Note: Descriptions are shown in the official language in which they were submitted.
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
REGULATED TARGET EXPRESSION FOR SCREENING
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority under 35 U.S.C. ~ 119(e) to the following
U.S. Provisional Patent applications: 60/098,563, filed April 14, 1998;
60/082,952, filed April 24, 1998; 60/100,430, filed July 10, 1998; 60/105,441,
filed October 23, 1998; 60/105,447, filed October 23, 1998; 60/117,758, filed
January 29, 1999 and 60/117,955, filed January 29, 1999. The disclosures of
all
of these applications are hereby incorporated by reference herein in their
entireties.
TECHNICAL FIELD
This invention is in the field of drug screening and drug discovery. More
particularly, techniques of microbial genetics are utilized to provide methods
and
compositions for identifying targets and screening candidate therapeutics.
BACKGROUND
Many methods exist for the discovery of novel therapeutic agents, such as
antibiotics. Cell-free, target-based assays often identify potent target
inhibitors,
but inhibitors identified in this fashion often exhibit no activity or only
poor
activity against whole cells. See, for example, Isaacson ( 1994} Exp. Opin.
Investig. Drugs 3:83-91; J. Sutcliffe and N. Georgopapadakou (eds.} Emerging
Targets in Antibacterial and Antifungal Chemistry, Chapman and Hall, London,
1992. Whole-cell methods have traditionally involved screening compounds
against wild-type strains of pathogens and selecting as candidates those
compounds which have a negative effect on the viability of the pathogen. Under
1
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
these conditions, compounds selected as candidates generally interact with a
target that is expressed at wild-type levels. The potential of this type of
assay is
limited, since it provides no information on mechanism of action, which is
critical
for selection of a candidate. Identification of drug targets and determination
of
target function are costly and time-consuming processes. One approach to
overcoming some of these problems has been to isolate mutants that are
hypersusceptible to a particular agent and use them to screen for new agents
having similar properties and/or mechanisms of action. In addition, compounds
having activity against a hypersusceptible strain can often, with minimal
modification, be converted to agents with strong activity against the wild-
type
strain. Such hypersusceptible mutants are generally obtained following
standard
chemical mutagenesis with agents such as N-methyl-N'-nitro-N-nitrosoguanidine.
See, for example, Kitano et al. ( 1977) The Japanese Journal of Antibiotics,
vol.
XXX Suppl., pp. 5239-S245; Numata et al. (1986) The Journal ofAntibiotics,
vol. XXXIX, pp. 994-1000; and Kamogashira et al. (1988) The Journal of
Antibiotics, vol. XLI, pp. 803-806.
Systems for regulated expression of cloned genes have been described.
These include the following promoters: trp, lpp, lac, tac, trc, ~,PL, ~,PR,
tetA, recA,
phoA, malX, malts (S. pneumoniae), xyl (S. carnosus) and T7. See, for example,
Tacon et al. (1980) Mol. Gen. Genet. 177:427-438; Ghrayeb et al. (1984) EMBO
J3:2437-2442; Germino et al. (1983) Cell 32:131-140; Russell et al. (1982)
Gene 20:231-243; Hallewell et al. (1985) Nucleic Acids Res. 13:2017-2034;
Yoakum et al. (1982) Proc. Natl. Acad. Sci. USA 82: 1766-1770; Queen (1983) J.
Mol. Appl. Genet. 2:I-10; De la Torre et al. (1984) J. Biol. Chem. 259:11571-
11575; Shirakawa et al. (1984) Gene 28:127-132; Miyake et al. (1985) J.
Biochem. 97:1429-1436; Studier et al. (1986) J. Mol. Biol. 189:113-130;
Johnston et al. (1985) Gene 34:137-145; Nieto et al. (1997) J. Biol. Chem.
272:30860-30865; and Sizemore et al. ( 1993) FEMS Microbiol. Lett. 107:303-
306. For general reviews, see Bauerle (ed.) "Inducible Gene Expression"
Birkhauser, Boston, 1985; A. Smith (ed.) "Gene expression in recombinant
microorganisms," M. Dekker, New York, 1994; Makrides (1996) Micrabiol. Rev.
2
CA 02325602 2000-10-13
WO 99/5292b PCT/US99/08164
60:512-538; and de Vos et al. (1997) Curr. Opin. Biotechnol. 8:547-553. Most
of the above-mentioned systems are capable of overexpression of one or more
cloned genes. These systems often exhibit moderate-to-high basal expression
levels, above which overexpression can be induced by manipulation of
environmental conditions and/or provision of inducing molecules. Fusions
between the Pg,qp promoter of the arabinose operon and a heterologous gene
have
been used for the overexpression of heterologous genes. See U.S. Patent No.
5,028,530. However, in contrast to other systems, the PgAD promoter can be
extremely tightly regulated to provide very low basal levels of expression.
See,
for example, Guzman et al. (1995) J. Bacteriology 177:4121-4130. Construction
of arabinose-dependent strains, generated by placing an essential gene under
the
control of ara regulatory elements, has been described. See, for example,
Brown
et al. (1995) J. Bacteriol. 177:4194-4197; Dalbey et al. (1985) J. Biol. Chem.
260:15925-15931; and Guzman et al., supra.
Systems for drug screening have been described wherein overexpression
of a target gene product results in acquisition of resistance to an inhibitor,
identifying the gene product as a potential target of the inhibitor. See, for
example, del Castillo et al. (1991) Proc. Natl. Acad. Sci. USA 88:8860-8864.
Screening for inhibitors of a particular enzyme has been accomplished by
comparing the effect of a test compound on a strain that is defective for the
enzyme with the effect of the test compound on a strain harboring a different
mutation. See, for example, EP 644268. Other screening systems have been
developed which depend on generating strains which express mutant proteins
(e.g., temperature-sensitive proteins) and assessing their sensitivity to test
compounds. See, for example, PCT Publication WO 96/23075.
Accordingly, highly-inducible regulatory systems with low basal
expression levels would be extremely useful for the identification of
essential
genes and inhibitors of essential genes in microorganisms.
3
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
DISCLOSURE OF THE INVENTION
One object of the invention is to provide methods and compositions for
identifying compounds which inhibit the growth or viability of an organism,
regardless of whether the mechanism of action of the inhibitor and/or the
function
of the inhibitor's target is known. Another object of the invention is to
provide
compositions and methods for screening compounds using cells that are
hypersusceptible to an inhibitor. An additional object of the invention is to
provide methods for generating cells that are hypersusceptible to a known
inhibitor, utilizing techniques of molecular genetics and recombinant DNA, in
particular, techniques that permit regulated expression of a target gene,
including
underexpression, expression at normal levels, and overexpression. A further
object of the invention is to provide compositions and methods for identifying
essential genes and gene products of microorganisms, as well as genes and gene
products that are involved in virulence and drug resistance. Yet another
object of
the invention is to provide methods and compositions for determining the
mechanism of action of an inhibitor. A further object of the invention is to
provide methods and compositions for controlled gene expression. An additional
object is to provide methods and compositions that will allow expression of a
particular target gene to be regulated at levels that are both lower and
higher than
those normally present in the cell.
Accordingly, in one aspect the invention provides cells in which the
expression of a gene product involved in an essential function can be
regulated.
In particular, the invention provides cells in which the expression of a gene
can be
down-regulated to express the gene product below wild-type levels, as well as
cells in which gene expression can be up-regulated to levels that are higher
than
wild-type. In some cases, expression of a gene product at lower-than-normal
levels will, in and of itself, result in an impairment or absence of growth
which
defines the gene product as being essential. In other cases, environmental
conditions (such as, for example, temperature, pH, nutrient sources, ionic
strength,
presence of other organisms, infection and/or presence of a compound) under
4
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
which expression of a particular level of a given gene product is essential
can be
determined.
In one aspect, the methods and compositions of the invention will allow
expression of any gene in a cell to be independently regulated by external
stimuli,
such as nutrient concentration. Genes whose expression can be down-regulated
to
a point at which levels of that particular gene product become limiting for
growth
or other important cell function (e.g., pathogenesis or resistance to
antibiotics) can
then be identified. Once such a gene has been identified, cells expressing
that
gene at any level between that which is limiting and any higher expression
level
can be challenged with a test compound. Compounds which exhibit higher
potency against cells expressing lower levels of gene product are candidate
inhibitors. It can be seen that, since this method depends simply on
regulating
levels of a particular gene product, it is not necessary beforehand to know
the
function of the gene product that is being regulated, nor is it necessary to
know
the mechanism of action of the inhibitor. Accordingly, knowledge of target
function is not necessary for the identification of an inhibitor in the
practice of the
invention.
In another aspect, the invention provides methods and compositions for
the identification of compounds that affect essential cellular processes, by
exposing to a test compound cells in which expression of a gene product that
is
involved in an essential cellular process is regulated to a lower-than-normal
level.
In yet another aspect, the invention provides methods and compositions
for determining the target and mechanism of action of an inhibitor by
exposing, to
a test compound, cells in which expression of a gene product that is involved
in an
essential cellular process is regulated to a lower-than-normal level.
In yet another aspect, the invention provides methods and compositions
for determining the target and mechanism of action of an inhibitor by
exposing, to
a test compound, a library of cells in which expression of a variety of gene
products that are involved essential cellular processes are regulated to lower-
than-
normal levels.
5
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
In a further aspect, the practice of the invention will allow identification
of
genes encoding drug targets, genes encoding essential cellular functions,
genes
encoding virulence factors, genes encoding antibiotic resistance factors,
polypeptides or fragments thereof that serve as drug targets or virulence
factors;
polypeptides or fragments thereof that participate in essential cellular
functions or
antibiotic resistance; RNAs that serve as drug targets or virulence factors
and
RNAs that participate in essential cellular functions or antibiotic
resistance.
Cells in which expression of a gene product that is involved in an essential
cellular process is regulated to a lower-than-normal level can be obtained
through
techniques of microbial genetics and molecular biology. For example, fusion of
a
heterologous regulatory element to an essential gene places that gene under
the
control of the heterologous regulatory element. The heterologous regulatory
element may intrinsically provide lower expression levels than the essential
gene's normal regulatory system, or the heterologous regulatory element may be
1 S capable of being down-regulated. In either case, expression of the
essential gene
at lower-than-normal levels is possible.
The invention also provides methods and compositions for regulated gene
expression, whereby expression is controlled over a range of levels ranging
from
underexpression through normal expression levels through overexpression.
Exemplary compositions include regulatable promoters, enhancers, operators and
other transcriptional and/or translational control elements. Exemplary methods
include methods for placing regulatable promoters, enhancers, operators and
other
transcriptional and/or translational control elements into operative linkage
with a
gene or coding sequence, and expression of such constructs in a cell, wherein
expression is regulated by an inducer and/or repressor.
Methods and compositions for regulated expression of a gene in a
microorganism are also provided; wherein the methods utilize a construct
comprising a gene, or a fragment thereof, in operative linkage with a
regulatory
element such as the E. coli PBAD promoter or the P~~A promoter of S.
pneumoniae.
The methods comprise introducing the construct into a host cell, culturing the
host
cell in a growth medium and adjusting the concentration of one or more
6
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08I64
modulator substances in the growth medium. Modulator substances can be
inducers and/or negative modulators (i. e. , repressors) of the raf regulatory
elements) present in the construct.
In another embodiment, compositions and methods for making a construct,
comprising a gene or a fragment thereof in operative linkage with a component
of
the raf regulatory region of S. pneumoniae, are provided. Such constructs can
be
chromosomal or extrachromosomal.
The invention will therefore be useful for drug screening, target
identification, determining mechanisms of action of antibiotics, determining
mechanisms of virulence and antibiotic resistance, and for other purposes as
will
be apparent to those of skill in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the nucleotide sequence of the S. pneumoniae Px and Pm
regions. (SEQ ID NO: 1). The mutation in the repressor binding site of the Px
promoter, converting a GGA sequence to GCG (mutant construction described in
Example 6) is indicated on the bottom line of the figure.
Figure 2 is a schematic diagram of the S. pneumoniae raf gene cluster,
including the two raf operons, with open reading frames (ORFs) represented by
arrows. Locations of promoters is also indicated. Shown for comparison is a
schematic diagram of ORFs in the msm region of S. mutans.
Figure 3 shows the nucleotide sequence of the raf region of S.
pneumoniae strain VSPN3026 (SEQ ID NO. 2). The general location of the PAGA
promoter is indicated by underlining.
Figure 4 shows idealized results of an experiment in which the minimum
inhibitory concentration of a compound is determined as a function of inducer
concentration, in a cell in which target expression level is regulated by
inducer
concentration and the target is a single component which is inhibited by the
compound.
Figure 5 shows idealized results of an experiment in which the minimum
inhibitory concentration of a compound is determined as a function of inducer
7
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
concentration, in a cell in which either 1 ) the target comprises multiple
components and the compound interacts with a site defined by two or more of
the
components or 2) the compound interacts with multiple targets, and the level
of
one of the components (or targets) is regulated by inducer concentration.
Figure 6 shows a scheme for replacement of wild type murA regulatory
elements with an ara regulatory cassette.
Figure 7 shows growth of a PB~D-murA fusion strain (E. coli VEC02055)
as a function of arabinose concentration.
Figure 8 shows the minimum inhibitory concentration of fosfomycin, as a
function of arabinose concentration, for the PBAD-murA fusion strain E. coli
VEC02055, compared to wild-type.
Figure 9 shows minimum inhibitory concentrations of fosfomycin,
ciprofloxacin, and tetracycline for the E. coli PBAO-murA fusion strain
VEC02055, expressed as a function of arabinose concentration.
Figure 10 shows optical density measurements, at various times after
inoculation, of cultures of VSPN3041 grown at different raffinose
concentrations.
Figure 11 shows optical density measurements of the growth of
VSPN3041 on either sucrose or raffinose.
Figure 12 shows the growth of VSPN3041 and the parent isogenic strain
VSPN3026, at different raffinose concentrations. Growth was measured by
optical density after 10 hours of culture.
Figure 13 shows the susceptibility of VEC02065, an E. coli strain having
a chromosomal Pean-def fusion, to VRC483, an inhibitor of the def gene
product.
Susceptibility is presented as minimum inhibitory concentration (MIC) of
VRC483 in ~g/ml, as a function of inducer (arabinose) concentration. Also
shown is the susceptibility of VEC02065 to fosfomycin and ciprofloxacin.
Figure 14 shows the susceptibility of VEC02079, an E. coli strain having
a chromosomal PBAO folA fusion, to trimethoprim, an inhibitor of the folA gene
product. Susceptibility is presented as minimum inhibitory concentration (MIC)
of trimethoprim in ~tg/ml, as a function of inducer (arabinose) concentration.
Also
shown is the susceptibility of VEC02079 to fosfomycin and ciprofloxacin, and
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
the susceptibility of the parent strain, VEC02054 (indicated by wt), to
trimethoprim.
Figure 15 shows the susceptibility of VEC02083, an E. coli strain having
a chromosomal PBan-gYrB fusion, to novobiocin, an inhibitor of the gyrB gene
product. Susceptibility is presented as minimum inhibitory concentration (MIC)
of novobiocin in p.g/ml, as a function of inducer (arabinose) concentration.
Also
shown is the susceptibility of VEC02083 to fosfomycin and ciprofloxacin.
Figure 16 shows the susceptibility of VEC02068, an E. coli strain having
a chromosomal PBAO-def fusion and a tolC deletion, to VRC483, an inhibitor of
the def gene product (indicated by the curve labeled VRC483). Susceptibility
is
presented as minimum inhibitory concentration (MIC) of VRC483 in pg/ml, as a
function of inducer (arabinose) concentration. Also shown is the
susceptibility of
VEC02068 to fosfomycin and ciprofloxacin, and the susceptibility to VRC483 of
the parent strain, VEC02066 (indicated by the curve labeled VRC483, tolC).
Figure 17 shows the susceptibility of VSPN3044 to VRC483, an inhibitor
of the def gene product. VSPN3044 contains a PA~,~-def transcriptional fusion,
so
that expression of the def gene product is regulated by raffinose.
Susceptibility is
presented as minimum inhibitory concentration (MIC) of VRC483 in ~,g/ml, as a
function of inducer (raffinose) concentration. Also shown in the
susceptibility of
VSPN3044 to erythromycin and vancomycin, and the susceptibility of the parent
strain VSPN3026 (indicated by VRC483wt) to VRC483.
Figure 18 shows the susceptibility of VEC02524 (PBAO-IpxC, OtolC)
toL 159692, an antibacterial compound that targets the IpxC gene product.
Minimum inhibitory concentration is shown as a function of arabinose
concentration. Also shown are minimum inhibitory concentrations of linezolid
and erythromycin as a function of arabinose concentration.
MODES FOR CARRYING OUT THE INVENTION
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques in organic chemistry, biochemistry,
molecular
biology, microbiology, genetics, recombinant DNA, and related fields as are
9
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
within the skill of the art. These techniques are fully explained in the
literature.
See, for example, Maniatis, Fritsch & Sambrook, MOLECULAR CLONING: A
LABORATORY MANUAL, Cold Spring Harbor Laboratory Press ( 1982);
Sambrook, Fritsch & Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL,
Second Edition, Cold Spring Harbor Laboratory Press (1989); Ausubel, et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons ( 1987, 1988,
1989, 1990, 1991, 1992, 1993, 1994, 1995, 1996); Silhavy et al., EXPERIMENTS
WITH GENE FUSIONS, Cold Spring Harbor Laboratory Press (1984); Gerhardt et
al., METHODS FOR GENERAL AND MOLECULAR MICROBIOLOGY, American
Society for Microbiology, Washington, D.C., 1994; Lorian, ANTIBIOTICS IN
LABORATORY MEDICINE, 4th ed., Williams & Wilkins, Baltimore, 1996; and
Murray et al. MANUAL OF CLINICAL MICROBIOLOGY, 6th ed., American Society
for Microbiology, Washington, D.C., 1995.
All patents, patent applications and publications cited herein are
incorporated by reference in their entirety.
The present invention provides methods and compositions useful for
identification of compounds that affect an essential cellular process,
compounds
that interfere with mechanisms of resistance, and compounds that interfere
with
virulence factors; for identification of the target or targets of a compound
that
affects an essential cellular process, a mechanism of resistance or a
virulence
factor; for identification of a gene or genes encoding a target or targets of
a
compound that affects an essential cellular process, a mechanism of resistance
or
a virulence factor; and for identification of genes, RNAs and polypeptides
involved in essential cellular processes, mechanisms of resistance or
virulence.
