analysis were
carried out as described previously (McPherron and Lee, J. Biol. Chem.,
268:3444,
1993).
At all stages examined, the expression of GDF-8 mRNA appeared to be restricted
to
developing skeletal muscle. At early stages, GDF-8 expression was restricted
to
developing somites. By whole mount in situ hybridization analysis, GDF-8 mRNA
could
first be detected as early as day 9.5 post coitum in approximately one-third
of the
somites. At this stage of development, hybridization appeared to be restricted
to the most
mature (9 out of 21 in this example), rostral somites. By day 10.5 p.c., GDF-8
expression was clearly evident in almost every somite (28 out of 33 in this
example
shown). Based on in situ hybridization analysis of sections prepared from day
10.5 p.c.
embryos, the expression of GDF-8 in somites appeared to be localized to the
myotome
compartment. At later stages of development, GDF-8 expression was detected in
a wide
range of developing muscles.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
- S1 -
GDF-8 continues to be expressed in adult animals as well. By Northern
analysis, GDF-8
mRNA expression was seen almost exclusively in skeletal muscle among the
different
adult tissues examined. A significantly lower though clearly detectable signal
was also
seen in adipose tissue. Based on Northern analysis of RNA prepared fi~om a
large
S number of different adult skeletal muscles, GDF-8 expression appeared to be
widespread
although the expression levels varied among individual muscles.
EXAMPLE 7
CHROMOSOMAL LOCALIZATION OF GDF-8
In order to map the chromosomal location of GDF-8, DNA samples from
human/rodent
IO somatic cell hybrids (Drwinga, et al., Ge~omics, 16:311-413, 1993; Dubois
and Naylor,
Genomics, 16:315-319, 1993) were analyzed by polymerase chain reaction
followed by
Southern blotting. Polymerase chain reaction was carried out using primer #83,
5'-C-
GCGGATCCGTGGATCTAAATGAGAACAGTGAGC-3' (SEQ ID NO: 15) and primer
#84, S'-CGCGAATTCTCAGGTAATGATTGTITCCGTTGTAGCG-3'(SEQ ID N0:16)
15 for 40 cycles at 94 ° C for 2 minutes, 60 ° C for 1 minute,
and 72 ° C for 2 minutes. These
primers correspond to nucleotides 119 to 143 (flanked by a Bam H1 recognition
sequence), and nucleotides 394 to 418 (flanked by an Eco Rl recognition
sequence),
respectively, in the human GDF-8 cDNA sequence. PCR products were
electrophoresed
on agarose gels, blotted, and probed with oligonucleotide #100,
20 5'-ACACTAAATCTTCAAGAATA-3' (SEQ ID N0:17), which corresponds to a
sequence internal to the region flanked by primer #83 and #84. Filters were
hybridized
in 6 X SSC, 1 X Denhardt's solution; 100p,g/ml yeast transfer RNA, and 0.05%
sodium
pyrophosphate at 50°C.
As shown in FIGURE 11, the human-specific probe detected a band of the
predicted size
25 (approximately 320 base pairs) in the positive control sample (total human
genomic
DNA) and in a single DNA sample from the human/rodent hybrid panel. This
positive
signal corresponds to human chromosome 2. The human chromosome contained in
each
of the hybrid cell lines is identified at the top of each of the first 24
lanes (1-22, X, and
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/OZ511
-52-
Y). In the lanes designated M, CHO, and H, the starting DNA template was total
genomic DNA from mouse, hamster, and human sources, respectively. In the lane
marked B1, no template DNA was used. Numbers at left indicate the mobilities
of DNA
standards. These data show that the human GDF-8 gene is located on chromosome
2.
EXAMPLE 8
GDF-8 TRANSGENIC KNOCKOUT MICE
The GDF-8, we disrupted the GDF-8 gene was disrupted by homologous targeting
in
embryonic stem cells. To ensure that the resulting mice would be null for GDF-
8
function, the entire mature C-terminal region was deleted and replaced by a
neo cassette
(Figure 12a). A marine 129 SV/J genomic library was prepared in lambda FIX II
according to the instructions provided by Stratagene (La Jolla, CA). The
structure of the
GDF-8 gene was deduced from restriction mapping and partial sequencing of
phage
clones isolated from this library. Vectors for preparing the targeting
construct were
kindly provided by Philip Soriano and Kirk Thomas University. Rl ES cells were
trans-
fected with the targeting construct, selected with gancyclovir (2 ,uM) and
6418 (250
,ug/ml), and analyzed by Southern analysis. Homologously targeted clones were
injected
into C57BL/6 blastocysts and transferred into pseudopregnant females. Germline
transmission of the targeted allele was obtained in a total of 9 male chimeras
from 5
independently-derived ES clones. Genomic Southern blots were hybridized at
42°C as
described above and washed in 0.2X SSC, 0.1% SDS at 42°C.
For whole leg analysis, legs of 14 week old mice were skinned, treated with
0.2 M EDTA
in PBS at 4°C for 4 weeks followed by 0.5 M sucrose in PBS at
4°C. For fiber number
and size analysis, samples were directly mounted and frozen in isopentane as
described
(Brumback and Leech, Color Atlas of Muscle Histochemistry, pp. 9-33, PSG
Publishing
Company, Littleton, MA, 1984). Ten to 30 ,um sections were prepared using a
cryostat
and stained with hematoxylin and eosin. Muscle fiber numbers were determined
from
sections taken from the widest part of the tibialis cranialis muscle. Muscle
fiber sizes
were measured from photographs of sections of tibialis cranialis and
gastrocnemius
muscles. Fiber type analysis was carned out using the mysosin ATPase assay
after
CA 02319703 2002-05-14
- 53 -
anent at pH 435 as descaibed (Cud et af, Color Atlas of l~~rscls Pathology,
Pp~ 184-185, 1994) and by inzmunohiatochemistry using an antibody ~irectod
against
type I myosin (MY32, Sigma) and the Vaxasfain methpd {Vector Labs); in the
immunohistochemical o~tpairnrnte, no was seen when t~ paimm~y mm'bodies
were IeR out. Carcasses was from shavod mice by removing tire ali of the
internal. pagans and as~oc~ed fat aid oo~tiv~ tisane. Fat oontmt of amcasses
from
4 month old males was determined as described (heshner, et al., Phys~ol.
Bei~avior,
x:281,1972).
For pmteia and DNA analysis, tisane was homo~iud in 150 mM NaCI, 100 mM
EDTA. Protein concentrations were detmmined using the Biorad protein assay.
DNA
was iOd by adding SDS to 1'y4, tt~e~ng with 1 mg/ml pmt~asa K overni~t at
55°C, extracting 3 times with phenol and twice with chlomform, and
pnecipitstin8 with
ammonium acetate and EtOH. DNA was digesbod with 2 mg~ml lZNase for 1 hour at
37°C, and following ptnteinase K d<gesbon and phenol and chloroform a~
the
DNA was precipitated twice with ammonium able and BtOH.
Homologous targeting of he CIDF-8 gene wan seen in 131131 gancyclovir/G418
doubly-resistant FS cell clones. Following irtjoction of these targ~ clones
into
blestocys<s, we obfaimd ~r~eras fiom S independently-derived ES clorrrs that
produced
heterozygous peps when cro~od t~ C57BLl6 acs ~gw~e 12b). Genotypic analysis
of fi78 o~sporing derived finrn of FI hues showed i 70 +I+ (2~%~ 380
+I (56%~ arid 128 -I (199~e). A.hho>~h the ratio of g~types was clox t~0 !he
expected
ratio of I :2:1, the smaller than expected number of homozygous mutants
appeared to be
statistically significant (p<0.001).
Homozygous mutants were viable and futile wi>ar cx~ed to C57BL6 mice and to
each
other Ha~ygous mubmt eniaaats, however, were app~Cimately 34% lager than their
_ heterozygous and wild type littarmates. Zhe did bav~roen mutant and
wild type body weights appeared to be relatively constant irrespective of age
and sex in
adult aniaaals. Adult mutants also displayed an abtronrral body shape, with
pronounced
CA 02319703 2002-05-14
-54-
shoulders and hips. When the skin was removed fibm animals that had been
sacrificed,
it was appamnt >hst the muscles of the mutants were much larger than those of
wild type
aninnals. The increase in skeletal muscle mass appeared to be widespa~ad
thsuughourt the
body. Individual muscles isolated from homozygous mutant animals weighed
approximately 2-3 times more than those isolated from wild type IitGormates.
Although the magnitude of the weight izxrease appearmd to roughly cor<elate
with the
level of GDF-8 atp~on in the muscles examined. To determine whether the
incr~ed
muscle mass could account for the entire difference in total body weights
between wild
typo and mutant animals or yether many tissues were generally larger in the
mutants,
we compa:ed the total body weights to cmr~s weights. The
diff~ce in carcass weights between wild type and mutant animals was comparable
to
the difference in total body weights. Moreover, because the fat content of
mutant and
wild type animals was similar; these data are consistent with all of the total
body vvaght
diffe~x resulting from en incmase in skeletal muscle mass, although wo have
not
formally ruled out the possibility that differences in bone mass might also
contribuf~e to
the differences in total body mass.
To determine whether the increase in skeletal muscle mass resulted from
hypaplas>a or
from hypertrophy, histologic analysis of several different muscle groups was
perfonaed.
The mutant muscle appe~ed grmsly normal. No excess connecrave risers; or fat
was seen
nor were'there auy obvious signs of degeon, such as widely varying fiber sues
(see
below) or centrally-placed nuclei. Quantitation of the number of muscle fibers
showed
that at the widest parson of the tibialis cranialis muscle, tlur total cell
number was 86°/.
higher in mutant animals compared to wild type littemoetes [mutant = 5470 +l-
121 (n
= 3), wild type = 2936 +/- 288 (n = 3); p < 0.01]. Consistent with this result
was the
finding that the amount of DNA extracted from mutant muscle was mughly 50'Y.
higher
than from wild type muscle [mutant ~ 350 peg (n = 4), wild type = 233 ,ug (n =
3) from
pooled gastmcx~emius, plantaris, triceps brachii, ti'bialis cranialis, and
peetoralis muscles;
p = 0.05]. Hence, a large part of the incaease in skeletal muscle mass
resulted from
muscle cell hyperplasia. However, muscle $ber hypertrophy also appeared to
contribute
to the overall increase in muscle mass. As shown in Figure 13, the mean fiber
diameter
CA 02319703 2002-05-14
-55-
of the tibialis cn3nialis muscle and gastrocnemius muscle was 7% and 22%
larger,
respectively, in mutant animals cod to wild typo lid, suggesting that the
cmssrsectional area of the fibers was increased by approximately 14'/o and
49'/0,
respectively. Notably, although the mean fiber diam~r was larger in the
mutants, the
standard deviation in fiber sizes was similar between mutant and wild type
muscle,
consistent with the ai~nce of muscle degeneration in mutant animals. The
increase in
fiber size was also consistent with the finding that the protein to DNA ratio
(w/w) was
slightly increased in mutant compared to wild type muscle [mutant = 871 +/ 111
(n =
4), wild type = 624 +l- 85 (n ~ 3); p ~ 0.05).
In a comparison between muscle weight (in grams) from wild-type (+/+),
heterozyous
(+/-) and an homozygous knock-out mice (-/-), it has been demonstrated that
the
muscle mass is increased in heterozyous as compared to wild-type animals.
Finally, fiber type analysis of various muscles was cairiod out to determine
the
number of both type I (slow) and type II (fast) frbexs was increased in the
mutant
animals. In most of the muscles examined, including the tibialis cxaaislis
muscle, the
vast majority of muscle fibers were type II in both mutant and wild type
animals. hence,
based on the cell counts discussed above, the absolute number of type Ii
fibers were
used in the tibialis cranialis muscle. In the coleus muscle, where the number
of type
I fibers was su~ciently high that we could attempt to quantitate the ratio of
fiber types
could be quantiatad, the percent of type 1 fibers was decreased by
approximately 33% in .
mutant compered to wild type muscle [wild type = 39.2 +/ 8.1 (n = 3), mutant =
26.4 +/-
9.3 (n = 4)J; however, the variability in this ratio for both wild type and
mutant animals
was too high to support any firm conclusions regarding the relative number of
fiber
CA 02319703 2001-02-05
-56
EXAMPLE 9
ISOLATION OF RAT AND CHICKEN GDF-8
In order to isolate rat and chicken GDF-8 cDNA clones, skeletal muscle cDNA
libraries
prepared from these species were obtained from Stratagene and screened with a
marine
GDF-8 probe. Library screening was carried out as described previously (Lee,
Mol.
Endocrinol., 4:1034-1040) except that final washes were carried out in 2 X SSC
at 65 ° C.
Partial sequence analysis of hybridizing clones revealed the presence of open
reading
frames highly related to marine and human GDF-8. Partial sequences of rat and
chicken
GDF-8 are shown in Figures 2c and 2d, respectively, and an alignment of the
predicated
rat and chicken GDF-8 amino acid sequences with those of marine and human GDF-
8
are shown in Figure 3b. Full length rat and chicken GDF-8 is shown in Figures
14d and
14c, respectively and sequence alignment between marine, rat, human, baboon,
porcine,
ovine, bovine, chicken, and turkey sequences is shown in Figures 15a and 15b.
All
sequences contain an RSRR (SEQ ID NO: 51) sequence that is likely to represent
the
proteolytic processing site. Following this RSRR (SEQ ID NO: 51) sequence, the
sequences
contain a C-terminal region that is 100% conserved among all four species. The
absolute
conservation of the C-terminal region between species as evolutionary far
apart as humans and
chickens, and baboons and turkeys, suggests that this region will be highly
conserved in many
other species as well.
Similar methodology was used to obtain the nucleotide and amino acid sequences
for
baboon (SEQ ID N0:18 and 19, respectively; Figure 14a); bovine (SEQ ID N0:20
and
21, respectively; Figure 14b); turkey (SEQ ID N0:26 and 27, respectively;
Figure 14e);
porcine (SEQ ID N0:28 and 29, respectively; Figure 14f); and ovine (SEQ ID
N0:30
and 31, respectively; Figure 14g).
CA 02319703 2002-05-14
-57-
The overall homology between GDF-I 1 and GDF-8 based upon their rapxtive amino
acid sequence is approximately 9286 (see for example WO 96/01845). Thus, it is
expected that animals expressing GDF-8 and GDF-11 will display similar
phenotypes. Similarly, animals having a disruption in a GDF-8 or GDF-11 gene
will
display similar phenotypes. The relationship of GDF-8 to GDF-11 will be
farther
understood in light of the following examples, in which GDF-11 knoekout~mice
were
created.
Lake most other TGF-~i family member, QDF-11 also appears to be highly
conserved
across species. By genomic Southern analysis, homologous sequences were
detected in
all mammalian species exaaiiaed as well as in chickens and fings (Figure I6).
In most
species, the GDF-I 1 probe also detected a second, more faintly hybridizing
fragment
corresponding to the myostatin gene (McPherron et al., Nature 387:83-90,
1997).
