Note: Descriptions are shown in the official language in which they were submitted.
CA 02323526 2000-09-22
Formulation with papillomavirus-specific protein, its preparation and use
The present invention relates to a formulation comprising at least one
papilloma
virus-specific protein with about 0.3 to about 4M of a salt at a pH of about
7.3 to
about 7.45.
Papillomaviruses, also called wart viruses, are double-stranded DNA viruses ha-
ving a genome size of approximately 8000 base pairs and an icosahedron-like
to capsid having a diameter of about 55 nm. To date, more than 100 different
human
papillomavirus types are known, of which some, e.g. HPV-16, HPV-18, HPV-31,
HPV-33, HPV-39, HPV-45, HPV-52 or HPV-58, can cause malignant tumours
and others, e.g. HPV-6, HPV-11 or HPV-42, can cause benign tumours.
The genome of the papillomaviruses can be subdivided into three areas: the
first
area concerns a non-coding region which contains regulation elements for the
transcription and replication of the virus. The second region, the so-called E
(ear-
ly) region, contains various protein-coding sections E 1-E7, of which, for
example,
the E6 and the E7 protein are responsible for the transformation of epithelial
cells
2o and the E 1 protein controls the DNA copy number. The E6 region and E7
region
are so-called oncogenes, which are also expressed in malignantly degenerate
cells.
The third region, also called the L (late) region, contains two protein-coding
secti
ons L1 and L2, which code for structural components of the virus capsid. The
L1
protein is present to over 90% in the viral capsid, the ratio of L1:L2 in
general
being 30:1.
HPV-6 and HPV-11 have been held responsible, inter alia, for genital warts;
some
papillomavirus types such as HPV-16, HPV-18, HPV-31, HPV-33, HPV-39,
HPV-45, HPV-52 and HPV-58 are associated with malignant tumours of the ano-
3o genital tract. In over 50% of the cases, HPV-16 is connected with cervical
cancer
CA 02323526 2000-09-22
-2-
(carcinoma of the cervix). HPV-16 is the main risk factor for the formation of
cervical neoplasias. In addition, the immune system plays an important role in
the
progress of the disease. Thus cellular immune responses and in particular
antigen-
specific T lymphocytes are supposedly important for the defence mechanism. It
has furthermore been found that in high-grade cervical intraepithelial
neoplasias
(CIN II/III) and cervical tumour the E7 gene is expressed constitutively in
all lay-
ers of the infected epithelium. The E7 protein is therefore considered as a
potenti-
al tumour antigen and as a target molecule for activated T cells. The E7-
induced
cellular immune response in the patient, however, is apparently not strong
enough
"' to to influence the course of the disease. The immune response can possibly
be am-
plified by suitable vaccines.
It has now been possible to show that the expression of the L1 gene or the
coex-
pression of the L1 and L2 gene forms virus-like particles (VLPs). It was
possible
to use the VLPs for the formation of neutralizing antibodies in various animal
systems. The formation of virus-neutralizing antibodies, however, is of
relatively
low clinical importance if the virus infection has already taken place, since
for the
elimination of virus-infected cells a virus-specific cytotoxic T-cell (CTL)
respon-
se appears to be necessary. So-called chimeric papillomavirus-like particles
(CVLPs) were therefore developed which consist of a chimeric L1-E7 protein
(Miiller, M. et al. (1997) Virology, 234, 93): some CVLPs induce an E7-
specific
CTL response in mice, although experiments failed to induce antibodies against
E7 by immunization of mice with CVLPs (Miiller, M. et al. ( 1997), supra). In
addition, neutralizing antibodies of HPV-associated disorders in patients
appear to
limit the immune response to administered L1 protein (Miiller, M. et al.
(1997),
supra). CVLPs, however, are still of interest for the development of a
vaccine, as
the E7 proteins of tumour cells presented via MHC molecules of class I would
represent target molecules of CTLs.
3o Peng et al. (1998) Virology, 240, 147 now describe CVLPs consisting of
C-terminally truncated L1 of the bovine papillomavirus (BPV) and
CA 02323526 2000-09-22
-3-
HPV-16E7a9_5~, which induce E7-specific cytotoxic T cells after inoculation of
C57B116 mice and protect against the growth of E7-expressing tumours. Green-
stone et al. (1998) Proc. Natl. Acad. Sci. USA, 95, 1800 describe CVLPs consi-
sting of HPV-16L1 plus HPV-16L2 fused to the full-length HPV-16E7 protein,
which protect against the growth of epithelial E7-expressing tumour cells
after
immunization of C57B1/6 mice, cytotoxic T cells, however, not being detected
and thus the induction of the immune response appearing to be less efficient.
