Note: Descriptions are shown in the official language in which they were submitted.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
Description
IMMUNOMODULATOR POLYPEPTIDE, ZSIG57
BACKGROUND OF THE INVENTION
Proliferation and differentiation of cells of
multicellular organisms are controlled by hormones and
polypeptide growth factors. These secreted molecules
allow cells to communicate with each other; act in concert
to regulate cell proliferation and organ development; and
regulate repair and regeneration of damaged tissue.
Hormones and growth factors influence cellular metabolism
by binding to receptors. Receptors may be integral
membrane proteins that are linked to signaling pathways
within the cell, such as second messenger systems. Other
classes of receptors are soluble molecules, such as
transcription factors.
The immunoglobulin superfamily is composed of
many cell surface and other glycoproteins that share
sequence homology with variable (V) and/or constant (C)
domains of antibody heavy and light chains. This diverse
family of proteins is involved in regulating immune system
interactions with other cells through molecules such as
major histocampatability complex (MHC) proteins;
lymphocyte adhesion molecules such as ICAM-1; and Fc
receptors, T-cell CD8, CD28, and the like (Jackson, D.G.,
et al., Eur. J. Immunol., 22:1157-1163, 1992). One such
interaction involves the mucosal immune system, mediated
by the secretory immunoglobulins IgA and IgM. These
secreted antibodies are transcytosed from the basolateral
side to the apical side (e.g., intestinal lumen) of the
mucosal epithelium via the polymeric immunoglobulin
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
2
receptor (pIgR), a member of the immunoglobulin
superfamily (Loman, S., et al., Am. Physiol. Soc. :L951-
L958, 1997). When IgA is transcytosed, pIgR is cleaved
and the extracellular portion, called the secretory
component (SC), of the molecule is released either free or
bound to IgA. The SC binds IgA and appears to play an
important role in protecting the secreted IgA from
degradation. Moreover, aside from a role for SC in the
humoral immune response, it appears to have other
activities associated with inflammation, cell adhesion,
and the like. See, Rindisbacher, L., et al., J. Biol.
Chem., 23:14220-14228, 1995; Nihei, Y., et al., Arch.
Dermatol. Res., 287:546-552; 1995; Brandtzaeg, P. and
Krajci, P., "Secretory Component (pIgR)" In: Encyclo edia
of Immunology, Ivan M. Roitt and Peter J. Delves (eds.),
pp. 1360-1364. Academic Press, London, 1992; Hughes, G.J.,
et al., FEBS Lett., 410:443-446, 1997; Bakos, M., et al.,
Molec. Immunol., 31:165-168, 1993). However, the
biological role of SC is not fully elucidated.
There is a continuing need to discover new
immune modulators, hormones, cytokines, growth factors and
the like. The in vivo activities of known immune
modulators, and immunoglobulin superfamily members, such
as pIgR and SC, illustrate the enormous clinical potential
of, and need for, related polypeptides, their agonists,
and antagonists.
The present invention provides such polypeptides
for these and other uses that should be apparent to those
skilled in the art from the teachings herein.
SUMMARY OF THE INVENTION
Within one aspect, the present invention
provides an isolated polynucleotide encoding a zsig57
polypeptide comprising a sequence of amino acid residues
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
3
that is~at least 90$ identical to an amino acid sequence
selected from the group consisting of: (a) the amino acid
sequence as shown in SEQ ID NO: 2 from residue number 18
(Ile), to residue number 108 (Gly); (b) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 18
(Ile) to amino acid number 125 (Pro); (c) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 18
(Ile) to amino acid number 156 (Gln); (d) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 18
(Ile) to amino acid number 199 (Gly); and (e) the amino
acid sequence as shown in SEQ ID N0:2 from amino acid
number 1 (Met) to amino acid number 199 (Gly), wherein the
amino acid percent identity is determined using a FASTA
program with ktup=1, gap opening penalty=10, gap extension
penalty=1, and substitution matrix=BLOSUM62, with other
parameters set as default. Within one embodiment, the
isolated polynucleotide disclosed above is selected from
the group consisting of: (a) a polynucleotide sequence as
shown in SEQ ID N0:1 from nucleotide 115 to nucleotide
387; (b) a polynucleotide sequence as shown in SEQ ID
N0:1 from nucleotide 115 to nucleotide 438; (c) a
polynucleotide sequence as shown in SEQ ID N0:1 from
nucleotide 115 to nucleotide 531; (d) a polynucleotide
sequence as shown in SEQ ID N0:1 from nucleotide 115 to
nucleotide 660; and (e) a polynucleotide sequence as shown
in SEQ ID NO:1 from nucleotide 64 to nucleotide 660.
Within another embodiment, the isolated polynucleotide
disclosed above comprises nucleotide 1 to nucleotide 597
of SEQ ID N0:3. Within another embodiment, the isolated
polynucleotide disclosed above consists of a sequence of
amino acid residues an amino acid sequence selected from
the group consisting of: (a) the amino acid sequence as
shown in SEQ ID NO: 2 from residue number 18 (Ile), to
residue number 108 (Gly); (b) the amino acid sequence as
CA 02331253 2000-12-18
WO 99/66040 PCT/iJS99/11337
4
shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 125 (Pro); (c) the amino acid sequence
as shown in SEQ ID N0:2 from amino acid number 18 {Ile) to
amino acid number 156 (Gln); (d) the amino acid sequence
as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 199 (Gly); and (e) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 1
(Met) to amino acid number 199 (Gly). Within another
embodiment, the isolated polynucleotide disclosed above
consists of a sequence of amino acid residues as shown in
SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid
number 199 {Gln).
Within a second aspect, the present invention
provides an expression vector comprising the following
operably linked elements: a transcription promoter; a DNA
segment encoding a zsig57 polypeptide with an amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 18
(Ile) to amino acid number 199 (Gln); and a transcription
terminator. Within one embodiment, the expression vector
as disclosed above, further comprises a secretory signal
sequence operably linked to the DNA segment.
Within a third aspect, the present invention
provides a cultured cell into which has been introduced an
expression vector as disclosed above, wherein the cell
expresses a polypeptide encoded by the DNA segment.
Within a fourth aspect, the present invention
provides a DNA construct encoding a fusion protein, the
DNA construct comprising: a first DNA segment encoding a
polypeptide that is selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO: 2 from residue
number 1 (Met) , to residue number 17 (Gly) ; (b) the amino
acid sequence of SEQ ID NO: 2 from residue number 18
{Ile), to residue number 108 (Gly); (c) the amino acid
sequence of SEQ ID N0: 2 from residue number 18 (Ile), to
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
residue.number 124 (Pro); (d) the amino acid sequence of
SEQ ID NO: 2 from residue number 18 (Ile), to residue
number 156 (Gly); (e) the amino acid sequence of SEQ ID
N0: 2 from residue number 186 (Lys), to residue number 199
5 (Gln); (f) the amino acid sequence of SEQ ID N0: 2 from
residue number 18 (Ile), to residue number 199 (Gln); and
at least one other DNA segment encoding an additional
polypeptide, wherein the first and other DNA segments are
connected in-frame; and encode the fusion protein.
Within another aspect, the present invention
provides a fusion protein produced by a method comprising:
culturing a host cell into which has been introduced a
vector comprising the following operably linked elements:
(a) a transcriptional promoter; (b) a DNA construct
encoding a fusion protein as disclosed above; and (c) a
transcriptional terminator; and recovering the protein
encoded by the DNA segment.
Within another aspect, the present invention
provides an isolated polypeptide comprising a sequence of
amino acid residues that is at least 90o identical to an
amino acid sequence selected from the group consisting of:
(a) the amino acid sequence as shown in SEQ ID NO: 2 from
residue number 18 (Ile), to residue number 108 (Gly); (b)
the amino acid sequence as shown in SEQ ID N0:2 from amino
acid number 18 (Ile) to amino acid number 125 (Pro); (c)
the amino acid sequence as shown in SEQ ID N0:2 from amino
acid number 18 (Ile) to amino acid number 156 (Gln); (d)
the amino acid sequence as shown in SEQ ID N0:2 from amino
acid number 18 (Ile) to amino acid number 199 (Gly); and
(e) the amino acid sequence as shown in SEQ ID N0:2 from
amino acid number 1 (Met) to amino acid number 199 (Gly),
wherein the amino acid percent identity is determined
using a FASTA program with ktup=1, gap opening penalty=10,
gap extension penalty=1, and substitution matrix=BLOSUM62,
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
6
with other parameters set as default. Within one
embodiment the isolated polypeptide disclosed above
consists of a sequence of amino acid residues selected
from the group consisting of: (a) the amino acid sequence
as shown in SEQ ID NO: 2 from residue number 18 (Ile), to
residue number 108 (Gly); (b) the amino acid sequence as
shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 125 (Pro); (c) the amino acid sequence
as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 156 (Gln); (d) the amino acid sequence
as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 199 (Gly); and (e) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 1
(Met) to amino acid number 199 (Gly). Within another
embodiment the isolated polypeptide disclosed above is as
shown in SEQ ID N0:2 from amino acid number 18 (Ile) to
amino acid number 199 (Gln).
Within another aspect, the present invention
provides a method of producing a zsig57 polypeptide
comprising: culturing a cell as disclosed above; and
isolating the zsig57 polypeptide produced by the cell.
Within another aspect, the present invention
provides a method of producing an antibody to zsig57
polypeptide comprising: inoculating an animal with a
polypeptide selected from the group consisting of: (a) a
polypeptide consisting of 9 to 199 amino acids, wherein
the polypeptide is a contiguous sequence of amino acids in
SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid
number 199 (Gln); (b) a polypeptide according to claim 11;
(c) a polypeptide having an amino acid sequence from
residue number 1$6 (Lys), to residue number 199 (Gln) of
SEQ ID N0:2; (d) a polypeptide having an amino acid
sequence from residue number 18 (Ile), to residue number
108 (Gly) of SEQ ID N0:2; (e) a polypeptide having an
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
7
amino acid sequence from residue number 96 (Glu) to
residue number 101 {Glu) of SEQ ID N0:2; (f) a polypeptide
having an amino acid sequence from residue number 129
(Pro) to residue number 129 (Glu) of SEQ ID N0:2; (g) a
polypeptide having an amino acid sequence from residue
number 125 (Pro) to residue number 130 (Glu) of SEQ ID
N0:2; (h) a polypeptide having an amino acid sequence from
residue number 185 (Arg) to residue number 190 (Glu) of
SEQ ID N0:2; and (i) a polypeptide having an amino acid
sequence from residue number 186 (Lys) to residue number
191 (Ser) of SEQ ID N0:2; and wherein the polypeptide
elicits an immune response in the animal to produce the
antibody; and isolating the antibody from the animal.
Within another aspect, the present invention
provides an antibody produced by the method disclosed
above, which binds to a zsig57 polypeptide. Within one
embodiment the antibody disclosed above is a monoclonal
antibody. Within another aspect, the present invention
provides an antibody which specifically binds to a
polypeptide disclosed above. Within another embodiment
the antibody disclosed above is coupled to a plasmid
containing a cDNA encoding a functional polypeptide.
Within another embodiment the antibody disclosed above is
coupled to a chemical agent.
These and other aspects of the invention will
become evident upon reference to the following detailed
description of the invention and attached drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates an alignment of zsig57
(ZSIG57) (SEQ ID N0:2), human CMRF35 protein (CM35 H) (SEQ
ID N0:29), and human pIgR (PIGR-H) (SEQ ID N0:30).
Figure 2 is a hydrophobicity plot of zsig57
determined from a Hopp/Woods hydrophilicity profile based
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
8
on a sliding six-residue window, with buried G, S, and T
residues and exposed H, Y, and W residues ignored.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail,
it may be helpful to the understanding thereof to define
the following terms:
The term "affinity tag" is used herein to denote
a polypeptide segment that can be attached to a second
polypeptide to provide for purification or detection of
the second polypeptide or provide sites for attachment of
the second polypeptide to a substrate. In principal, any
peptide or protein for which an antibody or other specific
binding agent is available can be used as an affinity tag.
