Note: Descriptions are shown in the official language in which they were submitted.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
CULTIVAR SPECIFICITY GENE FROM THE RICE PATHOGEN
MAGNAPORTHE GRISEA, AND METHODS OF USE
Pursuant to 35 U.S.C. ~202(c), it is
acknowledged that the U.S. Government has certain rights
in the invention described herein, which was made in part
with funds from the United States Department of
Agriculture, Grant Nos. 58-3655-3-107 and 58-3655-4-140,
and from the National Institutes of Health, Grant No.
GM33716-0851.
FIELD OF THE INVENTION
This invention relates to the field of disease
resistance in plants. In particular, the invention
provides a novel avirulence gene from the rice blast
pathogen, Magnaporthe grisea, and methods of using the
gene and its encoded products for improving resistance of
rice to this pathogen.
BACKGROUND OF THE INVENTION
Rice is a major staple food for about two-
thirds of the world's population. More than ninety
percent of the world's rice is grown and consumed in
developing countries. Rice blast disease, caused by the
fungus Magnaporthe gr.isea, threatens rice crops
worldwide. The disease can cause yield losses of ten to
thirty percent in infested fields. Rice blast has been
an ongoing problem in rice growing areas of the southern
United States. It has now become a significant problem
in rice growing areas of California, as well.
The "gene-for-gene" hypothesis has been advanced
to explain the very specific disease resistance /
susceptibility relationship that often exists between
races of a plant pathogen and cultivars of its host
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 2
species. The gene-for-gene hypothesis has been found
applicable to many host-pathogen interactions, including
that of the rice blast fungus, Magnaporthe grisea, and its
host, Oryza sativa. To be able to understand and
manipulate this host-pathogen relationship is of great
practical interest as M. grisea is rapidly able to
overcome new disease resistance in rice soon after their
deployment. Moreover, M. grisea exists as a complex genus
with many subspecific groups that are infertile, but
differ in their host range. How these different
subspecific groups interrelate evolutionarily is of great
concern to plant breeders since some of these alternate
hosts are frequently found growing in close proximity to,
or in rotation with rice, and M. grisea isolates infecting
these alternate hosts can sometimes also infect rice.
Gene-for-gene resistance (also known as
hypersensitive resistance (HR) or race-specific
resistance) depends for its activation on specific
recognition of the invading pathogen by the plant. Many
individual plant genes have been identified that control
gene-for-gene resistance. These genes are referred to as
resistance (R) genes. The function of a particular R
gene depends on the genotype of the pathogen. A pathogen
gene is referred to as an Avr gene if its expression
causes the pathogen to produce a signal that triggers a
strong defense response in a plant having a corresponding
R gene. This response is not observed in the absence of
either the Avr gene in the pathogen or the corresponding
R gene in the plant. It should be noted that a single
plant may have many R genes, and a single pathogen may
have many Avr genes. However, strong resistance occurs
only when an Avr gene and its specific R gene are matched
in a host-pathogen interaction. In this instance,
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 3 -
resistance generally occurs as activation of a HR
response, in which the cells in the immediate vicinity of
the infection undergo programmed necrosis in order to
prevent the further advance of the pathogen into living
plant tissue. Other features of the resistance response
may also include synthesis of antimicrobial metabolites
or pathogen-inhibiting enzymes, reinforcement of plant
cell walls in the infected area, and induction of signal
transduction pathways leading to systemic acquired
resistance (SAR) in the plant.
The molecular basis of host-cultivar
specificity and pathogenic variability in M. grisea is
only beginning to be elucidated with the identification,
mapping and, in some instances, cloning of specific Avr
genes from pathogenic isolates of M. grisea. For
instance, AVR2-YAMO (cultivar specificity) and PWL2 (host
specificity) (Valent & Chumley, pp. 3.113 - 3.134 in Rice
Blast Disease (R. Zeigler, S.A. Leong, P. Teng, Eds.),
Wallingford: CAB International, 1994) both function as
classic avirulence genes by preventing infection of a
specific cultivar or host. AVR2-YAMO encodes a 223-amino
acid protein with homology to proteases, while PWL2
encodes a 145-amino acid polypeptide which is glycine-
rich. Based on the predicted amino acid sequences of the
proteins, both may be secreted.
Homologs of both AVR2-YAMO and PWL2 appear to
be widely distributed in rice and in other grass-
infecting isolates of M. grisea, thereby confirming that
M. grisea isolates which do not infect rice still may
carry host or cultivar specificity genes for rice. In
some cases, homologs of AVR2-YAMO and PWL2 have been
shown to be functional and to exhibit the same host or
cultivar specificity as AVR2-YAMO or PWL2.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 4 -
As another example of a potentially useful Avr
gene, the cultivar specificity gene AVR1-C039, which
determines avirulence on rice cultivar C039, has been
identified (Valent et al., Genetics 127: 87-101, 1991)
and mapped to a position on M. grisea chromosome 1 (Smith
& Leong, Theor. Appl. Genet. 88: 901-908, 1994). A
segment of chromosome 1 that appears to contain the AVR1-
C039 gene has been isolated and cloned into a cosmid
vector (Leong et al., pp. 846-852 in Rice Genetics III,
Proceedinas of the Third Annual Rice Genetics Symposium,
G.S. Khush, Ed., Island Harbor Press, Manila, 1996):
however, the gene itself heretofore has not been
identified and characterized.
The availability of cloned cultivar and host
specificity genes from M. grisea and, ultimately, the
corresponding R genes from rice provides useful tools for
manipulating and augmenting resistance to this pathogen
in the field. Accordingly, it is an object of the
present invention to provide a new cloned M. grisea
cultivar specificity gene, AVR1-C039, and its functional
homologs for such use.
SUI~2ARY OF THE INVENTION
According to one aspect of the invention, there
is provided an isolated nucleic acid, AVR1-C039, from
Magnaporthe grisea that confers rice cultivar C039-
specific avirulence to fungal plant pathogens that
contain the nucleic acid. The nucleic acid preferably
comprises part or all of Sequence I.D. No. 1, or
hybridizes with part or all of Sequence I.D. No. 1 or its
complement.
According to another aspect of the invention,
there is provided a polypeptide encoded by part or all of
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 5 -
the isolated nucleic acid of claim 1. Preferably, the
polypeptide is selected from the group of polypeptides
encoded by ORFS 1, 2, 3, 4, 5, 6 and 7, corresponding to
Sequence ID No's. 2, 3, 4, 5, 6, 7 and 8, respectively,
and most preferably is encoded by ORF 3.
According to another aspect of the invention, a
transgenic epiphytic bacterium is provided, which
expresses a portion of an AVR1-C039 gene effective to
confer rice cultivar C039-specific avirulence to
microorganisms expressing the gene. Preferably, the
transgenic epiphytic bacterium expresses ORF3 of Sequence
ID No. 1, or a functional equivalent.
According to another aspect of the invention, a
method of enhancing the scope of resistance of rice
cultivar C039 plants to pathogenic microorganisms is
provided. The method comprises treating the plants with
an epiphytic bacterium that expresses a portion of an
AVR1-C039 gene effective to trigger expression of a C039-
specific R gene in the plants.