VLPs and CVLPs are in general prepared by means of genetic engineering by
expression of the corresponding genes coding for one or more L proteins or L
and
E proteins in suitable expression systems. The corresponding genes are
described,
for example, in Kirnbauer, R. et al. (1994) J. Virol., 67, 6929-6936 or
obtainable
via the EMBL databank. The accession numbers are, for example, for HPV 18:
PAPHPV 18; for HPV31: PAPPPH31; for HPV33: PAPPPH33 or for HPV~8:
PAPPPH58. Suitable expression systems are, for example, yeasts modified by
genetic engineering, e.g. Saccharomyces (cerevisiae), Pichia (pastoris),
Kluyver-
myces (lactis), Schizosaccharomyces (pombe) or Hansenula (polymorpha) (Car-
ter, J. J. et al. (1991), Virology, 182, 513), insect cells, such as, for
example,
Trichoplusia ni High Five (see, for example, Miiller, M. et al. (1997), supra)
or
prokaryotic cells (see, for example, WO 96/11272). In the case of the
production
of the particles in prokaryotic cells, these are in general deposited in the
cell and
form so-called inclusion bodies, which then have to be renatured and brought
into
solution. For use of the particles or capsids produced by genetic engineering
or
their precursors, the so-called capsomers, further purification steps are
necessary
after expression.
A significant problem in the use of capsids and capsomers as medicaments is
their
poor solubility. Thus, for example, capsids or capsomers of HPV-16 tend to ag-
gregate, whereby the solubility is significantly reduced. The low solubility
of the
capsids or capsomers in some cases leads not only to a loss of yield, but also
to
3o complicated use as a medicament or diagnostic. Moreover, sometimes
degradation
CA 02323526 2000-09-22
-4-
of the C terminus of the L 1 protein can be observed, which leads to
inhomogene-
ous material which is not suitable for licensing as a medicament or
diagnostic.
WO 98/44944 describes an HPV antigen formulation comprising a vaccine com-
ponent, a salt to physiologically acceptable concentrations and a non-ionic
deter-
gent to physiologically acceptable concentrations.
It was therefore the object of the present invention to make available a
simple and
advantageous formulation in which papillomavirus-specific proteins are soluble
1o and stable.
It has now surprisingly been found that the solubility of papillomavirus-
specific
proteins is dependent on the salt concentration and on the pH of the
formulation.
In particular, it was surprising that a composition without addition of an
excipient
is not stable at neutral pH in an isotonic salt solution of about 100-150 mM
salt,
although VLPs or CVLPs are formed in the cytoplasm of the host cells. In
additi-
on, it was found according to the present invention that at a pH of less than
about
5.5 the CVLPs precipitate and at a pH of greater than 9.5 the CVLPs aggregate.
2o One subject of the present invention is therefore a formulation comprising
at least
one late protein (L protein) of one or more papillomaviruses and/or at least
one
early protein (E protein) of one or more papillomaviruses and about 0.3 to
about
4 M, preferably about 0.4 to about 2.5-3 M, in particular about 0.4-0.5 to
about
1-2 M, especially about 1 to about 2 M, of a salt at a pH of about 7.3 to
about
7.45, preferably about 7.4, and, if appropriate, suitable additives and/or
excipients,
preferably without any additive and/or excipient.
The term "formulation" is understood according to the present invention as mea-
ning a composition in the form of a solution or a suspension of the
papillomavi-
3o rus-specific proteins mentioned, where immunoreactive papillomavirus-
specific
CA 02323526 2000-09-22
-5-
proteins in general and in particular do not significantly sediment at up to
at most
about 5000 g.
The salt is in general an alkali metal or alkaline earth metal salt,
preferably a hali-
de or phosphate, in particular an alkali metal halide, especially NaCI and/or
KCI.
Use of NaCI is particularly preferred for the production of a pharmaceutical
for-
mulation.
