Note: Descriptions are shown in the official language in which they were submitted.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
RETROVIRAL VECTORS INCLUDING MODIFIED ENVELOPE ESCORT PROTEINS
This invention relates to retroviral vectors which are "targeted" for binding
to a desired target
molecule. More particularly, this invention relates to retroviral vectors
having a first
envelope protein and at least one modified envelope protein. The first
envelope protein
includes a surface protein including a receptor binding region, a
hypervariable polyproline
region, and a body portion. The at least one modified envelope protein is a
modified
retroviral envelope protein in which at least 90% of the amino acid residues
of the receptor
binding region of the envelope protein are removed and replaced with a non-
retroviral
peptide. The non-retroviral peptide may be a ligand which binds to a desired
target
molecule. The term "target molecule," as used herein, means a molecule which
is capable
of being bound by the ligand. Such molecules include, but are not limited to,
cellular
receptors, extracellular components such as extracellular matrix components,
and
antibodies.
BACKGROUND OF THE INVENTION
Retroviral vector particles are useful agents for transducing polynucleotides
into cells,
such as eukaryotic cells.
Thus, retroviral vector particles have been used for introducing
polynucleotides into
cells for gene therapy purposes. In one approach, cells are obtained from a
patient, and
retroviral vector particles are used to introduce a desired polynucleotide
into the cells, and
such modified or engineered cells are returned to the patient for a
therapeutic purpose. In
another approach, retroviral vector particles may be administered to the
patient in vivo,
whereby the retroviral vector particles transduce cells of the patient in
vivo.
In many gene therapy protocols, it would be desirable to target retroviral
vector
particle infection to a specific population of cells either in vivo or in
vitro. In such
circumstances, the broad host range of typical retroviruses present a
significant problem. A
key determinant of viral host range is the "envelope" or "env" protein
(encoded by the env
gene) which is involved in binding to receptors on the surface of susceptible
cells. Where it
is possible to purify the desired target cells, either before or after
transduction, such
purification necessitates undesirable manipulations of the cells and may be
problematic in
situations in which the preferred target cells either are difficult to purify
or are present at low
CONE RMA[tON COPY.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-2-
or variable frequencies in mixed cell populations. Thus, it would be
advantageous to have
retroviral vector particles which could infect particular types of mammalian
cells.
Retroviral vectors have been made which have modified envelopes; however, such
vectors in general are less infective than wild-type retroviral vectors or
retroviral vectors
including foreign genes, but which have unmodified envelopes.
Attempts to insert large, complex, or bulky polypeptides such as single chain
antibodies, polypeptide ligands, or complement regulatory proteins have in the
past been
hampered by poor expression, incorporation, folding, and/or presentation of
the chimeric
env proteins. The present invention provides "modified env proteins" that
permit the
incorporation, expression and assembly of large polypeptides within the basic
framework
(i.e. N-terminal signal peptide, N-terminus, surface (SU) C-terminus and
membrane
spanning transmembrane (TM) domains) of the env protein of a virus, for
example a
retrovirus. These modified env proteins are devoid of much of the receptor
binding domains.
Hereinafter such proteins will be referred to as "escort proteins". Escort
protein necessarily
requires co-expression with a wild type env to gain infectivity. The "escort
protein" provides
the gain of function; i.e. targeting motif that directs or escorts the virus
to the specific target
cell or target ligand, such as IgG or exposed collagen or ECM.
A definition of the following terms is provided for the avoidance of doubt.
A "retroviral vector particle" is an infectious virion derived from a
retrovirus.
A "retroviral vector plasmid vector" is a non-infectious plasmid comprising
retroviral
DNA, wherein said plasmid is capable of use as a vector for transfection of a
target cell
"Retroviral DNA" is DNA transcribed from retroviral RNA by reverse
transcriptase.
SUMMARY OF THE INVENTION
It therefore is an object of the present invention to provide a retroviral
vector which
may be "targeted" to a desired target molecule while retaining the infectivity
of wild-type
retroviruses. Thus, the present invention provides a retroviral vector which
includes a first
envelope protein and at least one modified envelope protein. The first
envelope protein
includes a surface protein which includes a receptor binding region, a
hypervariable
polyproline region, and a body portion. Such an envelope protein may be an
unmodified, or
wild-type, envelope protein, or may be modified at the N-terminus without
removing any
portion of the receptor-binding domain, such as by insertion of a small
peptide or ligand.
The at least one modified envelope protein has been modified such that at
least a major
portion of the receptor binding region of such envelope protein has been
removed and
CA 02326407 2011-07-19
30966-3
-3-
replaced with a non-retroviral protein or peptide, such as a ligand that binds
to a
desired target molecule.
Specific aspects of the invention include:
- a retroviral vector comprising a first retroviral envelope protein and at
least one modified retroviral envelope protein, wherein said first retroviral
envelope
protein includes a transmembrane protein and a surface protein which in an N-
terminal to C-terminal direction includes (i) a receptor binding region; (ii)
a
hypervariable polyproline region; and (iii) a body portion which is associated
with the
transmembrane protein, and said modified retroviral envelope protein, prior to
modification, is a Moloney murine leukemia virus (Mo-MLV) envelope protein and
includes a transmembrane protein and a surface protein which in an N-terminal
to C-
terminal direction includes (i) an ecotropic receptor binding region having
the
sequence set forth as SEQ ID NO: 1; (ii) an amphotropic hypervariable
polyproline
region having the sequence set forth as SEQ ID NO: 2; and (iii) a body portion
which
is associated with the transmembrane protein, and wherein said modified
retroviral
envelope protein has been modified such that at least 90% of the amino acid
residues of the ecotropic receptor binding region of said surface protein of
said
modified retroviral envelope protein have been removed and replaced with a non-
retroviral protein or peptide that binds to a desired target molecule;
- an in vitro method for producing a non-retroviral protein or peptide, the
method comprising administering the vector as described above to cells
isolated from
a host, and expressing the non-retroviral protein or peptide in the cells;
- use of the vector as described above for expressing a non-retroviral
protein or peptide in a host;
- an in vitro method of expressing a non-retroviral protein or peptide in a
cell, comprising: administering to said cell the vector as described above;
CA 02326407 2011-07-19
30966-3
- 3a -
- a cell isolated from a host, wherein the cell comprises the vector as
described above and expresses the non-retroviral protein or peptide encoded in
the
vector;
- use of the cell as described above for expressing the non-retroviral
protein or peptide in the host recipient; and
- a modified retroviral envelope protein, wherein prior to modification,
said modified retroviral envelope protein includes a transmembrane protein and
a
surface protein which in an N-terminal to C-terminal direction includes (i) an
ecotropic
receptor binding region having the sequence set forth as SEQ ID NO: 1; (ii) an
amphotropic hypervariable polyproline region having the sequence set forth as
SEQ
ID NO: 2; and (iii) a body portion which is associated with the transmembrane
protein,
wherein said modified retroviral envelope protein has been modified such that
at least
90% of the amino acid residues of the ecotropic receptor binding region of
said
surface protein of said modified retroviral envelope protein have been removed
and
replaced with a non-retroviral protein or peptide that binds to a desired
target
molecule, wherein amino acid residues 1 through 35 of the sequence set forth
as
SEQ ID NO: 2 have been removed and replaced with said non-retroviral protein
or
peptide.
CA 02326407 2008-01-25
30966-3
-3b-
BRIEF DESCRIPTION OF THE DRAWINGS
The invention now will be described with respect to the drawings, wherein:
Figure 1 shows the results of an ELISA assay in which collagen-coated wells
were
contacted with the retroviral vectors WT-CEE, BS-CEE.CEE, BN-CEE.CEE, and BA-
CEE.CEE; and
Figure 2 shows the results of an ELISA assay in which Ig G coated wells were
contacted with retroviral vectors including an envelope "escort" protein which
includes
Protein A.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with an aspect of the present invention, there is provided a
modified
retroviral envelope protein as will be described further hereinbelow. In
general, such
modified retroviral envelope, prior to modification, includes a surface
protein which includes
a receptor binding region, a hypervariable polyproline region, and a body
portion. The
modified retroviral envelope protein has been modified such that at least 90%
of the amino
acid residues of the receptor binding region of the surface protein have been
removed and
replaced with a non-retroviral protein or peptide. Such modified retroviral
envelope protein
in general may be included in a retroviral vector. In one embodiment, the
retroviral vector
includes the modified retroviral envelope protein as well as a retroviral
envelope protein in
which the receptor binding region, the hypervariable polyproline region, and
the body
portion have not been modified.