Identification is facilitated by controlled expression of a gene that is
involved in
an essential cellular process. Knowledge of the function of a gene or its
product is
not required, either to identify it as being involved in an essential cellular
process,
or to identify a compound which affects the gene product.
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Cell types
In one embodiment, the present invention will be used in the identification
of compounds which have activity against microorganisms. Accordingly,
compositions embodied by the invention will include microorganisms wherein the
expression of an essential gene of the microorganism is regulated by fusion to
a
heterologous regulatory element. Similarly, target genes and polypeptides
whose
expression is regulated by a heterologous regulatory element will often be
those
that are essential for viability of a microorganism, or responsible for its
virulence
or drug resistance.
Microorganisms can be either prokaryotic or eukaryotic; and prokaryotes
can be either Gram-positive or Gram-negative. Exemplary prokaryotes include,
but are not limited to: Staphylococcus (e.g., S. aureus, S. epidermidis),
Streptococcus (e.g., S. pneumoniae, S. pyogenes, S agalactiae), Enterococcus
(E.
faecalis, E. faecium), Neisseria, Branhamella, Listeria, Bacillus (e.g., B.
subtilis),
Corynbacterium, Erysipelothrix, Gardnerella, Nocardia, Mycobacterium,
enterobacteriaceae, Escherichia (e.g., E. coli), Salmonella, Shigella,
Yersinia,
Enterobacter (e.g., E. cloacae), Klebsiella (e.g., K. pneumoniae, K. oxytoca),
Citrobacter, Serratia, Providencia, Proteus (e.g., P. mirabilis, P. vulgaris),
Morganella (e.g., M. morganii), Edwardsiella, Erwinia, Vibrio, Aeromonas,
Hedicobacter (e.g., H. pylori), Campylobacter, Eikenella, Pasteurella,
Pseudomonas (e.g., P. aeruginosa), Burkholderia, Stenotrophomonas,
Acinetobacter, Ralstonia, Alcaligenes, Moraxella, Legionella, Francisella,
Brucella, Haemophilus (e.g., H. influenzae), Bordetella, Clostridium,
Bacteroides,
Porphyromonas, Prevotella, Fusobacterium, Borrella, Chlamydia, Ricketsia,
Ehrlichia and Bartonella.
Exemplary eukaryotic microorganisms include, but are not limited to,
yeasts and fungi, for example, Candida (e.g., C. albicans), Cryptococcus,
Pneumocystis, Histoplasma, Blastomyces, Coccidioides, Aspergillus, Fusarium,
Saccharomyces and Schizosaccharomyces.
The practice of the invention can also be applied to eukaryotic cells, such
as plant cells, mammalian cells and human cells. In one embodiment, malignant
11
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
cells which are resistant to a therapeutic can be analyzed to determine the
locus of
resistance and to identify compounds that will reverse resistance by
interacting
with the cellular component responsible for resistance. In this context, a
therapeutic can comprise a compound, such as a drug, a composition comprising
multiple compounds, or a physical treatment, such as radiation.
Essential cellular functions
In one embodiment, the invention provides methods and compositions for
identifying genes and/or gene products involved in essential cellular
functions.
An essential function for a particular cell will depend on the genotype of the
cell
and the cell's environment. By way of example, essential cellular functions
are
those which are involved in replication, repair, recombination and
transcription of
genetic material; protein synthesis (translation), processing and transport;
protein
export; anabolic synthesis of cellular molecules; catabolism of cellular
nutrients;
synthesis of cell membranes and cell walls; lipid metabolism; protein
metabolism;
energy metabolism; cell division; cell shape; filamentation; regulation; DNA
binding; RNA binding; efflux systems; transport systems; virulence or
pathogenicity; and drug resistance. Protein metabolism can include protein
modifications such as glycosylation, phosphorylation, acetylation and
ubiquitination, to name but a few examples. Gene products that can be involved
in essential cellular processes include, but are not limited to,
topoisomerases,
nucleases, recombinases, primases, helicases, DNA polymerases, RNA
polymerases, histone modifying enzymes, kinases, phosphatases, acetylases,
deacetylases, formylases, deformylases, chaperonins, ion transporters,
cytoskeletal elements, colicins, cytochromes, ribosomal proteins, transfer
RNAs,
ribosomal RNAs, hydrolases, proteases, epimerases, rotamases, synthases,
racemases, dehydrogenases, transferases, ligases, reductases, oxidases,
transglycosylases, transpeptidases, peptidases, GTPases, ATPases,
translocases,
ribonucleases, transcription factors, sigma factors, ribosomal release
factors,
structural RNAs and structural proteins.
12
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
More generally, an essential cellular process is any process which, when it
occurs at a lower rate or to a lesser extent than normal, negatively
influences the
viability of the cell. Methods for determination of cell viability are well-
known to
those of skill in the art and include, but are not limited to, vital staining,
cell
counting, either microscopically or by colony counting following serial
dilution
and plating of cell cultures, measurement of light scattering by cell
cultures,
fluorescence-activated cell sorting, incorporation of polynucleotide and/or
polypeptide precursors, reporter gene expression, and measurement of cell
weight
and/or volume.
The types of molecules that can participate in essential cellular processes
can include nucleic acids, polypeptides and other cellular macromolecules.
Nucleic acids will include, for example, DNA; regulatory RNA molecules, such
as ribozymes and antisense RNA; transfer RNA and ribosomal RNA.
Polypeptides can include, for example, structural proteins, enzymes,
receptors,
intracellular signaling molecules, and cellular adhesion molecules.
Regulatory elements
In one aspect of the invention, the expression of a gene involved in an
essential cellular function is regulated by fusion of the gene, or a fragment
thereof, to a heterologous regulatory element. A heterologous regulatory
element
is one that is not normally associated with, and does not normally regulate,
the
gene which it regulates in the practice of the invention. Regulatory elements
can
comprise transcriptional, post-transcriptional, translational, and post-
translational
elements; as well as regulatory elements related to replication. By way of
example, transcriptional regulatory elements can include promoters, enhancers,
operators, and elements that modulate the rate of transcription initiation,
elongation and/or termination; post-transcriptional regulatory elements can
include those influencing messenger stability, processing and transport;
translational regulatory elements can include those which modulate the
frequency
of translation initiation and the rate of translational elongation; post-
translational
regulatory elements can include those which influence protein processing,
13
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
stability and transport; and replication-associated regulatory elements can
include
those related to gene dosage.
In preferred embodiments, the heterologous regulatory element comprises
a regulatable promoter. In a particularly preferred embodiment, the
regulatable
promoter is the araBAD promoter, also known as PgAD~ Regulation by PBaD has
been the subject of extensive study and its regulatory properties are well-
understood. See, for example, Schleif (1992) Ann. Rev. Biochem. 61:199-223;
Guzman et al. (1995) J. Bacteriology 177:4121-4130; and Gallegos et al. (1997)
Microbiology and Molecular Biology Reviews 61:393-410.
The PgAD promoter is regulated by the AraC protein, which has both
positive and negative regulatory activities. In the absence of L-arabinose or
other
inducers (such as, for example, L-ribose), AraC represses transcription from
PBaD
by binding to sites upstream of the PBAD transcription initiation site.
Inducers such
as L-arabinose interact with the AraC protein to form an activator of PBAD
transcription that binds to different upstream sites to stimulate
transcription. With
respect to the present invention, desirable features of the AraC/PBAp
regulatory
system are the very low basal levels of transcription obtained in the absence
of
arabinose and the direct relationship between transcription from PBAD and the
concentration of arabinose in the medium. See, for example, Guzman et al.,
supra.
The activity of PBav is directly proportional to the concentration of
arabinose in the environment and, importantly, at low arabinose concentration,
very low basal levels of expression are obtained. The PgAD promoter is also
subject to regulation by catabolite repression, mediated by cyclic AMP and by
the
cyclic AMP receptor protein, also known as the catabolite repressor protein
(CRP). Thus, further modulation of PBAO expression can be obtained by
regulating the concentration of glucose (or other carbon source such as, for
example, glucose-6-phosphate) in the environment, which modulates CRP activity
within the cell. In particular, minimal expression of PBAO (maximal
repression) is
obtained in the presence of glucose and the absence of arabinose. Withdrawal
of
glucose from the medium and addition of arabinose (or another inducer) results
in
14
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
rapid induction of transcription from PBAO wherein the expression level is
proportional to the arabinose concentration. Expression levels varying over a
1,000-fold range can be obtained, depending on the inducer concentration. See,
for example, Guzman et al., supra.
The PgAD promoter or any other promoter of the AraC/XyIS family, from
any prokaryotic or eukaryotic organism, can be used in the practice of the
invention. See, for example, Gallegos et al., supra; de Vos et al. (1997)
Curr.
Opin. Biotechnol. 8:547-553; and Kleerebezem et al. (1997) Mol. Microbiol.
24:895-904. Particularly preferred are the PB,~o promoters of E. coli and S.
typhimurium.
Another regulatory system that is useful in the practice of the invention is
the malMlmalX system of S. pneumoniae, regulated by MaIR. MaIR is a
repressor that controls the expression of the maltosaccharide regulon in S.
pneumoniae and belongs to the LacI-GaIR family of repressors. Two operons are
regulated in opposite direction, maIXCD (Px promoter) and malMP (Pm
promoter), see Figure 1 (SEQ ID NO: 1). Stassi et al. (1982) Gene 20:359-366;
and Nieto et al. (1997) J. Biol. Chem. 272:30860-30865. Affinity of MalR for
Pm is higher than for Px and, in both cases, a high basal level of expression
has
been reported. Nieto et al. (1997) J. Biol. Chem. 272:30860-30865. Example 6,
infra, describes fusion of mal Px to a catalase gene and modification of the
mal Px
promoter to obtain tight regulation by maltose in minimal medium.
Yet another example of a regulatory system that is useful in the practice of
the invention is the raf regulatory system of Streptococcus pneumoniae.
Example
14 shows that the rafR gene product acts as a positive regulator of promoters
such
as PAGA, the promoter for the S. pneumoniae a-galactosidase gene. Thus, fusion
of a target gene to P~a,~, in a cell expressing rafR function, will allow
raffinose-
regulated expression of the target gene. See Example 7. Additional regulatory
elements in the raf regulatory system include the promoter of the rafR gene,
P,.a~r,
and the promoter of the rafE gene, P,a~.
The PApA promoter was discovered through a search of the S. pneumoniae
genome sequence, disclosed at http://www.tigr.org. The sequence was searched
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
for sequences that might encode homologues to the AraC/XyIS family of
transcriptional activators. Gallegos et al. (1997) Microbiol. Molec. Biol.
Reviews
61:393-410. An open reading frame (ORF) encoding a protein homologous to the
Streptococcus mutans msmR gene was identified and named rafR. The
organization of additional ORFs in the vicinity of rafR was also investigated.
As
a result of these investigations, a gene cluster was identified, comprising
two
ORFs encoding regulatory proteins, rafR and rafS, an intergenic region, and
six
ORFs encoding structural proteins. See Figure 2. The gene cluster contains two
operons transcribed divergently: a regulatory operon encoding rafR and rats,
and
a metabolic operon which encodes aga, rafE, rafF, raft, gtfA and possibly
rafH.
The nucleotide sequence of the region of the raf gene cluster
encompassing rafs, rafR, and aga, in S. pneumoniae strain VSPN3026 was
determined. See Figure 3 (SEQ ID NO: 2). The rafs gene was determined to lie
between the complements of nucleotide coordinates 1001-291 of this sequence,
with the region encoding RaIS protein lying between the complements of
nucleotides 938-294. The rafR gene was determined to lie between the
complements of nucleotides 1798-935, with the RafR coding region
complementary to nucleotides 1795-938. The aga gene extended from
nucleotides 1903-4065, with the coding region lying between 1903-4062. Several
differences between the raf sequences of VSPN3026 (Figure 3) and those
disclosed in the database at http://www.tigr.org were detected. These
differences,
presented in Table 1, are likely to represent polymorphisms between different
strains of S pneumoniae.
16
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Table 1: Unique sequences in the S. pneumoniae raf region of VSPN 3026
Position in VSPN3026 sequenceSEQUENCE
(SEQ ID NO: 2)
VSPN 3026 database
326-329 ATCC ATACC
441 A G
561 T A
633 A G
765 T C
794 T C
828 A G
842 A C
953 C T
997 A C
1490 A G
1513 A C
1665 C G
1760 A G
1792 G A
2157 T C
2739 C T
2844 T G
3191-3192 AT GC
3287 C T
3297 G T
3399 A G
3405 C T
3495 A G
3662 A T
3693 G A
3818 C T
The S. pneumoniae raf
gene cluster is organized
into two domains. One
domain includes the two regulatory ORFs raf R and rafS, and the other includes
genes that are probably involved in uptake and catabolism, based on their
17
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
homology to S. mutans genes. See Figure 2. The term "raf gene cluster" refers
to
the raf transcriptional units and their related regulatory genes, in
particular the
region of the S. pneumoniae genome comprising the rafR, rafS, aga, rafE, rafF,
raft, gtfA and rafH genes, as well as the intergenic regions associated with
these
S genes. Intergenic regions refer to DNA sequences which do not encode
protein,
but which lie adjacent to protein-coding regions of DNA sequence. Intergenic
regions will often contain regulatory sequences such as promoters and
operators,
although regulatory sequences can also be located in coding regions.
Directly upstream of rafR is a divergently-transcribed gene, aga, with
sequence homology to S. mutans a-galactosidase. Construction of a strain with
a
mutation in the aga region, followed by a-galactosidase assay of the mutant
strain, shows that the S. pneumoniae aga gene does indeed encode a polypeptide
with a-galactosidase activity. See Example 14. Downstream of aga are
additional genes encoding proteins homologous to the msm transport system, and
a gene called gtfA, which is a homologue of S. mutans sucrose phosphorylase.
Although it contains several homologous ORFs, the fact that the S pneumoniae
raf gene cluster contains two regulatory genes suggests that its regulation
may be
more complex than that of the msm gene cluster in S. mutans.
The S pneumoniae raf gene cluster contains at least two regulatory genes,
rafR and ra~5', an intergenic region, and at least five structural genes: aga,
rafE,
rafF, raft and gtfA. See Figure 2. Sequences which regulate the expression of
the regulatory and structural genes of the S. pneumoniae raf gene cluster are
likely
to be found in the intergenic region and within genes adjacent to the
intergenic
region. Such sequences are denoted raf regulatory sequences and include, for
instance, promoter and operator sequences, such as the rafR promoter (P,Q~),
the
a-galactosidase promoter (PACa) and the rafE promoter PrQ~. Promoter sequences
are those to which RNA polymerase binds to initiate transcription. Operator
sequences are those to which regulatory proteins (such as, for example,
activators
and repressors) bind, thereby influencing the ability of RNA polymerase to
bind
to the promoter. In general, repressors inhibit binding of RNA polymerase, and
activators facilitate binding (or relieve repressor-mediated inhibition).
Transcript
18
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
analysis by RT-PCR has provided results consistent with the locations of the
PAGA
P,a~ and P,Q~ promoters being as shown in Figure 2. Based on the presence of
sequence elements homologous to well-known prokaryotic transcriptional
regulatory sequences, the location of PACA was determined to be between
nucleotides 1796-1902 of the sequence presented in Figure 3. The P,Q~ promoter
is also believed to lie within this region.
In one embodiment, the invention provides sequences from the raf
regulatory region, such as raf promoter and operator sequences, for the
regulated
expression of coding sequences, which can include, for example, homologous and
heterologous genes or gene fragments. With respect to the S. pneumoniae
regulatory sequences disclosed herein, a homologous gene is one that is
normally
found in association with the regulatory sequences in nature. A heterologous
sequence, by contrast, is a sequence from S. pneumoniae or any other organism,
that is not normally found in association with S. pneumoniae raf regulatory
sequences in nature. Exemplary S. pneumoniae regulatory sequences include, but
are not limited to, the rafR promoter (P,a~), the a-galactosidase promoter
(P~aA),
and the promoter of the rafE gene, Pray.
As discussed supra with respect to sequence homology, and demonstrated
experimentally in Example 14 infra, the rafR gene product acts as a positive
regulator and the raJS gene product acts as a negative regulator of the raf
operons.
Growth of cells in the presence of raffinose induces expression of genes under
the
control of raf regulatory sequences, while growth of cells on sugars other
than
raffinose inhibits expression of genes under the control of raf regulatory
sequences. Consequently, the methods and compositions provided by the
invention allow for both overexpression and underexpression of a gene,
mediated
by raf regulatory sequences. The basal level of expression is low and the
range of
expression level between repressed (cells grown on maltose, for example) and
induced (cells grown on raffinose) conditions is approximately a thousand-
fold.
See Example 14, infra.
In one embodiment, the invention provides recombinant constructs for
regulation of expression of a gene of interest. The recombinant constructs are
I9
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
made using standard methods of molecular biology and biotechnology to place a
coding sequence in operative linkage with raf regulatory region sequences,
either
by insertion of a coding sequence in proximity to a raf regulatory sequence,
or by
insertion of a raf regulatory sequence in proximity to coding sequence. In
S preferred embodiments, the raf regulatory sequence will be upstream of the
coding sequence when they are placed in operative linkage. Locations of
restriction enzyme recognition sequences within the raf gene cluster, for use
as
insertion sites, can be easily determined by one of skill in the art from the
nucleotide sequence of the raf gene cluster. Alternatively, various in vitro
techniques can be used for insertion of a restriction enzyme recognition
sequence
at a particular site, or for insertion of heterologous sequences at a site
that does
not contain a restriction enzyme recognition sequence. Such methods include,
but are not limited to, oligonucleotide-mediated heteroduplex formation for
insertion of one or more restriction enzyme recognition sequences (see, for
example, Zoller et al. (1982) Nucleic Acids Res. 10:6487-6500; Brennan et al.
(1990) Roux's Arch. Dev. Biol. 199:89-96; and Kunkel et al. (1987) Meth.
Enzymology 154:367-382) and PCR-mediated methods for insertion of longer
sequences. See, for example, Zheng et al. (1994) Virus Research 31:163-186.
Operative linkage refers to an arrangement of one or more regulatory
sequences with one or more coding sequences, such that the regulatory
sequences) is capable of exerting its regulatory effect on the coding
sequence.