The pH of the composition is in general adjusted using a suitable organic or
inor-
1o ganic buffer, such as, for example, preferably using a phosphate buffer,
tris buffer
(tris(hydroxymethyl)aminomethane), HEPES buffer
([4-(2-hydroxyethyl)piperazino]ethanesulphonic acid) or MOPS buffer
(3-morpholino-1-propanesulphonic acid). The choice of the respective buffer in
general depends on the desired buffer molarity. Phosphate buffer is suitable,
for
example, for injection and infusion solutions.
For the use of the composition according to the invention as a medicament or
dia-
gnostic it is particularly preferred if the papillomavirus-specific proteins
contain
no papillomavirus-unspecific epitopes, since hereby a papillomavirus-
unspecific
2o immune response can be reduced or prevented.
The terms L protein and E protein are understood within the meaning of the pre-
sent invention as meaning both the full-length proteins and their mutants,
such as,
for example, deletion mutants.
In a further preferred embodiment, the composition according to the invention
contains a deleted L protein, preferably a deleted L1 and/or L2 protein. The
dele-
tion has the advantage that different proteins, for example papillomavirus-
specific
E protein sequences, can be inserted into the deleted area, whereby the
application
3o area of the composition according to the invention can be widened. An L
protein
having a C terminal deletion and in particular a C-terminally deleted L1
protein is
CA 02323526 2000-09-22
-6-
particularly preferred. The C-terminal deletion has the advantage that the
efficien-
cy of the formation of virus-like particles can be increased, since the
nuclear loca-
tion signal located at the C terminus is deleted. The C-terminal deletion is
therefo-
re preferably up to about 35 amino acids, in particular about 25 to about 35
amino
acids, especially about 32 to 34 amino acids. For example, a C-terminal
deletion
of the HPV-16 L1 protein 32 amino acids long and a C-terminal deletion of the
BPV-1 L1 protein (bovine papillomavirus type 1) about 26 amino acids long is
adequate to be able to increase the formation of virus-like particles by at
least
about 10-fold.
to
In a further preferred embodiment, the E protein is also deleted, especially
the E6
and/or E7 protein. It is particularly preferred if the C,'-terminal part of
the E protein
is deleted, preferably the C-terminal part of the E7 protein, as these
constructs can
preferably form capsomers and/or capsids in combination with deleted L
protein.
Deletions of up to about 55 amino acids are particularly preferred, preferably
about 5 to about 55 amino acids, in particular about 38 to about 43 amino
acids.
A particularly preferred construct is, for example, E7 having the N-terminal
ami-
no acids 1 to about 60, as this construct contains a mouse epitope for the
activati-
on of cytotoxic T lymphocytes, which is located in the area of the amino acids
49-57. Another preferred construct is E7 having the N-terminal amino acids I
to
about 55, which preferably forms capsomers and capsids in combination with de-
leted L protein, as this construct presumably does nut contain E7-specific
sequen-
ces in the area of the amino acids 56-70, which can interfere with the
formation of
capsids. An Ll protein of HPV-16 C-terminally deleted by 32 amino acids and
which is linked to an E7 protein of HPV-16 having the amino acids 1-55 or 1-60
is particularly preferred. These constructs not only induce neutralizing
antibodies
or a specific CTL response, but on the one hand prevent the formation of
tumours
and on the other hand cause regression of already existing tumours in animal
ex-
periments. E7 having the amino acids 1-60 especially exhibits a marked prophy-
lactic and therapeutic action in tumours. A particularly preferred embodiment
of
CA 02323526 2000-09-22
-7_
the present invention is therefore an L1~E71_r fusion protein, preferably in
the
form of a CVLPS, in particular of HPV 16, x being an integer from 55 up to and
including 60, and in particular an LlaCE7~_55 or L1~CE7i-6o fusion protein.
For the production of a medicament which is active both prophylactically and
therapeutically, it is preferred if the protein is bonded to the E protein,
for ex-
ample in the form of a fusion protein. It is furthermore preferred if the
described
papillomavirus-specific proteins are present in the form of a capsid and/or
capso-
mer, since the immune reaction can additionally be markedly increased by the
to capsids and/or capsomers and in particular by the fraction of L protein.
Preferred
fusion proteins which are suitable for capsid and/or capsomer formation are
there-
fore, for example, fusion proteins from deleted L1 and E7, E6 and/or El.
Capsids within the meaning of the present invention are viral or virus-like
structu-
res in a generally icosahedral form, which in general are constructed of about
72 capsomers.
