Language selection

Search

Patent 2321129 Summary

Third-party information liability

Some of the information on this Web page has been provided by external sources. The Government of Canada is not responsible for the accuracy, reliability or currency of the information supplied by external sources. Users wishing to rely upon this information should consult directly with the source of the information. Content provided by external sources is not subject to official languages, privacy and accessibility requirements.

Claims and Abstract availability

Any discrepancies in the text and image of the Claims and Abstract are due to differing posting times. Text of the Claims and Abstract are posted:

  • At the time the application is open to public inspection;
  • At the time of issue of the patent (grant).
(12) Patent Application: (11) CA 2321129
(54) English Title: BEST'S MACULAR DYSTROPHY GENE
(54) French Title: GENE DE LA DYSTROPHIE CORNEENNE DE BEST
Status: Deemed Abandoned and Beyond the Period of Reinstatement - Pending Response to Notice of Disregarded Communication
Bibliographic Data
(51) International Patent Classification (IPC):
  • C12N 15/12 (2006.01)
  • C07H 21/02 (2006.01)
  • C07K 14/00 (2006.01)
  • C07K 14/435 (2006.01)
  • C07K 14/47 (2006.01)
  • C07K 16/00 (2006.01)
  • C07K 16/18 (2006.01)
  • C12N 5/10 (2006.01)
  • C12N 15/63 (2006.01)
  • C12P 19/34 (2006.01)
  • C12Q 1/00 (2006.01)
(72) Inventors :
  • PETRUKHIN, KONSTANTIN (United States of America)
  • CASKEY, C. THOMAS (United States of America)
  • METZKER, MICHAEL (United States of America)
  • WADELIUS, CLAES (Sweden)
(73) Owners :
  • MERCK AND CO., INC.
  • CLAES WADELIUS
(71) Applicants :
  • MERCK AND CO., INC. (United States of America)
  • CLAES WADELIUS (Sweden)
(74) Agent: NORTON ROSE FULBRIGHT CANADA LLP/S.E.N.C.R.L., S.R.L.
(74) Associate agent:
(45) Issued:
(86) PCT Filing Date: 1999-02-22
(87) Open to Public Inspection: 1999-09-02
Examination requested: 2004-01-15
Availability of licence: N/A
Dedicated to the Public: N/A
(25) Language of filing: English

Patent Cooperation Treaty (PCT): Yes
(86) PCT Filing Number: PCT/US1999/003790
(87) International Publication Number: WO 1999043695
(85) National Entry: 2000-08-16

(30) Application Priority Data:
Application No. Country/Territory Date
60/075,941 (United States of America) 1998-02-25
60/112,926 (United States of America) 1998-12-18

Abstracts

English Abstract


Novel human and mouse DNA sequences that encode the gene CG1CE, which, when
mutated, is responsible for Best's macular dystrophy, are provided. Provided
are genomic CG1CE DNA as well as cDNA that encodes the CG1CE protein. Also
provided is CG1CE protein encoded by the novel DNA sequences. Methods of
expressing CG1CE protein in recombinant systems are provided. Also provided
are diagnostic methods that detect patients having mutant CG1CE genes.


French Abstract

Nouvelles séquences d'ADN humain et de souris codant le gène CG1CE qui, lorsqu'il est muté, est responsable de la dystrophie cornéenne de Best. La présente invention concerne en outre de l'ADN génomique CG1CE ainsi que de l'ADNc qui code la protéine CG1CE, la protéine CG1CE codée par les nouvelles séquences d'ADN, des procédés d'expression de la protéine CG1CE dans des systèmes de recombinaison et des méthodes diagnostiques permettant d'identifier les patients possédant des gènes CG1CE mutés.

Claims

Note: Claims are shown in the official language in which they were submitted.


WHAT IS CLAIMED:
1. An isolated DNA comprising nucleotides encoding a
polypeptide having an amino acid sequence selected from the group
consisting of SEQ.ID.NO.:3, SEQ.ID.NO.:5, and SEQ.ID.NO.:29.
2. The DNA of claim 1 comprising a nucleotide
sequence selected from the group consisting of SEQ.ID.NO.:1,
SEQ.ID.NO.:2, SEQ.ID.NO.:4, SEQ.ID.NO.:28, positions 105-1,859 of
SEQ.ID.NO.:2, positions 105-1,409 of SEQ.ID.NO.:4, and positions
11-1,663 of SEQ.ID.NO.:28.
3. An isolated DNA comprising a sequence that is
identical to SEQ.ID.NO.:2 except that it contains a differennt nucleotide
at a position selected from the group consisting of positions 120, 121, 122,
357, 358, 359, 381, 382, 383, 783, 784, 785, 999,1000, and 1001.
4. An isolated DNA that hybridizes under stringent
conditions to a nucleotide sequence selected from the group consisting
of SEQ.ID.NO.:1, SEQ.ID.NO.:2, SEQ.ID.NO.:4, and SEQ.ID.NO.:28.
5. An expression vector comprising the DNA of
claim 1.
6. A recombinant host cell comprising the DNA of
claim 1.
7. A CG1CE protein, substantially free from other
proteins, having an amino acid sequence selected from the group
consisting of SEQ.ID.NO.: 3, SEQ.ID.NO.:5, and SEQ.ID.NO.: 29.
8. The CG1CE protein of claim 8 containing a single
amino acid substitution.
9. The CG1CE protein of claim 9 where the substitution
occurs at position 6, 85, 93, 227, or 299.
-42-

10. The CG1CE protein of claim 9 where the substitution
is a conservative substitution.
11. The CG1CE protein of claim 8 containing two amino
acid substitutions.
12. The CG1CE protein of claim 8 containing an amino
acid substitution where the substitution does not occur in a position
where the amino acid present in CG1CE is also present in the
corresponding position in one of the C. elegans proteins whose partial
amino acid sequence is shown in Figure 7.
13. An antibody that binds specifically to a CG1CE
protein where the CG1CE protein has the amino acid sequence selected
from the group consisting of SEQ.ID.NO.:3 and SEQ.ID.NO.:5.
14. A method of diagnosing whether a patient carries a
mutation in the CG1CE gene that comprises:
(a) providing a DNA sample from the patient;
(b) providing a set of PCR primers based upon
SEQ.ID.NO.:2 or SEQ.ID.NO.:4;
(c) performing PCR on the DNA sample to produce a
PCR fragment from the patient;
(d) determining the nucleotide sequence of the PCR
fragment from the patient;
(e) comparing the nucleotide sequence of the PCR
fragment from the patient with the nucleotide sequence of SEQ.ID.NO.:2
or SEQ.ID.NO.:4;
where a difference between the nucleotide sequence of the
PCR fragment from the patient with the nucleotide sequence of
SEQ.ID.NO.:2 or SEQ.ID.NO.:4 indicates that the patient carries a
mutation in the CG1CE gene.
15. The method of claim 15 where the DNA sample is
genomic DNA.
-43-

16. The method of claim 15 where the DNA sample is
cDNA.
17. A DNA or RNA oligonucleotide probe comprising at
least 18 contiguous nucleotides of at least one of a sequence selected from
the group consisting of SEQ.ID.NO.:1, SEQ.ID.NO.:2, SEQ.ID.NO.:4,
and SEQ.ID.NO.:28.
18. A method for determining whether a substance is an
activator or an inhibitor of a CG1CE protein or a mutant CG1CE protein
comprising:
(a) recombinantly expressing CG1CE protein or mutant
CG1CE protein in a host cell;
(b) measuring the biological activity of CG1CE protein or
mutant CG1CE protein in the presence and in the absence of a substance
suspected of being an activator or an inhibitor of CG1CE protein or
mutant CG1CE protein;
where a change in the biological activity of the CG1CE
protein or the mutant CG1CE protein in the presence as compared to the
absence of the substance indicates that the substance is an activator or
an inhibitor of CG1CE protein or mutant CG1CE protein.
-44-

Description

Note: Descriptions are shown in the official language in which they were submitted.


CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
TITLE OF THE INVENTION
BEST'S MACULAR DYSTROPHY GENE
CROSS-REFERENCE TO RELATED APPLICATIONS
Not applicable.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
The present invention is directed to novel human and
mouse DNA sequences encoding a protein which, when present in
mutated form, results in the occurrence of Best's Macular Dystrophy.
BACKGROUND OF THE INVENTION
Macular dystrophy is a term applied to a heterogeneous
group of diseases that collectively are the cause of severe visual loss in a
large number of people. A common characteristic of macular dystrophy
is a progressive loss of central vision resulting from the degeneration of
the pigmented epithelium underlying the retinal macula. In many
forms of macular dystrophy, the end stage of the disease results in legal
blindness. More than 20 types of macular dystrophy are known: e.g.,
age-related macular dystrophy, Stargardt's disease, atypical vitelliform
macular dystrophy (VMD1), Usher Syndrome Type 1B, autosomal
dominant neovascular inflammatory vitreoretinopathy, familial
egudative vitreoretinopathy, and Best's macular dystrophy (also known
as hereditary macular dystrophy or Best's vitelliform macular
dystrophy (VMD2)). For a review of the macular dystrophies, see
Sullivan & Daiger, 1996, Mol. Med. Today 2:380-386.
Best's Macular Dystrophy (BMD) is an inherited autosomal
dominant macular dystrophy of unknown biochemical cause. BMD has
an age of onset that can range from childhood to after 40. Clinical
symptoms include, at early stages, an abnormal accumulation of the
-1-

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
yellowish material lipofuscin in the retinal pigmented epithelium (RPE)
underlying the macula. This gives rise to a characteristic "egg yolk"
appearance of the RPE and gradual loss of visual acuity. With
increasing age, the RPE becomes more and more disorganized, as the
lipofuscin accumulations disperse and scarring and neovascularization
take place. These changes are accompanied by further loss of vision.
The pathological features seen in BMD are in many ways
similar to the features seen in age-related macular dystrophy, the
leading cause of blindness in older patients in the developed world. Age-
related macular dystrophy is an extraordinarily difficult disease to study
genetically, since by the time patients are diagnosed, their parents are
usually no longer living and their children are still asymptomatic.
Thus, family studies which have led to the discovery of the genetic basis
of many other diseases have not been practical for age-related macular
dystrophy. As there are currently no widely effective treatments for age-
related macular dystrophy, it is hoped that study of BMD, and in
particular the discovery of the underlying genetic cause of BMD, will
shed light on age-related macular dystrophy as well.
Linkage analysis has established that the gene responsible
for BMD resides in the pericentric region of chromosome 11, at 11q13,
near the markers D11S956, FCER1B, and UGB (Foreman et al., 1992,
Clin. Genet. 42:156-159; Hou et al.,1996, Human Heredity 46:211-220).
Recently, the gene responsible for BMD was localized to a ~1.7 mB PAC
contig lying mostly between the markers D11S1765 and UGB (Cooper et
al., 1997, Genomics 41:185-192). Recombination breakpoint mapping in a
large Swedish pedigree limited the minimum genetic region containing
the BMD gene to a 980 kb interval flanked by the microsatellite markers
D11S4076 and UGB (GrafFet al., 1997, Hum. Genet. 101: 263-279).
One difficulty in diagnosing BMD is that carriers of the
diseased gene for BMD may be asymptomatic in terms of visual acuity
and morphological changes of the RPE observable in a routine
ophthalmologic examination. There does exist a test, the electro-
oculographic examination (EOG), which detects differences in electrical
potential between the cornea and the retina, that can distinguish
asymptomatic BMD patients from normal individuals. However, the
EOG requires specialized, expensive equipment, is difficult to
-2-