Thus, in accordance with another aspect of the present invention, there is
provided a
retroviral vector including a first retroviral envelope protein and at least
one modified
retroviral envelope protein. The first retroviral envelope protein includes a
surface protein.
The surface protein includes (i) a receptor binding region; (ii) a
hypervariable polyproline, or
"hinge" region, and (iii) a body portion. The modified retroviral envelope
protein, prior to
modification, includes a surface protein which includes (i) a receptor binding
region; (ii) a
hypervariable polyproline, or "hinge" region; and (iii) a body portion. The
modified retroviral
envelope protein has been modified such that at least 90% of the amino acid
residues of
the receptor binding region of the surface protein of the modified retroviral
envelope protein
have been removed and replaced with a non-retroviral protein or peptide, such
as for
example, a Iigand which binds to a desired target molecule.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-4-
In one embodiment, at least 92% of the amino acid residues of the receptor
binding
region of the surface protein of the modified retroviral envelope protein have
been removed
and replaced with a non-retroviral protein or peptide, such as a ligand that
binds to a
desired target molecule. In another embodiment, all of the amino acid residues
of the
receptor binding region of the surface protein of the modified retroviral
envelope protein
have been removed and replaced with a non-retroviral protein or peptide.
In yet another embodiment, at least 90% of the amino acid residues of the
receptor
binding region of the surface protein of the modified retroviral envelope
protein have been
removed and replaced with a non-retroviral protein or peptide, and at least a
portion of the
amino acid residues of the hypervariable polyproline region of the surface
protein of the
modified retroviral envelope protein have been removed and replaced with a non-
retroviral
protein or peptide. In one embodiment, all of the amino acid residues of the
hypervariable
polyproline region of the modified retroviral envelope protein have been
removed.
In a further embodiment, the receptor binding region(s) of the modified
retroviral
envelope protein(s), prior to modification thereof, has (have) the sequence
(SEQ ID NO:1).
In the modified retroviral envelope protein(s), amino acid residues 19 through
229 of (SEQ
ID NO:1) have been removed and replaced with a non-retroviral protein or
peptide. In one
embodiment, amino acid residues 19 through 229 of (SEQ ID NO:1) and at least a
portion
of the amino acid residues of the hypervariable polyproline region of the
surface protein of
the modified retroviral envelope protein(s) have been removed and replaced
with a non-
retroviral protein or peptide.
In general, retroviral envelope protein(s) include a surface (SU) domain, or
surface
protein, and a transmembrane (TM) domain or protein. In general, the surface
protein
includes, in an N-terminal to C-terminal direction, the following regions: (i)
a receptor binding
region; (ii) a hypervariable polyproline region; and (iii) a body portion,
which is associated
with the transmembrane domain.
The first retroviral envelope protein includes the surface domain and the
transmembrane domain. In general, such envelope protein is free of non-
retroviral
peptides. The first retroviral envelope protein maintains wild-type
infectivity. The first
retroviral envelope protein, in one embodiment, may include regions of
different tropisms.
For example, in one embodiment, the first retroviral envelope protein may
include a surface
protein which includes (i) an ecotropic receptor binding region; (ii) an
amphotropic
hypervariable polyproline region; and (iii) an ecotropic body By "amphotropic"
is meant
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-5-
capable of infecting both rodent and other mammalian cells including human
cells. By
"ecotropic" is meant capable of infecting rodent cells only.
As hereinabove stated, the modified retroviral envelope protein(s) is (are) a
retroviral
envelope protein(s) which is (are) modified such that at least 90% of the
amino acid
residues of the receptor binding region of the surface protein have been
removed and
replaced with a non-retroviral protein or peptide. Shown in (SEQ ID NO:1) is
the receptor
binding region of the ecotropic envelope of Moloney Murine Leukemia Virus.
Applicants
have found that, by constructing a retroviral vector that includes a first
retroviral envelope
protein which maintains wild-type infectivity and retains a receptor binding
region, an
unmodified hypervariable polyproline region, and an unmodified body portion;
and at least
one modified retroviral envelope protein in which at least 90% of the amino
acid residues-of
the receptor binding region of the surface protein have been removed and
replaced with a
non-retroviral protein or peptide, the modified retroviral envelope protein(s)
serves as an
"escort-protein" which provides one or more additional functions to the
retroviral vector,
such as, for example, "targeting" the retroviral vector to a desired target
molecule. Such
retroviral vectors, while possessing such additional functions, retain the
infectivity of wild-
type retroviruses.
In one embodiment, the modified retroviral envelope protein(s), prior to the
modification of at least the receptor binding region to include the non-
retroviral protein or
peptide, may be an envelope which includes regions of different tropisms. For
example, the
modified retroviral envelope protein(s) may be a Moloney Murine Leukemia Virus
envelope
protein(s) which includes a surface protein (also known as gp 70 protein)
having an
ecotropic portion and an amphotropic portion and/or xenotropic portion
In another embodiment, the modified retroviral envelope protein, prior to
modification
thereof, has a gp 70 protein which includes: (i) an ecotropic receptor binding
region, i.e.,
(SEQ ID NO:1); (ii) an amphotropic hypervariable polyproline region, (SEQ ID
NO:2); and
(iii) an ecotropic body portion. At least 90% of the amino acid residues of
the ecotropic
receptor binding region (SEQ ID NO:1) have been removed and replaced as
hereinabove
described, with a non-retroviral protein or peptide. In a further embodiment,
at least a
portion of the amphotropic hypervariable polyproline region (SEQ ID NO:2) have
been
removed as well. In one embodiment, amino acid residues 1 through 35 of (SEQ
ID NO:2)
have been removed. In another embodiment, amino acid residues 1 through 48 of
(SEQ ID
NO:2) have been removed. In yet another embodiment, all 60 amino acid residues
of (SEQ
ID NO:2) have been removed.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-6-
In a preferred embodiment, the retroviral vector particle includes a first
retroviral
envelope protein and a modified retroviral envelope protein. The first
retroviral envelope
protein includes a surface protein including a receptor binding region, a
hypervariable
polyproline region, and a body portion as hereinabove described. In the
modified envelope
protein as hereinabove described, the non-retroviral protein or peptide is a
ligand which
binds to a desired target molecule.