Capsomers within the meaning of the present invention are assembled proteins
comprising at least one papillomavirus structural protein, preferably L 1 or
deleti-
ons of L1. For example, 5 fusion proteins can be assembled to give a capsomer
which in turn can be assembled to give a capsid.
For the production of a human medicament or diagnostic, proteins or peptides
of
the human papillomavirus (HPV) and preferably of HPV-6, HPV-11, HPV-16,
HPV-18, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-52 and/or HPV-58,
in particular HPV-16, HPV-18, HPV-31 and/or HPV-45 are suitable for the con-
structs described. Especially for the production of a combination vaccine, it
is
advantageous to combine proteins or peptides from various HPV types, for ex-
ample a combination of HPV-16 and HPV-18 or HPV-18, HPV-31, HPV-45 and
3o HPV-58 in the case of, for example, carcinoma of the cervix or HPV-6 and
HPV-11 in the case of, for example, condylomas.
CA 02323526 2000-09-22
_g_
The expression vectors can be, for example, prokaryotic or eukaryotic
expression
vectors. Examples of prokaryotic expression vectors are, for expression in E.
coli,
e.g. the vectors pGEM or pUC derivatives (see, for example, WO 96/11272). Ex-
amples of eukaryotic expression vectors are, for expression in Saccharomyces
cerevisiae, e.g. the vectors p426Met25 or p426GALl (Mumberg et al. (1994)
Nucl. Acids Res., 22, 5767-5768, Carter, J. J. et al. (1991) supra) and, for
expres-
sion in insect cells, e.g. Baculovirus vectors, in particular the Autographa
Califor-
nica virus, such as disclosed in EP-Bl-0 127 839 or EP-B1-0 549 721 (see, for
example, also WO 94/20137), and, for expression in mammalian cells, e.g. the
l0 vectors Rc/CMV and Rc/RSV or SV40 vectors which are all generally
obtainable.
However, commercially obtainable Baculovirus expression systems are also sui-
table, such as, for example, the Baculo GoldTT'' transfection kit from
Pharmingen
or the Bac-to-BacTM Baculovirus expression system from Gibco BRL. Further
suitable expression systems are recombinant vaccinia viruses (see, for example
t5 WO 93/02184).
In general, the expression vectors also contain promoters suitable for the
respecti-
ve host cell, such as, for example, the trp promoter for expression in E. coli
(see,
for example, EP-B1-0 154 133), the ADH2 promoter for expression in yeasts
20 (Russel et al. (1983), J. Biol. Chem. 258, 2674-2682), the Baculovirus
polyhedrin
promoter for expression in insect cells (see, for example EP-Bl-0 127 839 or
U.S. 5,004,687) or the early SV40 promoter or LTR promoters, e.g. of MMTV
(mouse mammary tumour virus; Lee et al. (1981) Nature 214, 228-232).
25 Suitable host cells are, for example, the E. coli strains DHS, HB101 or
BL21, the
yeast strains Saccharomyces cerevisia, Pichia, Kluyvermyces,
Schizosaccharomyces
or Hansenula (Carter, J. J. et al. (1991), Virology, 182, 513), the insect
cell line
Lepidopteran, e.g. from Spodoptera frugiperda, Trichoplusia ni, Rachiplusia ou
or
Galleria Mellonela or the animal cells COS, C127, Vero, 293 and HeLa, which
3o are all generally obtainable (see, for example, WO 94/00152).
CA 02323526 2000-09-22
-9-
The coding nucleic acids for the individual papillomavirus-specific proteins
can
be isolated and cloned, for example, from a gene bank by means of a PCR (poly-
merase chain reaction) amplification. For example, the genome of BPV-1 is gene-
rally obtainable under the GenBank Accession No. X02346 or HPV-16 under the
GenBank Accession No. K02718. An HPV-16 L1 sequence is also disclosed, for
example, in WO 94/05792. The sequence of the 98 amino acid-long HPV 16
E7 protein is described, for example, in Seedorf et al. (1985) Virology, 145,
181-
185. Another method of obtaining the desired nucleic acids is to isolate the
papil-
lomavirus-specific genes directly from warts or tumours by means of PCR. Sui-
1o table primers for the E6 and E7 genes from HPV-16 and HPV-18 are disclosed,
for example, in WO 93/21958. Further references for the desired nucleic acids
are,
for example, Kirnbauer, R. et al. (1994), supra or the clones deposited in the
EMBL databank already mentioned above.