By way of illustration, a transcriptional regulatory sequence or a promoter is
operably linked to a coding sequence if the transcriptional regulatory
sequence or
promoter promotes transcription of the coding sequence. Similarly, an operator
is considered operatively linked to a promoter or to a coding sequence if
binding
of a repressor to the operator inhibits initiation at the promoter so as to
prevent or
diminish expression of the coding sequence. An operably linked transcriptional
regulatory sequence is generally joined in cis with the coding sequence, but
it is
not necessarily directly adjacent to it.
Recombinant constructs comprising coding sequences in operative linkage
with one or more raf regulatory region sequences can also comprise other types
of
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
sequence including, but not limited to, replication origins, selectable
markers
(including, but not limited to, those encoding antibiotic resistance),
transcription
termination sites, sequences specifying translation initiation and
termination,
sequences mediating mRNA processing and/or stability and multiple cloning
sites.
In preferred embodiments, these additional sequences are functional in Gram-
positive microorganism, such as, for example, Streptococci, Staphylococci,
Enterococci, and Lactococci. Preferred species include, for example,
S. pneumoniae, S pyogenes, S. agalactiae, Lancefield group A streptococci,
Lancefield group B streptococci, Lancefield group C streptococci, Lancefield
group F streptococci, Lancefield group G streptococci, and viridans
streptococci.
Preferred non-streptococcal species in which these additional sequences are
functional include, for example, enterococci such as E. faecalis, and E.
faecium,
and lactococci such as L. lactis. Methods for the construction of such
recombinant constructs are well-known to those of skill in the art. See, for
example, Sambrook et al, supra. It will also often be useful to include a
selectable marker in the recombinant construct, to aid in the isolation and
identification of cells comprising the construct. Selectable markers include
those
which facilitate positive selection, such as a sequence which encodes
antibiotic
resistance, and those which facilitate negative selection. Bochner et al.
(1980) J.
Bacteriol. 143:926-933; and Gay et al. (1985) J. Bacteriol. 164:918-921.
Recombinant constructs can exist as freely-replicating extrachromosomal
elements, such as plasmids or episomes, or can exist as chromosomal
recombinants, such as would be achieved either by integration of a raf
regulatory
cassette into the chromosome of a microorganism adjacent to a gene of
interest, or
by insertion of a gene of interest into the chromosome adjacent to a raf
regulatory
sequence, for example. Methods for obtaining chromosomal integration of
recombinant constructs have been described, for example, by Gerhardt et al.,
METHODS FOR GENERAL AND MOLECULAR MICROBIOLOGY, American Society
for Microbiology, Washington, D.C., 1994; Link et al. (1997) J. Bacteriol.
179:6228-6237; and Metcalf et al. (1996) Plasmid 35:1-13.
2I
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
A coding sequence, as present in a recombinant construct, can encode a
full-length gene product (i.e., the length normally found in the wild-type
cell) or
any fragment of a gene product. A gene product can be a RNA or a polypeptide;
untranslated RNA gene products can include structural, catalytic and
regulatory
RNA molecules. Examples of untranslated RNA gene products include, but are
not limited to, tRNA, rRNA, antisense RNAs and ribozymes. In one embodiment,
a coding sequence comprises a gene, which can encode a virulence factor, a
resistance factor, or a gene product whose function is essential for a cell
under a
particular set of environmental conditions. Any gene of interest can be placed
in
operative linkage with raf regulatory region sequences, so that its expression
is
regulated by the raf regulatory region sequences.
In one embodiment, the invention provides recombinant constructs
capable of regulating the expression of coding sequences in a host cell. These
constructs comprise one or more raf regulatory sequences in operative linkage
with a coding sequence. The constructs are suitable for use in any cell in
which
raf operon regulatory sequences are functional. Since the raf regulatory
proteins
RafR and RafS can be introduced into a cell along with, or as part of the
above-
mentioned recombinant construct, regulation of a coding sequence by a raf
regulatory sequence will be attainable in many cells, which can include both
Gram-positive and Gram-negative microorganisms. In preferred embodiments,
the host cell is a Gram-positive microorganism, such as, for example,
Streptococci, Staphylococci, Enterococci, and Lactococci. Preferred species
include, for example, S. pneumoniae, S. pyogenes, S. agalactiae, Lancefield
group
A streptococci, Lancefield group B streptococci, Lancefield group C
streptococci,
Lancefield group F streptococci, Lancefield group G streptococci, and viridans
streptococci. Preferred non-streptococcal species in which the raf regulatory
system can be utilized for regulated expression of coding sequences include,
for
example, enterococci such as E. faecalis, and E. faecium, and lactococci such
as
L. lactis.
In the practice of one aspect of the invention, the recombinant construct is
introduced into a host cell to provide regulated expression of a coding
sequence.
22
CA 02325602 2000-10-13
WO 99!52926 PCT/US99/08164
Introduction of the construct into a host cell is performed by methods that
are
well-known to those of skill in the art, including, for example, natural or
artificial
transformation, transduction, conjugation, microinjection, transfection,
electroporation, CaPOa co-precipitation, DEAE-dextran, lipid-mediated
transfer,
particle bombardment, etc.
Host cells are cultured in any suitable growth medium, including liquid or
solid media. Appropriate growth media for various types of microorganisms are
well-know to those of skill in the art. See, for example, Bergey's Manual of
Systematic Bacteriology, vol. 2, Williams & Wilkins, Baltimore, 1980; Gerhardt
et al. "Methods for General and Molecular Microbiology," American Society for
Microbiology, Washington, D.C., 1994; and Murray et al., supra.
Modulator substances can be added to the growth medium to influence the
transcriptional activity of raf regulatory sequences. Such effects will be
manifested as changes in the expression level of a coding sequence to which
the
raf regulatory sequences are operatively linked. The modulator substances can
be
generally characterized as inducers, which increase transcriptional activity,
or
negative modulators, which decrease transcription. In one embodiment of the
invention, a modulator substance is a metabolite; in a preferred embodiment,
it is
a carbon source, in a more preferred embodiment, it is a sugar and, in a
particularly preferred embodiment, raffinose serves as an inducer and maltose
as a
negative modulator.
The present invention utilizes systems which provide low basal expression
levels and a high degree of induction. Such methods and compositions can be
used, for example, to identify compounds which inhibit the growth of a
microorganism, and for discovery of drug targets, including genes involved in
virulence and drug resistance. Because the S. pneumoniae raf regulatory system
is characterized by an induction level of at least 1,000-fold over a low basal
expression level (see Example 14), it is well-suited for use in the practice
of the
invention.
Accordingly, raf regulatory sequences can be used to identify an essential
gene of a microorganism, to regulate the level of expression of an essential
gene,
23
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
and to identify inhibitors of essential genes and gene products, as disclosed
herein.
These features are accomplished by fusing raf regulatory sequences, such as
P,a~,
P,Q~, PacA or others, to a homologous or heterologous coding sequence encoding
an essential gene, such that the coding sequence is under the transcriptional
control of the raf regulatory sequences. Essential genes can include those
which
are essential for the growth of S. pneumoniae, or those which are essential
for the
growth of any other microorganism. The essentiality of a gene may depend on
the
in vivo or in vitro environment of the cell in which it is expressed. For
example,
in the presence of an effective concentration of an antibiotic, a gene
encoding
resistance to that antibiotic is an essential gene. Example 7 shows the
construction and properties of a fusion between the S. pneumoniae
a-galactosidase promoter (P~G~) and the S. pneumoniae leader peptidase (spi)
gene. The fusion places the spi gene under raffinose control, limiting cell
growth
at low raffinose concentrations.
Additional positively-regulated promoter/activator systems will also find
use in the practice of the invention. These include, but are not limited to,
those
for rhamnose utilization (regulated by the rhaS or rhaR gene products),
melibiose
utilization (regulated by the melR gene product), xylose utilization
(regulated by
the xylR gene product), p-hydroxyphenylacetic acid utilization (regulated by
the
hpaA gene product), and urease production (regulated by the ureR gene
product).
See Gallegos et al., supra, for additional examples of positively regulated
systems. Additional regulatable promoters that will be of use in the present
invention will be well-known to those of skill in the art. They include, but
are not
limited to, lac, which is regulated by lactose and glucose; trp, which is
regulated
by tryptophan, tic, which is regulated by lactose, tet, which is regulated by
tetracycline and tetracycline analogues, gal, which is regulated by galactose,
T7,
which is regulated by provision of T7 RNA polymerise, T3, which is regulated
by
provision of T3 RNA polymerise, SP6, which is regulated by provision of SP6
RNA polymerise, ~,pR, which is regulated by ~, repressor (the cI gene
product),
and ~,p~, which is regulated by ~. repressor (the cI gene product). Additional
promoters from Gram-negative organisms which can be tested for their degree of
24
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
regulatability and can be useful in the practice of the invention include, but
are not
limited to, lpp, phoA, recA, proU, cst-l, tetA, cadA, nar, Ipp-lac, cspA, T7-
lac,
pL-T7, T3-lac, TS-lac, nprM lac, VHb, promoters regulated by two-component
regulatory systems, and promoters regulated by the araClXylS family of
regulators. Two-component systems include those which utilize protein
phosphorylation as a mechanism of signal transduction. In one embodiment, a
sensor protein is phosphorylated upon receipt, by the cell, of an
environmental
stimulus. The phosphate group is then transferred to a regulator protein that
undergoes a phosphorylation-induced conformational change which elicits a
response such as, for example, gene transcription. See, for example,
Malcrides,
supra; J.A. Hoch and T.J. Silhavy, eds. (1995) "Two-Component Signal
Transduction," American Society for Microbiology, Washington, D.C.; and
Gallegos et al., supra. Additional promoters from Gram-positive organisms
which can be tested for their degree of regulatability and can be useful in
the
practice of the invention include, but are not limited to, spat-l, xylA, lacA,
IacR,
P15, dnaJ, sodA, prtP, prtM, PA170, trpE, nisA, nisFmalX, malts, xyl, and
bacteriophage promoters from cprlt and cp3l. See, for example, de Vos et al.,
supra. Although some of these promoters are not capable, using current
techniques, of basal expression levels as low as those that can be obtained
with
PB~o, they will find use in less-preferred embodiments of the invention.
Construction of gene fusions
In a preferred embodiment of the invention, fusion of a heterologous
regulatory element to a gene encoding an essential cellular function is
accomplished by insertion of an ara regulatory cassette into the chromosome of
the organism under study, or insertion of an ara regulatory cassette into a
plasmid
resident in the organism under study. The ara regulatory cassette can include
a
DNA molecule containing, in the following order, the araC gene, P~ (the araC
promoter) and PBAD (the promoter regulating expression of the araB, araA, and
araD genes). This is the order in which these elements are arranged on the E.
coli
and S. typhimurium chromosomes, in which the Pc and PB~D promoters are
CA 02325602 2000-10-13
WO 99/52926 PCT/IJS99/08164
adjacent and oriented divergently. Insertion of this cassette will provide
AraC
function to the cell and place downstream coding sequences under the control
of
Pew, which is regulated by AraC. Alternatively, a cassette containing only
PB,av
can be inserted, if AraC function is already provided by the cell.
In another embodiment, a cassette containing a gene or nucleotide
sequence of interest can be inserted into the chromosome adjacent to PBav such
that the gene or sequence comes under the transcriptional control of PBAV. See
Example 13. Furthermore, it will be apparent to one of skill in the art that a
fusion between PgAp (or any other regulatory element) and a gene or nucleotide
sequence of interest can itself be moved to any one of a number of different
chromosomal or extrachromosomal locations, using techniques that are well-
known in the art.
By way of example, fusions can be obtained by random insertion of an ara
regulatory cassette into a chromosome or a plasmid of a microorganism,
followed
by screening for strains dependent on arabinose for growth. Arabinose-
dependent
strains will be those in which sequences encoding an essential cellular
function
have been fused to the ara regulatory cassette in such a way that the coding
sequences have come under PBav control. A coding sequence can encode a full-
length gene product (i.e., the length normally found in the wild-type cell) or
any
fragment of a gene product capable of encoding an essential cellular function.
A
gene product can be a RNA or a polypeptide; untranslated RNA gene products
can include structural, catalytic and regulatory RNA molecules.
Random chromosomal integration is typically achieved using transposons.
Transposons are DNA segments which have the ability to insert randomly within
the a chromosome or plasmid of a host organism. Very little homology is
required between the ends of a transposon and its integration site and the
process
is independent of the host's homologous recombination system. Transposon
insertion is typically monitored by selection for an antibiotic resistance
marker
carried on the transposon. Because transposons can have low site specificity,
they
are widely used for random inactivation by gene disruption.
26
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Efficient targeted chromosomal integration of an exogenous sequence,
involving site-specific recombination, typically requires a stretch of
homology of
200 base pairs or more and utilizes the host's homologous recombination system
to achieve integration. Targeted integration typically involves a
recombination
event between the chromosome and a conditionally replication-defective plasmid
containing chromosomal sequences and an antibiotic resistance marker. Under
conditions that are non-permissive for plasmid replication, and in the
presence of
selective agent, the majority of surviving cells are those in which targeted
recombination has occurred between the homologous sequences in the plasmid
and the chromosomal DNA. Gerhardt et al., supra; Link et al. (1997) J.
Bacteriol. 179:6228-6237; and Metcalf et al. (1996) Plasmid 35:1-13. The same
considerations apply to targeted insertion within a plasmid.
By way of example, one method for generating a fusion of an ara
regulatory cassette to a cellular coding sequence is by flanking the
regulatory
cassette with sequences homologous to the targeted coding sequence, as
described
in Example 1, infra; however, other methods for generating gene fusions will
be
known to those of skill in the art. See, for example, Casadaban et al. Meth.
Enzymology, vol. 100 (ed. R. Wu, L. Grossman, K. Moldave) Academic Press,
New York, 1983) pp. 293-308; Silhavy et al., supra; and Gerhardt et al.,
supra.
Additional embodiments of the invention include extrachromosomal gene fusions
residing, for example, on plasmids. Such plasmid fusions can be constructed in
vivo or in vitro, using techniques of genetics and recombinant DNA which are
well-known to those of skill in the art. See, for example, Sambrook et al.,
supra;
Ausubel, et al., supra; Silhavy et al., supra; and Gerhardt et al., supra. For
the
purposes of the present invention, nucleic acids constructed in vitro can be
introduced into cells by methods that are well-known in the art, including
transformation with naked DNA, electroporation, microinjection, calcium
phosphate-mediated transfer, DEAE-dextran-mediated transfer, gene gun, etc.,
to
generate transformed cells.
It is clear that methods similar to those described above for ara regulatory
cassettes can also be applied to the construction and integration of
regulatory
27
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
cassettes comprising mal, raf, or other regulatory elements which allow
controlled
expression of a gene to which they are operatively linked.
Methods for controlled, low-level expression
In a preferred embodiment of the present invention, expression of an
essential gene is regulated to a low basal level. A low basal level is less
than 50%
of wild-type, preferably, less than 30%, more preferably, less than 20%, and,
most
preferably, less than 10%. In some cases, expression of an essential gene at a
low
basal level will render a cell non-viable; in other cases, it will render a
cell
hypersusceptible to a biologically-active agent. An example of, low, basal-
level
regulation by ara PBAO IS provided by Guzman et al., supra. Regulation of cell
growth by arabinose, in a strain containing a PBAO-murA fusion, is
demonstrated in
Example 2, infra.
Regulation is accomplished by fusion of a target gene to a heterologous
regulatory element whose expression can be exogenously controlled, for
example,
by environmental conditions such as chemicals, nutrients, temperature, pH,
osmolarity, etc. In a preferred embodiment, regulation is such that the level
of the
target gene product is proportional to the concentration or level of the
environmental agent that is used for regulation. In a still more preferred
embodiment of the invention, a target gene is fused to PBAO and regulation is
achieved by adjusting the concentration of 1.-arabinose in the growth medium.
Low levels of expression are correlated with low concentrations of arabinose
and/or the presence of glucose in the medium.
In additional embodiments, regulation is achieved by varying the
concentration of an inducer other than arabinose. For example, regulation by
maltose is achieved, in cells expressing MaIR function, when a target gene is
fused to mal Pm or mal Px. To provide yet another example, fusion of a target
gene to the raf regulatory element PACA allows regulation by raffinose in a
cell
expressing RafR function. Additional regulatory elements in the raf regulatory
system include the promoter of the rafR gene, P,Q~, and the promoter of the
rafE
gene, P,.Q~. On the basis of these examples, it will be clear to one of skill
in the
28
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
art that any regulatable promoter, whether positively or negatively regulated,
can
be used to control the expression of a target gene in response to a substance
or
environmental condition that regulates that particular promoter.
In diploid organisms, controlled regulation of gene expression may not be
easy to achieve with a single chromosomal insertion, as it is in prokaryotes.
However, in certain situations, mutation or "knockout" of one of the two
copies of
a target gene may lower expression of the target sufficiently for newly-
acquired
degrees of drug sensitivity to be obtained. Alternatively, mutation or
"knockout"
of one copy of a target gene, coupled with controlled expression of the
remaining
wild-type copy, may be used to achieve heightened drug sensitivity in a
diploid.
Similarly, situations may be encountered, in both prokaryotes and eukaryotes,
in
which multiple copies of a gene are present (e.g., ribosomal genes in E.
coli). In
these situations, knockout and/or inactivation of all but one copy of the gene
will
allow regulation of that remaining functional copy according to the methods of
the
invention.
Exemplary applications
The methods and compositions of the present invention allow one to
control the susceptibility of a cell to a test compound by controlling the
amount of
a gene product (the target) that is expressed in the cell. This is achieved by
adjusting the concentration of an inducer, which will, in turn, regulate the
expression of a coding sequence that is fused to a heterologous regulatory
element. Sensitivity to a test compound is then determined at various levels
of
expression of the coding sequence and at different concentrations of the test
compound. Expression of lower-than-normal levels of the target will cause a
cell
to become hyper-susceptible to a compound which interacts with that particular
target. Alternatively, a cell expressing lower-than-normal levels of a
particular
gene product may become susceptible to a compound to which it is not normally
susceptible (i.e., to which the cell is not susceptible when it is expressing
normal
levels of the target). Such a compound is a candidate therapeutic which,
following chemical modification, may become capable of inhibiting the
viability
29
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
of cells expressing normal levels of the target. Techniques for chemical
modification of potential therapeutic compounds are well-known to those of
skill
in the art. See, for example, Morin et al., Chemistry and Biology of beta-
Lactam
Antibiotics, Academic Press, New York, 1982.