In one embodiment, the ligand includes a binding region which binds to a
receptor
located on a desired cell type. Such ligands include, but are not limited to,
antibodies and
fragments thereof, including single-chain antibodies, monoclonal antibodies,
and polyclonal
antibodies. Such antibodies include, but are not limited to, antibodies and
fragments or
portions thereof which bind to erb-B2, such as, for example, e23 antibody;
antibodies which
bind to receptors such as, for example, the CD4 receptor on T-cells;
antibodies which bind
to the transferrin receptor; antibodies directed against human leukocyte
antigen (HLA);
antibodies to carcinoembryonic antigen; antibodies to placental alkaline
phosphatase found
on testicular and ovarian cancer cells; antibodies to high molecular weight
melanoma-
associated antigen; antibodies to polymorphic epithelial mucin found on
ovarian cancer
cells; antibodies to a-human chorionic gonadotropin; antibodies to CD20
antigen of 13-
lymphoma cells; antibodies to alphafetoprotein; antibodies to prostate
specific antigen;
OKT-3 antibody, which binds to CD3 T-lymphocyte surface antigen; antibodies
which bind
to B-lymphocyte surface antigen; antibodies which bind to EGFR (c-erb-B1 or c-
erb-B2)
found on glioma cells, B-cell lymphoma cells, and breast cancer cells; anti-
tac monoclonal
antibody, which binds to the Interleukin-2 receptor; anti-transferrin
monoclonal antibodies;
monoclonal antibodies to gp 95/gp 97 found on melanoma cells; monoclonal
antibodies to
p-glycoproteins; monoclonal antibodies to cluster-1 antigen (N-CAM), cluster-
w4, cluster-5A,
or cluster-6 (LeY), all found on small cell lung carcinomas; monoclonal
antibodies to
placental alkaline phosphatase; monoclonal antibodies to CA-125 found on lung
and
ovarian carcinoma cells, monoclonal antibodies to epithelial specific antigen
(ESA) found on
lung and ovarian carcinoma cells; monoclonal antibodies to CD19, CD22, and
CD37 found
on B-cell lymphoma cells; monoclonal antibodies to the 250 kDa proteoglycan
found on
melanoma cells; monoclonal antibodies to p55 protein found on breast cancer
cells;
monoclonal antibodies to the TCR-IgH fusion protein found on childhood T-cell
leukemia
cells; antibodies to T-cell antigen receptors; antibodies to tumor specific
antigen on B-cell
lymphomas; antibodies to organ cell surface markers; anti-HIV antibodies, such
as anti-HIV
gp 120-specific immunoglobulin, and anti-erythrocyte antibodies.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-7-
Other ligands which may be employed include cytokines. Such cytokines include,
but
are not limited to, interleukins, including Interleukin-la, Interleukin-1(3,,
and
Interleukins 2 through 14; growth factors such as epithelial growth factor
(EGF), TGF-a,
TGF-(3,, fibroblast growth factor (FGF), keratinocyte growth factor (KGF),
PDGF-A, PDGF-
B, PD-ECGF, IGF-I, IGF-ll, and nerve growth factor (NGF), which binds to the
NGF receptor
of neural cells; colony stimulating factors such as GM-CSF, G-CSF, and M-CSF,
leukemic
inhibitory factor (LIF); interterons such as interferon-a, interferon-f3, and
interferon-y, inhibin
A; inhibin B; chemotactic factors; a-type intercrine cytokines; and ¾-type
intercrine
cytokines.
Still other ligands which may be employed include, but are not limited to,
vascular
endothelial growth factor, or VEGF, melanoma stimulating hormone, which binds
to the
MSH receptor on melanoma cells; the polypeptide FLA1 6, which has the sequence
Cys-
Gln-Ala-Gly-Thr-Phe-Ala-Leu-Arg-Gly-Asp-Asn-Pro-Gln-Gly-Cys,(SEQ. ID. NO. 5)
which
binds to the integrins VLA3, VLA4, and VLA5 found on human histiocytic
lymphoma cells;
the polypeptide having the structure Gly-Glu-Arg-Gly-Asp-Gly-Ser-Phe-Phe-Ala-
Phe-Arg-
Ser-Pro-Phe, (SEQ. ID. NO. 6) which binds to the integrin a,53 found on
melanoma cells;
erythropoietin, which binds to the erythropoietin receptor; adherins;
selectins; CD34, which
binds to the CD34 receptor of hematopoietic stem cells; CD33, which binds to
premyeloblastic leukemia cells; stem cell factor; asialoglycoproteins,
including
asialoorosomucoid, asialofetuin, and alpha-1 acid glycoprotein, which binds to
the
asialoglycoprotein receptor of liver cells; insulin; glucagon; gastrin
polypeptides, which bind
to receptors on hematopoietic stem cells; C-kit ligand; tumor necrosis factors
(or TNF's)
such as, for example, TNF-alpha and TNF-beta; ApoB, which binds to the LDL
receptor of
liver cells; alpha-2-macroglobulin, which binds to the LRP receptor of liver
cells; mannose-
containing peptides, which bind to the mannose receptor of macrophages; sialyl-
Lewis-X
antigen-containing peptides, which bind to the ELAM-1 receptor of activated
endothelial
cells; CD40 ligand, which binds to the CD40 receptor of B-lymphocytes; ICAM-1,
which
binds to the LFA-1 (CD1 1 b/CD1 8) receptor of lymphocytes, or to the Mac-1
(CD1 1 a/CD1 8)
receptor of macrophages; M-CSF, which binds to the c-fms receptor of spleen
and bone
marrow macrophages; VLA-4, which binds to the VCAM-1 receptor of activated
endothelial
cells; LFA-1, which binds to the ICAM-1 receptor of activated endothelial
cells; HIV gpl 20
and Class II MHC antigen, which bind to the CD4 receptor of T-helper cells;
and the LDL
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-8-
receptor binding region of the apolipoprotein E (ApoE) molecule. It is to be
understood,
however, that the scope of the present invention is not to be limited to any
specific ligand.
In one embodiment, the ligand is a single chain antibody.
In another embodiment, the ligand includes a binding region which binds to an
extracellular matrix component. The term "extracellular matrix component," as
used herein,
means a molecule that occupies the extracellular spaces of tissues. Such
extracellular
matrix components include, but are not limited to, collagen (including
collagen Type I and
collagen Type IV), laminin, fibronectin, elastin, glycosaminoglycans,
proteoglycans, and
sequences which bind to fibronectin, such as arginine-glycine-aspartic acid,
or RGD,
sequences. Binding regions which bind to an extracellular matrix component,
and which
may be included in a targeting polypeptide, include, but are not limited to,
polypeptide
domains which are functional domains within von Willebrand Factor or
derivatives thereof,
wherein such polypeptide domains bind to collagen. In one embodiment, the
binding region
is a polypeptide having the following structural formula: Trp-Arg-Glu-Pro-Ser-
Phe-Met-Ala-
Leu-Ser. (SEQ. ID. NO. 7)
Other binding regions which bind to an extracellular matrix component, and
which may
be included in the second retroviral envelope, include, but are not limited
to, the arginine-
glycine-aspartic acid, or RGD, sequences, which binds fibronectin, and a
polypeptide
having the sequence Gly-Gly-Trp-Ser-His-Trp, (SEQ. ID. NO. 8) which also binds
to
fibronectin.
In addition to the binding region, the ligand may further include linker
sequences of
one or more amino acid residues, placed at the N-terminal and/or C-terminal of
the binding
region, whereby such linkers increase rotational flexibility and/or minimize
steric hindrance
of the modified envelope polypeptide.
In another embodiment, the ligand is a peptide or protein which binds to an
antibody.
Such proteins or peptides include, but are not limited to, the Ig G-binding
domain of Protein
A, synthetic Ig G-binding domains, such as Protein ZZ, and Protein G.
It is to be understood, however, that the scope of the present invention is
not to be
limited to any specific ligand, binding region, or target molecule to which
the ligand may
bind.
In accordance with another aspect of the present invention, there is provided
a
modified polynucleotide encoding a modified retroviral envelope polypeptide
(i.e., the
modified retroviral envelope or "escort" protein hereinabove described). The
retroviral
envelope polypeptide includes a receptor binding region. In the modified
polynucleotide, a
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-9-
polynucleotide encoding at least 90% of the amino acid residues of the
receptor binding
region has been removed and replaced with a polynucleotide encoding a non-
retroviral
protein or peptide, as hereinabove described, such as, for example, a ligand
which binds to
a desired target molecule.
In one embodiment, prior to modification, the polynucleotide encoding the
receptor
binding region encodes the sequence of (SEQ ID NO:1). In the modified
polynucleotide, a
polynucleotide including the codons encoding amino acid residues 19 through
229 of (SEQ
ID NO:1) has been removed and replaced with the polynucleotide encoding the
ligand. In
another embodiment, a polynucleotide encoding at least a portion of the
hypervariable
polyproline region also has been removed as well. In one embodiment, the
hypervariable
polyproline region has the sequence (SEQ ID NO:2). The receptor binding region
having
the sequence (SEQ ID NO:1) is encoded by the polynucleotide having (SEQ ID
NO:3) or a
degenerative derivative or analogue thereof. The hypervariable polyproline
region having
the sequence (SEQ ID NO:2) is encoded by the polynucleotide having (SEQ ID
NO:4) or a
degenerative derivative or analogue thereof.
