Note: Descriptions are shown in the official language in which they were submitted.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-1-
TREATMENT OF BONY DEFECTS WITH
OSTEOBLAST PRECURSOR CELLS
FIELD OF THE INVENTION
This invention concerns treatments to assist in the healing of bone defects,
such as
those caused by surgical resection, developmental malformations, trauma or
disease. More
particularly, the invention concerns therapeutic biological compositions that
assist in the repair and
regeneration of bone, recombinant DNA techniques for making the compositions,
cell lines useful
in the method, and devices for delivering and localizing the therapeutic
compositions at osseous
repair sites.
BACKGROUND OF THE INVENTION
Unlike some other types of fully differentiated tissues, bone has the
remarkable
ability to regenerate. This regenerative capacity allows broken bones to heal,
and has been
15 exploited by surgeons when they perform bone transplants to heal osseous
defects left by trauma,
congenital malformations and oncologic resections. Bone grafts pose a risk of
infection with
Crutzfeld-Jacob disease, the human immunodeficiency virus, or other pathogens.
There is also an
unacceptably high failure rate for autografts ( 13-30 % ) and an even greater
level of failure for
allogeneic preparations (20-35 % ). These unacceptable clinical outcomes, as
well as problems with
20 pathogenic transmissions and immune responses (from allografts), warrant
developing safer and
more efficient alternatives. These considerations have prompted a search for
bioengineered
materials that provide a matrix into which bone can grow (osteoconduction),
while avoiding the
problems of bone grafts.
One proposal has been to use synthetic bone implants as a replacement for
human
25 tissue. Acrylic polymers, collagen, silicone elastomers, porous PTFE-carbon
fiber composites,
calcium phosphate bioceramics (such as biodegradable tricalcium phosphate and
hydroxyapatite),
and resorbable lactide polymers have all been suggested as possible materials
that will provide a
porous matrix into which bone can grow. However none of these materials
appears to induce
significant bone formation (osteogenesis) and are therefore said to lack
osteoinduction.
30 Another problem with bone transplants and synthetic implants is that they
are often
poorly effective in the elderly, which is the population in which most bone
trauma occurs. As the
body ages, it loses some of its capacity to regenerate bone, which is
essential if the uansplant or
implant is to be incorporated into the healing osseous defect. A related
clinical manifestation of
this impaired ability to regulate bone formation is osteoporosis, which often
results in debilitating
35 bone and spinal injuries. This disease is thought to be caused by an
imbalance between bone
formation (by osteoblasts) and bone resorption (by osteoclasts), perhaps
arising from a failure of
complex cell to cell interactions that maintain this system in homeostasis.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-2-
The molecular basis of the process of bone formation has been the subject of
intense research during the last few decades. A group of regulator molecules
known as bone
morphogenetic proteins (BMPs) has been found to direct the cellular processes
that form bone
during embryogenesis, maintenance and repair. The BMPs are categorized within
the
5 transforming growth factor beta (TGF-~) superfamily. The' BMPs within this
family include BMPs
2-15 (BMP-1 is not part of the TGF-(3 superfamily). The sequences of BMPs 2-9
were described
by Wozney et al. in Prog. Growth Factors 1:267-280 (1989), Mol. Reprod. Dev.
32:160-167
(1992); and Science 242:1528-1534 (1988); and Wang et al. in Proc. Natl. Acad.
Sci. USA
85:9484-9488 (1988).
10 The identification and cloning of these BMPs was performed by isolating 16-
18 kD
polypeptides from bovine bone, digesting them with trypsin, determining the
amino acid sequences,
and synthesizing oligonucleotide probes. The probes were then used to screen
bovine genomic
sequence libraries or cDNA libraries, and recombinant clones were identified
and used to screen
human cDNA libraries to derive recombinant clones that encoded human BMPs;
Wang, Proc. Natl.
15 Acad. Sci USA 85:9484 (1988); Wozney et al., Science 242:1528 (1988). Using
this strategy,
BMP-1 through BMP-9 were obtained, and their amino acid sequences deduced.
Amino acid
sequence conservation has allowed BMP-2 through BMP-9 to be partitioned into
several
subfamilies: BMP-2 and BMP-4; BMP-3 (referred to as osteogenin); BMP-5 through
BMP 8
(where BMP-7 and BMP-8 are respectively referred to as osteogenic protein 1
(OP-1) and
20 osteogenic protein 2 (OP-2)); and BMP-9.
More recently, the BMPs 10-15 have been identified with hybridization and
polymerase chain reaction technology by Inada et al., Biochem. BiopJrys. Res.
Common. 222:317-
322 (1996); Celeste et al., J. Bone Miner. Res. 10(1S) 334-339 (1995); and
Dube et al., J. Bone
Miner. Res. 10:333-339 (1995). BMP-12 and BMP-13 appear to be the human
homologues of
25 mouse growth/differentiation factor (GDF-7 and GDF-6, respectively).
The numerous patents that have issued on BMPs are a further testament to the
intensity of the research in this field. U.S. Patent No. 4,455,256 (Urist)
disclosed a general
method of making BMP by demineralizing bone tissue, extracting BMP in a
solubilizing agent, and
precipitating the BMP. The sequences of purified BMP-1 proteins, and DNA
sequences encoding
30 them, were disclosed in U.S. Patent No. 5,108,922 (Wang et al.). U.S.
Patent Nos. 5,166,058
(Wang et al.) and 5,318,898 (Israel) concerned a process for producing
recombinant BMP-2, U.S.
Patent No. 5,618,924 (Wang et al.) disclosed BMP-2 products, while U.S. Patent
No. 5,670,338
(Murakami et al.) disclosed a process for cloning DNA coding for BMP-2A. DNA
sequences
encoding proteins for BMP-3 were disclosed in U.S. Patent No. 5,116,738 (Wang
et al.), BMP-5
35 in U.S. Patent No. 5,106,748 (Wozney et al.), BMP-6 in U.S. Patent No.
5,187,076 (Wozney et
al.), and BMP-7 in U.S. Patent No. 5,141,905 (Rosen et al.), BMP-8 in PCT
Publication WO
91/18098, and BMP-9 in PCT Publication WO 93/00432. Screening techniques for
identifying and
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-3-
evaluating compounds that stimulate bone growth is discussed in WO 96/38590
(Harris et al.).
Sequences encoding a broad variety of the BMPs are therefore known, and the
term "bone
morphogenetic protein" encompasses a variety of peptides.
Properties, roles and anatomic locations of many of the BMPs are summarized in
TABLE 1.
TABLE 1
BMP Properties, Roles and Locations
10 BMP-1 protease (member of astacin family); may function as a procollagen C-
proteinase
responsible for removing carbonyl propeptides from procollagens I, II and III;
activates BMPs; not osteoinductive; may be involved with Larger-Giedon
syndrome;
Drosophila colloid gene homologue; dorso-ventral fetal patterning
BMP-2 osteoinduction and embryogenesis; fetal formation; differentiation of
osteoblasts,
adipocytes, and chondrocytes; may influence osteoclast activity and neuronal
differentiation; located in bone, spleen, liver, brain, kidney, heart,
placenta, and
regulates repair in long bone, alveolar clefts, spine fusions, and maxillary
sinus
augmentation, among others.
BMP-3 osteoinductive; promotes chondrogenic phenotype;
located in lung, kidney, brain,
intestine. Also known as osteogenin.
BMP-4. osteoinductive; found in apical eciodermal ridge,
meninges, lung, kidney, liver;
during embryogenesis it is involved in gastrulation
and mesoderm formation; produced
by dorsal aorta; involved in fracture repair; over-expression
associated with ectopic
ossification of fibrodysplasia ossificans progressiva.
BMP-5 osteoinductive; found in lung, kidney, liver; embryogenesis
BMP-6 not osteoinductive; involved in embryogenesis, neuronal
maturation, and chondrocyte
differentiation; found in lung, brain, kidney, uterus,
muscle, skin.
BMP-7 osteoinductive; found in adrenal glands, bladder,
brain, eye, heart, kidney, lung,
placenta, spleen, skeletal muscle; involved in embryogenesis,
and repair of long bone,
alveolar bone, and spine fusion; induces differentiation
of osteoblasts, chondroblasts,
adipocytes. Also known as osteogenic protein-1.
BMP-8 initiation and maintenance of spermatogenesis (mouse).
Also known as osteogenic
protein-2.
BMP-8B initiation and maintenance of spermatogenesis (mouse);
also known as osteogenic
protein-3.
BMP-9 osteoinductive; stimulates hepatocyte proliferation;
hepatocyte growth and function.
BMP-12 inhibits terminal differentiation of myoblasts
and
BMP-13
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-4-
The discovery of the BMPs was greeted with great expectations about the use of
exogenous BMP to help regenerate bone in osseous defects. However, it has been
more difficult
than initially anticipated to clinically harness their osteogenic activity.
Part of this disappointment
5 has been the difficulty of fording a delivery system that provides the
appropriate biological milieu
for the BMPs to exert their osteogenic effects. In the absence of an
appropriate carrier, BMP
rapidly diffuses away from its anatomic site of intended use, and its
concentration is too low to
exert its desired biological activity on mesenchymal cells. Kim et al., J.
Biomed. Material. Res.
35:279-285 (1997), suggested overcoming this problem by ex vivo stimulation of
osteoblastic cells
10 with recombinant human BMP-2 (rhBMP-2), followed by grafting of the
stimulated cells into areas
of bony non-union. However the authors reported no apparent stimulation of
osteoblasts using this
technique. Ripamonti et al., South African J. Science 91:277-280 (1995) noted
that development of
an effective carrier for BMPs had been hampered by the inability to find a
complementary,
biocompatible, nonimmunogenic, carvable substrate that provides mechanical
support while
15 promoting rapid mesenchymal and vascular invasion.
Proposals have been made to provide osteogenic proteins in a polymer matrix
that
can be implanted into a bony defect. Polymer matrices made of acrylic esters
(U.S. Patent No.
4,526,909, Urist) or lactic acid polymer (U.S. Patent No. 4,563,489, Urist)
have been proposed as
carriers for osteogenic proteins. In U.S. Patent No. 4,968,590, Kuber Sampath
et al. disclosed the
20 use of matrix polymers made of copolymers and homopolymers of glycolic acid
and lactic acid, as
well as hydroxyapatite, and calcium phosphates. U.S. Patent No. 5,266,683
(Opperman et al.)
discloses a matrix made up of particles of porous materials, with a particle
size of 70-850 ~cm,
where the matrix material was collagen, polymers of glycolic acid, lactic acid
and butyric acid, and
ceramics, such as hydroxyapatite, tricalcium phosphate, and others. The use of
poly(a-hydroxy
25 acids) as carriers for bone morphogenetic proteins was disclosed in
Hollinger and Leong,
Biomaterials 17:187-194 (1996). Calcium phosphate or calcium acetate matrices
were disclosed in
U.S. Patent Nos. 4,789,732 (Urist); 5,306,303 (Lynch); and 5,385,887 (Yim et
al.). A collagen
containing matrix was suggested in U.S. Patent Nos. 4,975,527 (Koezuka et al.)
and 5,531,791
(Wolfinbarger).
30 Delivery systems for BMPs were reviewed in Mayer et al., Plastic and
Recorutruc.
Surg. 98:247-259 (1996), where it was noted that a collagen delivery system
may not be ideal
because of the immunologic potential of that material. Similarly, a system
that included BMP-2
and autologous blood to poly(lactide-co-glycolide) particles was found to be
dislodged by soft tissue
movement and oozing from the recipient bone bed, which prevented localization
of an effective
35 dose of BMP-2 at the recipient site. Hence, even after years of research,
there is still a need for a
delivery system that is biocompatible, non-immunogenic, and which provides a
sufficient matrix to
suspend and localize osteogenie factors, while simultaneously permitting the
ingrowth of blood
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-5-
vessels and providing a structure into which bone can grow, without impeding
the final formation
of new bone in the defect. When BMP-2 has been used clinically to regenerate
bone, massive
doses of it have been required to overcome some of these problems, and the
result still has not been
clinically useful.
5 Intense scientific attention has also focused on the osteoblast precursor
cells
(OPCs), and their role in bone formation. Methods for isolating OPCs from
homogeneous
preparations of stromal cells were described by Rickard et al., J. Bone Min.
Res. 11:312-324
(1996). Immortalization of OPCs has been disclosed by Evans et al., J. Ortho.
Res. 13:317-324
(1995); Harris et al., J. Bone Min. Res. 10:178-186 (1995); and U.S. Patent
No. 5,693,511 (Harris
10 et al.). The use of osteoprogenitor cells has also been discussed as
targets for ex vivo gene transfer
in Onyia et al. , J. Bone Min. Res. 13:20-30 ( 1998), while the stimulation of
bone by direct transfer
of osteogenic plasmid genes into fibroblasts was proposed by Fang et al.,
Proc. Natl. Acad. Sci.
USA 93:5753-5758 (1996). Expression of BMP-2 and BMP-4 in mesenchymal C3H10T~h
cells
was discussed in Ahrens et al., DNA and Cell Bio. 10:871-880 (1993), while
expression of BMP-2
15 in Chinese Hamster Ovary Cells was disclosed in Israel et al., Growth
Factors 7:139-150 (1992).
In spite of many incremental advancements in the understanding of the biology
of
bone repair, a clinically useful technique for applying these concepts has
been elusive.
It is therefore an object of this invention to provide an effective method for
the
repair of bony defects which can be clinically applied to repair osseous
defects.
SUMMARY OF THE INVENTION
The foregoing object may be achieved by providing a therapeutically effective
amount of OPCs substantially immobilized in or adjacent to a porous matrix,
which is implanted
into a bony defect to repair the defect. Altennatively, the invention includes
a method in which a
25 bone morphogenetic protein (BMP) is expressed in an OPC, for example the
expression of BMP-2
in a conditionally immortalized OPC that is implanted into a bony defect. The
OPC which
produces the BMP may be immobilized in or adjacent to a porous matrix that
maintains the OPC at
the site of implantation, and the OPC is responsive to the BMP it expresses so
that it produces bone
at the site of the osseous defect. The exogenous supply of OPCs also boosts
the bone making
30 capability of an ill or aged individual in whom OPCs may be numerically
deficient or functionally
impaired. The invention also includes methods of transfecting OPCs to express
BMP, and
administering a therapeutically effective amount of those OPCs to express BMP
in effective
amounts to repair a bony defect.
The OPCs (either with or without transfection) may be administered in an
implant
35 which provides an environment that cushions the OPCs during implantation,
and provides a
degradable support matrix that localizes the OPCs to heal the bony defect. The
implant is also
suitable to allow or promote vascular ingrowth and bone formation, without
becoming a physical
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
-6-
barrier to the progression of bone formation. In particular embodiments, the
implant degrades at a
rate that is proportionate to bone formation at the site of localization, so
that the implant will
degrade as the bone is formed. The degrading implant may also be designed to
release a substance
that is toxic to the OPCs once bone formation has been substantially promoted
or completed.
5 The implant may include a cell suspension component (for example a gel
suspension such as a hydrogel) in which the OPCs are suspended for protection
and growth. The
implant also includes a porous support component, such as a degradable,
substantially
biocompatible and non-immunogenic material, for example a poly(a-hydroxy acid)
(PHA), such as
homopolymers of polylactide (PL), polyglycolide (PG), and their copolymers of
poly(lactide-co-
10 glycolide) (PLG). The support component provides a relatively rigid
environment that supports soft
tissue, protects the gel component, and provides a biological template into
which bone growth may
occur. The support component is disposed in protective relationship to the
suspension component,
for example as a contiguous cortex surrounding a gel core, or as an adjacent
layer in a laminate or
mufti-laminate implant. The support component may also include a
therapeutically effective
15 amount of a BMP to activate the OPCs in the suspension component. When
suspended in the
BMP-impregnated support component, the OPCs in particular embodiments have
been transformed
to express physiologic or supraphysiologic doses of BMP. However, the
invention also includes
native OPC cells that have not been engineered to express the BMP, but which
may be exposed to
BMP impregnated in the matrix of the porous support component, as well as OPCs
that have not
20 been engineered to express BMP, and are not in a BMP impregnated matrix.
The invention also includes methods of administering OPCs, such as cells
expressing supraphysiologic amounts of an osteogenic BMP, such as OPCs into
which have been
introduced an expression vector for the production of a BMP, such as BMP-2.
The OPCs are
introduced into a bony defect, such as a traumatic or congenital defect, or an
area of deficient bone
25 formation or density (osteopenic bone), as occurs for example in the spine
of a person with
osteoporosis. The OPCs may be administered in combination with the implant,
which provides
both protection for the OPCs and a structural matrix in which bone formation
occurs. When used
to treat osteoporosis, either a cellular suspension or the implant is
introduced into a recipient bed of
osteoporotic or osteopenic bone to promote new bone formation. The recipient
bed may be
30 prepared, for example, by introducing a catheter into the osteoporotic bone
and producing a local
void or cavity in the bone, into which the cells or implant can be introduced
without creating
excessive back pressure.
The invention also includes a porous matrix that includes a therapeutically
effective
amount of a cell that is committed to an osteogenic lineage, such as an OPC.
The cell that is
35 committed to an osteogenic lineage can include a conditionally immortalized
osteoblast precursor
cell having the characteristics of cell line OPC 1. In specific embodiments,
the porous matrix may
be made of a combination of poly(D,L-lactide) and collagen. In other
embodiments, the
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
compositions also contain a therapeutically effective amount of a BMP, more
specifically BMP-2.
Further embodiments include recombinant BMP-2 expressed by OPC 1.
A delivery device for introducing the cellular suspension or implant into the
body
includes a catheter through which the suspension or implant can be propelled
to its desired location.
5 The implant may be designed to conform to the walls of the catheter, for
example by making the
implant cylindrical when used with a tubular catheter. The cylindrical implant
can be formed by
providing a cylindrical support cortex around a gel OPC suspension core, or by
bending a laminate
implant into a cylindrical form for introduction into a tubular catheter.
Implants of other shapes
can also be used, and made to conform to the shape of a bony defect into which
the implant is
placed. The implant can also be surgically implanted, without the delivery
device.
The delivery device can be a fiber-optic endoscope, which may be used during
minimally invasive surgery to locate and treat a bony defect, such as an
osteopenic spine. The
endoscope may have a distal end with a cavity-forming tip that can be enlarged
after introduction of
the tip into the bone (for example by inflation of a balloon catheter tip), to
perform an "osteoplasry"
15 by compressing surrounding osteopenic bone, and creating the cavity into
which the OPCs are to be
placed. After the cavity is formed, the balloon catheter is deflated, and the
implant is introduced
under pressure through the catheter to be deposited in the enlarged cavity.
The dimensions of the
cavity may be substantially the same (or slightly larger) than the implant, so
that the implant
substantially fills the cavity. Alternatively, the OPCs can be gently
introduced into the cavity,
20 without disrupting the cells in the suspension. The gentle introduction can
be accomplished using
an auger that extends through the endoscope. Introducing the OPCs into the
area of osteopenic
bone not only helps form new bone to fill in the cavity, but the BMP
expressing OPCs also recruit
native OPCs in the patient's body to the site of the osteopenic bone, to
encourage additional bone
formation in the surrounding bone.
25 The invention also includes novel cell tines (such as OPC1) that are BMP
responsive and which also express exogenous or supraphysiologic concentrations
of BMP,
recombinant methods for producing such cell lines and rendering them
conditionally immortal,
compositions incorporating the OPCs, and methods of making the implants.
Particular disclosed
OPCs can begin bone formation without addition of ascorbic acid and
giycerophosphate to culture
30 medium, and may exhibit contact inhibition (so that there is an absence of
cellular proliferation
after confluence that indicates an absence of oncologic potential).
The foregoing and other objects, features, and advantages of the invention
will
become more apparent from the following detailed description of a preferred
embodiment which
proceeds with reference to the accompanying drawings.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
_g_
BRIEF DESCRIPTION OF TJfIE DRAWINGS
FIG. 1 is a schematic view of a method of making a cortex core device (CCD)
implant in accordance with the invention, and implanting it into a critical-
sized defect in a
mandible.
FIG. 2 is a schematic view of a method of making an integrated polymer
laminate
(IPL) embodiment of the implant, and implanting it into a critical-sized
defect in a mandible.
FIG. 3 is a schematic diagram of the plasmid pMXl-sv40T-Neo-195.
FIGS. 4A, 4B, 4C, and 4D are schematic views of several steps in a disclosed
method for introducing OPCs into an osteoporotic spine.
10 FIG. 5 is a top view of a vertebral body, illustrating a hollow cannula
introduced
through the vertebral pedicle, with an endoscope and a balloon catheter
introduced through the
cannula.
FIG. 6 is a view, similar to FIG. 5, but showing the balloon catheter inflated
to
compress surrounding osteopenic vertebral bone.
FIG. 7 is a schematic diagram of the plasmid hCNTF-pNUT-DNT.
FIG. 8 is a histogram representing the radiomorphometric analysis of bone
healing in
calvarial critical-sized defects in athymic rats, receiving one of four
treatments: PLC alone, PLC
with OPCs, PLC with rhBMP-2, or PLC, OPCs and rhBMP-2.
FIG. 9 is a histogram representing the histomorphometric analysis of bone
healing in
calvarial critical-sized defects in athymic rats, receiving one of four
treatments: PLC alone, PLC
with OPCs, PLC with rhBMP-2, or PLC, OPCs and rhBMP-2.
FIG. l0A is a schematic diagram of a cannula in which an inner channel
provides
access for an endoscope, and a coaxial outer channel provides a structure
through which the OPCs
can be introduced.