Many compounds that interact with a target are not active against wild-
type cells because an intracellular concentration of the compound cannot be
achieved that is sufficient for inhibition, given the concentration of target
in the
cell. Many factors are responsible for this type of natural resistance, for
example,
compounds can be hydrolyzed, effluxed, absent because lack of suitable
transport,
etc. See, for example, Davies (1994) Science 264:375-382; and Nikaido (1994)
Science 264:382-388. However, inactivation of genes that are involved in
natural
resistance, for example efflux pumps, allows the construction of mutants that
are
susceptible to compounds to which wild-type cells are resistant. Such mutants
can become hypersusceptible to many unrelated compounds and have been used
to characterize novel antimicrobial agents. The methods and compositions of
the
invention can be used in concert with mutants which display increased
susceptibility to compounds because of a mutation in a gene involved in
metabolism, transport, efflux, and the like, to identify inhibitors that would
not
otherwise be detectable. See Example 11.
Figure 4 shows idealized results for a situation in which a compound
inhibits cell viability by interacting with a single monomeric target, and
target
expression level is regulated. The figure depicts the relationship between
inducer
concentration and the minimum inhibitory concentration (MIC) of a test
compound. The MIC is determined by assessing the minimal concentration of test
compound that will inhibit growth, in the presence of a specified
concentration of
inducer (if applicable), typically using serial two-fold dilutions of test
compound.
Growth can be recorded, for example, by spectrophotometry or visual inspection
of cultures. The minimum amount of test compound that completely inhibits
growth, or supports less than 10% growth compared to a control culture, is
defined as the MIC. For a wild-type cell, the MIC is constant at all
concentrations
of inducing agent, because the expression level of the target is not expected
to
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
vary with inducer concentration. For a cell in which target expression is
regulated
by inducer concentration, there will be a range of inducer concentrations at
which
MIC is directly proportional to inducer concentration. Thus, lower inducer
concentrations, which result in expression of target at levels lower than wild-
type,
will be correlated with lower MICs than those observed with wild-type cells.
Since this assay relies solely on control of target levels, it provides a
screen for
candidate therapeutics regardless of whether the function of the target is
known.
Example 3, infra, shows that, for cells in which MurA expression is regulated
by
arabinose, MIC values both below and above the MIC for wild-type cells can be
obtained, when cells are challenged with fosfomycin, a MurA inhibitor.
In certain situations, a target can be part of a multimeric structure
composed of different subunits (e.g., a heteromultimer), and a test compound
can
interact with a sub-region of the multimer contributed by more than one of the
subunits, one of which is the target. If target levels are regulated, there
will be, as
in the situation described in the previous paragraph, a certain range of
inducer
concentrations at which MIC is proportional to inducer concentration. At the
target levels specified by this range of inducer concentrations, the target is
the
limiting component of the multimeric structure. However, with increasing
inducer concentration, and concurrent higher target levels, a point will be
reached
at which the target is no longer the rate-limiting component of the multimer.
At
this point, the relationship between MIC and inducer concentration reaches a
plateau value, which is independent of the MIC for the wild-type strain. This
situation is shown schematically in Figure 5.
Prior art screening methods are not applicable to situations in which a
particular compound has multiple targets within a cell, with each target
having a
different degree of sensitivity to the compound. In these cases, methods of
the
prior art would detect effects only on the target that is most easily
inhibited under
the assay conditions. The methods of the present invention can be used to
control
the expression of a target of an inhibitor. If the target is the only cellular
gene
product that is targeted by the inhibitor, increasing levels of expression of
the
target will result in higher MICs for the inhibitor (see Figure 4). If the
inhibitor
31
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
has additional targets, increase of MIC as a function of inducer concentration
(i. e. ,
target levels) will reach a plateau value, indicating inhibition of a second
target by
the inhibitor. Figure 5 shows an idealized depiction of the data that would be
obtained in such a situation. Fixing expression of the first (most sensitive)
gene
product, while varying expression of the other gene product(s), will allow
detection of additional targets.
Thus, if a test compound interacts with a single target, the relationship
between MIC and inducer concentration will be proportional at all inducer
concentrations that are consistent with cell growth. See Examples 3, 4 and 8-
13,
infra. By contrast, if a test compound interacts with multiple targets, or
with a
structure formed by multiple molecules, one of which is the target, the
relationship between MIC and inducer concentration will reach a plateau value
at
inducer concentrations at and above which the target is no longer the limiting
component. Targets can be polypeptides and/or nucleic acids. For example,
ribosomes contain both types of target.
Cells can be exposed to any compound that is known in the art or to be
synthesized, and the route of exposure can be, for example, by inclusion of
the
compound in a liquid cell culture medium, by incorporation of the compound
into
a solid culture medium, or by application of the compound to a solid culture
medium, for example, by application to the medium of a porous disc that is
saturated with the compound, or by simply pipetting droplets of the compound
onto a solid medium.
Use of the invention will allow the rapid identification of potential new
therapeutics, such as antibacterial agents. See Example 5, infra. Candidates
identified by this method can be subjected to chemical modification as known
in
the art (see, for example, Bristol, J.A. (ed.) Annual Reports in Medicinal
Chemistry, Academic Press, San Diego) and tested against cells expressing
normal levels of the target. Modified compounds that exhibit activity against
cells
expressing normal target levels are candidate therapeutics.
32
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
EXAMPLES
The following examples are intended to illustrate, not to limit the
invention.
Example 1: Construction of a strain containing a fusion of PBAn to
murA
The murA gene was selected for testing because it encodes a cytoplasmic
protein that is the target of the drug fosfomycin. An E. coli strain carrying
a
single functional copy of the murA gene under arabinose control in the
chromosome was constructed. In this strain, the level of expression of murA is
controlled by the amount of arabinose present in the medium. In addition, this
strain is dependent on arabinose because this sugar is required to induce the
expression of the essential gene murA, and this strain cannot metabolize
arabinose
because the catabolic genes have been deleted (d(araCBA )araD). The
susceptibility of the strain to fosfomycin, a uridine diphospho-N-acetyl-D-
glucosamine enolpyruvyl transferase (MurA) inhibitor, was tested at different
concentrations of arabinose. Susceptibility to unrelated antibiotics that
inhibit
other targets, i.e., tetracycline (a protein synthesis inhibitor) and
ciprofloxacin (a
DNA gyrase inhibitor), was also investigated. A new inhibitor of MurA was
identified by the practice of the invention. See Example S.
The E. coli strains used for this example are E. coli VEC02042 (pir+,
recA), E. coli VEC02054 (d(araCBA)araD) and E. coli VEC02055
((d(araCBA)araD) PmurA::Km-araC-PBaD)-
VEC02055 was constructed as follows:
Allele replacement requires a double recombination event to occur. Two
regions of homology used for recombination were the murA coding region and
400 base pairs of DNA immediately upstream of murA. The chromosomal
replacement cassette and the strategy used to replace wild type murA with PB~D-
murA is diagrammed in Figure 6.
A DNA sequence containing murA was PCR-amplified from E. coli strain
JM109 chromosomal DNA using oligonucleotides DYV-055 (SEQ ID NO. 3,
33
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Table 2) and DYV-056 (SEQ ID NO. 4, Table 2), and cloned as an Ncol/XbaI
fragment into the expression vector pBAD-MycHisB (Invitrogen Corporation,
Carlsbad, CA).
400 base pairs of upstream murA sequence was PCR amplified from E.
coli strain JM109 chromosomal DNA using oligonucleotides DYV-057 (SEQ ID
NO. 5, Table 2) and DYV-058 (SEQ ID NO. 6, Table 2), and directly cloned into
pCR2.1 (Invitrogen Corporation, Carlsbad, CA).
The suicide vector pWM95 (Metcalf et al. (1996) Plasmid 35:1-13) was
chosen to perform the allele replacement procedure. pWM95 is an ampicillin-
resistant, conditionally replicative plasmid requiring the pir gene in trans
for
plasmid replication to occur. pWM95 also carries the sacB gene which confers
sucrose sensitivity to transformed strains grown in the presence of sucrose.
When
this plasmid is introduced into a host that does not supply the Pir protein,
strains
carrying chromosomal integrants can be selected. The sacB gene then allows for
selecting plasmid-free segregants as sucrose-resistant clones. E. coli strain
VEC02042 (pir+, recA) was used for all cloning steps with the conditionally
replicative pWM95 and its derivatives.
The araC-PBAO-murA and upstream mur sequences were cloned into the
suicide vector pWM95 by three-way ligation to create pDY-10. The kanamycin
resistance gene from piasmid pBSL99 (ATCC 87141) was cloned as a HindIII
fragment into pDYlO to create pDYl 1.
pDYl l was introduced into E. coli strain VEC02054. Transformants
were plated on LB plates supplemented with kanamycin (25 pg/ml) and ampicillin
(100 pg/ml) and incubated at 37°C overnight. A number of transformants
were
streaked onto LB plates supplemented with kanamycin (25 ug/ml) and arabinose
(0.2%) and incubated at 37°C overnight. Isolated colonies were then
streaked
onto LB plates supplemented with kanamycin (25 p.g/ml), sucrose (6%), and
arabinose (0.2%) to select for sucrose-resistant recombinants. NaCI was
omitted
from LB plates during sucrose resistance selection. Sucrose-resistant
recombinants were screened for ampicillin sensitivity and arabinose growth
dependence. Chromosomal replacement in candidate clones was verified by
34
CA 02325602 2000-10-13
WO 99/SZ926 PCT/US99/08164
checking the chromosomal junctions with PCR primer pairs DYV-070 / DYV-073
(SEQ ID NO: 7/SEQ ID NO: 9) and DYV-082/DYV-071 (SEQ ID NO: 10/SEQ
ID NO: 8).
Table 2. Oligonucleotides used for PCR
Primer
Sequence
(5' ->
3') SEQ
ID NO.
DYV-O55 ~ATGGATAAATTTCGTGTTCAGG 3
DYV-056 ~ =T TA =P.TTATTCGCCTTTCACACGC 4
DYV-057 =A - - =TCTGATTTATCAGCGAGGC 5
DYV-058 r~'~'ATAT~CCCCAAGCTTAGTTTGTTCTCAGTTAAC 6
DYV-070 CCGGATATGGCGTTAACCG 7
DYV-071 CCCATGGTTCCAGTAAGTTCC 8
DYV-073 GTGAATGATGTAGCCGTC 9
DYV-082 CTCGCTAACCAAACCGGTAACC 10
Note: Underlined sequences corresponu to non-comp~ementary bases.
Example 2: Regulation of growth of VEC02055 by arabinose
Growth of the PBaD-murA fusion strain (E. coli VEC02055) was tested as
a function of arabinose concentration. Figure 7 shows that growth of the
fusion
strain is dependent on arabinose concentration, demonstrating the regulation
of
murA by a heterologous regulatory element and indicating that, at low
arabinose
concentrations, murA function is limiting for cell growth.
Example 3: Susceptibility of VEC02055 to fosfomycin
An experiment was conducted, using the PBAO-murA fusion strain
(VEC02055) and its parent strain (VEC02054), to compare their susceptibility
to
fosfomycin at different arabinose concentrations. Fosfomycin is an antibiotic
which targets the murA gene product. Kahan et al. (1974) Ann. NYAcad. Sci.
235:364-386.
Preparation of inoculum
Cells were grown overnight in 5 ml of LB supplemented with 0.1
arabinose on a rotary shaker at 35°C and 200 rpm. 100 pl of overnight
culture
was collected, centrifuged for 5 min. at room temperature at 14,000 rpm, and
the
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
cell pellet was suspended in 1 ml of LB with no added arabinose. The cell
suspension was diluted 1:1000 in LB and used as inoculum.
Preparation of 96 well plates for checkerboard assay
Checkerboard assays were performed in 96-well microtiter plates, in
which arabinose concentration was varied in the first dimension and fosfomycin
concentration was varied in the second dimension. Fosfomycin concentrations
varied by two-fold between rows; dilutions were performed in LB supplemented
with different concentrations of arabinose, or lacking arabinose. A control
row
lacking fosfomycin, and a control column lacking arabinose, were also
included.
Total volume in each well was 50 p.l.
Inoculation of plates and incubation
50 pl of inoculum, (i.e., diluted cell suspension) was added to each well.
After 20 hours of incubation at 35°C, cell growth was measured in each
well and
compared to wells with no inoculum.
The results, presented in Figure 8, show the minimum inhibitory
concentration (MIC) of fosfomycin, as a function of arabinose concentration,
for
the PB~o-murA fusion strain E. coli VEC02055, compared to wild-type. The
results demonstrate that MIC values above and below the MIC for wild-type
cells
can be attained in the fusion strain through adjustment of arabinose levels.
Example 4: Comparison of susceptibility of VEC02055 to fosfomycin
with susceptibility to antibiotics which do not target the murA gene product
An experiment was conducted on the PBAO-murA fusion strain (E. coli
VEC02055) to compare its susceptibility to fosfomycin with its susceptibility
to
several other antibiotics (tetracycline and ciprofloxacin) which do not target
the
murA gene product.
Preparation of inoculum
Cell culture and preparation of inocula were performed as described in
Example 3, supra.
36
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Preparation of 96 well plates for checkerboard assay
Checkerboard assays were performed in 96-well microtiter plates, in
which arabinose concentration was varied in the first dimension and antibiotic
concentration was varied in the second dimension. Antibiotic concentrations
varied by two-fold between rows; dilutions were performed in LB supplemented
with different concentrations of arabinose or lacking arabinose. A control row
lacking antibiotic, and a control column lacking arabinose, were also
included.
Total volume in each well was 50 pl. Similar assays were conducted, using
fosfomycin, tetracycline or ciprofloxacin, to test the influence of arabinose
on
susceptibility to these antibiotics.
Inoculation of plates and incubation
50 p.l of inoculum, (i.e., diluted cell suspension) was added to each well.
After 20 hours of incubation at 35°C, cell growth was measured in each
well and
compared to wells with no inoculum. Figure 9 shows that the susceptibility of
strain VEC02055 to tetracycline and ciprofloxacin was independent of the
presence of arabinose in the medium. The variation observed for sensitivity to
ciprofloxacin and tetracycline is typical of that obtained in a MIC
determination.
Sensitivity to fosfomycin was dependent on arabinose concentration, confirming
the results shown in Figure 8. The minimum concentration of arabinose needed
to
support growth was 5 x 10-5%.
The susceptibility of strain VEC02055 to fosfomycin was strongly
associated with the amount of arabinose present in the medium. MICs
comparable to the wild type were achievable when sufficient arabinose was
added
to the medium. Cells became more susceptible to fosfomycin at lower
concentrations, in a concentration-dependent manner. The difference in
susceptibility between the lowest and highest MICs was approximately 100-fold.
The susceptibility to tetracycline and ciprofloxacin remained constant and was
independent of arabinose concentration.
37
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
Example 5: Identification and validation of a new inhibitor of MurA
Preparation of inoculum
Cell culture and preparation of inocula were performed as described in
Example 3, supra. E. coli VEC02055 was used in all experiments.
Screening
Microtiter plates were used for screening. Wells contained LB with 0,
0.0004, or 0.002% arabinose. Eighty unrelated compounds were tested; test
compounds were added to the wells at final concentrations of 2, 4 and 8 wg/ml.
50 ~.1 of inoculum was added to each well and the plates were incubated at
35°C.
Growth was measured after 24 and 40 hours. The growth of cells incubated at
the
higher arabinose concentration (0.002%) was not inhibited by any of the test
compounds. When cells were incubated at the lower arabinose concentration
(0.0004%), compound 47-7-70 was the only test compound that inhibited growth
at all three concentrations tested. As a control, the MIC for fosfomycin was
determined at each arabinose concentration.
Inhibition of MurA activity
The enzymatic activity of purified MurA was assayed in the presence of
the same test compounds used in the screen described supra. Different
concentrations of the test compounds were added to buffer (50 mM Tris-HCI, pH
8; 0.2 mM UDP-N-acetylglucosamine) containing 7 p,g/ml MurA. The reaction
was started by addition of phosphoenolpyruvate to 0.1 mM, and the reaction
mixture was incubated for 30 min at 25°C. Released phosphate was
measured
with malachite green reagent, and quantitated by spectrophotometry. Only
compound 47-7-70 showed inhibitory activity, with an ICSO of 8 p,g/ml.
Susceptibility of VEC02055 to compound 47-7-70 as a function of
arabinose concentration
A checkerboard assay was performed in a 96-well microtiter plate, similar
to that described in Example 3, supra. Concentration of compound 47-7-70 was
varied in one dimension, and arabinose concentration was varied in the other
dimension. A control row lacking compound 47-7-70, and a control column
38
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
lacking arabinose, were also included on the plate. In addition, a control
plate
containing dilutions of fosfomycin instead of compound 47-7-70 was also
tested.
50 wl of VEC02055 inoculum, prepared as described in Example 3, supra,
was added to each well. The plates were incubated 20 hours at 3 S°C, at
which
time cell growth was measured and compared to that in wells that had not
received an inoculum. The results are presented in Table 3. As can be seen,
increasing susceptibility of VEC02055 to compound 47-7-70 was correlated with
lower concentrations of arabinose in the medium, as expected for a compound
that
blocks cell growth by inhibition of the MurA enzyme.
Table 3: MIC of compound 47-7-70 as a function
of arabinose concentration for VEC02055
arabinose in mediumMIC of 47-7-70 (p.g/ml)
0.00018 2
0.000375 4
0.00075 8
0.0015 16
0.00312 16
Example 6: Construction and properties of a tightly regulated
maltose regulatory system
MaIR is a repressor that controls the expression of the maltosaccharide
regulon in S. pneumoniae and belongs.to the LacI-GaIR family of repressors.
Two operons are regulated in opposite direction, maIXCD (Px promoter) and
malMP (Pm promoter), see Figure 1 (SEQ ID NO: 1). Affinity of the MaIR for
Pm is higher than for Px and, in both cases, a high basal level of expression
has
been reported. Nieto et al. (1997) J. Biol. Chem. 272:30860-30865. This
example shows that tighter regulation of the Px promoter can be obtained by
modifying the repressor site and by growing cells in minimal medium.
The S. pneumoniae strains used for this example are S. pneumoniae
VSPN3026, S. pneumoniae VSPN3021 with katA under Px control, S
39
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
pneumoniae VSPN3025 with katA under modified Px control, and S. pneumoniae
VSPN3022 with katA under Px control, with Pm upstream.