CA 02321129 2000-08-16
WO 99/43695 PC'f/US99/03790
administer, and requires that the patient be present at the site of the
equipment when the test is performed. It would be valuable to have an
alternative method of diagnosing asymptomatic carriers of mutations in
the gene responsible for BMD that is simpler, less expensive, and does
not require the presence of the patient while the test is being performed.
For example, a diagnostic test that relies on a blood sample from a
patient suspected of being an asymptomatic carrier of BMD would be
ideal.
SUMMARY OF THE INVENTION
The present invention is directed to novel human and
mouse DNA sequences that encode the gene CG1CE, which, when
mutated, is responsible for Best's macular dystrophy. The present
invention includes genomic CG1CE DNA as well as cDNA that encodes
the CG1CE protein. The human genomic CG1CE DNA is substantially
free from other nucleic acids and has the nucleotide sequence shown in
SEQ.ID.N0.:1. The human cDNA encoding CG1CE protein is
substantially free from other nucleic acids and has the nucleotide
sequence shown in SEQ.ID.N0.:2 or SEQ.ID.N0.:4. The mouse cDNA
encoding CG1CE protein is substantially free from other nucleic acids
and has the nucleotide sequence shown in SEQ.ID.N0.:28. Also
provided is CG1CE protein encoded by the novel DNA sequences. The
human CG1CE protein is substantially free from other proteins and has
the amino acid sequence shown in SEQ.ID.N0.:3 or SEQ.ID.N0.:5. The
mouse CG1CE protein is substantially free from other proteins and has
the amino acid sequence shown in SEQ.ID.N0.:29. Methods of
expressing CG1CE protein in recombinant systems are provided. Also
provided are diagnostic methods that detect carriers of mutant CG1CE
genes.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure lA-~' shows the genomic DNA sequence of human
CG1CE (SEQ.ID.N0.:1). Underlined nucleotides in capitals represent
exons. The start ATG codon in exon 2 and the stop TAA codon in exon
11 are shown in bold italics. The consensus polyadenylation signal
AATAAA in exon 11 is shown in bold. The alternatively spliced part of
-3-

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
egon 7 is shown in underlined italics. The enact lengths of two gaps
between exons 1 and 2 and between exons ? and 8 are unknown; these
gaps are presented as runs of ten Ns for the sake of convenience. The
portion of exon 1I beginning at position 15,788 represents the 3'
untranslated region; 132 base pairs downstream of the polyadenylation
signal of the CG1CE gene are multiple ESTs, representing the 3'-
untranslated region of the ferritin heavy chain gene (FTH). FTH has
been mapped to human chromosome 11q13 (Hentze et al., 1986, Proc.
Nat. Acad. Sci. 83: 7226-7230); the FTH gene was later shown to be a part
of the smallest minimum genetic region containing the BMD gene, as
determined by recombination breakpoint mapping in a 12 generation
Swedish pedigree (Graff et al ., 1997, Hum. Genet. 101: 263-279).
Figure 2 shows the complete sequence of the short form of
human CG1CE cDNA (SEQ.ID.N0.:2). The ATG start codon is at
position 105; the TAA stop codon is at position 1,860.
Figure 3 shows the complete amino acid sequence of the
long form of human CG1CE protein (SEf,~.ID.N0.:3). This long form of
the human CG1CE protein is produced by translation of the short form
of CG1CE cDNA.
Figure 4 shows the complete sequence of the long form of
human CG1CE cDNA (SEQ.ID.N0.:4). This long form of the human
CG1CE cDNA is produced when an alternative splice donor site is
utilized in intron ?. The ATG start codon is at position 105; the TGA stop
codon is at position 1410.
Figure 5 shows the complete amino acid sequence of the
short form of the human CG1CE protein (SEla.ID.N0.:5). This short
form of the human CG1CE orotein is produced by translation of the long
form of CG1CE cDNA.
Figure 6 shows the results of sequencing runs of PCI~
fragments that represent exon 4 and adjacent intronic regions from
three individuals from the Swedish pedigree S1, two of whom are
affected with BMD. From top to bottom, the runs are: patient Sl-5
(homozygous affected with BMD), sense orientation; patient S1-4
(heteroozygous affected with BMD), sense orientation; patient S1-3
(normal control, unaffected sister of S1-4.), sense orientation; patient S1-5
(affected with BMD), anti-sense orientation; patient Sl-4 (affected with
-4-

CA 02321129 2000-08-16
WO 99/43695 PGT/US99/03790
BMD), anti-sense orientation; patient S1-3 (normal control), anti-sense
orientation. Reading from left to right, the mutation shows up at
position 31 of the sequence shown in the case of patients S1-5 and Sl-4.
The mutation in family S1 changes tryptophan to cysteine.
Figure 7 shows a multiple sequence alignment of human
CG1CE protein with partial sequences of related proteins from C.
elegans. Related proteins from C. elegans were identified by BLASTP
analysis of non-redundant GenBank database. This figure shows that
two amino acids mutated in two different Swedish families with BMD
(families S1 and SL76) are evolutionarily conserved. 15 of 16 related
proteins from C. elegans contain a tryptophan at the position of the
mutation in family S1, as does the wild-type CG1CE gene. Only one C.
elegans protein does not have a tryptophan at the position of the
mutation. In this protein (accession number p34577), tryptophan is
changed for isofunctional phenylalanine (phenylalanine is highly
similar to tryptophan in that it also is a hydrophobic aromatic amino
acid). Mutation in the BMD family SL76 changes a tyrosine to histidine.
Again, all 16 related proteins from C. elegans contain tyrosine or
isofunctional phenylalanine in this position (tyrosine is highly similar to
phenylalanine in that it also is an aromatic amino acid).
Figure 8A=C sfiows the complete sequence of mouse CG1CE
cDNA (SEQ.ID.N0.:28) and mouse CG1CE protein (SEQ.ID.N0.:29).
Figure 9A-B shows an alignment of the amino acid
sequences of the long form of human CG1CE protein (SEQ.ID.N0.:3) and
mouse CG1CE protein (SEQ.ID.N0.:29). In this figure, CG1CE is referred to
as "bestrophin."
Figure l0A-C shows the results of in situ hybridization
experiments demonstrating that mouse CG1CE mRNA expression is
localized to the retinal pigmented epithelium cells (RPE). Figure l0A
shows the results of using an antisense CG1CE probe. The antisense
probe hybridizes to mouse CG1CE mRNA present in the various cell
layers of the retina, labeling with dark bands the cells containing
CG1CE mRNA. The antisense probe strongly hybridized to the RPE cells
and not to the cells of the other layers of the retina. Figure 10B shows
the results using a sense CG1CE probe as a control. The sense probe
does not hybridize to CG1CE mRNA and does not label the RPE cells.
-5

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
Figure 10C is a higher magnification of the RPE cells from Figure 10A.
Human CG1CE mRNA shows a similar distribution, being confined to
the RPE cells of the human retina.
DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention:
"Substantially free from other proteins" means at least 90%,
preferably 95%, more preferably 99%, and even more preferably 99.9%,
free of other proteins. Thus, a CGICE protein preparation that is
substantially free from other proteins will contain, as a percent of its
total protein, no more than 10%, preferably no more than 5%, more
preferably no more than 1%, and even more preferably no more than
0.1%, of non- CG1CE proteins. Whether a given CG1CE protein
preparation is substantially free from other proteins can be determined
by such conventional techniques of assessing protein purity as, e.g.,
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
combined with appropriate detection methods, e.g., silver staining or
immunoblotting.
"Substantially free from other nucleic acids" means at least
90%, preferably 95°~fo, more preferably 99%, and even more preferably
99.9%, free of other nucleic acids. Thus, a CG1CE DNA preparation that
is substantially free from other nucleic acids will contain, as a percent of
its total nucleic acid, no more than 100, preferably no more than 5°k,
more preferably no more than 1%, and even more preferably no more
than 0.1%, of non- CG1CE nucleic acids. Whether a given CG1CE DNA
preparation is substantially free from other nucleic acids can be
determined by such. conventional techniques of assessing nucleic acid
purity as, e.g., agarose gel electrophoresis combined with appropriate
staining methods, e.g., ethidium bromide staining, or by sequencing.
A "conservative amino acid substitution" refers to the
replacement of one amino acid residue by another, chemically similar,
amino acid residue. Ezamples of such conservative substitutions are:
substitution of one hydrophobic residue (isoleucine, leucine, valine, or
methionine) for another; substitution of one polar residue for another
polar residue of the same charge (e.g., arginine for lysine; glutamic acid
-6-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
for aspartic acid); substitution of one aromatic amino acid (tryptophan,
tyrosine, or phenylalanine) for another.
The present invention relates to the identification and
cloning of CG1CE, a gene which, when mutated, is responsible for
Best's macular dystrophy. That CG1CE is the Best's macular dystrophy
gene is supported by various observations:
1. CG1CE maps to the genetically defined region of
human chromosome 11q12-q13 that has been shown to contain the Best's
macular dystrophy gene. CG1CE is present on two PAC clones, 759J12
and 466A11, that lie precisely in the most narrowly defined region that
has been shown to contain CG1CE (Cooper et al., 1997, Genomics 41:185-
192; Stlhr et al., 1997, Genome Res. 8:48-56; Graffet al ., 1997, Hum.
Genet. 101: 263-279).
2. CG1CE is expressed predominately in the retina.
3. In patients having Best's macular dystrophy, CG1CE
contains mutations in evolutionarily conserved amino acids.
4. The CG1CE genomic clones contain another gene
(FTH) that has been physically associated with the Beat's macular
dystrophy region (Cooper et cal., 1997, Genomics 41:185-192; Stir et acl.,
1997, Genome R,es. 8:48-56; Graff et al., 1997, Hum. Genet. 101:263-279).
The FTH and CG1CE genes are oriented tail-to-tail; the distance between
their polyadenylation signals is 132 bp.
The present invention provides DNA encoding CG1CE that
is substantially free from other nucleic acids. The present invention
also provides recombinant DNA molecules encoding CG1CE. The
present invention provides DNA molecules substantially free from other
nucleic acids comprising the nucleotide sequence shown in Figure 1 as
SEQ.ID.NO.:1. Analysis of SEla.ID.N0.:1 revealed that this genomic
sequence defines a gene having 11 exons. These egons collectively have
an open reading frame that encodes a protein of 585 amino acids. If an
alternative splice donor site is utilized in exon 7, a cDNA containing an
additional 203 bases is produced. Although longer, this cDNA contains
a shorter open reading frame of 1,305 bases (due to the presence of a
change in reading frame that introduces a stop codon) that encodes a
protein of 435 amino acids. Thus, the present invention includes two
cDNA molecules encoding two forms of CG1CE protein that are
-7-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
substantially free from other nucleic acids and have the nucleotide
sequences shown in Figure 2 as SEQ.ID.N0.:2 and in Figure 4 as
SEQ.ID.N0.:4.
The present invention includes DNA molecules
substantially free from other nucleic acids comprising the coding
regions of SEQ.ID.N0.:2 and SEQ.ID.N0.:4. Accordingly, the present
invention includes DNA molecules substantially free from other nucleic
acids having a sequence comprising positions 105-1,859 of SEQ.ID.N0.:2
and positions 105-1,409 of SEQ.ID.N0.:4. Also included are recombinant
DNA molecules having a nucleotide sequence comprising positions 105-
1,859 of SEla.ID.N0.:2 and positions 105-1,409 of SEf~.ID.N0.:4.
Portions of the cDNA sequences of SEQ.ID.N0.:2 and
SEla.ID.N0.:4 are found in two retina-specific ESTs deposited in
GenBank by The Institute for Genomic Research (accession numbers
AA318352 and AA317489). Other ESTSs that correspond to this cDNA
are accession numbers AA307119 (from a colon carcinoma), AA205892
(from neuronal cell line), and AA326727 (from human cerebellum). A
true mouse ortholog of the CG1CE gene is represented in the mouse EST
AA497726 (from mouse testis).
The novel DNA sequences of the present invention encoding
CG1CE, in whole or in part, can be linked with other DNA sequences,
i.e., DNA sequences to which CG1CE is not naturally linked, to form
"recombinant DNA molecules" encoding CG1CE. Such other sequences
can include DNA sequences that control transcription or translation
such as, e.g., translation initiation sequences, promoters for RNA
polymerise II, transcription or translation termination sequences,
enhancer sequences, sequences that control replication in
microorganisms, sequences that confer antibiotic resistance, or
sequences that encode a polypeptide "tag" such as, e.g., a polyhistidine
tract or the myc epitope. The novel DNA sequences of the present
invention can be inserted into vectors such as plasmids, cosmids, viral
vectors, P1 artificial chromosomes, or yeast artificial chromosomes.
Included in the present invention are DNA sequences that
hybridize to at least one of SEQ.ID.NOs.:l, 2, or 4 under stringent
conditions. By way of example, and not limitation, a procedure using
conditions of high stringency is as follows: Prehybridization of filters
_g_