GDS'-11 ICNO('KOUT MICE
To detecnoine the biological function of GDF-I 1, we disrupted the GDF-I 1
gene by
homologous tar~ting in embryonic stem cells. A marine 129 SVlJ gnomic library
was
prepared in lambda FIX1T according to the instructioas provided by Stratagene
(La Jolla,
CA). The structure of the GDF-11 gene was deducai Erom restriction mapping and
partial sequencing of ghage clones isolated from the library. Vectors for ping
the
targding construct were kindly provided by Philip Soriano and Kirk Thomas. To
ensure
that the resulting mice would be null for GDF-11 function, the entire mature C-
terminal
region was deleted and replaced by a neo cassette (Figure l7ab). Rl ES cells
were
transfer with the targeting cx~nstruct, selected with gancyclovir (2 lttvl)
and 6418 ,(250
pg/ml), and analyzed by Southern analysis. Homologous targeting of the GDF-1 I
gene
was seen in 8/155 gancyclovirlG418 doubly repeat ES cell clones. Following
injection
of several targeted clones into CS7BLJ6J blastocysts, we obtained chimeras
from one ES
clone that produced heterozygous pups when crossed to both C57BL6J and 129/SvJ
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-58-
females. Crosses of C57BL/6J/129/SvJ hybrid F1 heterozygotes produced 49 wild-
type
(34%), 94 heterozygous (66%) and no homozygous mutant adult offspring.
Similarly,
there were no adult homozygous null animals seen in the 129/SvJ background (32
wild-type (36%) and 56 heterozygous mutant (64%) animals).
To determine the age at which homozygous mutants were dying, we genotyped
litters of
embryos isolated at various gestational ages from heterozygous females that
had been
mated to heterozygous males. At all embryonic stages examined, homozygous
mutant
embryos were present at approximately the predicted frequency of 25%. Among
hybrid
newborn mice, the different genotypes were also represented at the expected
Mendelian
ratio of 1:2:1 (34 +/+ (28%), 61 +/- (50%), and 28 -/- (23%)). Homozygous
mutant mice
were born alive and were able to breath and nurse. All homozygous mutants
died,
however, within the first 24 hours after birth. The precise cause of death was
unknown,
but the lethality may have been related to the fact that the kidneys in
homozygous
mutants were either severely hypoplastic or completely absent. A summary of
the
kidney abnormalities in these mice is shown in Figure 18.
EXAMPLE 12
ANATOMICAL DIFFERENCES IN GDF-11 KNOCKOUT MICE
Homozygous mutant animals were easily recognizable by their severely shortened
or
absent tails (Figure 19a). To further characterize the tail defects in these
homozygous
mutant animals, we examined their skeletons to determine the degree of
disruption of the
caudal vertebrae. A comparison of wild-type and mutant skeleton preparations
of late
stage embryos and newborn mice, however, revealed differences not only in the
caudal
region of the animals but in many other regions as well. In nearly every case
where
differences were noted, the abnormalities appeared to represent homeotic
transformations
of vertebral segments in which particular segments appeared to have a
morphology
typical of more anterior segments. These transformations, which are summarized
in
Figure 20, were evident throughout the axial skeleton extending from the
cervical region
to the caudal region. Except for the defects seen in the axial skeleton, the
rest of the
skeleton, such as the cranium and limb bones, appeared normal.
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-59-
Anterior transformations of the vertebrae in mutant newborn animals were most
readily
apparent in the thoracic region, where there was a dramatic increase in the
number of
thoracic (T) segments. All wild-type mice examined showed the typical pattern
of 13
thoracic vertebrae each with its associated pair of ribs (Figure 19(b,e)). In
contrast,
homozygous mutant mice showed a striking increase in the number of thoracic
vertebrae.
All homozygous mutants examined had 4 to 5 extra pairs of ribs for a total of
17 to 18
(Figure 19(d,g)) although in over 1 /3 of these animals, the 18th rib appeared
to be
rudimentary. Hence, segments that would normally correspond to lumbar (L)
segments
L 1 to L4 or LS appeared to have been transformed into thoracic segments in
mutant
animals.
Moreover, transformations within the thoracic region in which one thoracic
vertebra had
a morphology characteristic of another thoracic vertebra were also evident.
For example,
in wild-type mice, the first 7 pairs of ribs attach to the sternum, and the
remaining 6 are
unattached or free (Figure 19(e,h)). In homozygous mutants, there was an
increase in the
number of both attached and free pairs of ribs to 10-11 and 7-8, respectively
(Figure
19(gj)). Therefore, thoracic segments T8, T9, T10, and in some cases even Tl
l, which
all have free ribs in wild-type animals, were transformed in mutant animals to
have a
characteristic typical of more anterior thoracic segments, namely, the
presence of ribs
attached to the sternum. Consistent with this fording; the transitional
spinous process and
transitional articular processes which are normally found on T10 in wild-type
animals
were instead found on T13 in homozygous mutants (data not shown). Additional
transformations within the thoracic region were also noted in certain mutant
animals. For
example, in wild-type mice, the ribs derived from T1 normally touch the top of
the
sternum. However, in 2/23 hybrid and 2/3 129/SvJ homozygous mutant mice
examined,
T2 appeared to have been transformed to have a morphology resembling that of
T1; that
is, in these animals, the ribs derived from T2 extended to touch the top of
the sternum.
In these cases, the ribs derived from T1 appeared to fuse to the second pair
of ribs.
Finally, in 82% of homozygous mutants, the long spinous process normally
present on
T2 was shifted to the position of T3. In certain other homozygous mutants,
asymmetric
fusion of a pair of vertebrosternal ribs was seen at other thoracic levels.
CA 02319703 2000-08-03
WO 99/40181 PCTNS99/02511
-60-
The anterior transformations were not restricted to the thoracic region. The
anterior most
transformation that we observed was at the level of the 6th cervical vertebra
(C6). In
wild-type mice, C6 is readily identifiable by the presence of two anterior
tuberculi on the
ventral side. In several homozygous mutant mice, although one of these two
anterior
tuberculi was present on C6, the other was present at the position of C7
instead. Hence,
in these mice, C7 appeared to have been partially transformed to have a
morphology
resembling that of C6. One other homozygous mutant had 2 anterior tuberculi on
C7 but
retained one on C6 for a complete C7 to C6 transformation but a partial C6 to
CS
transformation.
Transformations of the axial skeleton also extended into the lumbar region.
Whereas
wild-type animals normally have only 6 lumbar vertebrae, homozygous mutants
had 8-9.
At least 6 of the lumbar vertebrae in the mutants must have derived from
segments that
would normally have given rise to sacral and caudal vertebrae as the data
described
above suggest that 4 to 5 lumbar segments were transformed into thoracic
segments.
Hence, homozygous mutant mice had a total of 33-34 presacral vertebrae
compared to
26 presacral vertebrae normally present in wild-type mice. The most common
presacral
vertebral patterns were C7/T18/L8 and C7/T18/L9 for mutant mice compared to
C7/T13/L6 for wild-type mice. The presence of additional presacral vertebrae
in mutant
animals was obvious even without detailed examination of the skeletons as the
position
of the hindlimbs relative to the forelimbs was displaced posteriorly by 7-8
segments.
Although the sacral and caudal vertebrae were also affected in homozygous
mutant mice,
the exact nature of each transformation was not as readily identifiable. In
wild-type
mice, sacral segments S 1 and S2 typically have broad transverse processes
compared to
S3 and S4. In the mutants, there did not appear to be an identifiable S 1 or
S2 vertebra.
Instead, mutant animals had several vertebrae that appeared to have morphology
similar
to S3. In addition, the transverse processes of all 4 sacral vertebrae are
normally fused
to each other although in newborns often only fusions of the first 3 vertebrae
are seen.
In homozygous mutants, however, the transverse processes of the sacral
vertebrae were
usually unfused. In the caudalmost region, all mutant animals also had
severely
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-61 -
malformed vertebrae with extensive fusions of cartilage. Although the severity
of the
fusions made it difficult to count the total number of vertebrae in the caudal
region, we
were able to count up to 15 transverse processes in several animals. We were
unable to
determine whether these represented sacral or caudal vertebrae in the mutants
because
we could not establish morphologic criteria for distinguishing S4 from caudal
vertebrae
even in wild-type newborn animals. Regardless of their identities, the total
number of
vertebrae in this region was significantly reduced from the normal number of
approxi-
mately 30. Hence, although the mutants had significantly more thoracic and
lumber
vertebrae than wild-type mice, the total number of segments was reduced in the
mutants
due to the truncation of the tails.
Heterozygous mice also showed abnormalities in the axial skeleton although the
phenotype was much milder than in homozygous mice. The most obvious
abnormality
in heterozygous mice was the presence of an additional thoracic segment with
an
associated pair of ribs (Figure 19(c,f)). This transformation was present in
every
heterozygous animal examined, and in every case, the additional pair of ribs
was attached
to the sternum (Figure 19(i)). Hence, T8, whose associated rib normally does
not touch
the sternum, appeared to have been transformed to a morphology characteristic
of a more
anterior thoracic vertebra, and L1 appeared to have been transformed to a
morphology
characteristic of a posterior thoracic vertebra. Other abnormalities
indicative of anterior
transformations were also seen to varying degrees in heterozygous mice. These
included
a shift of the long spinous process characteristic of T2 by one segment to T3,
a shift of
the articular and spinous processes from T10 to T11, a shift of the anterior
tuberculus on
C6 to C7, and transformation of T2 to Tl where the rib associated with T2
touched the
top of the sternum.
In order to understand the basis for the abnormalities in axial patterning
seen in GDF-11
mutant mice, we examined mutant embryos isolated at various stages of
development and
compared them to wild-type embryos. By gross morphological examination, homozy-
gous mutant embryos isolated up to day 9.5 of gestation were not readily
distinguishable
from corresponding wild-type embryos. In particular, the number of somites
present at
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-62-
any given developmental age was identical between mutant and wild-type
embryos,
suggesting that the rate of somite formation was unaltered in the mutants. By
day
10.5-I 1.5 p.c., mutant embryos could be easily distinguished from wild-type
embryos by
the posterior displacement of the hindlimb by 7-8 somites. The abnormalities
in tail
development were also readily apparent at this stage. Taken together, these
data suggest
that the abnormalities observed in the mutant skeletons represented true
transformations
of segment identities rather than the insertion of additional segments, for
example, by an
enhanced rate of somitogenesis.
Alterations in expression of homeobox containing genes are known to cause
transforma-
- 10 tions in Drosophila and in vertebrates. To see if the expression patterns
of Hox genes
(the vertebrate homeobox containing genes) were altered in GDF-11 null mutants
we
determined the expression pattern of 3 representative Hox genes, Hoxc-6, Hoxc-
8 and
Hoxc-11, in day 12.5 p.c. wild-type, heterozygous and homozygous mutant
embryos by
whole mount in situ hybridization. The expression pattern of Hoxc-6 in wild-
type
embryos spanned prevertebrae 8-15 which correspond to thoracic segments Tl-T8.
In
homozygous mutants, however, the Hoxc-6 expression pattern was shifted
posteriorly
and expanded to prevertebrae 9-18 (T2-Tl 1). A similar shift was seen with the
Hoxc-8
probe. In wild-type embryos, Hoxc-8 was expressed in prevertebrae 13-18 (T6-
T11) but,
in homozygous mutant embryos, Hoxc-8 was expressed in prevertebrae 14-22 (T7-
Tl 5).
Finally, Hoxc-11 expression was also shifted posteriorly in that the anterior
boundary of
expression changed from prevertebrae 28 tin wild-type embryos to prevertebrae
36 in
mutant embryos. (Note that because the position of the hindlimb is also
shifted
posteriorly in mutant embryos, the Hoxc-11 expression patterns in wild-type
and mutant
appeared similar relative to the hindlimbs). These data provide further
evidence that the
skeletal abnormalities seen in mutant animals represent homeotic
transformations.
The phenotype of GDF-11 mice suggested that GDF-11 acts early during
embryogenesis
as a global regulator of axial patterning. To begin to examine the mechanism
by which
GDF-11 exerts its effects, we determined the expression pattern of GDF-1I in
early
mouse embryos by whole mount in situ hybridization. At these stages the
primary sites
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-63-
of GDF-11 expression correlated precisely with the known sites at which
mesodermal
cells are generated. Expression of GDF-11 was first detected at day 8.25-8.5
p.c. (8-10
somites) in the primitive streak region, which is the site at which ingressing
cells form
the mesoderm of the developing embryo. Expression was maintained in the
primitive
streak at day 8.75, but by day 9.5 p.c., when the tail bud replaces the
primitive streak as
the source of new mesodermal cells, expression of GDF-11 shifted to the tail
bud. Hence
at these early stages, GDF-11 appears to be synthesized in the region of the
developing
embryo where new mesodermal cells arise and presumably acquire their
positional
identity.
The phenotype of GDF-11 knockout mice in several respects resembles the
phenotype
of mice carrying a deletion of a receptor for some members of the TGF-~3
superfamily,
the activin type IIB receptor (ActRIlB). As in the case of GDF-11 knockout
mice, the
ActRIIB knockout mice have extra pairs of ribs and a spectrum of kidney
defects ranging
from hypoplastic kidneys to complete absence of kidneys. The similarity in the
phenotypes of these mice raises the possibility that ActRIIB may be a receptor
for
GDF-11. However, Act RIIB cannot be the sole receptor for GDF-11 because the
phenotype of GDF-11 knockout mice is more severe than the phenotype of ActRIIB
mice. For example, whereas the GDF-11 knockout animals have 4-5 extra pairs of
ribs
and show homeotic transformations throughout the axial skeleton, the ActRIIB
knockout
animals have only 3 extra pairs of ribs and do not show transformations at
other axial
levels. In addition, the data indicate that the kidney defects in the GDF-11
knockout
mice are also more severe than those in ActRIIB knockout mice. The ActRIIB
knockout
mice show defects in leftlright axis formation, such as lung isomerixm and a
range of
heart defects that we have not yet observed in GDF-11 knockout mice. ActRIIB
can bind
the activins and certain BMPs, although none of the knockout mice generated
for these
ligands show defects in left/right axis formation.
If GDF-11 does act directly on mesodenmal cells to establish positional
identity, the data
presented here would be consistent with either short range or morphogen models
for
GDF-11 action. That is, GDF-11 may act on mesodermal precursors to establish
patterns
CA 02319703 2000-08-03
WO 99/40181 PCT/US99/02511
-64-
of Hox gene expression as these cells are being generated at the site of GDF-
11
expression, or alternatively, GDF-11 produced at the posterior end of the
embryo may
diffuse to form a morphogen gradient. Whatever the mechanism of action of GDF-
11
may be, the fact that gross anterior/posterior patterning still does occur in
GDF-11
knockout animals suggests that GDF-11 may not be the sole regulator of ante-
rior/posterior specification. Nevertheless, it is clear that GDF-11 plays an
important role
as a global regulator of axial patterning and that further study of this
molecule will lead
to important new insights into how positional identity along the
anterior/posterior axis
is established in the vertebrate embryo.
Similar phenotypes are expected in GDF-8 knockout animals. For example, GDF-8
knockout animals are expected to have increased number of ribs, kidney defects
and
anatomical differences when compared to wild-type.