Construction of VSPN3021
Px was PCR amplified from VSPN3026 using oligonucleotides MALI and
MAL2 {Table 4), and cloned into the T-tailed Pinpoint Xa-1 T-Vector (Promega
Corporation, Madison, WI). The construct was digested with EcoRI and BamHI,
and the 387 by Px-containing fragment was cloned into pR326 vector to create
pR326MX. The reporter gene used for measuring expression was the gene for
catalase, katA, from B. subtilis ATCC 6633. The gene encoding katA was PCR-
amplified using oligonucleotides KAT 1 and KAT2 (Table 4) and cloned into the
Ndel site of pR326MX to create pR326MXK.
An additional DNA sequence was added to the construct to target the
insertion into a non-essential DNA sequence of the S. pneumoniae chromosome.
For this purpose, a 300 by fragment of the cpbA gene was PCR-amplified from
the DNA ofS pneumonia VSPN3026, using oligonucleotides CPB1 and CPB2
(Table 4), and the amplification product was inserted into the CIaI site of
pR326MXK to create pR326MXKC. This plasmid was used to transform
VSPN3026 and construct a S. pneumoniae strain, VSPN3021, that carries the
insertion in the chromosome, according to the insertional duplication
mutagenesis
method of Claverys et al. (1995) Gene 164:123-128.
Construction of VSPN3025
A DNA sequence containing the repressor binding site of Px was
mutagenized, to convert a GGA to a GCG (see Figure 1), by using the
QuickChange site directed mutagenesis kit (Stratagene, La Jolla, CA). The
oligonucleotides MAL6 and MAL6C (Table 4) were used as primers, and
pR326MXKC was used as template. Note that MAL6C includes the mutant
sequence. The resultant plasmid, with a mutation in Px, was called
pR326MMXKC. This plasmid was used to transform VSPN3026 and construct a
S. pneumoniae strain, VSPN3025, that carries the insertion in the chromosome.
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Construction of VSPN3022
The Px and Pm regulatory region was PCR amplified from VSPN3026
using oligonucleotides MAL3 and MAL2 (Table 4), and cloned into the T-tailed
Pinpoint Xa-1 T-Vector (Promega Corporation, Madison, WI). The construct was
digested with EcoRI and BamHI, and the Px and Pm-containing fragment was
cloned into the pR326 vector to create pR326MXM. The catalase gene was
inserted under the control of this regulatory region as described above to
create
pR326MXMKC. This plasmid was used to transform VSPN3026 and construct a
S. pneumoniae strain, VSPN3022, that carries the insertion in the chromosome.
Table 4. Oligonucleotides used in mal constructions
Oligo Sequence (5' -> 3') SEQ ID
NO
MAL1 TAGGTTGAATTCATAGAAAATAGATAGGGATTAGAACCA 11
GGG
MAL2 TGCGAGGATCCTACTTGTCGTCGTCGTCCTTGTAGTCGAT 12
ATCATATGTATTCCTCCCAAAGAATAGCAAGT
KATI CCATCGCATATGAGTTCAAATAAACTGACAAC 13
KAT2 CACGACATATGAATCTTTTTTAATCGGCAATCC 14
CBP1 CTGAATCGATGCAGCCACTTCTTCTAATATGGC 15
CBP2 AGCTATCGATTTTCTAACCTTGTAGCCTCAGC 16
MAL3 TAGGTTGAATTCTCGTGTGTTAAAATAATG 17
MAL6 CGCAAACGTTTGCGTTTATGAGCTTAG 1 g
MAL6C CTAAGCTCATAAACGCAAACGTTTGCG 19
Catalase assay
Catalase activity was measured in cell cultures grown in medium C+Y ,
without glucose (Tomasz ( 1970) J Bacteriol. 101:860-871.) and minimal medium
CDEN without glucose. Rane et al. (1940) J. Bacteriol. 40:695-704. Cells were
collected in mid-logarithmic phase, centrifuged, and resuspended in 20 mM Tris-
HCl buffer, pH 8, containing 0.25% Triton-X100. After autolysis of cells, 10
p.l
of extract were added to 1 ml of 1.5 mM H202, and the reaction was followed
fluorometrically with scopoletin. One unit of catalase activity is 1 ~,mol
H202
hydrolysis per min. at 22°C (see Table 5).
41
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Table 5. Catalase activity in mal insertion strains
Growth conditions
_
C+Y C+Y CDEN CDEN
Strain (2% maltose)(No maltose)(2% maltose)(No maltose)
VSPN3022 43 14 69 1.12
V SPN3 60 16 62 13
021
VSPN3025 65 6 66 0.35
S
The data (expressed as units of catalase activity) show that tighter
regulation of the maltose regulatory system can be obtained when using minimal
medium (CDEN), and that the tightest regulation is obtained when using the
modified Px promoter (VSPN3025).
Example 7: Raffinose-regulated expression of the S. pneumoniae spi
gene by the S. pneumoniae aga promoter
A. Construction of transcriptional fusions
A DNA sequence containing S pneumoniae rafR and PACa (aga promoter)
was PCR-amplified from S. pneumoniae VSPN3026 chromosomal DNA using
oligonucleotides REGAGAEIS' (SEQ ID NO. 20, Table 6) and REGAGANB3'
(SEQ ID NO. 21, Table 6) and cloned as an EcoRI/NdeI fragment into the
integration vector pR326 (Claverys, et al., supra) to generate plasmid
pR326RafRPaga. A DNA fragment containing the first 270 by of the leader
peptidase gene (spi) from S. pneumoniae R6 chromosomal DNA was PCR-
amplified using oligonucleotides MALSPIS' (SEQ ID NO. 22, Table 6) and
MALSPI3' (SEQ ID NO. 23, Table 6) and cloned as an NdeIBamHI fragment
into plasmid pR326RafRPaga, resulting in plasmid pR326RPASPI.
Using this plasmid as a template, a DNA fragment containing only PACA
and spi sequences was amplified using oligonucleotides PagaS' EI (SEQ ID NO.
24, Table 6) and MALSPI3' (SEQ ID NO. 23, Table 6) and cloned into the T-
tailed pGEM-T Easy Vector (Promega Corporation, Madison, WI). The construct
was digested with EcoRI and the PACA-spi containing fragment was cloned into
42
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
the integration vector pR326 to create PR326PagaSpi. This plasmid was used to
transform VSPN3026, that had been grown in C+Y lacking sucrose and
supplemented with 0.2% raffinose (C+Y+Raf). Transformants were plated on
TSA-sheep blood plates supplemented with chloramphenicol (2.5 p,g/ml) and
raffinose (0.2%) and incubated at 37°C/5% C02 overnight.
Chloramphenicol-
resistant strains were cultured in C+Y+Raf medium.
The site of insertion was verified in one of the isolates, S. pneumoniae
strain VSPN3041. Insertion in the targeted site in the spi gene was verified
by
PCR using the primers Paga100 (SEQ ID NO. 25, Table 6) and Spi3'SPn (SEQ
ID NO. 26, Table 6). This analysis indicated that VSPN 3041 carried a
truncated
270 by spi gene under natural promoter control and a complete spi gene under
P~~~ control.
Table 6: Sequences of oligonucleotides used for construction of a PACA-spi
fusion
and tar~etin~ of the fusion to the chromosomal spi gene
OligonucleotideSequence (5' ~ 3') SEQ ID
NO.
REGAGAEIS' CCCGGAATTCAGCTTGGTAGGATTTCATAA 20
TGTTGCC
REGAGANB3' GCCGCGGATCCGCGCATATGCATTTACTTC 21
ACCTCATCACTTTATTG
MALSPIS' GGGGAATTCCATATGAATTTATTTAAAAAT 22
TTCTTAAAAGAGTGGG
MALSPI3' GCGCTCTAGATCATTTTCGTAACGAATGGT 23
GTCG
PagaS'EI GCGCCGGAATTCCATGTGCTACCTCCTACCT 24
AACATTTTACC
Paga100 CTCCTACCTAACATTTTACCAT 25
Spi3'Spn TTAAAATGTTCCGATACGGGTGATTGG 26
B. Regulation of growth of VSPN3041 by raffinose
Since VSPN3041 carries an essential gene (spi) under the control of PACA,
the strain should be dependent on raffinose for growth. Accordingly, the
effect of
43
CA 02325602 2000-10-13
WO 99/52926 ' PCT/US99/08164
raffinose on the growth of VSPN3041 and the parent isogenic strain VSPN3026
was compared.
Preparation of 96 well plates: 96-well microtiter plates were used for the
experiments. Serial twofold dilutions of raffinose (in C+Y medium) were
performed across columns, including one column in which no raffinose was
added. Total volume in each well was 501.
Preparation of inoculum: VSPN3041 and VSPN3026 were grown for 4
hours at 37° C in 5 ml C+Y+raf. Ten microliters of the culture was
added to 10
ml C+Y containing 1% sucrose, incubated for 6 hours at 37° C, then
frozen as a
15% glycerol solution. A 1:10 dilution of the frozen stock in C+Y lacking
sucrose, containing 2 x 106 colony forming units/ml, was used as inoculum.
Growth of bacteria in 96-well plates: 501 of inoculum was added to each
well, to give a final volume of 100 g.l. Plates were incubated ate 35°
C and
growth was monitored every hour up to 10 hours.
Results: Figure 10 shows the growth of VSPN3041 at different raffinose
concentrations, measured by optical density. It is clear that growth of the
fusion
strain is dependent on raffinose concentration, demonstrating that an
essential
gene is regulated by raffmose in VSPN3041. In the experiment shown in Figure
11, the growth of VSPN3041 on raffinose is compared to growth on sucrose (each
sugar present in medium at 0.2% w/v). The results of this experiment indicate
that VSPN3041 does not grow in the absence of raffinose, again demonstrating
that an essential gene is positively regulated by raffinose in this strain.
Figure 12
compares the growth of VSPN3041 and the parent isogenic strain VSPN3026, at
different raffmose concentrations. The results indicate that VSPN3041 is
raffinose dependent, while the growth of the parent strain is not dependent on
raffinose.
The raffinose-dependent phenotype of VSPN3041, compared to its parent
strain, indicates that PACA controls the expression of an essential gene in
VSPN3041. Given that the difference between VSPN3041 and its parent is an
insertion that places the spi gene under PACA control, the essential raffinose-
regulated gene in VSPN3041 is the spi gene (or a gene downstream of spi).
44
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Hence, the spi gene (or its downstream gene) in VSPN3041, regulated by the
PAGA
promoter in response to raffinose, is limiting for cell growth at low
raffinose
concentrations. Since growth is dependent on the expression of this essential
gene
and the level of induction can be controlled, the growth of VSPN3041 can be
controlled by the induction or repression of the PAGA promoter.
Example 8: Construction and properties of a strain containing a PBAn-
def transcriptional fusion
A Construction of PBAD-def transcriptional fusions in E. coli
The product of the def gene, the enzyme peptidyl deformylase, plays a
major role in protein synthesis in bacteria. A DNA sequence containing the
full-
length def gene was PCR-amplified from chromosomal DNA of E. coli strain
JM109 using oligonucleotides DYV-157 (SEQ ID NO: 27) and DYV-158 (SEQ
ID NO: 28), and cloned as a NcoIBgIII fragment into expression vector pBAD-
MycHisB (Invitrogen Corporation, Carlsbad, CA), to create pDYB.
Oligonucleotide sequences are given in Table 7.
pDY20 was created by PCR-amplification of the kanamycin resistance
cassette from plasmid pBSL99 with the primers DYV-087 (SEQ ID NO: 35) and
DYV-088 (SEQ ID NO: 36) and cloned into pBlueScriptSKII- (Stratagene, La
Jolla, CA) as an Xba/SacI fragment. 600 base pairs of upstream def sequence
were PCR amplified from E. coli strain JM109 chromosomal DNA using
oligonucleotides DYV-155 (SEQ ID NO: 29) and DYV-156 (SEQ ID NO: 30),
and cloned as a SacI/AscI fragment into vector pDY20 to create pDY9.
Oligonucleotide sequences are given in Table 7.
The suicide vector pK03 (Link et al., supra) was chosen to perform the
allele replacement procedure with the def gene. pK03 is a chloramphenicol-
resistant vector containing the temperature-sensitive pSC101 origin of
replication
and the sacB gene for counter-selection. pK03-derived plasmids are incapable
of
autonomous replication at 43°C. When a host strain harboring a pK03
construct
is plated at 43°C on media containing chloramphenicol, chromosomal
integrants
can be selected. Integration of a pK03 construct into a host chromosome at
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
elevated temperature occurs via homologous recombination between E. coli DNA
cloned into pK03 and the E. coli chromosome.
The araC-PBaD-def cassette was excised as an NdeIBgIII fragment from
pDYB, and the upstream def Kanamycin cassette was excised as an Ec1136
II/NdeI fragment from pDY9. The purified fragments were cloned in a three-way
ligation with SmaI/BamHI digested pK03 to create pDYlS.
pDYlS was introduced into E. coli strain VEC02054. Transformants
were selected on LB plates supplemented with chloramphenicol (25 pg/ml) and
kanamycin (25 pg/ml), incubated at 30°C overnight. A number of
transformants
were streaked onto LB plates supplemented with chloramphenicol (25 pg/ml) ,
kanamycin (25 ~g/ml) and arabinose (0.2%) and incubated at 43°C
overnight.
Isolated colonies were then streaked onto LB plates supplemented with
kanamycin (25 ~,g/ml) and arabinose (0.2%) and incubated at 37°C
overnight.
Isolated colonies were then streaked onto the same medium (LB+kan+ara)
supplemented with 6% sucrose and incubated at 37°C overnight to select
for
sucrose-resistant recombinants. NaCI was omitted from LB plates during this
sucrose resistance selection step. Sucrose-resistant recombinants were
screened
for chloramphenicol sensitivity and arabinose-dependent growth. Chromosomal
replacement of the def gene in a clone, VEC02065 (araC-PBAO-deb, was verified
by assaying for specific PCR products, derived from the chromosomal junctions,
with PCR primer pairs DYV-069 (SEQ ID NO: 37)IDYV-082 (SEQ ID NO: 10)
and DYV-073 (SEQ ID NO: 9)/DYV-1 SS (SEQ ID NO: 29). See Tables 2 and 7
for primer sequences.
B. Susceptibility of VEC02065 (PBao-def) strain to VRC483 and other
antimicrobial agents
An experiment was conducted using the VEC02065 strain and its parent
strain (VEC02054), to compare their susceptibility to VRC483 over a range of
arabinose concentrations. VRC483 is a compound with antibacterial activity
that
targets the def gene product. This compound was identified in a deformylase
screen at Versicor and the ICSO is 11 nM for E. coli defarmylase. Deformylase
activity was measured as described. Rajagopalan et al (1997) Biochemistry
46
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
36:13910-13918. The susceptibility of VEC02065 to the unrelated antibiotics
fosfomycin and ciprofloxacin was also tested.
1. Preparation of inoculum. Cells were grown overnight in 5 ml of LB
supplemented with 0.1 % arabinose, on a rotary shaker at 35°C and 200
rpm.
100 ~1 of overnight culture was collected, centrifuged at 14,000 rpm for 5 min
at
room temperature, and the cell pellet was suspended in 1 ml of medium with no
added arabinose. The cell suspension was diluted 1:1000 in medium and used as
inoculum.
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which arabinose concentration was varied in the
first
dimension, and the concentration of antimicrobial compound in the second. The
concentration of antimicrobial varied by two-fold between rows. Dilutions were
performed in medium supplemented with different concentrations of arabinose,
or
medium lacking arabinose. A control row lacking antimicrobial, and a control
column lacking arabinose, were also included. Total volume in each well was
50 pl.
3. Inoculation of plates and incubation. 50 ~l of inoculum (i.e., diluted
cell suspension) was added to each well. After 20 hours of incubation at
35°C,
cell growth was measured in each well and compared to wells with no inoculum.
4. Results. Figure 13 shows the minimum inhibitory concentration (MIC)
of VRC483, as a function of arabinose concentration, for the PBAn-def strain
VEC02065. T'he parent wild-type strain (VEC02054) was not susceptible to
VRC483 in the range tested. VEC02065 was susceptible to VRC483 at low
arabinose concentrations, and the susceptibility was inversely related to the
inducer concentration. Susceptibility of VEC02065 to compounds that do not
target the product of the def gene, such as fosfomycin and ciprofloxacin, did
not
change with arabinose concentration.
47
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Example 9: Construction and properties of a strain containing a PBAn-
folA transcriptional fusion
A Construction of PBAD-folA transcriptional fusions in E. coli
The product of the folA gene is a dihydrofolate reductase. This enzyme is
involved in folate synthesis in bacteria. A DNA sequence containing the full-
length folA gene was PCR-amplified from the chromosomal DNA of E. coli strain
JM109, using oligonucleotides DYV-095 (SEQ ID NO: 31) and DYV-096 (SEQ
ID NO: 32), and cloned as an NcoIBgIII fragment into expression vector pBAD-
MycHisB (Invitrogen Corporation, Carlsbad, CA), to create pDYS.
Oligonucleotide sequences are given in Table 7.
Six hundred base pairs of upstream folA sequence were PCR amplified
from E. coli strain JM109 chromosomal DNA, using oligonucleotides DYV-093
(SEQ ID NO: 33) and DYV-094 (SEQ ID NO: 34), and cloned as a SacI/AscI
fragment into vector pDY20 (see Example 8) to create pDY6. Oligonucleotide
sequences are given in Table 7.
The araC-PBAO folA cassette was excised as a NdeI/BgIII fragment from
pDYS, and the upstream folA-kanamycin cassette was excised as an Ec1136
II/NdeI fragment from pDY6. The purified fragments were cloned in a three-way
ligation with SmaIBamHI digested pWM95 to create pDY42.
pDY42 was introduced into E. coli strain VEC02054. Transformants were
selected on LB plates supplemented with ampicillin (100 ~g/ml) and kanamycin
(25 pg/ml), incubated at 37°C overnight. A number of transformants were
streaked onto LB plates supplemented with kanamycin (25 ~g/ml) and arabinose
(0.2%) and incubated at 37°C overnight. Isolated colonies were picked
and re-
streaked onto LB plates supplemented with kanamycin (25 pg/ml) and arabinose
(0.2%) and incubated at 37°C overnight. Isolated colonies were then
streaked
onto the same medium (LB+kan+ara) supplemented with 6% sucrose and
incubated at 37°C for 24 hours. The plates were then incubated for an
additional
24 hours at room temperature to select for sucrose-resistant recombinants.
NaCI
was omitted from LB plates during this selection for sucrose resistance.