FIG. lOB is a schematic diagram that shows a cartridge unit for delivery of
OPCs
using a auger mechanism.
FIG. lOC is a schematic diagram that shows an endoscope inserted through the
cannula of FIG. 10A.
FIG. lOD is a schematic diagram that shows the cartridge unit of FIG. lOB
inserted
into the cannula of FIG. 10A, for controlled delivery of OPCs from the
cartridge through the auger
mechanism into the bone.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence
listing are
shown using standard letter abbreviations for nucleotide bases, and three
letter code for amino
acids. Only one strand of each nucleic acid sequence is shown, but the
complementary strand is
understood as included by any reference to the displayed strand.
SEQ. ID. NO. 1: PCR primer to phenotype OPC cells for osteocalcin expression.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-9-
SEQ. ID. NO. 2: PCR primer to phenotype OPC cells for osteocalcin
expression.
SEQ. ID. NO. 3: PCR primer to phenotype OPC cells for osteonectin
expression.
SEQ. ID. NO. 4: PCR primer to phenotype OPC cells for osteonectin
expression.
SEQ. ID. NO. 5: PCR primer to phenotype OPC cells for osteopontin
expression.
S SEQ. ID. NO. 6: PCR primer to phenotype OPC cells for osteopontin
expression.
SEQ. ID. NO. 7: PCR primer to phenotype OPC cells for PTH-Receptor
expression.
SEQ. ID. NO. $: PCR primer to phenotype OPC cells for PTH-Receptor
expression.
SEQ. ID. NO. 9: PCR primer to phenotype OPC cells for alkaline
phosphatase expression.
SEQ. ID. NO. 10: PCR primer to phenotype OPC cells for alkaline
phosphatase
expression.
SEQ. ID. NO. 11: PCR primer to phenotype OPC cells for procollagen
I expression.
SEQ. ID. NO. 12: PCR primer to phenotype OPC cells for procollagen
I expression.
SEQ. ID. NO. 13. Nucleotide sequence of KS-hBMP-2 plasmid
vector.
SEQ. ID. NO. 14. Nucleotide sequence of IgSP-NS-hBMP-2 plasmid
vector.
SEQ. ID. NO. Nucleotide sequence of IgSP-KR-hBMP-2 plasmid
15. vector.
SEQ. ID. NO. 16. Nucleotide sequence of IgSP-RRRR -hBMP-2
plasmid vector.
DETAILED DESCRIPTION
TABLE 2
Abbreviations and Definitions
BMP Bone morphogenetic protein
CCD Cortex core device
CSD Critical-sized defect (a bone defect sufficiently
large that it does not
spontaneously heal). A CSD in the long bone
is considered 2-3X's the
diaphyseal diameter.
IPL Integrated polymer laminate
OPC Osteoblast precursor cells
OsteoconductionIngrowth of vascular tissue from host margins
followed by new bone
formation (osteoinduction)
PHA Poly(a-hydroxy acids)
PG Polyglycolide
PL Poylactide
PLG Poly (lactide-co-glycolide)
Isolated: An "isolated" biological component (such as a nucleic acid molecule,
protein or
organelle) has been substantially separated or purified away from other
biological components in
the cell of the organism in which the component naturally occurs, i. e. ,
other chromosomal and
40 extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and
proteins that have
been "isolated" include nucleic acids and proteins purified by standard
purification methods. The
term also embraces nucleic acids and proteins prepared by recombinant
expression in a host cell as
well as chemically synthesized nucleic acids.
Oligonucleotide: A linear polynucleotide sequence of between six and 300
nucleotide
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-10-
bases in length.
Operably linked: A first nucleic acid sequence is operably linked with a
second nucleic
acid sequence when the first nucleic acid sequence is placed in a functional
relationship with the
second nucleic acid sequence. For instance, a promoter is operably linked to a
coding sequence if
5 the promoter affects the transcription or expression of the coding sequence.
Generally, operably
linked DNA sequences are contiguous and, where necessary to join two protein-
coding regions, in
the same reading frame.
ORF (open reading frame): A series of nucleotide triplets (codons) coding for
amino
acids without any internal termination codons. These sequences are usually
translatable into a
peptide.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers
useful in
this invention are conventional. Remington's Pharmaceutical Sciences, by E. W.
Martin, Mack
Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and
formulations suitable
for pharmaceutical delivery of the fusion proteins herein disclosed.
15 In general, the nature of the carrier will depend on the particular mode of
administration
being employed. For instance, parenteral formulations usually comprise
injectable fluids that
include pharmaceutically and physiologically acceptable fluids such as water,
physiological saline,
balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
For solid compositions
(e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid
carriers can include, for
20 example, pharmaceutical grades of mannitol, lactose, starch, or magnesium
stearate. In addition to
biologically-neutral carriers, pharmaceutical compositions to be administered
can contain minor
amounts of non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives,
and pH buffering agents and the like, for example sodium acetate or sorbitan
monolaurate.
Purified: The term purified does not require absolute purity; rather, it is
intended as a
25 relative term. Thus, for example, a purified fusion protein preparation is
one in which the fusion
protein is more enriched than the protein is in its generative environment,
for instance within a cell
or in a biochemical reaction chamber. Preferably, a preparation of fusion
protein is purified such
that the fusion protein represents at least 50 % of the total protein content
of the preparation.
Recombinant: A recombinant nucleic acid molecule is one that has a sequence
that is not
30 naturally occurring or has a sequence that is made by an artificial
combination of two otherwise
separated segments of sequence. This artificial combination can be
accomplished by chemical
synthesis or, more commonly, by the artificial manipulation of isolated
segments of nucleic acids,
e.g., by genetic engineering techniques.
Similarly, a recombinant protein is one encoded for by a recombinant nucleic
acid
35 molecule.
Sequence identity: The similarity between two nucleic acid sequences, or two
amino acid
sequences is expressed in terms of the similarity between the sequences,
otherwise referred to as
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-11-
sequence identity. Sequence identity is frequently measured in terms of
percentage identity (or
similarity or homology); the higher the percentage, the more similar the two
sequences are.
Homologs of the bispecific fusion protein will possess a relatively high
degree of sequence identity
when aligned using standard methods.
5 Methods of alignment of sequences for comparison are well known in the art.
Various
programs and alignment algorithms are described in: Smith and Waterman (Adv.
Appl. Math. 2: 482,
1981); Needleman and Wunsch (J. Mol. Biol. 48: 443, 1970); Pearson and Lipman
(PNAS. USA 85:
2444., 1988); Higgins and Sharp (Gene, 73: 237-244, 1988); Higgins and Sharp
(CABIOS 5: 151-153,
1989); Corpet et al. (Nuc. Acids Res. 16: 10881-90, 1988); Huang et al. (Comp.
Appls Biosci. 8:
10 155-65, 1992); and Pearson et al. (Methods in Molecular Biology 24: 307-31,
1994). Altschul et al.
(Nature Genet., 6: 119-29, 1994) presents a detailed consideration of sequence
alignment methods
and homology calculations.
The alignment tools ALIGN (Myers and Miller, CABIOS 4:11-17, 1989) or LFASTA
(Pearson and Lipman, 1988) may be used to perform sequence comparisons
(Internet Program
15 1996, W. R. Pearson and the University of Virginia, °fasta20u63"
version 2.Ou63, release date
December 1996). ALIGN compares entire sequences against one another, while
LFASTA compares
regions of local similarity. These alignment tools and their respective
tutorials are available on the
Internet at http://biology.ncsa.uiuc.edu.
Orthologs of the disclosed bispecific fusion proteins are typically
characterized by possession
20 of greater than 75% sequence identity counted over the full-length
alignment with the amino acid
sequence of bispecific fusion protein using ALIGN set to default parameters.
Proteins with even
greater similarity to the reference sequences will show increasing percentage
identities when assessed
by this method, such as at least 80 %, at least 85 %, at least 90% , at least
92 % , at least 95 % , or at
least 98 % sequence identity. In addition, sequence identity can be compared
over the full length of
25 one or both binding domains of the disclosed fusion proteins. In such an
instance, percentage
identities will be essentially similar to those discussed for full-length
sequence identity.
When significantly less than the entire sequence is being compared for
sequence identity,
homologs will typically possess at least 80% sequence identity over short
windows of 10-20 amino
acids, and may possess sequence identities of at least 85 % , at least 90 %,
at least 95 % , or at least
30 99% depending on their similarity to the reference sequence. Sequence
identity over such short
windows can be determined using LFASTA; methods are described at
http://biology.ncsa.uiuc.edu.
One of skill in the art will appreciate that these sequence identity ranges
are provided for guidance
only; it is entirely possible that strongly significant homologs could be
obtained that fall outside of the
ranges provided. The present invention provides not only the peptide homologs
that are described
35 above, but also nucleic acid molecules that encode such homologs.
An alternative indication that two nucleic acid molecules are closely related
is that the two
molecules hybridize to each other under stringent conditions. Stringent
conditions are sequence-
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-12-
dependent and are different under different environmental parameters.
Generally, stringent
conditions are selected to be about 5°C to 20°C lower than the
thermal melting point (Tin) for the
specific sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined ionic
strength and pH) at which 50% of the target sequence hybridizes to a perfectly
matched probe.
5 Conditions for nucleic acid hybridization and calculation of stringencies
can be found in Sambrook et
al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York,
1989) and Tijssen
(Laboratory Techniques in Biochemistry and Molecular Biology Part I, Ch. 2,
Elsevier, New York,
1993). Nucleic acid molecules that hybridize under stringent conditions to the
disclosed bispecific
fusion protein sequences will typically hybridize to a probe based on either
the entire fusion protein
10 encoding sequence, an entire binding domain, or other selected portions of
the encoding sequence
under wash conditions of 0.2 x SSC, 0.1 % SDS at 65°C.
Nucleic acid sequences that do not show a high degree of identity may
nevertheless encode
similar amino acid sequences, due to the degeneracy of the genetic code. It is
understood that
changes in nucleic acid sequence can be made using this degeneracy to produce
multiple nucleic acid
15 sequences that each encode substantially the same protein.
Transformed: A transformed cell is a cell into which has been introduced a
nucleic acid
molecule by molecular biology techniques. As used herein, the term
transformation encompasses
all techniques by which a nucleic acid molecule might be introduced into such
a cell, including
transfection with viral vectors, transformation with plasmid vectors, and
introduction of naked
20 DNA by electroporation, lipofection, and particle gun acceleration.
Vector: A nucleic acid molecule as introduced into a host cell, thereby
producing a
transformed host cell. A vector may include nucleic acid sequences that permit
it to replicate in a
host cell, such as an origin of replication. A vector may also include one or
more selectable
marker genes and other genetic elements known in the art.
The present invention provides immortalized osteoblastic cells, including
osteoblast
precursor cells (OPCs), such as human fetal osteoblastic cells (hFOB) cells,
that can be localized in
a porous matrix for implantation into bone, to promote the healing of bony
defects (such as critical-
sized defects) that would heal very slowly, if at all. The OPCs may be
transfected with a
recombinant bone morphogenetic protein (rBMP), such as recombinant human BMP
(rhBMP), for
example rhBMP-2, 3, 4, 5, 7 or 9. As used herein, "immortal" or "immortalized"
cells refer to a
substantially continuous and permanently established cell culture with
substantially unlimited
35 cellular viability. That is the cells can be cultured substantially
indefinitely. The invention also
includes conditionally immortalized cells, which are cells that are mitotic
and divide in the presence
of a conditionally immortalizing medium, but stop cell division when the
conditionally
immortalizing component is removed from the medium, but continue to express
the proteins
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-13-
characteristic of OPCs. These cells produce a complement of proteins
characteristic of normal
human osteoblastic cells and are capable of osteoblastic differentiation.
In some embodiments of this invention, a conditionally immortalized human
fetal
osteoblastic cell expresses a simian virus 40 (SV40) large T (Tag) or small t
(tag) antigen, which is
capable of being inactivated. Although the inactivated cells are still viable
and express functional
proteins characteristic of osteoblasts, they can be put in a state of low
proliferation. This
inactivation may occur, for example, by placing the SV40 gene under the
control of a promoter that
relies on the presence of human interferon, or another biological substance.
The use of an
interferon-dependent promoter is preferred in the disclosed embodiment because
interferon is
10 endogenously produced in wounds (such as the osseous defects being treated
with the cells), and the
levels of interferon taper off as healing occurs. Hence the conditionally
immortalized cells are
designed to divide rapidly after initial implantation into a wound, but to
stop cell division and
continue their differentiation into bone-forming osteoblasts as the wound
heals.
Although these cells are part of an established "cell line," they are
generally non-
15 tumorgenic, i.e. they do not form tumors in mammals. They may be part of a
homogeneous
population, for example part of a clonal population of a cell line that has
been transfected with
genes that immortalize, or conditionally immortalize, the cell and code for
the expression of a
BMP. The term "clonal" refers to a homogenous population of cells derived from
a single
progenitor cell. The term "transfection" refers to a process by which foreign
DNA is introduced
20 into eucaryotic cells and expressed. The foreign DNA is typically included
in an expression vector,
such as a circular or linearized plasmid vector. In the preparation of a
disclosed embodiment of the
invention, human osteoprogenitor cells are conditionally immortalized by
transfection with the
expression vector pMX-1-SV40T. Additionally, the cells can be transfected with
a selectable
marker gene, such as a gene coding for resistance to an agent normally toxic
to the untransformed
25 cells, such as an antibiotic, antineoplastic agent, or a herbicide. In a
disclosed embodiment, the
cells are transfected with an expression vector that codes for a selection
factor such as resistance to
neomycin and similar drugs (pMX-1-SV40T-Neo-195), or which expresses a
"suicide gene" that
enables the transformed cells to be selectively killed.
Disclosed embodiments of the invention have the identifying characteristics of
30 OPC1, which is described in detail in this specification. These cells are
clonal, conditionally
immortaiized osteoblast precursor cells capable of osteoblastic
differentiation. They express
therapeutically effective amounts of a BMP, such as BMP-2, and/or other
factors required for
stimulation of bone formation and heating. The cells of the present invention
can be prepared from
the conditionally immortalized cells of the present invention, and include any
replicable expression
35 vector containing a gene coding for an osteogenic BMP. In a disclosed
embodiment, the BMP
expression vector is a plasmid, for example a plasmid having the identifying
characteristics of the
KS-hBMP-2, IgSP-NS-hBMP-2, IgSP-KR-hBMP-2, and IgSP-ItRRR-hBMP-2 expression
vectors.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-14-
This osteobiast progenitor cell (OPC) line is responsive to BMP-2 (i.e.
cellular
differentiation activity is stimulated by exposure to BMP-2) and boosts the
bone repair response.
Genetically modifying OPCs with a plasmid vector containing a rhBMP-2 gene,
and locally
introducing the OPCs into a bony defect, allows the OPC to constitutively
express BMP to help
5 stimulate and coordinate the cellular processes that repair the defect.
Hence a broad variety of
osseous defects (such as traumatic bone loss or congenital insufficiency) can
be treated using the
method of the present invention. The method can also be used in restoring
deficient bone mass,
congenital malformations, and especially osteopenic vertebrae, which are the
most common
anatomical site ravaged by osteoporosis. This method amplifies a BMP-
responsive cell pool (which
10 is often depleted in the elderly) and augments locally expressed BMP
molecules, to counteract
decreased vertebral bone mass, diminished bone formation, an imbalance between
osteoblasts and
osteoclasts, precursor cell decrement, and/or poor bone cell responsiveness.
The OPCs that
constitutively express BMP enrich local concentrations of these elements that
are pivotal to bone
regeneration.
BMP SELECTION
BMPs 2-15 are categorized within the transforming growth factor beta
superfamily
and direct the progression of cells and their organizational format to tissues
and organs in the
embryo; influence body patterning, limb development, size and number of bones;
and modulate
20 post-fetal chondro-osteogenic maintenance (Table 1). An example of a
particularly important BMP
for the regeneration of bone is BMP-2, which promotes undifferentiated
mesenchymal cells into
osteoblasts, which lay down the bone. This property has been exploited in
preclinical studies with
rhBMP-2 to regenerate calvaria; long bone in the rat; rabbit ulna and radius;
sheep long bone; the
mandible and premaxilla of the dog; and the ulna of the African green monkey.
Marden, et al., J.
25 Biomed. Mater. Res. 28:1127-1138 (1994); Smith, et al., J. Controlled Rel.
36:183-195 (1995);
Yasko, et al., J. Bone Joint Surg. 74-A:659-671 (1992); Stevenson, et al., J.
Bone Joint Surg.
76-A:1676-1687 (1994); Cook, et al., J. Bone Joira Surg. 76A:827-838 (1994);
Hollinger, et al., J
Controlled Rel. 39:287-304 (1996); Gerhart, et al., Clin. Orthop. Rel. Res.
293:317-326 (1993).
Furthermore, rhBMP has been applied for spine fusions in dogs and rhesus
nonhuman primates,
30 where the rhBMP prompted regeneration of critical-sized defects that
ordinarily would not have
healed by new bone formation; Boden, et al., Endocrinol 137:3401-3407 (1996).
In view of the
prior use of BMP-2 for these clinical applications, BMP-2 is described in
connection with the
disclosed embodiment of this invention. However, any of the osteoinductive
BMPs can be used in
connection with the method of increasing bone formation, for example BMP-3,
BMP-4, BMP-5,
35 BMP-7 and BMP-9, and especially BMPs 4 and 9. Other BMPs that are not
described as
osteogenic in Table 1 may also be used, to the extent that they regulate or
stimulate the activity of
the directly osteogenic BMPs.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-15-
SELECTING OSTEOBLAST PRECURSOR CELLS (OPCs)
The differentiation of osteoblastic cells in culture involves a programmed
development sequence. This sequence is characterized by an early proliferative
stage during which
cells are relatively undifferentiated osteoprogenitor or osteoprecursor cells
(OPCs), and later stages
5 which involve the expression of bone cell phenotypic markers and ultimately
extracellular matrix
mineralization. See, for example, Aronow et al. , J. Cell Physiol. 143:213 (
1989) and Stein et al. ,
FASEB J. 4:3111 (1990), which are incorporated by reference. OPCs are cells
that differentiate
into cells having the phenotypic markers associated with osteoblasts,
including expression of
osteocalcin (OSC), osteonectin (OSN), osteopontin (OSP), PTH receptor (PTHr),
alkaline
phosphatase (AP) and procollagen Type I (ProI). OPCs that express the BMP are
differentiated
into osteoblastic cells by the expressed BMP.
The BMP-mediated strategies to regenerate bone in accordance with the present
invention differ from other approaches in that they supply a sufficient
quantity of OPCs to restore
form and function to bone. The presence of OPCs localized or immobilized in a
porous matrix has
15 been found to increase bone formation to a surprising extent. In other
embodiments, a sufficient
amount of exogenous BMP is provided in the matrix to promote bone deposition.
In a particular
embodiment, BMP is expressed from the OPC, and the in situ availability of BMP
from the OPCs
minimizes the exogenous dose of rhBMP that must be supplied. In the absence of
in vivo
production from OPCs, milligram quantities of BMP (for example more than about
1.7-2.0 mg
20 doses) are required to produce an osteogenic effect by augmenting a locally
responsive cell stock to
differentiate into osteoblasts. The in situ production of BMP from an OPC (or
an osteoblast)
allows much smaller doses of the BMP to be delivered, because the BMP is
localized by the cells,
and delivered in a cellular vehicle that is also intimately involved in the
bone deposition process.
Therefore, the OPCs will function as a cellular "bioreactor" by synthesizing
BMP de novo,
25 allowing the production of a fresh and sustained BMP signal. Administration
of BMP from OPCs
is especially valuable for the geriatric patient who has a limited number of
precursor cells, that may
also be functionally challenged.
OPCs can be used from any species, although it is preferred that the OPC
selected
for use be from the same species as the animal being treated for the bony
defect. Hence OPCs
30 from humans, dogs, monkeys, rats, and other species may be used in
accordance with this
invention. The OPCs may be obtained by conventional techniques, and they are
then immortalized
(or conditionally immortalized) and localized in a matrix in the bone. Also,
the OPCs may be
transfected with a gene that expresses a BMP. The following Examples
illustrate specific steps in
this process.
35 Especially preferred cells in accordance with the present invention are
those
osteoprecursor cells that have sufficiently differentiated to commit to an
osteogenic lineage. Once
this commitment has occurred, the cell will more reliably produce bone in
response to BMP
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-16-
stimulation, instead of becoming a fibrocyte, chondrocyte, adipocyte, or other
cells that are the
successors of mesenchymal stem cells from which the OPCs of the present
invention may be
derived. The commitment to bone production is a particular advantage as
compared to cells which
could produce substantial amounts of fat or fibrosis at the site of the
healing bony defect, because
significant amounts of those non-bone tissues can interfere with bony union
and ultimate healing of
the defect.
A specific example of a cell useful with the present invention is the
conditionally
immortalized cell line OPC1 having the identifying characteristics of ATCC CRL-
12471 deposited
February 12, 1998, which is an OPC that has committed to the osteogenic
lineage, and which can
10 be transfected with a gene to express BMP-2. Commitment to the osteogenic
lineage of a cell can
be determined by stimulating the cell with a BMP, such as BMP-2, BMP-4, or BMP-
9, and
observing the development of the osteoblast phenotype by the screening
techniques described in
Example 2. Cells from the deposited cell line exhibit many preferred
characteristics, including the
ability to differentiate in response to very low doses of BMP, for example 10
ng/ml concentrations
1S of rhBMP-2, and perhaps even concentrations as low as S ng/ml or even 2
ng/ml rhBMP-2. The
deposited cell line has also been shown to be able to be passaged for at least
PSO, for example as
much as about P80.