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
containing DNA is carried out for 2 hr. to overnight at 65°C in buffer
composed of 6X SSC, 5X Denhardt's solution, and 100 ~,g/ml denatured
salmon sperm DNA. Filters are hybridized for 12 to 48 hrs at 65°C in
prehybridization mixture containing 100 ~.g/mI denatured salmon
sperm DNA and 5-20 X 106 cpm of 32P-labeled probe. Washing of filters
is done at 37°C for 1 hr in a solution containing 2X SSC, 0.1°~
SDS. This
is followed by a wash in O.1X SSC, 0.1°~ SDS at 50°C for 45 min.
before
autoradiography.
Other procedures using conditions of high stringency
would include either a hybridization carried out in SXSSC, 5X
Denhardt's solution, 50% formamide at 42°C for 12 to 48 hours or a
washing step carried out in 0.2X SSPE, 0.2% SDS at 65°C for 30 to 60
minutes.
Reagents mentioned in the foregoing procedures for
carrying out high stringency hybridization are well known in the art.
Details of the composition of these reagents can be found in, e.g.,
Sambrook, Fritsch, and Maniatis, 1989, Molecular Clo~ing;~
Laboratory ManLal. second edition, Cold Spring Harbor Laboratory
Press. In addition to the foregoing, other conditions of high stringency
which may be used are well known in the art.
The degeneracy of the genetic code is such that, for all but
two amino acids, more than a single codon encodes a particular amino
acid. This allows for the construction of synthetic DNA that encodes the
CG1CE protein where the nucleotide sequence of the synthetic DNA
differs significantly from the nucleotide sequences of SEQ.ID.NOs.:2 or
4, but still encodes the same CG1CE protein as SEQ.ID.NOs.:2 or 4.
Such synthetic DNAs are intended to be within the scope of the present
invention.
Mutated forms of SEQ.ID.NOs.:I, 2, or 4 are intended to be
within the scope of the present invention. In particular, mutated forms
of SEQ.ID.NOs.:l, 2, or 4 which give rise to Best's macular dystrophy are
within the scope of the present invention. Accordingly, the present .
invention includes a DNA molecule having a nucleotide sequence that is
identical to SEQ.ID.NO.:1 except that the nucleotide at position 7,259 of
SEQ.ID.NO.:1 is T, A, or C rather than G, so that the codon at positions
-9-

CA 02321129 2000-08-16
WO 99/43695 PGT/US99103790
7,257-7,259 encodes either cysteine or is a atop colon rather than
encoding tryptophan. Also included in the present invention is a DNA
molecule having a nucleotide sequence that is identical to SEQ.ID.NO.:1
except that at least one of the nucleotides at position 7,257 or 7,258 has
been changed so that the colon at positions 7,257-?,259 does not encode
tryptophan.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 383 is T, A, or C
rather than G, so that the colon at positions 381-383 encodes either
cysteine or is a stop colon rather than encoding tryptophan. Also
included in the present invention is a DNA molecule having a nucleotide
sequence that is identical to positions 105-1,859 of SEQ.ID.N0.:2 except
that at least one of the nucleotides at position 381 or 382 has been
changed so that the colon at positions 381-383 does not encode
tryptophan.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that the nucleotide at position 383 is T, A, or C
' 20 rather than G, so that the colon at positions 381-383 encodes either
cysteine or is a stop colon rather than encoding tryptophan. Also
included in the present invention is a DNA molecule having a nucleotide
sequence that is identical to positions 105-1,409 of SEQ.ID.N0.:4 except
' that at least one of the nucleotides at position 381 or 382 has been
changed so that the colon at positions 381-383 does not encode
tryptophan.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to SEQ.ID.NO.:1 except that the
nucleotide at position 7,233 of SEQ.ID.NO.:1 is C, A, or G rather than T,
so that the colon at positions 7,233-7,235 does not encode tyrosine. Also
included in the present invention is a DNA molecule having a nucleotide
sequence that is identical to SEQ.ID.NO.:1 except that at least one of the
nucleotides at position 7,234 or 7,235 has been changed so that the colon
at positions 7,233-7,235 does not encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
- 10-

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
SEQ.ID.N0.:2 except that the nucleotide at position 357 is C, A, or G
rather than T, so that the codon at positions 357-359 does not encode
tyrosine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that at least one of the nucleotides at position 358 or
359 has been changed so that the codon at positions 35?-359 does not
encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that the nucleotide at position 357 is C, A, or G
rather than T, so that the codon at positions 357-359 does not encode
tyrosine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that at least one of the nucleotides at position 358 or
359 has been changed so that the codon at positions 357-359 does not
encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to SEQ.ID.NO.:1 except that the
nucleotide at position 3,330 is C rather than A. Also included in the
present invention is a DNA molecule having a nucleotide sequence that
is identical to SEQ.ID.NO.:1 except that the nucleotide at position 3,330 of
SEQ.ID.NO.:1 is G, C, or T rather than A, so that the codon at positions
3,330-3,332 does not encode threonine. Also included in the present
invention is a DNA molecule having a nucleotide sequence that is
identical to SEQ.ID.NO.:1 except that at least one of the nucleotides at
position 3,330 or 3,331 has been changed so that the codon at positions
3,330-3,332 does not encode threonine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 120 is C rather than
A. Also included in the present invention is a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 120 is G, C, or T
rather than A, so that the codon at positions 120-122 does not encode
threonine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,859 of
- 11-

CA 02321129 2000-08-16
WO 99/43695 PCT/tJS99/03790
SEQ.IDN0.:2 except that at least one of the nucleotides at position 120 or
121 has been changed so that the codon at positions 120-122 does not
encode threonine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that the nucleotide at position 120 is C rather than
A. Also included in the present invention is a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SE(a.ID.N0.:4 except that the nucleotide at position 120 is G, C, or T
rather than A, so that the codon at positions 120-122 does not encode
threonine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that at least one of the nucleotides at position 120 or
121 has been changed so that the codon at positions 120-122 does not
encode threonine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to SEQ.ID.NO.:1 except that the
nucleotide at position 8,939 is A rather than T. Also included in the
present invention is a DNA molecule having a nucleotide sequence that
is identical to SEQ.ID.NO.:1 except that the nucleotide at position 8,939 of
SEQ.ID.NO.:1 is A, G, or C, rather than T, so that the codon at positions
8,939-8,941 does not encode tyrosine. Also included in the present
invention is a DNA molecule having a nucleotide sequence that is
identical to SEQ.ID.NO.:1 except that at least one of the nucleotides at
position 8,939-8,941 has been changed so that the codon at positions 8,939-
8,941 does not encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 783 is A rather than
T, Also included in the present invention is a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 783 is A, G, or C
rather than T so that the codon at positions 783-785 does not encode
tyrosine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that at least one of the nucleotides at position ?83-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
785 has been changed so that the colon at positions 783-785 does not
encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that the nucleotide at position 783 is A rather than
T. Also included in the present invention is a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that the nucleotide at position 783 is A, G, or C
rather than T, so that the colon at positions 783-785 does not encode
tyrosine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,409 of
SEQ.ID.N0.:4 except that at least one of the nucleotides at position 783-
785 has been changed so that the colon at positions 783-785 does not
encode tyrosine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to SEQ.ID.NO.:1 except that the
nucleotide at position 11,241 is A rather than G. Also included in the
present invention is a DNA molecule having a nucleotide sequence that
is identical to SEfa.ID.N0.:1 except that the nucleotide at position 11,241
is A, C, or T, rather than G, so that the colon at positions 11,240-11,242
does not encode glycine. Also included in the present invention is a
DNA molecule having a nucleotide sequence that is identical to
SEQ.ID.N0.:1 except that at least one of the nucleotides at position 11,240
or 11,241 has been changed so that the colon at positions 11,240-11,242
does not encode glycine.
The present invention includes a DNA molecule having a
nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that the nucleotide at position 1,000 is A rather
than G. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,859 of
SE4~.ID.N0.:2 except that the nucleotide at position 1,000 is A, C, or T
rather than G, so that the colon at positions 999-1,001 does not encode
glycine. Also included in the present invention is a DNA molecule
having a nucleotide sequence that is identical to positions 105-1,859 of
SEQ.ID.N0.:2 except that at least one of the nucleotides at position 999 or
1,000 has been changed so that the colon at positions 999-1,001 does not
-13-

CA 02321129 2000-08-16
WO 99/43695 pGT/US99/03790
encode glycine. Another aspect of the present invention includes host
cells that have been engineered to contain and/or express DNA
sequences encoding CG1CE protein. Such recombinant host cells can be
cultured under suitable conditions to produce CG1CE protein. An
expression vector containing DNA encoding CG1CE protein can be used
for expression of CG1CE protein in a recombinant host cell.
Recombinant host cells may be prokaryotic or eukaryotic, including but
not limited to, bacteria such as E. coli, fungal cells such as yeast,
mammalian cells including, but not limited to, cell lines of human,
bovine, porcine, monkey and rodent origin, and insect cells including
but not limited to Drosophilac and silkworm derived cell lines. Cell lines
derived from mammalian species which are suitable for recombinant
expression of CG1CE protein and which are commercially available,
include but are not limited to, L cells L-M(TK-) (ATCC CCL 1.3), L cells
L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), R~ji (ATCC CCL 86), CV-1
(ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651),
CHO-Kl (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL
1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL
26) and MRC-5 (ATCC CCL 171).
A variety of mammalian expression vectors can be used to
express recombinant CG1CE in mammalian cells. Commercially
available mammalian expression vectors which are suitable include,
but are not limited to, pMClneo (Stratagene), pSGS (Stratagene),
pcDNAI and pcDNAIamp, pcDNA3, pcDNA3.1, pCR3.1 (Invitrogen),
EBO-pSV2-neo (ATCC 37593), pBPV-1(8-2) (ATCC 37110), pdBPV-
MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo
(ATCC 37198), and pSV2-dhfr (ATCC 37146). Following expression in
recombinant cells, CG1CE can be purified by conventional techniques to
a level that is substantially free from other proteins.
The present invention includes CG1CE protein
substantially free from other proteins. The amino acid sequence of the
full-length CG1CE protein is shown in Figure 3 as SEQ.ID.N0.:3. Thus,
the present invention includes CG1CE protein substantially free from
other proteins having the amino acid sequence SEQ.ID.N0.:3. Also
included in the present invention is a CG1CE protein that is produced
- 14-