According to another aspect of the invention, a
second method of enhancing the scope of resistance of
rice cultivar C039 plants to pathogenic microorganisms is
provided. This method comprises treating the plants with
a protein extract comprising polypeptides produced by
expression of AVRI-C039, in an amount effective to
trigger expression of a C039-specific R gene in the
plants.
These and other features and advantages of the
present invention will be described in greater detail in
the description and examples set forth below.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04p47
- 6 -
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
Various terms relating to the biological
molecules of the present invention are used hereinabove
and also throughout the specifications and claims. The
terms "substantially the same," "percent similarity" and
"percent identity" are defined in detail below.
With reference to nucleic acids of the
invention, the term "isolated nucleic acid" is sometimes
used. This term, when applied to DNA, refers to a DNA
molecule that is separated from sequences with which it
is immediately contiguous (in the 5' and 3' directions)
in the naturally occurring genome of the organism from
which it was derived. For example, the "isolated nucleic
acid" may comprise a DNA molecule inserted into a vector,
such as a plasmid or virus vector, or integrated into the
genomic DNA of a procaryote or eucaryote. An "isolated
nucleic acid molecule" may also comprise a cDNA molecule.
With respect to RNA molecules of the invention
the term "isolated nucleic acid" primarily refers to an
RNA molecule encoded by an isolated DNA molecule as
defined above. Alternatively, the term may refer to an
RNA molecule that has been sufficiently separated from
RNA molecules with which it would be associated in its
natural state (i.e., in cells or tissues), such that it
exists in a "substantially pure" form (the term
"substantially pure" is defined below).
With respect to protein, the term "isolated
protein" or "isolated and purified protein" is sometimes
used herein. This term refers primarily to a protein
produced by expression of an isolated nucleic acid
molecule of the invention. Alternatively, this term may
refer to a protein which has been sufficiently separated
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
-
from other proteins with which it would naturally be
associated, so as to exist in "substantially pure" form.
The term "substantially pure" refers to a
preparation comprising at least 50-60% by weight the
compound of interest (e. g., nucleic acid,
oligonucleotide, protein, etc.). More preferably, the
preparation comprises at least 75% by weight, and most
preferably 90-99% by weight, the compound of interest.
Purity is measured by methods appropriate for the
compound of interest (e. g. chromatographic methods,
agarose or polyacrylamide gel electrophoresis, HPLC
analysis, and the like).
With respect to antibodies of the invention,
the term "immunologically specific" refers to antibodies
that bind to one or more epitopes of a protein of
interest, but which do not substantially recognize and
bind other molecules in a sample containing a mixed
population of antigenic biological molecules.
With respect to oligonucleotides, the term
"specifically hybridizing" refers to the association
between two single-stranded nucleotide molecules of
sufficiently complementary sequence to permit such
hybridization under pre-determined conditions generally
used in the art (sometimes termed "substantially
complementary"). In particular, the term refers to
hybridization of an oligonucleotide with a substantially
complementary sequence contained within a single-stranded
DNA or RNA molecule of the invention, to the substantial
exclusion of hybridization of the oligonucleotide with
single-stranded nucleic acids of non-complementary
sequence.
The term "pathogen-inoculated" refers to the
inoculation of a plant with a pathogen.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 8 -
The term "disease defense response" refers to a
change in metabolism, biosynthetic activity or gene
expression that enhances the plant's ability to suppress
the replication and spread of a microbial pathogen (i.e.,
to resist the microbial pathogen). Examples of plant
disease defense responses include, but are not limited
to, production of low molecular weight compounds with
antimicrobial activity (referred to as phytoalexins) and
induction of expression of defense (or defense-related)
genes, whose products include, for example, peroxidases,
cell wall proteins, proteinase inhibitors, hydrolytic
enzymes, pathogenesis-related (PR) proteins and
phytoalexin biosynthetic enzymes, such as phenylalanine
ammonia lyase and chalcone synthase. Such defense
responses appear to be induced in plants by several
signal transduction pathways involving secondary defense
signaling molecules produced in plants. Agents that
induce disease defense responses in plants include, but
are not limited to: (1) microbial pathogens, such as
fungi, bacteria and viruses; (2) microbial components and
other defense response elicitors, such as proteins and
protein fragments, small peptides, (3-glucans, elicitins
and harpins, cryptogein and oligosaccharides; and (3)
secondary defense signaling molecules produced by the
plant, such as salicylic acid, H202, ethylene and
~asmonates.
The term "promoter region" refers to the 5'
regulatory regions of a gene.
The term "reporter gene" refers to genetic
sequences which may be operably linked to a promoter
region forming a transgene, such that expression of the
reporter gene coding region is regulated by the promoter
and expression of the transgene is readily assayed.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 9
The term "selectable marker gene" refers to a
gene product that when expressed confers a selectable
phenotype, such as antibiotic resistance, on a
transformed cell or plant.
The term "operably linked" means that the
regulatory sequences necessary for expression of the
coding sequence are placed in the DNA molecule in the
appropriate positions.relative to the coding sequence so
as to effect expression of the coding sequence. This
same definition is sometimes applied to the arrangement
of coding sequences and transcription control elements
(e.g. promoters, enhancers, and termination elements) in
an expression vector.
The term "DNA construct" refers to genetic
sequence used to transform plants and generate progeny
transgenic plants. These constructs may be administered
to plants in a viral or plasmid vector. Other methods of
delivery such as Agrobacterium T-DNA mediated
transformation and transformation using the biolistic
process are also contemplated to be within the scope of
the present invention. The transforming DNA may be
prepared according to standard protocols such as those
set forth in "Current Protocols in Molecular Biology",
eds. Frederick M. Ausubel et al., John Wiley & Sons,
1998.
II. Description of ATTR1-C039
and its Encoded Peutides
In accordance with the present invention, a
novel Magnaporthe grisea avirulence gene has been
isolated and cloned. This gene is referred to herein as
AVR1-0039, to denote its function as a gene that confers
cultivar-specific interactions with rice cultivar C039.
CA 02321950 2000-08-24
WO 99/43824 PCTlUS99/04047
- 10
The cloning of an AVRI-C039 gene from M. grisea strain
2539 and analysis of the gene are described in detail in
Example 1. The gene contains four open reading frames,
one of which (ORF3) appears to play the most key role in
conferring cultivar specific avirulence to Magnaporthe
isolates that carry the gene. Homologs of the strain
2539 isolate AVR1C039 gene have been identified in a
diverse array of other Magnaporthe isolates.
A genomic clone of AVRI-C039 from M. grisea
strain 2539, an exemplary AVRl-C039 of the invention, is
described in detail herein and its nucleotide sequence is
set forth in Example 1 as Sequence I.D. No. 1. Sequence
I.D. No. 1 contains four open reading frames. It is
believed that one or more of these open reading frames
are responsible for conferring avirulence on cultivar
C039, either by virtue of the gene product expressed from
the open reading frame or by possession of critical
transcription or translation regulatory sequences (see
Example 1).