In addition to contacting the BMPs with OPCs, or expressing the BMPs from an
OPC, the BMPs can also be contacted with or expressed from more mature
osteoblasts (having the
20 phenotype described in Example 2). Like the OPC, an osteoblast is an
example of a cell that has
committed to an osteogenic lineage, it is just more highly differentiated. The
mature osteoblasts do
not usually divide, which does not permit the production of a clonal line of
dividing cells that can
be implanted into a bony defect. However, the BMP gene can be introduced into
an OPC which is
allowed to mature before implantation into a bony defect, where it is
localized and allowed to
2S produce BMP which enhances the healing process. To the extent production of
BMP in more
mature OPCs and osteoblasts improves bone formation, it is included within the
method of the
present invention.
Other cells that can be used with the present invention include nucleated
blood cells
that are present during healing (such as lymphocytes), but which do not
stimulate a significant
30 inflammatory response (as would occur with macrophages).
EXAMPLE 1
Establishing Immortalized Human Osteoprogenitor Cell Line OPC-1
The simian virus 40 (SV40) oncogenes, both small t antigen (tag) and large T
3S antigen (Tag), are nuclear phosphoproteins that transform a broad range of
cell types. In the
present invention, the pMXI-SV40Tag-Neo-19S plasmid DNA (FIG. 3) was utilized
in transfection
protocols to generate a conditionally immortalized cell line. A "conditionally
immortalized" cell
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-17-
line is one that continues to undergo cell division in a controllable set of
circumstances (such as the
presence of interferon for an interferon driven promoter), but which can
selectively be induced to
cease or significantly reduce cell division (for example, by removal from the
cellular environment
of effective amounts of interferon to drive the promoter).
5 In this example, the MX-1 promoter directs expression of SV40 large Tag.
Transfected cells expressing the pMX-1 DNA exhibit increased proliferation by
driving the SV40
Tag in the presence of human A/D interferon (an alpha interferon hybrid
constructed from the
recombinant human interferons Hu-IFN-nA and Hu-IFN-aD available from PBL, of
West
Caldwell, NJ). The cells exhibit diminished mitotic activity when interferon
is removed. Several
10 laboratories have investigated the establishment of bone cell lines
transfected with a gene
constitutively expressing the SV40 Tag (Keeling et al., J. Bone Miner. Res.
7:127-132 (1992);
Evans et al., J. Orthoped. Res. 13:317-324 (1995)) while others have utilized
a gene coding for a
temperature-sensitive mutant, tsA58, of SV40 Tag which conditionally
immortalizes the human
fetal osteoblastic cell line under permissive conditions; Harris et al., J.
Bone Miner. Res. 10:178-
15 186 (1995). The SV40 Tag is one of the most effective methods of either
constitutively or
conditionally immortalizing cell lines.
All reagents were purchased from Sigma Chemical Co. (St. Louis, MO) or Gibco
BRL Inc., (Grand Island, NY) unless otherwise noted. Falcon tissue culture
plasticware was
obtained from Becton Dickson and Co. (Franklin Lakes, NJ). A QuickPrep Micro
mRNA
20 Purification Kit was purchased from Pharmacia Biotech, Inc. (Piscataway,
NJ), and an Access RT-
PCR System was purchased from Promega Inc. (Madison, WI). PCR plasticware was
purchased
from Perkin Elmer, Inc. (Norwalk, CT). NuSieve 3: i agarose was obtained from
FMC
BioProducts (Rockland, ME). The recombinant human bone morphogenetic protein-2
(rhBMP-2)
was provided by Genetics Institute, Inc. (Andover, MA) and the methods of
production and
25 purification of BMP-2 have been previously described in Wang et al., Proc.
Natl. Acad. Sci. USA
87:2220-2224 (1990), and Wozney, Progress in Growth Factors 1:267-280 (1989).
Fetal tissue of gestational age of approximately 12-13 weeks was obtained
under
institutionally approved protocols. The tissue was maintained in EBSS
supplemented with 10 mM
HEPES, pH 7.4, and transported to the laboratory for dissection and isolation.
Osteoblasts were
30 derived from fetal human periosteum and femur utilizing a repeated
digestion technique involving
0.3 % collagenase P (Boeringer-Mannheim, Indianapolis, IN) and 0.25 % trypsin,
as in Gallagher et
al., in Human Cell Culture Protocols, Humana Press, pages 233-262 (1996)
(which is incorporated
by reference). Although three or four repeated digestions may be used, the
fourth cellular
preparation contains more mature osteoblasts. In contrast, the present method
collected the cellular
35 preparations from the first and second digestions, and plated them out in
anticipation of isolating and
selecting a precursor cell. Cells were plated at 0.25 x 106 in 75 cm2 tissue
culture flasks in alpha
MEM with 5 % FBS. The remaining tissue pieces were collected, washed with
calcium magnesium
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-18-
free EBSS and digested with 0.25 % trypsin-EDTA for 30 min. These cells were
also plated as
described above. These cultures represent the initial isolation, P0, and once
confluent, the cells
were subcultured after enrymatic removal with 0.25% trypsin-EDTA to passage 1
(P1).
The early passage bone cells were maintained and expanded to P3, at which time
5 they were transfected by a standard calcium phosphate-mediated methodology
(Stratagene~, La
Jolla, CA) to incorporate 10 ug of CsCI purified pMXl-SV40T antigen-Neo-195
plasmid DNA into
the host cell genome. The plasmid pMXl-SV40T-Neo-195 was fabricated by fusing
a 2.3-kb
mouse MX-1 promoter to a 2.1-kb SV40 large T fragment in the cloning vector
pSP65. A 1.9-kb
mouse beta globin 3' untranslated region (3'UTR) was introduced into the
plasmid at the BamHI
10 and XbaI sites; the resulting plasmid was named pMXI-SV40T. A 1,518-by
HincII-XmnI
fragment containing the neomycin phosphotransferase driven by the SV40
promoter was isolated
from pcDNA3 (InVitrogen, San Diego, CA), subcloned into pMXl-SV40T digested
with EcoRI,
and filled with a Klenow sequence to form the pMXl-SV40T antigen-Neo-195
plasmid DNA (FIG.
3). The P3 bone cells were transfected overnight in a mitogenic serum-free
defined medium
15 UltraCULTURE~ (BioWhittaker, Inc., Walkersville, MD) containing no
antibiotics.
Following the transfection protocol, plates were rinsed with media and placed
into
fresh alpha MEM/5 % FBS overnight. The following day the transfected cells
were selected in
alpha MEM/5 % FBS media supplemented with 0.5 mglml 6418-sulfate (neomycin
analog). The
6418 allows the selection of stable transfectants that have incorporated the
gene conferring
20 resistance to neomycin toxicity. After a selection period of 10-14 days,
the medium was changed
to the alpha MEM/5 % FBS containing 750 U/mL human A/D interferon and 0.2
mglml 6418.
Clonal lines were obtained by a standard limiting dilution protocol of the
polyclonal transfectants
and preference was determined by the clonal cell's morphology, growth rate of
approximately 3.5-4
doublings per week, and expression of alkaline phosphatase. Mock transfected
cells served as a
25 control for the selection.
The osteoblast precursor cell preparations at the time of the initial plating
(PO)
established an adherent culture with cells exhibiting generally a polygonal,
with intermittent
fusiform, morphology expressing a faint birefringence surrounding the cells.
Within 5-8 days of
the PO plating, the cells grew into a confluent monolayer exhibiting a
morphology consistent with
30 other osteogenic cell lines. Control non-transfected cells were maintained
and passaged in parallel
with the transfected cells to determine the growth rates and limits to
propagation. In general, the
growth rate of the normal human osteoblast-like cells was reduced as compared
to the transfected
cell lines (TABLE 3). The non-transformed cells also exhibited a growth rate
that significantly
diminished after passage 20 (P20), and between P25 and P28 became senescent
and ceased
35 propagation.
CA 02320136 2000-08-09
WO 99/39724 PCT1US99/02946
-19-
TABLE 3
Doubling APase APase passage
OPC clone times (days)control(10 ng/mIBMP-2) Mineralizeno.
1 1.8 15.6f 122.4117.6 +++ 10
1.5
2 1.9 13.612.348.615.4 ++ 10
3 1.67 14.512.155.816.6 ++ 10
4 3.3 *ND *ND - g
2.4 *ND *ND - g
6 2.2 14.412.468.415.8 + + 10
7 2.9 *ND *ND - g
Nontrans- 2.4 12.811.828.812.2 + 10
formed cells
*ND = Not
Determined
The cells were subcultured until passage 3 (P3) after which they were
transfected
with the pMx-1-SV40T-Neo-195 DNA expression vector. Following transfection and
selection for
5 10-14 days in the 0.5 mg/mL 6418-sulfate (neomycin analog), 1-2% of the
initial plated celis were
observed to survive the selection process. In contrast, all of the mock
transfected cells died within a
4-7 day period. The stable uansfectants were maintained in alpha MEM/5 % FBS
containing 750
U/mL human A/D interferon and thereafter, the cultures were not maintained
under continual
selection pressure (i.e. G418-containing medium). Seven clonal lines
designated OPC1-OPC7 were
10 obtained by a standard limiting dilution protocol of the polyclonal
transfectants in 96 well plates.
Three of the clones, OPC4, OPCS, OPC7 were eliminated from additional
evaluation as they
exhibited undesired morphologic and/or growth characteristics (TABLE 3). In
particular, they
displayed fusiform morphology (spindle-like, tapering at both ends) and a
doubling time greater than
or equal to the control non-transformed cell.
15 The remaining four clones were selected for additional expansion and
characterization. Morphologically, these clonal cells generally exhibited a
polygonal morphology
with the extension of short dendritic processes at low density, which when
grown to a confluent
monolayer possessed an epithelial morphology that did not exhibit extensive
hyperconfluence, thus
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-20-
cell growth was somewhat contact inhibited. Growth curve analysis for the 4
clones, OPC1,
OPC2, OPC3 & OPC6 approximated 3.5-4.2 doublings per week (population doubling
time of 40-
49 hrs) and the clone designated OPC 1 was selected as the lead candidate
based on the highest level
of alkaline phosphatase (APase) expression, but especially the ability of the
OPC1 line to
5 significantly up-regulate the APase activity to low dose rhBMP-2, 10 ng/ml,
as assessed at day 9.
OPC 1 can be maintained in a nutrient rich medium such as alpha MEM with 5 %
FBS, but it also
demonstrates an ability to survive in conditions that are nutrient poor (a
serum level of
approximately 0.6-0.9% v/v). This ability to survive in a nutrient poor
environment is a particular
advantage of OPC 1 that renders it especially useful in the method of the
present invention in which
the cell is implanted in situ into a nutrient poor osseous defect.
Cryovials containing 5 x IObcells of the OPC1 line maintained in antibiotic
and
antimycotic-free tissue culture medium for at least 3 passages were packaged
and sent to ViroMED
Laboratories (Minneapolis, MN) to test for the presence of Cytomegalovirus,
Hepatitis B, Hepatitis
C, HIV-1, HIV-2, and HTLV I/II. Conditioned medium was also collected and
shipped to
15 Microbiological Associates, Inc. (Rockville, MD) for assessing sterility.
Lastly, mycoplasma
detection was performed utilizing the CELLshipperTM kit as described by
BIONIQUEm Testing
Laboratories, Inc. (Saranac Lake, NY). The OPCI line was determined to be free
of these
pathogens.
EXAMPLE 2
Screening Methods to Determine if Cell has OPC Phenotype
Confirmation of an osteoblast/pre-osteoblast phenotype was performed at
various
passages (P10, P20, P30) with OPC1. The APase enzyme activity was
quantitatively measured by
the method of Lowry et al., J. Biol. Chem. 207:19-37 (1954) in cultures at
days 4, 9 and 16
25 following an initial seeding of 25K cells/well in a 6 well plate (Falcon)
overnight with a base
medium of alpha MEM/5% FBS (GIBCO). The osteoblast/pre-osteoblast/OPC
phenotype
primarily requires the identification of a marker for osteocalcin, and
preferably at least two other
markers selected from the group of alkaline phosphatase, mineralization,
osteonectin, osteopontin,
PTH-receptor, and procollagen.
Alkaline Phosphatase Activity
The wells with the OPCs contained the base medium of alpha MEM/5 % FBS
(GIBCO) overnight after their initial seeding. On the following day, the base
medium provided a
negative control { 1 ) and the additional groups included: (2) base medium
supplemented with 10
35 ng/ml of rhBMP-2; (3) base medium supplemented with 50 ng/ml of rhBMP-2;
(4) base medium
supplemented with 100 ng/ml of rhBMP-2; (5) base medium supplemented with the
osteogenic
supplement (OS) 10 mM beta-glycerophosphate, 10-7 M Dexamethasone, 50 pg/ml of
ascorbic acid
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-21 -
phosphate (Wako Chemical, Osaka, Japan) and (6) base medium supplemented with
OS plus 50
ng/ml rhBMP-2. Alkaline phosphatase enzyme activity was measured in triplicate
cultures after
rinsing the wells with calcium magnesium-free EBSS, collecting the cells by
scraping and
incubating SOK per well in a 96 well plate with 5 mM p-nitrophenyl phosphate
in 50 mM glycine
5 and 1 mM MgCl2 at 37° C for S to 20 min. Enzyme activity was
calculated after measuring the
absorbance of the p-nitrophenol product formed at 405 nm on a microplate
reader (MRX, Dynatech
Labs., Chantilly, VA) and compared to serially diluted standards. Enzyme
activity is expressed as
ng of p-nitrophenol/min/SOK cells. In addition, APase histochemistry was
performed on cultures at
P30 according to standard protocols described in Sigma Kit #85. However, in
this series of
10 experiments, group (4) from above (base medium supplemented with 100 ng/ml
of rhBMP-2), was
replaced with base medium supplemented with 50 ng/ml of bFGF, to evaluate
mitogenicity and/or
the ability to influence programmed osteogenic differentiation.
At P20, with the exception of the control, the OPCs exhibited a statistically
significant increase in the APase enzyme activity in all medium conditions at
4, 9 and 16 days after
15 the initial seeding period. A striking up-regulation of APase enzyme
activity was observed at 4
days in an osteogenic supplement (OS) group (base medium supplemented with 10
mM beta-
glycerophosphate, 10-' dexamethasone, 50 ~cg/ml of ascorbic acid phosphate
(Wako Chemical,
Osaka, Japan)) and 50 + OS (base medium supplemented with OS and 50 ng/ml
rhBMP-2) group.
Four days was also the time at which the wells approached confluence. These
groups exhibited
20 activities of 63.2 t 10.2 and 262.3114.8 ng p-nitrophenol/min/SOK cells,
respectively, as compared
to 9.6 t 2.4 for the control. By day 9, peak APase enzyme activities in ng p-
nitrophenol/min/SOK
cells were observed: control=16.6 t 2.6; 10 ng BMP=127.8 f 19.5; 50 ng
BMP=225.5 t 22.8;
100 ng BMP= 292.2 t 24.4; OS=310.1 t 19.2; 50 + OS=407.8 t 19.5. Similar
observations
were noted for the OPC1 line at P10 and P30. APase histochemistry revealed
staining that was
25 consistent with the enzyme activity data.
Mineralization
The OPC1 line was evaluated for the cells' ability to mineralize the
extracellular
matrix which they produce 7-10 days following confluence in the base medium,
but especially
30 following maintenance in the base medium supplemented osteogenic supplement
(OS). The
extracellular calcium content was quantitatively measured by scraping twice
rinsed with PBS cell
layers and exposing the cells to 0.1 N HCI. The cells were extracted by
shaking for 4 hours at
4°C, collecting the cells by centrifugation, and using the supernatant
for calcium determination
according to the manufacturer's protocol in Sigma Kit #587. Absorbance of the
sample was .
35 measured on the multiplate reader (MRX, Dynatech Labs) at 570 nm at S-10
min after the addition
of reagents. Total calcium was calculated from standard solutions prepared in
parallel and
expressed as ug/well.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 22 -
A histochemical analysis of mineralization was also evaluated utilizing the
staining
procedure of von Kossa. Postconfluent cells were fixed in 1 % (w/v)
paraformaldehyde in
phosphate-buffered saline (PBS, pH 7.4) for 1 hr, rinsed with PBS and treated
with 5 % (w/v) silver
nitrate in the dark for 15 min. The cells were then rinsed thoroughly with
distilled water, subjected
to ultraviolet light for 5-7 min, treated with sodium carbonate/formaldehyde
solution for 2 minutes
and finally with Farmer's reducer for 1 min.
The OPC 1 line has been characterized quantitatively for extracellular calcium
deposition during the formation of the mineralized nodules at P20. All
conditions were negative for
calcium content at day 4, while the groups with osteogenic supplement (t 50
ng/ml rhBMP-2) have
10 exhibited a significant increase in the quantity of extracellular matrix
deposition at day 9. By day
16, all of the groups have exhibited a significant increase in the deposition
of extracellular calcium,
while the groups maintained in the osteogenic sunplement have deposited nearly
20 ug of calcium
in a 6 well plate.
The von Kossa stained specimens were detected under light microscopy by day 4-
5
postconfluency and were extensive by days 7-10 in the treatment groups
maintained in the 50 ng
rhBMP-2 + OS. Once the cells reached confluency, a small number of mineralized
nodules were
visible in the cells maintained in base medium of alphaMEM/5 % FBS at day 9
following the initial
seeding. However, in groups maintained in the BMP groups t the OS, and
especially in the 50 ng
rhBMP-2 + OS cultures, the number of mineralized nodules was markedly greater
than controls.
20 The formation of mineralized nodules in the cells maintained in base medium
without beta-
glycerophosphate or dexamethasone is consistent with a previous report for
immortalized human
fetal osteoblastic cells (Harris, et al., J. Bone Miner. Res. 10:178-186
(1995)) but is otherwise
unusual for osteoblastic cell lines.
Osteocakin
The osteocalcin level in conditioned medium was determined by an EIA kit for
intact osteocalcin (Biomedical Technologies, Inc., Stoughton, MA). Pre- and
post-confluent OPC1
cells in 6 well multiwell plates (characterized in triplicate) were maintained
in 1 ml of the serum-
free medium UItraCULTURE~ with the various supplements included as previously
described in
30 the measurement of APase. Samples were collected after 48 hrs and a 50 ~l
sample was
innoculated onto the microtiter plate and assayed according to the
manufacturer's protocol. Data
are expressed as ng/ml and the limit of detection for the EIA is 0.1 ng/ml.
Intact osteocalcin (ng/ml/24 hr) was measured in the tissue culture medium
under
the following conditions: control= 1.1 t 0.3; 10 ng BMP=*1.7 t 0.3; 50 ng
BMP=*1.8 t 0.3;
50 ng bFGF= 0.8 t 0.2; OS = * 2.1 t 0.5; 50 + OS = *8.6 t 2.7. A significant
increase
(*p < 0.05) as compared to the control group was observed in all the treatment
groups except the
bFGF group. The lysate values from approximately 1 x 106 OPC 1 cells
maintained in the control
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-23-
medium was negligible (below the limit of detection), further indicating that
the osteocalcin
measured in the present study was intact and secreted de novo from the OPC 1
line.
Reverse Transcriptase Analyse
5 Established Reverse Transcriptase-Polymerase Chain Reaction {RT-PCR)
qualitative analysis techniques were used to detect {by PCR phenotyping) the
presence of
osteocalcin (OSC), osteonectin (OSN), osteopontin (OSP), PTH receptor (PTHr),
alkaline
phosphatase (ALP) and procollagen Type I (ProI). Rickard, et al., J. Bone
Miner. Res. 11:312-
324 (1996); Bilbe et al., Bone 19:437-445 (1996). The oligonucleotide RT-PCR
primer sequences
are listed in TABLE 4 and were purchased from GIBCO BRL.
TABLE 4
Reverse Transcriptase-PCR Primers for Phenotype Analysis
RT-PCR Primer Set Seguence Product Length
Osteocalcin 5'-ctggccctgactgcattctgc-3' 258bp
(SEQ. ID. Nos. 1 and 2) 5'-aacggtggtgccatagatgcg-3'
Osteonectin 5'-gatgaggacaacaaccttctgac-3' 369bp
(SEQ. ID. Nos. 3 and 4) 5'-~gatcacaagatccttgtcgat-3'
Osteopontin 5'-aaatacccagatgctgtggc-3' 348bp
(SEQ. ID. Nos. 5 and 6 ) 5'-aaccacactatcacctcggc-3'
PTH-Receptor 5'-aggaacagatcttcctgctgca-3' S7lbp
(SEQ. ID. Nos. 7 and 8) 5'-tgcatgtggatgtagttgcgcgt-3'
Alkaline Phosphatase 5'-gcgaacgtatttctccagacccag-3' 367bp
(SEQ. ID. Nos. 9, 10) 5'-~caaacaggagagtcgcttcaa-3'
Procollagen I 5'-tgacgagaccaagaactg-3' S99bp
(SEQ. ID. Nos. 11, 12) 5'-~~agtcaccaaacctacc-3'
The procedure involves 3-5 x 106 OPCs pelleted at 12,000 RPM in a microfuge
(Eppendorf 5412, Brinkman Instruments, Inc. Westbury, NY) and either used
immediately or
15 frozen at -80 °C for storage. Then mRNA was isolated using the
QuickPrep Micro mRNA
purification kit (Pharmacia Biotech, Inc.) according to the manufacturer's
specifications resulting in
a 200 ul final mRNA elution volume. The mRNA concentrations were determined by
CA 02320136 2000-08-09
WO 99/39724 PCT/US99102946
-24-
spectrophotometric absorbance using A2~ x 40 ~g/1c1. mRNA concentrations of
the elution
volumes were determined to be in the range of 50-160 ~g/~1. The cDNA was
synthesized from 50
1cg of the mRNA according to the Access RT-PCR System (Promega, Inc., Madison,
WI).