CA 02321129 2000-08-16
WO 99/43695 PGTNS99/03790
from an alternatively spliced CG1CE mRNA where the protein has the
amino acid sequence shown in Figure 5 as SEQ.ID.N0.:5.
Mutated forms of CG1CE proteins are intended to be within
the scope of the present invention. In particular, mutated forms of
SEQ.ID.NOs.:3 and 5 that give rise to Best's macular dystrophy are
within the scope of the present invention. Accordingly, the present
invention includes a protein having the amino acid sequence shown in
Figure 3 as SEQ.ID.N0.:3 except that the amino acid at position 93 is
cysteine rather than tryptophan. The present invention also includes a
protein having the amino acid sequence shown in Figure 5 as
SEQ.ID.N0.:5 except that the amino acid at position 93 is cysteine rather
than tryptophan. The present invention includes a protein having the
amino acid sequence shown in Figure 3 as SEQ.ID.N0.:3 except that the
amino acid at position 93 is not tryptophan. The present invention also
includes a protein having the amino acid sequence shown in Figure 5 as
SEQ.ID.N0.:5 except that the amino acid at position 93 is not tryptophan.
The present invention includes a protein having the amino
acid sequence shown in Figure 3 as SEQ.ID.N0.:3 except that the amino
acid at position 85 is histidine rather than tyrosine. The present
invention also includes a protein having the amino acid sequence shown
in Figure 5 as SEQ.ID.N0.:5 except that the amino acid at position 85 is
histidine rather than tyrosine. The present invention includes a protein
having the amino acid sequence shown in Figure 3 as SEQ.ID.N0.:3
except that the amino acid at position 85 is not tyrosine. The present
invention also includes a protein having the amino acid sequence shown
in Figure 5 as SEQ.ID.N0.:5 except that the amino acid at position 85 is
not tyrosine.
The present invention includes a protein having the amino
acid sequence shown in Figure 3 as SEQ.ID.N0.:3 except that the amino
acid at position 6 is proline rather than threonine. The present
invention also includes a protein having the amino acid sequence shown
in Figure 5 as SEQ.ID.N0.:5 except that the amino acid at position 6 is
proline rather than threonine. The present invention includes a protein
having the amino acid sequence shown in Figure 3 as SEQ.ID.N0.:3
except that the amino acid at position 6 is not threonine. The present
invention also includes a protein having the amino acid sequence shown
-15-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
in Figure 5 as SEQ.ID.N0.:5 except that the amino acid at position 6 is
not threonine.
The present invention includes a protein having the amino
acid sequence shown in Figure 3 as SEQ.ID.N0.:3 except that the amino
acid at position 227 is asparagine rather than tyrosine. The present
invention also includes a protein having the amino acid sequence shown
in Figure 5 as SEQ.ID.N0.:5 except that the amino acid at position 227 is
asparagine rather than tyrosine. The present invention includes a
protein having the amino acid sequence shown in Figure 3 as
SEQ.ID.N0.:3 except that the amino acid at position 227 is not tyrosine.
The present invention also includes a protein having the amino acid
sequence shown in Figure 5 as SEQ.ID.N0.:5 except that the amino acid
at position 227 is not tyrosine.
The present invention includes a protein having the amino
and sequence shown in Figure 3 as SEQ.ID.N0.:3 except that the amino
acid at position 299 is glutamate rather than glycine. The present
invention includes a protein having the amino acid sequence shown in
Figure 3 as SEQ.ID.N0.:3 except that the amino acid at position 299 is
not glycine. As with many proteins, it is possible to modify many of the
amino acids of CG1CE and still retain substantially the same biological
activity as the original protein. Thus, the present invention includes
modified CG1CE proteins which have amino acid deletions, additions, or
substitutions but that still retain substantially the same biological
activity as CG1CE. It is generally accepted that single amino acid
substitutions do not usually alter the biological activity of a protein (see,
e.g., Moleci la_,- l3ioloy of the Gene. Watson et al., 1987, Fourth Ed., The
Benjamin/Cummings Publishing Co., Inc., page 226; and Cunningham
& Wells, 1989, Science 244:1081-1085). Accordingly, the present invention
includes polypeptides where one amino acid substitution has been made
in SEQ.ID.NOs.:3 or 5 wherein the polypeptides still retain substantially
the same biological activity as CG1CE. The present invention also
includes polypeptides where two amino acid substitutions have been
made in SE(d.ID.NOs.:3 or 5 wherein the polypeptides still retain
substantially the same biological activity as CG1CE. In particular, the
present invention includes embodiments where the above-described
substitutions are conservative substitutions. In particular, the present
- 16-

CA 02321129 2000-08-16
WO 99/43695 pCTNS99J03790
invention includes embodiments where the above-described
substitutions do not occur in positions where the amino acid present in
CG1CE is also present in one of the C. elegans proteins whose partial
sequence is shown in Figure 7.
The CG1CE proteins of the present invention may contain
post-translational modifications, e.g., covalently linked carbohydrate.
The present invention also includes chimeric CG1CE
proteins. Chimeric CG1CE proteins consist of a contiguous polypeptide
sequence of at least a portion of a CG1CE protein fused to a polypeptide
sequence of a non- CG1CE protein.
The present invention also includes isolated forma of
CG1CE proteins and CG1CE DNA. By "isolated CG1CE protein" or
"isolated CG1CE DNA" is meant CG1CE protein or DNA encoding
CG1CE protein that has been isolated from a natural source. Use of the
term "isolated" indicates that CG1CE protein or CG1CE DNA has been
removed from its normal cellular environment. Thus, an isolated
CG1CE protein may be in a cell-free solution or placed in a different
cellular environment from that in which it occurs naturally. The Term
isolated does not imply that an isolated CG1CE protein is the only protein
present. but instead means that an isolated CG1CE protein is at least
95°6 free of non-amino acid material (e.g., nucleic acids, lipids,
carbohydrates) naturally associated with the CG1CE protein. Thus, a
CG1CE protein that is ezpresaed in bacteria or even in eukaryotic cells
which do not naturally (i.e., without human intervention) ezpreas it
through recombinant means is an "isolated CG1CE protein."
A cDNA fragment encoding full-length CG1CE can be
isolated from a human retinal cell cDNA library by using the
polymerase chain reaction (PCR) employing suitable primer pairs.
Such primer pairs can be selected based upon the cDNA sequence for
CG1CE shown in Figure 2 as SEQ.ID.N0.:2 or in Figure 4 as
SEQ.ID.N0.:4. Suitable primer pairs would be, e.g.:
CAGGGAGTCCCACCAGCC (SEQ.ID.N0.:6) and
TCCCCATTAGGAAGCAGG (SEQ.ID.N0.:7)
for SEG~,1.ID.N0.:2; and
CAGGGAGTCCCACCAGCC (SEQ.ID.N0.:6) and
TCTCCTCTTTGTTCAGGC (SEQ.ID.N0.:8)
- 17-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
for SEQ.ID.N0.:4.
PCR reactions can be carried out with a variety of
thermostable enzymes including but not limited to AmpliTaq, AmpliTaq
Gold, or Vent polymerase. For AmpliTaq, reactions can be carried out
in 10 mM Tris-Cl, pH 8.3, 2.0 mM MgCl2, 200 ~M for each dNTP, 50 mM
KCl, 0.2 N,M for each primer, 10 ng of DNA template, 0.05 unitsJN.l of
AmpliTaq. The reactions are heated at 95°C for 3 minutes and then
cycled 35 times using the cycling parameters of 95°C, 20 seconds,
62°C,
20 seconds, 72°C, 3 minutes. In addition to these conditions, a variety
of
suitable PCR protocols can be found in PCR Primer. A Laboratory
edited by C.W. Diefi'enbach and G.S. Dveksler, 1995, Cold
Spring Harbor Laboratory Press; or PCR Protocols: A Guide to Methods
and Applications. Michael et al., eds., 1990, Academic Press .
A suitable cDNA library from which a clone encoding
CG1CE can be isolated would be Human Retina 5'-stretch cDNA library
in lambda gtl0 or lambda gtll vectors (catalog numbers HL1143a and
HL1132b, Clontech, Palo Alto, CA). The primary clones of such a library
can be subdivided into pools with each pool containing approximately
20,000 clones and each pool can be amplified separately.
By this method, a cDNA fragment encoding an open
reading frame of 585 amino acids (SEf~.ID.N0.:3) or an open reading
frame of 435 amino acids (SEQ.ID.NO.:S) can be obtained. This cDNA
fragment can be cloned into a suitable cloning vector or expression
vector. For example, the fragment can be cloned into the mannmalian
expression vector pcDNA3.1 (Invitrogen, San Diego, Ca). CG1CE
protein can then be produced by transferring an expression vector
encoding CG1CE or. portions thereof into a suitable host cell and growing
the host cell under appropriate conditions. CG1CE protein can then be
isolated by methods well known in the art.
As an alternative to the above-described PCR method, a
cDNA clone encoding CG1CE can be isolated from a cDNA library using
as a probe oligonucleotides specific for CG1CE and methods well known
in the art for screening cDNA libraries with oligonucleotide probes.
Such methods are described in, e.g., Sambrook et al., 1989, Molecular
Cloning: A Lacborntory Manual; Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York; Glover, D.M. (ed.), 1985, DNA Cloning: A
_ 18_

CA 02321129 2000-08-16
WO 99/43695 PCT/US99I03790
Practical Approach, MRL Press, Ltd., Oxford, U.K., Vol. I, II.
Oligonucleotides that are specific for CG1CE and that can be used to
screen cDNA libraries can be readily designed based upon the cDNA
sequence of CG1CE shown in Figure 2 as SEG.~.ID.N0.:2 or in Figure 4 as
SEQ.ID.N0.:4 and can be synthesized by methods well-known in the art.
Genomic clones containing the CG1CE gene can be obtained
from commercially available human PAC or BAC libraries available
from Research Genetics, Huntsville, AL. PAC clones containing the
CG1CE gene (eg., PAC 759J12, PAC 466A11) are commercially available
from Research Genetics, Huntsville, AL (Catalog number for individual
PAC clones is RPCLC). Alternatively, one may prepare genomic
libraries, especially in P1 artificial chromosome vectors, from which
genomic clones containing the CG1CE can be isolated, using probes
based upon the CG1CE sequences disclosed herein. Methods of
preparing such libraries are known in the art (Ioannou et a1.,1994,
Nature Genet. 6:84-89).
The novel DNA sequences of the present invention can be
used in various diagnostic methods relating to Beat's macular
dystrophy. The present invention provides diagnostic methods for
determining whether a patient carries a mutation in the CG1CE gene
that predisposes that patient toward the development of Best's macular
dystrophy. In broad terms, such methods comprise determining the
DNA sequence of a region of the CG1CE gene from the patient and
comparing that sequence to the sequence from the corresponding region
of the CG1CE gene from a normal person, i.e., a person who does not
suffer from Best's macular dystrophy.
Such methods of diagnosis may be carried out in a variety of
ways. For example, one embodiment comprises:
(a) providing PCR primers from a region of the CG1CE
gene where it is suspected that a patient harbors a mutation in the
CG1CE gene;
(b) performing PCR on a DNA sample from the patient
to produce a PCR fragment from the patient;
(c) performing PCR on a control DNA sample having a
nucleotide sequence selected from the group consisting of
SEQ.ID.NOs.:l, 2 and SEQ.ID.N0.:4 to produce a control PCR fragment;
-19-

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
(d) determining the nucleotide sequence of the PCR
fragment from the patient and the nucleotide sequence of the control
PCR fragment;
(e) comparing the nucleotide sequence of the PCR
S fragment from the patient to the nucleotide sequence of the control PCR
fragment;
where a difference between the nucleotide sequence of the
PCR fragment from the patient and the nucleotide sequence of the
control PCR fragment indicates that the patient has a mutation in the
CG1CE gene.
In a particular embodiment, the PCR primers are from the
coding region of the CG1CE gene, i.e., from the coding region of
SEQ.ID.NOs.:l, 2, or 4.
In a particular embodiment, the DNA sample from the
patient is cDNA that has been prepared from an RNA sample from the
patient. In another embodiment, the DNA sample from the patient is
genomic DNA.
In a particular embodiment, the nucleotide sequences of the
PCR fragment from the patient and the control PCR fragment are
determined by DNA sequencing.
In a particular embodiment, the nucleotide sequences of the
PCR fragment from the patient and the control PCR fragment are
compared by direct comparison after DNA sequencing. In another
embodiment, the comparison is made by a process that includes
hybridizing the PCR fragment from the patient and the control PCR
fragment and then using an endonuclease that cleaves at any
mismatched positions in the hybrid but does not cleave the hybrid if the
two fragments match perfectly. Such an endonuclease is, e.g., S1. In
this embodiment, the conversion of the PCR fragment from the patient to
smaller fragments after endonuclease treatment indicates that the
patient carries a mutation in the CG1CE gene. In such embodiments, it
may be advantageous to label (radioactsvely, enzymatically,
immunologically, etc. ) the PCR fragment from the patient or the control
PCR fragment.
The present invention provides a method of diagnosing
whether a patient carries a mutation in the CG1CE gene that comprises:
_ Zp _