Although a genomic clone of AVR1-C039 from M.
grisea isolate 2539 is described and exemplified herein,
this invention is intended to encompass nucleic acid
sequences and proteins from other Magnaporthe isolates
that are sufficiently similar to be used instead of the
isolate 2539 AVR1-C039 nucleic acid and proteins for the
purposes described below. These include, but are not
limited to, allelic variants and natural mutants of
Sequence I.D. No. 1, which are likely to be found in any
given population of Magnaporthe isolates. Because such
variants are expected to possess certain differences in
nucleotide and amino acid sequence, this invention
provides an isolated AVRI-C039 nucleic acid molecule
having at least about 60°a (preferably 70°s and more
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 11 -
preferably over 80%) sequence homology :in the coding
regions with the nucleotide sequence set forth as
Sequence I.D. No. 1 (and, most preferably, specifically
comprising the coding region of sequence I.D. No. 1).
This invention also provides isolated polypeptide
products of the open reading frames of Sequence I.D. No.
1, having at least about 60% (preferably 70% or 80% or
greater) sequence homology with the amino acid sequences
of Sequence I.D. No's. 2, 3, 4, 5, 6 or 7, respectively.
Because of the natural sequence variation likely to exist
among AVRI-0039 genes, one skilled in the art would
expect to find up to about 30-40% nucleotide sequence
variation, while still maintaining the unique properties
of the AVR1-0039 gene and encoded polypeptides of the
present invention. Such an expectation is due in part to
the degeneracy of the genetic code, as well as to the
known evolutionary success of conservative amino acid
sequence variations, which do not appreciably alter the
nature of the encoded protein. Accordingly, such
variants are considered substantially the same as one
another and are included within the scope of the present
invention.
For purposes of this invention, the term
"substantially the same" refers to nucleic acid or amino
acid sequences having sequence variation that do not
materially affect the nature of the protein (i.e. its
structure and/or biological activity). With particular
reference to nucleic acid sequences,. the term
"substantially the same" is intended to refer to coding
regions and to conserved sequences governing expression,
and refers primarily to degenerate codons encoding the
same amino acid, or alternate codons encoding
conservative substitute amino acids in the encoded
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 12
polypeptide. With reference to amino acid sequences, the
term "substantially the same" refers generally to
conservative substitutions and/or variations in regions
of the polypeptide that do not affect structure or
function. The terms "percent identity" and "percent
similarity" are also used herein in comparisons among
amino acid sequences. These terms are intended to be
defined as they are in the UWGCG sequence analysis
program (Devereaux et al., Nucl. Acids Res. 12: 387-397,
1984), available from the University of Wisconsin.
The following description sets forth the
general procedures involved in practicing the present
invention. To the extent that specific materials are
mentioned, it is merely for purposes of illustration and
is not intended to limit the invention. Unless otherwise
specified, general cloning procedures, such as those set
forth in Sambrook et al., Molecular Cloning, Cold Spring
Harbor Laboratory (1989) (hereinafter "Sambrook et al.")
or Ausubel et al. (eds) Current Protocols in Molecular
Biology, John Wiley & Sons (1998) (hereinafter"Ausubel
et al.") are used.
A. Preparation of AVR1-C039 Nucleic
Acid Molecules, encoded Polypeptides and
Antibodies Specific for the Polmeptides
1. Nucleic Acid Molecules
AVR1-0039 nucleic acid molecules of the
invention may be prepared by two general methods: (1)
they may be synthesized from appropriate nucleotide
triphosphates, or (2) they may be isolated from
biological sources. Both methods utilize protocols well
known in the art.
The availability of nucleotide sequence
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 13 -
information, such as the genomic isolate having Sequence
I.D. No. 1, enables preparation of an isolated nucleic
acid molecule of the invention by oligonucleotide
synthesis. Synthetic oligonucleotides may be prepared by
the phosphoramadite method employed in the Applied
Biosystems 38A DNA Synthesizer or similar devices. The
resultant construct may be purified according to methods
known in the art, such as high performance liquid
chromatography (HPLC). Long, double-stranded
polynucleotides, such as a DNA molecule of the present
invention, must be synthesized in stages, due to the size
limitations inherent in current oligonucleotide synthetic
methods. Thus, for example, a 1.05 kb double-stranded
molecule may be synthesized as several smaller segments
of appropriate complementarity. Complementary segments
thus produced may be annealed such that each segment
possesses appropriate cohesive termini for attachment of
an adjacent segment. Adjacent segments may be ligated by
annealing cohesive termini in the presence of DNA ligase
to construct an entire 1.05 kb double-stranded molecule.
A synthetic DNA molecule so constructed may then be
cloned and amplified in an appropriate vector.
AVR1-C039 genes also may be isolated from
appropriate biological sources using methods known in the
art. In one embodiment, a genomic clone has been
isolated from a M. grisea strain 2539 cosmid library. In
an alternative embodiment, a cDNA clone comprising one or
more of the open reading frames of the genomic AVRI-C039
locus may be isolated.
In accordance with the present invention,
nucleic acids having the appropriate level sequence
homology with part or all the coding regions of Sequence
I.D. No. 1 may be identified by using hybridization and
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 14 -
washing conditions of appropriate stringency. For
example, hybridizations may be performed, according to
the method of Sambrook et al., using a hybridization
solution comprising: 5X SSC, 5X Denhardt~s reagent, 1.0%
SDS, 100 /cg/ml denatured, fragmented salmon sperm DNA,
0.05% sodium pyrophosphate and up to 50% formamide.
Hybridization is carried out at 37-42aC for at least six
hours. Following hybridization, filters are washed as
follows: (1) 5 minutes at room temperature in 2X SSC and
1% SDS; (2) 15 minutes at room temperature in 2X SSC and
0.1% SDS; (3) 30 minutes-1 hour at 37~C in 2X SSC and
0.1% SDS; (4) 2 hours at 45-55~in 2X SSC and 0.1% SDS,
changing the solution every 30 minutes. Alternatively, a
modification of the Amasino hybridization protocol (Anal.
Biochem. 152: 304-307) is preferred for use in the
present invention and is described in greater detail in
Example 1.
One common formula for calculating the
stringency conditions required to achieve hybridization
between nucleic acid molecules of a specified sequence
homology (Sambrook et al., 1989):
Tm = 81.5°C + 16.6Log [Na+) + 0.41(% G+C) - 0.63 (% formamide) -
600/#bp in duplex
As an illustration of the above formula, using [N+]
[0.368] and 50% formamide, with GC content of 42% and an
average probe size of 200 bases, the Tm is 57°C. The Tm
of a DNA duplex decreases by 1 - 1.5°C with every 1%
decrease in homology. Thus, targets with greater than
about 75% sequence identity would be observed using a
hybridization temperature of 42°C.
Nucleic acids of the present invention may be
maintained as DNA in any convenient cloning vector. In a
preferred embodiment, clones are maintained in plasmid
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 15 -
cloning/expression vector, such as pGEM-T (Promega
Biotech, Madison, WI) or pBluescript (Stratagene, La
Jolla, CA), either of which is propagated in a suitable
E. coli host cell.
AVR1-C039 nucleic acid molecules of the
invention include cDNA, genomic DNA, RNA, and fragments
thereof which may be single- or double-stranded. Thus,
this invention provides oligonucleotides (sense or
antisense strands of DNA or RNA) having sequences capable
of hybridizing with at least one sequence of a nucleic
acid molecule of the present invention, such as selected
segments of the cDNA having Sequence I.D. No. 1. Such
oligonucleotides are useful as probes for detecting AVRI-
C039 genes or mRNA in test samples of fungal isolates,
e.g. by PCR amplification, or for the positive or
negative regulation of expression of AVRI-C039 genes at
or before translation of the mRNA into proteins.