In a further preferred embodiment, the expression vector is constructed such
that
the expressed fusion protein is extended by no further amino acids caused by
the
vector. This is achieved, for example, by removing undesired nucleotides which
code for additional amino acids by mutagenesis in a PCR reaction by means of
suitable primer oligonucleotides (Ho et al. (1989) Gene, 77, 51-59). In this
way, a
fusion protein is obtained which is free of additional amino acids and thus
free of
2o possible additional foreign epitopes which can cause immunological side
reacti-
ons.
After the expression of the described fusion protein, it is preferred to
purify this
further or to renature it. Examples of chromatographic purification processes
are
found in Hjorth, R. & Moreno-Lopez, L. (1982) J. Virol. Meth. 5, 151; Nakai,
Y.
et al. (1987) J. Gen. Virol., 68, 1891; Hofmann, K. J. et al. (1995) Virology,
209,
506; Rose, R. C. et al. (1993) J. Virol., 67, 1936, Sasagawa, T. et al. (1995)
Viro-
logy, 206, 126 or WO 95/31532..
3o Suitable additives and/or excipients which serve, for example, for the
further sta-
bilization of the papillomavirus-specific protein in the composition according
to
CA 02323526 2000-09-22
- 10-
the invention are, for example, detergents, such as, for example, Triton X-100
or
sodium deoxycholate, but also polyols, such as, for example, polyethylene
glycol
or glycerol, sugars, such as, for example, sucrose or glucose, zwitterionic
com-
pounds, such as, for example, amino acids such as glycine or in particular
taurine
or betaine and/or protein, such as, for example, bovine or human serum
albumin.
Detergents, polyols and/or zwitterionic compounds are preferred.
Other suitable additives and/or excipients are protease inhibitors, such as,
for ex-
ample, aprotinin, E-aminocaproic acid or pepstatin A.
Another subject of the present invention is a process for the production of
the
formulation according to the invention, in which the papillomavirus-specific
pro-
tein described above is introduced, for example, into solution comprising
about
0.3 to about 4 M, preferably about 0.4 to about 2.5-3 M, in particular about
t5 0.4-0.5 to about 1-2 M, especially about 1 to about 2 M, of a salt at a
suitable pH
of about 7.3 to about 7.45, preferably about 7.4, and, if appropriate,
suitable addi-
tives and excipients, andlor is dialysed against the described composition.
The
formulation can preferably be stably stored at about 4°C or especially
about -
80°C over a relatively long period of time, for example 1-2 months or
longer.
The formulation according to the invention is suitable as a medicament or
diagno-
stic. The present invention therefore also relates to the use of the
formulation ac-
cording to the invention as a medicament or diagnostic. For the immediate use
as
a medicament or diagnostic, the formulation according to the invention is pre-
ferably adjusted to a concentration of about 0.45 M. In particular, it is
preferred if
the medicament contains no adjuvant, i.e. no substance which amplifies the im-
munogenicity of the papillomavirus-specific protein, since the immunogenicity
is
already adequately amplified, in particular in the presence of an L protein
espe-
cially of Ll. This property is particularly advantageous in the licensing as a
medi-
cament or diagnostic, as the only immunostimulating materials at present
licensed
by the licensing authorities are aluminium salts.
CA 02323526 2000-09-22
-11-
The medicament is particularly suitable for the avoidance and/or treatment of
pa-
pillomavirus-specific benign or malignant tumour, in particular of malignant
tu-
mour, such as, for example, carcinoma of the larynx, cervix, penis, vulva or
anus,
and the diagnostic for the diagnosis of one or more papillomavirus infections.
An
example of a diagnostic is the immunodiagnostic known to the person skilled in
the art, for example an ELISA for the measurement of papillomavirus-specific
antibodies (see, for example, Voller, A. et al. (1976) Bull. World Health
Organ.,
53, 55-63) or a skin test according to, for example, Hopfl et al. (1991)
Lancet. l,
373-374).
In general, the medicament can be administered orally, parenterally, such as,
for
example, subcutaneously, intramuscularly or via the mucous membrane, in liquid
or suspended form, in the form of an elixir or as capsules, preferably as an
injec-
tion or infusion solution. In the case of the formulations according to the
inventi-
on, an adjuvant can be dispensed with, which is particularly advantageous.