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
(a) obtaining an RNA sample from the patient;
(b) performing reverse transcription-PCR (RT-PCR) on
the RNA sample using primers that span a region of the coding
sequence of the CG1CE gene to produce a PCR fragment from the patient
where the PCR fragment from the patient has a defined length, the
length being dependent upon the identity of the primers that were used
in the RT-PCR;
(c) hybridizing the PCR fragment to DNA having a
sequence selected from the group consisting of SEfa.ID.NOs.:l, 2 and
SEQ.ID.N0.:4 to form a hybrid ;
(d) treating the hybrid produced in step (c) with an
endonuclease that cleaves at any mismatched positions in the hybrid but
does not cleave the hybrid if the two fragments match perfectly;
(e) determining whether the endonuclease cleaved the
hybrid by determining the length of the PCR fragment from the patient
after endonuclease treatment where a reduction in the length of the PCR
fragment from the patient after endonuclease treatment indicates that
the patient carries a mutation in the CG1CE gene.
The present invention provides a method of diagnosing
whether a patient carries a mutation in the CG1CE gene that comprises:
(a) making cDNA from an RNA sample from the
patient;
(b) providing a set of PCR primers based upon
SEQ.ID.N0.:2 or SEQ.ID.N0.:4;
(c) performing PCR on the cDNA to produce a PCR
fragment from the patient;
(d) determining the nucleotide sequence of the PCR
fragment from the patient;
(e) comparing the nucleotide sequence of the PCR
fragment from the patient with the nucleotide sequence of SEfa.ID.N0.:2
or SEQ.ID.N0.:4;
where a difference between the nucleotide sequence of the
PCR fragment from the patient with the nucleotide sequence of
SEf~.ID.N0.:2 or SEQ.ID.N0.:4 indicates that the patient carries a
mutation in the CG1CE gene.
-21-

CA 02321129 2000-08-16
WO 99/43695 PGT/US99/03790
The present invention provides a method of diagnosing
whether a patient carries a mutation in the CG1CE gene that comprises:
(a) preparing genomic DNA from the patient;
(b) providing a set of PCR primers based upon
SEQ.ID.NO.:1, SEQ.ID.N0.:2, or SEQ.ID.N0.:4;
(c) performing PCR on the genomic DNA to produce a
PCR fragment from the patient;
(d) determining the nucleotide sequence of the PCR
fragment from the patient;
(e) comparing the nucleotide sequence of the PCR
fragment from the patient with the nucleotide sequence of SEQ.ID.N0.:2
or SEQ.ID.N0.:4;
where a difference between the nucleotide sequence of the
PCR fragment from the patient with the nucleotide sequence of
SEQ.ID.N0.:2 or SEQ.ID.N0.:4 indicates that the patient carries a
mutation in the CG1CE gene.
In a particular embodiment, the primers are selected so
that they amplify a portion of SEQ.ID.NOs.:2 or 4 that includes at least
one position selected from the group consisting of positions 120, 121, 122,
357, 358, 359, 381, 382, 383, 783, 784, and 785. In another embodiment, the
primers are selected so that they amplify a portion of SEQ.ID.NOs.:2 or 4
that includes at least one position selected from the group consisting of
positions 384, 385, and 386. In another embodiment, the primers are
selected so that they amplify a portion of SEQ.ID.N0.:2 that includes at
least one position selected from the group consisting of positions 999,
1,000, and 1,001. In another embodiment, the primers are selected so
that they amplify a portion of SEQ.ID.NOs.:2 or 4 that includes at least
one codon that encodes an amino acid present in CG1CE that is also
present in the corresponding position in at least one of the C. elegans
proteins whose partial amino acid sequence is shown in Figure 7.
In a particular embodiment, the present invention provides
a diagnostic method for determining whether a person carries a
mutation of the CG1CE gene in which the G at position 383 of
SEQ.ID.N0.:2 has been changed to a C. This change results in the
creation of a Fnu4HI restriction site. By amplifying a PCR fragment
spanning position 383 of SEQ.ID.N0.:2 from DNA or cDNA prepared

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
from a person, digesting the PCR fragment with Fnu4HI, and
visualizing the digestion products, e.g., by SDS-PAGE, one can easily
determine if the person carries the G383C mutation. For example, one
could use the PCR primer pair 5'-CTCCTGCCCAGGCTTCTAC-3'
(SEQ.ID.N0.:30) and 5'-CTTGCTCTGCCTTGCCTTC-3' (SEQ.ID.N0.:31)
to amplify a 125 base pair fragment. Heterozygotea for the G383C
mutation have three Fnu4HI digestion products: 125 bp, 85 bp, and 40 bp;
homozygotes have two: 85 by and 40 bp; and wild-type individuals have a
single fragment of 125 bp.
In a particular embodiment, the present invention provides
a diagnostic method for determining whether a person carries a
mutation of the CG1CE gene in which the T at position ?83 of
SEQ.ID.N0.:2 has been changed to an A. This change results in the
creation of a PfIMI restriction site. By amplifying a PCR fragment
spanning position 783 of SEQ.ID.N0.:2 from DNA or cDNA prepared
from a person, digesting the PCR fragment with PflMI, and visualizing
the digestion products, e.g., by SDS-PAGE, one can easily determine if
the person carries the T783A mutation.
The present invention also provides oligonucleotide probes,
based upon the sequences of SEQ.ID.NOs.:l, 2, or 4, that can be used in
diagnostic methods related to Beat's macular dystrophy. In particular,
the present invention includes DNA oligonucleotides comprising at least
18 contiguous nucleotides of at least one of a sequence selected from the
group consisting of SEQ.ID.NOs.:l, 2 and SEQ.ID.:N0.4. Also provided
by the present invention are corresponding RNA oligonucleotides. The
DNA or RNA oligonucleotide probes can be packaged in kits.
In addition to the diagnostic utilities described above, the
present invention makes possible the recombinant expression of the
CG1CE protein in various cell types. Such recombinant expression
makes possible the study of this protein so that its biochemical activity
and its role in Best's macular dystrophy can be elucidated.
The present invention also makes possible the development
of assays which measure the biological activity of the CG1CE protein.
Such assays using recombinantly expressed CG1CE protein are
especially of interest. Assays for CG1CE protein activity can be used to
screen libraries of compounds or other sources of compounds to identify

CA 02321129 2000-08-16
WO 99/43695 pCT/US99/03790
compounds that are activators or inhibitors of the activity of CG1CE
protein. Such identified compounds can serve as "leads" for the
development of pharmaceuticals that can be used to treat patients
having Best's macular dystrophy. In versions of the above-described
assays, mutant CG1CE proteins are used and inhibitors or activators of
the activity of the mutant CG1CE proteins are discovered.
Such assays comprise:
(a) recombinantly expressing CG1CE protein or mutant
CG1CE protein in a host cell;
(b) measuring the biological activity of CG1CE protein or
mutant CG1CE protein in the presence and in the absence of a substance
suspected of being an activator or an inhibitor of CG1CE protein or
mutant CG1CE protein;
where a change in the biological activity of the CGICE
protein or the mutant CG1CE protein in the presence as compared to the
absence of the substance indicates that the substance is an activator or
an inhibitor of CG1CE protein or mutant CG1CE protein.
The present invention also includes antibodies to the
CG1CE protein. Such antibodies may be polyclonal antibodies or
monoclonal antibodies. The antibodies of the present invention are
raised against the entire CG1CE protein or against suitable antigenic
fragments of the protein that are coupled to suitable carriers, e.g.,
serum albumin or keyhole limpet hemocyanin, by methods well known
in the art. Methods of identifying suitable antigenic fragments of a
protein are known in the art. See, e.g., Hopp & Woods, 1981, Proc. Natl.
Acad. Sci. USA 78:3824-3828; and Jameson & Wolf, 1988, CABIOS
(Computer Applications in the Biosciences) 4:181-186.
For the production of polyclonal antibodies, CG1CE protein
or an antigenic fragment, coupled to a suitable carrier, is injected on a
periodic basis into an appropriate non-human host animal such as, e.g.,
rabbits, sheep, goats, rats, mice. The animals are bled periodically and
sera obtained are tested for the presence of antibodies to the injected
antigen. The injections can be intramuscular, intraperitoneal,
subcutaneous, and the like, and can be accompanied with adjuvant.
For the production of monoclonal antibodies, CG1CE
protein or an antigenic fragment, coupled to a suitable carrier, is

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
injected into an appropriate non-human host animal as above for the
production of polyclonal antibodies. In the case of monoclonal
antibodies, the animal is generally a mouse. The animal's spleen cells
are then immortalized, often by fusion with a myeloma cell, as described
in Kohler & Milstein, 1975, Nature 256:495-497. For a fuller description
of the production of monoclonal antibodies, see Antibodies: A Laboratory
Harlow & Lane, eds., Cold Spring Harbor Laboratory Press,
1988.
Gene therapy may be used to introduce CG1CE polypeptides
into the cells of target organs, e.g., the pigmented epithelium of the
retina or other parts of the retina. Nucleotides encoding CG1CE
polypeptides can be ligated into viral vectors which mediate transfer of
the nucleotides by infection of recipient cells. Suitable viral vectors
include retrovirus, adenovirus, adeno-associated virus, herpes virus,
vaccinia virus, and polio virus based vectors. Alternatively, nucleotides
encoding CG1CE polypeptides can be transferred into cells for gene
therapy by non-viral techniques including receptor-mediated targeted
transfer using ligand-nucleotide conjugates, lipofection, membrane
fusion, or direct microinjection. These procedures and variations
thereof are suitable for ex vivo as well as ire vivo gene therapy. Gene
therapy with CG1CE polypeptides will be particularly useful for the
treatment of diseases where it is beneficial to elevate CG1CE activity.
The present invention includes DNA comprising
nucleotides encoding mouse CG1CE. Included within such DNA is the
DNA sequence shown in Figure 8A-C (SEQ. ID. N0.:28). Also included
is DNA comprising positions 11-1,663 of SEQ. ID. N0.:28. Also included
are mutant versions of DNA encoding mouse CG1CE. Included is DNA
comprising nucleotides that are identical to positions 11-1,663 of SEQ.
ID. N0.:28 except that at least one of the nucleotides at positions 2fi-28,
positions 263-265, positions 287-289, positions 689-691, and/or positions
905-907 differs from the corresponding nucleotide at positions 26-28,
positions 263-265, positions 287-289, positions 689-691, and/or posiiaona
905-907 of SEQ. ID. N0.:28. Particularly preferred versions of mutant
DNAs are those in which the nucleotide change results in a change in
the corresponding encoded amino acid. The DNA encoding mouse
_ ~r _

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
CG1CE can be in isolated form, can be substantially free from other
nucleic acids, and/or can be recombinant DNA.
The present invention includes mouse CG1CE protein (SEQ.
ID. N0.:29). This mouse CG1CE protein can be in isolated form and/or
can be sustantially free from other proteins. Mutant versions of mouse
CG1CE protein are also part of the present invention. Examples of such
mutant mouse CG1CE proteins are proteins that are identical to SEQ.
ID. N0.:29 except that the amino acid at position 6, position 85, position
93, position 227, and/or position 299 differs from the corresponding
amino acid at position 6, position 85, position 93, position 227, and/or
position 299 in SEQ. ID. N0.:29.
cDNA encoding mouse CG1CE can be amplified by PCR
from cDNA libraries made from mouse eye or mouse testis. Suitable
primers can be readily designed based upon SEQ. ID. N0.:28.
Alternatively, cDNA encoding mouse CG1CE can be isolated from cDNA
libraries made from mouse eye or mouse testis by the use of
oligonucleotide probes based upon SEQ. ID. N0.:28.
In situ hybridization studies demonstrated that mouse
CG1CE is specifically expressed in the retinal pigmented epithelium
(see Figure 10).
By providing DNA encoding mouse CG1CE, the present
invention allows for the generation of an animal model of Beat's
macular dystrophy. This animal model can be generated by making
"knockout" or "knockin" mice containing altered CG1CE genes.
Knockout mice can be generated in which portions of the mouse CG1CE
gene have been deleted. Knockin mice can be generated in which
mutations that have.been shown to lead to Best's macular dystrophy
when present in the human CG1CE gene are introduced into the mouse
gene. In particular, mutations resulting in changes in amino acids 6,
85, 93, 227, or 299 of the mouse CG1CE protein (SEf~.ID.N0.:29) are
contemplated. Such knockout and knockin mice will be valuable tools in
the study of the Best's macular dystrophy disease process and will
provide important model systems in which to test potential
pharmaceuticals or treatments for Beat's macular dystrophy.
Methods of producing knockout and knockin mice are
well known in the art. For example, the use of gene-targeted ES cells