2. Proteins
The AVRI-C039 genomic isolate described herein
contains four open reading frames (ORF's 1-4), whose
deduced amino acid sequences are set forth herein as
Sequence I.D. No's. 2-5, respectively. Any one of these
polypeptides may be prepared in a variety of ways,
according to known methods. If produced in situ the
polypeptides may be purified from appropriate sources,
e.g., fungal isolates.
Alternatively, the availability of nucleic acid
molecules encoding the polypeptides enables production of
the proteins using in vitro expression methods known in
the art. For example, a cDNA or gene may be cloned into
an appropriate in vitro transcription vector, such a
pSP64 or pSP65 for in vitro transcription, followed by
cell-free translation in a suitable cell-free translation
CA 02321950 2000-08-24
WO 99/43824 P~,T/US99/04047
- 16 -
system, such as wheat germ or rabbit reticulocytes. In
vitro transcription and translation systems are
commercially available, e.g., from Promega Biotech,
Madison, Wisconsin or BRL, Rockville, Maryland.
According to a preferred embodiment, larger
quantities of AVR1-C039-encoded polypeptides may be
produced by expression in a suitable procaryotic or
eucaryotic system. For example, part or all of a DNA
molecule, such as the cDNA having Sequence I.D. No. 1,
may be inserted into a plasmid vector adapted for
expression in a bacterial cell (such as E. coli) or a
yeast cell (such as Saccharomyces cerevisiae), or into a
baculovirus vector for expression in an insect cell.
Such vectors comprise the regulatory elements necessary
for expression of the DNA in the host cell, positioned in
such a manner as to permit expression of the DNA in the
host cell. Such regulatory elements required for
expression include promoter sequences, transcription
initiation sequences and, optionally, enhancer sequences.
The AVR1-0039 polypeptide(s) produced by gene
expression in a recombinant procaryotic or eucyarotic
system may be purified according to methods known in the
art. In a preferred embodiment, a commercially available
expression/secretion system can be used, whereby the
recombinant protein is expressed and thereafter secreted
from the host cell, to be easily purified from the
surrounding medium. If expression/secretion vectors are
not used, an alternative approach involves purifying the
recombinant protein by affinity separation, such as by
immunological interaction with antibodies that bind
specifically to the recombinant protein. Such methods
are commonly used by skilled practitioners.
The AVR1-C039-encoded polypeptides of the
invention, prepared by the aforementioned methods, may be
analyzed according to standard procedures. Methods for
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 17 -
analyzing the functional activity, i.e. ability to confer
avirulence, are described in Example 1.
. The present invention also provides antibodies
capable of immunospecifically binding to polypeptides of
the invention. Polyclonal or monoclonal antibodies
directed toward any of the peptides encoded by the ORFs
of AVR1-C039 may be prepared according to standard
methods. Monoclonal antibodies may be prepared according
to general methods of Kohler and Milstein, following
standard protocols. In a preferred embodiment,
antibodies are prepared, which react immunospecifically
with various epitopes of the AVR1-C039-encoded
polypeptides.
Polyclonal or monoclonal antibodies that
immunospecifically interact with one or more of the
polypeptides encoded by AVR1-C039 can be utilized for
identifying and purifying such proteins. For example,
antibodies may be utilized for affinity separation of
proteins with which they immunospecifically interact.
Antibodies may also be used to immunoprecipitate proteins
from a sample containing a mixture of proteins and other
biological molecules. Other uses of the antibodies are
described below.
B. Uses of AVR1-C039 Nucleic Acids,
Encoded Proteins and Antibodies
The potential of recombinant genetic
engineering methods to enhance disease resistance in
agronomically important plants has received considerable
attention in recent years. Protocols are currently
available for the stable introduction of genes into
plants, as well as for augmentation of gene expression.
The present invention provides nucleic acid molecules
which, upon stable introduction into a recipient plant,
or into an epiphytic microorganism, can enhance the
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 18 -
plant's ability to resist pathogen attack. AVR1-C039-
encoded proteins of the invention may also be applied
directly to a plant, to induce a disease defense
response.
1. AVR1-C039 Nucleic Acids
AVRI-C039 nucleic acids (genomic clones or
cDNAs) may be used for a variety of purposes in
accordance with the present invention. The DNA, RNA, or
fragments thereof may be used as probes to detect the
presence of and/or expression of AVR1-C039 genes.
Methods in which AVR1-C039 nucleic acids may be utilized
as probes for such assays include, but are not limited
to: (1) in situ hybridization; (2) Southern hybridization
(3) northern hybridization; and (4) assorted
amplification reactions such as polymerase chain
reactions (PCR) . The AVRI-C039 nucleic acids of the
invention may also be utilized as probes to identify
homologs from other Magnaporthe isolates. As described
above, AVR1-C039 nucleic acids are also used to advantage
to produce large quantities of substantially pure AVR1-
C039 proteins, or selected portions thereof.
Of perhaps greater significance, however, is
the use of AVR1-C039 nucleic acids to broaden the scope
of resistance of rice cultivars carrying the C039
resistance gene to pathogens other than M. grisea
isolates carrying the AVR1-C039 avirulence gene. For
instance, in one embodiment of the invention, the AVR1-
C039 coding region is operably linked to a heterologous
promoter, preferably one that is either generally
pathogen inducible (i.e. inducible upon challenge by a
broad range of pathogens) or wound inducible. Such
promoters include, but are not limited to:
a) promoters of genes encoding lipoxygenases
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 19 -
(preferably from plants, most preferably from rice, e.g.,
Peng et al., J. Biol. Chem. 269: 3755-3761, 1994; Peng et
al., Abstract presented at the general meeting of the
International Program on Rice Biotechnology, Malacca,
Malaysia, Sept. 15-19, 1997);
b) promoters of genes encoding peroxidases
(preferably from plants, most preferably from rice, e.g.,
Chittoor et al., Mol. Plant-Microbe Interactions _l0: 861-
871, 1997);
c) promoters of genes encoding
hydroxymethylglutaryl-CoA reductase (preferably from
plants, most preferably from rice, e.g., Nelson et al.,
Plant Mol. Biol. 25: 401-412, 1994);
d) promoters of genes encoding phenylalanine
ammonia lyase (preferably from rice; e.g., Lamb et al.,
Abstract of the general meeting of the International
Program on Rice Biotechnology, Malacca, Malaysia, Sept.