Aliquots of the total cDNA were amplified in each PCR with 2.5 U of Taq
polymerise (Promega,
5 Inc.) and amplifications were performed in a GeneAmp 2400 thermal cycler
(Perkin-Eimer, Inc.,
Norwalk, CT) for 30 cycles after an initial 30 sec denaturation at
94°C, annealed for 2 min at
55°C, and extended for 2 min at 72°C. The amplification reaction
products were resolved by 2.5
NuSieve agarose/TBE gels (FMC BioProducts, Rockland, ME) electrophoresed at 85
mV for 90
min and visualized by ethidium bromide. Base ladders of SO by and 100 by
(Boehringer
Mannheim, Inc.) provided standards.
The OPC 1 line expressed abundant mRNA generated from 30 cycles of RT-PCR
for the presence of osteocalcin (OSC), osteonectin (OSN), osteopontin (OSP),
PTH receptor
(PTHr), alkaline phosphatase (AP) and procollagen Type I (Prol). The
representative RT-PCR
products (bands) were resolved by agarose gel electrophoresis and correspond
to base pair product
lengths of 258, 369, 348, 571, 367 and 599 for OSC, OSN, OSP, PTHr, AP and
ProI,
respectively, as outlined in TABLE 4.
The levels of expression of these positive markers appears to be influenced by
the
conditions in which the OPC 1 line are maintained. For example, osteocalcin
and PTH receptor
messages (markers corresponding to the late phase of osteoblast
differentiation) appear to have
20 greater intensity in the cells maintained in the 50+ OS medium condition
than the base medium
alone. Human-derived glioblasts have provided a control cell type and are
negative for OSC, OSN,
OSP and PTHr.
This example therefore demonstrates and characterizes a new human fetal
osteoprecursor cell line (OPC1) which is immortalized with a gene coding for
the SV40 large T
antigen (Tag). The incorporation of the DNA plasmid into the primary cultures
drives a gene, the
MX-1 promoter, to conditionally express SV40 large T antigen when activated by
human A/D
interferon. However, when the OPC 1 line is maintained in nutrient-rich tissue
culture medium,
i.e., alpha MEM containing 5% (v/v) FBS, no difference in the rate of cell
proliferation is
observed either in the presence or absence of human A/D interferon. The Tag is
therefore
30 expressed constituitively. When the OPC 1 reaches confluence in standard
two-dimensional tissue
culture plastic, the cells exhibit contact inhibition, with a concurrent down
regulation of
immunopositive nuclear Tag staining. Hence the OPC1 line does not exhibit
tumorigenic
characteristics. Additionally, these cells have been repeatedly frozen and
thawed and continue to
maintain consistent levels of the osteogenic phenotypic markers, further
indicating that a successful
derivation of an osteoprecursor clonal cell line was accomplished.
Numerous phenotypic markers establish the stability of expression in the OPCl
line in association with osteoblastic differentiation. These include alkaline
phosphatase expression,
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-25-
the ability to mineralize, measurement of intact osteocalcin, and mRNA
expression of osteocalcin
(OSC), osteonectin (OSN), osteopontin (OSP), PTH receptor (PTHr), alkaline
phosphatase (AP)
and procollagen Type I (ProI). The present studies indicate that postconfluent
cultures of the OPC 1
line express high levels of these osteoblastic-associated markers at passage
10 (P10), P20 and P30.
5 In the present studies, rhBMP-2 elicits a stimulatory effect on APase
activity in
the OPC 1 line in vitro. However, rhBMP-2 has no stimulatory effect on
differentiated osteoblasts
obtained from human iliac bone or a more differentiated rat-derived osteoblast
cell, ROB-C20.
Yamaguchi et al., J. Cell Biol. 113:681-687 (1991). Thus, based on the OPCl
line's capacity to
generate programmed osteoblastic differentiation in the presence of low dose
rhBMP-2 (10 ng/ml),
10 the OPC1 line represents a homogeneous osteoprecursor cell line. The
absence of any fibroblastic
or adipocytic activity also indicates that the OPC has sufficiently
differentiated to commit to an
osteogenic lineage. The ability to demonstrate programmed differentiation at a
dose of 10 ng/ml
rhBMP-2 is markedly lower than described for the mouse-derived MC3T3-El
(Takuwa et al.,
Biochem. Biophys. Res. Common. 174:96-101 (1991)), a rat-derived "potential"
osteoblast
15 precursor cell line (Yamaguchi et al. (1991)), and differentiated
osteoblasts from human iliac bone
(Kim et al., J. Biomed. Mater. Res. 35:279-285 (1997)).
The OPC1 (and other cells that can be obtained by the methods of the present
invention) provide a consistent and reproducible culture system to provide a
biomimetic for
endogenous human osteoprecursor cells.
EXAMPLE 3
Transfection with Suicide Gene
This example discloses an alternative embodiment of the invention in which a
SV40 plasmid incorporates a suicide gene that enables the OPCs incorporating
the plasmid to be
selectively destroyed. Some of the early passage bone cells are transfected
with the
pMXI-SV40-Tt antigen construct with a TK-neomycin gene for selection. This DNA
construct
contains both the large T and small t antigen. Ten micrograms of CsCI purified
pMXl-SV40T t-
antigen-Neo-431 DNA (p431) are introduced into the pre-osteoblast cells at P3
using GIBCO BRL's
LIPOFECTAMINETM PLUS mammalian transfection kit for 6 hrs suspended in a
mitogenic serum-
30 free defined medium UltraCULTURE~ from BioWhittaker, Inc, containing no
antibiotics.
Following the transfection protocol, plates are rinsed with media and placed
into fresh alpha
MEM/5 % FBS overnight. The following day the transfected cells are exposed to
alpha MEM/5 %
FBS media supplemented with 0.5 mg/ml 6418-sulfate (GIBCO BRL-neomycin
analog). The
6418 allows the selection of stable transfectants that have incorporated the
gene conferring
resistance to neomycin toxicity.
After a selection period of 10-14 days, the medium is changed to the alpha
MEM/5 % FBS containing 750 U/mL human A/D interferon and 0.2 mg/ml 6418.
Clonal lines are
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-26-
obtained by a standard limiting dilution protocol of the polyclonal
transfectants and preference is
based on the clonal cell's morphology, growth rate of approximately 3.5-4
doublings per week, and
abundant expression of alkaline phosphatase. The MX-1 promoter conditionally
activates the
expression of SV40-large T and/or small t antigens when stimulated by human
A/D interferon.
5 The conditional immortalizing gene can be reversible, i.e., upon removal of
the stimulating
condition (interferon production), the preferred cell line will exit the cell
cycle, commit to a
differentiated phenotype, and exist in a stable, non-mitotic state. The small
t antigen generates cell
lines that exhibit a truly conditional immortalizing state. The TK-neomycin
gene offers the
additional advantage of providing a suicide gene in the construct for safety
purposes which can
destroy the cells in the presence of the antibiotic ganciclovir,
valganciclorvir, acyclovir, or related
compounds if desired or necessary.
A pre-osteoblast cell can also be transfected with hCNTF-pNUT-DNT. A plasmid
expression vector containing the hCNTF gene was constructed by introducing a
linker generating a
Smal site introduced at +600 of the mouse metallothionein-1 (MT-1) promoter.
This Smal site was
15 fused to a Klenow-filled XbaI site at the 5' end of a approximately 150
base pair (bp) human
immunoglobulin region containing the hCNTF cDNA. The hCNTF gene was obtained
by PCR
amplification of human DNA with primers that include an EcoRI site at the
position of the natural
hCNTF initiation codon and Bglll site 7 by 3 of its termination codon. A 325
by PavI fragment
containing the poly-adenylation signal sequence has been modified such that a
BamHI site can be
20 added to the 5' end and a NotI site added to the 3' end. This fragment was
cloned into the Bglll-
NotI sites on the 3' end of the hCNTF gene. The entire 2854 by MT-1/IglItCNTF-
2/hGH KpnI-
NotI fragment was then inserted between the Kpn and NotI sites of a pNUT
vector in which the
EcoRI site was converted to a NotI site by inserting a linker into a Klenow-
filled EcoRI site. A 2
kb PwII fragment containing the herpes simplex virus-thymidine kinase (HSV-tk)
gene was cloned
25 into the EcoRV site of the Bluescript and the XhoI site was converted to
NotI such that the NotI
fragment containing the HSV-TK gene was isolated and inserted into the NotI
site to generate the
current plasmid expression vector. This vector (shown in FIG. 7) has been
utilized to transfect the
OPCs to produce hCNTF and has been used to transfect C2C12 myoblasts and BHK
cells.
Plasmids have also been used which utilize the MX-1-KS-v-myc+NEOR and the
30 CMV-KS-v-myc+NEOR. The plasmid with the MX-1 promoter conditionally
activates the v-myc
oncogene in the presence of human interferon. The second plasmid has the KS-v-
myc gene under
control of the CMV promoter, to result in efficient levels of expression.
Other alternatives include
conditional immortalizing and growth factor/bone differentiating factor
plasmids that are under the
activation of bone-specific promoters such as osteocalcin.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-27-
EXAMPLE 4
Determining Transgene Expression
Immunostaining for the presence of positive large T antigen (Tag) expression
is
performed on the OPC line that has been maintained in medium that drives the
promoter for Tag
5 (human AID interferon in the conditionally immortalized example), and in
cultures without the
stimulus. The Tag monoclonal antibody is available from CytoTherapeutics, Inc.
(Lincoln, RI),
and the staining protocol follows standard immunoperoxidase techniques
utilizing a Vectastain
Elite~ ABC Mouse Kit. The SCT-l/hNGF cell line is utilized as the positive
control for the
immunopositive nuclear Tag; Schinstine et al., Cell Trans. 4:93-102 (1995).
10 Immunostaining revealed positive nuclear staining for the presence of
positive
large T antigen (Tag) expression in the OPC 1 line maintained in medium with
human A/D
interferon, that drives the promoter for Tag. In the absence of the
stimulating agent, some of the
OPCs still retain a positive nuclear immunostaining for the Tag antibody (S-
8%), suggesting that
the large T antigen may be constituitively expressed in some of the OPC 1
line, rendering these cells
15 immortal and not retaining the capacity for reversal. However, in preferred
embodiments, the
OPC cells selected for use in the method of the present invention do not
constitutively express the
large T antigen. The SCT-1/hNGF cell line exhibited immunopositive nuclear Tag
as a positive
control.
In summary, the OPC1 line is a contaminant-free human-derived immortalized
20 osteoprecursor cell line that appears to exhibit contact inhibition and
undergoes programmed
osteogenic differentiation. This cell line has exhibited a stable
incorporation of the SV40-T antigen
transgene, without continual selection pressure, that does not appear
negatively to impact the
growth, maintenance or differentiation genome of the host cell. The OPC1 line
can be maintained
for greater than 80 passages, and does not exhibit growth crisis and
senescence observed in the non-
25 transformed parent cell line. The OPC1 has also been utilized to stably
incorporate a second
transgene to produce and secrete a growth or differentiation factor. The
osteoprecursor cell line
also provides a sensitive in vitro cell culture system to evaluate bone
development, cell/biomaterial
interactions, and screen for putative bone differentiating factors.
30 Construction of hBMP-2 Expression Vectors
A variety of hBMP expression vectors can be used to introduce BMP genes into
the
OPC cells of the present invention. The following examples (5-10) illustrate
some specific
examples of varying approaches to constructing hBMP-2 expression vectors for
transfection into the
OPC cells, and serves as an example for other hBMPs.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-28-
EXAMPLE 5
Construction of the KS-hBMP-2 Expression Vectors pcDNA3.1(+)-KS-hBMP2-SO8 and
pPI-DN-KS-hBMP2-512
Total RNA from the OPC1 line is prepared using the guanidinium thiocyanate-
5 based TRI reagent (Molecular Research Center, Inc., Cincinnati, OH). Five
hundred ng of the
OPC 1 line total RNA is reverse transcribed at 42°C for 30 minutes in a
20 ml reaction volume
containing 10 mM Tris HCl (pH 8.3), 50 mM KCI, 4 mM of each dNTP, 5 mM MgClz,
1.25 mM
oligo(dT) 15-mer, 1.25 mM random hexamers, 31 units of RNase Guard RNase
Inhibitor
(Pharmacia, Sweden) and 200 units of Superscript II reverse transcriptase
(Gibco BRL,
10 Gaithersburg, MD). Two microliters of the above reverse transcribed cDNA is
added to a 25 ml
PCR reaction mixture containing 10 mM Tris-HCl (pH 8.3), 50 mM KCI, 800 nM of
each dNTP,
2 mM MgCl2, 400 nM of primers ohBMP2-597 and ohBMP2-598, and 2.5 units of
Thermos
aquatics (Taq) DNA polymerase (Boehringer Mannheim, Germany). The primer
ohBMP2-597 has
the synthetic HindIII restriction site and the consensus ribosome binding site
(referred to as Kozak
15 Sequence, KS, hereafter) at the 5' end whereas ohBMP2-598 has BamHI at the
5' end.
The PCR reaction mixture is subjected to 30 amplification cycles consisting
of:
denaturation, 94°C 30 seconds (first cycle 2 minutes); annealing,
50°C 1 minute; and extension,
72°C 3.5 minutes (last cycle 5 minutes). The 1215-by hBMP-2 PCR product
is digested with
restriction endonucleases BamHI and HindIII and resolved on an 1 % Trivie
agarose gel. The 1215-
20 by HindIII/BamIiI DNA fragment is excised and purified using the Spin-X DNA
purification kit
(Corning Costars Corporation, Cambridge, MA). The pcDNA3.1(+) expression
vector is also
digested with BamHI and HindIII and purified from 1 % agarose using the Spin-X
DNA purification
kit (Corning Costars Corporation, Cambridge, MA). The ligation mixture is
transformed into E.
coli DHSa (Gibco BRL, Gaithersburg, MD). A cracking gel procedure (Promega
Protocols and
25 Applications Guide, 1991) is used to screen out the positive sub-clones.
The identity of the correct clones will be further verified by BamHI/HindIII
double digestion. The positive sub-clone for the full-length hBMP-2 in
pcDNA3.1(+) is named
pcDNA3.1(+)-hBMP-2-508. The nucleotide sequence of the full-length hBMP-2
clone is
determined by the dideoxynucleotide sequence determination using the
SequaTherm kit (Epicentre
30 Technologies, Madison, WI) for the automated DNA Sequencer. Subsequently,
the full-length
KS-hBMP-2 insert is subcloned out of pcDNA3.1(+)-hBMP-2-508 by NheI/NotI
digestions and
directionally cloned into the pPI-DN expression vector resulting in pPI-DN-KS-
hBMP2-512.
EXAMPLE 6
35 Construction of the IgSP-NS-hBMP-2 expression vectors: pcDNA3.1(+)-IgSP-NS-
hBMP2-509
and pPI-DN-IgSP-NS-hBMP2-513
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-29-
Recombinant PCR methodology is used to generate the IgSP-NS-hBMP-2 fusion
gene. Oligonucleotides oIgSP-221 and ohBMP2-601 are specific for the IgG
signal peptide
sequence (IgSP) and the mature hBMP-2 sequence, respectively, and contain
synthetic HindIII and
BamHI restriction sites at the 5' end, respectively. Oligonucleotides ohBMP2-
599 and ohBMP2-
5 600 are complementary to each other. Furthermore, oligonucleotide ohBMP2-600
has its 5' 14
nucleotides identical to the IgSP sequence and its 3' 16 nucleotides identical
to the mature hBMP-2
sequence; and vice versa for ohBMP2-599. Two first PCR reactions are carried
out using
oligonucleotide pairs oIgSP-221/ohBMP2-599 and ohBMP2-600/ohBMP2-601 on
templates
pNUT-hCNTF-TK and pcDNA3.1(+)-KS-hBMP-2-508 plasmids, respectively. One
hundred ng of
10 template DNA is added to a 50 ml PCR reaction mixture containing 10 mM Tris
HCl (pH 8.3), 50
mM KCI, 800 nM of each dNTP, 2 mM MgClz, 400 nM of primers #1 and #2, and 2.5
units of
Taq DNA polymerase (Boehringer Mannheim, Germany).
The PCR reaction mixtures are subjected to 30 amplification cycles consisting
of:
denaturation, 94°C for 30 seconds; annealing, 50°C 30 seconds;
and extension, 72°C 30 seconds.
15 The PCR products are resolved on 1 % TrivieGel (TrivieGen). Two agarose
plugs containing each
one of the first PCR products are transferred to a tube containing 50 ml of
PCR reaction mixtures
identical to the one described above with the exception that the
oligonucleotides oIgSP-221 and
ohBMP2-601 are used. The second PCR reaction is subjected to 30 amplification
cycles consisting
of: denaturation, 94°C for 30 seconds (first cycle 2 minutes);
annealing, 60°C 30 seconds (second
20 to fourth cycles 37°C 2 minutes); and extension, 72°C 30
seconds (last cycle 2 minutes). The 535
by IgSP-mature hBMP-2 fusion PCR product and the cloning vectors pcDNA3.1(+)
are digested
with BamHI and HindIII restriction enzymes and subsequently purified from I %
Trivie and agarose
gels, respectively, using the Spin-X DNA purification kit (Corning Costars
Corporation,
Cambridge, MA). The ligation mixture is transformed into E. toll DHSa (Gibco
BRL,
25 Gaithersburg, MD). A cracking gel procedure (Promega Protocols and
Applications Guide, 1991)
is used to screen out the positive sub-clones.
The identity of the correct clones will be further verified by BamHI/HindIII
double digestion. The positive sub-clones for the IgSP-NS-hBMP-2 is named
pcDNA3.1(+)-IgSP-
NS-hBMP2-509. The nucleotide sequence of the IgSP-NS-hBMP-2 clone is
determined by the
30 didexoynucleotide sequence determination using the SequaTherm kit
(Epicentre Technologies,
Madison, WI) for the automated DNA Sequencer. Subsequently, the IgSP-NS-Hbmp-2
insert is
subcloned out of pcDNA3.1(+)-IgSP-NS-hBMP2-509 by NheI/NotI digestions and
directionally
cloned into the pPI-DN expression vector resulting in pPI-DN-IgSP-NS-hBMP2-
513.
35 EXAMPLE 7
Construction of the IgSP-KR-hBMP-2 expression vectors:
pcDNA3.1(+)-IgSP-KR-hBMP2-510 and pPI-DN-IgSP-KR-hBMP2-514
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-30-
Recombinant PCR methodology is used to generate the IgSP-KR-hBMP-2 fusion
gene. Oligonucleotides oIgSP-221 and ohBMP2-601 are specific for the IgG
signal peptide
sequence (IgSP) and the mature hBMP-2 sequence, respectively, and contain
synthetic HindIII and
BamHI restriction sites at the 5' end, respectively. Oligonucleotides ohBMP2-
602 and ohBMP2-
5 603 are complementary to each other. Furthermore, oligonucleotide ohBMP2-603
has its 5' 14
nucleotides identical to the IgSP sequence and its 3' 16 nucleotides identical
to the mature hBMP-2
sequence; and vice versa for ohBMP2-602. Two first PCR reactions are carried
out using
oligonucleotide pairs oIgSP-221/ohBMP2-602 and ohBMP2-603/ohBMP2-601 on
templates pNUT-
hCNTF-TK and pcDNA3.1(+)-KS-hBMP-2-508 plasmids, respectively. One hundred ng
of
i0 template DNA is added to a 50 ml PCR reaction mixture containing 10 mM Tris-
HCl (pH 8.3), 50
mM KCI, 800 nM of each dNTP, 2 mM MgCl2, 400 nM of primers #1 and #2, and 2.5
units of
Taq DNA polymerase (Boehringer Mannheim, Germany).
The PCR reaction mixtures are subjected to 30 amplification cycles consisting
of:
denaturation, 94°C for 30 seconds; annealing, 50°C 30 seconds;
and extension, 72°C 30 seconds.
15 The PCR products are resolved on 1 % TrivieGel (TrivieGen). Two agarose
plugs containing each
one of the first PCR products are transferred to a tube containing 50 ml of
PCR reaction mixtures
identical to the one des.,ribed above with the exception that the
oligonucleotides oIgSP-221 and
ohBMP2-601 are used. The second PCR reaction is subjected to 30 amplification
cycles consisting
of: denaturation, 94°C for 30 seconds (first cycle 2 minutes);
annealing, 60°C 30 seconds (second
20 to fourth cycles 37°C 2 minutes); and extension, 72°C 30
seconds {last cycle 2 minutes). The 541
by IgSP-KR-hBMP-2 fusion PCR product and the cloning vectors pcDNA3.1(+) are
digested with
BamHI and HindIII restriction enzymes and subsequently purified from 1 %
Trivie and agarose
gels, respectively, using the Spin-X DNA purification kit (Corning Costart
Corporation,
Cambridge, MA). The ligation mixture is transformed into E. coli DHSa (Gibco
BRL,
25 Gaithersburg, MD). A cracking gel procedure (Promega Protocols and
Applications Guide, 1991)
is used to screen out the positive sub-clones.