Sucrose-
resistant recombinants were screened for ampicillin sensitivity and arabinose-
48
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
dependent growth. Chromosomal replacement of the folA gene in a clone,
VEC02079 (araC-PBAO folA), was verified by assaying for specific PCR
products, derived from the chromosomal junctions, with PCR primer pairs DYV-
093 (SEQ ID NO: 33)/DYV-163 (SEQ ID NO: 38) and DYV-107 (SEQ ID NO:
39)/DYV-218 (SEQ ID NO: 40). See Table 7 for primer sequences.
B. Susceptibility of VEC02079 (PBAO folA) strain to trimethoprim and
other antimicrobial agents
An experiment was conducted using the VEC02079 strain and its parent
strain (VEC02054), to compare their susceptibility to trimethoprim over a
range
of arabinose concentrations. trimethoprim is a compound with antibacterial
activity that targets dihydrofolate reductase, the product of the folA gene.
Huovinen et al. (1995) Antimicrob. Agents Chemother. 39(2):279-289. The
susceptibility of VEC02079 to the unrelated antibiotics fosfomycin and
ciprofloxacin was also tested.
1. Preparation of inoculum. Cells were grown overnight in 5 ml of LB
supplemented with 0.1 % arabinose, on a rotary shaker at 35°C and 200
rpm. 100
pl of overnight culture was collected, centrifuged at 14,000 rpm for 5 min at
room
temperature, and the cell pellet was suspended in 1 ml of medium with no added
arabinose. The cell suspension was diluted 1:1000 in medium and used as
inoculum.
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which arabinose concentration was varied in the
first
dimension, and the concentration of antimicrobial compound in the second. The
concentration of antimicrobial varied by two-fold between rows. Dilutions were
performed in medium supplemented with different concentrations of arabinose,
or
medium lacking arabinose. A control row lacking antimicrobial, and a control
column lacking arabinose, were also included. Total volume in each well was 50
~1.
3. Inoculation of plates and incubation. 50 ~l of inoculum (i.e., diluted
cell suspension) was added to each well. After 20 hours of incubation at
35°C,
cell growth was measured in each well and compared to wells with no inoculum.
49
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
4. Results. Figure 14 shows the minimum inhibitory concentration (MIC)
of trimethoprim, as a function of arabinose concentration, for the PB~~ folA
strain
(VEC02079) compared to the parent wild-type strain, VEC02054. The results
show that the MIC of trimethoprim, a folA inhibitor, was dependent on
arabinose
S concentration in the PBAO folA strain (VEC02079); while MIC values of
trimethoprim for the wild-type strain were not dependent on arabinose
concentration. Figure 14 also shows that susceptibility of VEC02079 to
compounds that do not target the product of the folA gene, such as fosfomycin
and
ciprofloxacin, did not change with arabinose concentration.
Example 10: Construction and properties of a strain containing a
pBAD g.YrB transcriptional fusion
A Construction of PBAO-gyrB transcriptional fusions in E. coli.
The product of the gyrB gene is the beta subunit of gyrase, a bacterial
DNA topoisomerase. A DNA sequence containing the full-length gyrB gene was
PCR-amplified from the chromosomal DNA of E. coli strain JM109, using
oligonucleotides DYV-099 (SEQ ID NO: 41 ) and DYV-204 (SEQ ID NO: 42),
and cloned as an NcoI/PstI fragment into expression vector pBAD-MycHisB
(Invitrogen Corporation, Carlsbad, CA) to create pDY34. Oligonucleotide
sequences are given in Table 7.
Six hundred base pairs of upstream gyrB sequence were PCR-amplified
from E. coli strain JM109 chromosomal DNA using oligonucleotides DYV-097
(SEQ ID NO: 43) and DYV-098 (SEQ ID NO: 44}, and cloned as a Sacl/Ascl
fragment into vector pDY20 (see Example 8) to create pDY38. Oligonucleotide
sequences are given in Table 7.
The araC-PBAO-gyrB cassette was excised as an NdeI/ Xba fragment from
pDY34, and the upstream gyrB-kanamycin cassette was excised as an Ec1136 II/
NdeI fragment from pDY38. The purified fragments were cloned in a three-way
ligation with SmaI/XbaI digested pWM95 to create pDY40.
pDY40 was introduced into E. coli strain VEC02054. Transformants
were selected on LB plates supplemented with ampicillin (100 pg/ml) and
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
kanamycin (25 wg/ml), incubated at 37°C overnight. A number of
transformants
were streaked onto LB plates supplemented with kanamycin (25 pg/ml) and
arabinose (0.2%) and incubated at 37°C overnight. Isolated colonies
were picked
and re-streaked onto the same medium (LB+kan+ara) and incubated at 37°C
overnight. Isolated colonies were then streaked onto the same medium
(LB+kan+ara) supplemented with 6% sucrose and incubated at 37°C for 24
hours.
The plates were then incubated for an additional 24 hours at room temperature
to
select for sucrose-resistant recombinants. NaCI was omitted from LB plates
during this selection for sucrose resistance. Sucrose-resistant recombinants
were
screened for ampicillin sensitivity and arabinose-dependent growth.
Chromosomal replacement of the gyrB gene in a clone, VEC02083 (araC-PBAD-
gyrB), was verified by assaying for specific PCR products, derived from the
chromosomal junctions, with PCR primer pairs DYV-211 (SEQ ID
NO: 45)/DYV-163 (SEQ ID NO: 38) and DYV 107 (SEQ ID NO: 39)/DYV-214
(SEQ ID NO: 46). See Table 7 for primer sequences.
B Susceptibility of VEC02083 (PBAO-gyrB) strain to novobiocin and other
antimicrobial agents
The susceptibility of VEC02083 strain to novobiocin, and to the unrelated
antibiotics fosfomycin and ciprofloxacin, was tested. Novobiocin is an
antibiotic
of the coumarin group that inhibits gyrase by binding to the gyrB gene
product.
Maxwell (1993) Mol Microbiol. 9(4):681-686.
1. Preparation of inoculum. Cells were grown overnight in 5 ml of LB
supplemented with 0.1 % arabinose, on a rotary shaker at 35°C and 200
rpm. 100
~1 of overnight culture was collected, centrifuged at 14,000 rpm for 5 min at
room
temperature, and the cell pellet was suspended in 1 ml of medium with no added
arabinose. The cell suspension was diluted 1:1000 in medium and used as
inoculum.
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which arabinose concentration was varied in the
first
dimension, and concentration of antimicrobial compound in the second. The
concentration of antimicrobial varied by two-fold between rows. Dilutions were
51
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
performed in medium supplemented with different concentrations of arabinose,
or
medium lacking arabinose. A control row lacking antirnicrobial, and a control
column lacking arabinose, were also included. Total volume in each well was 50
~1.
3. Inoculation of plates and incubation. 50 ~1 of inoculum (i.e., diluted
cell suspension) was added to each well. After 20 hours of incubation at
35°C,
cell growth was measured in each well and compared to wells with no inoculum.
4. Results. Figure 15 shows the minimum inhibitory concentration (MIC)
of novobiocin, as a function of arabinose concentration, for the PB,~D-~rB
strain
VEC02083. The results show that the MICs of novobiocin, an inhibitor of gyrase
subunit B, are arabinose-dependent. Figure 15 also shows that the
susceptibility
of VEC02083 to compounds that do not target the product of the gyrB gene, such
as fosfomycin and ciprofloxacin, did not vary with arabinose concentration.
52
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Table 7: Oligonucleotides used for PCR
Oligo Sequence (5' -> 3') SEQ ID
NO
DYV-157 GCATGCCATGGTTTCAGTTTTGCAAGTGTTAC 27
DYV-158 CGAAGATCTTTAGTTCTTATCCTTAAGC 28
DYV-155 GCGGAGCTCGCAGACTGGCAGCCAGTCG 29
DYV-156 TTGGCGCGCCTCCAGAGATGTGTTCAGG 30
DYV-095 GCATGCCATGGCAATCAGTCTGATTGCGGCGTTAGC 31
DYV-096 CGAAGATCTTTACCGCCGCTCCAGAATCTCAAAGC 32
DYV-093 GCGGAGCTCGGCGATGCCACGCGGA'rGG 33
DYV-094 GCTTGGCGCGCCAACGAGTCCACGCTCTCTCC 34
DYV-087 GGTATACCATATGCGAGCTCCAGGCGCGCCTGCAGGA 35
ATTCGATATCAAGC
DYV-088 TGCTCTAGAGCCATATGTTCCGCTAGCTTCACGCTGCC 36
DYV-069 GCACCGGAATTCCCGGGTCAGCCAGTCTAACTGCGAA 37
AGCG
DYV-163 CCTCGACGGTATCGATAAGC 38
DYV-107 TAGCGGATCCTACCTGACGC 39
DYV-218 CGGGATCCGCGAAGAGTACCAGTACACC 40
DYV-099 GCATGCCATGGCATCGAATTCTTATGACTCCTCC 41
DYV-204 GTCCGATCGTTAAATATCGATATTCGCCGC 42
DYV-097 GCGGAGCTCAGCGATTGCTCAAGCAGCG 43
DYV-098 GCTTGGCGCGCCTCTCGCTCATTTATACTTGGG 44
DYV-211 TCAGCGGCCGCCAGCGTGCAGATTGAAGATGC 45
DYV-214 TGACTCGAGCCGTGTAGTAGCTGATATCACGG 46
VCJ005 CCACCATAATTGACGAACGC 47
VCJ007 GTCTTCGGTACGGTCATGGTG 48
53
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Example 11: Construction and properties of a hypersusceptible E. coli
strain
This example describes the construction of a strain of E. coli, VEC02068,
with an essential gene, def, under PB~D control, and with a deletion in the
tolC
S gene. Because the essential def gene is under PBAD control, the
susceptibility of
VEC02068 to inhibitors of the def gene product depends on the concentration of
arabinose in the growth medium. Mutants in tolC are hypersusceptible to many
compounds, because tolC encodes an outer membrane protein, which can serve as
a component of an efflux pump. Thus, the threshold for susceptibility to
compounds which interact with the def gene product is lowered in a tolC
mutant,
compared to wild-type. Because of its heightened susceptibility, the tolClPBRO-
def
strain can be used for detecting compounds that otherwise would not have been
identified as inhibitors of a strain that is wild-type for tolC.
A. Construction of a tolC deletion in an E. coli strain containing a PBAO-def
transcriptional fusion
The tolC gene was PCR amplified from E. coli strain VEC01004 using
primers VCJ005 (SEQ ID NO: 47, Table 7) and VCJ007 (SEQ ID NO: 48, Table
7). The 2.7 kb PCR product was blunt-end cloned into pUCl8 creating pCHl2.
A 700 by internal deletion of tolC was created by digestion of pCHl2 with the
compatible enzymes PstI and NsiI, creating pCHl3. The 2.0 kb OtolC fragment
was excised from pCHl3 by SmaI/EheI digestion and cloned into SmaI digested
pK03 creating pDY92.
The pDY92 plasmid was used to introduce the tolC deletion mutation
(~tolC) into the chromosome of VEC02065 (an E. coli strain containing a
chromosomal PBAO-def fusion) via the selection /counter-selection procedure
previously described for other suicide vector constructs. See Examples 8-10
Transformed cells were screened for successful integration of the OtolC
mutation
by plating on LB + 0.2% arabinose, and replica-plating onto MacConkey agar,
which does not support growth of ~tolC mutants. Confirmation of OtolC
integration in MacConkey-sensitive clones was verified by PCR with
oligonucleotides VCJ005 (SEQ ID NO: 47, Table 7) and VCJ007 (SEQ ID
54
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
NO: 48, Table 7). A OtolC strain containing the PB~D-def fusion, VEC02068, was
selected for susceptibility testing.
B Susceptibility of VEC02068 to VRC483 and other antimicrobial agents
An experiment was conducted using VEC02068 (OtolC, PBAO-def) and a
parent strain (VEC02066) containing a deleted tolC gene and lacking the PBAD-
def
fusion, to compare their susceptibility to VRC483 over a range of arabinose
concentrations. VRC483 is a compound with antibacterial activity that targets
the
def gene product. This compound was identified in a deformylase screen at
Versicor and the ICSO is 11 nM for E. coli deformylase. Deformylase activity
was
measured as described in Example 8 (Rajagopalan et al., supra).
1. Preparation of inoculum. Cells were grown overnight in 5 ml of LB
supplemented with 0.1 % arabinose, on a rotary shaker at 35°C and 200
rpm. 100
~1 of overnight culture was collected, centrifuged at 14,000 rpm for 5 min at
room
temperature, and the cell pellet was suspended in 1 ml of medium with no added
arabinose. The cell suspension was diluted 1:1000 in medium and used as
inoculum.
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which arabinose concentration was varied in the
first
dimension, and concentration of antimicrobial compound in the second. The
concentration of antimicrobial varied by two-fold between rows. Dilutions were
performed in medium supplemented with different concentrations of arabinose,
or
medium lacking arabinose. A control row lacking antimicrobial, and a control
column lacking arabinose, were also included. Total volume in each well was
501.
3. Inoculation of plates and incubation. 501 of inoculum (i.e., diluted cell
suspension) was added to each well. After 24 hours of incubation at
35°C, cell
growth was measured in each well and compared to wells with no inoculum.
4. Results. Figure 16 shows the minimum inhibitory concentration (MIC)
of VRC483, as a function of arabinose concentration, for the tolClPBAO-def
strain
VEC02068. The results show that the MIC of VRC483, a deformylase inhibitor,
for VEC02068 is dependent on the concentration of arabinose in the growth
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
medium. The parent wild type strain was not susceptible to the antibiotic in
the
range tested. Comparison to Figure 13 (Example 8) indicates that
susceptibility to
VRC483 occurs at lower arabinose concentrations, as predicted. Figure 16 also
shows that the susceptibility of VEC02068 to compounds that do not target the
def gene, such as fosfomycin and ciprofloxacin, did not vary with arabinose
concentration.
Example 12: Construction and properties of a S. pneumoniae strain
containing a P,,cA-def transcriptional fusion
A Construction of PACA-def transcriptional fusions in S. pneumoniae
A DNA sequence containing rafR and PACA (aga promoter) was PCR-
amplified from S. pneumoniae VSPN3026 chromosomal DNA using
oligonucleotides REGAGAEIS' (SEQ ID NO: 20, Table 6) and REGAGANB3'
(SEQ ID NO: 21, Table 6) and cloned as an EcoRI/NdeI fragment into the
integration vector pR326 (Claverys et al., supra), resulting in plasmid
pR326RafRPaga.
The first 317 by of the deformylase gene (deb from S. pneumoniae
VSPN3026 chromosomal DNA were PCR amplified using oligonucleotides
MALDEFS' (SEQ ID NO: 49 Table 8) and MALDEF3' (SEQ ID NO: 50 Table 8)
and cloned as an NdeIBamHI fragment into plasmid pR326RafRPaga, resulting
in plasmid pR326RPADEF.
Using pR326RPADEF as a template, a DNA sequence containing only
Paca and the def fragment was amplified using oligonucleotides PagaS'EI (SEQ
ID NO: 24, Table 6) and MALDEF3' (SEQ ID NO: S0, Table 8) and cloned into
the T-tailed pGEM-T Easy Vector (Promega Corporation, Madison, WI}. The
construct was digested with EcoRI and the PACA-def containing fragment was
cloned into the integration vector pR326 to create pR326Pagadef. This plasmid
was used to transform VSPN3026, grown in C+Y without sucrose and
supplemented with different raffinose concentrations (two-fold dilutions from
2%
to 0.008 %). Transformants were used to inoculate tubes containing 2 ml C+Y
medium supplemented with chloramphenicol (2.5 ~g/ml) and different raffinose
56
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
concentrations (1% to 0.041%), and incubated at 37°C overnight. The
overnight
culture was used to inoculate (10 pl per well} a 96 well microtiter plate
containing
200 ~l C+Y with different raffinose concentrations, ranging from 1 % to 0.041
(see above,) and incubated at 37°C in a C02 incubator with S% C02.
Cultures
were plated on TSA sheep-blood agar plates containing chloramphenicol (2.5
p.g/ml) and 0.2% raffinose. The plates were incubated overnight at 35°C
and a
single colony was picked and transferred to C+Y medium supplemented with
chloramphenicol (2.5 pg/ml) and raffinose (0.03%). The resulting S. pneumoniae
strain, VSPN3044, carries an insertion at the def locus in the chromosome,
which
was verified by PCR using the primers Paga100 (SEQ ID NO: 25, Tabie 6) and
DEF3'Bam (SEQ ID NO: 51, Table 8). The strain carries a truncated 316 by def
gene under natural promoter control and a full-length def gene under P,~G~
control.
Table 8: Oligonucleotides used in PACA construction and mutant
characterization
Oligo Sequence (5' -> 3') SEQ ID
NO
MALDEFS' GGGGAATTCCATATGTCTGCAATAGAACGTATTAC 49
MALDEF3' CCGCGGATCCAAATCGTAGGCTTCCTGTGG 50
DEF3'Bam GGCGCGGATCCTTAAGCTTCGATTTCTGTAACCATAC 51
CTG
B. Susceptibility of VSPN3044 to VRC483, vancomycin, and
erythromycin
An experiment was conducted using the PACa-def strain VSPN3044 and its
parent strain (VSPN3026), to compare their susceptibility to VRC483 as a
function of raffinose concentration. Susceptibility of VSPN 3044 to vancomycin
and erythromycin at different raffinose concentrations was also tested. VRC483
is a compound with antibacterial activity that targets the def gene product.
This
compound was identified in a deformylase screen at Versicor and the ICSO is 11
nM for E. coli deformylase. Deformylase activity was measured as described in
Example 8 (Rajagopalan et al., supra).
57
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
1. Preparation of inoculum. VSPN3044 and VSPN3026 were grown for 4
hours at 37°C in 5 ml C+Y lacking sucrose and supplemented with 0.03
raffinose. Cells were grown to an OD of 0.2 at 600 nm. Aliquots of 200 pl were
frozen at -70°C as a 15% glycerol solution. When needed for
inoculation, frozen
stock was melted, centrifuged, and the supernatant discarded. The cell pellet
was
resuspended in 1 ml of C+Y with glucose, diluted 1:1000 into the same medium
(chloramphenicol was added to the VSPN3044 medium) and used as inoculum.
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which raffinose concentration was varied in the
first
dimension, and concentration of antimicrobial compound (VRC483, vancomycin,
or erythromycin) in the second. The concentration of antimicrobial varied by
two-fold between rows. Dilutions were performed in C+Y supplemented with
different concentrations of raffinose, or C+Y lacking raffinose. A control row
lacking antimicrobial, and a control column lacking raffinose, were also
included.