15-19, 1997}
e) promoters of genes encoding glutathione-S-
transferase (preferably from plants, most preferably from
rice, or alternatively, the PRP1 promoter from potato);
f) promoters from pollen-specific genes, such
as corn Zmgl3, which has been show to be expressed in
rice transgenic pollen carrying the corn gene (Aldemita
et al., Abstract of the general meeting of the
International Program on Rice Biotechnology, Malacca,
Malaysia, Sept. 15-19, 1997);
g) promoters from genes encoding chitinases
(preferably from plants, most preferably from rice; e.g.,
Zhu & Lamb, Mol. Gen. Genet. 226: 289-296, 1991);
h) promoters from genes induced early (within 5
hours post-inoculation) in the interaction of M. grisea
and rice (e.g., Bhargava & Hamer; Abstract B-10, 8th
International Congress Molecular Plant Microbe
Interactions, Knoxville, TN July 14-19, 1996);
CA 02321950 2000-08-24
WO 99/43824 PCTlUS99/04047
- 20 -
i) promoters from plant (preferably rice) viral
genes, either contained on a bacterial plasmid or on a
plant viral vector, as described by Hammond-Kosack et
al., Mol. Plant-Microbe Interactions 8_: 181-185 (1994);
j) promoters from genes involved in the plant
(preferably rice} respiratory burst (e. g., Groom et al.,
Plant J. ZO 3 515-522, 1996); and
k) promoters from plant (preferably rice)
anthocyanin pathway genes (e.g., Reddy, pp 341-352 in
Rice Genetics III, supra; Reddy et al., Abstract of the
general meeting of the International Program on Rice
Biotechnology, Malacca, Malaysia, Sept. 15-19, 1997).
The chimeric gene is then used to transform
rice cultivars that already carry the appropriate R gene.
Upon wounding or challenge with a plant pathogen, the
resulting transgenic plants would be induced to produce
the AVR1-C039 gene product, thereby triggering the R gene
defense response. In this embodiment, care must be taken
to avoid using a promoter that is induced by necrosis,
since use of such a promoter could result in a self-
perpetuating hypersensitive response that may be lethal
to the plant (see, e.g., Kim et al., Proc. Natl. Acad.
Sci. USA 91: 10445-10449, 1994).
In a preferred embodiment, a coding region of
AVR1-C039 (preferably the coding region corresponding to
ORF3) is inserted into an expression vector in a
microorganism that grows epiphytically on rice plants. A
suspension of such recombinant microorganisms is sprayed
on rice cultivars carrying the appropriate R gene. Upon
pathogen attack, two levels of protection can occur: (1)
the gene product produced by the recombinant epiphytes
triggers an interaction on the plant surface that
prevents further penetration by the pathogen (e.g., the
fungal conidia develop appresoria, but do not develop
penetration pegs); or (2) the gene product produced by
CA 02321950 2000-08-24
WO 99/43824 PGT/US99/04047
- 21 -
the recombinant epiphytes is carried into the plant
tissue at the wound site, where it interacts with the
corresponding R gene product and induces an internal
disease defense response. Thus, this pre-treatment
confers resistance to Maganporthe isolates (and,
presumably, other plant pathogens) which normally are
virulent on those cultivars. This embodiment is
described in greater detail in Example 3.
In connection with the use of epiphytic
bacteria, it should be noted that bacterial and phage
expression and delivery systems, such as those
commercially available from InVitrogen, will be
particularly useful. The bacterial system expresses a
protein hybrid with pilin, such that the foreign protein
is exposed on the exterior of the bacterium. The phage
system also expresses a hybrid protein with coat
component and exterior exposure of the foreign protein.
The AVR1-C039 gene also may be used as a tool
to identify and isolate its corresponding R gene. Thus,
in a manner similar to that described for isolation of
the tomato CF-9 gene for resistance to Cladosporium
fulvum (Jones et al., Science 266: 789-793, 1994), the R
gene in rice that corresponds to AVR1-C039 can be
isolated by transposon tagging: (1) AVR1-C039 is
transformed into, and constitutively expressed in a
susceptible rice line; (2) the transgenic line is crossed
with a resistant line that carries an identifiable
transposon; (2) seedlings of F1 progeny constitutively
expressing both the Avr gene and the corresponding R gene
should die, thereby enabling a simple screening for live
F1 progeny; (4) any live Fl progeny should be surviving
by virtue of interruption of either the AVRI-C039
transgene or the corresponding R gene, presumably by the
transposon. The transposon, along with the gene it has
interrupted, can thus be isolated.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 22 -
2. AVRl-C039 Proteins and Antibodies
Purified gene products of AVRI-C039, or
fragments thereof, may be used to produce polyclonal or
monoclonal antibodies, which also may serve as sensitive
detection reagents for the presence and accumulation of
AVR1-C039 polypeptides in transformed microbial
epiphytes, transgenic plants, or other biological
materials. Polyclonal or monoclonal antibodies
immunologically specific for AVR1-C039 polypeptides may
be used in a variety of assays designed to detect and
quantitate the proteins. Such assays include, but are
not limited to: (1) flow cytometric analysis; (2)
immunochemical localization of expressed proteins in
cells or tissues; and (3) immunoblot analysis (e.g., dot
blot, Western blot) of extracts from various cells and
tissues. Additionally, as described above, antibodies
can be used for purification of AVR1-C039 polypeptides
(e. g., affinity column purification,
immunoprecipitation).
In a preferred embodiment, purified AVR1-C039
polypeptides (most preferably from ORF3) are used as a
pre-treatment or co-treatment to confer broad-spectrum
pathogen resistance to rice cultivars carrying the C039 R
gene. Thus, in a manner similar to the above-described
use of AVR1-C039-expressing epiphytic microorganisms, a
solution of the peptide is applied to the plants, and
subsequent or concurrent wounding or inoculation with a
pathogenic microorganism brings the peptide into contact
with the R gene product, thereby stimulating a defense
response. The inventors have experimentally demonstrated
the feasibility of this approach, as described in detail
in Example 4.
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 23 -
The following specific examples are provided to
illustrate embodiments of the invention. They are not
intended to limit the scope of the invention in any way.
EXAMPhE 1
Cloning and Analysis of AVRI-C039
A chromosomal segment putatively containing the
cultivar specificity gene, AVRI-C039, was isolated from
M. grisea strain 2539 using a map-based cloning approach,
followed by chromosome walking (Leong et al., 1996). In
this example we describe the identification, cloning and
analysis of the AVR1-C039 gene.
Methods:
Hynridization protocol. Hybridization methods
were modified from Amasino (1986) "Acceleration of
Nucleic Acid Hybridization Rate by Polyethylene Glycol",
Analytical Biochemistry 152:304-307. The hybridization
buffer was prepared according the Amasino protocol, but
without the PEG and NaCl and with reduced concentrations
of NaHP04: 0.125M NaHP04, 7% SDS, 50% formamide, 1.0 mM
EDTA, pH 7.2. High stringency conditions were used (42
°C, 16 h). Post hybridization washes were: one rinse
with 2XSSC at room temperature; one wash in 2XSSC for 10
min at 65 °C; one wash in 2XSSC, 15 min at 65 °C; one
final wash in 0.1 X SSC, 0.1% SDS for 15 min at 65 °C.
The final washing conditions were of greater stringency
than were the hybridization conditions, giving a Tm of 68.
Thus, greater than 95% homology would be required to
maintain a hybrid. None of the post hybridization
phosphate-containing buffers described in Amasino (1986)
were employed.