The identity of the correct clones will be further verified by BamHI/HindIII
double digestion. The positive sub-clones for the IgSP-KR-hBMP-2 are named
pcDNA3.1(+)-
IgSP-KR-hBMP2-510. The nucleotide sequence of the IgSP-KR-hBMP-2 clone is
determined by
30 the didexoynucleotide sequence determination using the SequaTherm kit
(Epicentre Technologies,
Madison, WI) for the automated DNA Sequencer. Subsequently, the IgSP-NS-hBMP-2
insert is
subcloned out of pcDNA3.1(+)-IgSP-KR-hBMP2-510 by NheI/NotI digestions and
directionally
cloned into the pPI-DN expression vector resulting in pPI-DN-IgSP-KR-hBMP2-S
I4.
35 EXAMPLE 8
Construction of the IgSP-RRRR-hBMP-2 expression vectors:
pcDNA3.1(+)-IgSP-RRRR-hBMP2-511 and pPI-DN-IgSP-RRRR-hBMP2-515
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-31 -
Recombinant PCR methodology is used to generate the IgSP-RRRR-hBMP-2
fusion gene. Oligonucleotides oIgSP-221 and ohBMP2-601 are specific for the
IgG signal peptide
sequence (IgSP) and the mature hBMP-2 sequence, respectively, and contain
synthetic HindIII and
BamHI restriction sites at the 5' end, respectively. Oligonucleotides ohBMP2-
604 and ohBMP2-
5 605 are complementary to each other. Furthermore, oiigonucleotide ohBMP2-605
has its 5' 14
nucleotides identical to the IgSP sequence and its 3' 16 nucleotides identical
to the mature hBMP-2
sequence; and vice versa for ohBMP2-604. Two first PCR reactions are carried
out using
oligonucleotide pairs oIgSP-221/ohBMP2-604 and ohBMP2-605/ohBMP2-601 on
templates pNUT-
hCNTF-TK and pcDNA3.1(+)-KS-hBMP-2-508 plasmids, respectively. One hundred ng
of
10 template DNA is added to a 50 ml PCR reaction mixture containing 10 mM Tris-
HCl (pH 8.3), 50
mM KCI, 800 nM of each dNTP, 2 mM MgCl2, 400 nM of primers /il and //2, and
2.5 units of
Taq DNA polymerase (Boehringer Mannheim, Germany).
The PCR reaction mixtures are subjected to 30 amplification cycles consisting
of:
denaturation, 94°C for 30 seconds; annealing, 50°C 30 seconds;
and extension, 72°C 30 seconds.
15 The PCR products are resolved on 1 % TrivieGel (TrivieGen). Two agarose
plugs containing each
one of the first PCR products are transferred to a tube containing 50 ml of
PCR reaction mixtures
identical to the one described above with the exception that the
oligonucleotides oIgSP-221 and
ohBMP2-601 are used. The second PCR reaction is subjected to 30 amplification
cycles consisting
of: denaturation, 94°C for 30 seconds (first cycle 2 minutes);
annealing, 60°C for 30 seconds
20 (second to fourth cycles 37°C, 2 minutes); and extension,
72°C for 30 seconds (last cycle 2
minutes). The 547 by IgSP-RRRR-hBMP-2 fusion PCR product and the cloning
vectors
pcDNA3.1(+) are digested with BamHI and HindIII restriction enzymes and
subsequently purified
from 1 % Trivie and agarose gels, respectively, using the Spinz-X DNA
purification kit (Corning
Costart Corporation, Cambridge, MA). The ligation mixture is transformed into
E. toll DHSa
25 (Gibco BRL, Gaithersburg, MD). A cracking gel procedure (Promega Protocols
and Applications
Guide, 1991) is used to screen out the positive sub-clones.
The identity of the correct clones is further verified by BamHI/HindIII double
digestion. The positive sub-clones for the IgSP-RRRR-hBMP-2 are named
pcDNA3.l(+)-IgSP-
RRRR-hBMP2-511. The nucleotide sequence of the IgSP-RRRR-hBMP-2 clone is
determined by
30 the didexoynucleotide sequence determination using the SequaTherm kit
(Epicentre Technologies,
Madison, WI) for the automated DNA Sequencer. Subsequently, the IgSP-RRRR-hBMP-
2 insert is
subcloned out of pcDNA3.l(+)-IgSP-RRRR-hBMP2-511 by NheI/NotI digestions and
directionally
cloned into the pPI-DN expression vector resulting in pPI-DN-IgSP-RRRR-hBMP2-
515.
The nucleotide sequences of the plasmid vectors described in this example are
35 shown in TABLE 5.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-32-
TABLE 5
1'tucleottde Sequences of the KS-hBMP-2, IgSP-NS-hBMP-2,
IgSP-KR-hBMP-2, and IgSP-R.RRR-hBMP-2 Genes
KS-hBMP-2.seq (SEQ. ID. No. 13)
~~c:aagcttLGC:c:AC:c:atggtggccgggacccgctgtcttctagcgttgctgcttccccaggtcctcctgggcg
gcgcggctggcctcgtt
ccggagctgggccgcaggaagttcgcggcggcgtcgtcgggccgcccctcatcccagccctctgacgaggtcctgagcg
agttcgagttgcgg
ctgctcagcatgttcggcctgaaacagagacccacccccagcagggacgccgtggtgcccccctacatgctagacctgt
atcgcaggcactcag
gtcagccgggctcacccgccccagaccaccggttggagagggcagccagccgagccaacactgtgcgcagcttccacca
tgaagaatctttgg
aagaactaccagaaacgagtgggaaaacaacccggagattcttctttaatttaagttctatccccacggaggagtttat
cacctcagcagagcttcag
gttttccgagaacagatgcaagatgctttaggaaacaatagcagtttccatcaccgaattaatatttatgaaatcataa
aacctgcaacagccaactcg
15
aaattccccgtgaccagacttttggacaccaggttggtgaatcagaatgcaagcaggtgggaaagttttgatgtcaccc
ccgctgtgatgcggtgga
ctgcacagggacacgcclaccatggattcgtggtggaagtggcccacttggaggagaaacaaggtgtctccaagagaca
tgttaggataagcag
gtctttgcaccaagatgaacacagctggtcacagataaggccattgctagtaacttttggccatgatggaaaagggcat
cctctccacaaaagagaa
aaacgtcaagccaaacacaaacagcggaaacgccttaagtccagctgtaagagacaccctttgtacgtggacttcagtg
acgtggggtggaatga
ctggattgtggctcccccggggtatcacgccttttactgccacggagaatgcccttttcctctggctgatcatctgaac
tccactaatcatgccattgttc
20
agacgttggtcaactctgttaactctaagattcctaaggcatgctgtgtcccgacagaactcagtgctatctcgatgct
gtaccttgacgagaatgaaa
aggttgtattaaagaactatcaggacatggttgtggagggttgtgggtgtcgctagGATCCggg
IgSP-NS-hBMP-2.seq (SEQ. ID. No. 14)
25 CCcaagcttGCGTCACCCCTAGAGTCGAGCTGTGACGGTCCTTACAATGAAATGCAGCTGGG
TTATCTTCTTCCTGATGGCAGTGGTTACAGGTAAGGGGCTCCCAAGTCCCAAACTTGAG
GGTCCATAAACTCTGTGACAGTGGCAATCACTTTGCCTTTCTTTCTACAGGGGTGAATTC
Gcaagccaaacacaaacagcggaaacgccttaagtccagctgtaagagacaccctttgtacgtggacttcagtgacgtg
gggtggaatgactgg
attgtggctcccccggggtatcacgccttttactgccacggagaatgcccttttcctctggctgatcatctgaactcca
ctaatcatgccattgttcagac
30
gttggtcaactctgttaactctaagattcctaaggcatgctgtgtcccgacagaactcagtgctatctcgatgctgtac
cttgacgagaatgaaaaggtt
gtattaaagaactatcaggacatggttgtggagggttgtgggtgtcgctagGATCCggg
IgSP-KR-hBMP-2.seq (SEQ. ID. No. 15)
35
CCCaagcttGCGTCACCCCTAGAGTCGAGCTGTGACGGTCCTTACAATGAAATGCAGCTGG
GTTATCTTCTTCCTGATGGCAGTGGTTACAGGTAAGGGGCTCCCAAGTCCCAAACTTGA
GGGTCCATAAACTCTGTGACAGTGGCAATCACTTTGCCTTTCTTTCTACAGGGGTGAATT
CGaaacgtcaagccaaacacaaacagcggaaacgccttaagtccagctgtaagagacaccctttgtacgtggacttcag
tgacgtggggtggaa
40
tgactggattgtggctcccccggggtatcacgccttttactgccacggagaatgcccttttcctctggctgatcatctg
aactccactaatcatgccatt
gttcagacgttggtcaactctgttaactctaagattcctaaggcatgctgtgtcccgacagaactcagtgctatctcga
tgctgtaccttgacgagaatg
aaaaggttgtattaaagaactatcaggacatggttgtggagggttgtgggtgtcgctagGATCCggg
tg~r-xxlcit-tiBMP.seq (SEQ. ID. No. 16)
45 _
~~~aagctttit:G-rc:AC:c:C;CTAGAGTCGAGCTGTGACGGTCCTTACAATGAAATGCAGCTGG
GTTATCTTCTTCCTGATGGCAGTGGTTACAGGTAAGGGGCTCCCAAGTCCCAAACTTGA
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-33-
GGGTCCATAAACTCTGTGACAGTGGCAATCACTTTGCCTTTCTTTCTACAGGGGTGAATT
CGcgccggcgccgacaagccaaacacaaacagcggaaacgccttaagtccagctgtaagagacaccctttgtacgtgga
cttcagtgacgtgg
ggtggaatgactggattgtggctcccccggggtatcacgccttttactgccacggagaatgcccttttcctctggctga
tcatctgaactccactaatc
atgccattgttcagacgttggtcaactctgttaactctaagattcctaaggcatgctgtgtcccgacagaactcagtgc
tatctcgatgctgtaccttgac
gagaatgaaaaggttgtattaaagaactatcaggacatggttgtggagggttgtgggtgtcgctagGATCCggg
EXAMPLE 9
Expression of other BMPs
10 The expression of BMP-2 outlined in Example 8 can also be used to express
other
BMPs in accordance with this invention, for example by changing the BMP
sequence to a sequence
that expresses another BMP (such as BMP-2,3,4,5,6,7,8 or 9), or expresses a
protein having the
activity of a BMP (a morphogen that stimulates the differentiation of an OPC
into an osteoblast).
Many other transfection protocols are known to those skilled in the art to
introduce such sequences
into immortalized or conditionally immortalized cells of the osteoblast
lineage.
EXAMPLE 10
Expression of Functionally Equivalent BMPs
It will be apparent to one skilled in the art that the bone morphogenetic
activity of
the BMPs lies not in their precise amino acid sequence, but rather in the
epitopes inherent in the
amino acid sequences encoded by the DNA sequences. It will therefore also be
apparent that it is
possible to recreate the bone morphogenetic activity of one of these peptides,
without necessarily
recreating the exact amino acid sequence. This could be achieved by designing
a nucleic acid
sequence that encodes for the epitope, but which differs, by reason of the
redundancy of the genetic
code, from the sequences disclosed herein, while still producing a functional
bone morphogenetic
protein.
Accordingly, the degeneracy of the genetic code further widens the scope of
the
present invention as it enables major variations in the nucleotide sequence of
a DNA molecule
while maintaining the amino acid sequence of the encoded protein. The genetic
code and variations
30 in nucleotide codons for particular amino acids is presented in Tables 6
and 7. Based upon the
degeneracy of the genetic code, variant DNA molecules may be derived from the
DNA sequences
disclosed herein using standard DNA mutagenesis techniques, or by synthesis of
DNA sequences.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-34-
TABLE 6
The Genetic Code
First
Third
Position Position
(5' end) Second Position (3' end)
T C A G
Phe Ser Tyr Cys T
Phe Ser Tyr Cys C
T Leu Ser Stop (ooh) Stop A
Ser Stop (amb) Trp G
Leu Pro His Arg T
I-eu Pro His Arg C
C Leu Pro Gln Arg A
Leu Pro Gln Arg G
Ile Thr Asn Ser T
Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met Thr Lys Arg G
Val Ala Asp Gly T
Val Ala Asp Gly C
G Val Ala Glu Gly A
Val (Met) Ala Glu Gly G
"Stop (ooh)" stands for amber.
the ocre termination ATG
triplet, and "Stop (amb)" is
for the the
most
common initiator colon; for
GTG usually codes for methionine
valine, but it can also to
code initiate
an mRNA chain.
TABLE 7
The Degeneracy of the
Genetic Code
Number of Total
Synonymous
Number
of
Colons Amino Acid Colons
Leu, Ser, Arg 18
4 Gly, Pro, Ala, Val, 20
Thr
3 Ile 3
2 Phe, Tyr, Cys, His, lg
Gln,
Glu, Asn, Asp, Lys
1 Met, Trp 2
Total number of colons 61
for amino acids
Number of colons for
termination
3
Total number of colons 64
in genetic code
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-35-
Additionally, standard mutagenesis techniques may be used to produce peptides
which vary in amino acid sequence from the peptides encoded by the DNA
molecules disclosed
herein. However, such peptides will retain the essential characteristic of the
peptides encoded by
the DNA molecules disclosed herein, i.e. the ability to induce mesenchymal
precursor cells to
differentiate into an osteoblastic lineage, and begin the deposition of bone.
This characteristic can
readily be determined by the assay technique described herein for the
detection of characteristic
proteins produced by OPCs that have differentiated in this fashion, using the
methods of Example
2. Variant peptides include those with variations in amino acid sequence,
including minor
deletions, additions and substitutions.
10 While the site for introducing an amino acid sequence variation is
predetermined,
the mutation per se need not be predetermined. For example, in order to
optimize the performance
of a mutation at a given site, random mutagenesis may be conducted at the
target codon or region
and the expressed protein variants screened for the optimal combination of
desired activity.
Techniques for making substitution mutations at predetermined sites in DNA
having a known
15 sequence as described above are well known.
In order to maintain a functional peptide, preferred peptide variants will
differ by
only a small number of amino acids from the peptides encoded by the native DNA
sequences.
Preferably, such variants will be amino acid substitutions of single residues.
Substitutional variants
are those in which at least one residue in the amino acid sequence has been
removed and a different
20 residue inserted in its place. Such substitutions generally are made in
accordance with the
following Table 8 when it is desired to finely modulate the characteristics of
the protein. As noted,
all such peptide variants are tested to confirm that they retain the ability
to induce OPCs to
differentiate into an osteoblastic lineage, and initiate bone formation.
The present invention includes OPCs that express any DNA that encodes for a
25 BMP to which the OPC responds by differentiating into a cell demonstrating
an osteogenic
phenotype.
TABLE 8
30 Original Residue Conservative Substitutions
Ala ser
Arg lys
Asn gln, his
35 Asp glu
Cys ser
Gln asn
Glu ~p
Gly pro
40 His asn; gln
Ile leu, val
~u ile; val
Lys ar'g; g~; glu
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-36-
Met leu; ile
Phe met; leu; tyr
Ser ~r
T~ ser
Trp tyr
Tyr trp; phe
ile; leu
Changes in biological activity may be made by selecting substitutions that are
less
conservative than those in Table 8, i.e., selecting residues that differ more
significantly in their
effect on maintaining (a) the structure of the polypeptide backbone in the
area of the substitution,
for example, as a sheet or helical conformation, (b) the charge or
hydrophobicity of the molecule at
the target site, or (c) the bulk of the side chain. In particular embodiments,
at least 90 or 95 % of
the amino acids in a BMP are identical to the native BMP.
EXAMPLE 11
Dog Derived Osteoblast Precursor Cell (dOPC) that Secretes rhBMP-2
This example describes a conditionally immortalized dog-derived OPC line that
can be engineered to secrete rhBMP-2, and can be delivered by the implant to
an osseous defect
(such as a standardized mandibular defect) in the dog or other animal. It is
preferred that the
implanted cell be derived from the species into which the implantation occurs,
to avoid antibody
and complement mediated lysis of the cells. However, a universal donor cell
could also be used,
regardless of the species. The dOPC line disclosed in this example is derived
from a neonatal dog
periosteum cell lineage; the derived dOPCs express specific osteoblast-like
markers; and dOPCs
can be engineered to secrete rhBMP-2 to promote the osteogenic differentiation
of the cell, and
subsequent accelerated bone formation.
OPCs derived from dog periosteum are isolated by a digestion technique
involving
a stepwise treatment of approximately 30 minutes each with 0.2 % collagenase,
followed by 0.25
trypsin. Instead of using four digestions, the cellular preparations from the
first and second
digestions are plated out. Cells at the time of isolation (PO) are plated at
0.25 x 106 in 75 cm2
tissue culture flasks in alpha MEM with 5% FBS (GIBCO BRL, Inc). The remaining
tissue pieces
are collected, washed with calcium magnesium free HBSS and digested with 0.25
% trypsin-EDTA
for 30 minutes. Once the flasks expand to confluence each cell type is
subcultured after enzymatic
removal with 0.25% trypsin-EDTA to passage 1 (P1). BMP genes can be introudced
into the
dOPC using the techniques described in Example 5.
Additional characterization and transfection protocols can be performed as in
Examples 2-4. The dOPC can be used as an alternative to a human OPC/rhBMP-2
line, such as
OPC-1. If the dOPC is used in a human, a short course of immunosuppressive
treatment will help
assure viability of the recombinant cells in the animal.
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
-37-
Using similar techniques, OPCs derived from monkeys, rats, and a variety of
other species can be obtained.
METHODS OF USE
The following Examples 12 to 16 describe how the genetically engineered OPCs
of the present invention are used in rats, dogs, and rhesus monkeys, and how
they are to be used in
humans. In these examples, OPCs that express BMP are placed in critical-sized
defects (CSDs) in
various bones, such as the mandible and maxilla. Later examples will
illustrate the use of a matrix
containing OPCs that have not been transformed to express rBMP. However, any
of the techniques
described in these examples could also be used to introduce the OPCs that have
not been
transformed.
CSDs are bony defects of a sufficient size that they do not spontaneously heal
with
new bone formation unless they are treated with a bone promotion formulation,
such as the OPCs
of the present invention that are engineered to express BMP. The BMP
expressing OPCs of the
present example (of the matrix localized OPCs of other examples) can be used
in a wide variety of
anatomical sites, including the flat bones of the skull to neat craniotomy
defects, sinus obliteration
(for example in the maxillary and frontal sinuses); as therapies for LeFort
osteotomy gaps (in the
midface); in the mandible, maxilla, and long bones; as a treatment for spine
fusions; to improve
bone density in osteopenic bones (as in prophylactic treatment of spinal
pathological fractures in
osteoporosis); and to fill cystic defects.
BMP expressing cells of the osteoblastic lineage (or their precursors such as
OPCs) which are responsive to the BMP, are implanted into a bony defect. The
cells express a
therapeutic amount of the BMP that is sufficient to improve the healing of the
defect. The cells can
be administered in a variety of delivery systems, including gels suspensions,
polymer implants
25 (such as the poly(D,L-lactide) disclosed in Examples 20 and 21), gel
components (such as collagen
hydrogel cores) of polymer implants as disclosed in Example 20), or a
Helistat~ collagen sponge, to
name but a few examples. The cells can be delivered either by direct surgical
implantation into the
bone defect, or delivered endoscopically, as described in Example 20. Once
implanted, the cells
are preferably sufficiently immobilized to be maintained at the site of
implantation for about 24-72
30 hours to initiate the healing process. Immobilization is achieved by a
carrier that both localizes and
protects the cells. The carrier can also act as a substratum for the
attachment of cells, and act as an
orientation platform for signaling molecules.
The BMP expressing osteo-committed cells of the invention should produce
supraphysiologic amounts of the BMP, sufficient to stimulate osteoblastic
differentiation and bone
35 formation in the cells. The local concentration of BMP produced could be,
for example, 1-100 mg,
more specifically 1-5 mg, or less than about 1 mg, for example less than 500
fig, 35 ~cg, 1 ug, for
example 100 ng or less. A dose of about 0.5 mg rhBMP-2 per ml volume of bony
defect is
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-38-
believed to be appropriate for a young or middle aged healthy adult. A target
value for the dose in
a typical wound would be, for example, about S-10 x 105 cells/cmz, or about 1
million cells per ml
of bone defect volume. The dose could be increased in patients of increased
age, poor health, or in
a site that is normally slow to heal. Under these conditions, bone repair
would be expected to
proceed at a rate of at least about l~.m/day.
EXAMPLE 12
Treatment of Mandibular Defects in Dogs
Dogs are administered antibacterial prophylaxis, intravenous fluids, and
anesthesia. After surgical preparation of the surgical site, the tissue
overlying the inferior aspect of
the left side of the mandible is infiltrated with 3.6 ml of 2% lidocaine
hydrochloride with 1:100,000
epinephrine. A 7 cm incision is made along the inferior border of the body of
the mandible (a
modified Risdon incision), beginning 2 cm from the canine tooth. A full-
thickness flap is raised,
the mid body of the mandible is visualized, periosteum is dissected from the
defect site, and using a
high-speed rotary Hall drill with a 703 dental burr and copious sterile water
irrigation, a full-
thickness bony "saddle defect" with dimensions 2.5 cm in length and 1.0 cm in
height of known
dimensions is created along the inferior aspect of the mandible. The defect
begins 3 cm from the
canine tooth and the distal margin is 5.5 cm. After achieving hemostasis, the
BMP producing cells
are implanted, for example in the implant described in Examples 20 or 21, the
soft tissue
reapproximated with 3-0 Vicryl, and the incision closed with 2-0 nylon
sutures.