Affinity tags include a poly-histidine tract, protein A
(Nilsson et al., EMBO J. 9:1075, 1985; Nilsson et al.,
Methods Enzymol. 198:3, 1991), glutathione S transferase
(Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity
tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA
82:7952-4, 1985), substance P, FlagTM peptide (Hopp et al.,
Biotechnology 6:1204-10, 1988), streptavidin binding
peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and
Purification 2: 95-107, 1991. DNAs encoding affinity tags
are available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to
denote any of two or more alternative forms of a gene
occupying the same chromosomal locus. Allelic variation
arises naturally through mutation, and may result in
phenotypic polymorphism within populations. Gene
mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered
amino acid sequence. The term allelic variant is also
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
used herein to denote a protein encoded by an allelic
variant of a gene.
The terms "amino-terminal" and "carboxyl
terminal" are used herein to denote positions within
polypeptides. Where the context allows, these terms are
used with reference to a particular sequence or portion of
a polypeptide to denote proximity or relative position.
For example, a certain sequence positioned carboxyl-
terminal to a reference sequence within a polypeptide is
located proximal to the carboxyl terminus of the reference
sequence, but is not necessarily at the carboxyl terminus
of the complete polypeptide.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently
associated, stable pair under appropriate conditions. For
instance, biotin and avidin (or streptavidin) are
prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
complement/anti-complement pair preferably has a binding
affinity of <109 M-1.
The term "complements of a polynucleotide
molecule" denotes a polynucleotide molecule having a
complementary base sequence and reverse orientation as
compared to a reference sequence. For example, the
sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that
has a contiguous stretch of identical or complementary
sequence to another polynucleotide. Contiguous sequences
are said to "overlap" a given stretch of polynucleotide
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
sequence either in their entirety or along a partial
stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-
ATGGAGCTT-3' axe 5'-AGCTTgagt-3' and 3'-tcgacTACC-5'.
5 The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or
more degenerate codons (as compared to a reference
polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of
10 nucleotides, but encode the same amino acid residue (i.e.,
GAU and GAC triplets each encode Asp).
A "DNA construct" is a single or double
stranded, linear or circular DNA molecule that comprises
segments of DNA combined and juxtaposed in a manner not
found in nature. DNA constructs exist as a result of
human manipulation, and include clones and other copies of
manipulated molecules.
A "DNA segment" is a portion of a larger DNA
molecule having specified attributes. For example, a DNA
segment encoding a specified polypeptide is a portion of a
longer DNA molecule, such as a plasmid or plasmid
fragment, that, when read from the 5' to the 3' direction,
encodes the sequence of amino acids of the specified
polypeptide.
The term "expression vector" is used to denote a
DNA molecule, linear or circular, that comprises a segment
encoding a polypeptide of interest operably linked to
additional segments that provide for its transcription.
Such additional segments include promoter and terminator
sequences, and may also include one or more origins of
replication, one or more selectable markers, an enhancer,
a polyadenylation signal, etc. Expression vectors are
generally derived from plasmid or viral DNA, or may
contain elements of both.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
11
The term "isolated", when applied to a
polynucleotide, denotes that the polynucleotide has been
removed from its natural genetic milieu and is thus free
of other extraneous or unwanted coding sequences, and is
in a form suitable for use within genetically engineered
protein production systems. Such isolated molecules are
those that are separated from their natural environment
and include cDNA and genomic clones. Isolated DNA
molecules of the present invention are free of other genes
with which they are ordinarily associated, but may include
naturally occurring 5' and 3' untranslated regions such as
promoters and terminators. The identification of
associated regions will be evident to one of ordinary
skill in the art (see for example, Dynan and Tijan, Nature
316:774-78, 1985).
An "isolated" polypeptide or protein is a
polypeptide or protein that is found in a condition other
than its native environment, such as apart from blood and
animal tissue. In a preferred form, the isolated
polypeptide is substantially free of other polypeptides,
particularly other polypeptides of animal origin. It is
preferred to provide the polypeptides in a highly purified
form, i.e. greater than 95~ pure, more preferably greater
than 99~ pure. When used in this context, the term
"isolated" does not exclude the presence of the same
polypeptide in alternative physical forms, such as dimers
or alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to
DNA segments, indicates that the segments are arranged so
that they function in concert for their intended purposes,
e.g., transcription initiates in the promoter and proceeds
through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or
protein obtained from one species that is the functional
CA 02331253 2000-12-18
WO 99/bb040 PCT/US99/11337
12
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
"Paralogs" are distinct but structurally related
proteins made by an organism. Paralogs are believed to
arise through gene duplication. For example, a-globin, (3
globin, and myoglobin are paralogs of each other.
A "polynucleotide" is a single- or double
stranded polymer of deoxyribonucleotide or ribonucleotide
bases read from the 5' to the 3' end. Polynucleotides
include RNA and DNA, and may be isolated from natural
sources, synthesized in vitro, or prepared from a
combination of natural and synthetic molecules. Sizes of
polynucleotides are expressed as base pairs (abbreviated
"bp"), nucleotides ("nt"), or kilobases ("kb"). Where the
context allows, the latter two terms may describe
polynucleotides that are single-stranded or double-
stranded. When the term is applied to double-stranded
molecules it is used to denote overall length and will be
understood to be equivalent to the term "base pairs". It
will be recognized by those skilled in the art that the
two strands of a double-stranded polynucleotide may differ
slightly in length and that the ends thereof may be
staggered as a result of enzymatic cleavage; thus all
nucleotides within a double-stranded polynucleotide
molecule may not be paired.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
naturally or synthetically. Polypeptides of less than
about 10 amino acid residues are commonly referred to as
"peptides".
The term "promoter" is used herein for its art-
recognized meaning to denote a portion of a gene
containing DNA sequences that provide for the binding of
CA 02331253 2000-12-18
WO 99/6b040 PCT/US99/11337
13
RNA polymerase and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
A "protein" is a macromolecule comprising one or
more polypeptide chains. A protein may also comprise non
peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be
added to a protein by the cell in which the protein is
produced, and will vary with the type of cell. Proteins
are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are
generally not specified, but may be present nonetheless.
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule (i.e., a
ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-
peptide structure comprising an extracellular ligand-
binding domain and an intracellular effector domain that
is typically involved in signal transduction. Binding of
ligand to receptor results in a conformational change in
the receptor that causes an interaction between the
effector domain and other molecules) in the cell. This
interaction in turn leads to an alteration in the
metabolism of the cell. Metabolic events that are linked
to receptor-ligand interactions include gene
transcription, phosphorylation, dephosphorylation,
increases in cyclic AMP production, mobilization of
cellular calcium, mobilization of membrane lipids, cell
adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In general, receptors can be membrane
bound, cytosolic or nuclear; monomeric (e. g., thyroid
stimulating hormone receptor, beta-adrenergic receptor) or
multimeric (e. g., PDGF receptor, growth hormone receptor,
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
14
IL-3 receptor, GM-CSF receptor, G-CSF receptor,
erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a
DNA sequence that encodes a polypeptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger
polypeptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a protein
encoded by a splice variant of an mRNA transcribed from a
gene.
Molecular weights and lengths of polymers
determined by imprecise analytical methods (e.g., gel
electrophoresis) will be understood to be approximate
values. When such a value is expressed as "about" X or
"approximately" X, the stated value of X will be
understood to be accurate to ~10$.
All references cited herein are incorporated by
reference in their entirety.
The present invention is based in part upon the
discovery of a novel DNA sequence that encodes a
polypeptide having homology to human CMRF35 and to the
poly-Ig receptor secretory component. Analysis of the
tissue distribution of the mRNA corresponding to this
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
novel DNA showed that expression was highest in small
intestine, bone marrow and peripheral blood leukocytes
(PBLs), followed by apparent but decreased expression
levels in liver and kidney. The polypeptide has been
5 designated zsig57.
The novel zsig57 polypeptides of the present
invention were initially identified by querying an EST
database for proteins homologous to proteins having a
secretory signal sequence. These proteins are
10 characterized by an upstream methionine start site and a
hydrophobic region of approximately 13 amino acids,
followed by a peptide signal peptidase cleavage site. An
EST database was queried for novel DNA sequences whose
translations would meet these search criteria. An EST was
15 found and its corresponding cDNA was sequenced. The novel
polypeptide encoded by the cDNA, when fully sequenced,
showed a Ig-variable domain sequence and homology with the
human CMRF35 and the human pIgR secretory component
(Jackson, et al., supra; Krajci, P., et al., Hum. Genet.
87:642-698, 1991). The zsig57 nucleotide sequence is
believed to encode the entire coding sequence of the
predicted protein. Zsig57 may be a new transcytosis
receptor, immunomodulator, or the like, and is a novel
member of the immunoglobulin superfamily of proteins.
The sequence of the zsig57 polypeptide was
obtained from a single clone believed to contain its
corresponding polynucleotide sequence. The clone was
obtained from a white blood cell (WBC) library. Other
libraries that might also be searched for such sequences
include small intestine, bone marrow, PBLs, and the like.
The nucleotide sequence of a representative
zsig57-encoding DNA is described in SEQ ID N0:1, and its
deduced 199 amino acid sequence is described in SEQ ID
N0:2. In its entirety, zsig57 polypeptide (SEQ ID N0:2)
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
16
represents a full-length polypeptide segment (residue 1
(Met) to residue 199 (Gln) of SEQ ID N0:2). Zsig57
contains a signal sequence, single Ig-variable domain, a
transmembrane domain, and a short cytoplasmic tail. These
domains positioned throughout zsig57 polypeptide
correspond to the homologous regions of CMRF35. These
domains and structural features of zsig57 are further
described below.
Analysis of the DNA encoding zsig57 polypeptide
ZO (SEQ ID NO:l) revealed an open reading frame encoding 199
amino acids (SEQ ID N0:2) comprising a predicted signal
peptide of 15 to 17 amino acid residues (residue 1 (Met)
to residue 15 (Gly) or 17 (Gly) of SEQ ID N0:2), and a
mature polypeptide of 182 to 184 amino acids (residue 18
(Ile) or residue 16 (Gln) to residue 199 (Gln) of SEQ ID
N0:2, depending on where the signal peptide is cleaved).
Zsig57 contains the following 4 regions of conserved amino
acids (see Figure):
1) The first region, referred to hereinafter as
the "Ig-variable domain" corresponds to amino acid
residues 18 (Ile) to amino acid residue 108 (Gly) of SEQ
ID N0:2.
2) The second region, referred to hereinafter
as "acidic cleavage site(s)," corresponds to amino acid
residues 126 (Glu) to amino acid residue 130 (Glu) of SEQ
ID N0:2, with potential cleavage at residue 126 (Glu); and
the di-acid Asp-Glu at residues 157 (Asp) and 158 (Glu) of
SEQ ID N0:2, with potential cleavage at residue 157 (Asp).
These acidic cleavage sites suggest that the portion of
zsig57 containing the Ig-variable domain is secreted.
3) The third region, referred to hereinafter as
the "transmembrane domain" corresponds to amino acid
residues 161 (Ile) to amino acid residue 185 (Ala) of SEQ
ID N0:2.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
17
4) The fourth region, referred to hereinafter
as the "cytoplasmic stub" corresponds to amino acid
residues 186 (Lys) to amino acid residue 199 (Gln) of SEQ
ID N0:2.
In addition, within the Ig-Variable domain,
zsig57 contains conserved cysteines located at residues
38, 52, 59 and 104. Disulfide bonds are predicted between
cysteine residues 52 and 59 and between residues 38 and
104. These cysteines likely maintain a structurally
important fold in the Ig-variable domain, and are
conserved throughout the protein family.
The corresponding polynucleotides encoding the
zsig57 polypeptide regions, domains, motifs, residues and
sequences described above are as shown in SEQ ID NO:1.
The presence of conserved motifs generally
correlates with or defines important structural regions in
proteins. The regions between such motifs may be more
variable, but are often functionally significant because
they can relate to or define important structures and
activities such as binding domains, biological and
enzymatic activity, signal transduction, tissue
localization domains and the like.