Chromosome walking strategy. A total genomic
DNA library of M. grisea strain 2539 consisting of 5,194
CA 02321950 2000-08-24
WO 99/43824 PC'T/US99/04047
- 24 -
clones was constructed in cosmid vector pMLFl (Leong et
al., 1994, supra) and pMLF2 (An et al., Gene 176: 93-96,
1996). Clones were templated individually as colony
blots as well as in pools in which the DNA was
restriction digested, electrophoresed and blotted. The
latter blots were used initially to identify candidate
pools containing hybridizing clones. Colony blots
derived from these pools were then screened. Steps were
performed using endclones prepared from the insert DNA by
digesting the cosmid clones with ApaI, which does not
digest the vector, and recircularizing the plasmid by
ligation. This procedure results in a derivative
containing DNA from each end of the insert (An et al.,
1996 supra). Liberation of both ends of the insert from
the vector was achieved by digesting with ApaI and NotI.
The required endclone was then identified by virtue of
its inability to hybridize with the previous cosmid in
the walk.
Transformation of virulent strain Guyll with
cosmids within the AVR1-C039 locus: Cosmids from within
the genetic interval containing AVR1-0039 were introduced
into Guyll using the transformation protocol described in
LEUNG et al. (1990). The procedure was modified as
follows: After the protoplasts were incubated in
complete medium (CM)+sorbitol, they were poured into 100
ml molten (45°C) CM+20% sucrose agar. The agar was then
poured into four petri plates. When the agar had
solidified (1 h) it was overlaid with 15 ml of 1.5% water
agar containing 800 E.cg/ml hygromycin B (300 ,ug/ml final
concentration).
Creation of frameshift mutations in open
reading frames at the AVR1-C039 gene locus. 1.05 kb
fragment was cloned into pBSKS IIf (pBSC039) to make the
first two clones. The mutant 1.05 kb fragments were then
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 25
cloned into pCB1004 a hygr vector from J. Sweigard
(Dupont). Plasmids were linearized by NotI digestion and
transformed into Guyll protoplasts.
Initial frameshift mutations were created in
ORFs 2 and 3 by digestion and relegation as follows:
Frameshift in ORF2~ The AccI site at
nucleotide (nt) position 499 was cut and the 2 nt 3'
overhangs were trimmed off with T4 DNA polymerase. The
site was then relegated resulting in the removal of 4 by
or a net frameshift of -2. The nucleotide sequence
changed from 5' CTAGACAGTCTACCTCTCTGCCA 3' (SEQ ID N0:9)
to 5' CTAGACAGTACCTCTCTGCCA 3' (SFQ ID NO:10).
Frameshift in ORFS 2 & 3~ The PfIMI site at nt
position 641 was cut and the 3 nt 3' overhang was trimmed
off with T4 polymerase. A klenow-filled HindIII fragment
containing the streptomycin resistance gene cassette from
pHP45S2 (Prentki and Kritsch, Gene 29: 303, 1984) was
legated to the flush-ended PfIMI fragment. The conserved
HindIII site was then digested and relegated. The net
effect was the substitution of the 3 nt in the PfIMI site
with 4 nt from the HindIII site. This created a net
frameshift of +1. The nucleotide sequence change was
from 5' CCAGCAGCCAATGCTTGGAAAGATTG 3' (SEQ ID NO:11) to
5' CCAGCAGCCAAAGCTTTGGAAAGATTG 3' (SEQ ID N0:12).
In the ~AccI construct, the peptide retains
only 19 as of its original sequence and is truncated
after 36 aa. The native ORF2 peptide is 77 aa. In the
~Pfl construct, the ORF2 peptide sequence is almost
unchanged except for the terminal 10 as and the resulting
peptide is 17 as longer. ORF3, on the other hand,
retains only 20 as from its N-terminal and terminates
after 31 aa.
The frameshift in ORF1 was created by "Quick
Change" site-directed mutagenesis (Stratagene) using
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 26 -
primers designed to introduce an extra G nucleotide after
the ATG:
P1: CAACGTACTAGAAATGGAGTAATAAGTACC (SEQ ID N0:13)
P2: GGTACTTATTAGTCCATTTCTAGTACGTTG (SEQ ID N0:14)
The mutagenesis basically abolished the ORF
completely.
Creation of ATG mutations in open reading
frames at the AVRI-C039 gene locus: The 1.05 kb fragment
containing AVR1-C039 was cloned into pCB1004 and
Quickchange mutagenesis (Stratagene) was used to make the
following mutant constructs:
L10RF1 (ATG->TTT): Start codon of ORF1 was eliminated by
quick change mutagenesis using a primer with the mutant
ATG sequence.
~ORF3 (ATG->TTT): Start codon of ORF3 was eliminated by
quick change mutagenesis using a primer with the mutant
ATG sequence.
The following clone was made but the mutant
allele has not yet been tested by transformation to
determine the phenotype.
~ORF2 (ATG->TTT): Start codon of ORF2 was eliminated by
quick change mutagenesis using a primer with the mutant
ATG sequence.
Results:
As mentioned above, a gene conferring cultivar-
specific interactions with rice cultivar C039 was
isolated from M, grisea strain 2539 using a map-based
cloning approach, followed by a 20-step chromosome walk.
The AVR1-C039 locus was delimited to a 1.05 kb region by
subcloning and transformation of Guyll, a strain normally
virulent on C039, to avirulence. The nucleotide sequence
of this 1.05 kb region of Chromosome 1 is set forth below
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 27 -
as SEQ ID NO:1:
SEQ ID NO: 1 (5' ~ 3')
GATCTGTAAA TTACATATAT TTATTTTGCC GCATTTTGCT AACCGCCTAT
TCTTTTTAAA ATTTTAACGA TTAAGAACGC AATTCAATTT TGCGTTCTAC
ACAAATTAAC AATTCGTCCA AAAGAGGTAT TTAAGCGAAG ATTTGGCATT
TTTTTAATCC ATTTTTAAAA AAATACATCT GCTTTAACCC ACCTTTGCCA
AGGGTACCCG GCTAGCATAG CCTTGGTTAC CAAAAACGGC TAAAGCTGTC
GATCTATACT ACATTCGGCG CTCTGAACAA CTAAGCAACA GCGAGGAGAT
T5
CACACCCTAA ATCATGCTGC TAGTAATGCG ATATAATGGC CAAACAACGT
ORF1~
ACTAGAAATG ACTAATAAGT ACCCAGTCAA GTCAACTTGC TGTAGTATTA
-ORF5 ORF2 ~
TATTTAACGA AGCGTCCATT TACTGCCAGG GCAAGTTTAT CAATGGGACC
T1
AGTGTTCTCC CTCCTCTGGA CAACTCAGTT CTTTGCAAAC GCTAGACAGT
CTACCTCTCT GCCACCATTT TTACTTTTCA AAAATTTACT CCTTGCCGCT
T4 ORF3
ACTGAAACTT CTACAATTGA AAGAGCCCAC AATGAAAGTC CAAGCTACAT
TCGCCACCCT TATCGCCCTT GCGGCTTACT TTCCAGCAGC CAATGCTTGG
T2
AAAGATTGCA TCATCCAACG TTATAAAGAC GGCGATGTCA ACAACATATA
TACTGCCAAT AGGAACGAAG AGATAACTAT TGAGGAATAT AAAGTCTTCG
ORF6~ ~ORF4
TTAATGAGGC CTGCCATCCC TACCCAGTTA TACTTCCCGA CAGATCGGTC
T3
CTTTCTGGCG ATTTTACATC AGCTTACGCT GACGACGATG AGTCTTGTTG
T6 ORF7~
ATCAATAAGA GTCCAGGTTG AA.AAATTCGCCACCATGGTA ATAGAGGGTT
ATTTATCTCG GAATAGCAGC CGTGTGTGCA ATTATCACGG CTGTTCCTCT
GCGATAGGGA TATTAGAAGC AGGACAAATT TACGGCAATA GCAACCAATT
GTCCTTGTCT ATGGATTCGC CCGTCGAATG GAGGCGACGG CGGATCC
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 28 -
DNA sequence analysis revealed four small open
reading frames of 45, 77, 89 and 69 amino acids in length
(ORF1, ORF2., ORF3, ORF4, respectively, as shown on SEQ ID
No. 1 above). The amino acid sequences encoded by the
four open reading frames are set forth below as Sequence
ID No's. 2, 3, 4 and 5, respectively. Three other open
reading frames were also identified (ORFS 5, 6, and 7,
set forth below as SEQ ID NOS: 6, 7 and 8, respectively.