EXAMPLE 13
Treatment of Mandibular Defects in Rhesus Monkeys
Rhesus monkeys (weight 6-9 kg) are administered antibacterial prophylaxis,
intravenous fluids, and anesthesia as in Example 12 above. A 6 cm incision is
made interiorly and
medially to the inferior border of the body of the mandible (i.e., a modified
Risdon incision)
beginning 1 cm from the canine tooth. A full-thickness flap is raised, the mid-
body of the mandible
visualized, and periosteum dissected from the defect site. Using a high-speed
rotary Hall drill with
a 703 dental burr as in Example 12, a full-thickness bony saddle defect 1.5 cm
long and 1.0 cm
high is created along the inferior aspect of the mandible, extending 2-5 cm
from the canine tooth.
After hemostasis has been achieved, one or more implants are placed in the
bony defect as in
Example 12, and soft tissue and skin reapproximated.
EXAMPLE 14
Treatment of Maxillary Alveolar Clefts in Dogs
The palatal and mucobuccal fold mucosa circumscribing and contiguous to the
right maxillary canine to the left maxillary canine is anesthetized, and full-
thickness palatal and
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-39-
mucobuccal fold flaps are raised to visualize maxillary incisors, the palatine
process of the maxilla,
and alveolar crestal bone. Two of the three maxillary incisors on each side of
the midline are
extracted with dental forceps, and a high-speed rotary Hall drill with a 703
dental burr and copious
sterile water irrigation is used to prepare a I.5 cm-wide bony defect
extending cephalically from
the foramina of the incisive canals to the floor of the nose. A cruciate
incision is made and the
nasal mucosa is sutured to the oral mucosa with 3-0 Dexon suture to facilitate
development of a
fistula. A number 6 endotracheal tube (ET-tube) is filled with quick setting,
self-curing
polymethylmethacrylate to provide a scent that prevents collapse and promotes
fistula development.
After three months stems are removed and patency of the fistulas are verified
by
gentle probing. Several weeks later, the bilateral maxillary cleft defects are
incised, granulation
tissue removed, and bony walls of the palatine process of the maxillary
complex decorticated gently
with a high-speed rotary Hall drill with a 703 dental bur and copious sterile
water irrigation. Nasal
mucosa is sutured with 3-0 Dexon suture to establish a "roof', the implant is
inserted, and
peridental and palatal mucosa closed with 3-0 Dexon suture.
EXAMPLE 15
Treatment of Maxillary Alveolar Clefts in Rhesus Monkeys
Gingival tissues are gently reflected from the maxillary lateral incisors and
canines, and the teeth are extracted with dental forceps. Following
extraction, an alveoloplasty is
performed using a burr and rotary instruments with copious irrigation (0.9%
physiologic saline).
Bone is removed unilaterally to the level of the nasal mucosa, and a I cm wide
oronasal fistula is
formed. A number 5 endotracheal tube is inserted through the fistula from the
oral opening, into
the external hares and through the nasal mucosal defect, then back into the
oral opening, to produce
a naso-alveolar cleft defect. The tube is filled with poly(methyl
methacrylate).
After 8 weeks, the subject is returned to the operating room, the endotracheal
tube
gently removed, the cleft examined, and the site irrigated with 0.9%
physiologic saline. After an
additional 4 weeks, the cleft defect is again examined for patency. The
implant is then placed into
the defect as described in Example 12.
EXAMPLE 16
Treatment of Ostectomy Gaps in Rabbits and Monkeys
The New Zealand white rabbits are anesthetized and the operative site on
either
the left or right front limb was shaved. A supero-medial incision,
approximately 4 cm in length is
made and the tissues overlying the diaphysis of the radius dissected away. A
20 millimeter
segmental defect is made in the radius with a surgical oscillating saw
supplemented by copious
0.9% sterile saline irrigation and the appropriately PDS treatment is placed
in the CSD.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 40 -
Skeletally mature adult male Macaca mulatta (rhesus) monkeys are anesthetized
and an incision is made over the radius to expose a full-thickness flap
(including periosteum)~using
gentle, blunt dissection. Radius ostectomies are randomly assigned to either
left or right radii, one
per animal. The ostectomy is 35 mm long (approximately 4 times the diameter of
the radius).
5 Defects are surgically prepared using a nitrogen-driven reciprocating saw
with copious irrigation
(0.9% sterile physiologic saline). Following removal of the diaphyseal
segment, residual bony
debris is removed, and the site is stabilized using internal fixation with
fracture fixation plates and
screws (Leibinger Corporation, Dallas, TX). The appropriate experimental
treatment (such as the
implant) is placed into each defect, and the wound is closed.
10 Critical-sized defects (CSDs) are prepared in 60 rabbit skulls, divided
evenly
among five treatments and two time periods. The rabbits are placed in a supine
position, and a full
thickness incision down to periosteum is made from the nasal bone to the
posterior occipital
protuberance in a semilunar design, soft tissues sharp-dissected to visualize
the parietal bones, and
a 15-mm diameter trephine in a slow speed rotary surgical drill used to
prepare a mid-line
IS craniotomy with copious irrigation. Following hemostasis, the implant is
inserted into the
craniotomy incision.
EXAMPLE 17
Delivery System
20 When rhBMPs have been used in the past to treat osseous defects, very high
(milligram) doses have been required to achieve a therapeutic effect. The
present invention takes
advantage of a uniquely designed polymer delivery system (PDS) implant that
sustains OPCs and
localizes rhBMP to enrich local concentrations to promote bone formation. The
rhBMP-2 and
OPCs, coupled (independently or jointly) to the PDS, constitute a powerful
therapeutic package for
25 a broad spectrum of patients.
Two examples of PDS designs are illustrated herein: a cortex-core device (CCD)
and an integrated polymer laminate (IPL). The CCD includes a cortex of
poly(lactide-co-glycolide)
(PLG) containing a known dose of rhBMP-2, which surrounds a gel-like matrix
core (for example a
hydrogel) with a known quantity of the OPCs of the present invention. The IPL
includes
30 alternating PLG and hydrogel laminates with a known rhBMP-2 dose and
quantity of OPCs. The
PDS strategy fulfills key functions of amplifying a BMP-responsive cell pool
and augmenting
locally expressed BMP molecules, and is especially relevant for elderly
patients who have delayed
bone healing, precursor cell decrement, and diminished cell responsiveness.
This treatment is
therefore especially helpful for the elderly, because the localization of
rhBMP-2 and OPCs to
35 enrich local BMP bolsters the BMP-responsive OPC population to enhance the
bone regenerative
capacity. The PDS also performs a critical function of providing a porous
scaffold that supports
cell attachment, promotes cell differentiation, orients bone regeneration, and
prevents soft tissue
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-41 -
prolapse. The PDS is a substratum that provides a haven for attachment of host
pluripotential cells,
supports their conversion to osteoblasts, and shuttles the rhBMP and OPCs to
the bone defect.
Unlike previous attempts to deliver rhBMP-2 to restore bone and skull defects
in
rats, sheep and dogs, supra-physiological doses of rhBMP are not needed with
the PDS which
localizes OPCs and rhBMP, and strategically positions these agents, which
decreases dosing
requirements. The two specific embodiments of the PDS disclosed in FIGS. 1 and
2 provide a two-
component matrix in which the porous PLG scaffold surrounds an inner hydrogei
member
containing OPCs. The hydrogel carrier supports and localizes the OPCs, while
the surrounding
PLG (or other polymer) matrix supplies a biodegradable scaffolding that
promotes osteoconduction
without impairing ultimate bone formation.
Cortex-Core Embodiment
In the embodiment of FIG. I, a cortex 10 is formed from a mixture of PLG and a
BMP, and molded around a hollow core 11. Teflon molds of suitable dimensions
are used to cure
the polymers in the desired shape, for example at 1 atmosphere of pressure in
a vacuum chamber at
15 millitorr at 40°C for 72 hours per each 32 cubic millimeters of
cortex volume. The cortex is
then loaded with rhBMP-2, for example in a dose of about 100 ~cg to 500 ~cg
BMP per 1 cubic
millimeter of bone volume to be regenerated. The OPCs (or osteoblasts) of the
present invention
(which express rhBMP) are mixed with a hydrogel in tissue culture 12, and that
mixture is then
placed in the core 11 of cortex 10 to form an implant 14. Although the
quantity of OPCs placed in
the hydrogel can vary widely, in this specific example about 100,000 OPCs are
provided for each
cubic centimeter of bone defect.
The PLG implant, carrying the core of cells, is then placed into an osseous
defect, such as the mandibular defect 15 shown in FIG. 1. The cortex will be
formed or cut to
substantially fill and conform to the edges of the osseous defect. In ablative
wounds of long bones,
bone fragments may be fixed with fixation plates and screws, and the proximal
and distal fragments
of bone, once plated, can press fit the implant. Surgical soft tissue closure
also secures the implant
in place with overlying layers of fascia, tendon, subcuticular tissues and
skin. In calvarial wounds
(such as trephination defects in flat bone), the implant can be shaped to
conform to, and be held in
place by, the margins of the wound, and the underlying dura mater and
overlying pericranial
tissues.
Once the implant is in place, the BMP in the cortex 10 stimulates activity of
the
OPCs in the core 11, which also produce BMP. The BMP rich environment of the
OPCs
encourages formation of bone in the surrounding porous PLG matrix, and
recruitment of more
OPCs from the host. As bone forms, the PLG matrix degrades, which allows bone
formation to be
completed without interference from the matrix.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 42 -
Multi-Laminate Implant
FIG. 2 shows an alternative embodiment of the matrix, in which a BMP
impregnated sheet 16 of PLG is formed. On top of sheet 16 is then layered a
separate layer of
hydrogel 17 (such as a collagen gel, agaraose or alginate) in which have been
cultured OPCs.
Multiple alternating layers of BMP/PLG and OPC/hydrogel form a multi-laminate
implant 18. The
implant 18 is then placed into a bony defect (such as the mandibular defect 19
shown in FIG. 2), or
interposed between the apposed edges of a break in a bone.
The laminate may also be wound into a spiral module 18a in situations where a
greater interface surface, a circular cross-section, or more mass transfer
capability is desired
between the PLG component and the hydrogel layers. The spiral module promotes
maximal
exchange of signaling components and cell proliferation by communication
between the contiguous
layers of the spiral. The circular cross-section can also facilitate movement
of the implant through
a tubular endoscope.
The laminate embodiment of the implant is particularly useful for
interpositional
bone deficits. The spiral module laminate is also more flexible than the one
piece cortex
embodiment, hence the laminate can be inserted into deep bony defects having
irregular walls, such
as clefts in the premaxilla and palate. The spiral module is also useful for
placement into
irregularly shaped bone defects such as the sinuses of the craniofacial
complex, for example sinus
defects of the maxilla and frontal sinuses.
20 The PLG in the implant undergoes non-specific hydrolysis in body fluids.
Synthesis and post-synthesis modification of the PDS can also be undertaken to
calibrate
biodegradation rates of the matrix, so that the matrix degrades at a rate that
optimizes the ingrowth
of bone into the matrix as it degrades.
The matrix of the polymer (such as the PLG) is sufficiently porous to improve
the
25 ingrowth of vascular tissue from host margins, followed by new bone
formation (osteoconduction).
To help establish optimum pore sizes, disks of poly(D,L-lactide) (DLPL) (3.5
mm-thick) with pore
sizes 100 ~cm, 200 ~cm, and 350 ~cm were implanted in rabbits' calvariae. More
bone formation
was found through disks with 350 ~m-sized pores than in the other pores, hence
350 ~cm pore disks
may be used in association with the PDS of the present invention. Bulk erosion
of the disks
30 appears to be gradual, and bone ingrowth supports controlled mass loss of
DLPL.
The matrix of the present invention can have a variety of chemical
compositions,
for example a 50:50 poly(D,L-lactide-co-glycolide) (PLG) film or a poly(D,L-
lactide) (DLPL) film
(e.g., from THM Biomedical, Inc., Duluth, MN). The porous poly(alpha-hydroxy
acids) can have
a variety of molecular weights, pore sizes, and inherent viscosities, to help
fulfill alternative design
35 goals. Representative molecular weights are 10-700 kD, a porosity
characterized by a void volume
of 70-95 % , a pore size range of 15-400 ~cm, and a pore size distribution in
which 75 % of the pores
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 43 -
are in the 250-400 ~cm range and less than about 25 % of the pores are within
the 15-250 ~m range.
The inherent viscosity of the porous polymer is, for example, less than about
1.
EXAMPLE 18
Matrix Fabrication
Physicochemical properties of the implant designs promote OPC attachment,
support OPC differentiation to osteoblasts, and optimize rhBMP-2 release to
promote and support
bone formation. To fabricate one such implant, a highly characterized,
biodegradable poly(alpha-
hydrozy acid) (such as 50:50 PLG) is obtained from a commercial source (e.g,
Birmingham
Polymers Incorporated, Birmingham, AL) and purified by repeated precipitation
in methanol from
chloroform solutions. Molecular weights are verified by viscometry at
25°C. Viscosity average
molecular weights str calculated from the Marc-Houwink equation: ~. = 5.45 x
10~M0.73.
Porous polymer is fabricated by a multiple solvent/thermodynamic procedure in
which the poly(alpha-hydroxy acid) (e.g., PLG) is dissolved into methylene
chloride/cyclohezane
or diozane/water mixed solvents, and the solutions are frozen at 0 to -
4°C, and sublimed under
vacuum. The use of these two miscible solvents controls the polymer solution
thermodynamics,
chain extension and aggregation, and predictably yields a solid-state polymer
with suitable pore
morphology. Suitably sized Teflon molds are used to cure the polymers and form
the sheet or
cortex configurations. Pore morphologies can be mapped as a function of
solvent compositions and
temperature of sublimation. Each of these variables allows modifications in
pore engineering, to
yield a product with a pore volume of 90% and a size optimized for
osteoconduction and
osteoinduction.
As a specific example, known quantities of poly(alpha-hydrozy acid)or poly(L-
lactide)(PLLA) or poly(D,L-lactide)(PDLLA) can be dissolved in a measured
amount of molten
naphthalene (at approximately 90°C) and the solution cast into a heated
mold and quenched in
liquid nitrogen, producing a solid block. The block can be heated at
50°C and 10 millitorr for 12
hours to remove residual naphthalene. Porosity of the product can be
controlled by varying the
concentration of the polymer in solution, and products with reproducible
porosity can be prepared.
A porous matrix can also be made by the techniques described in Mikos et al.,
Biomateriats 14:323 (1993) and Polymer 35:1068 (1994). Briefly, the PLLA (or
PDLLA) in
highly purified form is placed in methylene chloride and vortexed with known
concentrations of
sodium chloride salt crystals. The concentrations may be, for example, 50, 80
and 90 wt% of the
salt:PLLA, and crystal sizes of 300 and 500 Vim. The salt suspensions can be
cast or spin-coated
on to clean glass substrates, and the methylene chloride allowed to evaporate
ambiently from
covered films. Films can be vacuum-dried to completely remove residual
solvent. The films are
heated above the PLLA melt temperature (Tmz 180°C) to ensure complete
melting of the PLLA-
salt crystallites formed on the membrane casing and erase membrane thermal
history. The
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
-
membranes can then be either quenched in liquid nitrogen, or annealed to room
temperature to
produce amorphous, semi-crystalline membranes with specific crystalline
content.
The PLLA-salt membranes may be immersed in pure deionized water at
25°C for
48 hours to remove the salt, leaving salt-free porous membranes (mesh). The
mesh can be air-
s dried for 24 hours, vacuum dried for 48 hours, and stored in a dessicator
under vacuum or dry
nitrogen until needed. Membranes made by this method have reproducible
properties, with
controlled membrane porosity between 300-500 um for each size of salt crystal,
and controlled
PLLA crystallinity and degradation characteristics. The porous mesh can be
loaded with rhBMP to
make the porous matrix of the present invention.
An alternative method for making the porous mesh involves reverse-phase
coagulation where a PLLA-salt suspensions is prepared in acetone. This system
gels spontaneously
at room temperature, however by slowly adding ethanol to the acetone
suspension, a porous PLLA
mesh membrane can be produced. Acetone and ethanol can be removed under
vacuum, yielding a
dry, porous PLLA-salt membrane mesh. Distilled water removes the salt, leaving
a porous, pliant
mesh.
Alternatively, several copolymers of poly(a-hydroxy acid) can be used to
prepare
the porous matrix. For example, a molar ratio of 1:1 D,L lactide co-glycolide
(PLG, described in
U.S. Patent No. 4,578,384) with a viscosity of 0.45 dL/g in 1,1,1,3,3,3
hexafluoroisopropanol
(HFIP) at 30°C, with a weight average molecular weight of 35 kD can be
used. Other copolymers
could include different molar rations, such as 3:1, 4:1, and 9:1 PLG. The
inherent viscosities may
range from 20 kD to 80 kD. In preparing the post-synthesis product, 15 grams
of the PLG may be
dissolved in 100 mL acetone, stirred for 10 minutes at 25°C, followed
by re-precipitation in 100
mL of 100% ethanol. A similar weight to volume ratio may be exploited using
methylene chloride
followed by re-precipitation with anhydrous methanol. Additional methods
useful to the PLG
matrix synthesis can be found in Coombes et al. , Biomaterials 14:297 ( 1992)
and Biomaterials
13:217 (1992).
The sample copolymer can be dissolved in dioxane/water or methylene
chloride/cyclohexane (96/4 to 95/5, v/v) at a concentration of 10 mg/mL. The
solution can be
transferred to crystallization dishes and frozen at -24°C and solid
disks produced are freeze-dried
for 4-5 days. A post-lyophilization vacuum is applied to remove residual
solvent, first at room
temperature and then at 37°C for two days.
The physical characteristics of the pre-synthesis polymer and post- synthesis
product can be derived by using differential scanning calorimetry (DSC). For
example, ten mg of
well-blended PLLA-naphthalene mixture can be lowered to 90°C and
maintained for 5 minutes, .
followed by slow cooling at 0.2°C/min to 70°C. A phase
transition can be noted at the
temperature where an exothermic event occurs within this lowering range. The
same procedure
can be repeated for different PLLA concentrations until the equilibrium versus
composition phase
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 45 -
diagram can be constructed. Cooling can be modulated with different
combinations of PLLA
compositions and time points to examine the physicochemical properties of PLLA
after naphthalene
sublimation.
Polymers can be characterized to ensure uniformity. Molecular weight can be
5 determined by gel permeation chromatography (GPC) and intrinsic viscosity.
GPC can be
performed with a Hewlett-Packard 1090M system equipped with column temperature
control, a
diode array, and a refractive index refractometer. The intrinsic viscosity
(iv) measurements can be
done in Ubbelohde viscometers in chloroform or dimethyl formamide. The
combination of iv
measurements and a universal calibration curve based on monodispersed
polystyrene can be used to
determine the "absolute" molecular weight of the PLLA.
Thermal properties can be evaluated by differential scanning calorimetry (DSC)
to
derive thermograms and glass transitions (tg) temperatures and crystallinity
of the PLLA foams. A.
Seiko DSC 220 can be used according to ASTM method D3418 to derive the phase
diagram for the
PLLA-naphthalene mixtures prepared as detailed above. The PLLA products can
also be coated
15 with gold in a Hummer C sputter-coater and an AMRay (Series 1810) scanning
electron microscope
(SEM) can be used to visualize the surface topography, or internal porosity
(if freeze fractured).
Porosity can be quantitated with a Leica 970 image analyzer, which measures
equivalent diameter
of pores, pore range, distribution and connectivity. Pore volume and surface
areas can be
determined by mercury intrusion porosimetry using a Mercury Porosimeter (Model
30K-A-1).
Compression measurements can be made following ASTM Method D5024, and
compression creep
tests by ASTM Method D2990.
EXAMPLE 19
Chemical Modification to Enhance Cell Attachment
The RGD sequence from fibrinogen, fibronectin, and vitronectin are
integrin-binding peptide motifs. Massia et al., Curr. Opin. Cell Biol. 6:656-
662 (1991); Massia et
al., J. Cell Biol. 114:1089-1093 (1991). Similarly, the peptide fragment p15
(GTPGPQGIAGQRGVV) mimics cell receptor binding activity of type I collagen,
and it is this
sequence from the type I collagen alpha(I) chain (peptides 766-780) that is
associated with cell
30 binding activity of osteoblasts and subsequent osteogenesis. Consequently,
the implants of the
present invention can include bioactive peptide motifs which are immobilized
on the polymer
substratum surface to enhance cell accessibility and adhesion. Cell adhesion
to the implant's porous
matrix can additionally be promoted by copolymerizing lactide monomers with
lysine to produce a
lysine/lactide random copolymer, as in Cook et al., J. Biomed. Maser. Res.
35:513-523 (1997).
35 However, this approach does not preferentially place the cell adhesion
molecules at the polymer
surface for optimal interaction with OPCs.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-46-
RGDs and p 15 cell adhesion peptides are produced by standard solid-phase
peptide
synthesis methods. A fluorinated (preferably perfluorinated) alkyl chain (such
as
perfluorododecanoic acid) is covalently attached to the peptide amino terminus
using standard
amide coupling chemistry while the peptide is bead-bound under solid-phase
synthesis conditions.
5 The perfluoroalkyl peptide conjugates are cleaved from the solid phase and
purified to yield cell
adhesion peptides tagged with a chemical marker useful for both polymer
surface localization and
surface analytical quantification. Schnurer, et al., Chem. Mater. 8:1475-1481
(1996); Sun, et al.,
J. Am. Chem. Soc. 118:1856-1866 (1996); Wang, et al., Supramolec. Sci. 4:488-
497 (1997).