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
in the generation of gene-targeted transgenic knockout mice is
described in, e.g., Thomas et al., 1987, Cell 51:503-512, and is
reviewed elsewhere (Frohman et al., 1989, Cell 56:145-147; Capecchi,
1989, Trends in Genet. 5:70-76; Baribault et al., 1989, Mol. Biol. Med.
6:481-492).
Techniques are available to inactivate or alter any
genetic region to virtually any mutation desired by using targeted
homologous recombination to insert specific changes into
chromosomal genes. Generally, use is made of a "targeting vector,"
i.e., a plasmid containing part of the genetic region it is desired to
mutate. By virtue of the homology between this part of the genetic
region on the plasmid and the corresponding genetic region on the
chromosome, homologous recombination can be used to insert the
plasmid into the genetic region, thus disrupting the genetic region.
Usually, the targeting vector contains a selectable marker gene as
well.
In comparison with homologous extrachromosomal
recombination, which occurs at frequencies approaching 100%,
homologous plasmid-chromosome recombination was originally
reported to only be detected at frequencies between 10-6 and 10-3 (Lin
et al., 1985, Proc. Natl. Acad. Sci. USA 82:1391-1395; Smithies et al.,
1985, Nature 317: 230-234; Thomas et al.,1986, Cell 44:419-428).
Nonhomologous plasmid-chromosome interactions are more
frequent, occurring at levels 105-fold (Lin et al., 1985, Proc. Natl.
Acad. Sci. USA 82:1391-1395) to 102-fold (Thomas et al.,1986, Cell
44:419-428) greater than comparable homologous insertion.
To overcome this low proportion of targeted
recombination in marine ES cells, various strategies have been
developed to detect or select rare homologous recombinants. One
approach for detecting homologous alteration events uses the
polymerase chain reaction (PCR) to screen pools of transformant
cells for homologous insertion, followed by screening individual
clones (Kim et al., 1988, Nucleic Acids Res. 16:8887-8903; Kim et al.,
1991, Gene 103:227-233). Alternatively, a positive genetic selection
approach has been developed in which a marker gene is constructed
which will only be active if homologous insertion occurs, allowing
_ 27 -

CA 02321129 2000-08-16
WO 99/43695
PCT/US99J03790
these recombinants to be selected directly (Sedivy et al.,1989, Proc.
Natl. Acad. Sci. USA 86:227-231). One of the most powerful
approaches developed for selecting homologous recombinants is the
positive-negative selection (PNS) method developed for genes for
which no direct selection of the alteration exists (Mansour et al.,
1988, Nature 336:348-352; Capecchi, 1989, Science 244:1288-1292;
Capecchi, 1989, Trends in Genet. 5:70-76). The PNS method is more
efficient for targeting genes which are not expressed at high levels
because the marker gene has its own promoter. Nonhomologous
recombinants are selected against by using the Herpes Simplex virus
thymidine kinase (HSV-TK) gene and selecting against its
nonhomologous insertion with herpes drugs such as gancyclovir
(GANC) or FIAU (1-(2-deoxy 2-fluoro-B-D-arabinofluranosyl~5-
iodouracil). By this counter-selection, the percentage of homologous
recombinants in the surviving transformants can be increased.
The following non-limiting examples are presented to better
illustrate the invention.
EXAMPLE 1
Construction of Libraries for Shot un S uencin
Bacterial strains containing the BMD PACs (P1 Artificial
Chromosomes) were received from Research Genetics (Huntsville, AL).
The minimum tiling path between markers D11S4076 and UGB that
represents the minimum genetic region containing the BMD gene
includes the following nine PAC clones: 363M5 (140 kb), 519013(120 kb),
527E4 (150 kb), 688P12 (140 kb), 741N15 (170 kb), 756B9 (120 kb), 759~J12 (140
kb),1079D9 (170 kb), and 363P2 (160 kb). Cells were streaked on Luria-
Bertani (LB) agar plates supplemented with the appropriate antibiotic.
A single colony was picked up and subjected to colony-PCR analysis with
corresponding STS primers described in Cooper et al., 1997, Genomics
41:185-192 to confirm the authenticity of PAC clones. A single positive
colony was used to prepare a 5-ml starter culture and then 1-L overnight
_ 2g _

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
culture in LB medium. The cells were pelleted by centrifugation and
PAC DNA was purified by equilibrium centrifugation in cesium
chloride-ethidium bromide gradient (Sambrook, Fritach, and Maniatis,
1989, Molecular Cloning. A Lal~oratQrv Manual, second edition, Cold
Spring Harbor Laboratory Press). Purified PAC DNA was brought to 50
mM Tris pH 8.0, 15 mM MgCl2, and 25% glycerol in a volume of 2 ml
and placed in a AERO-MIST nebulizer (CIS-US, Bedford, MA). The
nebulizer was attached to a nitrogen gas source and the DNA was
randomly sheared at 10 psi for 30 sec. The sheared DNA was ethanol
precipitated and resuspended in TE ( 10 mM Tris, 1 mM EDTA). The
ends were made blunt by treatment with Mung Bean Nuclease
(Promega, Madison, WI) at 30°C for 30 min, followed by
phenol/chloroform extraction, and treatment with T4 DNA polymerase
(GIBCO/BRL, Gaithersburg, MD) in multicore bufi'er (Promega,
Madison, WI) in the presence of 40 uM dNTPa at 16°C. To facilitate
subcloning of the DNA fragments, BstX I adapters (Invitrogen,
Carlsbad, CA) were ligated to the fragments at 14°C overnight with
T4
DNA ligase (Promega, Madison, WI). Adapters and DNA fragments
less than 500 by were removed by column chromatography using a
cDNA sizing column (GTBCO/BRL, Gaithersburg, MD) according to the
instructions provided by the manufacturer. Fractions containing DNA
greater than 1 kb were pooled and concentrated by ethanol precipitation.
The DNA fragments containing BatX I adapters were ligated into the
BstX I sites of pSHOT II which was constructed by subcloning the BstX I
sites from pcDNA II (Invitrogen, Carlabad, CA) into the Bases II sites of
pBlueScript (Stratagene, La Jolla, CA). pSHOT II was prepared by
digestion with BstX I restriction endonuclease and purified by agarose
gel electrophoresis. The gel purified vector DNA was extracted from the
agaroae by following the Prep-A-Gene (BioRad, Richmond, CA) protocol.
To reduce ligation of the vector to itself, the digested vector was treated
with calf intestinal phosphatase (GIBCO/BRL, Gaithersburg, MD.
Ligation reactions of the DNA fragments with the cloning vector were
transformed into ultra-competent XL-2 Blue cells (Stratagene, La Jolla,
CA), and plated on LB agar plates supplemented with 100 ~,g/ml
ampicillin. Individual colonies were picked into a 96 well plate
containing 100 ~,1/well of LB broth supplemented with ampicillin and
_ 2g _

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
grown overnight at 37°C. Approximately 25 ~.1 of 80% sterile glycerol
was added to each well and the cultures stored at -80°C.
Preparation of nlasmid DNA
Glycerol stocks were used to inoculate 5 ml of LB broth
supplemented with 100 ~.g/ml ampicillin either manually or by using a
Tecan Genesis RSP 150 robot (Tecan AG, Hombrechtikon, Switzerland)
programmed to inoculate 96 tubes containing 5 ml broth from the 96
wells. The cultures were grown overnight at 37°C with shaking to
provide aeration. Bacterial cells were pelleted by centrifugation , the
supernatant decanted, and the cell pellet stored at -20°C. Plasmid DNA
was prepared with a QIAGEN Bio Robot 9600 (QIAGEN, Chataworth,
CA) according to the Qiawell Ultra protocol. To test the frequency and
size of inserts, plasmid DNA was digested with the restriction
endonuclease Pvu II. The size of the restriction endonuclease products
was examined by agarose gel electrophoresis with the average insert
size being 1 to 2 kb.
DNA Seauenc-a A_~al_vsis of Shot~m rt~..o~
DNA sequence analysis was performed using the ABI
PRISMT"' dye terminator cycle sequencing ready reaction kit with
AmpliTaq DNA polymerase, FS (Perkin Elmer, Norwalk, CT). DNA
sequence analysis was performed with M13 forward and reverse
primers. Following amplification in a Perkin-Elmer 9600, the extension
products were purified and analyzed on an ABI PRISM 377 automated
sequencer (Perkin Elmer, Norwalk, CT). Approximately 4 sequencing
reactions were performed per kb of DNA to be examined (384 sequencing
reactions per each of nine PACs).
Phred/Phrap was used for DNA sequences assembly. This
program was developed by Dr. Phil Green and licensed from the
University of Washington (Seattle, WA). Phred/Phrap consists of the
following programs: Phred for base-calling, Phrap for sequence
assembly,, Crossmatch for sequence comparisons, Consed and
- 30 -

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
Phrapview for visualization of data, Repeatmasker for screening
repetitive sequences. Vector and E. coli DNA sequences were identified
by Croasmatch and removed from the DNA sequence assembly process.
DNA sequence assembly was on a SUN Enterprise 4000 server running
a Solaria 2.51 operating system (Sun Microsystems Inc., Mountain
View, CA) using default Phrap parameters. The sequence assemblies
were further analyzed using Consed and Phrapview.
Identification of new microsate lit. genetic m;t~rkers from the Best's
macular dvstrogj~,v re ' on
Isolation of CA microsatellites from PAC-specific
sublibraries, Southern blotting and hybridization of PAC DNA with a
(dC-dA)"~(dG-dT)" probe (Pharmacia Biotech, Uppsala, Sweden) was
used to confirm the presence of CA repeats in nine PAC clones that
represent a minimum tiling path. Shotgun PAC-specific sublibraries
were constructed from DNA of all 9 PAC clones using a protocol
described above. The sublibraries were plated on agar plates, and
colonies were transfered to nylon membranes and probed with randomly
primed polynucleotide, (dC-dA)n (dG-dT)n, Hybridization was
performed overnight in a solution containing 6X SSC, 20 mM sodium
phosphate buffer (pH 7.0), 1°k bovine serum albumin, and 0,2°k
sodium
dodecyl sulfate at 65°C. Filters were washed four times for 15 min each
in 2X SSC and 0.2°6 SDS at 65°C. CA-positive subclones were
identified
for all but one PAC clone (527E4). DNA from these subclones was
isolated and sequenced as descrobed above for the shotgun library
clones.
Identification of simple repeat sequences in assembled
DNA sequences. DNA sequence at the final stage of assembly was
checked for the presence of microsatellite repeats using a Consed
visualization tool of the Phred/Phrap package.
Polvmornhism a_nalvsis and re~'.nmhins~tinn mane
Sequence fragments containing CA repeats were analyzed
using the PRIMER program; oligonucleotide pairs flanking each of the
CA repeats were synthesized. The forward primer was kinase-labeled
with (gamma-32P]-ATP. Amplification of the genomic DNA was
-31-