AVR1-C039 ORFl (SEQ ID NO: 2)
MTNKYPVKST CCSIIFNEAS IYCQGKFING TSVLPPLDNS
VLCKR
AVR1-C039 ORF2 (SEQ ID NO: 3)
MGPVFSLLWT TQFFANARQS TSLPPFLLFK NLLLAATETS
TIERAHNESP SYIRHPYRPC GLLSSSQCLE RLHHPTL
AVR1-C039 ORF3 (SEQ ID NO: 4)
MKVQATFATL IALAAYFPAA NAWKDCIIQR YKDGDVNNIY
TANRNEEITI EEYKVFVNEA CHPYPVILPD RSVLSGDFTS
AYADDDESC
AVR1-C039 ORF4 (SEQ ID NO: 5)
MAGLINEDFI FLNSYLFVPI GSIYVVDIAV FITLDDAIFP
SIGCWKVSRK GDKGGECSLD FHCGLFQL
AVR1-C039 ORF5 (SEQ ID NO: 6)
MDASLNIILQ QVDLTGYLLV ISSTLFGHYI ALLAA
AVR1-C039 ORF6 (SEQ ID NO: 7)
MRPAIPTQLY FPTDRSFLAI LHQLTLTTMS LVDQ
AVR1-C039 ORF7 (SEQ ID NO: 8)
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 29 -
MVIEGYLSRN SSRVCNYHGC SSAIGILEAG QIYGNSNQLS
LSMDSPVEWR RRRI (continues beyond cloned DNA)
The sequence surrounding the ATG of ORF3
matched four out of five of the conserved bases found in
fungal translation start sites and contained a
hydrophobic amino terminus punctuated by a lysine in
position 2, and two putative cleavage sites for removal
of the signal peptide. A fourth open reading frame
(ORF4) was identified on the opposite strand. However,
the sequence surrounding that ATG contained only two
matches with the fungal translation start site consensus
sequence.
Site-directed mutations in ORF1, ORF2 and ORF3
were created in order to assess the roles of these ORFS
in conferring avirulence. The translation start codon of
each ORF was converted from ATG to TTT. In ORFs 1 and 3,
these mutations led to loss of avirulence. Frameshift
mutations in ORF1 and ORF3 also led to a loss of
avirulence, while the frameshift mutation of ORF 2 did
not. Taken together, these data indicate a role for ORF1
and ORF3 in conferring avirulence to M. grisea strain
2539 on rice cultivar C039.
The absence of a splice site and a lariat
sequence, as well as any putative TATA element
immediately upstream of the ATG of ORF1 may indicate that
ORF1 overlaps sequences critical to the promotion of
transcription of AVR1-0039.
EXAMPLE 2
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 30 -
Distribution of AVR1-C039 Homologs
in Diverse Isolates of Magrn~orthe ctrisea
The distribution of AVRI-C039 homologs was
investigated by probing a large sample of host-specific
forms of M. grisea with a segment of AVR1-0039 DNA, using
hybridization conditions such as those described in
Example 1. The results of this survey indicate that
isolates infecting rice, Digitaria and wheat largely lack
homologs of Avr-C039. However, homologs of the gene were
commonly found in Elutine (Setaria)-infecting isolates.
Moreover, a detailed analysis of the AVR1-C039 locus from
virulent rice isolate Guy 11 indicated that at least 20
Kb of DNA corresponding to and containing the AVR1-C039
locus of isolate 2539 was absent.
EXAMPLE 3
Improved Resistance to M. grisea Infection
in Rice Plants Sprayed with Bacterial
Epiphytes expressing ORF 3 of AVR1-C039
The ORF3 of AVRI-C039 described in Example 1
was transferred into a pET expression vector in
Escherichia coli. A suspension containing the
transformed E. coli was sprayed onto leaves of rice
plants carrying the corresponding R gene for AVR1-C039.
The plants were then inoculated with M. grisea isolate
Guy 11, which is a virulent strain on the plant cultivars
tested. As a control, plants were sprayed with an E.
coli suspension which did not contain the ORF-3 encoding
plasmid, then inoculated with isolate Guy 11.
Inoculated plants pre-treated with the ORF3-
expressing E. coli displayed reduced lesion size and
number as compared to inoculated control plants pre-
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
- 31 -
treated with E. coli lacking the ORF3-expressing plasmid.
These data support the role of ORF3 in conferring
avirulence in M. grisea.
EXAMPLE 4
Improved Resistance to M. grisea Infection
in Rice Plants Sprayed with Protein Encoded by
ORF 3 of AVR1-0039
The ORF3 of AVR1-0039 described in Example 1
was transferred into a pET expression vector in
Escherichia coli. Protein extracts from: IPTG-induced E.
coli cells carrying either the pET vector alone (control)
or the pET-ORF3 construct were tested for their effects
on virulence. The cellular protein extracts were
concentrated by ammonium sulfate precipitation. Cultivar
C039 was inoculated with virulent M. grisea strain Guyll
in combination with the concentrated protein extract to
give 5 x 105 conidia and 20 mg total protein extract in 10
ml sterile water.
Inoculated plants co-treated with the ORF3-
containing protein extract displayed reduced lesion size
and number as compared to inoculated control plants co-
treated with protein extract lacking ORF3. These data
further support the role of ORF3 in conferring avirulence
in M. grisea.
While certain of the preferred embodiments of
the present invention have been described and
specifically exemplified above, it is not intended that
the invention be limited to such embodiments. Various
modifications may be made thereto without departing from
the scope and spirit of the present invention, as set
forth in the following claims.