The term "derivative or analogue thereof "as used herein means that the
polynucleotides encoding the polypeptides (SEQ ID NO:1) and (SEQ ID NO:2) may
have
sequences different from the polynucleotides (SEQ ID NO:3) and SEQ ID NO:4),
yet
encode the same polypeptide. Such differences in polynucleotide sequences may,
for
example, be due to the degeneracy of the genetic code. It is also contemplated
within the
scope of the present invention that, prior to the modification of (SEQ ID
NO:2) or (SEQ ID
NO:4) with a polynucleotide encoding a ligand, (SEQ ID NO:2) or (SEQ ID NO:4)
may be
modified such that one or more codons encode different amino acid residues
than the
unmodified sequences. Such modifications may facilitate the insertion of the
polynucleotide
encoding the ligand.
The above polynucleotides may be constructed by genetic engineering techniques
known to those skilled in the art. For example, a first expression plasmid may
be
constructed which includes a polynucleotide encoding the unmodified envelope
protein.
The plasmid then is engineered such that a polynucleotide encoding at least
90% of the
amino acid residues of the receptor binding region, and which, in some
embodiments, also
may encode at least a portion of the hypervariable polyproline region, has
been removed,
whereby such polynucleotide has been replaced with a polynucleotide encoding
the ligand.
The polynucleotide encoding the ligand may be contained in a second expression
plasmid
or may exist as a naked polynucleotide sequence. The polynucleotide encoding
the ligand
CA 02326407 2000-10-24
WO 99/55893 PC1'/1B99/00764
-10-
or the plasmid containing such polynucleotide is cut at appropriate
restriction enzyme sites'
and cloned into the first expression plasmid which also has been cut at
appropriate
restriction enzyme sites. The resulting expression plasmid thus includes a
polynucleotide
which includes the modified retroviral envelope protein. Such plasmid also
includes a
polynucleotide encoding a minimal signal peptide-of the retroviral envelope
protein
"minimal signal geatide" is meant a signal peptide plus a cleavage site. .
The term "polynucleotide" as used herein means a polymeric form of nucleotide
of any length, and includes ribonucleotides and deoxyribonucleotides. Such
term also
includes single- and double-stranded DNA, as well as single- and double-
stranded RNA.
The term also includes modified polynucleotides such as methylated or capped
polynucleotides.
In a preferred embodiment, the retroviral vector particle having a first
envelope protein
and a modified envelope protein in accordance with the present invention
includes a
polynucleotide encoding a heterologous polypeptide which is to be expressed in
a desired
cell. The heterologous polypeptide may, in one embodiment, be a therapeutic
agent. The
term "therapeutic" is used in a generic sense and includes treating agents,
prophylactic
agents, and replacement agents.
It is to be understood, however, that the scope of the present invention is
not to be
limited to any particular therapeutic agent.
The polynucleotide encoding the therapeutic agent is under the control of a
suitable
promoter. It is to be understood, however, that the scope of the present
invention is not to
be limited to specific foreign genes or promoters.
The polynucleotide encoding the therapeutic agent may be placed into an
appropriate
retroviral plasmid vector by genetic engineering techniques known to those
skilled in the art.
In one embodiment, the retroviral plasmid vector may be derived from Moloney
Murine
Leukemia Virus and is of the LN series of vectors, which are described further
in Bender, at
a/., J. Virol., Vol. 61, pgs. 1639-1649 (1987) and Miller, at a1.,
Biotechnigues, Vol. 7, pgs
980-990 (1989). Such vectors have a portion of the packaging signal derived
from a mouse
sarcoma virus, and a mutated gag initiation codon. The term "mutated" as used
herein
means that the gag initiation codon has been deleted or altered such that the
gag protein or
fragments or truncations thereof, are not expressed.
In another embodiment, the retroviral plasmid vector may include at least four
cloning,
or restriction enzyme recognition sites, wherein at least two of the sites
have an average
frequency of appearance in eukaryotic genes of less than once in 10,000 base
pairs; i.e.,
CA 02326407 2008-01-25
30966-3
-11-
the restriction product has an average DNA size of at least 10,000 base pairs.
Preferred
cloning sites are selected from the group consisting of Notl, SnaBI, Sall, and
Xhol. In a
preferred embodiment, the retroviral plasmid vector includes each of these
cloning sites.
Such vectors are further described in U.S. Patent No. 5,672,510.
When a retroviral plasmid vector including such cloning sites is employed,
there may
also be provided a shuttle cloning vector which includes at least two cloning
sites which are
compatible with at least two cloning sites selected from the group consisting
of Notl, SnaBI,
Sall, and Xhol located on the retroviral plasmid vector. The shuttle cloning
vector also
includes at least one desired polynucleotide encoding a therapeutic agent
which is capable
of being transferred from the shuttle cloning vector to the retroviral plasmid
vector.
The shuttle cloning vector may be constructed from a basic "backbone" vector
or
fragment to which are ligated one or more linkers which include cloning or
restriction
enzyme recognition sites. Included in the cloning sites are the compatible, or
complementary cloning sites hereinabove described. Genes and/or promoters
having ends
corresponding to the restriction sites of the shuttle vector may be ligated
into the shuttle
vector through techniques known in the art.
The shuttle cloning vector can be employed to amplify DNA sequences in
prokaryotic
systems. The shuttle cloning vector may be prepared from plasmids generally
used in
prokaryotic systems and in particular in bacteria. Thus, for example, the
shuttle cloning
vector may be derived from plasmids such as pBR322; pUC 18; etc.
The retroviral plasmid vector includes one or more promoters for the genes
contained
in the vector. Suitable promoters which may be employed include, but are not
limited to, the
retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV)
promoter
described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or
any other
promoter (e.g., cellular promoters such as eukaryotic cellular promoters
including, but not
limited to, the histone, pol III, and (3-actin promoters). Other viral
promoters which may be
employed include, but are not limited to, adenovirus promoters, TK promoters,
and B19
parvovirus promoters. The selection of a suitable promoter will be apparent to
those skilled
in the art from the teachings contained herein.
In one embodiment, the polynucleotide encoding the modified retroviral
envelope
protein is contained in a separate expression vehicle, such as an expression
plasmid.
Alternatively, the polynucleotide encoding the modified retroviral envelope
protein may be
CA 02326407 2008-01-25
30966=3
-12-
contained in a retroviral plasmid vector for transduction and expression of
the modified
retroviral envelope protein in producer cell lines.
In one embodiment, the retroviral plasmid vector which includes a
polynucleotide
encoding a therapeutic agent, and the expression vehicle including the
polynucleotide
encoding the modified retroviral envelope protein in accordance with the
invention are
transduced into a packaging cell line including nucleic acid sequences
encoding the gag,
pol, and wild-type (i.e., unmodified) env retroviral proteins. Examples of
such packaging
cell lines include, but are not limited to, the PE501, PA317 (ATCC No. CRL
9078) 'I`-2,
'P-AM, PA12, T19-14X, VT-19-17-H2, 'PCRE, 'I`CRIP, GP+E-86,
GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy,
Vol. 1,
pgs. 5-14 (1990). The vector may transduce the packaging cells through
any means known in the art. Such means include, but are not limited to,
electroporation, and use of liposomes, such as hereinabove
described, and CaPO4 precipitation. Such producer cells generate infectious
retroviral
vector particles that include the first, or unmodified wild-type retroviral
envelope protein, the
modified retroviral envelope protein, and a polynucleotide encoding a
therapeutic agent.
In another embodiment, there is provided a packaging cell which includes
polynucleotides encoding the gag and pol proteins, a polynucleotide encoding a
first
retroviral envelope protein free of non-retroviral peptides (which in one
embodiment, may be
a wild-type retroviral envelope protein), and a polynucleotide encoding the
modified
retroviral envelope protein. A producer cell for generating retroviral vector
particles which
include the first and modified envelope proteins in accordance with the
present invention is
produced by introducing into such packaging cell either a retroviral vector
particle or a
retroviral plasmid vector, in each case including a polynucleotide encoding a
therapeutic
agent. The producer cell line thus generates infectious retroviral vector
particles including
the first retroviral envelope protein and the modified retroviral envelope
protein and the
polynucleotide encoding the therapeutic agent.