Although the invention has been described with reference to the presently
preferred
embodiment, it should be understood that various modifications can be made
without
departing from the spirit of the invention. Accordingly, the invention is
limited only by
the following claims.
i:
CA 02319703 2001-08-08
1
SEQUENCE LISTING
<110> Johns Hopkins University School of Medicine
<120> Growth Differentiation Factor-8
<130> 581-195
<140> 2,319,703
<141> 1999-02-05
<150> US 09/019,070
<151> 1998-02-05
<150> US 09/124,180
<151> 1998-07-28
<160> 53
<170> PatentIn version 3.0
<210> 1
<211> 35
<212> DNA
<213> Artificial
<220>
<223> Primer
<220>
<221> misc_feature
<222> (1) . (35)
<223> n = A, T, G, or C; v = A, G, or C, not T; r = G
or A; y = T or C: k = T or G
<220>
<221> misc_feature
<222> (1). (35)
<223> 12,27,30,33 n = inosine
<400> 1
ccggaattcg gntggvanra ytggrtnrtn kcncc 35
<210> 2
<211> 33
<212> DNA
<213> Artificial
<220>
<223> Primer
<220>
<221> misc_feature
<222> (1). (33)
<223> 13,25,28 n = inosine
CA 02319703 2001-08-08
0
' 2
<220>
<221> misc_feature
<222> (1) . (33)
<223> n = A, T, G, or C; r = A or G; y = C or T; s = G or C
<400> 2
ccggaattcr canscrcarc tntcnacnry cat 33
<210> 3
<211> 31
<212> DNA
<213> Artificial '
<220>
<223> primer
<400> 3
cgcggatcca gagtcaaggt gacagacaca c 31
<210> 4
<211> 33
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 4
cgcggatcct cctcatgagc acccacagcg gtc 33
<210> 5
<211> 550
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (59) . . (436)
<400> 5
ttaaggtagg aaggatttca ggctctattt acataattgt tctttccttt tcacacag 58
aat ccc ttt tta gaa gtc aag gtg aca gac aca ccc aag agg tcc cgg 106
Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro :Lys Arg Ser Arg
1 5 10 15
aga gac ttt ggg ctt gac tgc gat gag cac tcc acg ~gaa tcc cgg tgc 154
Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr ~Glu Ser Arg Cys
20 25 30
tgc cgc tac ccc ctc acg gtc gat ttt gaa gcc ttt ~gga tgg gac tgg 202
Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe ~GIy Trp Asp Trp
35 40 45
att atc gca ccc aaa aga tat aag gcc aat tac tgc tca gga gag tgt 250
Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys
i,
CA 02319703 2001-08-08
3
50 55 60
gaa ttt gtg ttt tta caa aaa tat ccg cat act cat ctt gtg cac caa 298
Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln
65 70 75 80
gca aac ccc aga ggc tca gca ggc cct tgc tgc act ccg aca aaa atg 346
Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met
85 90 95
tct ccc att aat atg cta tat ttt aat ggc aaa gaa caa ata ata tat 394
Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr
100 105 110
ggg aaa att cca gcc atg gta gta gac cgc tgt ggg tgc tca 436
Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser
115 120 125
tgagctttgc attaggttag aaacttccca agtcatggaa ggtcttcccc tcaatttcga 496
aactgtgaat tcctgcagcc cgggggatcc actagttcta gagcggccgc cacc 550
<210> 6
<211> 126
<212> PRT
<213> Mus musculus
<400> 6
Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro :Lys Arg Ser Arg
1 5 10 15
Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr (ilu Ser Arg Cys
20 25 30
Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe (31y Trp Asp Trp
35 40 45
Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys
50 55 60
Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His heu Val His Gln
65 70 75 80
Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr F?ro Thr Lys Met
85 90 95
Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu CTln Ile Ile Tyr
100 105 110
Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly C:ys Ser
115 12 0 1.2 5
CA 02319703 2001-08-08
4
<210> 7
<211> 326
<212> DNA
<213> Homosap iens
<220>
<221> CDS
<222> (3). 6)
. (32
<400> 7
ca agatcc agaagggat tttggtctt gactgtchatgagcactca 47
aaa
Lys ArgSer Arg Asp PheGlyLeu CysAsp HisSer
Arg Asp Glu
1 5 10 15
aca tcacga tgctgtcgt taccctcta actgtggat tttgaaget 95
gaa
Thr SerArg CysCysArg TyrProLeu ThrValAsp PheGluAla
Glu
20 25 30
ttt tgggat tggattatc getcctaaa agatataag gccaattac 143
gga
Phe TrpAsp TrpIleIle AlaProLys ArgTyrLys AlaAsnTyr
Gly
35 40 45
tgc ggagag tgtgaattt gtattttta caaaaatat cctcatact 191
tct
Cys GlyGlu CysGluPhe ValPheLeu GlnLysTyr ProHisThr
Ser
50 55 60
cat gtacac caagcaaac cccagaggt tcagcaggc ccttgctgt 239
ctg
His ValHis GlnAlaAsn ProArgGly SerAlaGly ProCysCys
Leu
65 70 75
act acaaag atgtctcca attaatatg ctatatttt aatggcaaa 287
ccc
Thr ThrLys MetSerPro IleAsnMet LeuTyrPhe AsnGlyLys
Pro
80 85 90 95
gaa ataata tatgggaaa attccagcg atggtagta 326
caa
Glu IleIle TyrGlyLys IleProAia MetValVal
Gln
100 ~ 105
<210> 8
<211> 108
<212> PRT
<213> Homo Sapiens
<400> 8
Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr
1 5 10 15
Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe
20 25 30
Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys .Ala Asn Tyr Cys
35 40 45
Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His
50 55 60
CA 02319703 2001-08-08
S
Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr
65 70 75 80
Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu
85 90 95
Gln Ile IIe Tyr Gly Lys Ile Pro Ala Met Val Val
100 105
<210> 9
<211> 9
<212> FRT
<213> Artificial
<220>
<223> amino acid encoded by oligonucleotide for PCR
<220>
<221> VARIANT
<222> (3) .. (3)
<223> Xaa = His, Gln, Asn, Lys, Asp, Glu
<220>
<221> VARIANT
<222> (4) . . (4)
<223> Xaa = Asp, Asn
<220>
<221> VARIANT
<222> (6) . . (7)
<223> Xaa = Val, Ile, Met
<220>
<221> VARIANT
<222> (8) . . (8)
<223> Xaa = Ala, Ser
<400> 9
Gly Trp Xaa Xaa Trp Xaa Xaa Xaa Pro
1 5
<210> 10
<211> 8
<212> PRT
<213> Artificial
<220>
<223> amino acid encoded by oligonucleotide for PCR
<220>
<221> VARIANT
_. »a>.~. _.__~___ ~.:~ .,~~_------.~ ,~
CA 02319703 2001-08-08
° ~ 6
<222> {2) . . (2)
<223> Xaa = Val, Ile, Met, Thr, Ala
<220>
<221> VARIANT
<222> (4) . . {4)
<223> Xaa = Asp, Glu
<220>
<221> VARIANT
<222> (7) . . (7)
<223> Xaa = Gly, Ala
<400> 10
Met Xaa Val Xaa Ser Cys Xaa Cys
1 5
<210> 11
<211> 2676
<212> DNA
<213> Mus musculus
<220>
<221>CDS
<222>{104)..'(1231)
<400>11
gtctctcgga cggtacatgc cacttggcat tactcaaaag caaaaagaag
60
actaatattt
aaataagaac aagggaaaaa gctgattttt aaaatg atgcaa aaa 115
aaaagattgt
Met MetGln Lys
:1
ctg atg tat tat att ctg atgctgatt getget ggc 163
caa gtt tac ttc
Leu Met Tyr Tyr Ile Leu MetLeu:CleAlaAla Gly
Gln Val Tyr Phe
10 15 20
cca gat cta gag ggc gag gaagaa<~.atgtggaa aaa 211
gtg aat agt aga
Pro Asp Leu Glu Gly Glu GluGluAsn ValGlu Lys
Val Asn Ser Arg
25 30 35
gag ggg ctg tgt aat gca tgt gcg tgg aga caa aac acg agg tac tcc 259
Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg Gln Asn '.Chr Arg Tyr Ser
40 45 50
aga ata gaa gcc ata aaa att caa atc ctc agt aag cag cgc ctg gaa 307
Arg Ile Glu Ala Ile Lys Ile G1n Ile Leu Ser Lys I~eu Arg Leu Glu
55 60 fi5
aca get cct aac atc agc aaa gat get ata aga caa cat ctg cca aga 355
Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln heu Leu Pro Arg
70 75 80
gcg cct cca ctc cgg gaa ctg atc gat cag tac gac dtc cag agg gat 403
Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp
85 90 95 100
~~~ _. _._-____..~...,. ~a - i,.-.
CA 02319703 2001-08-08
gacagc agtgatggc tctttg gaagatgac gattatcac getaccacg 45I
AspSer SerAspGly SerLeu GluAspAsp AspTyrHis AlaThrThr
105 110 115
gaaaca atcattacc atgcct acagagtct gactttcta atgcaagcg 499
GluThr IleIleThr MetPro ThrGluSer AspPheLeu MetGlnAla
120 125 130
gatggc aagcccaaa tgttgc ttttttaaa tttagctct aaaatacag 547
AspGly LysProLys CysCys PhePheLys PheSerSer LysIleGln
135 140 145
tacaac aaagtagta aaagcc caactgtgg atatatctc agacccgtc 595
TyrAsn LysValVal LysAla GlnLeuTrp IleTyrLeu ArgProVal
150 155 160
aagact cctacaaca gtgttt gtgcaaatc ctgagactc atcaaaccc 643
LysThr ProThrThr ValPhe ValGlnIle LeuArgLeu IleLysPro
165 170 175 180
atgaaa gacggtaca aggtat actggaatc cgatctctg aaacttgac 691
MetLys AspGlyThr ArgTyr ThrGlyIle ArgSerLeu LysLeuAsp
185 190 195
atgagc ccaggcact ggtatt tggcagagt attgatgtg aagacagtg 739
MetSer ProGlyThr GlyIle TrpGlnSer IleAspVal LysThrVal
200 205 210
ttgcaa aattggctc aaacag cctgaatcc aacttaggc attgaaatc 787
LeuGln AsnTrpLeu LysGln ProGluSer AsnLeuGly IleGluIle
215 220 225
aaaget ttggatgag aatggc catgatctt getgtaacc ttcccagga 835
LysAla LeuAspGlu AsnGly HisAspLeu AlaValThr PheProGly
230 235 240
ccagga gaagatggg ctgaat cccttttta gaagtcaag gtgacagac 883
ProGly GluAspGly LeuAsn ProPheLeu GluValLys ValThrAsp
245 250 255 260
acaccc aagaggtcc cggaga gactttggg cttgactgcgat gagcac 931
ThrPro LysArgSer ArgArg AspPheGly LeuAspCysAsp GluHis
265 270 275
tccacg gaatcccgg tgctgc cgctacccc ctcacggtcgat tttgaa 979
SerThr GluSerArg CysCys ArgTyrPro LeuThrValAsp PheGlu
280 285 290
gccttt ggatgggac tggatt atcgcaccc aaaagatataag gccaat 1027
AlaPhe GlyTrpAsp TrpIle IleAlaPro LysArgTyrLys AlaAsn
295 300 305
tactgc tcaggagag tgtgaa tttgtgttt ttacaaaaatat ccgcat 1075
TyrCys SerGlyGlu CysGlu PheValPhe LeuGlnLysTyr ProHis
310 315 320
actcat cttgtgcac caagca aaccccaga ggctcagcaggc ccttgc 1123
ThrHis LeuValHis GlnAla AsnProArg GlySerAlaGly ProCys
325 330 335 340
tgc act ccg aca aaa atg tct ccc att aat atg cta tat ttt aat ggc 1171
CA 02319703 2001-08-08
c
Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly
345 350 355
aaa gaa caa ata ata tat ggg aaa att cca gcc atg gta gta gac cgc 1219
Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg
360 365 370
tgt ggg tgc tca tgagctttgc attaggttag aaacttccca agtcatggaa 1271
Cys Gly Cys Ser
375
ggtcttcccc tcaatttcga aactgtgaat tcaagcacca caggctgtag gccttgagta 1331
tgctctagta acgtaagcac aagctacagt gtatgaacta aaagagagaa tagatgcaat 1391
ggttggcatt caaccaccaa aataaaccat actataggat gttgtatgat ttccagagtt 1451
tttgaaatag atggagatca aattacattt atgtccatat atgtatatta caactacaat 1511
ctaggcaagg aagtgagagc acatcttgtg gtctgetgag ttaggagggt atgattaaaa 1571
ggtaaagtct tatttcctaa cagtttcact taatatttac agaa~gaatct atatgtagcc 1631
tttgtaaagt gtaggattgt tatcatttaa aaacatcatg tacacttata tttgtattgt 1691
atacttggta agataaaatt ccacaaagta ggaatggggc ctcacataca cattgccatt 1751
cctattataa ttggacaatc caccacggtg ctaatgcagt gctg~aatggc tcctactgga 1811
cctctcgata gaacactcta caaagtacga gtctctctct cccttccagg tgcatctcca 1871
cacacacagc actaagtgtt caatgcattt tctttaagga aaga~agaatc tttttttcta 1931
gaggtcaact ttcagtcaac tctagcacag cgggagtgac tgctgcatct taaaaggcag 1991
ccaaacagta ttcatttttt aatctaaatt tcaaaatcac tgtcitgcctt tatcacatgg 2051
caattttgtg gtaaaataat ggaaatgact ggttctatca atatitgtata aaagactctg 2111
aaacaattac atttatataa tatgtataca atattgtttt gtaaataagt gtctcctttt 2171
atatttactt tggtatattt ttacactaat gaaatttcaa atcat:.taaag tacaaagaca 2231
tgtcatgtat cacaaaaaag gtgactgctt ctatttcaga gtgaattagc agattcaata 2291
gtggtcttaa aactctgtat gttaagatta gaaggttata ttacaatcaa tttatgtatt 2351
ttttacatta tcaacttatg gtttcatggt ggctgtatct atgaatgtgg ctcccagtca 2411
aatttcaatg ccccaccatt ttaaaaatta caagcattac taaa<:atacc aacatgtatc 2471
taaagaaata caaatatggt atctcaataa cagctacttt tttat=tttat aatttgacaa 2531
tgaatacatt tcttttattt acttcagttt tataaattgg aacttagttt atcaaatgta 2591
ttgtactcat agctaaatga aattatttct tacataaaaa tgtgt:agaaa ctataaatta 2651
aagtgttttc acatttttga aaggc 2676
<210> 12
CA 02319703 2001-08-08
9
<211> 376
<212> PRT
<213> Mus musculus
<400> 12
Met Met Gln Lys Leu Gln Met Tyr Val Tyr Ile Tyr Leu Phe Met Leu
1 5 10 15
Ile Ala Ala Gly Pro Val Asp Leu Asn Glu Gly Ser Glu Arg Glu Glu
20 25 30
Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg Gln Asn
35 40 45
Thr Arg Tyr Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys
50 55 60
Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp .Ala Ile Arg Gln
65 70 75 80
Leu Leu Pro Arg Ala Pro Pro Leu Arg Glu Leu Ile .Asp Gln Tyr Asp
85 90 95
Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu :~lsp Asp Asp Tyr
100 105 ~ 110
His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe
115 12 0 :12 5
Leu Met Gln Aia Asp Gly Lys Pro Lys Cys Cys Phe 7?he Lys Phe Ser
130 135 140
Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr
145 150 155 160
Leu Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val C~ln Ile Leu Arg
165 170 175
Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Cily Ile Arg Ser
180 185 190
Leu Lys Leu Asp Met Ser Pro Gly Thr Gly Ile Trp CTln Ser Ile Asp
195 200 x;05
Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro C:lu Ser Asn Leu
210 215 220
CA 02319703 2001-08-08
Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val
225 230 235 240
Thr Phe Pro Gly Pro Gly GIu Asp Gly Leu Asn Pro Phe Leu Glu Val
245 250 255
Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp
260 265 270
Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr
275 280 285
Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg
290 295 300
Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln
305 310 315 320
Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser
325 330 335
Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu
340 345 350
Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met
355 360 365
Val Val Asp Arg Cys Gly Cys Ser
370 375
<210> 13
<211> 2743
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (59)-.(1183)
<400> 13
aagaaaagta aaaggaagaa acaagaacaa gaaaaaagat tata,ttgatt ttaaaatc 58
atg caa aaa ctg caa ctc tgt gtt tat att tac ctg ttt atg ctg att 106
Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
gtt get ggt cca gtg gat cta aat gag aac agt gag caa aaa gaa aat 154
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
25 30
.~-_- m~~
CA 02319703 2001-08-08
11
gtggaaaaa ggg tgtaatgca act tgg aac 202
gag ctg tgt aga act
caa
ValGluLysGlu Gly CysAsnAla Thr TrpArg Asn
Leu Cys Gln Thr
35 40 45
aaatcttcaaga atagaa gccattaag atacaa atcctcagt aaactt 250
LysSerSerArg IleGlu AlaIleLys IleGln IleLeuSer LysLeu
50 55 60
cgtctggaaaca getcct aacatcagc aaagat gttataaga caactt 298
ArgLeuGluThr AlaPro AsnIleSer LysAsp ValIleArg GlnLeu
65 70 75 80
ttacccaaaget cctcca ctccgggaa ctgatt gatcagtat gatgtc 346
LeuProLysAla ProPro LeuArgGlu LeuIle AspGlnTyr AspVal
85 90 95
cagagggatgac agcagc gatggctct ttggaa gatgacgat tatcac 394
GlnArgAspAsp SerSer AspGlySer LeuGlu AspAspAsp TyrHis
100 105 110
getacaacggaa acaatc attaccatg cctaca gagtctgat tttcta 442
AlaThrThrGlu ThrIle IleThrMet ProThr GluSerAsp PheLeu
115 120 125
atgcaagtggat ggaaaa cccaaatgt tgcttc tttaaattt agctct 490
MetGlnValAsp GlyLys ProLysCys CysPhe PheLysPhe SerSer
130 135 140
aaaatacaatac aataaa gtagtaaag gcccaa ctatggata tatttg 538
LysIleGlnTyr AsnLys ValValLys AlaGln LeuTrpIle TyrLeu
145 150 155 160
agacccgtcgag actcct acaacagtg tttgtg caaatcctg agactc 586
ArgProValGlu ThrPro ThrThrVal PheVal GlnIleLeu ArgLeu
165 170 175
atcaaacctatg aaagac ggtacaagg tatact gga;atccga tctctg 634
IleLysProMet LysAsp GlyThrArg TyrThr Gly:IleArg SerLeu
180 185 190
aaacttgacatg aaccca ggcactggt atttgg cagagcatt gatgtg 682
LysLeuAspMet AsnPro GlyThrGly IleTrp GlnSerIle AspVal
195 200 ;Z05
aagacagtgttg caaaat tggctcaaa caacct gaat aac ttaggc 730
cc
LysThrValLeu GlnAsn TrpLeuLys GlnPro GluSerAsn LeuGly
210 215 220
attgaaataaaa gettta gatgagaat ggtcat gat<atget gtaacc 778
IleGluIleLys AlaLeu AspGluAsn GlyHis AspI~euAla ValThr
225 230 235 240
ttcccaggacca ggagaa gatgggctg aatccg ttttaagag gtcaag 826
PheProGlyPro GlyGlu AspGlyLeu AsnPro PheheuGlu ValLys
245 250 255
gtaacagacaca ccaaaa agatccaga agggat tttdgtctt gactgt 874
ValThrAspThr ProLys ArgSer Arg PheLilyLeu AspCys
Arg Asp
260 265 270
gatgagcactca acagaa tcacgatgc tgtcgt tacc:ctcta actgtg 922
,,,..~...~~ ___..