As described above, the novel zsig57 polypeptide
encoded by the polynucleotide described herein contains an
Ig-variable domain. The structural topology of Ig
variable domains are conserved in the immunoglobulin
superfamily of proteins. This domain may be involved in
binding another immunoglobulin superfamily protein family
member, and confer an essential function in transcytosis
in tissues where it is expressed, such as the small
intestine; similarly, the Ig-variable domain can also
associate or bind with polypeptides or peptides involved
in antigen presentation, or confer an immunomodulator
activity in PBLs or bone marrow. Additionally, zsig57
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
18
polypeptide could be involved in binding other immune
effector protein destined for translocation, for instance
in bone marrow or small intestine.
The highly conserved amino acids in the Ig
variable domain, transmembrane domain, or other regions of
zsig57 can be used as a tool to identify new family
members. For instance, reverse transcription-polymerase
chain reaction (RT-PCR) can be used to amplify sequences
encoding the conserved regions from RNA obtained from a
variety of tissue sources or cell lines. In particular,
highly degenerate primers designed from the zsig57
sequences are useful for this purpose. Designing and
using such degenerate primers is readily performed by one
of skill in the art.
The present invention also provides
polynucleotide molecules, including DNA and RNA molecules,
that encode the zsig57 polypeptides disclosed herein.
Those skilled in the art will readily recognize that, in
view of the degeneracy of the genetic code, considerable
sequence variation is possible among these polynucleotide
molecules. SEQ ID N0:3 is a degenerate DNA sequence that
encompasses all DNAs that encode the zsig57 polypeptide of
SEQ ID N0:2. Those skilled in the art will recognize that
the degenerate sequence of SEQ ID N0:3 also provides all
RNA sequences encoding SEQ ID N0:2 by substituting U for
T. Thus, zsig57 polypeptide-encoding polynucleotides
comprising nucleotide 1 to nucleotide 597 of SEQ ID N0:3
and their RNA equivalents are contemplated by the present
invention. Table 1 sets forth the one-letter codes used
within SEQ ID N0:3 to denote degenerate nucleotide
positions. "Resolutions" are the nucleotides denoted by a
code letter. "Complement" indicates the code for the
complementary nucleotide(s). For example, the code Y
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
19
denotes.either C or T, and its complement R denotes A or
G, A being complementary to T, and G being complementary
to C.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
TABLE 1.
Nucleoti Resolutio Compleme Resolutio
de n nt n
A A T T
C C G G
G G C C
T T A A
R AIG Y CIT
Y CIT R AIG
M ABC K GIT
K GIT M AIC
S CIG S CIG
W AIT W AIT
H AICIT D AIGIT
B CIGIT V AICIG
V A~CIG B CIGIT
D A~GIT H AICIT
N AICIGIT N AICIGIT
The degenerate codons used in SEQ ID N0:3,
5 encompassing all possible codons for a given amino acid,
are set forth in Table 2.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
21
TABLE 2.
One
Amino Letter Codons Degenerate
Acid Code Codon
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT ACN
Pro P CCA CCC CCG CCT- CCN
Ala A GCA GCC GCG GCT GCN
Gly G GGA GGC GGG GGT GGN
Asn N AAC AAT ~y
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
Asn ~ B ~y
Asp
Gly Gln Z SAR
Any X NNN
CA 02331253 2000-12-18
WO 99/66040 PCT/US99111337
22
One of ordinary skill in the art will appreciate
that some ambiguity is introduced in determining a
degenerate codon, representative of all possible codons
encoding each amino acid. For example, the degenerate
codon for serine (WSN) can, in some circumstances, encode
arginine (AGR), and the degenerate codon for arginine
(MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding
phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant
amino acid sequences, but one of ordinary skill in the art
can easily identify such variant sequences by reference to
the amino acid sequence of SEQ ID N0:2. Variant sequences
can be readily tested for functionality as described
herein.
One of ordinary skill in the art will also
appreciate that different species can exhibit
"preferential codon usage." In general, see, Grantham, et
al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene _13:355-69,
1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm,
Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential
codon usage" or "preferential codons" is a term of art
referring to protein translation codons that are most
frequently used in cells of a certain species, thus
favoring one or a few representatives of the possible
codons encoding each amino acid (See Table 2). For
example, the amino acid Threonine (Thr) may be encoded by
ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the
most commonly used codon; in other species, for example,
insect cells, yeast, viruses or bacteria, different Thr
codons may be preferential. Preferential codons for a
particular species can be introduced into the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
23
polynucleotides of the present invention by a variety of
methods known in the art. Introduction of preferential
codon sequences into recombinant DNA can, for example,
enhance production of the protein by making protein
translation more efficient within a particular cell type
or species. Therefore, the degenerate codon sequence
disclosed in SEQ ID N0:3 serves as a template for
optimizing expression of polynucleotides in various cell
types and species commonly used in the art and disclosed
herein. Sequences containing preferential codons can be
tested and optimized for expression in various species,
and tested for functionality as disclosed herein.
Within preferred embodiments of the invention
the isolated polynucleotides will hybridize to similar
sized regions of SEQ ID N0:1, or a sequence complementary
thereto, under stringent conditions. In general,
stringent conditions are selected to be about 5°C lower
than the thermal melting point (Tm) for the specific
sequence at a defined ionic strength and pH. The Tm is
the temperature (under defined ionic strength and pH) at
which 50~ of the target sequence hybridizes to a perfectly
matched probe. Numerous equations for calculating Tm are
known in the art, and are specific for DNA, RNA and DNA-
RNA hybrids and polynucleotide probe sequences of varying
length (see, for example, Sambrook et al., Molecular
Cloning: A Laboratory Manual, Second Edition (Cold Spring
Harbor Press 1989); Ausubel et al., (eds.), Current
Protocols in Molecular Biology (John Wiley and Svns, Inc.
1987); Berger and Kimmel (eds.), Guide to Molecular
Cloning Techniques, (Academic Press, Inc. 1987); and
Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)).
Sequence analysis software such as OLIGO 6.0 (LSR; Long
Lake, MN) and Primer Premier 9.0 (Premier Biosoft
International; Palo Alto, CA), as well as sites on the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
24
Internet, are available tools for analyzing a given
sequence and calculating Tm based on user defined criteria.
Such programs can also analyze a given sequence under
defined conditions and identify suitable probe sequences.
Typically, hybridization of longer polynucleotide
sequences, >50 base pairs, is performed at temperatures of
about 20-25°C below the calculated Tm. For smaller probes,
<50 base pairs, hybridization is typically carried out at
the Tm or 5-10°C below. This allows for the maximum rate
of hybridization for DNA-DNA and DNA-RNA hybrids. Higher
degrees of stringency at lower temperatures can be
achieved with the addition of formamide which reduces the
Tm of the hybrid about 1°C for each 1a formamide in the
buffer solution. Suitable stringent hybridization
conditions are equivalent to about a 5 h to overnight
incubation at about 42°C in a solution comprising: about
40-50~ formamide, up to about 6X SSC, about 5X Denhardt's
solution, zero up to about 10~ dextran sulfate, and about
10-20 ~g/ml denatured commercially-available carrier DNA.
Generally, such stringent conditions include temperatures
of 20-70°C and a hybridization buffer containing up to 6x
SSC and 0-50~ formamide; hybridization is then followed by
washing filters in up to about 2X SSC. For example, a
suitable wash stringency is equivalent to O.1X SSC to 2X
SSC, 0.1~ SDS, at 55°C to 65°C. Different degrees of
stringency can be used during hybridization and washing to
achieve maximum specific binding to the target sequence.
Typically, the washes following hybridization are
performed at increasing degrees of stringency to remove
non-hybridized polynucleotide probes from hybridized
complexes. Stringent hybridization and wash conditions
depend on the length of the probe, reflected in the Tm,
hybridization and wash solutions used, and are routinely
determined empirically by one of skill in the art.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
As previously noted, the isolated
polynucleotides of the present invention include DNA and
RNA. Methods for preparing DNA and RNA are well known in
the art. In general, RNA is isolated from a tissue or
5 cell that produces large amounts of zsig57 RNA. Such
tissues and cells are identified by Northern blotting
(Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and
include small intestine, bone marrow, PBLs, and cell lines
derived therefrom. Total RNA can be prepared using
10 guanidinium isothiocyanate extraction followed by
isolation by centrifugation in a CsCl gradient (Chirgwin
et al., Biochemistry 18:52-99, 1979). Poly (A)+ RNA is
prepared from total RNA using the method of Aviv and Leder
(Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
15 Complementary DNA (cDNA) is prepared from poly(A)+ RNA
using known methods. In the alternative, genomic DNA can
be isolated. Polynucleotides encoding zsig57 polypeptides
are then identified and isolated by, for example,
hybridization or PCR.
20 A full-length clone encoding zsig57 can be
obtained by conventional cloning procedures.
Complementary DNA (cDNA) clones are preferred, although
for some applications (e. g., expression in transgenic
animals) it may be preferable to use a genomic clone, or
25 to modify a cDNA clone to include at least one genomic
intron. Methods for preparing cDNA and genomic clones are
well known and within the level of ordinary skill in the
art, and include the use of the sequence disclosed herein,
or part s thereof, for probing or priming a library.
Expression libraries can be probed with antibodies to
zsig57, receptor fragments, or other specific binding
partners.
The polynucleotides of the present invention can
also be synthesized using DNA synthesis machines.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
26 _ . _ _
Currently the method of choice is the phosphoramidite
method. If chemically synthesized double stranded DNA is
required for an application such as the synthesis of a
gene or a gene fragment, then each complementary strand is
made separately. The production of short genes (60 to 80
bp) is technically straightforward and can be accomplished
by synthesizing the complementary strands and then
annealing them. For the production of longer genes (>300
bp), however, special strategies must be invoked, because
the coupling efficiency of each cycle during chemical DNA
synthesis is seldom 100. To overcome this problem,
synthetic genes (double-stranded) are assembled in modular
form from single-stranded fragments that are from 20 to
100 nucleotides in length.
One method for building a synthetic gene
requires the initial production of a set of overlapping,
complementary oligonucleotides, each of which is between
to 60 nucleotides long. The sequences of the strands
are planned so that, after annealing, the two end segments
20 of the gene are aligned to give blunt ends. Each internal
section of the gene has complementary 3' and 5' terminal
extensions that are designed to base pair precisely with
an adjacent section. Thus, after the gene is assembled,
the only remaining requirement to complete the process is
sealing the nicks along the backbones of the two strands
with T4 DNA ligase. In addition to the protein coding
sequence, synthetic genes can be designed with terminal
sequences that facilitate insertion into a restriction
endonuclease sites of a cloning vector and other sequences
should also be added that contain signals for the proper
initiation and termination of transcription and
translation.
An alternative way to prepare a full-size gene
is to synthesize a specified set of overlapping
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
27
oligonucleotides (40 to 100 nucleotides). After the 3' and
5' extensions (6 to 10 nucleotides) are annealed, large
gaps still remain, but the base-paired regions are both
long enough and stable enough to hold the structure
together. The duplex is completed and the gaps filled by
enzymatic DNA synthesis with E. coli DNA polymerase I.
This enzyme uses the 3'-hydroxyl groups as replication
initiation points and the single-stranded regions as
templates. After the enzymatic synthesis is completed,
the nicks are sealed with T4 DNA ligase. Double-stranded
constructs are sequentially linked to one another to form
the entire gene sequence and the sequence is verified by
DNA sequence analysis. See Glick and Pasternak, Molecular
Biotechnology, Principles & Ap lications of Recombinant
DNA, (ASM Press, Washington, D.C. 1994); Itakura et al.,
Annu. Rev. Biochem. 53: 323-56, 1984 and Climie et al.,
Proc. Natl. Acad. Sci. USA 87:633-7, 1990.
The present invention further provides
counterpart polypeptides and polynucleotides from other
species (orthologs). These species include, but are not
limited to mammalian, avian, amphibian, reptile, fish,
insect and other vertebrate and invertebrate species. Of
particular interest are zsig57 polypeptides from other
mammalian species, including murine, porcine, ovine,
bovine, canine, feline, equine, and other primate
polypeptides. Orthologs of human zsig57 can be cloned
using information and compositions provided by the present
invention in combination with conventional cloning
techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zsig57
as disclosed herein. Suitable sources of mRNA can be
identified by probing Northern blots with probes designed
from the sequences disclosed herein. A library is then
prepared from mRNA of a positive tissue or cell line. A
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/I 1337
28
zsig57-encoding cDNA can then be isolated by a variety of
methods, such as by probing with a complete or partial
human cDNA or with one or more sets of degenerate probes
based on the disclosed sequences. A cDNA can also be
cloned using the polymerase chain reaction, or PCR
(Mullis, U.S. Patent No. 4,683,202), using primers
designed from the representative human zsig57
polynucleotide sequence disclosed herein. Within an
additional method, the cDNA library can be used to
transform or transfect host cells, and expression of the
cDNA of interest can be detected with an antibody to
zsig57 polypeptide. Similar techniques can also be
applied to the isolation of genomic clones.