The retroviral vector particles, which include the first retroviral envelope
protein and
the modified retroviral envelope protein, and a polynucleotide encoding a
therapeutic agent,
may be administered to a host in order to express the therapeutic agent in the
host. In one
embodiment, the retroviral vector particles are administered to the host in an
amount
effective to produce a therapeutic effect in the host. The host may be a
mammalian host,
which may be a human or non-human primate host. In a preferred embodiment, the
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-13-
retroviral vector particles are administered to a host for the targeting of
desired cells in vivo.
The retroviral vector particles, upon administration to the host, travel to
and transduce the
desired target cells, whereby the transduced target cells express the
therapeutic agent in
vivo. When the modified retroviral envelope protein includes a ligand which
binds to an
antibody, the retroviral vector particles, upon administration to the host,
bind to the antibody
through the ligand. The retroviral vector particles and the bound antibody
then travel to and
transduce target cells which have a receptor which binds to the antibody. The
exact
dosage of retroviral vector particles which may be administered is dependent
upon a variety
of factors, including the age, sex, and weight of the patient, the target
cells which are to be
transduced, the therapeutic agent which is to be administered, and the
severity of the
disorder to be treated.
The retroviral vector particles may be administered systemically, such as, for
example,
by intravenous, intraperitoneal, intracolonic, intratracheal, endotracheal,
intranasal,
intravascular, intrathecal, intraarterial, intracranial, intramarrow,
intravesicular, intrapleural,
intradermal, subcutaneous, intramuscular, intraocular, intraosseous, and
intrasynovial
administration. The retroviral vector particles also may be administered
topically.
Cells which may be transduced with the retroviral vector particles of the
present
invention include, but are not limited to, primary cells, such as primary
nucleated blood cells,
primary tumor cells, endothelial cells, epithelial cells, vascular cells,
keratinocytes, stem
cells, hepatocytes, chondrocytes, connective tissue cells, fibroblasts and
fibroelastic cells of
connective tissues, mesenchymal cells, mesothelial cells, and parenchymal
cells; smooth
muscle cells of the vasculature; hematopoietic stem cells; T-lymphocytes; B-
lymphocytes;
neutrophils; macrophages; platelets; erythrocytes; reparative mononuclear
granulocytic
infiltrates of inflamed tissues; nerve cells; brain cells; muscle cells;
osteocytes and
osteoblasts in bone; lung cells, pancreatic cells; epithelial and
subepithelial cells of the
gastrointestinal and respiratory tracts; and malignant and non-malignant tumor
cells. The
selection of the particular cells which are to be transduced is dependent upon
the disease
or disorder to be treated as well as the ligand contained in the second
retroviral envelope
protein. It is to be understood that the scope of the present invention is not
to be limited to
the transduction of any specific target cells.
Diseases or disorders which may be treated with the retroviral vector
particles of the
present invention include, but are not limited to, severe combined immune
deficiency
caused by adenosine deaminase deficiency; sickle cell anemia; thalassemia;
hemophilia A
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-14-
and B; diabetes; emphysema caused by a-l-antitrypsin deficiency; Alzheimer's
disease;
AIDS; chronic granulomatosis; Gaucher's disease; Lesch-Nyhan syndrome;
muscular
dystrophy, including Duchenne muscular dystrophy; Parkinson's disease; cystic
fibrosis;
phenylketonuria; hypercholesterolemia; and other illnesses such as growth
disorders and
heart diseases, such as, for example, those caused by alterations in the way
cholesterol is
metabolized and defects in the immune system, and other cardiovascular
diseases.
When the modified retroviral envelope protein of the retroviral vector
particle includes
a ligand which binds to an extracellular matrix component, such retroviral
vector particles
may be employed in treating diseases or disorders which are associated with an
exposed
extracellular matrix component. Such diseases or disorders include, but are
not limited to,
cardiovascular diseases; cirrhosis of the liver; and connective tissue
disorders (including
those associated with ligaments, tendons, and cartilage), and vascular
disorders associated
with the exposition of collagen. The retroviral vector particles may be used
to deliver
therapeutic genes to restore endothelial cell function and to combat
thrombosis, in addition
to limiting the proliferative and fibrotic responses associated with neointima
formation. The
retroviral vector particles also may be employed in treating vascular lesions;
ulcerative
lesions; areas of inflammation; sites of laser injury, such as the eye, for
example; sites of
surgery; arthritic joints; scars; and keloids. The retroviral vector particles
also may be
employed in wound healing.
In addition, retroviral vector particles which include the modified retroviral
envelope
protein hereinabove described wherein said modified retroviral envelope
protein includes a
ligand which binds to an extracellular matrix component also may be employed
in the
treatment of tumors, including malignant and non-malignant tumors. Although
Applicants
do not intend to be limited to any theoretical reasoning, tumors, when
invading normal
tissues or organs, secrete enzymes such as collagenases or metalloproteinases
which
provide for the exposition of extracellular matrix components. By targeting
retroviral vector
particles to such exposed extracellular matrix components, the retroviral
vector particles
become concentrated at the exposed matrix components which are adjacent the
tumor,
whereby the retroviral vector particles then infect the tumor cells. Such
tumors include, but
are not limited to, carcinomas; sarcomas, including chondrosarcoma,
osteosarcoma, and
fibrosarcoma; and brain tumors. For example, a retroviral vector particle,
including the
modified retroviral envelope protein as hereinabove described and which
includes a ligand
which binds to an extracellular matrix component located at a tumor site, and
a
polynucleotide encoding a negative selective marker or "suicide" gene, such
as, for
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-15-
example, the Herpes Simplex Virus thymidine kinase (TK) gene, may be
administered to a
patient, whereby the retroviral vector particles transduce the tumor cells.
After the tumor
cells are transduced with the retroviral vector particles, an interaction
agent or prodrug, such
as gancyclovir or acyclovir, is administered to the patient, whereby the
transduced tumor
cells are killed.
It is to be understood that the present invention is not to be limited to the
treatment of
any particular disease or disorder.
The retroviral vector particles, which include the first retroviral envelope
protein and
the modified retroviral envelope protein hereinabove described and a
polynucleotide
encoding a therapeutic agent, may be administered to an animal in vivo as part
of an animal
model for the study of the effectiveness of a gene therapy treatment. The
retroviral vector
particles may be administered in varying doses to different animals of the
same species,
whereby the retroviral vector particles will transduce the desired target
cells in the animal.
The animals then are evaluated for the expression of the desired therapeutic
agent in vivo
in the animal. From the data obtained from such evaluations, one may determine
the
amount of retroviral vector particles to be administered to a human patient.
The retroviral vector particles of the present invention also may be employed
in the in
vitro transduction of desired target cells, which are contained in a cell
culture containing a
mixture of cells. Upon transduction of the target cells in vitro, the target
cells produce the
therapeutic agent or protein in vitro. The therapeutic agent or protein then
may be obtained
from the cell culture by means known to those skilled in the art.
The retroviral vector particles also may be employed for the transduction of
cells in
vitro in order to study the mechanism of the genetic engineering of cells in
vitro.
In addition, the "escort-protein" which forms the modified retroviral envelope
protein
may be employed to form proteoliposomes; i.e., the "escort-protein" forms a
portion of the
liposome wall. Such proteoliposomes may be employed for gene transfer or for
drug
delivery to desired target cells.