Perfluoro-conjugated RGDs or p15 peptides are dissolved with the selected
10 polymer in methylene chloride solutions and mixed with cyclohexane to
produce a two-component
solvent-polymer solution for sublimation. Porous foams of these materials are
prepared by the
dual-solvent sublimation method described in Example 18, using designated
peptide loadings.
The internal morphology of the PDS devices can be approached using standard
approaches, such as x-ray diffraction, acoustic spectroscopy, and confocal
microscopy. Additional
15 analyses may be performed if needed, and these could include dye diffusion,
mercury porosimetry,
capillary flow porosimetry, and Brunauer-Immett Teller (BET) area measurement
to measure
continuity of microcellular polymer structure. Other post-synthesis device
properties are void size,
range, distribution, and interconnectivity.
Using differential scanning calorimetry (DSC), PLG crystallinity is
determined.
20 Glass and crystalline transitions and per cent crystallinity are determined
from thermal
transitionslenthalpic changes in these materials measured on a Perkin-Elmer
DSC-7 (heating rate =
10°C/ min). Samples (10-20 mg) are scanned from 20-200°C, cooled
and re-scanned to generate
endotherms.
Gel permeation chromatography (GPC) can be used to determine homopolymer
25 and copolymer molecular weight distributions using a Hewlett-Packard 1050
HPLC system with a
series of StyragelT"' size-exclusion GPC columns, refractive index detector,
and methylene chloride
as the mobile phase. Polystyrene standards are used as calibration references.
Polymer samples are analyzed by SEM after gold-sputtering using a JEOL SEM
images are assessed for pore morphology, sizes, distributions, and
interconnectivity. Pore size
30 distributions are determined using mercury intrusion porosimetry. Values of
pore void fractions
and pore area result from such measurements as a function of mercury pressure.
Standard
analytical methods are adapted to determine porosity, foam density,
surface/volume ratio. Helium
pycnometry can provide this information.
35 EXAMPLE 20
Alternative Matrix Designs
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-47-
Alternative materials for the PLG component (i.e., for both "cortex" and
"laminate
sheet" embodiments) are commercially available poly(alpha-hydroxy acid)
fabrics available from
Albany International Corporation, Acton, MA; and Johnson & Johnson, New
Brunswick, NJ.
Bioresorbable PLG fabrics are produced as velours and weaves that can be post-
synthesis-modified
5 to specific textures, thicknesses, fiber diameters, and porosities. Flexible
sheets can be cut to size
according to the desired shape of the matrix. The fabrics can be surface-
modified and coated with
cell adhesion peptides to enhance cellular interaction. Surface modification
can take the form of (1)
coating perfluoroalkylated RGDs or p15 directly onto the fabric surface using
organic solvent-based
solutions compatible with surface swelling of the PLG fabric, or (2)
dissolution of the peptide
10 conjugate, followed by drying to remove the solvent. The conjugates lack
appreciable water-
solubility and therefore remain hydrophobically tethered to the PLG fabric
surface.
When manufacturing some embodiments of the laminates, one goal may be to
provide a pliant sheet that is capable of being deformed into a cylindrical
shape. To produce such
shapes, molecular weight ranges of PLG can be from about 20 kD to 90 kD.
However, in some
15 cases, PLG less than about 20 kD may be optimal for biodegradation in
osseous wounds of the size
described in the Examples. However, these relatively low molecular weights may
result in brittle
laminate sheets. If the sheets become brittle, they can be reinforced with a
porous polyester
surgical weave. This strategy will slow biodegradation, but the thin outer
scaffolding of the
stugical weave provides structural integrity that offsets the slower
biodegradation.
20 The CCD has a PLG cortex containing rhBMP around a core of OPCs in
hydrogel. Instead of preforming the core, the cortex may be fabricated as a
porous block into
which the core is then bored. A known concentration of rhBMP in buffer can be
administered to
the porous CCD cortex.
25 EXAMPLE 21
The Hydrogel-OPC Core
The hydrogel carrier for OPCs may be bovine or human type I collagen. Collagen
gels or sponges are well-known culture materials and have been shown to
regulate cell
proliferation, shape and collagen synthesis. Mauch, et al., Exp. Cell. Res.
178:493-503 (1988);
30 Nakagawa, et al., J. Invest. Dermatol. 93:792-798 (1989); Watt, TIBS 11:482-
485 (1986). In
addition, glycosaminoglycans (GAGs) may be added to the collagen to induce
phenotypic
differentiation, as in Bouvier et al., Differentiation 45:128-137 (1990), and
can provide additional
properties to enhance osteoneogenesis. Harakas, Clin. Orthop. Rel. Res.
188:239-251 (1984).
Type I collagen (Vitrogen~, provided by Collagen Corp.) at 3 mg/ml, is
prepared
35 by mixing 8 parts collagen with 1 part lOx PBS, with the pH adjusted to 7.3-
7.4 by the addition of
0.1 N NaOH. To achieve a three-dimensional OPC culture within a collagen
carrier, OPCs {106
cells/ml of gel) are mixed gently into type I collagen solution, set after 45-
60 minutes, and are
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-48-
immersed in alpha MEM containing 5 % FBS. Cell culture media is changed 3
times/week to
maintain cultures up to 30 days. OPC seeding on top of the type I collagen
gels is similar except
that the OPCs are plated directly into media on top of the molded collagen
gels instead of mixed
within the gel.
A known, designated quantity of chondroitin-4 sulfate may be added to selected
sets of collagen solutions prior to gel formation and OPC seeding.
Glycosaminoglycans {GAGS)
such as chondroitin-4 sulfate can be added to enhance progression of OPCs to
an osteobiast
phenotype.
Many alternative hydrogel materials are candidate carriers for OPCs, such as
fibrillar collagen, and polymers such as polyethylene glycol (PEG). However,
Type I collagen is
preferred because of the ease of adding other components (such as GAGs).
EXAMPLE 22
Preparation of PDS with rhBMP and OPCs
The rhBMP-2 is prepared and incorporated with the polymer under aseptic
conditions. Sterilization of materials may be carried out, for example, with
ethylene oxide or
cobalt-60 gamma irradiation sterilization. Before loading the implants with
rhBMP, the implants
are sterilized with a bactericidal/viricidal dose of cobalt-60 gamma
irradiation. The radiation dose
preferably does not exceed 3 Mrad to avoid adverse effects on the properties
of the polymer. The
product is then stored in a sterile package until needed. The hydrogel
compositions are tissue
culture quality, and are maintained aseptically. The OPCs are introduced into
the hydrogel, and the
implant is assembled in the operating room to prevent contamination.
EXAMPLE 23
Pharmacokinetic Determinations
Combinations of selected doses of rhBMP-2 with hOPCs and PLG-hydrogel can
be screened to determine an optimum dose of rhBMP needed to promote bone
formation in a
desired time period. Different doses of rhBMP-2 will cause a dose-dependent
expression of
osteoblast-like cell markers, which enable pharmacokinetic determinations to
be made.
Using a Chinese Hamster ovarian (CHO) cell expression system previously
described, rhBMP-2 is produced as a glycosylated 32-kDa homodimer. The amino
acid sequence
and carbohydrate sites have been determined, as reported in Rosen et al.,
Trends in Genetics 8:97-
102 (1992) and Wozney, Progress in Growth Factors 1:267-280 (1989). The rhBMP-
2 is prepared
in a sterile manner, placed in sterile glass vials, closed with rubber
stoppers, and freeze-dried.
The rhBMP-2 may be added to the porous polymer either iu
carboxymethylcellulose (CMC), in a sucrose/arginine (SA) buffer, or in a type
I thermal setting
collagen (COL). CMC is a water-soluble macromolecule that is prepared as a
viscous solution with
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-49-
known amounts of rhBMP-2, and the solution is then used to impregnate the
porous polymer
matrix. Sucrose/arginine (SA) buffer solution may also be prepared and used in
this manner,
particularly because this buffer stabilizes rhBMP.
Under aseptic conditions in a laminar flow hood, lrnown concentrations of
rhBMP-
2/CMC, rhBMP-2/SA, or rhBMP-2/COL are applied to the polymer "cortex" or
laminate "sheets,"
and pressure is applied to the polymer to ensure homogeneous and complete
loading by pore
impregnation and polymer adsorption. The impregnated rhBMP-2/PDS component is
dried and
stored in sterile vials until needed.
Pharmacokinetics of rhBMP-2 release from the PDS is measured with 125I-
labeled rhBMP-2 (available from the Genetics Institute, Cambridge, MA., or
made using
commercially available iodogen reagents) or with an ELISA technique. Following
the method of
Thies et al., Endocrinol. 130:1318-1324 (1992), known concentrations of 125I-
rhBMP-2 are added
to the porous polymer. Loading of 125I-rhBMP-2 for mid-point pharmacologic
activity should be,
for example, 100 ~cg 125I-rhBMP-2/100 mm2 of each laminate sheet. Three
bracketing doses on
each side of the estimated pharmacologic dose include: 0, 10, 50, 200, 400,
and 800 ~cg rhBMP-2.
Each format of the loaded polymer sheet is placed in appropriate vials
containing a 10-fold excess
volume of PBS + 1 % BSA, and slowly agitated in a circular motion at
37°C. PBS solution is
removed for gamma counting and replaced with fresh buffer at the following
times: 1,2,4,8,12 hrs;
1,2,4,5,7,14 days. All samples are counted to determine percent cumulative
release of 125I-
rhBMP-2. Remaining polymer is solubilized to determine mass balance.
Linear regressions and orthogonal contrasts (i.e., Fishers PLSD) are performed
to
determine the dose of rhBMP-2 producing the optimum in vitro pharmacokinetic
profile.
An in vivo method can also be used to determine rhBMP-2 dose. PL disks (8 mm
in diameter) are loaded with either 0, 10, 50, or 100 ~g of rhBMP-2, or rat
demineralized bone
matrix (DBM) and implanted in the pectoralis major muscles of 54, 35 day-old,
Long-Evans rats.
At 4 weeks post-implantation, recipient sites are recovered and assayed by
previously reported
radiomorphometric and histomorphometric methods (Marden et al., Calcif.
Tissue. Int. 53:262-268
( 1993)).
EXAMPLE 24
In Vitro Screening of Implants
CCD and IPL devices may be optimized in a tissue culture setting prior to in
vivo
studies, and multiple configurations can be evaluated for cell proliferation,
osteoblast phenotype
and ability to mineralize on days 4, 15 and 30. An example of variables that
can be tested is shown
in TABLE 9.
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
- 50 _
TABLE 9
In Vitro Assays
Device
ConfigurationCollagen GAG PEG hBMP-2
CCDI / IPLI 3 mg/ml 1 mg/ml (-) 0.5 mg
CCD2 / IPL2 3 mg/ml 1 mg/ml (-) 1.0 mg
CCD3 / IPL3 2 mg/ml 2 mg/ml (-) 0.5 mg
CCD4 / IPL4 2 mg/ml 2 mg/ml (-) 1.0 mg
CCDS / IPLS 3 mg/ml 1 mg/ml (+) 0.5 mg
CCD6 / IPL6 3 mg/ml 1 mg/ml (+) 1.0 mg
The OPC-loaded implant may be evaluated for cell proliferation by the use of a
non-destructive colorimetric assay, such as WST-1 (Boehringer Mannheim, Inc.),
which determines
the number of viable cells that cleave tetrazolium salts added to the tissue
culture medium. The
5 amount of formazan dye formed directly correlates to the number of
metabolically active cells in
the culture system. In addition, one can screen for osteoblast markers such as
mineralization,
APase expression, and PCR phenotyping for osteocalcin, osteonectin, PTH
receptor, and collagen
type I (procollagen).
EXAMPLE 25
Use of the Implant in Athymic Rats
The implant of this example includes known doses of rhBMP-2 impregnated into
the implant (such as the porous polymer or the gel component), along with the
cargo of hOPCs
engineered to express BMP-2. This example demonstrates that the implant can
deliver hOPCs and
rhBMP-2 to a heterotopic wound in the athymic rat, and promote heterotopic
ossification
15 (osteoinduction) in a quantity that is dependent on the exogenous BMP dose
provided by the
implant.
In the operating suite, known doses of aseptically prepared rhBMP-2 are added
to
pre-measured laminates for the laminate or cortex device. The implant is
placed subcutaneously
and bilaterally in tissue overlying each pectoralis major muscle. After 14 and
28 days, rats are
20 euthanized, implants recovered, and placed into 70% ethanol for 24 hours.
Implants are processed
for quantitative radiography and histomorphometry as previously described and
the quantity of bone
induced by different treatments is determined.
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-51-
In vivo bone induction is correlated with pharmacokinetic profiles of
rhBMP-2/carriers according to the following experiment summarized in TABLE 10.
TABLE 10
Athymtc Rat In Vivo Bone Information
Group # Treatment In Life
1-6 SPS/rhBMP-2 (0,10,50,200,400,800 fig) 2 Weeks
7-12 SPS/OPCs/rhBMP-2 (0,10,50,200,400,800 ~cg) 2 Weeks
13 positive contro!* 2 Weeks
14-19 SPS/rhBMP-2 (0,10,50,200,400,800 fig) 4 Weeks
20-25 SPS/OPCs/rhBMP-2 4 Weeks
(0,10,50,200,400,800 ug)
26 positive control* 4 Weeks
8 implants/group
*positive control = rat type I collagen+rhBMP-2
Data from these experiments permits determination of the dose-response curve
of
various rhBMP-2s on bone induction. However, bone formation varies with
anatomical site and
species.
Similar trials can be performed in dogs, monkeys, humans and other species, in
a
variety of sites, to determine optimal doses of OPCs expressing each type of
BMP, and optimal
amounts (if any) of BMP to be placed in the porous polymer matrix to activate
the OPCs in the
implant.
Other techniques for assessing bone inductive response include
radiomorphometry
and histomorphometry.
Radiomorphometry
After 24 hours in 70% ethanol, specimens are radiographed using X-OMATr~" TL
high contrast X-ray film (Eastman Kodak Company, Rochester, Nl~ in a Minishot
bench top
cabinet (TFI Corporation, West Haven, CT) at 25 KVp, 3 Ma, for 10 seconds.
Each
roentgenogram is assessed for radiopacity within a standard reference frame
superimposed over the
specimen. A Leica 970 Image Analysis System (Leica Instruments Inc.,
Cambridge, England)
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-52-
measures the area of radiopacity within the standard frame (reported as a
percentage of the total
area of the frame).
Histomorphometry
After radiographs are obtained, specimens are dehydrated in increasing
concentrations of ethanol, followed by embedding in poly(methylmethacrylate),
and 4.5-~cm coronal
sections are prepared and stained with Goldner-Masson trichrome stain (for
photomicography and
examination of cell and stromal detail) and von Kossa stain. Von Kossa-stained
histologic
specimens are quantitatively assessed for bone at a standard magnification
using a Leica 970 Image
Analysis System interfaced with Zeiss Axiophot Microscope (Zeiss Instrument
Company, Inc.,
NY, NY). Using accepted image enhancements techniques (standardized for all
specimens),
satisfactory optical contrast is achieved for fibrous connective tissue,
cartilage, bone, and cellular
features by selection of gray level that will be consistent for all sections.
EXAMPLE 26
In vivo Regeneration of Calvarial Critical-Sized Defects in Athymic Rats
This example describes the administration of a specific implant, poly(D,L-
lactide), alone or in the presence of rhBMP-2, OPCs, or rhBMP-2 and OPCs, to a
calvarial
critical-sized defect in athymic rats.
The bone implant was generated from poly(D,L-lactide) (PL) (670 kDa; 0.8 iv)
(gift from THM Biomedical, Inc., Duluth, MN, originally supplied by Sofamor
Danek, Memphis,
TN). All solvents and reagents were ACS grade and purchased from Fisher, Inc.,
unless otherwise
noted. The PL was purified by dissolving in methylene chloride, precipitated
in absolute methanol,
and dried under vacuum. Following purification, dioxane, which was refluxed
and distilled over
sodium metal, was utilized to dissolve PL at a concentration 0.01 g/mL (room
temperature). The
PL solution ($0 mL) was poured into a crystallizing dish with a 15 cm diameter
and frozen at
-20°C. The solvent was removed by freeze-drying under vacuum ( < 50
mTorr) for 3 days at 0°C.
The PL sheets formed were warmed to 23, 30 and 37°C each for 12 hrs to
ensure solvent removal.
Discs 8 mm in diameter were prepared from PL sheets, packaged 8-10/container
and sterilized with hydrogen peroxide plasma gas (58 % ) in a Sterrad~ 100
Sterilizer using the
following cycle: Vacuum Stage, 297 mTorr for 7 minutes; Injection Stage, 7 Ton
for 6 minutes;
Diffusion Stage, 9.2 Torr for 44 minutes; Plasma Stage, 497 mTorr for 16
minutes; Vent Stage, 4
minutes. The devices were allowed to de-gas for 4 days prior to implantation.
Sterility of each run
was determined by an American Association of Medical Instrument (AAMI)
Biological Standard.
The maximum temperature of the run was 43 °C.
Purified rhBMP-2 (> 98% ; lot II 0213J01, provided by Genetics Institute,
Andover, MA) was produced as described in Example 23. After reconstituting
according to
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
- 53 -
manufacturer's specifications in a sodium glutamate buffer (5 mM, pH 5.5),
appropriate dilutions
were placed in sterile glass vials, closed with a rubber stopper, and handled
aseptically. To
determine the amount of rhBMP-2 to administer, an in vivo assay using PL disks
(see Example 23),
was used. Data analyses favored a 50 ~g dose.
Three hours before surgery, the sterilized PL discs were pre-wet with 70%
isopropyl alcohol for 15 min and purged 2 times (10 min each) with filter
sterilized distilled-
deionized water to decrease surface hydrophobicity. The PL discs were washed
in HEPES-
buffered EBSS, pH 7.4, for 30 min. Two hours prior to surgery, a 22 PL volume
of fluid was
added to the PL disc to prepare the following 4 treatments: 1) PLC: 11 ~,L
Vitrogen'~ (Collagen
Corp., Palo Alto, CA), a type I bovine dermal collagen matrix at 3 mg/mL, pH
7.0 in phosphate-
buffered saline (PBS) mixed with 11 ~,L sodium glutamate buffer (5 mM, pH
6.0); 2) PLC/OPC:
11 ~,L Vitrogen'", 2 x 105 OPCs with 11 ~.L sodium glutamate buffer (5 mM, pH
6.0); 3)
PLC/rhBMP-2: 11 ~L Vitrogen'~, 11 ~L of 50 ~g rhBMP-2 in sodium glutamate
'buffer (5 mM,
pH 6.0); and 4) PLC/OPCs/rhBMP-2: 11 ~L Vitrogen'~ and 2 x 105 OPCs with 11 ~L
of 50 ~,g
rhBMP-2 in the sodium glutamate buffer (5 mM, pH 6.0).
The bone biomimetic devices were placed on a petri dish previously treated
with
Sigmacote'~ to inhibit non-specific adsorption of rhBMP-2, followed by
placement in a humidified
37°C incubator for 90 min prior to implantation to allow thermal
gelation of the Vitrogen'~. Bone
implant devices were transported aseptically to the surgical suite for
implantation.
Following aseptic procedures, an 8 mm diameter defect was prepared in the
calvarial bone with an 8 mm trephine and copious irrigation with physiologic
saline. The
craniotomy segment with attached periosteum was removed gently, leaving the
dura intact and 1 of
the 4 designated treatments was inserted. The PLC implants were retained at
the site by
surrounding soft tissues, which were closed with 4-0 sutures. Rats were
euthanized at 2 and 4
weeks post-operatively, calvarectomies were accomplished, and tissues were
prepared and assessed
for radiomorphometry and histomorphometry as described in Example 25. Data
were analyzed by
multiple analysis of variance (ANOVA) and Fisher's protected least significant
difference test for
multiple comparisons to determine differences among treatments and between
time periods.
Statistical significance was established at pS0.05.
The fabricated PL exhibited an interconnecting open-pore meshwork, which
allows cellular access for penetration, growth, and differentiation. The 8 mm
diameter PL device
had an average unit mass of 21.7 mg and a void volume approximating 85-90% .
Quantitative
scanning electron microscopic (SEM) assessment of PL scaffolds revealed a
porous structure with
pores between 50-250 ~,m. Although plasma gas sterilization resulted in 20-25
% shrinkage, after
wetting and rehydration the scaffolds regained their pre-sterilization
architecture and morphology.
The experimental bone implants were convenient to manage at surgery and were
inserted easily into the craniotomy defects, retained within the bone margins,
provided hemostasis
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-54-
control, and prevented soft tissue prolapse. No mortality occurred throughout
the course of the
study and tissue healing was unremarkable.
By week 2, PLC/OPC, PLC/rhBMP-2 and PLC/OPC/rhBMP-2 treatment groups
displayed more radiopacity compared to the PLC alone. This result was
confirmed with
radiomorphometric data (FIG. 8). The PLC/OPCs exhibited a mean radiopacity of
38 % versus
22% for PLC. Radiopacity superior to PLC alone was also observed for PLC/rhBMP-
2 and
PLC/OPC/rhBMP-2. A histological analysis at 2 weeks revealed some new bone
formation in the
defects treated with either PLC or PLC/OPCs, and fibrotic tissue prevailed.
Numerous
multinucleated giant cells were observed in PLC/OPC-treated sites. Remnants of
PLC could not be
detected either with brightfield or polarization microscopy techniques.
Defects implanted with
PLC/BMP-2 and PLC/BMP/OPC had numerous bony trabeculae, a greater amount of
new bone, as
well as a consolidation of lamellar bone along the dural aspect.