Those skilled in the art will recognize that the
sequence disclosed in SEQ ID N0:1 represents a single
allele of human zsig57 and that allelic variation and
alternative splicing are expected to occur. Allelic
variants of this sequence can be cloned by probing cDNA or
genomic libraries from different individuals according to
standard procedures. Allelic variants of the DNA
sequence shown in SEQ ID NO:1, including those containing
silent mutations and those in which mutations result in
amino acid sequence changes, are within the scope of the
present invention, as are proteins which are allelic
variants of SEQ ID N0:2, cDNAs generated from
alternatively spliced mRNAs, which retain the properties
of the zsig57 polypeptide are included within the scope of
the present invention, as are polypeptides encoded by such
cDNAs and mRNAs. Allelic variants and splice variants of
these sequences can be cloned by probing cDNA or genomic
libraries from different individuals or tissues according
to standard procedures known in the art.
The present invention also provides isolated
zsig57 polypeptides that are substantially similar to the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/1133?
29
polypept,ides of SEQ ID N0:2 and their orthologs. The term
"substantially similar" is used herein to denote
polypeptides having 700, preferably 800, more preferably
at least 85°s, sequence identity to the sequences shown in
SEQ ID N0:2 or their orthologs. Such polypeptides will
more preferably be at least 90o identical, and most
preferably 950 or more identical to SEQ ID N0:2 or its
orthologs.) Percent sequence identity is determined by
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
Briefly, two amino acid sequences are aligned to optimize
the alignment scores using a gap opening penalty of 10, a
gap extension penalty of 1, and the "blosum 62" scoring
matrix of Henikoff and Henikoff (ibid.) as shown in Table
3 (amino acids are indicated by the standard one-letter
codes). The percent identity is then calculated as:
Total number of identical matches
x 100
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences]
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
N M
ri I
H
~1 N N O
I
d' r-I M N N
I I I
r-1 r1 d~ M N
I I I I
~ ~i' N N e-I M rl
I 1 I i
'F" L11 O N rl ri r-1 r1 r-i
I I I I
'y'' Lfl '-I M rl O r-1 M N N
I 1 1 I I 1 I
a d' N N o M N v-I N r-I rl
1 1 I 1 I 1
d~ N M ri O M N e-~ M rl M
I I 1 I I I
CO M M rl N rl N r-I N N N M
1 I 1 1 1 I 1 I I I
N d' d' N M M N O N N M M
I 1 I 1 I I I 1 I 1 1
II1 N O M M r-i N f'~1 rl O r-1 M N N
I I I I I 1 I I I 1
Lf1 N N O M N ri O M rl O r-I N ~-I N
I 1 I I 1 i I 1 I
U ~ M di M M ~-i rl M ri N M '-1 ri N N r-I
I I I 1 I I I 1 1 I I I 1 i I
La l0 M O N rl '-I M d~ rl M M rl O rl di M M
I I I 1 I a I I 1 1 I 1 1
~.r l0 r-1 M O O O ri M M O N M N rl O ~i N M
1 I I I I I I I I
P.' l(1 O N M r-1 O N O M N N '-1 M N rl e-i M N M
1 1 I I a I I I I 1 I I I
~: ~i' v-I N N O ri ,--I O N rl e-1 rl rl N r1 r-1 O M N O
1 1 I I I 1 I I I 1 1 I 1 1
~C x z a a a w ~ x H a x ~ r~i w cn H
M
H
° ~ o
ri '"'~ N
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
31
Sequence. identity of polynucleotide molecules is
determined by similar methods using a ratio as disclosed
above.
Those skilled in the art appreciate that there
are many established algorithms available to align two
amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein
alignment method for examining the level of identity
shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative variant zsig57. The
FASTA algorithm is described by Pearson and Lipman, Proc.
Nat'1 Acad. Sci. USA 85:2449 (1988), and by Pearson, Meth.
Enzymol. 183:63 (1990).
Briefly, FASTA first characterizes sequence
similarity by identifying regions shared by the query
sequence (e. g., SEQ ID N0:2) and a test sequence that have
either the highest density of identities (if the ktup
variable is 1) or pairs of identities (if ktup=2), without
considering conservative amino acid substitutions,
insertions, or deletions. The ten regions with the
highest density of identities are then rescored by
comparing the similarity of all paired amino acids using
an amino acid substitution matrix, and the ends of the
regions are "trimmed" to include only those residues that
contribute to the highest score. If there are several
regions with scores greater than the "cutoff" value
(calculated by a predetermined formula based upon the
length of the sequence and the ktup value}, then the
trimmed initial regions are examined to determine whether
the regions can be joined to form an approximate alignment
with gaps. Finally, the highest scoring regions of the
two amino acid sequences are aligned using a modification
of the Needleman-Wunsch-Sellers algorithm (Needleman and
Wunsch, J. Mol. Biol. 98:444 (1970); Sellers, SIAM J.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
32
Appl. Math. 26:787 (1974)), which allows for amino acid
insertions and deletions. Preferred parameters for FASTA
analysis are: ktup=1, gap opening penalty=10, gap
extension penalty=1, and substitution matrix=BLOSUM62,
S with other parameters set as default. These parameters
can be introduced into a FASTA program by modifying the
scoring matrix file ("SMATRIX"), as explained in Appendix
2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence
identity of nucleic acid molecules using a ratio as
disclosed above. For nucleotide sequence comparisons, the
ktup value can range between one to six, preferably from
three to six, most preferably three, with other parameters
set as default.
The BLOSUM62 table (Table 3) is an amino acid
substitution matrix derived from about 2,000 local
multiple alignments of protein sequence segments,
representing highly conserved regions of more than 500
groups of related proteins (Henikoff and Henikoff, Proc.
Nat'1 Acad. Sci. USA 89:10915 (1992)). Accordingly, the
BLOSUM62 substitution frequencies can be used to define
conservative amino acid substitutions that may be
introduced into the amino acid sequences of the present
invention. Although it is possible to design amino acid
substitutions based solely upon chemical properties (as
discussed below), the language "conservative amino acid
substitution" preferably refers to a substitution
represented by a BLOSUM62 value of greater than -1. For
example, an amino acid substitution is conservative if the
substitution is characterized by a BLOSUM62 value of 0,
1, 2, or 3. According to this system, preferred
conservative amino acid substitutions are characterized by
a BLOSUM62 value of at least 1 (e. g., 1, 2 or 3), while
more preferred conservative amino acid substitutions are
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
33
characterized by a BLOSUM62 value of at least 2 (e.g., 2
or 3 ) .
Variant zsig57 polypeptides or substantially
homologous zsig57 polypeptides are characterized as having
one or more amino acid substitutions, deletions or
additions. These changes are preferably of a minor
nature, that is conservative amino acid substitutions (see
Table 4) and other substitutions that do not significantly
affect the folding or activity of the polypeptide; small
deletions, typically of one to about 30 amino acids; and
amino- or carboxyl-terminal extensions, such as an amino-
terminal methionine residue, a small linker peptide of up
to about 20-25 residues, or an affinity tag. The present
invention thus includes polypeptides of from about 70 to
about 210 amino acid residues that comprise a sequence
that is at least 800, preferably at least 90~, and more
preferably 95~ or more identical to the corresponding
region of SEQ ID N0:2. Polypeptides comprising affinity
tags can further comprise a proteolytic cleavage site
between the zsig57 polypeptide and the affinity tag.
Preferred such sites include thrombin cleavage sites and
factor Xa cleavage sites.
Table 4
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
34
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
The present invention further provides a variety
of other polypeptide fusions and related multimeric
proteins comprising one or more polypeptide fusions. For
example, a zsig57 polypeptide can be prepared as a fusion
to a dimerizing protein as disclosed in U. S . Patents Nos .
5,155,027 and 5,567,589. Preferred dimerizing proteins in
this regard include immunoglobulin constant region
domains. Immunoglobulin-zsig57 polypeptide fusions can be
expressed in genetically engineered cells to produce a
variety of multimeric zsig57 analogs. Auxiliary domains
can be fused to zsig57 polypeptides to target them to
specific cells, tissues, or macromolecules (e. g.,
collagen). For example, a zsig57 polypeptide or protein
could be targeted to a predetermined cell type by fusing a
zsig57 polypeptide to a ligand that specifically binds to
a receptor on the surface of the target cell. In this
way, polypeptides and proteins can be targeted for
therapeutic or diagnostic purposes. A zsig57 polypeptide
can be fused to two or more moieties, such as an affinity
tag for purification and a targeting domain. Polypeptide
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
fusions.can also comprise one or more cleavage sites,
particularly between domains. See, Tuan et al.,
Connective Tissue Research 34:1-9, 1996.
The proteins of the present invention can also
5 comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without
limitation, traps-3-methylproline, 2,4-methanoproline,
cis-4-hydroxyproline, traps-4-hydroxyproline, N
methylglycine, allo-threonine, methylthreonine,
10 hydroxyethylcysteine, hydroxyethylhomocysteine,
nitroglutamine, homoglutamine, pipecolic acid,
thiazolidine carboxylic acid, dehydroproline, 3- and 4-
methylproline, 3,3-dimethylproline, tert-leucine,
norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-
15 azaphenylalanine, and 4-fluorophenylalanine. Several
methods are known in the art for incorporating non-
naturally occurring amino acid residues into proteins.
For example, an in vitro system can be employed wherein
nonsense mutations are suppressed using chemically
20 aminoacylated suppressor tRNAs. Methods for synthesizing
amino acids and aminoacylating tRNA are known in the art .
Transcription and translation of plasmids containing
nonsense mutations is carried out in a cell-free system
comprising an E, coli S30 extract and commercially
25 available enzymes and other reagents. Proteins are
purified by chromatography. See, for example, Robertson
et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et al.,
Methods Enzymol. 202:301, 1991; Chung et al., Science
259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci.
30 USA 90:10195-9, 1993). In a second method, translation is
carried out in Xenopus oocytes by microinjection of
mutated mRNA and chemically aminoacylated suppressor tRNAs
(Turcatti et al., J. Biol. Chem. 271:19991-8, 1996).
Within a third method, E. coli cells are cultured in the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
36 w
absence, of a natural amino acid that is to be replaced
(e. g., phenylalanine) and in the presence of the desired
non-naturally occurring amino acids) (e.g., 2-
azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine,
or 4-fluorophenylalanine). The non-naturally occurring
amino acid is incorporated into the protein in place of
its natural counterpart. See, Koide et al., Biochem.
33:7470-6, 1994. Naturally occurring amino acid residues
can be converted to non-naturally occurring species by in
vitro chemical modification. Chemical modification can be
combined with site-directed mutagenesis to further expand
the range of substitutions (Wynn and Richards, Protein
Sci. 2:395-403, 1993) .
A limited number of non-conservative amino
acids, amino acids that are not encoded by the genetic
code, non-naturally occurring amino acids, and unnatural
amino acids can be substituted for zsig57 amino acid
residues.
Essential amino acids in the polypeptides of the
present invention can be identified according to
procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham
and Wells, Science 244: 1081-5, 1989; Bass et al., Proc.
Natl. Acad. Sci. USA 88:4498-502, 1991). In the latter
technique, single alanine mutations are introduced at
every residue in the molecule, and the resultant mutant
molecules are tested for biological activity as disclosed
below to identify amino acid residues that are critical to
the activity of the molecule. See also, Hilton et al., _J.
Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor
or other biological interaction can also be determined by
physical analysis of structure, as determined by such
techniques as nuclear magnetic resonance, crystallography,
electron diffraction or photoaffinity labeling, in
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
37
conjunction with mutation of putative contact site amino
acids. See, for example, de Vos et al., Science 255:306-
12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992;
Wlodaver et al., FEBS Lett. 309:59-64, 1992. The
identities of essential amino acids can also be inferred
from analysis of homologies with related proteins such as
the human CMRF35.Multiple amino acid substitutions can be
made and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc.
Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these
authors disclose methods for simultaneously randomizing
two or more positions in a polypeptide, selecting for
functional polypeptide, and then sequencing the
mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Patent
No. 5,223,409; Huse, WIPO Publication WO 92/06204) and
region-directed mutagenesis (Derbyshire et al., Gene
46:145, 1986; Ner et al., DNA 7:127, 1988).
Variants of the disclosed zsig57 DNA and
polypeptide sequences can be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389-91,
1994, Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51,
1994 and WIPO Publication WO 97/20078. Briefly, variant
DNAs are generated by in vitro homologous recombination by
random fragmentation of a parent DNA followed by
reassembly using PCR, resulting in randomly introduced
point mutations. This technique can be modified by using
a family of parent DNAs, such as allelic variants or DNAs
from different species, to introduce additional
variability into the process. Selection or screening for
the desired activity, followed by additional iterations of
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
38
mutagenesis and assay provides for rapid "evolution" of
sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be
combined with high-throughput, automated screening methods
to detect activity of cloned, mutagenized polypeptides in
host cells. Mutagenized DNA molecules that encode active
polypeptides (e. g., IgA binding activity, or cAMP
suppression as described herein) can be recovered from the
host cells and rapidly sequenced using modern equipment.
These methods allow the rapid determination of the
importance of individual amino acid residues in a
polypeptide of interest, and can be applied to
polypeptides of unknown structure.
Using the methods discussed herein, one of
ordinary skill in the art can identify and/or prepare a
variety of polypeptide fragments or variants of SEQ ID
N0:2 or that retain the Ig-variable domain properties,
binding, transcytosis, or signal transduction activity of
the wild-type zsig57 protein. For example, using the
methods described above, one could identify a ligand
binding domain on zsig57; heterodimeric and homodimeric
binding domains; other functional or structural domains;
or other domains important for protein-protein
interactions or signal transduction. Such polypeptides
can also include additional polypeptide segments, such as
affinity tags, as generally disclosed herein.
For any zsig57 polypeptide, including variants
and fusion proteins, one of ordinary skill in the art can
readily generate a fully degenerate polynucleotide
sequence encoding that variant using the information set
forth in Tables 1 and 2 above.
The zsig57 polypeptides of the present
invention, including full-length polypeptides,
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
39
biologically active fragments, and fusion polypeptides,
can be produced in genetically engineered host cells
according to conventional techniques. Suitable host cells
are those cell types that can be transformed or
transfected with exogenous DNA and grown in culture,
including bacteria, fungal cells, and cultured higher
eukaryotic cells. Eukaryotic cells, particularly cultured
cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are
disclosed by Sambrook et al., Molecular Cloning: _A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY, 1989, and Ausubel et al.,
eds., Current Protocols in Molecular Biolo y, John Wiley
and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zsig57
polypeptide is operably linked to other genetic elements
required for its expression, generally including a
transcription promoter and terminator, within an
expression vector. The vector will also commonly contain
one or more selectable markers and one or more origins of
replication, although those skilled in the art will
recognize that within certain systems selectable markers
can be provided on separate vectors, and replication of
the exogenous DNA can be provided by integration into the
host cell genome. Selection of promoters, terminators,
selectable markers, vectors and other elements is a matter
of routine design within the level of ordinary skill in
the art. Many such elements are described in the
literature and are available through commercial suppliers.
To direct a zsig57 polypeptide into the
secretory pathway of a host cell, a secretory signal
sequence (also known as a leader sequence, prepro sequence
or pre sequence) is provided in the expression vector.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
The secretory signal sequence can be that of zsig57, or
can be derived from another secreted protein (e.g., t-PA)
or synthesized de novo. The secretory signal sequence is
operably linked to the zsig57 DNA sequence, i.e., the two
5 sequences are joined in the correct reading frame and
positioned to direct the newly synthesized polypeptide
into the secretory pathway of the host cell. Secretory
signal sequences are commonly positioned 5' to the DNA
sequence encoding the polypeptide of interest, although
10 certain secretory signal sequences may be positioned
elsewhere in the DNA sequence of interest (see, e.g.,
Welch et al., U.S. Patent No. 5,037,743; Holland et al.,
U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence
15 contained in the polypeptides of the present invention is
used to direct other polypeptides into the secretory
pathway. The present invention provides for such fusion
polypeptides. A signal fusion polypeptide can be made
wherein a secretory signal sequence that encodes a signal
20 peptide from amino acids 12 (Met) to 15 (Gly) of SEQ ID
N0:2 is operably linked to another DNA segment encoding a
polypeptide using methods known in the art and disclosed
herein. The secretory signal sequence contained in the
fusion polypeptides of the present invention is preferably
25 fused amino-terminally to an additional peptide to direct
the additional peptide into the secretory pathway. Such
constructs have numerous applications known in the art.
For example,, these novel secretory signal sequence fusion
constructs can direct the secretion of an active component
30 of a normally non-secreted protein. Such fusions can be
used in vivo or in vitro to direct peptides through the
secretory pathway.
Cultured mammalian cells are suitable hosts
within the present invention. Methods for introducing
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
41
exogenous DNA into mammalian host cells include calcium
phosphate-mediated transfection (Wigler et al., Cell
14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics
w 7:603, 1981: Graham and Van der Eb, Virology 52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-5,
1982), DEAE-dextran mediated transfection (Ausubel et al.,
ibid.), and liposome-mediated transfection (Hawley-Nelson
et al., Focus 15:73, 1993; Ciccarone et al., Focus _15:80,
1993, and viral vectors (Miller and Rosman, BioTechniques
7:980-90, 1989; Wang and Finer, Nature Med. 2:714-6,
1996). The production of recombinant polypeptides in
cultured mammalian cells is disclosed, for example, by
Levinson et al., U.S. Patent No. 4,713,339; Hagen et al.,
U.S. Patent No. 4,784,950; Palmiter et al., U.S. Patent
No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC
No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No.
CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and
Chinese hamster ovary (e. g. CHO-K1; ATCC No. CCL 61) cell
lines. Additional suitable cell lines are known in the
art and available from public depositories such as the
American Type Culture Collection, Manassas, VA. Other
suitable cell lines include but are not limited to
intestinal cell lines, osteoblast, osteoclast,
hematopoietic cell lines, and leukocyte cell lines. In
general, strong transcription promoters are preferred,
such as promoters from SV-90 or cytomegalovirus. See,
e.g., U.S. Patent No. 4,956,288. Other suitable promoters
include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late
promoter.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
42
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the
gene of interest to their progeny are referred to as
"stable transfectants." A preferred selectable marker is
a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-
type drug, such as G-418 or the like. Selection systems
can also be used to increase the expression level of the
gene of interest, a process referred to as
"amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of
selective agent to select for cells that produce high
levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g. hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can
also be used. Alternative markers that introduce an
altered phenotype, such as green fluorescent protein, or
cell surface proteins such as CD4, CD8, Class I MHC,
placental alkaline phosphatase can be used to sort
transfected cells from untransfected cells by such means
as FACS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used
as hosts, including plant cells, insect cells and avian
cells. The use of Agrobacterium rhizogenes as a vector
for expressing genes in plant cells has been reviewed by
Sinkar et al., J. Biosci. (Bangalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign
polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and WIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus,
CA 02331253 2000-12-18
WO 99/660A0 PCT/US99/11337
43
commonly derived from Autographa californica nuclear
polyhedrosis virus (AcNPV). See, King, L.A. and Possee,
R.D., The Baculovirus Ex ression System' A Laboratory
Guide, London, Chapman & Hall; 0'Reilly, D.R. et al.,
Baculovirus Expression Vectors: A Laboratory Manual, New
York, Oxford University Press., 1994; and, Richardson, C.
D., Ed., Baculovirus Expression Protocols Methods in
Molecular Biology, Totowa, NJ, Humana Press, 1995. The
second method of making recombinant zsig57 baculovirus
utilizes a transposon-based system described by Luckow
(Luckow, V.A, et al., J Virol 67:4566-79, 1993). This
system, which utilizes transfer vectors, is sold in the
Bac-to-BacT"" kit (Life Technologies, Rockville, MD). This
system utilizes a transfer vector, pFastBaclT"' (Life
Technologies) containing a Tn7 transposon to move the DNA
encoding the zsig57 polypeptide into a baculovirus genome
maintained in E. coli as a large plasmid called a
"bacmid." The pFastBaclT"" transfer vector utilizes the
AcNPV polyhedrin promoter to drive the expression of the
gene of interest, in this case zsig57. However,
pFastBaclT'" can be modified to a considerable degree. The
polyhedrin promoter can be removed and substituted with
the baculovirus basic protein promoter (also known as
Pcor, p6.9 or MP promoter) which is expressed earlier in
the baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins. See, Hill-
Perkins, M.S. and Possee, R.D., J. Gen. Virol. 71:971-6,
1990; Bonning, B.C. et al., J. Gen. Virol. 75:1551-6,
1994; and, Chazenbalk, G.D., and Rapoport, B., J. Biol.
Chem. 270:1593-9, 1995. In such transfer vector
constructs, a short or long version of the basic protein
promoter can be used. Moreover, transfer vectors can be
constructed which replace the native zsig57 secretory
signal sequences with secretory signal sequences derived
CA 02331253 2000-12-18
WO 99166040 PCT/US99/11337
44
from insect proteins. For example, a secretory signal
sequence from Ecdysteroid Glucosyltransferase (EGT), honey
bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus
gp67 (PharMingen, San Diego, CA) can be used in constructs
to replace the native zsig57 secretory signal sequence.
In addition, transfer vectors can include an in-frame
fusion with DNA encoding an epitope tag at the C- or N-
terminus of the expressed zsig57 polypeptide, for example,
a Glu-Glu epitope tag (Grussenmeyer, T. et al., Proc.
Natl. Acad. Sci. 82:7952-4, 1985). Using a technique
known in the art, a transfer vector containing zsig57 is
transformed into E. Coli, and screened for bacmids which
contain an interrupted lacZ gene indicative of recombinant
baculovirus. The bacmid DNA containing the recombinant
baculovirus genome is isolated, using common techniques,
and used to transfect Spodoptera frugiperda cells, e.g.
Sf9 cells. Recombinant virus that expresses zsig57 is
subsequently produced. Recombinant viral stocks are made
by methods commonly used the art.
The recombinant virus is used to infect host
cells, typically a cell line derived from the fall
armyworm, Spodoptera frugiperda. See, in general, Glick
and Pasternak, Molecular Biotechnology: Principles an_d
Applications of Recombinant DNA, ASM Press, Washington,
D.C., 1994. Another suitable cell line is the High FiveOT""
cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent No. 5,300,435). Commercially available serum-free
media are used to grow and maintain the. cells. Suitable
media are Sf900 IIT"" (Life Technologies) or ESF 921T""
(Expression Systems) for the Sf9 cells; and Ex-ce110405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life
Technologies) for the T, ni cells. The cells are grown up
from an inoculation density of approximately 2-5 x 105
cells to a density of 1-2 x 106 cells at which time a
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
recombinant viral stock is added at a multiplicity of
infection (MOI) of 0.1 to 10, more typically near 3.
Procedures used are generally described in available
laboratory manuals (King, L. A. and Possee, R.D., ibid.;
5 0'Reilly, D.R. et al., ibid.; Richardson, C. D., ibid.).
Subsequent purification of the zsig57 polypeptide from the
supernatant can be achieved using methods described
herein.
Fungal cells, including yeast cells, can also be
10 used within the present invention. Yeast species of
particular interest in this regard include Saccharomyces
cerevisiae, Pichia pastoris, and Pichia metnanolica.
Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides
15 therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al.,
U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent
No. 4,845,075. Transformed cells are selected by
20 phenotype determined by the selectable marker, commonly
drug resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POTI
vector system disclosed by Kawasaki et al. (U. S. Patent
25 No. 4,931,373), which allows transformed cells to be
selected by growth in glucose-containing media. Suitable
promoters and terminators for use in yeast include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
30 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and
alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe,
CA 02331253 2000-12-18
WO 99/66040 PCT/U599/11337
46
Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
S 132:3959-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells can be utilized according to the methods
of McKnight et al., U.S. Patent No. 4,935,349. Methods
for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 9,486,533.
The use of Pichia methanolica as host for the
production of recombinant proteins is disclosed in WIPO
Publications WO 97/I7450, WO 97/I7451, WO 98/02536, and WO
98/02565. DNA molecules for use in transforming P.
methanolica will commonly be prepared as double-stranded,
circular plasmids, which are preferably linearized prior
to transformation. For polypeptide production in P.
methanolica, it is preferred that the promoter and
terminator in the plasmid be that of a P. methanolica
gene, such as a P. methanolica alcohol utilization gene
(A UG1 or AUG2). Other useful promoters include those of
the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To
facilitate integration of the DNA into the host
chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which
encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21), which allows ade2 host cells to grow in the
absence of adenine. For large-scale, industrial processes
where it is desirable to minimize the use of methanol, it
is preferred to use host cells in which both methanol
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
47
utilization genes (A UGl and A UG2) are deleted. For
production of secreted proteins, host cells deficient in
vacuolar protease genes (PEP4 and PRB.t) are preferred.
Electroporation is used to facilitate the introduction of
a plasmid containing DNA encoding a polypeptide of
interest into P. methanolica cells. It is preferred to
transform P. methanolica cells by electroporation using
an exponentially decaying, pulsed electric field having a
field strength of from 2.5 to 4.5 kV/cm, preferably about
3.75 kV/cm, and a time constant (t) of from 1 to 40
milliseconds, most preferably about 20 milliseconds. P.
methanolica cells are cultured in a medium comprising
adequate sources of carbon, nitrogen and trace nutrients
at a temperature of about 25°C to 35°C. Liquid cultures
are provided with sufficient aeration by conventional
means, such as shaking of small flasks or sparging of
fermentors. A preferred culture medium for P. methanolica
is YEPD (2~ D-glucose, 2~ BactoTM Peptone (Difco
Laboratories, Detroit, MI), 1~ BactoTM yeast extract (Difco
Laboratories), 0.004$ adenine and 0.006 L-leucine).
Prokaryotic host cells, including strains of the
bacteria Escherichia coli, Bacillus and other genera are
also useful host cells within the present invention.
Techniques for transforming these hosts and expressing
foreign DNA sequences cloned therein are well known in the
art (see, e.g., Sambrook et al., ibid.). When expressing
a zsig57 polypeptide in bacteria such as E. coli, the
polypeptide may be retained in the cytoplasm, typically as
insoluble granules, or may be directed to the periplasmic
space by a bacterial secretion sequence. In the former
case, the cells are lysed, and the granules are recovered
and denatured using, for example, guanidine isothiocyanate
or urea. The denatured polypeptide can then be refolded
and dimerized by diluting the denaturant, such as by
CA 02331253 2000-12-18
WO 99/66040 PCT/IJS99/11337
48
dialysis against a solution of urea and a combination of
reduced and oxidized glutathione, followed by dialysis
against a buffered saline solution. In the latter case,
the polypeptide can be recovered from the periplasmic
space in a soluble and functional form by disrupting the
cells (by, for example, sonication or osmotic shock) to
release the contents of the periplasmic space and
recovering the protein, thereby obviating the need for
denaturation and refolding.
Transformed or transfected host cells are
cultured according to conventional procedures in a culture
medium containing nutrients and other components required
for the growth of the chosen host cells. A variety of
suitable media, including defined media and complex media,
are known in the art and generally include a carbon
source, a nitrogen source, essential amino acids, vitamins
and minerals. Media can also contain such components as
growth factors or serum, as required. The growth medium
will generally select for cells containing the exogenously
added DNA by, for example, drug selection or deficiency in
an essential nutrient which is complemented by the
selectable marker carried on the expression vector or co-
transfected into the host cell.
It is preferred to purify the polypeptides of
the present invention to X80$ purity, more preferably to
?90$ purity, even more preferably >_95$ purity, and
particularly preferred is a pharmaceutically pure state,
that is greater than 99.9 pure with respect to
contaminating macromolecules, particularly other proteins
and nucleic acids, and free of infectious and pyrogenic
agents. Preferably, a purified polypeptide is
substantially free of other polypeptides, particularly
other polypeptides of animal origin.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
49
. Expressed recombinant zsig57 polypeptides (or
chimeric zsig57 polypeptides) can be purified using
fractionation and/or conventional purification methods and
media. For example, the particular purification methods
described in Rindisbacher, L., et al., su ra., are
exemplary, and can be adapted to zsig57 polypeptide by one
of ordinary skill in the art using methods described
below.
Protein purification methods include,
fractionation of samples by ammonium sulfate precipitation
and acid or chaotrope extraction. Exemplary purification
steps may include hydroxyapatite, size exclusion, FPLC and
reverse-phase high performance liquid chromatography.
Suitable chromatographic media include derivatized
dextrans, agarose, cellulose, polyacrylamide, specialty
silicas, and the like. PEI, DEAF, QAE and Q derivatives
are preferred. Exemplary chromatographic media include
those media derivatized with phenyl, butyl, or octyl
groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl
butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose (Pharmacia) and the like; or polyacrylic resins,
such as Amberchrom CG 71 (Toso Haas) and the like.
Suitable solid supports include glass beads, silica-based
resins, cellulosic resins, agarose beads, cross-linked
agarose beads, polystyrene beads, cross-linked
polyacrylamide resins and the like that are insoluble
under the conditions in which they are to be used. These
supports may be modified with reactive groups that allow
attachment of proteins by amino groups, carboxyl groups,
sulfhydryl groups, hydroxyl groups and/or carbohydrate
moieties. Examples of coupling chemistries include
cyanogen bromide activation, N-hydroxysuccinimide
activation, epoxide activation, sulfhydryl activation,
hydrazide activation, and carboxyl and amino derivatives
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
for carbodiimide coupling chemistries. These and other
solid media are well known and widely used in the art, and
are available from commercial suppliers. Methods for
binding receptor polypeptides to support media are well
5 known in the art. Selection of a particular method is a
matter of routine design and is determined in part by the
properties of the chosen support. See, for example,
Affinity Chromatography: Principles & Methods, Pharmacia
LKB Biotechnology, Uppsala, Sweden, 1988.
10 The polypeptides of the present invention can be
isolated by exploitation of their biochemical, structural,
and biological properties. For example, immobilized metal
ion adsorption (IMAC) chromatography can be used to purify
histidine-rich proteins, including those comprising
15 polyhistidine tags. Briefly, a gel is first charged with
divalent metal ions to form a chelate (Sulkowski, Trends
in Biochem. 3:1-7, 1985). Histidine-rich proteins will be
adsorbed to this matrix with differing affinities,
depending upon the metal ion used, and will be eluted by
20 competitive elution, lowering the pH, or use of strong
chelating agents. Other methods of purification include
purification of glycosylated proteins by lectin affinity
chromatography and ion exchange chromatography (Methods in
Enzymol., Vol. 182, "Guide to Protein Purification", M.
25 Deutscher, (ed.), Acad. Press, San Diego, 1990, pp.529-
39). Within additional embodiments of the invention, a
fusion of the polypeptide of interest and an affinity tag
(e. g., maltose-binding protein, an immunoglobulin domain)
may be constructed to facilitate purification.
Moreover, using methods described in the art,
polypeptide fusions, or hybrid zsig57 proteins, are
constructed using regions or domains of the inventive
zsig57 in combination with those of other related proteins
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
51
(e. g. human CMRF35 or poly-Ig receptor), or heterologous
proteins (Sambrook et al., ibid., Altschul et al., ibid.,
Picard, Cur. Opin. Biology, 5:511-5, 1994, and references
therein). These methods allow the determination of the
biological importance of larger domains or regions in a
polypeptide of interest. Such hybrids may alter reaction
kinetics, binding, constrict or expand the substrate
specificity, or alter tissue and cellular localization of
a polypeptide, and can be applied to polypeptides of
unknown structure.
Fusion proteins can be prepared by methods known
to those skilled in the art by preparing each component of
the fusion protein and chemically conjugating them.
Alternatively, a polynucleotide encoding different
components of the fusion protein in the proper reading
frame can be generated using known techniques and
expressed by the methods described herein. For example,
part or all of a domains) conferring a biological
function can be swapped between zsig57 of the present
invention with the corresponding domains) from another
Ig-variable-domain family member, such as CMRF35. Such
domains include, but are not limited to, the secretory
signal sequence, conserved motifs, Ig-variable domain,
transmembrane domain, acidic cleavage sites, and the
cytoplasmic stub. Such fusion proteins would be expected
to have a biological functional profile that is the same
or similar to polypeptides of the present invention or
other members of the protein family, depending on the
fusion constructed. Moreover, such fusion proteins can
exhibit other properties as disclosed herein.
Zsig57 polypeptides or fragments thereof can
also be prepared through chemical synthesis. Zsig57
polypeptides may be monomers or multimers; glycosylated or
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/I 1337
52
non-glycosylated; pegylated or non-pegylated; and may or
may not include an initial methionine amino acid residue.
Polypeptides of the present invention can also
be synthesized by exclusive solid phase synthesis, partial
solid phase methods, fragment condensation or classical
solution synthesis. Methods for synthesizing polypeptides
are well known in the art. See, for example, Merrifield,
J. Am. Chem. Soc. 85:2149, 1963; Kaiser et al., Anal.
Biochem. 34:595, 1970. After the entire synthesis of the
desired peptide on a solid support, the peptide-resin is
with a reagent which cleaves the polypeptide from the
resin and removes most of the side-chain protecting
groups . Such methods are well established in the art . The
activity of molecules of the present invention can be
measured using a variety of assays that measure for
example, signal transduction, Ig binding or cAMP
modulation. Such assays are well known in the art. For a
general reference, see Nihei, Y., et al., su ra.; and
Rindisbacher, L., et al., supra..
The activity of the zsig57 polypeptides of the
present invention can be measured by their ability to bind
Ig. For example, the IgA binding assay for the secretory
component of pIgR is known in the art and can be applied
to the polypeptides of the present invention. See,
Rindisbacher, L., et al., J. Biol. Chem., 270:14220-14228,
1995.
In addition, zsig57 polypeptides of the present
invention can be used to study pancreatic cell
proliferation or differentiation. Such methods of the
present invention generally comprise incubating a cells, (3
cells, 8 cells, F cells and acinar cells in the presence
and absence of zsig57 polypeptide, monoclonal antibody,
CA 02331253 2000-12-18
WO '99/66040 PCT/ITS99/11337
53
agonist.or antagonist thereof_ and observing changes in
islet cell proliferation or differentiation.
A further aspect of the invention provides a
method for studying insulin. Such methods of the present
invention comprise incubating adipocytes in a culture
medium comprising zsig57 polypeptide, monoclonal antibody,
agonist or antagonist thereof ~ insulin and observing
changes in adipocyte protein secretion or differentiation.
The present invention also provides methods of
studying mammalian cellular metabolism. Such methods of
the present invention comprise incubating cells to be
studied, for example, human vascular endothelial cells, ~
zsig57 polypeptide, monoclonal antibody, agonist or
antagonist thereof and observing changes in adipogenesis,
gluconeogenesis, glycogenolysis, lipogenesis, glucose
uptake, or the like.
Also, zsig57 polypeptides, agonists or
antagonists thereof can be therapeutically useful for
promoting wound healing, for example, in the intestine.
To verify the presence of this capability in zsig57
polypeptides, agonists or antagonists of the present
invention, such zsig57 polypeptides, agonists or
antagonists are evaluated with respect to their ability to
facilitate wound healing according to procedures known in
the art. If desired, zsig57 polypeptide performance in
this regard can be compared to growth factors, such as
EGF, NGF, TGF-a, TGF-~3, insulin, IGF-I, IGF-II, fibroblast
growth factor (FGF) and the like. In addition, zsig57
polypeptides or agonists or antagonists thereof can be
evaluated in combination with one or more growth factors
to identify synergistic effects.