In another embodiment, the retroviral vector particles may include, in
addition to the
first retroviral envelope protein and the modified retroviral envelope protein
hereinabove
described, one or more additional modified envelope proteins, wherein the non-
retroviral
protein(s) or peptide(s) which replaces the amino acid residues which were
removed from
the unmodified envelope protein provides an additional function(s) to the
retroviral vector
particles. Such functions include, but are not limited to, complement
regulation or
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-16-
complement resistance, resistance to humoral and cellular immune responses,
and
stimulation of the growth of cells to which the retroviral vector particle may
be targeted,
thereby enabling more target cells to be infected by the retroviral vector
particle. Examples
of such proteins or peptides which may be placed in the additional retroviral
envelope
protein(s) include, but are not limited to, complement regulatory proteins or
complement
resistance proteins such as CD55, CD46, and CD59; immunosuppressive agents
such as
TGF-(31 and Interleukin-10; and growth factors and cytokines including, but
not limited to,
EGF, IGF, VEGF, and all interleukins. Such additional modified envelope
proteins may be
generated by transducing a polynucleotide encoding such a modified envelope
protein into
a packaging cell as hereinabove described. Thus, one may construct a
retroviral vector
particle that may be targeted to a particular cell, and possess additional
properties such as
those hereinabove described.
In one preferred embodiment, the retroviral vector particle has, in addition
to the first
retroviral envelope protein, first and second modified retroviral envelope
proteins as
hereinabove described. In the first modified retroviral envelope protein, the
non-retroviral
protein or peptide is a ligand which binds to a desired target molecule. In
the second
modified retroviral envelope protein, the non-retroviral protein or peptide is
a complement
regulatory protein. Such a retroviral vector particle may be administered to a
host, whereby
the retroviral particle is targeted to a desired cell, retains the infectivity
of wild-type
retrovirus, and is resistant to complement.
EXAMPLES
The invention now will be described with respect to the following examples;
however,
the scope of the present invention is not intended to be limited thereby.
Example 1
Construction of Retroviral Vectors Having an
Escort Protein Which Binds to Collagen
Synthetic oligonucleotides encoding a collagen binding domain with strategic
linkers
were generated. The polypeptide including the collagen binding domain and
linkers has the
following sequence:
GHMWREPSFMALSGAS (SEQ ID NO:9).
The following synthetic oligonucleotides encoding the above polypeptide also
were
synthesized by the USC Microchemical Core Facility as deoxyoligonucleotides.
Sense: 5'- TAACCGGCCATATGTGGCGCGAA
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-17-
BstEll
CCGAGCTTCATGCTCTGAGCGGTGCTAGCAAC-3' (SEQ ID NO:10).
Antisense: 3' - GCCGGTATACACCGCGCTTGGCTCGA
AGTACGAGACTCGCCACGATCGTTGGAT - 5' (SEQ ID NO:11).
Avrll
Sense: 5- GTAACCGGCCATATGTGGCGCGAACC
BstEll
GAGCTTCATGGCTCTGAGCGGTGCTAGCG - 3' (SEQ ID NO:12).
Antisense: 3'- GCCGGTATACACCGCGCTTGGCTCGA
AAGTACCGAGACTCGCCACGATCGCGGCC - 5' (SEQ ID NO:13).
NgoM1
Sense: 5' - GTAAC CGGCCATATGTGGCGCGAA
BstEll
CCGAGCTTCATGGCTCTGAGCGGTGCTAGCTCAGG - 3' (SEQ ID NO:14)
Stul
Antisense: 3' - GCCGGTATACACCGCGCTTGGCTCG
AAGTACCGAGACTCGCCACGATCGAGTCC - 5' (SEQ ID.NO:15).
Stul
The tandem synthetic oligonucleotides were heated to 95 C and allowed to
anneal by
gradual cooling to room temperature. The DNA duplexes were separated from
single-
stranded oligonucleotides by passage through a G25 column (5 Prime 3 Prime,
Inc.,
Boulder, Colorado). Agarose gels were used to confirm the purity and
conformation of the
synthetic oligonucleotide inserts.
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-18-
The inserts were cloned into the CEE (ecotropic) - delta hinge env construct
(Wu, et
al., J. Virol.,, July 1998, p 5383-5391), which was modified by replacement of
an
amphotropic hypervariable polyproline or "hinge" region (SEQ ID NO:2)
containing three
unique restriction sites (Avrll (at codon 1 of the "hinge" region), Pstl (at
codon 35 of the
"hinge" region), Stul (at codon 48 of the "hinge" region)), and an NgoMl
restriction site (at
codon 60 of the "hinge" region). The vector was cut with the following
restriction enzymes
to generate the respective constructs: BstEll insert; BstEll to Avrll; BstEll
to Pstl; BstEll to
Stul; BstEll to NgoMI; and Stul insert. The linearized vectors were confirmed
by restriction
analysis on agarose gels and purified by the GeneClean method (Bio 101, Vista,
California),
prior to ligation with the respective collagen binding domain inserts and T4
DNA ligase (New
England Biolabs, Beverly, Massachusetts) for either 3 hours at room
temperature or
overnight at 4 C.
After ligation, the various constructs of plasmid DNA were transformed into
XL1 Blue
strain of E. coli and grown on LB agar plates under ampicillin selection.
Plasmid DNA was
extracted from selected transformed clones using QIA prep Miniprep Kits
(Qiagen, Valencia,
California). Each construct was confirmed by digestion with the appropriate
restriction
enzymes described above and analysis of the respective inserts. Restriction
analysis was
followed by direct DNA sequence analysis using the T7 Sequenase sequencing kit
(Amersham Life Science, Inc., Cleveland, Ohio).
The plasmids containing the coding sequences for the modified envelope
proteins,
which include the 18 amino acid residues of the N-terminal of the receptor
binding region of
the ecotropic envelope, the collagen binding domain, a portion of the
hypervariable
polyproline region of amphotropic envelope protein, the remaining C-terminus
of the surface
protein, and the transmembrane proteins, sometimes are hereinafter referred to
as
"pESCORT."
Retroviral vectors bearing "escort" protein constructs were assembled using a
four-
plasmid transient transfection system modified from Soneoka, et al., Nucleic
Acids
Research, Vol. 23, pgs. 628-633 (1995), in which the wild-type (amphotropic or
ecotropic)
envelope was co-expressed. The four plasmids employed were (i) pHIT1 12; (ii)
pHIT60; (iii)
one of the pESCORT plasmids; and (iv) either pCAE or pCEE (Morgan, et al., J.
Virol., Vol.
67, No. 8, pgs. 4712-4721 (August 1993)). Plasmid pHlT60, provided by Dr.
Paula Cannon,
University of Oxford, Oxford, United Kingdom, includes the SV40 origin of
replication and
the retroviral gag-pol gene under the control of a cytomegalovirus (CMV)
promoter. Plasmid
pHIT1 12, provided by Ling Li, USC Gene Therapy Laboratories, Los Angeles,
California,
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-19-
includes a LacZgene under the control of a hybrid CMV-LTR promoter, and a
neomycin
resistance gene under the control of the SV40 promoter. 10mg of each plasmid
were
cotransfected by the calcium phosphate method into 293 T cells, which express
SV40 large
T antigen. (Pear, et al., Proc. Nat. Acad. Sci., Vol. 90, pgs. 8392-8396
(September 1993)).
The producer cells were treated subsequently with 10mM sodium butyrate for 8
to 12 hours
and retroviral supernatants were harvested 24 hours after transfection. The
retroviral vector
supernatants then were tested (i) for binding affinity to collagen matrices
using a modified
ELISA (Hall, et al., Human Gene Therapy, Vol. 8, pgs. 2183-2192 (1997)) and
(ii) for
infectivity by the expression of ji-galactosidase activity in NiH 3T3 cells.
(Hall, et al., 1997).
In the ELISA assay, 50m1 of vector supernatant was applied to each collagen-
coated
microtiter well and allowed to bind for 20 minutes, followed by washing with 1
xPBS,
followed by incubation for 4 hours at room temperature at a primary antibody
dilution of
1:1,000. A biotinylated goat antibody to rat IgG then was applied, followed by
a
streptavidin-horseradish peroxidase conjugate. Diaminobenzidine (DAB) was used
as a
chromogen followed by nickel chloride enhancement for microtiter plates.