____.~____.~
__..
,~m~~.~~..
~~"_ T ~~
CA 02319703 2001-08-08
12
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
gat ttt gaa get ttt gga tgg gat tgg att atc get cct aaa aga tat 970
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
aag gcc aat tac tgc tct gga gag tgt gaa ttt gta ttt tta caa aaa 1018
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys
305 310 315 320
tat cct cat act cat ctg gta cac caa gca aac ccc aga ggt tca gca 1066
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
ggc cct tgc tgt act ccc aca aag atg tct cca att aat atg cta tat 1114
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
ttt aat ggc aaa gaa caa ata ata tat ggg aaa att cca gcg atg gta 1162
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
gta gac cgc tgt ggg tgc tca tgagatttat attaagcgta cataacttcc 1213
Val Asp Arg Cys Gly Cys Ser
370 375
taaaacatgg aaggttttcc cctcaacaat tttgaagctg tgaa~attaag taccacaggc 1273
tataggccta gagtatgcta cagtcactta agcataagct acag~tatgta aactaaaagg 1333
gggaatatat gcaatggttg gcatttaacc atccaaacaa atca.tacaag aaagttttat 1393
gatttccaga gtttttgagc tagaaggaga tcaaattaca tttatgttcc tatatattac 1453
aacatcggcg aggaaatgaa agcgattctc cttgagttct gatgaattaa aggagtatgc 1513
tttaaagtct atttctttaa agttttgttt aatatttaca gaaaaatcca catacagtat 1573
tggtaaaatg caggattgtt atataccatc attcgaatca tccttaaaca cttgaattta 1633
tattgtatgg tagtatactt ggtaagataa aattccacaa aaatagggat ggtgcagcat 1693
atgcaatttc cattcctatt ataattgaca cagtacatta acaatccatg ccaacggtgc 1753
taatacgata ggctgaatgt ctgaggctac caggtttatc acat~aaaaaa cattcagtaa 1813
aatagtaagt ttctcttttc ttcaggtgca ttttcctaca cctccaaatg aggaatggat 1873
tttctttaat gtaagaagaa tcatttttct agaggttggc tttc<~attct gtagcatact 1933
tggagaaact gcattatctt aaaaggcagt caaatggtgt ttgti~tttat caaaatgtca 1993
aaataacata cttggagaag tatgtaattt tgtctttgga aaattacaac actgcctttg 2053
caacactgca gtttttatgg taaaataata gaaatgatcg actct:atcaa tattgtataa 2113
aaagactgaa acaatgcatt tatataatat gtatacaata ttgttatgta aataagtgtc 2173
tcctttttta tttactttgg tatattttta cactaaggac atttc:aaatt aagtactaag 2233
CA 02319703 2001-08-08
13
gcacaaagac atgtcatgca tcacagaaaa gcaactactt atat~ttcaga gcaaattagc 2293
agattaaatagtggtcttaaaactccatatgttaatgattagat;ggttatattacaatca2353
ttttatatttttttacatgattaacattcacttatggattcatc~atggctgtataaagtg2413
aatttgaaatttcaatggtttactgtcattgtgtttaaatctcaacgttccattatttta2473
atacttgcaaaaacattactaagtataccaaaataattgactct:attatctgaaatgaag2533
aataaactgatgctatctcaacaataactgttacttttatttta~taatttgataatgaat2593
atatttctgc atttatttac ttctgttttg taaattggga tttt.gttaat caaatttatt 2653
gtactatgac taaatgaaat tatttcttac atctaatttg taga.aacagt ataagttata 2713
ttaaagtgtt ttcacatttt tttgaaagac 2743
<210> 14
<211> 375
<212> PRT
<213> Homo sapiens
<400> 14
Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
20 25 30
Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Trp .Arg Gln Asn Thr
35 40 45
Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile :Leu Ser Lys Leu
50 55 60
Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Val :Ile Arg Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp i~sp Asp Tyr His
100 105 110
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu :>er Asp Phe Leu
115 120 125
Met Gln Val Asp Gly Lys Pro Lys Cys Cys Phe Phe hys Phe Ser Ser
130 135 140
,~___.
.,.~..~- -_-_ . I
CA 02319703 2001-08-08
' 14
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu
145 150 155 160
Arg Pro Val Glu Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 220
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr
225 230 235 240
Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys
305 310 315 320
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
CA 02319703 2001-08-08
<210> 15
<211> 34
<212> DNA
<213> Artificial
<220>
<223> oligonucleotide for PCR
<400> 15
cgcggatccg tggatctaaa tgagaacagt gagc 34
<210> 16
<211> 37
<212> DNA
<213> Artificial
<220>
<223> oligonucleotide for PCR
<400> 16
cgcgaattct caggtaatga ttgtttccgt tgtagcg 37
<210> 17
<211> 20
<212> DNA
<213> Artificial
<220>
<223> oligonucleotide for PCR
<400> 17
acactaaatc ttcaagaata
<210> 18
<211> 1128
<212> DNA
<213> Papio hamadryas
<220>
<221> CDS
<222> (1) . . (1125)
<400> 18
atg caa aaa ctg caa ctc tgt gtt tat att tac ctg ttt atg ctg att 48
Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
gtt .gct ggt cca gtg gat cta aat gag aac agt gag caa aaa gaa aat 96
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
20 25 30
gtg gaa aaa gag ggg ctg tgt aat gca tgt act tc~g aga caa aac act 144
Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Trp Arg Gln Asn Thr
35 40 45
aaa tct tca aga ata gaa gcc att aaa ata caa at:c ctc agt aaa ctt 192
Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln I7_e Leu Ser Lys Leu
50 55 6U
CA 02319703 2001-08-08
' 16
t aa acagetcct atc agcaaa getataaga caactt 240
aac gat
cgtg g A Ile SerLysAsp Ala:IleArg GlnLeu
c
ArgLeuGlu ThrAlaPro sn 80
65 70 75
t cc aaa getcctcca ctccgg gaactgatt gatcagtat gatgtc 288
a c o LeuArg GluLeuIle Asp~GlnTyr AspVal
t P
LeuProLys AlaPror 95
85 90
c c gatggc tctttggaa gatgacgat tatcac 336
a
cagagggat gacag g L Glu AspAspAsp TyrHis
GlnArgAsp AspSerSer AspGly Sereu
100. 105 110
atc attacc atgcctaca gagtctgat ttttta 384
getacaacg gaaaca Il Thr MetProThr GluSerAsp PheLeu
AlaThrThr GluThrIle e
115
120 125
aa cccaaa tgttgcttc tttaaattt agctct 432
atgcaagtg gatggaa C Phe PheLysPhe SerSer
MetGlnVal AspGlyLys ProLys Cysys
130 135 140
at aaa gtggta aaggcccaa ctatggata tatttg 480
aaaatacaa taca ValVal LysAlaGln LeuTrpIle TyrLeu
LysIleGln TyrAsnLys 160
145
150 155
actcct acaaca gtgtttgtg caaatcctg agactc 528
agaccc gag ThrThr ValPheVal Gln Leu ArgLeu
gtc Ile
ArgProVal GluThrPro 175
165 170
atcaaacct atgaaagac ggtaca tatactgga atccga.tct ctg 576
IleLysPro MetLysAsp Glyagg TyrThrGly IleArgSer Leu
180 Thr 190
Arg
185
aaacttgac atgaaccca ggcactggt atttggcag agcattgat gtg 624
LysLeuAsp MetAsnPro GlyThrGly IleTrpGln.SerIleAsp Val
195 200 205
aagacagtg ttgcaaaat tggctcaaa caacctgaa,tccaactta ggc 672
LysThrVal LeuGlnAsn TrpLeuLys GlnProGlu SerAsnLeu Gly
210 215 220
attgaaata aaagettta gatgagaat ggtcatgat:cttgetgta acc 720
IleGluIle LysAlaLeu AspGluAsn GlyHisAsp LeuAlaVal Thr
225
230 235 240
ttcccagga ccaggagaa gatgggctg aatccctti~ttagaggtc aag 768
PheProGly ProGlyGlu AspGlyLeu AsnProPhc~LeuGluVal Lys
245 250 255
gta.aca gac aca cca aaa aga tcc aga agg gat ttt ggt ctt gac tgt 816
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Ph~e Gly Leu Asp Cys
260 265 270
gat gag cac tca aca gaa tcg cga tgc tgt cgt tac cct cta act gtg 864
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
gat ttt gaa get ctt gga tgg gat tgg att atc get cct aaa aga tat 912
Asp Phe Glu Ala Leu Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
CA 02319703 2001-08-08
17
aag gcc aat tac tgc tct gga gag tgt gaa ttt gta ttt tta caa aaa 960
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys
315 320
305 310
tat cct cat act cat ctg gta cac caa gca aac ccc aga ggt tca gca 1008
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
ggccct tgt actccc aagatgtct ccaatt atg tat 1056
Glytgc Cys Thraca LysMetSer Proaat cta Tyr
Pro 340 Pro 345 Ile Met
Cys Thr Asn Leu
350
tttaat aaa gaacaa atatatggg aaaatt gcc gta 1104
Pheggc Lys Gluata IleTyrGly Lyscca atg Val
Asn Gln 360 Ile Ala
Gly Ile Pro Met
355 365
gta gac cgc tgc ggg tgc tca tga
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 19
<211> 375
<212> PRT
<213> Papio hamadryas
<400> 19
Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu. Gln Lys Glu Asn
20 25 30
Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Tr~> Arg Gln Asn Thr
35 40 45
Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln I'le: Leu Ser Lys Leu
50 55 60
Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Al<~ Ile Arg Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile As;p Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu
115 120 125
1128
Met Gln Val Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser
CA 02319703 2001-08-08
130 135 140
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu
150 155 160
145
Arg Pro Val Glu Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 220
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr
230 235 240
225
Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe: Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyi- Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Leu Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Va:l Phe Leu Gln Lys
310 315 320
305
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Il.e Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
CA 02319703 2001-08-08
19
<210> 20
<211> 1128
<212> DNA
<213> Bos taurus
<220>
<221> CDS
<222> (1)..(1125)