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
peformed in a total volume of 10 El containing 5 ng/El of genomic DNA;
mM Tris-HCl pH 8.3; 1.5 mM MgCl2 ; 50 mMKCl; 0.01% gelatin; 200
EM dNTPs; 0.2 pmol/El of both primers; 0.025 unitJEl of Taq polymerase.
The PCR program consisted of 94° C for 3 min followed by 30 cycles
of
5 94°C for 1 min, 55°C for 2 min, 72°C for 2 min and a
final elongation step
at 72°C for 10 min. Following amplification, samples were mixed with 2
vol of a formamide dye solution and run on a 6% polyacrylamide
sequencing gel. Two newly identified markers detected two
recombination events in disease chromosomes of individuals from
10 family S 1. This limited the minimum genetic region to the interval
covered by 6 PAC clones: 519013, 759J12, ?56B9, 363M5, 363P2, and
741N15.
Identification of the retina-s~~ecific EST lit i_n_ the nCA7591'12-2 clone
A CA-positive subclone (pCA759J12-2) was identified in the
shotgun library generated from the PAC ?59j12 DNA by hybridization to
the (dC-dA)n (dG-dT)n probe. DNA sequence from pCA759J12-2 was
queried against the EST sequences in the GenBank database using the
BLAST algorithm (S.F. Altschul, et al., 1990, J. Mol. Biol. 215:403-410).
The BLAST analysis identified a high degree of similarity between the
DNA sequence obtained from the clone pCA759J12-2 and a retina-
specific human EST with GenBank accession number AA318352.
BLASTX analysis of EST AA318352 revealed a strong homology of the
corresponding protein to a group of C. elegans proteins with unknown
function (RFP family). The RFP family is known only from C. elegans
genome and EST sequences (e.g., C. elegans C29F4.2 and 80564.3) and is
named for the amino acid sequence R,FP that is invariant among 15 of
the 16 family members; members share a conserved 300-400 amino acid
sequence including 25 highly conserved aromatic residues.
A human gene partially represented in pCA759J12-2 and
EST AA318352 was dubbed CG1CE (candidate gene #~, with the
homology to the ,~. glegans grnup of genes) and selected for detaled
analysis.
- 32 -

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
When the assembled DNA sequences from the nine BMD
PACs approached 0.5-1-fold coverage, the DNA contigs were randomly
concatenated, and prediction abilities of the program package AceDB
were utilized to aid in gene identification.
In addition to the DNA sequence generated from the nine
PACs mentioned above, Genbank database entries for PACs 466A11 and
363P2 (GeneBank accession numbers AC003025 and AC003023,
respectively) were analyzed with the use of the same AceDB package.
PAC clones 466A11 and 363P2 represent parts of the PAC contig across
the BMD region (Cooper et al., 199?, Genomics 41:185-192); both clones
map to the minimum genetic region containing the BMD gene that was
determined by recombination breakpoint analysis in a 12-generation
Swedish pedigree (Graff' et al ., 1997, Hum. Genet. 101: 263-279). Datbase
entries for PACs 466A11 and 363P2 represent unordered DNA pieces
genereated in Phase 1 High Throughput Genome Sequence Project
(HTGS phase 1) by Genome Science and Technology Center, University
of Texas Southwestern Medical Center at Dallas.
cDNA sequence and exon/intron organization of th~~ CG1CE gene
Genomic DNA sequences from PACs 466A11 and 759J12
were compared with the CG1CE cDNA sequence from EST AA318352
using the program Crossmatch which allowed for a rapid and sensitive
detection of the location of exons. The identification of intron/exon
boundaries was then accomplished by manually comparing visualized
genomic and cDNA sequences by using the AceDB package. This
analysis allowed the identification of exons 8, 9, and 10 that are
represented in EST AA318352. To increase the accuracy of the analysis,
the DNA sequence of EST AA318352 was verified by comparison with
genomic sequence obtained from pCA759J12-2, PAC 466A11, and
shotgun PAC 759J12 subclones. The verified EST AA318352 sequence
was reanalyzed by BLAST; two new EST's (accession numbers AA307119
and AA205892) were found to partially overlap with EST AA318352. They
were assembled into a contig using the program Sequencher (Perkin
Elmer, Norwalk, CT), and a consensus sequence derived from three
ESTs (AA318352, AA307119, and AA205892) was re-analyzed by BLAST.

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
BLAST analysis identified a fourth EST belonging to this cluster
(accession number AA317489); EST AA317489 was included in the
consensus cDNA sequence. The consensus sequence derived from the
four ESTs (AA318352, AA307119, AA205892, and AA317489) was
compared with genomic sequences obtained from pCA759J12-2, PAC
466A11, and shotgun PAC 759J12 subclones using the programs
Crossmatch and AceDB. This analysis verified the sequence and
corrected sequencing errors that were found in AA318352, AA307119,
AA205892, and AA317489. Comparison of cDNA and genomic sequences
revealed a total of 7 exons. The order of the exons from 5' end to 3' end
was 5'-ex4-ex5-ex6-ex8-ex9-exl0-exll-3'. BLASTX analysis of the
genomic segment located between exons 6 and 8 in PAC 466A11 revealed
strong homology of the corresponding protein to a group of C. elegans
proteins (RFP family). Since there were no EST hits in the GenBank
EST database that covers this stretch of genomic sequence, this part of
the CG1CE gene was called exH (hypothetical ex 7). This finding
changed the order of exons in the CG1CE gene to 5'-ex4-ex5-ex6-ex7-ex8-
ex9-exl0-exll-3'. The BLAST analysis of the DNA region located
upstream of the exon 4 identified an additional human EST (AA326727)
with a high degree of similarity to genomic sequence. Comparison of
DNA and genomic sequences revealed the presence of two additional
exons (exl and ex2) in the CG1CE gene. This finding changed the order
of the exons in the CG1CE gene to 5'-exl-ex2- ex4-ex5-ex6-ex7-ex8-ex9-
exl0-exll-3'. Bioinformatic analysis did not allow the prediction of
boudaries between exons 2 and 4, exons 6 and 7, and exons 7 and 8. In
addition, there was no overlap between ESTs represented in exons 1 and
2 from one side and axons 4, 5, 6, 7, 8, 9, 10, and 11 from another. There
was the possibility of the presence of additional axons in the CG1CE gene
that were not represented in the GenBank EST database.
Identification o a_n additional_ axon nd deternination o he enact
exon/intron boLnd r; .a wi .h;n the CG CAF-g~,nP~
To identify additional exon(s) within the CG1CE gene and
verify the exonic composition of this gene, forward and reverse PCR
primers from all known axons of the CG1CE gene were synthesized and
used to PCR amplify CG1CE cDNA fragments from human retina
-

CA 02321129 2000-08-16
WO 99/43695 PCTNS99/03790
"Marathon-ready" cDNA (Clontech, Palo Alto, CA). In these RT-PCR
experiments forward primer from exl (LF:
CTAGTCGCCAGACCTTCTGTG) (SEQ.ID.N0.:9) was paired with a
reverse primer from ex4 (GR: CTTGTAGACTGCGGTGCTGA)
(SEQ.ID.NO.:10), forward primer from ex4 (GF:
GAAAGCAAGGACGAGCAAAG) (SEQ.ID.NO.:11) was paired with a
reverse primer from ex6 (ER: AATCCAGTCGTAGGCATACAGG )
(SEQ.ID.N0.:12), forward. primer from ex6 (EF:
ACCTTGCGTACTCAGTGTGGA ) (SEQ.ID.N0.:13) was paired with a
reverse primer from ex8 (AR: TGTCGACAATCCAGTTGGTCT)
(SEQ.ID.N0.:14), forward primer from ex8 (AF:
CCCTTTGGAGAGGATGATGA) (SEQ.ID.N0.:15) was paired with a
reverse primer from exl0 (CR: CTCTGGCATATCCGTCAGGT)
(SEQ.ID.N0.:16), forward primer from exl0 (CF:
CTTCAAGTCTGCCCCACTGT) (SEQ.ID.N0.:17) was paired with a
reverse primer from exll (DR: GCATCCCCATTAGGAAGCAG)
(SEQ.ID.N0.:18).
A 50 ~,1 PCR reaction was performed using the Taq Gold
DNA polymerase (Perkin Elmer, Norwalk, CT) in the reaction buffer
supplied by the manufacturer with the addition of dNTPs, primers, and
approximately 0.5 ng of human retina cDNA. PCR products were
electrophoresed on a 2% agarose gel and DNA bands were excised,
purified and subjected to sequence analysis with the same primers that
were used for PCR amplification. The assembly of the DNA sequence
results of these PCR products revealed that:
(i) exons 1 and 2 from one side and exons 4, 5, 6, 7, 8, 9,
10, and 11 indeed represent fragments of the same gene
(ii) an additional exon is present between exons 2 and 4
(named ex3)
(iii) exon ? (Hypothetical) predicted by the BLASTX
analysis is present in the CG1CE cDNA fragment amplified by EF/AR
primers.
Comparison of the DNA sequences obtained from RT-PCR
fragments with genomic sequences obtained from pCA759J12-2, PAC
466A11, and shotgun PAC 759J12 subclones was performed using the
5_

CA 02321129 2000-08-16
WO 99/43695 PCT/US99l03790
programs Crossmatch and AceDB. This analysis confirmed the
presence of the exons originally found in five ESTs (AA318352,
AA307119, AA205892, AA317489, and AA326727) and identified an
additional exon (exon3) in the CG1CE gene. Exact sequence of
exon/intron boundaries within the CG1CE gene were determined for all
of the exons. The splice signals in all introns conform to publish
consensus sequences. The CG1CE gene appears to span at least 16 kb of
genomic sequence. It contains a total of 11 exons.
Two splice donor sites for 'ntrn" 7
Two splicing variants of exon 7 were detected upon
sequence analysis of RT-PCR products amplified from human retina
cDNA with the primer pair EF/AR. Two variants utilize alternative
splice donor sites separated from each other by 203 bp. Both splicing
sites conform to the published consensus sequence.
Identification of 5' and 3' ends of C =1 F cnNA
RACE is an established protocol for the analysis of cDNA
ends. This procedure was performed using the Marathon RACE
template from human retina, purchased from Clontech (Palo Alto, CA).
cDNA primers KR (CTAAGCGGGCATTAGCCACT) (SEQ.ID.N0.:19)
and LR(TGGGGTTCCAGGTGGGTCCGAT) (SEQ.ID.N0.:20) in
combination with a cDNA adaptor primer AP 1
(CCATCCTAATACGACTCACTATAGGGC ) (SEQ.ID.N0.:21) were
used in 5'RACE. cDNA primer DF
(GGATGAAGCACATTCCTAACCTGCTTC) (SEQ.ID.N0.:22) in
combination with a . cDNA adaptor primer AP 1
(CCATCCTAATACGACTCACTATAGGGC ) (SEQ.ID.N0.:21) was used
in 3'R,ACE. Products obtained from these PCR amplifications were
analyzed on 2°b agarose gels. Excised fragments from the gels were
purified using Qiagen QIAquick spin columns and sequenced using
ABI dye-terminator sequencing kits. The products were analyzed on
ABI 37? sequencers according to standard protocols.