A further subject of the present invention therefore relates to the use of the
for-
mulation according to the invention as an injection ar infusion solution.
2o Injection solutions are in general used if only relatively small amounts of
a soluti-
on or suspension, for example about 1 to about 20 ml, are to be administered
to
the body. Infusion solutions are in general used if a larger amount of a
solution or
suspension, for example one or more litres, are to be administered. Since, in
con-
trast to the infusion solution, only a few millilitres are administered in the
case of
injection solutions, small differences from the pH and from the osmotic
pressure
of the blood or the tissue fluid in the injection do not make themselves
noticeable
or only make themselves noticeable to an insignificant extent with respect to
pain
sensation. Dilution of the formulation according to the invention before use
is
therefore in general not necessary. In the case of the administration of
relatively
large amounts, however, the formulation according to the invention should be
diluted briefly before administration to such an extent that an isotonic
solution can
CA 02323526 2000-09-22
- 12-
be obtained. An example of an isotonic solution is a 0.9% strength sodium
chlori-
de solution. In the case of infusion, the dilution can be carried out, for
example,
using sterile water while the administration can be carried out, for example,
via a
so-called bypass.
The significant advantage of the present invention is that the formulation
accor-
ding to the invention essentially does not lead to precipitation of immuno-
reactive
papillomavirus-specific protein. In particular, more than about 90%,
especially
more than about 95%, of the protein remains in solution and does not
precipitate
1o for a period of time of at least about 12 hours. The immunoreactive
papillomavi-
rus-specific protein is also not substantially sedimentable by centrifugation
at a
maximum of 5000 g. In addition, the formulation remains homogeneous and sta-
ble over a relatively long period of time of about 1-2 months and longer.
The figure and the following examples are intended to illustrate the invention
in
greater detail without restricting it.
Fig. 1 shows graphically the dependence of the solubility of virus-like
particles on
the salt concentration.
Examples
1. Preparation of chimeric Qenes coding for HPV 16L 1 E7 fusion proteins
HPV 16L1~C* E7 1-55 was prepared according to Miiller, M. et al. (1997),
supra.
The HPV-16L1 open reading frame (ORF) was in this case excized from the
plasmid HPV-16-114/k-L1/L2-pSynxtVI- (Kirnbauer, R. et al. (1994) J. Virol.
67,
6929) using the restriction endonuclease BgIII and cloned into the BamHI site
in
the vector pUCl9 (New England Biolabs).
For the preparation of HPV-l6Ll~C, two primers were constructed which are
complementary to HPV-16L1 ORF. The first primer has the sequence
CA 02323526 2000-09-22
-13-
AAAGATATCTTGTAGTAAAAATTTGCGTCCTAAAGGAAAC
and the second primer
AAAGATATCTAATCTACCTCTACAACTGCTAAACGCA~AAA.AACG.
Both primers encode an EcoRV restriction enzyme cleavage site 5'. In the
primers
lying downstream, a TAA translation stop codon follows the EcoRV site in order
to delete the last 34 amino acids of the HPV16L1 ORF. The PCR reaction was
carried out in order to amplify the entire L1 ORF and the entire vector. The
linear
product was cleaved with EcoRV, circularized with T4 DNA ligase and transfor-
1o med E. coli DHSa cells. The clones were analysed for the presence of an
EcoRV
site. The construct pUCHPV16L10C obtained was used in order to clone the ORF
of HPV16E7 1-50 into the EcoRV site.
For the cloning of the fragment, primers having a 5'EcoRV restriction enzyme
cleavage site were used. The following primer pair was used:
AAA.AGATATCATGCATGGAGATACACCTACATTGC
and
TTTTGATATCGGCTCTGTCCGGTTCTGCTTGTCC.
2o The PCR products were cleaved with EcoRV and inserted into the EcoRV site
of
the modified L1 gene.
For the elimination of the EcoRV sites, two PCR reactions were carried out in
order to amplify two overlapping fragments of the clone pUC-HPV16L10CE7
1-50. The resulting DNA fragments overlapped in the position of the L1IE7 boun-
dart' (Four Primer PCR, Ho, S. N. et al ( 1989) Gene 77, 51 ). However, the
pri-
mers did not contain the two EcoRV restriction enzyme cleavage sites. Frag-
ment 1 was prepared using the primers P1 and P2 and fragment 2 using the pri-
mers P3 and P4.