<400> 20
atg caa aaa ctg caa tat att 48
atc tct gtt tac cta
Met Gln Lys Leu Gln ttt atg
Ile Ser Val ctg att
1 5 Tyr Ile
Tyr Leu
Phe Met
Leu Ile
10 15
gtt get ggc cca gtg ctg gag aac aag gaa aat 96
gat aat agc gag. Lys Glu Asn
Val Ala Gly Pro Val Leu cag 30
Asp Asn Glu Asn
20 Ser Glu.
Gln
25
gaa aaa gag ggg ctg tgt gca tgt tgc~ gaa aac act 144
gtg aat ttg agg Glu Asn Thr
Val Glu Lys Glu Gly Cys Ala Cys -
Leu Asn Leu Trp
35 40 Arg
45
aca tcc tca aga cta gcc aaa atc atc: agt aaa ctt 192
gaa ata caa ctc Ser Lys Leu
Thr Ser Ser Arg Leu Ala Lys Ile Ile:
Glu Ile Gln Leu
50 55 60
cgc ctg gaa aca get aac agc aaa gct: aga caa ctt 240
cct atc gat atc Arg Gln Leu
Arg Leu Glu Thr Ala Asn Ser Lys Ala 80
Pro Ile Asp Ile
65 70 75
ttg cce aag get cct ctc gaa ctg gait ttc gat gtc 288
eca ctg att cag Phe Asp Val
Leu Pro Lys Ala Pro Leu Glu Leu Asp 95
Pro Leu Ile Gln
85 gp
cag aga gat gcc agc gac tcc ttg gac gac tac cac 336
agt ggc gaa gat Asp Tyr His
Gln Arg Asp Ala Ser Asp Ser Leu As:p 110
Ser Gly Glu Asp
100 105
gcc agg acg gaa acg att atg ccc gag gat ctt cta 384
gtc acc acg tct Asp Leu Leu
Ala Arg Thr Glu Thr Ile Met Pro Glu
Val Thr Thr Ser
115 120 125
acg caa gtg gaa gga ccc tgt tgc ttt ttt agc tct 432
aaa aaa ttc aaa Phe Ser Ser
Thr Gln Val Glu Gly Pro Cys Cys Ph.e
Lys Lys Phe Lys
130 135 140
aag ata caa tac aat cta ct:g ata tat ctg 480
aaa gta tgg Ile Tyr Leu
Lys.Ile Gln Tyr Asn aag Le:u
Lys gcc Trp 160
caa
150 Leu
145 Val
Lys
Ala
Gln
155
agg cct gtc aag act caa ctg aga ctc 528
cct gcg aca gtg atc Leu Arg Leu
ttt gtg G7_n 175
Arg Pro Val Lys Thr Ile
Pro Ala Thr Val.Phe
Val
165 170
atc aaa ccc atg aaa 576
gac ggt aca agg
tat act gga atc
cga tct ctg
Ile Lys Pro Met Lys
Asp Gly Thr Arg
Tyr Thr G:Ly Ile
Arg Ser Leu
180 185 190
aaa ctt gac atg aac 624
cca ggc act ggt
att tgg c<~g agc
att gat gtg
CA 02319703 2001-08-08
' 20
Lys Leu Asp Met IleTrp GlnSerIle
Asn Pro Gly 205Asp
Thr Gly Val
195 200
aag aca gtg ttg aac tgg ctc caacct gaatcc ttaggc 672
cag aaa GlnPro Gluaac LeuGly
Lys Thr Val Leu Asn Trp Leu 220Ser
Gln Lys Asn
210 215
att gaa atc aaa tta gat gag ggccat gatcttget gtaacc 720
get aat GlyHis AspLeuAla ValThr
Ile Glu Ile Lys Leu Asp Glu
Ala Asn 235 240
225
230
ttc cca gaa cca gaa gat gga actcct tttttagaa gtcaag 768
Phe Pro Glu gga ctg ThrPro PheLeuGlu ValLys
Pro Glu Asp Gly 250 255
Gly Leu
245
gta aca gac aca aaa aga tct agagat tttgggctt gattgt 816
Val Thr Asp cca agg ArgAsp PheGlyLeu AspCys
Thr Lys Arg Ser 270
Pro Arg
260 265
gat gaa cac tcc gaa tct cga tgtcgt taccctcta actgtg 864
Asp Glu His aca tgc CysArg TyrProLeu ThrVal
275 Ser Glu Ser Arg 285
Thr Cys
280
gat ttt gaa get gga tgg gat attatt gcacctaaa agatat 912
Asp Phe Glu ttt tgg IleIle AlaProLys ArgTyr
290 Ala Gly Trp Asp 300'
Phe Trp
295
aag gcc aat tac tct gga gaa gaattt gtatttttg caaaag 960
Lys Ala Asn tgc tgt GluPhe ValPheLeu GlnLys
305 Tyr Ser Gly Glu
Cys Cys 315 320
310
tat cct cat acc ctt gtg cac gcaaac cccagaggt tcagcc 1008
Tyr Pro His cat caa AlaAsn ProArgGly SerAla
Thr Leu Val His 330 335
His Gln
325
ggc ccc tgc tgt cct aca aag tct aatatg ctatat 1056
Gly Pro Cys act atg cca : Met LeuTyr
Cys Pro Thr Lys att Asn350
Thr Met Ser
340 345 Pro
Ile
ttt aat ggc gaa gcc gta 1104
Phe Asn Gly gga atg Val
355 caa Ala
ata Met
ata
tac
ggg
aag
att:
cca
Glu
Gly
Gln
Ile
Ile
Tyr
Gly
Lys
Ile:
Pro
360
365
gta gat cgc tgt 1128
ggg
tgt
tca
tga
Val Asp Arg Cys
Gly Cys Ser
370 375
<210> 21
<211> 375
<212> PRT
<213> Bos taurus
<400> 21
Met Gln Lys Leu Gln Ile Ser Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
20 25 30
CA 02319703 2001-08-08
21
Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Leu Trp Arg Glu Asn Thr
35 40 45
Thr Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu
so 55 so
Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Leu Glu Leu Ile Asp Gln Phe Asp Val
85 90 95
Gln Arg Asp Ala Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Ala Arg Thr Glu Thr Val Ile Thr Met Pro Thr Glu Ser Asp Leu Leu
115 120 125
Thr Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe: Lys Phe Ser Ser
130 135 140
Lys Ile Gln Tyr Asn Lys Leu Val Lys Ala Gln Leu Trp Ile Tyr Leu
145 150 155 160
Arg Pro Val Lys Thr Pro Ala Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 22~D
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His As:p Leu Ala Val Thr
225 230 235 240
Phe Pro Glu Pro Gly Glu Asp Gly Leu Thr Pro Phe Leu Glu Val Lys
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys
260 265 270
CA 02319703 2001-08-08
22
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
f
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys
310 315 320
305
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
Phe Asn Gly Glu Gly Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 22
<211> 1128
<212> DNA
<213> Callus gallus
<220>
<221> CDS
<222> (1) . . (1125)
<400>
22 ctaca gtctatgtt tatatttac ctc~ttcatg cagatc 48
at caaaag L g Valg Val TyrIleTyr LemPheMet GlnIle
l L u Ala Tyr
Metn ys e
G
1 5 10 15
gcggttgat ccggtg getctggat ggcagtagt cac~cccaca gagaac 96
-
AlaValAsp ProVal AlaLeuAsp GlySerSer GlnProThr GluAsn
20 25 30
getgaaaaa gacgga ctgtgcaat gettgtacg tgc~agacag aataca 144
-
AlaGluLys AspGly LeuCysAsn AlaCysThr TrpArgGln AsnThr
35 40 45
aaatcctcd agaata gaagccata aaaattcaa atcctcagc aaactg 192
LysSerSer ArgIle GluAlaIle LysIleGln IlELeuSer LysLeu
50 55 60
cgcctggaa caagca cctaacatt agcagggac gttattaag cagett 240
ArgLeuGlu GlnAla ProAsnIle SerArgAsp Va.lIleLys GlnLeu
65 70 75 80
ttacccaaa getcct ccactgcag gaactgatt gatcagtat gatgtc 288
LeuProLys AlaPro ProLeuGln GluLeuIle As;pGlnTyr AspVal
CA 02319703 2001-08-08
23
85 90 95
cag tat 336
agg cat
gac
gac
agt
agc
gat
ggc
tct
ttg
gaa
gac
gat
gac
Gln Tyr
Arg His
Asp
Asp
Ser
Ser
Asp
Gly
Ser
Leu
Glu
Asp
Asp
Asp
100 105 110
gcc aca cct acg gatttt 384
aca atg gag ctt
acc tct
gag
acg
att
atc
Ala Thr Pro Thr Ser AspPhe
Thr Met Glu Leu
Thr
Glu
Thr
Ile
Ile
115 120 125
gtacaa aaa tgc ttctttaag tttagc 432
atg tgt tct
gag
gga
aaa
cca
Val Lys Cys PhePheLys PheSer Ser
Gln Cys
Met
Glu
Gly
Lys
Pro
130 135 140
aaaata tat aacaaa gta gca caattatgg atatac ttg 480
caa gta aag
LysIle Tyr Lys Val Ala GlnLeuTrp IleTyr Leu
Gln Asn Val Lys
145 150 155 160
aggcaa caa aaacct acg ttt gtgcagatc ctgaga ctc 528
gtc aca gtg
ArgGln Gln LysPro Thr Phe ValGlnIle LeuArg Leu
Val Thr Val
165 170 175
attaag atg aaagac aca tat actggaatt cgatct ttg 576
ccc ggt aga
IleLys Met LysAsp Thr Tyr ThrGlyIle ArgSer Leu
Pro Gly Arg
180 185 190
aaactt atg aaccca act atc tggcagagt attgat gtg 624
gac ggc ggt
LysLeu Met AsnPro Thr Ile TrpGln.Ser IieAsp Val
Asp Gly Gly
195 200 205
aagaca ctg caaaat ctc cag cctgaa.tcc aattta ggc 672
gtg tgg aaa
LysThr Leu GlnAsn Leu Gln ProGluSer AsnLeu Gly
Val Trp Lys
210 215
220
atcgaa aaa getttt gag gga cgagat;ctt getgtc aca 720
ata gat act
IleGlu Lys AlaPhe Glu Gly ArgAsF>Leu AlaVal Thr
Ile Asp Thr
225 230 235 240
ttccca ccg ggtgaa gga aac ccattt:tta gaggtc aga 768
gga gat ttg
PhePro Pro GlyGlu Gly Asn ProPhe:Leu GluVal Arg
Gly Asp Leu
245 250 255
gttaca aca ccgaaa tcc aga gatttt~ggc cttgac tgt 816
gac cgg cgc
ValThr Thr ProLys Ser Arg AspPh<sGly LeuAsp Cys
Asp Arg Arg
260 265 270
gatgag tca acggaa cga tgt cgctacccg ctg gtg 864
cac tcc tgt aca
AspGlu Ser ThrGlu Arg Cys ArgTy:rPro Leu Val
His Ser Cys Thr
275 280 285
gatttc get tttgga gac att atagc.acet aaa tac 912
gaa tgg tgg aga
AspPhe Ala PheGly Asp Ile IleAl~aPro Lys Tyr
Glu Trp Trp Arg
290 295 300
aaagcc tac tgctcc gaa gbgttt aaa 960
aat gga ttt cta
gaa cag
tgc
LysAla Tyr CysSer Glu ValPhe Lys
Asn Gly Phe Leu
Glu Gln
Cys
305 310 315 320
tacccg act cacctg ccc gca 1008
cac gta aga
cac ggc
caa tca
gca
aat
Tyr Thr HisLeu Ala
Pro Val
His His
Gln
Ala
Asn
Pro
Arg
Gly
Ser
325 330 335
CA 02319703 2001-08-08
' 24
ggc cct tgc tgc aca ccc acc aag atg tcc cct ata aac atg ctg tat 1056
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
ttc aat gga aaa gaa caa ata ata tat gga aag ata cca gcc atg gtt 1104
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
gta gat cgt tgc ggg tgc tca tga 1128
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 23
<211> 375
<212> PRT
<213> Callus gallus
<400> 23
Met Gln Lys Leu Ala Val Tyr Val Tyr Ile Tyr Leu Phe Met Gln Ile
1 5 10 15
Ala Val Asp Pro Val Ala Leu Asp Gly Ser Ser Gln. Pro Thr Glu Asn
20 25 30
Ala Glu Lys Asp Gly Leu Cys Asn Ala Cys Thr Trp~ Arg Gln Asn Thr
35 40 45
Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile: Leu Ser Lys Leu
50 55 60
Arg Leu Glu Gln Ala Pro Asn Ile Ser Arg Asp Val. Ile Lys Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Gln Glu Leu Ile Asp Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu
115 120 125
Val Gln Met Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser
13 0 13 5 14 ~D
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu
145 150 155 160
CA 02319703 2001-08-08
Arg Gln Val Gln Lys Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu. Ser Asn Leu Gly
210 215 220
Ile Glu Ile Lys Ala Phe Asp Glu Thr Giy Arg Asp Leu Ala Val Thr
225 230 235 240
Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe: Leu Glu Val Arg
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe: Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Va:L Phe Leu Gln Lys
305 310 315 320
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Il~e Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 24
<211> 1131
<212> DNA
<213> Rattus norvegiCUs
CA 02319703 2001-08-08
Y
26
<220>
<221>
CDS
<222> (1128)
(1)..