Histomorphometric data for new
bone formation corroborated the histological observations (FIG. 9).
By week 4, PLC/OPC, PLC/rhBMP-2 and PLC/OPC/rhBMP-2 treatments had
more radiopacity than PLC. The PLC/rhBMP-2 had a significantly greater percent
radiopacity
than other groups (FIG. 8). In addition, PLC/OPCs/rhBMP-2 had significantly
more radiopacity
than either the PLC or PLC/OPCs. Moreover, defects treated with PLC/rhBMP-2
had a time-
dependent increase in percent radiopacity from 2 to 4 weeks. At 4 weeks, the
histological profile
among treatments was similar to the 2 week profile. However, the quantity of
new bone for the
PLC/BMP and PLC/BMP/OPC groups was greater than at 2 weeks (FIG. 9), and the
appearance
of the new bone in the PLC/BMP/OPC at 4 weeks was more lamellar than for the
same treatment
at 2 weeks. While multinucleated giant cells were evident at 4 weeks in
PLC/OPC-treated defects,
this cell phenotype was absent in PLC/BMP and PLC/BMP/OPC sites at 4 weeks.
These results
demonstrate that the tissue-engineered bone implants promote time-dependent
bone regeneration in
calvarial CSDs in athymic rats.
Although PLC/OPCs at 4 weeks did not inspire as robust a response, boosting
cell-
loading from 105 to 106 (a one log increase) is expected to provide more bone
formation. In
addition, the PLCIOPCs/rhBMP-2 response can be increased by a log increase in
OPC quantity. A
seeding density of 2 x 105 OPCs per bone implant was used, which is
considerably less than the
quantity of cells implanted previously: 5 x 106 for W-20-BMP-2 producing cells
implanted into an
8 mm femoral gap model in athymic rats (Lieberman et al. , J. Orthop. Res. ,
16:330-339 ( 1998)),
7.5 x 106 for human MSCs delivered with a ceramic carrier into athymic rats,
and 7.5 x 106 dog
MSCs applied with a ceramic to a femoral dog gap model (Bruder et al. J Bone
joint Surg.
80A:985-996 (1998)). Consequently, a log increase in OPC cell density may
enhance the effect of
both PL/OPC and PL/OPC/rhBMP-2 on bone regeneration.
In conclusion, this example demonstrates for the first time that a combination
of
PLC10PC or PLC/OPCs/rhBMP-2 can regenerate bone in calvarial CSDs. While
untreated CSDs
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-55-
were not part of the experimental design, substantial, well-documented
previous data clearly and
unambiguously confirm untreated 8 mm-diameter CSDs in rats will not heal with
new bone
formation.
EXAMPLE 27
Endoscopic Delivery of OPCs
This example discloses an improved method and endoscope device for delivering
the OPCs into bone to heal bony defects or promote the growth of denser bones
in osteopenic areas.
An overview of the method is disclosed in FIGS. 4-6, which illustrate the
introduction of OPCs
through a cannula 42, endoscope 46, and/or balloon catheter 48, into an area
of osteoporotic
vertebral trabeculae 24. FIGS. l0A-lOD show specific embodiments of such
devices.
Delivery of OPCs
FIG. 4A shows a spinal vertebrae 20 having a cortex 22 surrounding a less
dense
cancellous bone (trabecular) portion 24. Each vertebra also includes a pedicle
26, a transverse
process 28, a spinous process 30, and a lamina 31 extending between the
pedicle 26 and spinous
process 30. These structures form a vertebral canal, surrounding and enclosing
the spinal cord 32
in a protective casing to avoid injury to the delicate neural tissue of the
spinal cord. FIG. 4A
illustrates an osteoporotic vertebral body 20 in which the cancellous bone 24
in the body 20 has
become less dense (as shown in the photomicrographic enlargement of a portion
36 of the
cancellous bone of the vertebral body 24). This loss of bone density
predisposes the body 20 to
pathological fractures which are painful, contribute to compression of the
spinal column, and can
lead to spinal cord injury with consequent neurological impairment.
To deliver the OPCs of the present invention into the cancellous bone of the
vertebral body 24, a rigid, sharp-tipped instrument (such as K wire 40 in FIG.
4A) is introduced
percutaneously through the skin and into the bone of the pedicle 26, or
lateral vertebral wall 22.
After the K wire 40 is placed, the tract is dilated with dilators up to the
diameter of a rigid cannula
42. The cannula 42 is then inserted over the K wire 40 and the K wire 40 is
removed leaving the
cannula 42 in place to provide a passageway to the body 20. An endoscopic
drill 44 is introduced
through cannula 42 to drill a pathway through the pedicle 26 into the
vertebral body 20 (FIG. 4B).
If a lateral approach is chosen, the drill will penetrate the lateral conical
wall of the vertebral body
22.
The cannula 42 is advanced along with the endoscopic drill 44 through the
pedicle
26 or lateral vertebral wall 22 until the cancellous bone of the vertebral
body 24 is encountered.
The endoscopic drill 44 is a specially co~gured drill where there is a small
fiberoptic endoscope in
the center of the drill bit. This endoscopic drill 44 allows the user to view
the path of entry of the
drill, so that the drill 44 can be advanced through the pedicle 26 or
vertebral wall 22 in a highly
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-56-
controlled fashion. This limits the potential for entering the vertebral
foramen or spinal canal,
which can lead to damage of the spinal cord 32 or nerve root.
FIG. 4C demonstrates the introduction of a steerable endoscope 46, through a
cannula 42 into the vertebral body 20. A balloon catheter 48 can be introduced
through the
steerable endoscope 46 into the cancellous bone of the vertebral body 24. The
route of the catheter
48 will be guided by the steerable endoscope 46. The balloon catheter 48 has
one or more side
vents SO (FIGS. 5 and 6) through which OPCs can be delivered into the
cancellous bone of the
vertebral body 24. The vents 50 have dimensions of a sufficient size (e.g., 20
pm i.d.) to provide
free passage of the cells from the endoscope/catheter unit without physically
disrupting the cells.
Once the balloon catheter 48 has been endoscopically guided to the proper
predetermined location
in the vertebral body 20, the OPCs can be delivered through the balloon
catheter 48 into the
cancellous bone 24. The cells may be introduced while suspended in a hydrogel,
or in a calcium-
phosphate based commercially available "ceramic" preparation (such as Bone
SourceT~~ HA cement,
from LEIBINGER, Dallas, TX, or Alpha BSMT"" from ETEX Corporation of
Cambridge, MA.)
which may be gently moved through the steerable endoscope 46 by an auger
mechanism (FIG. lOB)
that extends through the balloon catheter 48. Alternatively, the OPCs can be
placed in the
protective cortex core or mufti-lamellar matrix embodiment (wound into a
spiral with a circular
cross section) and introduced under pressure through the balloon catheter 48.
The matrix
embodiment provides additional protection to the OPCs during their passage
through the balloon
catheter 48, and introduction into bone.
Areas in which OPCs have already been deposited are illustrated in black dots
in
FIG. 4C, and the photomicrographic enlargement of that area shows that the
trabeculae 24 provide
a porous structure in which the OPCs (or the implant matrix) is supported. The
balloon catheter 48
can be advanced and retracted to deposit the OPCs at multiple spaced or
predetermined locations
throughout the vertebral body 20. If desired, the cancellous (trabecular) bone
24 in the vicinity of
the catheter tip can be gently compressed by inflating the balloon catheter
48, or by windshield
wiper-like motion of the steerable endoscope 46. This local trabecular
compression creates a small
cavity into which the OPCs can be introduced without creating excessive back-
pressure in the
balloon catheter 48 that requires forcing the cells out of the balloon
catheter 48 into the bony matrix
under a large positive pressure.
The steerable endoscope 46 has a flexible tip that can be oriented by
manipulation
of external controls to determine the direction the endoscope points. As shown
in FIG. 6, the
balloon catheter 48 can then be advanced through the steerable endoscope 46
until it reaches a
position where the OPCs are to be deposited. At this point, the tip of the
balloon catheter 48 is
inflated to gently compress surrounding bone. The balloon is deflated, leaving
a small cavity into
which the OPCs are introduced through vent openings 50. The balloon catheter
48 is then
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
-57-
withdrawn through the steerable endoscope 46 and then the endoscope is
withdrawn through
cannula 42.
EXAMPLE 28
Specific Delivery Embodiments
A particular embodiment of a coxaxial cannula 100 for delivering OPCs into
bone
is illustrated in FIG. 10A. Once an endoscopic drill has provided an access
port into bone of the
vertebral body 20, the coxaxial cannula 100 is introduced through cannula 42
into the vertebral
body 20 (FIG. 4B). This coaxial cannula 100 can be made of any suitable
sterilizable material
(such as plastic or stainless steel). The cannuia 100 has a cylindrical inner
wall 101 that defines an
inner (central) lumen 102 and a cylindrical outer wall 103 that is coaxial
with the inner wall 101
such that an outer (peripheral) lumen 104 is defined between the inner and
outer walls. The outer
lumen is divided into sections 106, 108, 110 and 112 by continuous partitions
114, 116, 118 and
120 that extend longitudinally or helically along substantially the length of
cannula 100. The
illustrated cannula 100 has an outer lumen that is divided into four sections.
There can be as few as
two sections and potentially an infinite number. The inner lumen and the
sections of the outer
lumen serve as longitudinal passageways through the cannula 100.
A steerable endoscope 122 (FIG. lOC), having a steerable tip 124 (FIG. lOD),
can
be introduced through the inner lumen 102 of cannula 100 (FIG. l0A). In
particular embodiments,
OPCs can be introduced through the lumen of the endoscope I22. The cannula
sections between
the inner and outer walls (FIG. l0A) allow pressurized air and bone
barrow/blood to escape,
preventing barotrauma to the OPCs that are introduced into the vertebral body
20 (FIG. 4) and
preventing venous embolism.
Another embodiment of a delivery system is shown in FIGS. lOB and lOD, in
which the steerable endoscope 122 is provided with an inner cartridge unit
126. This cartridge unit
is composed of a reservoir 134 connected with a flexible tubular outer body or
cannula 128
containing a helical screw/auger 130. The auger 130 is of sufficient diameter
in relation to the
inside diameter of the cannula 128 that rotation of the auger can transport
liquid or particulate
material through the cannula. As illustrated in FIG, lOD, the coaxial cannula
100 contains the
steerable endoscope 122, which in turn contains the cannula 128 of the
cartridge unit 126. By using
these components together, excessive pressure in the bone (which can damage
OPCs or cause
venous embolization) can be avoided because the pressure will be vented
through, the outer lumen
104 of cannula 100.
The cartridge unit 126 is loaded with OPCs. By either manual or motorized
rotation of the auger screw 130 (FIG. 10 B), the OPCs are gently advanced into
the vertebral body
24 (FIG. 4). The helical screw 130 may be made as a twisted-in-wire or other
form of screw or
brush. The material making up the auger must be sterilizabie and not harm the
OPCs (could be
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-58-
stainless steel, plastic or other material). The auger will be flexible so
that it can bend within the
steerable endoscope 122. In order to keep the auger from collapsing within the
cannula 128 when it
is bent within the steerable endoscope 122, a portion of the screwblade or
brush bristle will be
made of a stiffer material so as to maintain the augers location in the middle
of the cannula 128.
Alternatively, the cartridge unit 126 could be used to deliver a great range
of
biologic compounds, plastics or other materials that might be administered
into the cancellous
component of any bone in the body. In addition, the cartridge unit 126 could
be used to deliver
materials to any bone in the body directly, without an endoscope. For example,
the cartridge unit
128 could be used to deliver bone marrow.
EXAMPLE 29
BMP Expression Systems
A variety of expression systems which can be used for production of
recombinant
BMPs is shown in Table 11.
TABLE 11
Vector* Expression Product Reference
system
pMT2CX plasmid monkey COS-1 rhBMP-1, 2 and Wozney
cells 3 et
al 1983
pMT2CX CHO1 cells rhBMP-1, 2 and Wozney
3 et
plasmid E.coli al.
1988
Xenopus BMP-4 cDNA underCOS-1 cells rxBMP-4 Koster
et
control of CMV-promoter al.
1991
CHO cells BMP-2 Israel
et
al.
1992
pMBC-2T-fl marine mesenchymalrhBMP-2 and Ahrens
4 et
progenitor al 1993
cell line
C3H10T1 /2
pCVD(X) + SV40 promoterCHOcells rxBMP-4 Suzuki
+ et
CMV-promoter + dbfr-gene al.
1993
pSVD(X)+ SV40 promoter
+ dhfr-
gene
pUCl9 and pdKCR- CHO cells marine rBMP-4 Takaoka
dehydrofolate reductase et al.
(dhfr) 1993
pAG60 with neomycin BMGE+H cell human rDVR-6 Wall
resistance line et
al.
gene, cotransfection 1993
with DVR-6
gene, under control
of keratin III
and IV regulation element
C3H10T1/2 rhBMP-2 Wang
et
mesenchymal al.
cell line 1993
Co-transfection with Silworm larvaerhBMP-2 Ishida
BmNPV et
(strain PGE) and pBm4-hBMP2 al.
1994
pDSRa CHO(DG44) cellsBMP-2 and BMP-4Koenig
et
plT4 COS-7 BRK-1 and DAF-4al 1994
receptor proteins
PMS32C/BMP1 plasmid E. coli human BMP Ma et
al
1994
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
-59-
EMC GS CHO rhBMP-2 Marden
1994
pUCl9 and pdKCR- CHO cells expandedmarine rBMP-4Shimitzu
dehydrofolate reductase and inoculated et al.
(dhfr) into the 1994
hindlimbs of nude
mice
pUC 19 and pdKCR- CHO cells without marine rBMP-4Takaoka
and
dehydrofolate reductase in diffusion chambers et al.
(dhfr) 1994
s.c. in nude mice
pVL1393 & Insect Sf9 cells rxBMP-2 Hazama
AcNPVco-tranfection rxBMP-4 et. al
1995
rxBMP-7
pBlueBacII & Insect Sf9 cells rhBMP-2 Maruoka
AcNPV co-transfection et al
1995
vector = ?? E. coli rhBMP-2 Ruppert
et
al. 1996
pRK7 CHO cells marine vgr-1Gitelman
(BMP-6) et al
1994
aGlyTag plasmid Transgenic mice BMP-2-T-Ag Ghosh-
fusion proteinChoudhury
et al.
1996
*Nomenclature does not names of
follow uniform criteria; the plasmids
either the original or the names
after ligation of BMP-cDNA
have been used.
In view of the many possible embodiments to which the principles of our
invention may be applied, it should be recognized that the illustrated
embodiments are only
preferred examples of the invention and should not be taken as a limitation on
the scope of the
invention. Rather, the scope of the invention is defined by the following
claims. We therefore
claim as our invention all that comes within the scope and spirit of these
claims.
CA 02320136 2000-08-09
WO 99/39724 PCTNS99/02946
SEQUENCE LISTING
<110> Hollinger, J. 0. et al.
<120> Treatment of Bony Defects with Osteoblast Precursor
Cells
<130> 51670
<190>
<141>
<150> 60/074,951
<151> 1998-02-12
<150> 60/074,240
<151> 1998-02-10
<160> 16
<170> PatentIn Ver. 2.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 1
ctggccctga ctgcattctg c 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 2
aacggtggtg ccatagatgc g 21
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 3
gatgaggaca acaaccttct gac 23
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
<223> Description of Artificial Sequence: PCR primer
<900> 9
ttagatcaca agatccttgt cgat 24
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: PCR primer
<400> 5
aaatacccag atgctgtggc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: PCR primer
<900> 6
aaccacacta tcacctcggc 20
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: PCR primer
<400> 7
aggaacagat cttcctgctg ca 22
<210> B
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: PCR primer
<400> 8
tgcatgtgga tgtagttgcg cgt 23
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: PCR primer
<400> 9
gcgaacgtat ttctccagac ccag 24
<210> 10
2
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<900> 10
ttccaaacag gagagtcgct tcaa 24
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<900> 11
tgacgagacc aagaactg 18
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<900> 12
ccaaagtcac caaacctacc 20
<210> 13
<211> 1215
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sea_uence: KS-hBMP-2
plasmid
<400> 13
cccaagcttc gccaccatgg tggccgggac ccgctgtctt ctagcgttgc tgcttcccca 60
ggtcctcctg ggcggcgcgg ctggcctcgt tccggagctg ggccgcagga agttcgcggc 120
ggcgtcgtcg ggccgcccct catcccagcc ctctgacgag gtcctgagcg agttcgagtt 180
gcggctgctc agcatgttcg gcctgaaaca gagacccacc cccagcaggg acgccgtggt 240
gcccccctac atgctagacc tgtatcgcag gcactcaggt cagccgggct cacccgcccc 300
agaccaccgg ttggagaggg cagccagccg agccaacact gtgcgcagct tccaccatga 360
agaatctttg gaagaactac cagaaacgag tgggaaaaca acccggagat tcttctttaa 420
tttaagttct atccccacgg aggagtttat cacctcagca gagcttcagg ttttccgaga 480
acagatgcaa gatgctttag gaaacaatag cagtttccat caccgaatta atatttatga 540
aatcataaaa cctgcaacag ccaactcgaa attccccgtg accagacttt tggacaccag 600
gttggtgaat cagaatgcaa gcaggtggga aagttttgat gtcacccccg ctgtgatgcg 660
gtggactgca cagggacacg ccaaccatgg attcgtggtg gaagtggccc acttggagga 720
gaaacaaggt gtctccaaga gacatgttag gataagcagg tctttgcacc aagatgaaca 780
cagctggtca cagataaggc cattgctagt aacttttggc catgatggaa aagggcatcc 840
tctccacaaa agagaaaaac gtcaagccaa acacaaacag cggaaacgcc ttaagtccag 900
ctgtaagaga caccctttgt acgtggactt cagtgacgtg gggtggaatg actggattgt 960
ggctcccccg gggtatcacg ccttttactg ccacggagaa tgcccttttc ctctggctga 1020
tcatctgaac tccactaatc atgccattgt tcagacgttg gtcaactctg ttaactctaa 1080
gattcctaag gcatgctgtg tcccgacaga actcagtgct atctcgatgc tgtaccttga 1190
3
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
cgagaatgaa aaggttgtat taaagaacta tcaggacatg gttgtggagg gttgtgggtg 1200
tcgctaggat ccggg 1215
<210> 19
<211> 535
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: IgSP-NS-hBMP-2
plasmid
<900> 19
cccaagcttg cgtcacccct agagtcgagc tgtgacggtc cttacaatga aatgcagctg 60
ggttatcttc ttcctgatgg cagtggttac aggtaagggg ctcccaagtc ccaaacttga 120
gggtccataa actctgtgac agtggcaatc actttgcctt tctttctaca ggggtgaatt 180
cgcaagccaa acacaaacag cggaaacgcc ttaagtccag ctgtaagaga caccctttgt 240
acgtggactt cagtgacgtg gggtggaatg actggattgt ggctcccccg gggtatcacg 300
ccttttactg ccacggagaa tgcccttttc ctctggctga tcatctgaac tccactaatc 360
atgccattgt tcagacgttg gtcaactctg ttaactctaa gattcctaag gcatgctgtg 920
tcccgacaga actcagtgct atctcgatgc tgtaccttga cgagaatgaa aaggttgtat 480
taaagaacta tcaggacatg gttgtggagg gttgtgggtg tcgctaggat ccggg 535
<210> 15
<211> 591
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: IgSP-KR-hBMP-2
plasmid
<400> 15
cccaagcttg cgtcacccct agagtcgagc tgtgacggtc cttacaatga aatgcagctg 60
ggttatcttc ttcctgatgg cagtggttac aggtaagggg ctcccaagtc ccaaacttga 120
gggtccataa actctgtgac agtggcaatc actttgcctt tctttctaca ggggtgaatt 180
cgaaacgtca agccaaacac aaacagcgga aacgccttaa gtccagctgt aagagacacc 240
ctttgtacgt ggacttcagt gacgtggggt ggaatgactg gattgtggct cccccggggt 300
atcacgcctt ttactgccac ggagaatgcc cttttcctct ggctgatcat ctgaactcca 360
ctaatcatgc cattgttcag acgttggtca actctgttaa ctctaagatt cctaaggcat 420
gctgtgtccc gacagaactc agtgctatct cgatgctgta ccttgacgag aatgaaaagg 480
ttgtattaaa gaactatcag gacatggttg tggagggttg tgggtgtcgc taggatccgg 590
g 541
<210> 16
<211> 547
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
IgSP-RRRR-hBMP-2 plasmid
<400> 16
cccaagcttg cgtcacccct agagtcgagc tgtgacggtc cttacaatga aatgcagctg 60
ggttatcttc ttcctgatgg cagtggttac aggtaagggg ctcccaagtc ccaaacttga 120
gggtccataa actctgtgac agtggcaatc actttgcctt tctttctaca ggggtgaatt 180
cgcgccggcg ccgacaagcc aaacacaaac agcggaaacg ccttaagtcc agctgtaaga 240
gacacccttt gtacgtggac ttcagtgacg tggggtggaa tgactggatt gtggctcccc 300
cggggtatca cgccttttac tgccacggag aatgcccttt tcctctggct gatcatctga 360
actccactaa tcatgccatt gttcagacgt tggtcaactc tgttaactct aagattccta 920
4
CA 02320136 2000-08-09
WO 99/39724 PCT/US99/02946
aggcatgctg tgtcccgaca gaactcagtg ctatctcgat gctgtacctt gacgagaatg 480
aaaaggttgt attaaagaac tatcaggaca tggttgtgga gggttgtggg tgtcgctagg 540
atccggg
547