In addition, zsig57 polypeptides, agonists or
antagonists thereof can be therapeutically useful for
anti-microbial applications. To verify the presence of
CA 02331253 2000-12-18
WO 99/66040 PGT/US99/11337
54
this capability in zsig57 polypeptides, agonists or
antagonists of the present invention, such zsig57
polypeptides, agonists or antagonists are evaluated with
respect to their antimicrobial properties according to
procedures known in the art. See, for example, Barsum et
al., Eur. Respir. J. 8: 709-14, 1995; Sandovsky-Losica et
al., J. Med. Vet. Mycol (England) 28: 279-87, 1990;
Mehentee et al., J. Gen. Microbiol (En land) 135: 2181-88,
1989; Segal and Savage, Journal of Medical and Veterinary
Mycology 24: 477-479, 1986, and the like. If desired,
zsig57 polypeptide performance in this regard can be
compared to proteins known to be functional in this
regard, such as proline-rich proteins, lysozyrne,
histatins, lactoperoxidase or the like. Moreover, zsig57
may bind and protect immune molecules (e. g., IgA) from
proteolytic or other microbial attack (Brandtzaeg, P. and
Krajci, P., "Secretory Component (pIgR)" In' Encyclo edia
of Immunology, Ivan M. Roitt and Peter J. Delves (eds.),
pp. 1360-1364. Academic Press, London, 1992). In
addition, zsig57 polypeptides or agonists or antagonists
thereof can be evaluated in combination with one or more
antimicrobial agents to identify synergistic effects.
The activity of molecules of the present
invention can be measured using a variety of assays that
measure stimulation of gastrointestinal cell
contractility, modulation of nutrient uptake and/or
secretion of digestive enzymes. Of particular interest
are changes in contractility of smooth muscle cells. For
example, the contractile response of segments of mammalian
duodenum or other gastrointestinal smooth muscles tissue
(Depoortere et al., J. Gastrointestinal Motility _1:150-
159, 1989). An exemplary in vivo assay uses an ultrasonic
micrometer to measure the dimensional changes radially
between commissures and longitudinally to the plane of the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
valve base (Hansen et al., Society of Thoracic Sur eons
60:S384-390, 1995).
Anti-microbial protective agents can be directly
acting or indirectly acting. Such agents operating via
5 membrane association or pore forming mechanisms of action
directly attach to the offending microbe. Anti-microbial
agents can also act via an enzymatic mechanism, breaking
down microbial protective substances or the cell
wall/membrane thereof. Anti-microbial agents, capable of
10 inhibiting microorganism proliferation or action or of
disrupting microorganism integrity by either mechanism set
forth above, are useful in methods for preventing
contamination in cell culture by microbes susceptible to
that anti-microbial activity. Such techniques involve
15 culturing cells in the presence of an effective amount of
said zsig57 polypeptide or an agonist or antagonist
thereof .
Also, zsig57 polypeptides or agonists thereof
can be used as cell culture reagents in in vitro studies
20 of exogenous microorganism infection, such as bacterial,
viral or fungal infection. Such moieties can also be used
in in vivo animal models of infection. Also, the
microorganism-adherence properties of zsig57 polypeptides
or agonists thereof can be studied under a variety of
25 conditions in binding assays and the like.
Moreover, zsig57 polypeptides, agonists or
antagonists thereof can be therapeutically useful for
mucosal integrity maintenance. Tissue expression of
zsig57 is high in small intestine, a tissue involved in
30 mucosal secretion. To verify the presence of this
capability in zsig57 polypeptides, agonists or antagonists
of the present invention, such zsig57 polypeptides,
agonists or antagonists are evaluated with respect to
their mucosal integrity maintenance according to
CA 02331253 2000-12-18
WO 99/G6040 PCT/US99J11337
56
procedures known in the art. See, for example, Zahm et
al., Eur. Respir. J. 8: 381-6, 1995, which describes
methods for measuring viscoelastic properties and surface
properties of mucous as well as for evaluating mucous
transport by cough and by ciliary activity. If desired,
zsig57 polypeptide performance in this regard can be
compared to mucins or the like. In addition, zsig57
polypeptides or agonists or antagonists thereof can be
evaluated in combination with mucins to identify
synergistic effects.
Bone cell precursors, such as osteoblasts and
osteociasts, are generated from bone marrow. Given the
bone marrow localization of the present invention, assays
that measure bone formation and/or resorption are
important assays to assess zsig57 activity. One example
is an assay system that permits rapid identification of
substances having selective calcitonin receptor activity
on cells expressing the calcitonin receptor. The
calcitonin receptor is a member of the G-protein receptor
family and transducer signal via activation of adenylate
cyclase, leading to elevation of cellular cAMP levels (Lin
et al., Science 254:1022-24, 1991). This assay system
explaits the receptor's ability to elevate cAMP levels as
a way to detect other molecules that are able to stimulate
the calcitonin receptor and initiate signal transduction.
Receptor activation can be detected by: (1)
measurement of adenylate cyclase activity (Salomon et al.,
Anal. Biochem. 58:541-48, 1974; Alvarez and Daniels, Anal.
Biochem. 187:98-103, 1990); (2) measurement of change in
intracellular CAMP levels using conventional
radioimmunoassay methods (Steiner et al., J. Biol. Chem.
247:1106-13, 1972; Harper and Brooker, J. Cyc. Nucl. Res.
1:207-18, 1975); or (3) through use of a CAMP
scintillation proximity assay (SPA) method (Amersham
CA 02331253 2000-12-18
WO 99/66040 PCTlUS99/11337
57 . _.
Corp., .Arlington Heights, IL). While these methods
provide sensitivity and accuracy, they involve
considerable sample processing prior to assay, are time
consuming, involve the use of radioisotopes, and would be
cumbersome for large scale screening assays.
An alternative assay system involves selection
of polypeptides that are able to induce expression of a
cyclic AMP response element (CRE)-luciferase reporter
gene, as a consequence of elevated cAMP levels, in cells
expressing a calcitonin receptor, but not in cells lacking
calcitonin receptor expression, as described in U.S.
patent No. 5,622,839, U.S. Patent No. 5,674,689, and U.S.
patent No. 5,674,981.
Well established animal models are available to
test in vivo efficacy of zsig57 polypeptides that interact
with the calcitonin receptor. Moreover, these models can
be used to test effects of zsig57 on bone other than
through the calcitonin receptor. For example, the
hypocalcemic rat or mouse model can be used to determine
the effect on serum calcium, and the ovariectomized rat or
mouse can be used as a model system for osteoporosis.
Bone changes seen in these models and in humans during the
early stages of estrogen deficiency are qualitatively
similar. Calcitonin has been shown to be an effective
agent for the prevention of bone loss in ovariectomized
women and rats (Mazzuoli et al., Calcif. Tissue Int.
47:209-14, 1990; Wronski et al., Endocrinology 129:2246-
50, 1991). High dose estrogen has been shown to inhibit
bone resorption and to stimulate bone formation in an
ovariectomized mouse model (Bain et al., J. Bone Miner.
Res. 8:435-42, 1993).
Biologically active zsig57 polypeptides of the
present invention that interact with the calcitonin
receptor, or exert other effects on bone, are therefore
CA 02331253 2000-12-18
WO 99/66040 PC'T/US99/11337
58
contemplated to be advantageous for use in therapeutic
applications for which calcitonin is useful. Such
applications, for example, are in the treatment of
osteoporosis, Paget's disease, hyperparathyroidism,
osteomalacia, idiopathic hypercalcemia of infancy and
other conditions. Additional applications are to inhibit
gastric secretion in the treatment of acute pancreatitis
and gastrointestinal disorders, and uses as analgesics, in
particular for bone pain.
In vivo assays for measuring changes in bone
formation rates include performing bone histology (see,
Recker, R., eds. Bone Histomorphometry: Techniques and
Interpretation. Boca Raton: CRC Press, Inc., 1983) and
quantitative computed tomography (QCT; Ferretti,J. Bone
17:3535-3645, 1995; Orphanoludakis et al., Investig.
Radiol. 14:122-130, 1979; and Durand et al., Medical
Physics 19:569-573, 1992). An exemplary ex vivo assay for
measuring changes in bone formation is a calavarial assay
(Gowen et al., J. Immunol. 136:2478-2482, 1986) or
resorption calvarial assay (Linkhart, T.A., and Mohan, S.,
Endocrinology 125:1484-1491, 1989).
In addition, polypeptides of the present
invention can be assayed and used for their ability to
modify inflammation. Methods to determine proinflammatory
and antiinflammatory qualities of zsig57 are known in the
art and discussed herein.
Proteins of the present invention are useful for
example, in treating gastrointestinal, lymphoid,
inflammatory, pancreatic, blood or bone disorders, can be
measured in vitro using cultured cells or in vivo by
administering molecules of the claimed invention to the
appropriate animal model. For instance, host cells
expressing a secreted form of zsig57 polypeptide can be
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
59
embedded in an alginate environment and injected
(implanted) into recipient animals. Alginate-poly-L-
lysine microencapsulation, permselective membrane
encapsulation and diffusion chambers are a means to entrap
transfected mammalian cells or primary mammalian cells.
These types of non-immunogenic "encapsulations" permit the
diffusion of proteins and other macromolecules secreted or
released by the captured cells to the recipient animal.
Most importantly, the capsules mask and shield the
foreign, embedded cells from the recipient animal's immune
response. Such encapsulations can extend the life of the
injected cells from a few hours or days (naked cells) to
several weeks (embedded cells). Alginate threads provide
a simple and quick means for generating embedded cells.
The materials needed to generate the alginate
threads are known in the art. In an exemplary procedure,
3$ alginate is prepared in sterile H20, and sterile
filtered. Just prior to preparation of alginate threads,
the alginate solution is again filtered. An approximately
50$ cell suspension (containing about 5 x 105 to about 5 x
10~ cells/ml) is mixed with the 3~ alginate solution. One
ml of the alginate/cell suspension is extruded into a 100
mM sterile filtered CaCl2 solution over a time period of
~15 min, forming a "thread". The extruded thread is then
transferred into a solution of 50 mM CaCl2, and then into
a solution of 25 mM CaCl2. The thread is then rinsed with
deionized water before coating the thread by incubating in
a 0.01 solution of poly-L-lysine. Finally, the thread is
rinsed with Lactated Ringer's Solution and drawn from
solution into a syringe barrel (without needle). A large
bore needle is then attached to the syringe, and the
thread is intraperitoneally injected into a recipient in a
minimal volume of the Lactated Ringer's Solution.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
An alternative in vivo approach for assaying
proteins of the present invention involves viral delivery
systems. Exemplary viruses for this purpose include
adenovirus, herpesvirus, retroviruses, vaccinia virus, and
5 adeno-associated virus (AAV). Adenovirus, a double-
stranded DNA virus, is currently the best studied gene
transfer vector for delivery of heterologous nucleic acid
(for review, see T.C. Becker et al., Meth. Cell Biol.
43:161-89, 1999; and J.T. Douglas and D.T. Curiel, Science
10 & Medicine 4:44-53, 1997). The adenovirus system offers
several advantages: (i) adenovirus can accommodate
relatively large DNA inserts; (ii) can be grown to high-
titer; (iii) infect a broad range of mammalian cell types;
and (iv) can be used with many different promoters
15 including ubiquitous, tissue specific, and regulatable
promoters. Also, because adenoviruses are stable in the
bloodstream, they can be administered by intravenous
injection.
Using adenovirus vectors where portions of the
20 adenovirus genome are deleted, inserts are incorporated
into the viral DNA by direct ligation or by homologous
recombination with a co-transfected plasmid. In an
exemplary system, the essential El gene has been deleted
from the viral vector, and the virus will not replicate
25 unless the E1 gene is provided by the host cell (the human
293 cell line is exemplary). When intravenously
administered to intact animals, adenovirus primarily
targets the liver. If the adenoviral delivery system has
an El gene deletion, the virus cannot replicate in the
30 host cells. However, the host's tissue (e. g., liver) will
express and process (and, if a secretory signal sequence
is present, secrete) the heterologous protein. Secreted
proteins will enter the circulation in the highly
CA 02331253 2000-12-18
WO 99/6b040
PCT/US99/11337
61
vascularized liver, and effects on the infected animal can
be determined.