CA 02323526 2000-09-22
- - 14-
P 1: GTTATGACATACATACATTCTATG (L 1 )
P2: CCATGCATTCCTGCTTGTAGTAAAAATTTGCGTCC (E7)
P3: CTACAAGCAGGAATGCATGGAGATACACC (E7)
P4:CATCTGAAGCTTAGTAATGGGCTCTGTCCGGTTCTG (E7)
A tenth of the purified products was mixed and used as a matrix in the PCR
reac-
tion with the primers P 1 and P4 exclusively. The resulting product was
cleaved
using EcoNI (L1) and HindIII (downstream of the stop codon on the primer P4)
and used in order to replace an EcoNI/HindIII fragment of the cloned
1o HPV16L10RF. The resulting clone therefore differs from the clone
HPVI6Ll~CE7 1-SO by the loss of the two internal EcoRV restriction enzyme
cleavage sites and the corresponding non-HPV amino acids Asp and Ile between
the L 1 ORF and E7 and downstream of E7. The first EcoRV site was replaced by
the original L1 amino acids in this position (AlaGly). The second EcoRV site
was
t5 replaced by a translation stop signal. This clone (HPVI6Ll~C*E7 1-52)
additio-
nally contains the first 52 amino acids of HPV 16E7. Clone HPV l6LlOC*E7 1-52
was used for the preparation of the clones HPV16L.10C*E7 1-55 with the aid of
the primer P 1 in combination with PS.
2o P5: CATCTGAAGCTTATCAATATTGTAATGGGCTCTGTCCG (E7 1-55)
In all cases, EcoNI and HindIII were used in order to replace the
corresponding
fragments. The clones were analysed by DNA sequencing.
25 2. Preparation of recombinant baculoviruses
Spodoptera frugiperda (Sf~) cells were used as a monolayer or in suspension
cul-
ture in TNM-FH insect medium (Sigma, Deisenhofen) with 10% foetal calf serum
and 2 mM glutamine. Recombinant baculoviruses HPV16L1~CE7 1-SS were
3o transfected by cotransfection of 10 pg of the recombinant plasmids and 2 pg
of
linearized Baculo-Gold DNA (Phanningen, San Diego, CA) into S~ cells. Re-
CA 02323526 2000-09-22
-15-
combinant viruses were purified according to the instructions of the
manufacturer.
In order to test the expression, 106 Sf~ cells were infected with recombinant
Baculovirus and an m.o.i. (multiplicity of infection) of 5 to 10. After the
incubati-
on, the medium was removed and the cells washed with PBS (140 mM NaCI,
2.7 mM KC1, 8.1 mM Na2P04, 1.5 mM KHzP04, pH 7.2). The cells were then
lysed in SDS sample buffer and tested by SDS gel chromatography and immuno-
blot assay.
3. Purification of virus-like particles
For the preparation of CVLPs, Trichoplusia ni (TN) High Five cells were
cultured
at 27°C up to a density of 1-1.5 x 106 cells per ml in Ex-Cell 405
serum-free me-
dium (JRH, Biosciences, Lennexa, KS). A 400 ml culture was harvested and in-
fected with an m.o.i. of 2 to S with recombinant baculoviruses for one hour
with
periodic inversions. Up to 240 ml of medium were added and the cells grew for
3
to 4 days. The cells were then pelleted and resuspended in 10 ml of extraction
buffer (25 mM tris/HCI, pH 7.5; 500 mM NaCI, 1 mM EDTA) and sonicated for
45 seconds at 60 watts. After centrifugation at 10,000 rpm in a Sorvall SS34
rotor,
the pellet was dissolved in 6 ml of extraction buffer, sonicated for 30
seconds at
60 watts and centrifuged again. The supernatants were combined and applied to
a
two-stage gradient of 40% (w/v) sucrose and 57.5% (w/v) CsCI. After centrifuga-
tion in an SW-28 rotor at 27,000 rpm for two hours, the interphase and the
CsCI
layer were collected, adjusted to a CsCI density of 1.38 g/ml and centrifuged
at
45,000 rpm for 16 hours. The gradients were fractionated and each fraction was
tested by Western blot using anti-HPV16L1mAb Camvirl (Pharmingen,
San Diego, CA). The reactive fractions were combined and dialysed by means of
an ultrafiltration using a Centricon 30 microconcentrator (Amicon Corp.