<400>
24 aaa caaatg tat tat atttacctg tttgtgctg 48
tt cc gtt
atga caa g
MetIle Lys ProGlnMet Tyr Tyr IleTyr PheValLeu
Gln Val Leu
1 5 10 15
attget getggc ccagtggat ctaaatgag gacagtgag agagaggcg 96
IleAla AlaGly ProValAsp Leu Glu AspSerGlu ArgGluAla
Asn
20 25 30
aatgtg gaaaaa gaggggctg tgtaatgcg tgtgcgtgg agacaaaac 144
AsnVal GluLys GluGlyLeu CysAsnAla CysAlaTrp ArgGlnAsn
35 40 45
acaagg tactcc agaatagaa gccataaaa attcaaatc ctcagtaaa 192
ThrArg TyrSer ArgIleGlu AlaIleLys IleGlnIle LeuSerLys
50 55 60
ctccgc ctggaa acagcgcct aacatcagc aaagatget ataagacaa 240
LeuArg LeuGlu ThrAlaPro AsnIleSer LysAspAla IleArgGln
65 70 75 80
cttctg cccaga gcgcctcca ctccgggaa ctgatcgat cagtacgac 288
LeuLeu ProArg AlaProPro LeuArgGlu LeuIleAsp GlnTyrAsp
85 90 95
gtccag agggat gacagcagt gacggctct ttggaagat gacgattat 336
ValGln ArgAsp AspSerSer AspGlySer LeuGluAsp AspAspTyr
100 105 110
cacget accacg gaaacaatc attaccatg cctacc:gag tctgacttt 384
HisAla ThrThr GluThrIle IleThrMet ProThrGlu SerAspPhe
115 120 125
ctaatg caagcg gatggaaag cccaaatgt tgcttt:ttt aaatttagc 432
LeuMet GlnAla AspGlyLys ProLysCys CysPhe:Phe LysPheSer
130 135 140
tctaaa atacag tacaacaaa gtggtaaag gcccac~ctg tggatatat 480
SerLys IleGln TyrAsnLys ValValLys AlaGlnLeu TrpIleTyr
145 150 155 160
ctgaga gccgtc aagactcct acaacagtg tttgtc~caa atcctgaga 528
LeuArg AlaVal LysThrPro ThrThrVal PheVa7LGln IleLeuArg
165 170 175
ctcatc aaaccc atgaaagac ggtacaagg tatacc:gga atccgatct 576
LeuIle LysPro MetLysAsp GlyThrArg TyrTh~_~Gly IleArgSer
180 185 190
ct aaa cttgac atgagccca ggcactggt atttggcag agtattgat 624
g
LeuLys LeuAsp MetSerPro GlyThrGly IleTrpGln SerIleAsp
195 200 205
gtg acagtg ttgcaa tggctcaaa cag gaa tcc tta 672
aag aat cc't aac
ValLys Thr LeuGln TrpLeuLys Gln Glu Ser Leu
Val Asn Pro Asn
210 215 220
CA 02319703 2001-08-08
' ~ 27
ggcatt gaaatcaaa getttggat gagaatggg catgat cttgetgta 720
GlyIle GluIleLys AlaLeuAsp GluAsnGly HisAsp LeuAlaVal
225 230 235 240
accttc ccaggacca ggagaagat gggctgaat cccttt ttagaagtc 768
ThrPhe ProGlyPro GlyGluAsp GIyLeuAsn ProPhe LeuGluVal
245 250 255
aaagta acagacaca cccaagagg tcccggaga gacttt gggcttgac 816
LysVal ThrAspThr ProLysArg SerArgArg AspPhe GlyLeuAsp
260 265 270
tgtgat gaacactcc acggaatcg cggtgctgt cgctac cccctcacg 864
CysAsp GluHisSer ThrGluSer ArgCysCys ArgTyr ProLeuThr
275 280 285
gtcgat ttcgaagcc tttggatgg gactggatt attgca cccaaaaga 912
ValAsp PheGluAla PheGlyTrp AspTrpIle IleAla ProLysArg
290 295 300
tataag getaattac tgctctgga gagtgtgaa ttt.gtg ttcttacaa 960
TyrLys AlaAsnTyr CysSerGly GluCysGlu Phe:Val PheLeuGln
305 310 315 320
aaatat ccgcatact catcttgtg caccaagca aac:ccc agaggctcg 1008
LysTyr ProHisThr HisLeuVal HisGlnAla AsnPro ArgGlySer
325 330 335
gcaggc ccttgctgc acgccaaca aaaatgtct ccc;att aatatgcta 1056
AlaGly ProCysCys ThrProThr LysMetSer ProIle AsnMetLeu
340 345 350
tatttt aatggcaaa gaacaaata atatatggg aaaatt ccagccatg 1104
TyrPhe AsnGlyLys GluGlnIle IleTyrGly LysIle ProAlaMet
355 360 365
gtagta gaccggtgt gggtgctcg tga 1131
ValVal AspArgCys GlyCysSer
370 375
<210> 25
<211> 376
<212> PRT
<213> Rattus gicus
norve
<400> 25
Met Ile Gln Lys Pro Gln Met Tyr Val Tyr Ile Tyr Leu Phe Val Leu
1 5 10 15
Ile Ala Ala Gly Pro Val Asp Leu Asn Glu Asp Ser Glu Arg Glu Ala
20 25 30
Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg G1n Asn
35 40 45
Thr Arg Tyr Ser Arg Ile Glu Ala Ile Lys Ile Gl.n Ile Leu Ser Lys
CA 02319703 2001-08-08
28
50 55 60
Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln
65 70 75 80
Leu Leu Pro Arg Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp
85 90 95
Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr
100 105 110
His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe
115 120 125
Leu Met Gln Ala Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser
130 135 140
Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr
150 155 160
145
Leu Arg Ala Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg
165 170 175
Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser
180 185 190
Leu Lys Leu Asp Met Ser Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp
195 200 205
Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu
210 215 220
Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly Hi~~ Asp Leu Ala Val
225 230 235 240
Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val
245 250 255
Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp
260 265 270
Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg_ Tyr Pro Leu Thr
275 280 285
Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg
300
290 295
CA 02319703 2001-08-08
~ ' 29
Tyr Lys Ala Asn Tyr Cys Ser Giy Glu Cys Glu Phe Val Phe Leu Gln
305 310 315 320
Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser
325 ~ 330 335
Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu
340 345 350
Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met
355 360 365
Val Val Asp Arg Cys Gly Cys Ser
370 375
<210> 26
<211> 1128
<212> DNA
<213> Meleagris gallopavo
<220>
<221> CDS
<222> (1) . . (1125)
<400>
26
atgcaaaag ctagcagtc tatgtt tatatttac ctgttcatg cagatt 48
MetGlnLys LeuAlaVal TyrVal TyrIleTyr LeuPheMet GlnIle
1 5 10 15
ttagttcat ccggtgget cttgat ggcagtagt cagcccaca gagaac 96
LeuValHis ProValAla LeuAsp GlySerSer GlnProThr GluAsn
20 25 30
getgaaaaa gacggactg tgcaat gettgcacg tggagacag aatact 144
AlaGluLys AspGlyLeu CysAsn AlaCysThr TrpArgGln AsnThr
35 40 45
aaatcctcc agaatagaa gccata aaaattcaa atcctcagc aaactg 192
LysSerSer ArgIleGlu AlaIle LysIleGin IleLeuSer LysLeu
50 55 60
cgcctggaa caagcacct aacatt agcagggac gttattaaa caactt 240
ArgLeuGlu GlnAlaPro AsnIle SerArgAsp ValIleLys GlnLeu
65 70 75 80
ttacccaaa getcctccg ctgcag gaactgatt gatcagtat gacgtc 288
LeuProLys AlaProPro LeuGln GluLeuIle AspGlnTyr AspVal
85 90 95
cagagagac gacagtagc gatggc tctttggaa gacgatgac tatcat 336
GlnArgAsp AspSerSer AspGly SerLeuGlu AspAspAsp TyrHis
100 105 110
gccacaacc gaaacgatt atcaca atgcctacg gac~tatgat tttctt 384
CA 02319703 2001-08-08
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu
115 12 12
0 5
gta atg aaacca aaatgttgc tttaag tttagctct 432
caa gag ttc
gga
Val Met LysPro LysCysCys PhePheLys PheSerSer
Gln Glu
Gly
130 135 140
aaa atacaatat aacaaagta gtaaaggca caattatgg atatacttg 480
Lys IleGlnTyr AsnLysVal ValLysAla GlnLeuTrp IleTyrLeu
145 150 155 160
agg caagtccaa aaacctaca acggtgttt gtgcagatc ctgagactc 528
Arg GlnValGln LysProThr ThrValPhe ValGlnIle LeuArgLeu
165 170 175
att aaacccatg aaagacggt acaagatat actggaatt cgatctttg 576
Ile LysProMet LysAspGly ThrArgTyr ThrGlyIle ArgSerLeu
~
180 185 190
aaa cttgacatg aacccaggc actggtatc tggcagagt attgatgtg 624
Lys LeuAspMet AsnProGly ThrGlyIle TrpGlnSer IleAspVal
195 200 205
aag acagtgttg caaaattgg ctcaaacag cctgaatcc aatttaggc 672
Lys ThrValLeu GlnAsnTrp LeuLysGln ProGluSer AsnLeuGly
210 215 220
ate gaaataaaa gettttgat gagaatgga cgagatctt getgtaaca 720
Ile GluIleLys AlaPheAsp GluAsnGly ArgAspLeu AlaValThr
225 230 235 240
ttc ccaggacca ggtgaagat ggactgaac ccattttta gaggtcaga 768
Phe ProGlyPro GlyGluAsp GlyLeuAsn ProPheLeu GluValArg
245 250 255
gtt acagacaca ccaaaacgg tcccgcaga gattttggc cttgactgc 816
Val ThrAspThr ProLysArg SerArgArg AspPhe;Gly LeuAspCys
260 265 270
gac gagcactca acggaatct cgatgttgt cgctacoccg ctgacagtg 864
Asp GluHisSer ThrGluSer ArgCysCys ArgTyrPro LeuThrVal
275 280 285
gat tttgaaget tttggatgg gactggatt atagCc'LCCt aaaagatac 912
Asp PheGluAla PheGlyTrp AspTrpIle IleAlaPro LysArgTyr
290 295 300
aaa gccaattac tgctctgga gaatgtgaa ttcgtattt ctacagaaa 960
Lys AlaAsnTyr CysSerGly GluCysGlu PheVa7LPhe LeuGlnLys
305 310 315 320
tac ccgcacact cacctggta caccaagca aatcca~aga ggctcagca 1008
Tyr ProHisThr HisLeuVal HisGlnAla AsnProArg SerAla
Gly
325 330 335
ggc ccttgctgc aca acc aagatg cctata ctg 1056
ccc tcc aac tat
atg
Gly Cys Thr Thr LysMetSer ProIle Leu
Pro Pro Asn Tyr
Cys Met
340 345 350
ttc aat aaa ata tat aag atg 1104
gga gaa ata gga at;a gtt
caa cca
gcc
Phe Glu Ile Tyr Il~
Asn Gln Ile Gly Pro
Gly Lys Ala
Lys Met
Val
CA 02319703 2001-08-08
31
355 360 365
gta gat cgt tgc ggg tgc tca tga 1128
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 27
<211> 375
<212> PRT
<213> Meleagris gallopavo
<400> 27
Met Gln Lys Leu Ala Val Tyr Val Tyr Ile Tyr Leu Phe Met Gln Ile
1 5 lp 15
Leu Val His Pro Val Ala Leu Asp Gly Ser Ser Gln Pro Thr Glu Asn
20 25 30
Ala Glu Lys Asp Gly Leu Cys Asn Ala Cys Thr Trp Arg Gln Asn Thr
35 40 45
Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu
50 55 60
Arg Leu Glu Gln Ala Pro Asn Ile Ser Arg Asp Val Ile Lys Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Gln Glu Leu Ile Asp Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu
115 120 125
Val Gln Met Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser
130 135 140
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu. Trp Ile Tyr Leu
145 150 155 160
Arg Gln Val Gln Lys Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
IIe Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
CA 02319703 2001-08-08
32
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 220
Ile Glu Ile Lys Ala Phe Asp Glu Asn Gly Arg Asp Leu Ala Val Thr
225 230 235 240
Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Arg
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys
305 310 315 320
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile: Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile: Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 28
<211> 1128
<212> DNA
<213> Sus scrofa
<220>
<221> CDS
<222> (1) . . (1125)
<400> 28
atg caa aaa ctg caa atc tat gtt tat att tac ctg ttt atg ctg att 48
Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile
_-___. .--.-__ _... _
CA 02319703 2001-08-08
' ' 33
1 5 10 15
gttgetggt ccc gatctgaat gagaacagc gagcaaaag gaaaat 96
gtg
ValAlaGly Pro AspLeuAsn GluAsnSer GluGlnLys GluAsn
Val
20 25 30
gtggaaaaa gagggg ctgtgtaat gcatgtatg tggagacaa aacact 144
ValGluLys GluGly LeuCysAsn AlaCysMet TrpArgGln AsnThr
35 40 45
aaatcttca agacta gaagccata aaaattcaa atcctcagt aaactt 192
LysSerSer ArgLeu GluAlaIle LysIleGln IleLeuSer LysLeu
50 55 60
cgcctggaa acaget cctaacatt agcaaagat getataaga caactt 240
ArgLeuGlu ThrAla ProAsnIle SerLysAsp AlaIleArg GlnLeu
65 70 75 80
ttgcccaaa getcct ccactccgg gaactgatt gatcagtac gatgtc 288
LeuProLys AlaPro ProLeuArg GluLeuIle AspGlnTyr AspVal
85 90 95
cagagagat gacagc agtgatggc tccttggaa gatgatgat tatcac 336
GlnArgAsp AspSer SerAspGly SerLeuGlu AspAspAsp TyrHis
100 105 110
getacgacg gaaacg atcattacc atgcctaca gagtctgat cttcta 384
AlaThrThr GluThr IleIleThr MetProThr GluSerAsp LeuLeu
115 120 125
atgcaagtg gaagga aaacccaaa tgctgcttc tttaaattt agctct 432
MetGlnVal GluGly LysProLys CysCysPhe PheLysPhe SerSer
130 135 140
aaaatacaa tacaat aaagtagta aaggcccaa ctgtggata tatctg 480
LysIleGln TyrAsn LysValVal LysAlaGln LeuTrpIle TyrLeu
145 150 155 160
agacccgtc aagact cctacaaca gtgtttgtg caaatcctg agactc 528
ArgProVal LysThr ProThrThr ValPheVal GlnIleLeu ArgLeu
165 170 175
atcaaaccc atgaaa gacggtaca aggtatact ggaatccga tctctg 576
IleLysPro MetLys AspGlyThr ArgTyrThr GlyIleArg SerLeu
180 185 190
aaacttgac atgaac ccaggcact ggtatttgg cagagcatt gatgtg 624
LysLeuAsp MetAsn ProGlyThr GlyIleTrp GlnSerIle AspVal
195 200 205
aagacagtg ttgcaa aattggctc aaacaacct gaatccaac ttaggc 672
LysThrVal LeuGln AsnTrpLeu LysGlnPro GluSerAsn LeuGly
210 215 220
attgaaatc aaaget ttagatgag aatggtcat gatcttget gtaacc 720
IleGluIle LysAla LeuAspGlu AsnGlyHis AspLeuAla ValThr
225 230 235 240
ttcccagga ccagga gaagatggg ctgaatccc ttt.ttagaa gtcaag 768
Phe Gly Gly GIuAspGly AsnPro LeuGlu Lys
Pro Pro Leu Phe: Val
245 250 255
CA 02319703 2001-08-08
' v 34
gtaaca gacacacca aaaagatcc aggagagat tttggactc gactgt 816
ValThr AspThrPro LysArgSer ArgArgAsp PheGlyLeu AspCys
260 265 270
gatgag cactcaaca gaatctcga tgctgtcgt taccctcta actgtg 864
AspGlu HisSerThr GluSerArg CysCysArg TyrProLeu ThrVal
275 280 285
gatttt gaagetttt ggatgggac tggattatt gcacccaaa agatat 912
AspPhe GluAlaPhe GlyTrpAsp TrpIleIle AlaProLys ArgTyr
290 295 300
aaggcc aattactgc tctggagag tgtgaattt gtattttta caaaaa 960
LysAla AsnTyrCys SerGlyGlu CysGluPhe ValPheLeu GlnLys
305 310 315 320
taccct cacactcat cttgtgcac caagcaaac cccagaggt tcagca 1008
TyrPro HisThrHis LeuValHis GlnAlaAsn ProArgGly SerAla
325 330 335
ggcccc tgctgtact cccacaaag atgtctcca atcaatatg ctatat 1056
GlyPro CysCysThr ProThrLys MetSerPro IleAsnMet LeuTyr
340 345 350
tttaat ggcaaagaa caaataata tatgggaaa attccagcc atggta 1104
PheAsn GlyLysGlu GlnIleIle TyrGlyLys IleProAla MetVal
355 360 365
gtagat cgctgtggg tgctcatga 1128
ValAsp ArgCysGly CysSer
370 375
<210> 29
<211> 375
<212> PRT
<213> Susscrofa
<400> 29
Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile
1 5 10 15
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
20 25 30
Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Met Trp Arg Gln Asn Thr
35 40 45
Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu
50 55 60
Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala. Ile Arg Gln Leu
65 70 75 80
CA 02319703 2001-08-08
Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Leu Leu
115 120 125
Met Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser
130 135 140
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu
145 150 155 160
Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
195 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 220
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr
225 230 235 240
Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val_ Phe Leu Gln Lys
305 310 315 320
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala
-.____..~~,~., ka..~.~---- - _~..