Total volume in each well was 50 pl.
3. Inoculation of plates and incubation. 50 pl of inoculum (i.e., diluted
cell suspension) was added to each well. After 20 hours of incubation at
35°C,
cell growth was measured in each well and compared to wells with no inoculum.
4. Results. Figure 17 shows the minimum inhibitory concentration (MIC)
of VRC483, as a function of raffinose concentration, for the PACA-def strain
VSPN3044, compared to the parent wild type strain VSPN 3026. The results
show that, for VSPN3044, the MIC of VRC 483, a deformylase inhibitor, is
dependent on the concentration of raffinose in the growth medium. MIC values
for the wild-type strain are not dependent on raffinose concentration. Figure
17
also shows that the susceptibility of VSPN 3044 to erythromycin and
vancomycin,
which do not target the def gene, did not vary with raffinose concentration.
Example 13: Construction and properties of a strain containing a
PaAn-IPxC transcriptional fusion and a tolC deletion
This example demonstrates the construction and properties of a fusion in
which the gene of interest is inserted downstream of the PBAO promoter at the
58
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
normal chromosomal location of PBaD. In this way, potential polar effects on
genes downstream from the gene of interest are avoided.
A Construction of an E coli OtolC strain with a PeAD-lpxC transcriptional
fusion
The product of the IpxC gene is the enzyme UDP-3-O-(R-3-
hydroxymyristoyl)-N-acetylglucosamine deacetylase, which plays a major role in
lipopolysaccharide synthesis in Gram-negative bacteria. A DNA sequence
containing the full-length lpxC gene was PCR-amplified from E. coli strain
MG1655 chromosomal DNA using oligonucleotides DYV-240 (SEQ ID NO: 56)
and DYV-241 (SEQ ID NO: 57, Table 9), and cloned as an NcoIBgIII fragment
into pNR41 creating pNR43. pNR41 contains two regions of homology with the
araBAD locus on the chromosome. One region contains an optimized PBAD
promoter and approximately 500 by of upstream DNA corresponding to the araC
gene, the second region contains 600 by of an internal fragment of the araD
gene.
The araC-PBAp-IpxC-araD cassette was excised from pNR43 as an XmaI/SaII
fragment and cloned into XmaI/SaII digested pK03, thus creating pNR48.
pNR48 was transformed in E. coli strain MG1655. Transformants were
selected on LB plates supplemented with chloramphenicol (25 pg/ml) at
30°C. A
number of transformants were streaked onto LB plates supplemented with
chloramphenicol (25 pg/ml) and incubated at 43°C overnight. Isolated
colonies
were then restreaked at 43°C onto LB plates supplemented with
chloramphenicol
(25 pg/ml). Isolated colonies were next streaked onto LB plates and incubated
at
37°C overnight. Isolated colonies were then streaked onto LB plates
supplemented with sucrose (6%) and incubated at 37°C overnight to
select for
sucrose-resistant recombinants. NaCI was omitted from LB plates during sucrose
resistance selection. Sucrose-resistant recombinants were screened for the
inability to ferment arabinose on MacConkey agar plates supplemented with 0.4%
arabinose and scored for chloramphenicol sensitivity. Chloramphenicol-
sensitive
clones that were deficient in arabinose utilization were candidates for
successful
integration of the IpxC gene into the araBAD operon. One clone, VEC02520
59
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
(araC-PBAO-lpxC), was verified by checking the chromosomal junctions with PCR
primer pair DYV-246/DYV-249 (SEQ ID NOS: 58 and 59, Table 9).
Having placed the lpxC gene under arabinose control at the araBAD locus,
the next step was to delete the endogenous lpxC gene from its normal
chromosomal context. An in frame deletion of lpxC, which resides in a
dicistronic operon with the essential gene secA, was made using crossover PCR.
Link et al. (1997) J. Bacteriol. 179:6228-6237. The crossover PCR reaction
created a 1.2 kb product consisting of 600 by fragments of DNA to the left and
right of the sequence targeted for deletion. The four primers used for
crossover
PCR amplification were DYV-224 (SEQ ID NO: 52), DYV-225 (SEQ ID
NO: 53), DYV-226 (SEQ ID NO: 54) and DYV-227 (SEQ ID NO: 55, Table 9).
The resulting PCR product was digested with BamHI and cloned into BamHI-
digested pK03, creating pNR36.
Plasmid pNR36 was transformed in E. coli strain VEC02520.
Transformants were selected on LB plates supplemented with 0.2% arabinose and
chloramphenicol (25 ~g/ml) at 30°C. A number of transformants were
streaked
onto LB plates supplemented with 0.2% arabinose and chloramphenicol (25
pg/ml) and incubated at 43°C overnight. Isolated colonies were then
restreaked at
43°C onto LB plates supplemented with 0.2% arabinose and
chloramphenicol (25
~g/ml). Isolated colonies were next streaked onto LB plates supplemented with
0.2% arabinose and incubated at 37°C overnight. Isolated colonies were
then
streaked onto LB plates supplemented with 0.2% arabinose and sucrose (6%) and
incubated at 37°C overnight to select for sucrose-resistant
recombinants. NaCI
was omitted from LB plates during sucrose resistance selection. Sucrose-
resistant
recombinants were screened for arabinose-dependent growth and scored for
chloramphenicol sensitivity. Chloramphenicol-sensitive clones that required
arabinose for growth were candidates for successful deletion of the lpxC gene
from its normal chromosomal context. One clone, VEC02522 (araC- PBAO-lpxC
,~lpxC), was verified by checking the chromosomal junctions with PCR primer
pairs DYV-224/DYV-227 (SEQ ID NOS: 52 and 55, Table 9).
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
The tolC gene was PCR-amplified from E. coli strain VEC01004 using
primers VCJ005 (SEQ ID NO: 47, Table 7) and VCJ007 (SEQ ID NO: 48, Table
7). The 2.7 kb PCR product was blunt-end cloned into pUCl8 creating pCHl2.
A 700 by internal deletion of tolC was created by digestion of pCHl2 with the
compatible enzymes PstI and NsiI, creating pCHl3. The 2.0 kb ~tolC fragment
was excised from pCHl3 with SmaI-EheI and cloned into SmaI digested pK03,
creating pDY92.
The OtolC mutation was introduced onto VEC02522 and E. coli MJ1655
with pDY92 via the selection/counter-selection procedure previously described
for other suicide vector constructs. Successful integration of the OtolC
mutation
was screened on MacConkey agar which does not support growth of tltolC
mutants. Confirmation of OtolC integration in MacConkey-sensitive clones was
verified by PCR with oligonucleotides VCJ005 (SEQ ID NO: 47, Table 7) and
VCJ007 (SEQ ID NO: 48, Table 7). VEC02524 is an araC-PB~D-lpxC, OlpxC,
~tolC mutant and VEC02526 is a OtolC mutant. These strains were used for
further experiments.
B. Susceptibility of VEC02524 (PBAn-IPxC) to L159692 and other
antimicrobial agents
An experiment was conducted using the VEC02524 strain and the tolC
isogenic strain (VEC02526), to compare their susceptibility to L159692 within
a
range of arabinose concentrations. L159692 is an antibacterial compound that
targets the lpxC gene product. Onishi et al. (1996) Science 274:980-982. The
susceptibility of VEC02526 to other unrelated antibiotics, linezolid and
erythromycin, was also tested.
1. Preparation of inoculum. Cells were grown overnight in 5 ml of LB
supplemented with 0.1 % arabinose, on a rotary shaker at 35°C and 200
rpm. 100
pl of overnight culture was collected, centrifuged for 5 min. at room
temperature
at 14,000 rpm, and the cell pellet was suspended in 1 ml of medium with no
added
arabinose. The cell suspension was diluted 1:1000 in medium and used as
inoculum.
61
CA 02325602 2000-10-13
WO 99/52926 PGT/US99/08164
2. Preparation of 96 well plates. Checkerboard assays were performed in
96-well microtiter plates, in which arabinose concentration was varied in the
first
dimension, and antimicrobial compound in the second. Antimicrobial
concentration varied by two-fold between rows. Dilutions were performed in
medium supplemented with different concentrations of arabinose or lacking
arabinose. A control row lacking antimicrobial, and a control column lacking
arabinose, were also included. Total volume in each well was 50 ~1.
3. Inoculation of plates and incubation. 50 wl of inoculum (i.e., diluted
cell suspension) was added to each well. After 20 hours of incubation at
35°C,
cell growth was measured in each well and compared to wells with no inoculum.
4. Results. Figure 18 shows the minimum inhibitory concentration (MIC)
of L159692, linezolid, and erythromycin, as a function of arabinose
concentration,
for the PBAO-lpxC strain. The susceptibility of the isogenic tolC strain,
VEC02526, to any of the compounds tested was not influenced by the amount of
inducer in the medium.
Table 9: Oligonucleotides used for PCR in the construction of PBAn-lpxC
fusions
_ SEQ ID
Oligo Sequence NO
DYV-224 TCGGATCCGGCTACGCAATGATGGGTTC $2
DYV-225 CCCATCCACTAAACTTAAACATGTCCTTTGTTTGATCATCG 53
DYV-226 TGTTTAAGTTTAGTGGATGGGTTGGCCTTCAAAGCGCCTTCA 54
DYV-227 GTGGATCCGTAATGCAAGATCTTGCGC 55
DYV-240 GGTTCCATGGCAATCAAACAAAGGACACTTAAACG 56
DYV-241 GTCAGATCTTTATGCCAGTACAGCTGAAGG 57
DYV-246 GACCCGGGTGATACCATTCGCGAGCC 58
DYV-249 GAGTCGACGCAGCGTTTGCTGCATATCC 59
Example 14: Regulatory properties of the S. pneumoniae raf gene
cluster
The regulation of the S. pneumoniae raf operons by various sugars,
including raffinose, was investigated, using a-galactosidase activity as a
reporter.
The aga gene exhibits sequence homology to other prokaryotic a-galactosidases,
62
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
and this example shows that a-galactosidase activity is encoded by aga in
S. pneumoniae. Hence, the S. pneumoniae aga gene, regulated by its promoter
P~o~, serves as a naturally-occurring reporter gene for use in the study of
induction and regulation of the S. pneumoniae raf gene cluster, and can also
be
used as a reporter gene for the analysis of other potential regulatory
sequences in
S. pneumoniae and other microorganisms.
Cells and Cell Growth
S. pneumoniae strain VSPN3026 was used as wild-type for the
experiments described herein. Cells were grown in C+Y Medium (Tomasz (1970)
J. Bacteriol. 101:860-871 ) containing 0.2% (w/v) sucrose and 0.2% (w/v)'
glucose, and logarithmic phase cells were frozen in 20% (v/v) glycerol, to be
used
for inoculation. In experiments to identify inducers of galactosidase
activity, C+Y
medium containing various sugars was used. All sugars were used at a
concentration of 0.2% (w/v). Eight ml of medium was inoculated with 200 ~tl of
frozen stock cells, and the culture was grown at 37°C. Growth of the
culture was
measured by absorbance at 600 nm, using a visible spectrophotometer. When
A6oo reached 0.4, cells were used for experiments.
Measurement of a-~~alactosidase activity
To prepare cell lysates for measurement of enzyme activity, 1.5 ml
samples of cell culture were collected and immediately centrifuged for 5 min.
at
14,000 rpm to pellet the cells. The supernatant was discarded and the pellet
was
resuspended in 0.1 ml of 100 mM sodium phosphate buffer, pH 7.5 containing
0.25% Triton X-100. This mixture was incubated at 37°C for 10 min to
lyse the
cells.
Alpha-galactosidase activity was measured in a buffer containing 100 mM
sodium phosphate, 1 mM MgCl2, 45 mM (3-mercaptoethanol, pH 7.5, containing
p-nitrophenyl-a-D-galactopyranoside (Sigma Chemical, St. Louis, MO) at a final
concentration of 0.9 mg/ml. The reaction was initiated by addition of 10 p,l
cell
lysate to 90 ~,! of reaction buffer and the reaction mixture was incubated at
25°C.
Enzymatic activity was monitored by measuring absorbance at 405 nm. A4os
measurements were taken every 30 sec for 30 min using a Spectramax 250
63
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
microtiter plate reader (Molecular Devices, Sunnyvale, CA). Specific activity
was calculated using a p-nitrophenol standard.
Results are shown in Table 10. As can be seen, low basal levels of
a-galactosidase activity were observed in lysates from cells grown with sugars
other than raffmose as a sole carbon source. However, a 200-1,000-fold
induction
of a-galactosidase activity was observed in cells grown on raffinose.
Combinations of raffinose and a second sugar gave enzyme levels that were
16-500-fold greater than those obtained with the second sugar alone. Thus, by
adjusting the concentration of sugar and/or the combination of sugars in the
medium, expression of coding sequences regulated by raf regulatory sequences
can be modulated over an approximately 1,000-fold range.
Table 10: Galactosidase activity measured in
lvsates from cells gown on different sugars
Sugar* Specific Activity
(nmolp-nitrophenoUmin/mg
protein)
glucose 12
fructose 20
sucrose 24
galactose 3 0
lactose 17
maltose 7
raffinose 7,099
fructose + raffmose4,681
sucrose + raffinose382
galactose +raffinose9,714
lactose + raffinose8,258
maltose +raffinose~ 3,580
*All sugars are present in the medmm at a concentration or u.~ ro ~mv~
64
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Construction of mutants in the aga, rafR and ra~S' genes
To characterize the raf regulatory system, gene knockouts in the aga, rafR
and rafS genes were constructed by the method of Claverys et al. (1995) Gene
164:123-128, as follows.
A DNA fragment containing a region of the aga gene was amplified by
polymerise chain reaction (PCR) using oligonucleotides agal and aga2 as
primers. See Table 11 for the sequences of oligonucleotides. This generated a
320 by amplification product. The amplified sequence was ligated into
pGEM-T Easy (Promega, Madison, WI). The resulting construct was digested
with EcoRI, to release an approximately 339 by fragment containing aga
sequences. This fragment was inserted into the EcoRI site of pR 326 (Claverys
et
al., supra) to create pR326AGAK0. This plasmid was used to transform
VSPN3026 to construct a S. pneumoniae strain, VSPN3037, with an insertion of
pR326 sequence in the chromosomal aga gene, thereby inactivating the aga gene.
I 5 A DNA fragment containing an internal portion of the rafR gene was
PCR-amplified using oligonucleotides rafRl and rafR2 as primers. See Table 11
for sequences. This generated a 449 by amplification product. The amplified
sequence was ligated into pCRII (Invitrogen, Carlsbad, CA). The resulting
construct was digested with EcoRI, and an approximately 440 by rafR-containing
fragment was inserted into the EcoRI site of pR 326 to create pR326RAFRKO.
This plasmid was used to transform VSPN3026 to construct a S. pneumoniae
strain, VSPN3038, with an insertion of pR326 sequence in the chromosomal rafR
gene, thereby inactivating the rafR gene.
A DNA fragment containing an internal portion of the rah gene was
PCR-amplified using oligonucleotides rafS 1 and rafS2 as primers. See Table 11
for sequences. This generated a 454 by amplification product, which was
ligated
into pCRII (Invitrogen, Carlsbad, CA). The resulting construct was digested
with
EcoRI and an approximately 445 by rafS-containing fragment was obtained,
which was inserted into the EcoRI site of pR 326 to create pR 326RAFSKO. This
plasmid was used to transform VSPN3026 to construct a S. pneumoniae strain,
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
VSPN3039, with an insertion of pR326 sequence in the chromosomal rafS gene,
thereby inactivating the rafS gene.
Table 11: Sequences of Oligonucleotide used for
construction of mutations in the aga, rafR and rafS genes
OligonucleotideSequence (5' ~ 3') SEQ ID
NO.
agal GCTCAACTTAGTCTGACTTTG 60
aga 2 CAAACACATTCCCAGCATCCTCTG 61
rafRl CGCGGATCCTCGAGAAGTTGTCTAGCTCGG 62
rafR 2 CCGGAATTCTAGGAATCACTGGAGGGAAA 63
raf51 CCGCGGATCCGCTACAAGTAGTGTGTAGGATGG 64
raf5 2 GCCGGAATTCAATCCTACCAAGCTGTCTACC 65
Characterization of mutants
The aga, rafR and rafS mutant strains were tested for growth and for
a-galactosidase activity, when provided with raffinose, sucrose or a mixture
of
raffinose and sucrose as carbon source. Mutant strains were grown in C+Y
medium containing different carbon sources (as indicated in Table 12) and
growth
was monitored by absorbance of cultures at 600 nm, measured by
spectrophotometry. When cultures reached an A6~ of 0.4, cells were collected
and assayed for a-galactosidase activity as described supra. Assay results are
shown in Table 12.
Strains with a mutation in aga were unable to grow on raffinose. The
inability of an aga mutant strain to grow on raffinose confirmed that mutation
had
occurred in a gene necessary for raffinose metabolism and, since raffinose is
an
a-galactoside, is consistent with the inactivation of an a-galactosidase.
The aga mutant strains grew when either sucrose or sucrose + raffinose
were provided as carbon sources, but exhibited non-measurable levels of
a-galactosidase activity under both of these conditions. See Table 12. These
results indicate that the a-galactosidase activity observed in wild-type cells
grown
on raffinose is provided by the product of the aga gene. Taken together, the
66
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
results indicate that expression of the aga gene is activated by raffinose;
i.e.,
raffinose is an inducer of aga.
A strain harboring a mutation in the rafR gene is able to grow on raffinose,
but induced levels of a-galactosidase in this strain are seven-fold lower than
in
wild-type cells. See Table 12. Thus, rafR function is required for maximal
induction of aga activity. These results are those expected if the rafR gene
product acts as an activator of the aga gene, and are consistent with the
presence,
in the amino acid sequence of the rafR gene product, of the AraC family
signature
sequence. They are also consistent with the high degree of homology between
the
RafR amino acid sequence and the sequences of other transcriptional activator
proteins.
Strains with rafR mutations grow slowly when raffinose is provided as a
sole carbon source, as expected if RafR is an inducer of the raf metabolic
operon.
However, rafR mutants also grow more slowly than wild-type when sugars other
than raffinose are provided as a carbon source. This suggests that RafR has
additional regulatory targets outside the raf metabolic operon, and that the
RafR
protein may have additional regulatory functions beyond those that are related
to
raffinose metabolism. Products of non-raf genes that are regulated by RafR may
serve as potential targets for drug discovery.