Beverly,
MA) against Hepes buffer ( 1 mM Hepes, 149 mM NaCI, 0.5 mM KCI, pH 7.2)
and the presence of CVLPs was confirmed by means of transmission electron
3o microscopy. The concentration of L1E7 protein was determined approximately,
in
CA 02323526 2000-09-22
- 16-
an SDS gel which was stained with Coomassie blue, by comparison with
BSA standards.
4. Microdialysis experiments
The sample used was a fraction containing virus-like particles which had been
isolated from High Five cells by sucrose cushion and caesium chloride
equilibri-
um ultracentrifugation. The total protein concentration was 0.29 mg/ml and the
CVLP concentration 0.17 mg/ml.
40 ml of the corresponding solution were introduced into a 50 ml plastic
vessel
with a screw closure. On this solution was carefully placed a dialysis filter
having
a pore diameter of 0.025 Vim, which floats on the liquid during the carrying-
out of
the dialysis. 30 pl of the pure CVLP solution were pipetted onto this filter
and the
~5 vessel was sealed. The vessel was allowed to stand at 4-6°C for at
least 12 hours
so that the solution of the drop was exchanged for the dialysis solution (50
mM
tris/HCI, pH 7.5 with increasing NaCI concentration). The drop was removed
using the piston pipette and it was equalized with 3() p,l of reservoir
solution. After
centrifugation at 10,000 g (10 min, 4°C), the supernatant was
investigated in the
2o ELISA (Kemeny, D. M. (1994) indirect ELISA from: ELISA, use of the enzyme-
linked immunosorbent assay in the biologicaUmedicinal laboratory, Gustav Fi-
scher Verlag, Stuttgart, p. 111, Test 6.2) using a conformation-specific
monoclo-
nal antibody against HPV16L1 and in a protein assay. The protein concentration
was determined using a bicinchoninic acid assay (Smith, P. K. et al. (1985)
Anal.
25 Biochem., 150, 76-85) against bovine serum albumin as a standard. The
result is
shown in Fig. 1.
CA 02323526 2000-09-22
Sequence Listing
< 110> MediGene Aktiengesellschaft
<120> Formulation having a papilloma virus-specific protein, and the pro-
duction and use thereof
to <150> 198 12 940.8
<151> 1998-03-24
<160> 9
i 5 < 170> FastSEQ for Windows Version 3.0
<210> 1
<211 > 40
<212> DNA
20 <213> artificial sequence
<220>
<223> Oligonucleotide PCR-primer that introduces a restriction site.
25 <400> 1
aaagatatct tgtagtaaaa atttgcgtcc taaaggaaac 40
<210> 2
30 <211 > 44
<212> DNA
<213> artificial sequence
<220>
35 <223> Oligonucleotide PCR-primer that introduces a restriction site.
<400> 2
aaagatatct aatctacctc tacaactgct aaacgcaaaa aacg 44
<210> 3
<211> 35
<212> DNA
<213> artificial sequence
CA 02323526 2000-09-22
-2-
<220>
<223> Oligonucleotide PCR-primer that introduces a restriction site.
<400> 3
to aaaagatatc atgcatggag atacacctac attgc 35
<210> 4
<211> 34
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide PCR-primer that introduces a restriction site.
<400> 4
ttttgatatc ggctctgtcc ggttctgctt gtcc 34
<210> 5
<211> 24
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide primer for "Four primer PCR"
<400> 5
gttatgacat acatacattc tatg 24
<210> 6
<211> 35
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide primer for "Four primer PCR"
a5 <400> 6
ccatgcattc ctgcttgtag taaaaatttg cgtcc 35
<210> 7
so <211> 29
i
CA 02323526 2000-09-22
-3-
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide primer for "Four primer PCR"
<400> 7
ctacaagcag gaatgcatgg agatacacc 29
<210> 8
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide primer for "Four primer PCR"
<400> 8
catctgaagc ttagtaatgg gctctgtccg gttctg 36
<210> 9
<211> 38
<212> DNA
<213> artificial sequence
<220>
<223> Oligonucleotide PCR-primer that introduces three additional codons
for a C-terminal extension of the coded fusion protein.
<400> 9
catctgaagc ttatcaatat tgtaatgggc tctgtccg 38