Viral titers were determined and quantified based on expression of the ~i-
galactosidase reporter gene. Briefly, 2.5 x 104 NIH 3T3 cells were plated in
each well of 6
well plates prior to transduction. The medium was replaced with 1 ml of serial
dilutions of
viral supernatant with 8 mg/ml polybrene for 2 hours. One ml of fresh D10 was
added to
the cultures, which then were maintained overnight at 37 C and 5% CO2. The
medium was
replaced with fresh D10 and cultures were maintained for an additional 24
hours.
Expression of p-galactosidase in the respective cultures was evaluated by X-
gal staining 48
hours after transduction of the NIH 3T3 cells.
In another experiment, 1.5 ml of vector supernatant or buffer were incubated
at 37 C
in 6-well plates in which an island of collagen was applied within a cloning
ring, and washed
twice with 1 X PBS. Then, 1 x105 NIH 3T3 cells, suspended in DMEM-10% FBS
medium
containing 8 mg/ml Polybrene, were plated into each well. The cultures were
incubated at
37 C overnight, replaced with D10 medium not containing polybrene, and stained
with X-gal
after an additional 24 hrs. at 37 C.
Figure 1 shows ELISA results for the retroviral vectors WT-CEE, BS-CEE.CEE, BN-
CEE.CEE, and BA-CEE.CEE. The vector WT-CEE is a wild-type vector with an
ecotropic
envelope protein. BS-CEE.CEE is a retroviral vector with a wild-type ecotropic
envelope
protein, and an "escort protein" envelope protein formed by inserting the
collagen binding
CA 02326407 2000-10-24
WO 99/55893 PCT/1B99/00764
-20-
domain between BstEll and Stul sites of the CEE (ecotropic)-delta hinge
construct. BN-
CEE.CEE is a retroviral vector with a wild-type ecotropic envelope protein,
and an "escort
protein" envelope formed by inserting the collagen binding domain between the
BstEll and
NgoMl sites of the CEE (ecotropic)-delta hinge env construct. BA-CEE.CEE is a
retroviral
vector including a wild-type ecotropic envelope protein, and an "escort
protein" envelope
formed by inserting the collagen binding domain between the Bstll and Avrll
sites of the
CEE (ecotropic)-delta hinge env construct.
As shown in Figure 1, the BS-CEE.CEE, BN-CEE.CEE and BA-CEE.CEE vectors
bound to the collagen-coated wells. Thus, it was determined that the majority
of the
receptor binding region of the envelope protein and a portion or all the
hypervariable
polyproline region could be removed and replaced with a collagen binding
domain.
Example 2
Ig G binding of Protein A-env escort proteins
A series of retroviral vectors including chimeric envelope proteins including
Protein A
(Lowenadler, et al., Gene, Vol. 58, pgs. 87-97 (1987)) which binds to Ig G,
were constructed
by employing (i) pHIT60; (ii) pHIT 112; (iii) plasmid encoding a chimeric
envelope protein,
wherein Protein A replaces a portion of the envelope or Protein A is inserted
between
amino acid residues of the envelope protein; and/or (iv) a plasmid encoding
wild-type CEE
or CAE envelope proteins. The plasmids are co-transfected into 293 T-cells as
described in
Example 1, followed by sodium butyrate treatment to produce high titer
retroviral vectors.
The following retroviral vectors were generated, as described in Table I
below:
Table 1
Vector Construct
PABN Protein A at BstEll and Ngo
PABN.CAE Protein A at BstEll and Ngo + Wild Type CAE env
PABN.CEE Protein A at BstEll and Ngo + Wild Type Cee env
PABA Protein A at BstEll and Avr
PABA.CAE Protein A at BstEll and Avr + Wild Type CAE env
PABA.CEE Protein A at BstEll and Avr + Wild Type Cee env
PAP Protein A at Pstl (insert)
CA 02326407 2000-10-24
WO 99/55893 PCT/IB99/00764
-21-
PAP.CAE Protein A at Pstl (insert) + Wild Type CAE env
PAP.CEE Protein A at Pstl (insert) + Wild Type CEE env
PAB Protein A at BstEll (insert)
PAB.CAE Protein A at BstEll (insert) + Wild type CAE env
PAB.CEE Protein A at BstEll (insert) + Wild type Cee env
CAE Wild Type CAE env
CEE Wild type CEE env
CEE.C.PS Wild type CEE + CAE Hinge at Pst Stu
The binding affinity of the Protein A bearing virions for purified IgG was
evaluated in
comparison to wild type CEE and CAE virions using a modification of standard
ELISA
techniques described in Hall, 1997, except that the ELISA assay employed the
83A25 rat
monoclonal antibody directed against the murine leukemia virus env protein
(Evans, et al., J.
ViroL, Vol. 64, No. 12, pgs. 6176-6183(1990)), and the wells were pre-coated
with purified
human Ig G (Gamma Immune N) instead of collagen Type I.
As shown in Figure 2, the virions including a wild-type envelope protein, and
an "escort
protein" in which a portion of the envelope protein is removed and replaced
with Protein A,
remained bound to IgG (dark staining wells) upon washing with PBS, while the
wild-type CEE
and CAE virions were removed.
Example 3
Construction of Retroviral Vectors Having
an Escort Protein Including Protein ZZ
The retroviral vectors PABA.CAE and PABN.CAE were generated as described in
Example 2. Vector PZBA.CAE is identical to PABA.CAE, except that in the
"escort protein,"
protein ZZ (Nilsson, et al., Protein Eng., VOL 1, pgs. 107-113 (1987)), a 116
amino acid residue
protein which binds to IgG, was inserted between the BstEll and Avrll sites.
The vectors had
viral titers approaching those of wild-type envelopes (PABA.CAE = 2 x 106
cfu/ml; PZBA.CAE=
2 x 106 cfu/ml; PABN.CAE= 1 x 106 cfu/ml; wild-type CAE = 2 x 106 cfu/ml), and
demonstrated
high affinity binding to IgG1 coated ELISA plates. The ELISA assay was
conducted in
accordance with the procedure described in Example 2.
Wells containing 5 x 105 KSY1 Kaposi sarcoma cells (Masood, et al., Proc. Nat
Acad.
Sci., Vol. 94, pgs. 979-984 (1994)) were contacted with 1,000 ng or 5,000 ng
of KDR/Flk-1
antibody, or with Polybrene. One well was contacted with neither material. The
cells which
were contacted with antibody then were contacted with PABA.CAE or wild-type
CAE having a
CA 02326407 2000-10-24
WO 99/55893 PCTlIB99/00764
-22-
titer of 2 x 106 cfu/mI at a multiplicity of infection (MOI) of 4. The cells
then were stained with X-
-gal, and blue colonies were counted. The results are given in Table 2 below.
TABLE 2
KSY1 Sample KDR/Flk-1 Ab Vector # Blue Colonies
x 105 cells/well ng 2 x 106 cfu/ml MOI=4
1 1000 PABA.CAE 648
2 5000 PABA.CAE 946
3 5000 WT.CAE 66
4 0 None 0
5 Polybrene None 0
In another experiment, wells containing 1 x 105 KSY1 cells in each well were
contacted
with Ong, 1,000ng. or 5,000ng of KDR/Flk-1 antibody. The cells that were
contacted with
antibody then were contacted with PABN.CAE or wild-type CAE having a titer of
1 x 106 cfu/ml,
and at a multiplicity of infection (MOI) of 10. The cells then were stained
with X-gal and the
number of blue colonies were counted. The results are given in Table 3 below.
TABLE 3
KSY1 Sample KDR/Flk-1 Ab Vector # Blue Colonies
1 x 105 cells/well ng 1 x 106 cfu/ml MOI=10
1 1000 PABN.CAE 1560
2 5000 PABN.CAE 2554
3 5000 WT.CAE 20
CA 02326407 2008-01-25
30966-3
-23-
4 0 None 0
L 5 0 Polybrene 0
The above results indicate that the vectors including the "escort proteins"
exhibited an
antibody-dependent and dose-dependent increase in efficiency of transduction
of KDR/Flk-1
antibody-coated endothelial KSY1 Kaposi's sarcoma cells, when compared to
vectors including
only a wild-type env. The data indicate that transduction efficiency is
enhanced by molecular
'tethering" of chimeric virions against the endothelial cell surface. Based
upon the above
results, such IgG-targeted vectors may provide an efficient gene delivery
vehicle for delivering
genes to endothelial cell receptors in transplanted vascular grafts and
organs, including hearts,
kidneys, lungs, pancreases, and livers.