Strains carrying mutations in rafS that were grown in the presence of
raffinose (i.e., either raffinose alone or raffinose + sucrose) express higher
levels
of a-galactosidase activity than wild-type cells. These results are consistent
with
the rafS gene product being a negative regulator of aga expression.
An alternative interpretation of these results is possible if, for example,
inactivation of rafR has a polar effect on rafS, such that the activity
detected in
rafR mutants reflects absence of both RafR and RafS function. If this were the
case, the rafR gene product could be an activator, or the combined activity of
the
rafR and rafS gene products could provide activator function.
67
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
Table 12: a-galactosidase activity in mutant strains
grown on different carbon sources
Specific Activity
(nmol p-nitrophenoUmin/mg
protein)
Strain Sucrose Raffinose Sucrose + Raffinose
VSPN3026 (wild-type)4.8 2,538 137
VSPN3037(aga 0.1 ND (no growth)0.1
)
VSPN3038(rafR-)3.9 346 32
VSPN3039 (rah')8.3 3,756 403
While the foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
apparent to those skilled in the art that various changes and modifications
may be
practiced without departing from the spirit of the invention. Therefore the
foregoing descriptions and examples should not be construed as limiting the
scope
of the invention.
68
CA 02325602 2000-10-13
WO 99/52926 PGT/US99/08164
SEQUENCE LISTING
<110> Trias, Joaquim
Young, Dennis
Rosenow, Carsten
<120> REGULATED TARGET EXPRESSION FOR
SCREENING
<130> 342312000840
<140> Unassigned
<141> Unassigned
<160> 65
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4065
<212> DNA
<213> S. pneumoniae
<400> 1
attttacttccaactattgagagaaatttc 60
gccactattt
agccagattt
cttttccgtt
atcacattgaactaaaagttttccattttctgagatgtct ccttgtagtc 120
ttagcaagtc
tttttgctctagtgtgaaagtgacttcttttcctagaatg ttttgtatag 180
aatgactgtt
gtataatagctcttctgctggtgtttcgaagaaagcacgccagatttctatgatcaattc 290
attccttgttataggagctgtagctttaaataagctggcagctttttcttttaattcctg 300
agggaagtctttaatagtgaaattgatcctactccaataatgatatctgtgactaagcca 360
gtttctacagaggtcattgcttcagtaaggattcctccaattttatgattgtttagatag 420
atatcattgacccattttatatcgacatctattaaagttaggttcttaatggctttgtag 480
acagctccagctacaagtagtgtgtaggatggtaatttgtcataggggagatttggttta 540
agatggagtgtcatataaattccaccttgtggtgagtagaaggaacgttgaaaacggcct 600
cggcctgctgtttgataggaagctagatagagagtatttgcttcatggcctaaatcaatt 660
gcttcttttgcatctagttgtgttgattttgtttcgggtttaaagctgactttaattgga 720
agattttcttctagaatctctggaagaataaggtcaccattcattagtttatatcctcta 780
tttttgatactattaatttcaatgccttcttgttctagtcgcttgatagctttccaaatt 840
gatgttcggcttagggatagtttttctgcgattttttctccgctgatatagtcggtttct 900
ttagataggatttggtagacagcttggtaggatttcataatgttgcctttctcactagtt 960
ggtattgagagtattcttttcttgtatgacttggagactgattaaagtattgtttataag 1020
ctttcgaaaaatggagtggatctgaaaaacctaccgagtatgcaattaccttgatggact 1080
cttgggtattttcgagaagttgtctagctcggtgcattcgaacgtagagtaggtattctt 1140
tgggtgataaggtattaaattctttgaatacgcttgataagtagcttctgtgaacggata 1200
gttcttttgctaaatcttgaattgtaagtgattgaggatagtggctatcaattaatcgtt 1260
tgcattcaagatagagttggtgggttgatgaaatattcttttttttctgattgggagcaa 1320
tagttcccagatgaaacatcagttcatgaagttgtcccatgatatggagttgagctaatt 1380
cacttgattttgtaatctgagcgaagcggacaatgtctgagatgagttttgcagtagtct 1440
gggtatgacaagtttcagattggatgagataggattgatcagaaatttgagaaagagcaa 1500
aataatcaggggatttccctccagtgattcctaaccagtagtaggcccaaggttctttac 1560
tatctgcttgataaaaggttagttcctctggttttaatagaaagaaatctccttctttta 1620
aatcaacaattttacccttgtaatgaaattttccttgtcctttactaatgtaatgtagga 1680
cgtatgtatcacgaatggctggaccaaaagagtaattaggtgtgcattcctcatatccat 1740
aaaagcttagggcaaggtcaattgttccagtctggtattctgaaaaaactagcatgtgct 1800
acctcctacctaacattttaccatattcttgagacatttttctattttggaaagcgattt 1860
caggtgataaaatataatcaataaagtgatgaggtgaagtaaatgggagttaggatagag 1920
aataatctattttatgttgagagtaaaaatctaagtttgattattgaaaatcgaaatggc 1980
tacttacttt aggaaagactattaagaactataaaggttccaatagtgtt 2090
tgaaacattt
tatgaacgag ttcaggaaatccaacggctactaatcgaacctttagttta 2100
accatgcctt
CA 02325602 2000-10-13
WO 99/52926 PCTNS99/08164
gatactcagcgacagatttttggacaacatggcttaggagattttaggaaaccaactata2160
caggttcagcatagtgtaactgaagtaacagactttcgatttgtagaagcaaagatttta2220
aaaggtcagaatggtccacagggcttaccttctccacatagcatggacgatacagagact2280
cttgtcttaatgttagaagattctaaggctcaacttagtctgactttgtattatactact2340
tttaataatgatgcgactattgctagctacagtaaattagataataatagtaatcaggaa2400
gttgtcatccataaagatttttcttttatggctgattttccagctgcagattacgaaata2460
gtaactctgcagggtgcttatgctcgtgaaaagactgttagacgtcaacaggtagaacaa2520
ggaatcttttcgattagttcaaaccgaggtgcttctggtcatgctcaaacaccagctctt2580
ctactatgcgaacaaggagtcacagaggatgctgggaatgtgtttgctattcaactaatg2640
tatagtggcaactttgaagcttttgttcaaaaaaatcaattgaatgaagttcgggtggct2700
attggcattaatccagaaaacttttcttggaagttagcccctgaggaatactttgaaaca2760
ccggtagctttagtgactcattcagatcagggattaactggtattagtcatgaaagtcag2820
aattttgtactgaagcacattattctaagtgaattttctaaaaaagaacgtccaattcta2880
atcaataactgggaagctacttactttgactttcagagagaaaaactgttagagttagca2940
gatgaagctaagaaagttggcattgaactttttgtattagatgatggttggtttggcaat3000
cgttttgatgataatcgtgctttaggtgattgggttgttaatgaggaaaaactgggtgga3060
agtctagaaagtctgatttcagctatccatgaaagaggtttgcagtttggactttggtta3120
gaacccgaaatgatttctgtagatagtgatttgtatcgtcaacatcctgactgggctatt3180
caggttcctgattatgagcatacttattctcggaatcaattagtacttaatcttgccaat3290
cctcaggtagtagaatacttgaaaagtgtcttagatcaactcctatcttatcatgagatt3300
gattacattaaatgggatatgaaccgcaatatcactaagctagggaatggattaacttat3360
ctagagacacagatgcaatctcatcagtacatgctgggactttacgaactcgtttcttat3920
ctgacagagaagcacagccatattctctttgagtcctgctctggtggtggtggacgaaat3480
gatcttggtatgatacgctatttcccacaagtctgggctagtgataatactgatgccatt3540
gcacgtttaccaattcaatacggttcatcctatctctatccaaccatttctatgggggct3600
catgtgtcagcagtaccgaatcatcagatgggacgaatgacaccattagaaacacgtggc3660
catgtagcaatgatgggaaatttgggctatgagcttgatttgacaaatttatcagatgaa3720
gagaaagctacgattgctaatcaggtgaacttgtataaagaattacgaccagtagttcag3780
ttaggacagcagtatagactaattaatcctgatactgcatccaatgaagcagctgtacaa3840
tttaattacggaaatcaaacgattgtaacctacgttcgcgttttatctgttgtagagacc3900
atggaaacaactttaaaattaaaagatttggatgaagagggactatataaattacaggaa3960
aatggcgaagtttactcaggtgcagaactaatgtatgcgggcttaactgttatcttatcc4020
caaggagattttttgagtagacagtatatttttagaaaactatga 4065
<210> 2
<211> 544
<212> DNA
<213> S. pneumoniae
<400> 2
cataatagcacctcgtgtgttaaaataatggaacgttgcgtattttgcagacgcaaacgt 60
ttgcgttacttataagtatactccttttcaacgcataattgcaagcgttttaaaaacttt 120
tgatatttaggagactaactcatttagcaagataactaaactatctaatcctaaggtttg 180
actctcacgagacagtctacaaagtacaaaacctccttagggagcttgaatttatatgta 240
acaaagcacaaacgtccatagaaaatagatagggattagaaccagggaggtagcccctcc 300
tggtttccctctttagacagattccatatatttttattaaaaaatactgtattcttatct 360
atttcatacttttcttctattaaaatgcaaaattatgctatcaaatcaagcttaaaaatt 420
ttttaaaatttttacaaaaaatacttgcaaccgttttctatttgtgctatactaagctat 480
aaaggaaaacgtttgcgtttccttatcaataaaacttgctattctttgggaggaatacac 540
544
tatg
<210> 3
<211> 26
<212> DNA
<213> Unknown
<220>
<223> primer
<900> 3
2
CA 02325602 2000-10-13
WO 99/52926 PC'T/US99108164
26
ggccatggat aaatttcgtg ttcagg
<210> 4
<211> 27
<212> DNA
<213> Unknown
<400> 4
2~
ggtctagatt attcgccttt cacacgc
<210> 5
<211> 28
<212> DNA
<213> Unknown
<400> 5
28
ggacccgggt ctgatttatc agcgaggc
<210> 6
<211> 37
<212> DNA
<213> Unknown
<400> 6
37
gccatatgtc cggaagctta gtttgttctc agttaac
<210> 7
<211> 19
<212> DNA
<213> Unknown
<400> 7
19
ccggatatgg cgttaaccg
<210> 8
<211> 21
<212> DNA
<213> Unknown
<400> 8
21
cccatggttc cagtaagttc c
<210> 9
<211> 18
<212> DNA
<213> Unknown
<400> 9
18
gtgaatgatg tagccgtc
<210> 10
<211> 22
<212> DNA
<213> Unknown
<400> 10
22
ctcgctaacc aaaccggtaa cc
<210> 11
<211> 42
3
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<212> DNA
<213> Unknown
<400> 11
42
taggttgaat tcatagaaaatagataggga ttagaaccag gg
<210> 12
<211> 72
<212> DNA
<213> Unknown
<400> 12
60
tgcgaggatc ctacttgtcgtcgtcgtcct tgtagtcgat atcatatgta ttcctcccaa
72
agaatagcaa gt
<210> 13
<211> 32
<212> DNA
<213> Unknown
<400> 13
32
ccatcgcata tgagttcaaataaactgaca ac
<210> 19
<211> 33
<212> DNA
<213> Unknown
<900> 14
33
cacgacatat gaatcttttttaatcggcaa tcc
<210> 15
<211> 33
<212> DNA
<213> Unknown
<400> 15
33
ctgaatcgat gcagccacttcttctaatat ggc
<210> 16
<211> 32
<212> DNA
<213> Unknown
<400> 16
agctatcgat tttctaaccttgtagcctca gc 32
<210> 17
<211> 30
<212> DNA
<213> Unknown
<900> 17
taggttgaat tctcgtgtgt 30
taaaataatg
<210> 18
<211> 27
<212> DNA
<213> Unknown
4
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<400> 18
27
cgcaaacgzt tgcgtttatg agcttag
<210> 19
<211> 27
<212> DNA
<213> Unknown
<400> I9
27
ctaagctcat aaacgcaaac gtttgcg
<210> 20
<211> 37
<212> DNA
<213> Unknown
<900> 20
37
cccggaattc agcttggtag gatttcataatgttgcc
<210> 21
<211> 47
<212> DNA
<213> Unknown
<900> 21
gccgcggatc cgcgcatatg catttacttcacctcatcac tttattg 47
<210> 22
<211> 46
<212> DNA
<213> Unknown
<400> 22
46
ggggaattcc atatgaattt atttaaaaatttcttaaaag agtggg
<210> 23
<211> 34
<212> DNA
<213> Unknown
<400> 23
gcgctctaga tcattttcgt aacgaatggtgtcg 39
<210> 24
<211> 42
<212> DNA
<213> Unknown
<400> 24
42
gcgccggaat tccatgtgct acctcctacctaacatttta cc
<210> 25
<211> 22
<212> DNA
<213> Unknown
<400> 25
ctcctaccta acattttacc at 22
<210> 26
S
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<211> 27
<212> DNA
<213> Unknown
<400> 26
ttaaaatgtt ccgatacgggtgattgg 27
<210> 27
<211> 32
<212> DNA
<213> Unknown
<400> 27
gcatgccatg gtttcagttttgcaagtgtt ac 32
<210> 28
<211> 28
<212> DNA
<213> Unknown
<900> 28
cgaagatctt tagttcttatccttaagc 28
<2I0> 29
<211> 28
<212> DNA
<213> Unknown
<400> 29
gcggagctcg cagactggcagccagtcg 28
<210> 30
<211> 28
<212> DNA
<213> Unknown
<900> 30
ttggcgcgcc tccagagatgtgttcagg 28
<210> 31
<211> 36
<212> DNA
<213> Unknown
<400> 31
gcatgccatg gcaatcagtctgattgcggc gttagc 36
<210> 32
<211> 35
<212> DNA
<213> Unknown
<400> 32
cgaagatctt taccgccgctccagaatctc aaagc 35
<210> 33
<211> 28
<212> DNA
<213> Unknown
6
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<400> 33
28
gcggagctcg gcgatgccac gcggatgg
<210> 34
<211> 32
<212> DNA
<213> Unknown
<900> 34
32
gcttggcgcg ccaacgagtc cacgctctctcc
<210> 35
<211> 51
<212> DNA
<213> Unknown
<900> 35
51
ggtataccat atgcgagctc caggcgcgcctgcaggaatt cgatatcaag
c
<210> 36
<211> 38
<212> DNA
<213> Unknown
<900> 36
38
tgctctagag ccatatgttc cgctagcttcacgctgcc
<210> 37
<211> 41
<212> DNA
<213> Unknown
<400> 37
41
gcaccggaat tcccgggtca gccagtctaactgcgaaagc g
<210> 38
<211> 20
<212> DNA
<213> Unknown
<400> 38
20
cctcgacggt atcgataagc
<210> 39
<211> 20
<212> DNA
<213> Unknown
<400> 39
20
tagcggatcc tacctgacgc
<210> 90
<211> 28
<212> DNA
<213> Unknown
<900> 40
28
cgggatccgc gaagagtacc agtacacc
<210> 41
7
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<211> 34
<212> DNA
<213> Unknown
<900> 41
34
gcatgccatg gcatcgaattcttatgactc ctcc
<210> 42
<211> 30
<212> DNA
<213> Unknown
<400> 42
gtccgatcgt taaatatcgatattcgccgc 30
<210> 43
<211> 28
<212> DNA
<213> Unknown
<400> 43
28
gcggagctca gcgattgctcaagcagcg
<210> 44
<211> 33
<212> DNA
<213> Unknown
<400> 44
gcttggcgcg cctctcgctcatttatactt ggg 33
<210> 45
<211> 32
<212> DNA
<213> Unknown
<400> 45
32
tcagcggccg ccagcgtgcagattgaagat gc
<210> 46
<211> 32
<212> DNA
<213> Unknown
<400> 46
tgactcgagc cgtgtagtagctgatatcac gg 32
<210> 47
<211> 20
<212> DNA
<213> Unknown
<400> 47
20
ccaccataat tgacgaacgc
<210> 48
<211> 21
<212> DNA
<213> Unknown
8
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<400> 48
21
gtcttcggta cggtcatggt
g
<210> 49
<211> 35
<212> DNA
<213> Unknown
<400> 49
35
ggggaattcc atatgtctgc attac
aatagaacgt
<210> 50
<211> 30
<212> DNA
<213> Unknown
<400> 50
30
ccgcggatcc aaatcgtaggcttcctgtgg
<210> 51
<211> 40
<212> DNA
<213> Unknown
<400> 51
40
ggcgcggatc cttaagcttcgatttctgtaaccatacctg
<210> 52
<211> 28
<212> DNA
<213> Unknown
<900> 52
28
tcggatccgg ctacgcaatgatgggttc
<210> 53
<211> 41
<212> DNA
<213> Unknown
<400> 53
cccatccact aaacttaaacatgtcctttgtttgatcatc g 41
<210> 54
<211> 41
<212> DNA
<213> Unknown
<400> 54
tgtttaagtt tagtggatgggttggccttcaaagcgcctt c 41
<210> 55
<211> 27
<212> DNA
<213> Unknown
<400> 55
gtggatccgt aatgcaagatcttgcgc 27
<210> 56
9
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<211> 35
<212> DNA
<213> Unknown
<400> 56
ggttccatgg caatcaaaca aaggacactt aaacg 35
<210> 57
<211> 30
<212> DNA
<213> Unknown
<400> 57
gtcagatctt tatgccagta cagctgaagg 30
<210> 58
<211> 26
<212> DNA
<213> Unknown
<400> 58
gacccgggtg ataccattcg cgagcc 26
<210> 59
<211> 28
<212> DNA
<213> Unknown
<400> 59
gagtcgacgc agcgtttgct gcatatcc 28
<210> 60
<211> 21
<212> DNA
<213> Unknown
<400> 60
gctcaactta gtctgacttt g 21
<210> 61
<211> 24
<212> DNA
<213> Unknown
<400> 61
caaacacatt cccagcatcc tctg 24
<210> 62
<211> 30
<212> DNA
<213> Unknown
<400> 62
cgcggatcct cgagaagttg tctagctcgg 30
<210> 63
<211> 29
<212> DNA
<213> Unknown
CA 02325602 2000-10-13
WO 99/52926 PCT/US99/08164
<400> 63
ccggaattct aggaatcact ggagggaaa 29
<210> 69
<211> 33
<212> DNA
<213> Unknown
<900> 64
ccgcggatcc gctacaagta gtgtgtagga tgg 33
<210> 65
<211> 31
<212> DNA
<213> Unknown
<400> 65
gccggaattc aatcctacca agctgtctac c 31