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
EXAMPLE 2
Best's macLa_r dvst_ro~hv is associat.~rl w;th Tr",t.~trons ink
evolutionarily conserved re~~on of CG'1 CE
Genomic DNA from BMD patients from two Swedish
pedigrees having Best's macular dystrophy (families S1 and SL76) was
amplified by PCR using the following primer pair:
exG Left AAAGCTGGAGGAGCCGAG (SEQ.ID.N0.:23)
exG_right CTCCACCCATCTTCCGTTC (SEQ.ID.N0.:24)
This primer pair amplifies a genomic fragment that is 412 by long and
contains exon4 and adjacent intronic regions.
The patients were:
Family Sl:
S1-3, a normal individual, i.e., not having BMD; sister of S1-4
S1-4, an individual heterozygous for BMD; and
S1-5, an individual homozygous for BMD.
Patients S1-4 and Sl-5 had the clinical symptoms of BMD, including
morphological changes observable upon ophthalmologic examination.
Family SL76:
SL76-3, an individual heterozygous for BMD; mother of SL76-2
SL76-2, an individual heterozygous for BMD, son of SL-3.
PCR products produced using the primer sets mentioned
above were amplified in 50 ~tl reactions consisting of Perlan-Elmer 10 x
PCR Buffer, 200 mM dNTP's, 0.5 ul of Taq Gold (Perkin-Elmer Corp.,
Foster City, CA), 50 ng of patient DNA and 0.2 ~M of forward and
reverse primers. Cycling conditions were as follows:
1. 94°C 10 min
2. 94°C 30 sec
3. 72°C 2 min (decrease this temperature by 1.1°C per cycle)
4. 72°C 2 min
5. Go to step 2 15 more times
6. 94°C 30 sec
7. 55°C 2 min
8. 72°C 2 min
9. Go to step 6 24 more times
- 37 -

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
10. 72°C 7 min
11. 4°C
Products obtained from this PCR amplification were
analyzed on 2°do agarose gels and excised fragments from the gels were
purified using Qiagen faIAquick spin columns and sequenced using
ABI dye-terminator sequencing kits. The products were analyzed on
ABI 377 sequencers according to standard protocols.
The results are shown in Figure 6. Figure 6 shows a
chromatogram from sequencing runs on the PCR fragments from
patients Sl-3, Sl-4, and S1-5. The six readings represent sequencing of
both strands of the PCR fragments from the patients. As can be seen
from Figure 6, the two patients affected with BMD, patients S1-4 and S1-
5, both carry a mutation at position 383 of SEQ.ID.N0.:2. Both copies of
the CG1CE gene are mutated in homozygous affected Sl-5, while
heterozygous affected S1-4 contains both normal and mutated copies of
the CG1CE gene. This mutation changes the codon that encodes the
amino acid at position 93 of SEfa.ID.N0.:3 from TGG (encoding
tryptophan) to TGC (encoding cysteine). Patient S1-3, a normal
individual, has the wild-type sequence, TGG, at this codon. This disease
mutation that changes this TGG codon to a TGC codon was not found
upon sequencing of 50 normal unrelated individulas (100 chromosomes)
of North American descent.
Both patients from family SL76 carry a mutation at position
357 of SEQ.ID.N0.:2. This mutation changes the codon that encodes the
amino acid at position 85 of SEQ.ID.N0.:3 from TAC (encoding tyrosine)
to CAC (encoding histidine). This disease mutation that changes this
TAC codon to a CAC codon was not found upon sequencing of 50 normal
unrelated individulas (100 chromosomes) of North American descent.
Amino acid positions 85 and 93 of the CG1CE protein are
evolutionarily conserved. Figure ? demonstrates that position 93 is
occupied by tryptophan not only in the CG1CE protein, but also in 15 of 16
related C. elegans proteins. The lone C. elegans protein in which this
residue is not tryptophan contains an isofunctional phenylalanine
instead. Phenylalanine and tryptophan, both being hydrophobic,
aromatic amino acids, are highly similar. Position 85 is occupied by
_ 3g _

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
tyrosine and isofunctional phenylalanine in all 16 related C. elgans
proteins. Phenylalanine and tyrosine, both being aromatic amino acids,
are highly similar.
EXAMPLE 3
RT PCR: RT-PCR experiments were performed on "quick-
clone" human cDNA samples available from Clontech, Palo Alto, CA.
cDNA samples from heart, brain, placenta, lung, liver, skeletal muscle,
kidney, pancreas, and retina were amplified with primers AF
(CCCTTTGGAGAGGATGATGA) (SEQ.ID.N0.:15) and CR
(CTCTGGCATATCCGTCAGGT) (SEQ.ID.N0.:16) in the following PCR
conditions:
1. 94°C 10 min
2. 94°C 30 sec
3. 72°C 2 min (decrease this temperature by 1.1°C per cycle)
4. 72°C 2 min
5. Go to step 2 15 more times
6. 94°C 30 sec
7. 55°C 2 min
8. 72°C 2 min
9. Go to step 6 19 more times
10. 72°C 7 min
11. 4°C
The CG1CE gene was found to be predominantly expressed in human
retina and brain
Northern blot analysis: Northern blots containing poly(A+)-
RNA from different human tissues were purchased from Clontech, Palo
Alto, CA. Blot #1 contained human heart, brain placenta, lung, liver,
skeletal muscle, kidney, and pancreas poly(A+)-RNA. Blot #2 contained
stomach, thyroid, spinal cord, lymph node, trachea, adrenal gland, and
bone marrow poly(A+~RNA.
_ 3g _

CA 02321129 2000-08-16
WO 99/43695
PCTNS99/03790
Primers CF (CTTCAAGTCTGCCCCACTGT) (SEQ.ID.N0.:17) and
exC_right (TAGGCTCAGAGCAAGGGAAG) (SEQ.ID.N0.:25) were
used to amplify a PCR product from total genomic DNA. This product
was purified on an agarose gel, and used as a probe in Northern blot
hybridization. The probe was labeled by random priming with the
Amersham Rediprime kit (Arlington Heights, IL) in the presence of 50-
100 ~.Ci of 3000 Ci/mmole [alpha 32P]dCTP (Dupont/NEN, Boston, MA).
Unincorporated nucleotides were removed with a ProbeQuant G-50 spin
column (Pharmacia/Biotech, Piscataway, NJ). The radiolabeled probe
at a concentration of greater than 1 x 106 cpm/ml in rapid hybridization
buffer (Clontech, Palo Alto, CA) was incubated overnight at 65°C. The
blots were washed by two 15 min incubations in 2X SSC, 0.1% SDS
(prepared from 20X SSC and 20 °do SDS stock solutions, Fisher,
Pittsburgh, PA) at room temperature, followed by two 15 min
incubations in 1X SSC, 0.1°Jo SDS at room temperature, and two 30 min
incubations in O.1X SSC, 0.1% SDS at 60°C. Autoradiography of the blots
was done to visualize the bands that specifically hybridized to the
radiolabeled probe.
The probe hybridized to an mR,NA transcript that is
uniquely expressed in brain and spinal cord.
Mouse probe for the marine ortholog of the GC1CE gene
was generated based on the sequence of an EST with GenBank accession
number AA497726. The 246 by probe was amplified from mouse heart
cDNA (Clontech, Palo Alto, CA) using the primers mouseCGICE_L
(ACACAACACATTCTGGGTGC) (SEQ.ID.N0.:26) and
mouseCGICE ft (TTCAGAAACTGCTTCCCGAT) (SEQ.ID.N0.:27).
Due to an extremely low expression level of the CG1CE gene in mouse
heart, repetitive amplification steps were used to generate this probe.
The authenticity of this probe was verified by sequence analysis of the gel
purified DNA band. Northern blot containing poly(A+)-RNA from
several rat tissues (heart, brain, spleen, lung, liver, skeletal muscle,
kidney, testis) was purchase from Clontech, Palo Alto, CA. The probe
hybridized to an mRNA transcript that is expressed in testis only.
The present invention is not to be Limited in scope by the
specific embodiments described herein. Indeed, various modifications
of the invention in addition to those described herein will become
_ 4p

CA 02321129 2000-08-16
WO 99/43695 PCT/US99/03790
apparent to those sl~lled in the art from the foregoing description. Such
modifications are intended to fall within the scope of the appended
claims.
Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
-41-

Representative Drawing

Sorry, the representative drawing for patent document number 2321129 was not found.

Administrative Status

2024-08-01:As part of the Next Generation Patents (NGP) transition, the Canadian Patents Database (CPD) now contains a more detailed Event History, which replicates the Event Log of our new back-office solution.

Please note that "Inactive:" events refers to events no longer in use in our new back-office solution.

For a clearer understanding of the status of the application/patent presented on this page, the site Disclaimer , as well as the definitions for Patent , Event History , Maintenance Fee  and Payment History  should be consulted.

Event History

Description Date
Inactive: IPC expired 2018-01-01
Application Not Reinstated by Deadline 2008-05-27
Inactive: Dead - No reply to s.30(2) Rules requisition 2008-05-27
Deemed Abandoned - Failure to Respond to Maintenance Fee Notice 2008-02-22
Inactive: Abandoned - No reply to s.30(2) Rules requisition 2007-05-28
Inactive: S.30(2) Rules - Examiner requisition 2006-11-27
Amendment Received - Voluntary Amendment 2006-09-20
Inactive: S.30(2) Rules - Examiner requisition 2006-03-20
Inactive: S.29 Rules - Examiner requisition 2006-03-20
Inactive: IPC from MCD 2006-03-12
Letter Sent 2004-01-27
All Requirements for Examination Determined Compliant 2004-01-15
Request for Examination Requirements Determined Compliant 2004-01-15
Request for Examination Received 2004-01-15
Letter Sent 2001-03-26
Letter Sent 2001-03-26
Inactive: Correspondence - Formalities 2001-02-26
Inactive: Single transfer 2001-02-26
Inactive: Correspondence - Formalities 2001-02-23
Inactive: Cover page published 2000-11-29
Inactive: First IPC assigned 2000-11-28
Inactive: IPC assigned 2000-11-28
Inactive: IPC assigned 2000-11-28
Inactive: IPC assigned 2000-11-28
Inactive: IPC assigned 2000-11-28
Inactive: First IPC assigned 2000-11-22
Inactive: Courtesy letter - Evidence 2000-11-07
Inactive: Notice - National entry - No RFE 2000-11-02
Inactive: Inventor deleted 2000-10-31
Application Received - PCT 2000-10-30
Application Published (Open to Public Inspection) 1999-09-02

Abandonment History

Abandonment Date Reason Reinstatement Date
2008-02-22

Maintenance Fee

The last payment was received on 2007-01-16

Note : If the full payment has not been received on or before the date indicated, a further fee may be required which may be one of the following

  • the reinstatement fee;
  • the late payment fee; or
  • additional fee to reverse deemed expiry.

Please refer to the CIPO Patent Fees web page to see all current fee amounts.

Fee History

Fee Type Anniversary Year Due Date Paid Date
Basic national fee - standard 2000-08-16
MF (application, 2nd anniv.) - standard 02 2001-02-22 2000-12-29
Registration of a document 2001-02-26
MF (application, 3rd anniv.) - standard 03 2002-02-22 2002-01-02
MF (application, 4th anniv.) - standard 04 2003-02-24 2003-01-20
MF (application, 5th anniv.) - standard 05 2004-02-23 2003-12-23
Request for examination - standard 2004-01-15
MF (application, 6th anniv.) - standard 06 2005-02-22 2005-01-12
MF (application, 7th anniv.) - standard 07 2006-02-22 2005-12-21
MF (application, 8th anniv.) - standard 08 2007-02-22 2007-01-16
Owners on Record

Note: Records showing the ownership history in alphabetical order.

Current Owners on Record
MERCK AND CO., INC.
CLAES WADELIUS
Past Owners on Record
C. THOMAS CASKEY
KONSTANTIN PETRUKHIN
MICHAEL METZKER
Past Owners that do not appear in the "Owners on Record" listing will appear in other documentation within the application.
Documents

To view selected files, please enter reCAPTCHA code :



To view images, click a link in the Document Description column. To download the documents, select one or more checkboxes in the first column and then click the "Download Selected in PDF format (Zip Archive)" or the "Download Selected as Single PDF" button.

List of published and non-published patent-specific documents on the CPD .

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.


Document
Description 
Date
(yyyy-mm-dd) 
Number of pages   Size of Image (KB) 
Description 2000-08-16 41 2,489
Description 2001-02-23 62 3,396
Cover Page 2000-11-29 1 36
Abstract 2000-08-16 1 44
Claims 2000-08-16 3 114
Drawings 2000-08-16 18 928
Description 2006-09-20 62 3,391
Claims 2006-09-20 2 58
Reminder of maintenance fee due 2000-10-31 1 110
Notice of National Entry 2000-11-02 1 193
Courtesy - Certificate of registration (related document(s)) 2001-03-26 1 113
Courtesy - Certificate of registration (related document(s)) 2001-03-26 1 113
Reminder - Request for Examination 2003-10-23 1 112
Acknowledgement of Request for Examination 2004-01-27 1 174
Courtesy - Abandonment Letter (R30(2)) 2007-08-06 1 166
Courtesy - Abandonment Letter (Maintenance Fee) 2008-04-21 1 175
Correspondence 2000-11-02 1 15
PCT 2000-08-16 13 494
Correspondence 2001-02-23 23 971
Correspondence 2001-02-26 2 121

Biological Sequence Listings

Choose a BSL submission then click the "Download BSL" button to download the file.

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.

Please note that files with extensions .pep and .seq that were created by CIPO as working files might be incomplete and are not to be considered official communication.

BSL Files

To view selected files, please enter reCAPTCHA code :