CA 02319703 2001-08-08
' ~ 36
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 30
<211> 1128
<212> DNA
<213> Ovis aries
<220>
<221> CDS
<222> (1) . . (1125)
<400>
30
atgcaaaaa ctgcaa atctttgtt tatatttac ctatttatg ctgctt 48
MetGlnLys LeuGln IlePheVal TyrIleTyr LeuPheMet LeuLeu
1 5 10 15
gt getggc ccagtg gatctgaat gagaacagc gac~cagaag gaaaat 96
t
ValAlaGly ProVal AspLeuAsn GluAsnSer GluGlnys GluAsn
L
20 25 30
gtggaaaaa aagggg ctgtgtaat gcatgcttg tg<~agacaa aacaat 144
ValGluLys LysGly LeuCysAsn AlaCysLeu TrpArgGln AsnAsn
35 40 ~ 45
aaatcctca agacta gaagccata aaaatccaa atcctcagt aagctt 192
LysSerSer ArgLeu GluAlaIle LysIleGln I1<:LeuSer LysLeu
50 55 60
cg ctggaa acaget cctaacatc agcaaagat getataaga caactt 240
c
ArgLeuGlu ThrAla ProAsnIle SerLysAsp AlaIleArg GlnLeu
65 70 75 80
ttgcccaag getcct ccactccgg gaactgatt gatcagtac gatgtc 288
LeuProLys AlaPro ProLeuArg GluLeuIle AspGlnTyr AspVal
85 90 95
cagagagat gacagc agcgacggc tccttggaa gacgatgac taccac 336
GlnArgAsp AspSer SerAspGly SerLeuGlu As;pAspAsp TyrHis
100 105 110
gttacgacg gaaacg gtcattacc atgcccacg gagtctgat cttcta 384
ValThrThr GluThr ValIleThr MetProThr GluSerAsp LeuLeu
115 120 125
gcagaagtg caagaa aaacccaaa tgttgcttc tttaaattt agctct 432
AlaGluVal GlnGlu LysProLys CysCysPhe PheLysPhe SerSer
130 135 140
__-- _~_ _ __ I
CA 02319703 2001-08-08
9
37
aag aaa caactgtgg atatatctg 480
ata gta
caa gta
cac aag
aat gcc
Lys Lys Leu IleTyrLeu
Ile Vai Trp
Gln Val
His Lys
Asn Ala
Gln
145
150 155 160
aag cct aca ttt gtgcaaatc ctgagactc 528
act aca gtg
a
cct
gtc
a
_ Pro Thr Phe ValGlnIle LeuArgLeu
g Thr Val
Arg
Pro
Val
Lys
Thr
165 170 175
atcaaa ccc gac aca tat actggaatc cgatctctg 576
atg aaa ggt agg
IleLys Pro Asp Thr Tyr ThrGlyIle ArgSerLeu
Met Lys G1y Arg
180 185 190
aaactt gac aaccca act att tggcagagc attgatgtg 624
atg ggc ggt
LysLeu Asp AsnPro Thr Ile TrpGlnSer IleAspVal
Met Gly Gly
195 200 205
aagaca gtg caaaac ctc caa cctgaatcc aacttaggc 672
ttg tgg aaa
LysThr Val GlnAsn Leu Gln ProGluSer AsnLeuGly
Leu Trp Lys
210 215 220
attgaa atc gettta gag ggt catgatctt getgtaacc 720
aaa gat aat
IleGlu Ile AlaLeu Glu Gly HisAspLeu AlaValThr
Lys Asp Asn
225 230 235 240
ttccca gaa ggagaa gga aat cctttttta gaagtcaag 768
cca gaa ctg
PhePro Glu GlyGlu Gly Asn ProPheLeu GluValLys
Pro Glu Leu
245 250 255
gtaaca gac ccaaaa tct aga gattttggg cttgattgt 816
aca aga agg
ValThr Asp ProLys Ser Arg AspPheGly LeuAspCys
Thr Arg Arg
260 265 270
gatgag cac acagaa cga tgt cgttaccct ctaactgtg 864
tcc tct tgc
AspGlu His ThrGlu Arg Cys ArgTyrPro LeuThrVal
Ser Ser Cys
275 280 285
gatttt gaa tttgga gat att attgca,cct aaaagatat 912
get tgg tgg
AspPhe Glu PheGly Asp Ile IleAla.Pro LysArgTyr
Ala Trp Trp
290 295
3
0
0~
aaggcc aat tgctct gaa gaa tttttattt ttgcaaaag 960
tac gga tgt
LysAla Asn CysSer Glu Glu PheLeuPhe LeuGlnLys
Tyr Gly Cys
305 310 315 320
tatcct cat catctt cac gca aacccc;aaa ggttcagcc 1008
acc gtg caa
TyrPro His HisLeu His Ala Asn Lys GlySerAla
Thr Val Gln Pro
325 330 335
c cct tgc act aag tct cca aat atgcta 1056
tgt cct atg att: tat
aca
gg Pro Cys Thr Lys Ser Pro Asn Leu
GlyCys Pro Met Ile: Met Tyr
Thr
340 345 350
tttaat ggc gaa ata ggg cca atg 1104
aaa caa tat aag ggc gta
ata att
PheAsn Gly Glu Ile Pro
Lys Gln Tyr Gly
Ile Gly Met
Lys Val
Ile
355 360 365
gta ggg 1128
gat tgc
cgc tca
tgt tga
Val Gly
Asp Cys
Arg Ser
Cys
370 375
CA 02319703 2001-08-08
38
<210> 31
<211> 375
<212> PRT
<213> Ovis aries
<400> 31
Met Gln Lys Leu Gln Ile Phe Val Tyr Ile Tyr Leu Phe Met Leu Leu
1 5 10 15
Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn
20 25 30
Val Glu Lys Lys Gly Leu Cys Asn Ala Cys Leu Trp Arg Gln Asn Asn
35 40 45
Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu
50 55 60
Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu
65 70 75 80
Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val
85 90 95
Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His
100 105 110
Val Thr Thr Glu Thr Val Ile Thr Met Pro Thr Glu Ser Asp Leu Leu
115 120 125
Ala Glu Val Gln Glu Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser
130 135 140
Lys Ile Gln His Asn Lys Val Val Lys Ala Gln Leu. Trp Ile Tyr Leu
145 150 155 160
Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu
165 170 175
Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu
180 185 190
Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val
lg5 200 205
Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly
210 215 220
CA 02319703 2001-08-08
r
' 39
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr
225 230 235 240
Phe Pro Glu Pro Gly Glu Glu Gly Leu Asn Pro Phe Leu Glu Val Lys
245 250 255
Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys
260 265 270
Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
275 280 285
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
290 295 300
Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Leu Phe Leu Gln Lys
305 310 315 320
Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Lys Gly Ser Ala
325 330 335
Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
340 345 350
Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val
355 360 365
Val Asp Arg Cys Gly Cys Ser
370 375
<210> 32
<211> 480
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (1) . . (390)
<400> 32
gaa gat ggg ctg aat ccc ttt tta gaa gtc aaa gta. aca gac aca ccc 48
Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val. Thr Asp Thr Pro
1 5 10 15
aag agg tcc cgg aga gac ttt ggg ctt gac tgt gat: gaa cac tcc acg 96
Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr
20 25 30
gaa tcg cgg tgc tgt cgc tac ccc ctc acg gtc gat: ttc gaa gcc ttt 144
CA 02319703 2001-08-08
GluSerArg CysCysArg TyrProLeu ThrValAsp PheGluAla Phe
35 40 45
a tgggac tggattatt gcacccaaa agatataag getaattac tgc 192
gg TrpAsp TrpIleIle AlaProLys ArgTyrLys AlaAsnTyr Cys
Gly
55 60
tctggagag tgtgaattt gtgttctta caaaaatat ccgcatact cat 240
SerGlyGlu CysGluPhe ValPheLeu GlnLysTyr ProHisThr His
65 70 75 80
cttgtgcac caagcaaac cccagaggc tcggcaggc ccttgctgc acg 288
LeuValHis GlnAlaAsn ProArgGly SerAlaGly ProCysCys Thr
85 90 95
ccaacaaaa atgtctccc attaatatg ctatatttt aatggcaaa gaa 336
ProThrLys MetSerPro IleAsnMet LeuTyrPhe AsnGlyLys Glu
100 105 110
caaataata tatgggaaa attccagcc atggtagta gaccggtgt ggg 384
GlnIleIle TyrGlyLys IleProAla MetValVal AspArgCys Gly
115 120 125
tgctcgtga gctttgcattagctt ta tccca ggaaggtcttcccc 440
aaatt aatcgt.
CysSer
130
tcgatttcga aactgtgaat tatgtacca 480
t caggctgtag
<210> 33
<211> 130
<212> PRT
<213> Rattus
norvegicus
<400> 33
Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Va:l Thr Asp Thr Pro
1 5 10 15
Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr
20 25 30
Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val As:p Phe Glu Ala Phe
35 40 45
Gly.Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys
50 55 60
Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His
65 70 75 80
Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gl.y Pro Cys Cys Thr
85 90 95
CA 02319703 2001-08-08
Y
° 41
Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu
100 105 110
Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly
115 120 125
Cys Ser
130
<210> 34
<211> 790
<212> DNA
<213> Gallus gallus
<220>
<221> CDS
<222> (1) . . (678)
<400>
34
ttagtagta aaggca caattatgg atatacttg aggfcaagtc caaaaa 48
LeuValVal LysAla GlnLeuTrp IleTyrLeu Aro~GlnVal GlnLys
1 5 10 15
cctacaacg gtgttt gtgcagatc ctgagactc att;aagccc atgaaa 96
ProThrThr ValPhe ValGlnIle LeuArgLeu Ile:LysPro MetLys
20 25 30
gacggtaca agatat actggaatt ggatctttg aaacttgac atgaac 144
AspGlyThr ArgTyr ThrGlyIle GlySerLeu Ly:>LeuAsp MetAsn
35 40 ' 45
ccaggcact ggtatc tggcagagt attgatgtg aac~acagtg ctgcaa 192
-
ProGlyThr GlyIle TrpGlnSer IleAspVal Ly:~ThrVal LeuGln
50 55 60
aattggctc aaacag cctgaatcc aatttaggc atcgaaata aaaget 240
AsnTrpLeu LysGln ProGluSer AsnLeuGly Ile:GluIle LysAla
65 70 75 80
tttgatgag actgga cgagatett getgtcaca ttcccagga ccgggt 288
PheAspGlu ThrGly ArgAspLeu AlaValThr PheProGly ProGly
85 90 95
gaagatgga ttgaac ccattttta gaggtcaga gtttacagac acaccg 336
GluAspGly LeuAsn ProPheLeu GluValArg Va.1ThrAsp ThrPro
100 105 110
aaacggtcc cgcaga gattttggc cttgactgt gatgagcac tcaacg 384
LysArgSer ArgArg AspPheGly LeuAspCys As;pGluHis SerThr
115 120 125
gaatcccga tgttgt cgctacccg ctgacagtg gatttcgaa getttt 432
GluSerArg CysCys ArgTyrPro LeuThrVal As;pPheGlu AlaPhe
13 13 14
0 5 0
ggatgggac tggatt atagcacct aaaagatac aaagccaat tactgc 480
GlyTrpAsp TrpIle IleAlaPro LysArgTyr LysAlaAsn TyrCys
145 150 155 160
CA 02319703 2001-08-08
P
d
42
tccggagaatgc gaatttgtg tttctacag aaatac ccgcacact cac 528
SerGlyGluCys GluPheVal PheLeuGln LysTyr ProHisThr His
165 170 175
ctggtacaccaa gcaaatccc agaggctca gcaggc ccttgctgc aca 576
LeuValHisGln AlaAsnPro ArgGlySer AlaGly ProCys.CysThr
180 185 190
cccaccaagatg tcccctata aacatgctg tatttc aatggaaaa gaa 624
ProThrLysMet SerProIle AsnMetLeu TyrPhe AsnGlyLys Glu
195 200 205
caaataatatat ggaaagata ccagccatg gttgta gatcgttgc ggg 672
GlnIleIleTyr GlyLysI1e ProAlaMet ValVal AspArgCys Gly
210 215 220
tgctcatgaggctgtc gtgagatcca gccaccaaaa 728
ccattcgata
aattgtc~gaa
_
CysSer
225
aaaaaagcta tatcccct ca attacgtacg etaggcattg
788
tccatctttg
aaactgtgaa
790
cc
<210> 35
<211> 226
<212> PRT
<213> Gallus gallus
<400> 35
Leu Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Gln Val Gln Lys
1 5 10 15
Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys
20 25 30
Asp Gly Thr Arg Tyr Thr Gly Ile Gly Ser Leu Lys Leu Asp Met Asn
35 40 45
Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln
50 55 60
Asn.Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala
65 70 75 80
Phe Asp Glu Thr Gly Arg Asp Leu Ala Val Thr Phe Pro Gly Pro Gly
g5 g0 95
Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Arg Val Thr Asp Thr Pro
100 105 110
_-._~.__._ ~* _. r_
CA 02319703 2001-08-08
' ~ 43
Lys Arg Ser Arg Arg Asp Phe Giy Leu Asp Cys Asp Glu His Ser Thr
115 120 125
Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe
130 135 140
Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys
150 155 160
145
Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His
165 170 175
Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr
180 185 190
Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe: Asn Gly Lys Glu
195 200 205
Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Va7L Asp Arg Cys Gly
210 215 220
Cys Ser
225
<210> 36
<211> 123
<212> PRT
<213> Homo Sapiens
<400> 36
Arg Pro Arg Arg Asp Ala Glu Pro Val Leu Gly Gly Gly Pro Gly Gly
1 5 10 15
Ala Cys Arg Ala Arg Arg Leu Tyr Val Ser Phe Arg Glu Val Gly Trp
20 25 30
His Arg Trp Val Ile Ala Pro Arg Gly Phe Leu Ala Asn Tyr Cys Gln
35 40 45
Gly Gln Cys Ala Leu Pro Val Ala Leu Ser Gly Ser Gly Gly Pro Pro
50 55 60
Ala Leu Asn His Ala Val Leu Arg Ala Leu Met His Ala Ala Ala Pro
65 70 75 80
Gly Ala Ala Asp Leu Pro Cys Cys Val Pro Ala Arg Leu Ser Pro Ile
85 90 95
Ser Val Leu Phe Phe Asp Asn Ser Asp Asn Val Val Leu Arg Gln Tyr
100 105 110
Glu Asp Met Val Val Asp Glu Cys Gly Cys Arg
CA 02319703 2001-08-08
44
115 120
<210> 37
<211> 118
<212> PRT
<213> Homo Sapiens
<400> 37
Arg Glu Lys Arg Gln Ala Lys His Lys Gln Arg Lys Arg Leu Lys Ser
1 5 10 15
Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp
20 25 30
Asn Asp Trp Ile Val Ala. Pro Pro Gly Tyr His Ala Phe Tyr Cys His
35 40 45
Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His
50 55 60
Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Lys Ile Pro Lys
65 70 75 80
Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Ser Met Leu Tyr Leu
85 90 95
Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gln Asp Met Val Val
100 105 110
Glu Gly Cys Gly Cys Arg
115
<210> 38
<211> 118
<212> PRT
<213> Homo sapiens
<400> 38
Lys Arg Ser Pro Lys His His Ser Gln Arg Ala Arg Lys Lys Asn Lys
1 5 10 15
Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp
20 25 30
Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala. Phe Tyr Cys His
35 40 45
Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His
50 55 60
Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Sex' Ser Ile Pro Lys
65 70 75 80
Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Sex: Met Leu Tyr Leu
85 90 95
Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu Met Val Val
100 105 110
CA 02319703 2001-08-08
Glu Gly Cys Gly Cys Arg
115
<210> 39
<211> 119
<212> PRT
<2I3> Homo Sapiens
<400> 39
Ser Arg Gly Ser Gly Ser Ser Asp Tyr Asn Gly Ser Glu Leu Lys Thr
1 5 10 15
Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Gln Asp Leu Gly Trp
20 25 30
Gln Asp Trp Ile Ile Ala Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp
35 40 45
Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His
55 60
Ala Ile Val Gln Thr Leu Val His Leu Met Asn Pro Glu Tyr Val Pro
65 70 75 80
Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala Ile Ser Val Leu Tyr
85 90 95
Phe Asp Asp Asn Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val
100 105 110
Val Arg Ala Cys Gly Cys His
115
<210> 40
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 40
Leu Arg Met Ala Asn Val Ala Glu Asn Ser Ser Ser Asp Gln Arg Gln
1 5 10 15
Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Ar<~ Asp Leu Gly Trp
20 25 30
Gln Asp Trp Ile Ile Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu
35 40 45
Gly Glu Cys Ala Phe Pro Leu Asn Ser Tyr Met Assn Ala Thr Asn His
50 55 60
Ala Ile Val Gln Thr Leu Val His Phe Ile Asn Pro Glu Thr Val Pro
65 70 75 80
Lys Pro Cys Cys Ala Pro Thr Gln Leu Asn Ala Ile Ser Val Leu Tyr
85 90 95
Phe Asp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val
100 105 110
CA 02319703 2001-08-08
r
46
Val Arg Ala Cys Gly Cys His
115
<210> 41
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 41
Ser Arg Met Ser Ser Val Gly Asp Tyr Asn Thr Ser Glu Gln Lys Gln
1 5 10 15
Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp
20 25 30
Gln Asp Trp Ile Ile Ala Pro Glu Gly Tyr Ala Ala Phe Tyr Cys Asp
35 40 45
Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His
50 55 60
Ala Ile Val Gln Thr Leu Val His Leu Met Phe Pro Asp His Val Pro
65 70 75 80
Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala Ile Ser Val Leu Tyr
85 90 95
Phe Asp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val
100 105 110
Val Arg Ser Cys Gly Cys His
115
<210> 42
<211> 120
<212> PRT
<213> Homo Sapiens
<400> 42
Glu Gln Thr Leu Lys Lys Ala Arg Arg Lys Gln Trp Ile Glu Pro Arg
1 5 . 10 15
Asn Cys Ala Arg Arg Tyr Leu Lys Val Asp Phe Ala Asp Ile Gly Trp
20 25 30
Ser Glu Trp Ile Ile Ser Pro Lys Ser Phe Asp Ala Tyr Tyr Cys Ser
35 40 45
Gly Ala Cys Gln Phe Pro Met Pro Lys Ser Leu Ly,a Pro Ser Asn His
50 55 60
Ala Thr Ile Gln Ser Ile Val Arg Ala Val Gly Val Val Pro Gly Ile
65 70 75 80
Pro Glu Pro Cys Cys Val Pro Glu Lys Met Ser Ser Leu Ser Ile Leu
85 90 95
Phe Phe Asp Glu Asn Lys Asn Val Val Leu Lys Val Tyr Pro Asn Met
i
CA 02319703 2001-08-08
r
47
100 105 110
Thr Val Glu Ser Cys Ala Cys Arg
115 120
<210> 43
<211> 116
<212> PRT
<213> Homo Sapiens
<400> 43
G1y Pro Gly Arg Ala Gln Arg Ser Ala Gly Ala Thr Ala Ala Asp Gly
1 5 10 15
Pro Cys Ala Leu Arg Glu Leu Ser Val Asp Leu Arg Ala Glu Arg Ser
20 25 30
Val Leu Ile Pro Glu Thr Tyr Gln Ala Asn Asn Cys Gln Gly Val Cys
35 40 45
Gly Trp Pro Gln Ser Asp Arg Asn Pro Arg Tyr Gly Asn His Val Val
50 55 60
Leu Leu Leu Lys Met Gln Ala Arg Gly Ala Ala Leu Ala Arg Pro Pro
65 70 75 80
Cys Cys Val Pro Thr Ala Tyr Ala Gly Lys Leu Leu Ile Ser Leu Ser
85 90 95
Glu Glu Arg Ile Ser Ala His His Val Pro Asn Met Val Ala Thr Glu
100 105 110
Cys Gly Cys Arg
115
<210> 44
<211> 122
<212> PRT
<213> Homo Sapiens
<400> 44
Ala Leu Arg Leu Leu Gln Arg Pro Pro Glu Glu Pro Ala Ala His Ala
1 5 10 15
Asn Cys His Arg Val Ala Leu Asn Ile Ser Phe Gln Glu Leu Gly Trp
20 25 30
Glu Arg Trp Ile Val Tyr Pro Pro Ser Phe Ile Phe His Tyr Cys His
35 40 45
Gly Gly Cys Gly Leu His Ile Pro Pro Asn Leu Ser Leu Pro Val Pro
50 55 60
Gly Ala Pro Pro Thr Pro Ala Gln Pro Tyr Ser Leu Leu Pro Gly Ala
65 70 75 80
Gln Pro Cys Cys Ala Ala Leu Pro Gly Thr Met Arg Pro Leu His Val
85 90 95
CA 02319703 2001-08-08
w
48
Arg Thr Thr Ser Asp Gly Gly Tyr Ser Phe Lys Tyr Glu Thr Val Pro
100 105 110
Asn Leu Leu Thr Gln His Cys Aia Cys Ile
115 120
<210> 45
<211> 122
<212> PRT
<213> Homo Sapiens
<400> 45
His Arg Arg Arg Arg Arg Gly Leu Glu Cys Asp Gly Lys Val Asn Ile
1 5 10 15
Cys Cys Lys Lys Gln Phe Phe Val Ser Phe Lys Asp Ile Gly Trp Asn
20 25 30
Asp Trp Ile Ile Ala Pro Ser Gly Tyr His Ala Asn. Tyr Cys Glu Gly
35 40 45
Glu Cys Pro Ser His Ile Ala Gly Thr Ser Gly Ser Ser Leu Ser Phe
50 55 60
His Ser Thr Val Ile Asn His Tyr Arg Met Arg Gly His Ser Pro Phe
65 70 75 80
Ala Asn Leu Lys Ser Cys Cys Val Pro Thr Lys Leu Arg Pro Met Ser
85 90 95
Met Leu Tyr Tyr Asp Asp Gly Gln Asn Ile Ile Lys Lys Asp Ile Gln
100 105 110
Asn Met Ile VaT Glu Glu Cys Gly Cys Ser
115 120
<210> 46
<211> 121
<212> PRT
<213> Homo Sapiens
<400> 46
His Arg Ile Arg Lys Arg Gly Leu Glu Cys Asp G1~~ Arg Thr Asn Leu
1 5 10 15
Cys Cys Arg Gln Gln Phe Phe Ile Asp Phe Arg Leu Ile Gly Trp Asn
20 25 30
Asp Trp Ile Ile Ala Pro Thr Gly Tyr Tyr Gly Assn Tyr Cys Glu Gly
35 40 45
Ser Cys Pro Ala Tyr Leu Ala Gly Val Pro Gly Ser Ala Ser Ser Phe
50 55 60
His Thr Ala Val Val Asn Gln Tyr Arg Met Arg Gly Leu Asn Pro Gly
65 70 75 80
Thr Val Asn Ser Cys Cys Ile Fro Thr Lys Leu Ser Thr Met Ser Met
85 90 95
CA 02319703 2001-08-08
49
Leu Tyr Phe Asp Asp Glu Tyr Asn Ile Val Lys Arg Asp Val Pro Asn
100 105 110
Met Ile Val Glu Glu Cys Gly Cys Ala
115 120
<210> 47
<211> 115
<212> PRT
<213> Homo sapiens
<400> 47
His Arg Arg Ala Leu Asp Thr Asn Tyr Cys Phe Ser Ser Thr Glu Lys
1 5 10 15
Asn Cys Cys Val Arg Gln Leu Tyr Ile Asp Phe Arch Lys Asp Leu Gly
20 25 30
Trp Lys Trp Ile His Glu Pro Lys Gly Tyr His Ala Asn Phe Cys Leu
35 40 45
Gly Pro Cys Pro Tyr Ile Trp Ser Leu Asp Thr Gln Tyr Ser Lys Val
50 55 60
Leu Ala Leu Tyr Asn Gln His Asn Pro Gly Ala Ser Ala Ala Pro Cys
65 70 75 80
Cys Val Pro Gln Ala Leu Glu Pro Leu Pro Ile Val Tyr Tyr Val Gly
85 90 95
Arg Lys Pro Lys Val Glu Gln Leu Ser Asn Met Ile Val Arg Ser Cys
100 105 110
Lys Cys Ser
115
<210> 48
<211> 115
<212> PRT
<213> Homo sapiens
<400> 48
Lys Lys Arg Ala Leu Asp Ala Ala Tyr Cys Phe Arg Asn Val Gln Asp
1 5 10 15
Asn Cys Cys Leu Arg Pro Leu Tyr Ile Asp Phe Lys Arg Asp Leu Gly
20 25 30
Trp Lys Trp Ile His Glu Pro Lys Gly Tyr Asn Ala Asn Phe Cys Ala
35 40 45
Gly Ala Cys Pro Tyr Leu Trp Ser Ser Asp Thr Gl.n His Ser Arg Val
50 55 60~
Leu Ser Leu Tyr Asn Thr Ile Asn Pro Glu Ala Se:r Ala Ser Pro Cys
65 70 75 BO
Cys Val Ser Gln Asp Leu Glu Pro Leu Thr Ile Le:u Tyr Tyr Ile Gly
CA 02319703 2001-08-08
85 90 95
Lys Thr Pro Lys Ile Glu Gln Leu Ser Asn Met Ile Val Lys Ser Cys
100 105 110
Lys Cys Ser
115
<210> 49
<211> 115
<212> PRT
<213> Homo Sapiens
<400> 49
Lys Lys Arg Ala Leu Asp Thr Asn Tyr Cys Phe Arg Asn Leu Glu Glu
1 5 10 15
Asn Cys Cys Val Arg Pro Leu Tyr Ile Asp Phe Arg Gln Asp Leu Gly
20 25 30
Trp Lys Trp Val His Glu Pro Lys Gly Tyr Tyr Ala Asn Phe Cys Ser
35 40 45
Gly Pro Cys Pro Tyr Leu Arg Ser Ala Asp Thr Thr His Ser Thr Val
50 55 60
Leu Gly Leu Tyr Asn Thr Leu Asn Pro Glu Ala Ser Ala Ser Pro Cys
65 70 75 80
Cys Val Pro Gln Asp Leu Glu Pro Leu Thr Ile Leu Tyr Tyr Val Gly
85 90 95
Arg Thr Pro Lys Val Glu Gln Leu Ser Asn Met Val Val Lys Ser Cys
100 105 110
Leu Cys Ser
115
<210> 50
<211> 4
<212> PRT
<213> Artificial
<220>
<223> proteolytic cleavage site
<220>
<221> VARIANT
<222> {1) . . (4)
<223> Xaa = Any Amino Acid
<400> 50
Arg Xaa Xaa Arg
1
<210> 51
<211> 4
<212> PRT
I;
CA 02319703 2001-08-08
SI
<213> Artificial
<220>
<223> Eukaryotic- proteolytic processing site
<400> 51
Arg Ser Arg Arg
1
<210> 52
<211> 405
<212> PRT
<213> Mus musculus
<400> 52
Met Val Leu Ala Ala Pro Leu Leu Leu Gly Phe Leu Leu Leu Ala Leu
1 5 10 15
Glu Leu Arg Pro Arg Gly Glu Ala Ala Glu Gly Prcr Ala Ala Ala Ala
20 25 30
Ala Ala Ala Ala Ala Ala Ala Gly Val Gly Gly Glu Arg Ser Ser Arg
35 40 45
Pro Ala Pro Ser Ala Pro Pro Glu Pro Asp Gly Cy~o Pro Val Cys Val
50 55 60
Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu Ser Ile Lys Ser Gln
65 70 75 80
Ile Leu Ser Lys Leu Arg Leu Lys Glu Ala Pro Asn Ile Ser Arg Glu
85 90 95
Val Val Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Gln Ile Leu
100 105 110
Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln Pro Glu Asp Phe Leu
115 120 125
Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr Val Ile Ser Met Ala
130 135 140
Gln Glu Thr Asp Pro Ala Val Gln Thr Asp Gly Ser Pro Leu Cys Cys
145 150 155 160
His Phe His Phe Ser Pro Lys Val Met Phe Asn Lys Val Leu Lys Ala
I65 170 175
Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg Pro Ala Thr Val Tyr
180 185 190
Leu Gln Ile Leu Arg Leu Lys Pro Leu Thr Gly Glu Gly Thr Ala Gly
195 200 205
Gly Gly Gly Gly Gly Arg Arg His Ile Arg Ile Arg Ser Leu Lys Ile
210 215 220
Glu Leu His Ser Arg Ser Gly His Trp Gln Ser Il~e Asp Phe Lys Gln
225 230 235 240
CA 02319703 2001-08-08
ca
52
Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser Asn Trp Gly Ile Glu
245 250 255
Ile Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu Ala Val Thr Ser Leu
260 265 270
Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met Glu Leu Arg Val Leu
275 280 285
Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly Leu Asp Cys Asp Glu
290 295 300
His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe
305 310 315 320
Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala
325 330 335
Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe Met Gln Lys Tyr Pro
340 345 350
His Thr His Leu Val Gln Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro
355 360 365
Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn
370 375 380
Asp Lys Gln Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val Val Asp
385 390 395 400
Arg Cys Gly Cys Ser
405
<210> 53
<211> 407
<212> PRT
<213> Homo Sapiens
<400> 53
Met Val Leu Ala Ala Pro Leu Leu Leu Gly Phe Leu Leu Leu Ala Leu
1 5 10 15
Glu Leu Arg Pro Arg Gly Glu Ala Ala Glu Gly Pro Ala Ala Ala Ala
20 25 30
Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Val Gly Gly Giu Arg Ser
35 40 45
Ser Arg Pro Ala Pro Ser Val Ala Pro Glu Pro Asp Gly Cys Pro Val
50 55 60
Cys Val Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu Ser Ile Lys
65 70 75 80
Ser Gln Ile Leu Ser Lys Leu Arg Leu Lys Glu Ala Pro Asn Ile Ser
85 90 95
Arg Glu Val Val Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Gln
100 105 110
CA 02319703 2001-08-08
53
Ile Leu Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln Pro Glu Asp
115 120 125
Phe Leu Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr Val Ile Ser
130 135 140
Met Ala Gln Glu Thr Asp Pro Ala Val Gln Thr Asp Gly Ser Pro Leu
145 150 155 160
Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr Lys Val Leu
165 170 175
Lys Ala Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg Pro Ala Thr
180 185 190
Val Tyr Leu Gln Ile Leu Arg Leu Lys Pro Leu Thr Gly Glu Gly Thr
195 200 205
Ala Gly Gly Gly Gly Gly Gly Arg Arg His Ile Arg Ile Arg Ser Leu
210 215 220
Lys Ile Glu Leu His Ser Arg Ser Gly His Trp Gln Ser Ile Asp Phe
225 230 235 240
Lys Gln Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser Asn Trp Gly
245 250 255
Ile Glu Ile Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu Ala Val Thr
260 265 270
Ser Leu Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met Glu Leu Arg
275 280 285
Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly Leu Asp Cys
290 295 300
Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val
305 310 315 320
Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr
325 330 335
Lys Ala Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe Met Gln Lys
340 345 350
Tyr Pro His Thr His Leu Val Gln Gln Ala Asn Pro Arg Gly Ser Ala
355 360 365
Gly_Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr
370 375 380
Phe Asn Asp Lys Gln Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val
385 390 395 400
Val Asp Arg Cys Gly Cys Ser
405