CA 02321950 2000-08-24
WO 99/43824 PCTNS99/04047
1
SEQUENCE LISTING
<110> Sally A. Leong
Mark L. Farman
<120> Cultivar Specificity Gene from the Rice
Pathogen Magnaporthe grisea, and Methods of Use
<130> WARF P98067W0
<150> US 60/075,925
<151> 1998-02-25
<160> 14
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 1047
<212> DNA
<213> Magnaporthe grisea
<400>
1
gatctgtaaattacatatatttattttgccgcattttgctaaccgcctattctttttaaa 60
attttaacgattaagaacgcaattcaattttgcgttctacacaaattaacaattcgtcca 120
aaagaggtatttaagcgaagatttggcatttttttaatccatttttaaaaaaatacatct 180
gctttaacccacctttgccaagggtacccggctagcatagccttggttaccaaaaacggc 240
taaagctgtcgatctatactacattcggcgctctgaacaactaagcaacagcgaggagat 300
cacaccctaaatcatgctgctagtaatgcgatataatggccaaacaacgtactagaaatg 360
actaataagtacccagtcaagtcaacttgctgtagtattatatttaacgaagcgtccatt 420
tactgccagggcaagtttatcaatgggaccagtgttctccctcctctggacaactcagtt 480
ctttgcaaacgctagacagtctacctctctgccaccatttttacttttcaaaaatttact 540
ccttgccgctactgaaacttctacaattgaaagagcccacaatgaaagtccaagctacat 600
tcgccacccttatcgcccttgcggcttactttccagcagccaatgcttggaaagattgca 660
tcatccaacgttataaagacggcgatgtcaacaacatatatactgccaataggaacgaag 720
agataactattgaggaatataaagtcttcgttaatgaggcctgccatccctacccagtta 780
tacttcccgacagatcggtcctttctggcgattttacatcagcttacgctgacgacgatg 840
agtcttgttgatcaataagagtccaggttgaaaaattcgccaccatggtaatagagggtt 900
atttatctcggaatagcagccgtgtgtgcaattatcacggctgttcctctgcgataggga 960
tattagaagcaggacaaatttacggcaatagcaaccaattgtccttgtctatggattcgc 1020
~
ccgtcgaatggaggcgacggcggatcc 1047
<210> 2
<211> 45
<212> PRT
<213> Magnaporthe grisea
<400> 2
Met Thr Asn Lys Tyr Pro Val Lys Ser Thr Cys Cys Ser Ile Ile Phe
1 5 10 15
Asn Glu Ala Ser Ile Tyr Cys Gln Gly Lys Phe Ile Asn Gly Thr Ser
20 25 30
Val Leu Pro Pro Leu Asp Asn Ser Val Leu Cys Lys Arg
35 40 45
<210> 3
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
2
<zll> 77
<2I2> PRT
<213> Magnaporthe grisea
<400> 3
Met Gly Pro Val Phe Ser Leu Leu Trp Thr Thr Gln Phe Phe Ala Asn
1 5 10 15
Ala Arg Gln Ser Thr Ser Leu Pro Pro Phe Leu Leu Phe Lys Asn Leu
20 25 30
Leu Leu Ala Ala Thr Glu Thr Ser Thr Ile Glu Arg Ala His Asn Glu
35 40 45
Ser Pro Ser Tyr Ile Arg His Pro Tyr Arg Pro Cys Gly Leu Leu Ser
50 55 60
Ser Ser Gln Cys Leu Glu Arg Leu His His Pro Thr Leu
65 70 75
<210> 4
<211> 89
<212> PRT
<213> Magnaporthe grisea
<400> 4
Met Lys Val Gln Ala Thr Phe Ala Thr Leu Ile Ala Leu Ala Ala Tyr
1 5 10 15
Phe Pro Ala Ala Asn Ala Trp Lys Asp Cys Ile Ile Gln Arg Tyr Lys
20 25 30
Asp Gly Asp Val Asn Asn Ile Tyr Thr Ala Asn Arg Asn Glu Glu Ile
35 40 45
Thr Ile Glu Glu Tyr Lys Val Phe Val Asn Glu Ala Cys His Pro Tyr
50 55 60
Pro Val Ile Leu Pro Asp Arg Ser Val Leu Ser Gly Asp Phe Thr Ser
65 70 75 80
Ala Tyr Ala Asp Asp Asp Glu Ser Cys
<210> 5
<211> 68
<212> PRT
<213> Magnaporthe grisea
<400> 5
Met Ala Gly Leu Ile Asn Glu Asp Phe Ile Phe Leu Asn Ser Tyr Leu
1 5 10 15
Phe Val Pro Ile Gly Ser Ile Tyr Val Val Asp Ile Ala Val Phe Ile
20 25 30
Thr Leu Asp Asp Ala Ile Phe Pro Ser Ile Gly Cys Trp Lys Val Ser
35 40 45
Arg Lys Gly Asp Lys Gly Gly Glu Cys Ser Leu Asp Phe His Cys Gly
50 55 60
Leu Phe Gln Leu
<210> 6
<211> 35
<212> PRT
<213> Magnaporthe grisea
<400> 6
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
3
Met Asp Ala Ser Leu Asn Ile Ile Leu Gln Gln VaI Asp Leu Thr Gly
1 5 10 15
Tyr Leu Leu Val Ile Ser Ser Thr Leu Phe Gly His Tyr Ile Ala Leu
20 25 30
Leu Ala Ala
<210> 7
<211> 34
<212> PRT
<213> Magnaporthe grisea
<400> 7
Met Arg Pro Ala Ile Pro Thr Gln Leu Tyr Phe Pro Thr Asp Arg Ser
1 5 10 15
Phe Leu Ala Ile Leu His Gln Leu Thr Leu Thr Thr Met Ser Leu Val
20 25 30
Asp Gln
<210> 8
<211> 54
<212> PRT
<213> Magnaporthe grisea
<400> 8
Met Val Ile Glu Gly Tyr Leu Ser Arg Asn Ser Ser Arg Val Cys Asn
1 5 10 15
Tyr His Gly Cys Ser Ser Ala Ile Gly Ile Leu Glu Ala Gly Gln Ile
20 25 30
Tyr Gly Asn Ser Asn Gln Leu Ser Leu Ser Met Asp Ser Pro Val Glu
35 40 45
Trp Arg Arg Arg Arg Ile
<210> 9
<211> 23
<212> DNA
<213> Magnaporthe grisea
<400> 9
ctagacagtc tacctctctg cca 23
<210> 10
<211> 21
<212> DNA
<213> Magnaporthe grisea
<400> 10
ctagacagta cctctctgcc a 21
<210> 11
<211> 26
<212> DNA
<213> Magnaporthe grisea
<400> 11
ccagcagcca atgcttggaa agattg 26
CA 02321950 2000-08-24
WO 99/43824 PCT/US99/04047
4
<210> 12
<21I> 27
<212> DNA
<213> Magnaporthe grisea
<400> 12
ccagcagcca aagctttgga aagattg 27
<210> 13
<211> 30
<212> DNA
<213> Magnaporthe grisea
<400> 13
caacgtacta gaaatggagt aataagtacc 30
<210> 14
<211> 30
<212> DNA
<213> Magnaporthe grisea
<400> 14
ggtacttatt agtccatttc tagtacgttg 30