It is to be understood, however, that the scope of the present invention is
not to be
limited to the specific embodiments described above. The invention may be
practiced other
than as particularly described and still be within the scope of the
accompanying claims.
CA 02326407 2001-04-26
1
SEQUENCE LISTING
<110> University of Southern california
<120> retroviral vectors including modified envelope escort proteins
<130> 21489-9650
<140> 2,326,407
<141> 1999-04-28
<150> US 09/069,398
<151> 1998-04-29
<160> 15
<170> Patentln version 3.0
<210> 1
<211> 229
<212> PRT
<213> Moloney murine leukemai virus
<400> 1
Ala Ser Pro Gly Ser Ser Pro His Gln Val Tyr Asn Ile Thr Trp Glu
1 5 10 15
Val Thr Asn Gly Asp Arg Glu Thr Val Trp Ala Thr Ser Gly Asn His
20 25 30
Pro Leu Trp Thr Trp Trp Pro Asp Leu Thr Pro Asp Leu Cys Met Leu
35 40 45
Ala His His Gly Pro Ser Tyr Trp Gly Leu Glu Tyr Gln Ser Pro Phe
50 55 60
Ser Ser Pro Pro Gly Pro Pro Cys Cys Ser Gly Gly Ser Ser Pro Gly
65 70 75 80
Cys Ser Arg Asp Cys Glu Glu Pro Leu Thr Ser Leu Thr Pro Arg Cys
85 90 95
Asn Thr Ala Trp Asn Arg Leu Lys Leu Asp Gln Thr Thr His Lys Ser
100 105 110
Asn Glu Gly Phe Tyr Val Cys Pro Gly Pro His Arg Pro Arg Glu Ser
115 120 125
Lys Ser Cys Gly Gly Pro Asp Ser Phe Tyr Cys Ala Tyr Trp Gly Cys
130 135 140
Glu Thr Thr Gly Arg Ala Tyr Trp Lys Pro Ser Ser Ser Trp Asp Phe
145 150 155 160
Ile Thr Val Asn Asn Asn Leu Thr Ser Asp Gln Ala Val Gln Val Cys
165 170 175
CA 02326407 2001-04-26
2
Lys Asp Asn Lys Trp Cys Asn Pro Leu Val Ile Arg Phe Thr Asp Ala
180 185 190
Gly Arg Arg Val Thr Ser Trp Thr Thr Gly His Tyr Trp Gly Leu Arg
195 200 205
Leu Tyr Val Ser Gly Gin Asp Pro Gly Leu Thr Phe Gly Ile Arg Leu
210 215 220
Arg Tyr Gln Asn Leu
225
<210> 2
<211> 60
<212> PRT
<213> artificial sequence
<220>
<223> amphotropic hypervariable polyproline region of amphotropic gp 70
protein
<400> 2
Gly Pro Arg Val Pro Ile Gly Pro Asn Pro Val Leu Pro Asp Gln Arg
1 5 10 15
Leu Pro Ser Ser Pro Ile Glu Ile Val Pro Ala Pro Gln Pro Pro Ser
20 25 30
Pro Leu Asn Thr Ser Tyr Pro Pro Ser Thr Thr Ser Thr Pro Ser Thr
35 40 45
Ser Pro Thr Ser Pro Ser Val Pro Gln Pro Pro Pro
50 55 60
<210> 3
<211> 687
<212> DNA
<213> artificial sequence
<220>
<223> polynucleotide encoding hypervariable polyproline region of ecotropic
gp 70 protein
<400> 3
gcttcgcccg gctccagtcc tcatcaagtc tataatatca cctgggaggt aaccaatgga 60
gatcgggaga cggtatgggc aacttctggc aaccaccctc tgtggacctg gtggcctgac 120
cttaccccag atttatgtat gttagcccac catggaccat cttattgggg gctagaatat 180
caatcccctt tttcttctcc cccggggccc ccttgttgct cagggggcag cagcccaggc 240
tgttccagag actgcgaaga acctttaacc tccctcaccc ctcggtgcaa cactgcctgg 300
aacagactca agctagacca gacaactcat aaatcaaatg agggatttta tgtttgcccc 360
gggccccacc gcccccgaga atccaagtca tgtgggggtc cagactcctt ctactgtgcc 420
tattggggct gtgagacaac cggtagagct tactggaagc cctcctcatc atgggatttc 480
atcacagtaa acaacaatct cacctctgac caggctgtcc aggtatgcaa agataataag 540
tggtgcaacc ccttagttat tcggtttaca gacgccggga gacgggttac ttcctggacc 600
acaggacatt actggggctt acgtttgtat gtctccggac aagatccagg gcttacattt 660
gggatccgac tcagatacca aaatcta 687
CA 02326407 2001-04-26
3
<210> 4
<211> 180
<212> DNA
<213> artificial sequence
<220>
<223> polynucleotide encoding amphotropic hypervariable polyproline region of
amphotropic gp 70 protein
<400> 4
ggaccccgag tccccatagg gcccaaccca gtattacccg accaaagact cccttcctca 60
ccaatagaga ttgtaccggc tccacagcca cctagccccc tcaataccag ttacccccct 120
tccactacca gtacaccctc aacctcccct acaagtccaa gtgtcccaca gccaccccca 180
<210> 5
<211> 16
<212> PRT
<213> artificial sequence
<220>
<223> polypeptide FLA16 which binds to the integrins VLA3, VLA4, and VLA5
found on human histiocytic lymphoma cells;
<400> 5
Cys Gln Ala Gly Thr Phe Ala Leu Arg Gly Asp Asn Pro Gln Gly Cys
1 5 10 15
<210> 6
<211> 15
<212> PRT
<213> artificial sequence
<220>
<223> polypeptide which binds to integrin alphavbeta3found on melanoma cells
<400> 6
Gly Glu Arg Gly Asp Gly Ser Phe Phe Ala Phe Arg Sear Pro Phe
1 5 10 15
<210> 7
<211> 10
<212> PRT
<213> artificial sequence
<220>
<223> functional domain within von Willebrand Factor which binds to collagen
<400> 7
Trp Arg Glu Pro Ser Phe Met Ala Leu Ser
1 5 10
<210> 8
<211> 6
<212> PRT
<213> artificial sequence
ICI
CA 02326407 2001-04-26
4
<220>
<223> polypeptide that binds to fibronectin.
<400> 8
Gly Gly Trp Ser His Trp
1 5
<210> 9
<211> 16
<212> PRT
<213> artificial sequence
<220>
<223> polypeptide including collagen binding domain and linkers
<400> 9
Gly His Met Trp Arg Glu Pro Ser Phe Met Ala Leu Ser Gly Ala Ser
1 5 10 15
<210> 10
<211> 55
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 10
taaccggcca tatgtggcgc gaaccgagct tcatgctctg agcggtgcta gcaac 55
<210> 11
<211> 55
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 11
gccggtatac accgcgcttg gctcgaagta cgagactcgc cacgatcgtt ggatc 55
<210> 12
<211> 55
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 12
gtaaccggcc atatgtggcg cgaaccgagc ttcatggctc tgagcggtgc tagcg 55
CA 02326407 2001-04-26
<210> 13
<211> 55
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 13
gccggtatac accgcgcttg gctcgaaagt accgagactc gccacgatcg cggcc 55
<210> 14
<211> 59
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 14
gtaaccggcc atatgtggcg cgaaccgagc ttcatggctc tgagcggtgc tagctcagg 59
<210> 15
<211> 54
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide encoding the polypeptide including collagen binding
domain and linkers of sequence 9
<400> 15
gccggtatac accgcgcttg gctcgaagta ccgagactcg ccacgatcga gtcc 54