Moreover, adenoviral vectors containing various
deletions of viral genes can be used in an attempt to
reduce or eliminate immune responses to the vector . Such
adenoviruses are E1 deleted, and in addition contain
deletions of E2A or E4 (Lusky, M. et al., J. Virol.
72:2022-2032, 1998; Raper, S.E. et al., Human Gene Thera
9:671-679, 1998). In addition, deletion of E2b is
reported to reduce immune responses (Amalfitano, A. et
al., J. Virol. 72:926-933, 1998). Moreover, by deleting
the entire adenovirus genome, very large inserts of
heterologous DNA can be accommodated. Generation of so
called "gutless" adenoviruses where all viral genes are
deleted are particularly advantageous for insertion of
large inserts of heterologous DNA. For review, see Yeh,
P. and Perricaudet, M., FASEB J. 11:615-623, 1997.
The adenovirus system can also be used for
protein production in vitro. By culturing adenovirus
infected non-293 cells under conditions where the cells
are not rapidly dividing, the cells can produce proteins
for extended periods of time. For instance, BHK cells are
grown to confluence in cell factories, then exposed to the
adenoviral vector encoding the secreted protein of
interest. The cells are then grown under serum-free
conditions, which allows infected cells to survive for
several weeks without significant cell division.
Alternatively, adenovirus vector infected 293 cells can be
grown as adherent cells or in suspension culture at
relatively high cell density to produce significant
amounts of protein (See Gamier et al., Cytotechnol.
15:145-55, 1994). With either protocol, an expressed,
secreted heterologous protein can be repeatedly isolated
from the cell culture supernatant, lysate, or membrane
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
62
fractions depending on the disposition of the expressed
protein in the cell. Within the infected 293 cell
production protocol, non-secreted proteins may also be
effectively obtained.
As a ligand, the activity of zsig57 polypeptide
can be measured by a silicon-based biosensor
microphysiometer which measures the extracellular
acidification rate or proton excretion associated with
receptor binding and subsequent physiologic cellular
responses. An exemplary device is the CytosensorT""
Microphysiometer manufactured by Molecular Devices,
Sunnyvale, CA. A variety of cellular responses, such as
cell proliferation, ion transport, energy production,
inflammatory response, regulatory and receptor activation,
and the like, can be measured by this method. See, for
example, McConnell, H.M. et al., Science 257:1906-1912,
1992; Pitchford, S. et al., Meth. Enzymol. 228:84-108,
1997; Arimilli, S. et al., J. Immunol. Meth. 212:49-59,
1998; Van Liefde, I. et al., Eur. J. Pharmacol. 346:87-95,
1998. The microphysiometer can be used for assaying
adherent or non-adherent eukaryotic or prokaryotic cells.
By measuring extracellular acidification changes in cell
media over time, the microphysiometer directly measures
cellular responses to various stimuli, including zsig57
polypeptide, its agonists, or antagonists. Preferably,
the microphysiometer is used to measure responses of a
zsig57-responsive eukaryotic cell, compared to a control
eukaryotic cell that does not respond to zsig57
polypeptide. ZSIG57-responsive eukaryotic cells comprise
cells into which a receptor for zsig57 has been
transfected creating a cell that is responsive to zsig57;
or cells naturally responsive to zsig57 such as cells
derived from small intestine, PBLs, or bone marrow tissue.
Differences, measured by a change, for example, an
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
63
increase or diminution in extracellular acidification, in
the response of cells exposed to zsig57 polypeptide,
relative to a control not exposed to zsig57, are a direct
measurement of zsig57-modulated cellular responses.
Moreover, such zsig57-modulated responses can be assayed
under a variety of stimuli. Using the microphysiometer,
there is provided a method of identifying agonists of
zsig57 polypeptide, comprising providing cells responsive
to a zsig57 polypeptide, culturing a first portion of the
cells in the absence of a test compound, culturing a
second portion of the cells in the presence of a test
compound, and detecting a change, for example, an increase
or diminution, in a cellular response of the second
portion of the cells as compared to the first portion of
the cells. The change in cellular response is shown as a
measurable change extracellular acidification rate.
Moreover, culturing a third portion of the cells in the
presence of zsig57 polypeptide and the absence of a test
compound can be used as a positive control for the zsig57-
responsive cells, and as a control to compare the agonist
activity of a test compound with that of the zsig57
polypeptide. Moreover, using the microphysiometer, there
is provided a method of identifying antagonists of zsig57
polypeptide, comprising providing cells responsive to a
zsig57 polypeptide, culturing a first portion of the cells
in the presence of zsig57 and the absence of a test
compound, culturing a second portion of the cells in the
presence of zsig57 and the presence of a test compound,
and detecting a change, for example, an increase or a
diminution in a cellular response of the second portion of
the cells as compared to the first portion of the cells.
The change in cellular response is shown as a measurable
change extracellular acidification rate. Antagonists and
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
64
agonists, for zsig57 polypeptide, can be rapidly
identified using this method.
Moreover, zsig57 can be used to identify cells,
tissues, or cell lines which respond to a zsig57
stimulated pathway. The microphysiometer, described
above, can be used to rapidly identify ligand-responsive
cells, such as cells responsive to zsig57 of the present
invention. Cells can be cultured in the presence or
absence of zsig57 polypeptide. Those cells which elicit a
measurable change in extracellular acidification in the
presence of zsig57 are responsive to zsig57. Such cell
lines, can be used to identify antagonists and agonists of
zsig57 polypeptide as described above.
In view of the tissue distribution observed for
zsig57, agonists (including the natural ligand/ substrate/
cofactor/ etc.) and antagonists have enormous potential in
both in vitro and in vivo applications. Compounds
identified as zsig57 agonists are useful for stimulating
cell growth or signal transduction in vitro and in vivo.
For example, zsig57 and zsig57 agonist and antagonist
compounds are useful as components of defined cell culture
media, and can be used alone or in combination with other
cytokines and hormones to replace serum that is commonly
used in cell culture. Agonists are thus useful in
specifically promoting the growth and/or development of
cells in culture. Considering the high expression of
zsig57 in PBLs and bone marrow, zsig57 polypeptides and
zsig57 agonists are useful as research reagents, for the
growth of many cell types, including T-cells, B-cells, and
other cells of the lymphoid and myeloid lineages and
hematopoetic lineages. As such, zsig57 polypeptide can be
provided as a supplement in cell culture medium.
Antagonists are also useful as research reagents
for characterizing sites of ligand-receptor interaction.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
Inhibitors of zsig57 activity (zsig57 antagonists) include
anti-zsig57 antibodies and soluble proteins which bind
zsig57 polypeptide, as well as other peptidic and non-
peptidic agents (including ribozymes).
5 Zsig57 can be used to identify inhibitors
(antagonists) of its activity. Test compounds are added
to the assays disclosed herein to identify compounds that
inhibit the activity of zsig57. In addition to those
assays disclosed herein, samples can be tested for
10 inhibition of zsig57 activity within a variety of assays
designed to measure receptor binding or the
stimulation/inhibition of zsig57-dependent cellular
responses. For example, zsig57-responsive cell lines can
be transfected with a reporter gene construct that is
15 responsive to a zsig57-stimulated cellular pathway.
Reporter gene constructs of this type are known in the
art, and will generally comprise a zsig57-DNA response
element operably linked to a gene encoding an assay
detectable protein, such as luciferase. DNA response
20 elements can include, but are not limited to, cyclic AMP
response elements (CRE), hormone response elements (HRE)
insulin response element (IRE) (Nasrin et al., Proc. Natl.
Acad. Sci. USA 87:5273-7, 1990) and serum response
elements (SRE) (Shaw et al. Cell 56: 563-72, 1989).
25 Cyclic AMP response elements are reviewed in Roestler et
al., J. Biol. Chem. 263 (19):9063-6; 1988 and Habener,
Molec. Endocrinol. 4 (8):1087-94; 1990. Hormone response
elements are reviewed in Beato, Cell _55:335-44; 1989.
Candidate compounds, solutions, mixtures or extracts are
30 tested for the ability to inhibit the activity of zsig57
on the target cells as evidenced by a decrease in zsig57
stimulation of reporter gene expression. Assays of this
type will detect compounds that directly block zsig57
binding to cell-surface receptors, as well as compounds
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
66
that block processes in the cellular pathway subsequent to
receptor-ligand binding. In the alternative, compounds or
other samples can be tested for direct blocking of zsig57
binding to receptor using zsig57 tagged with a detectable
label (e. g., 125I, biotin, horseradish peroxidase, FITC,
and the like). Within assays of this type, the ability of
a test sample to inhibit the binding of labeled zsig57 to
the receptor is indicative of inhibitory activity, which
can be confirmed through secondary assays. Receptors used
within binding assays may be cellular receptors or
isolated, immobilized receptors.
Moreover, zsig57 activity may be exerted when
bound to when bound to another polypeptide or protein in a
complex. Zsig57 can be used to identify proteins to which
it binds as disclosed herein. Moreover, inhibitors
(antagonists) of these zsig57 complexes can be identified
as described above.
A zsig57 polypeptide can be expressed as a
fusion with an immunoglobulin heavy chain constant region,
typically an Fc fragment, which contains two constant
region domains and lacks the variable region. Methods for
preparing such fusions are disclosed in U.S. Patents Nos.
5,155,027 and 5,567,584. Such fusions are typically
secreted as multimeric molecules wherein the Fc portions
are disulfide bonded to each other and two non-Ig
polypeptides are arrayed in closed proximity to each
other. Fusions of this type can be used to affinity
purify ligand, as an in vitro assay tool, or zsig57
antagonist. For use in assays, the chimeras are bound
to a support via the Fc region and used in an ELISA
format.
A zsig57 polypeptide can also be used for
purification of ligand or polypeptides to which it binds.
The zsig57 polypeptide is immobilized on a solid support,
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
67
such as. beads of agarose, cross-linked agarose, glass,
cellulosic resins, silica-based resins, polystyrene,
cross-linked polyacrylamide, or like materials that are
stable under the conditions of use. Methods for linking
polypeptides to solid supports are known in the art, and
include amine chemistry, cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, and hydrazide activation. The
resulting medium will generally be configured in the form
of a column, and fluids containing ligand are passed
through the column one or more times to allow ligand to
bind to the receptor zsig57 polypeptide. The ligand is
then eluted using changes in salt concentration,
chaotropic agents (guanidine HC1), or pH to disrupt
ligand-receptor binding.
An assay system that uses a ligand-binding
receptor (or an antibody, one member of a complement/
anti-complement pair) or a binding fragment thereof, and a
commercially available biosensor instrument (BIAcore,
Pharmacia Biosensor, Piscataway, NJ) can be advantageously
employed. Such receptor, antibody, member of a
complement/anti-complement pair or fragment is immobilized
onto the surface of a receptor chip. Use of this
instrument is disclosed by Karlsson, J. Immunol. Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or
fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold
film within the flow cell. A test sample is passed
through the cell. If a ligand, epitope, or opposite
member of the complement/anti-complement pair is present
in the sample, it will bind to the immobilized receptor,
antibody or member, respectively, causing a change in the
refractive index of the medium, which is detected as a
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
68
change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates,
from which binding affinity can be calculated, and
assessment of stoichiometry of binding.
Ligand-binding receptor polypeptides can also be
used within other assay systems known in the art. Such
systems include Scatchard analysis for determination of
binding affinity (see Scatchard, Ann. NY Acad. Sci. _51:
660-72, 1949) and calorimetric assays (Cunningham et al.,
Science 253:545-48, 1991; Cunningham et al., Science
245:821-25, 1991).
Zsig57 polypeptides can also be used to prepare
antibodies that bind to zsig57 epitopes, peptides or
polypeptides. The zsig57 polypeptide or a fragment thereof
serves as an antigen (immunogen) to inoculate an animal
and elicit an immune response. One of skill in the art
would recognize that antigenic, epitope-bearing
polypeptides contain a sequence of at least 6, preferably
at least 9, and more preferably at least 15 to about 30
contiguous amino acid residues of a zsig57 polypeptide
(e. g., SEQ ID N0:2). Polypeptides comprising a larger
portion of a zsig57 polypeptide, i.e., from 30 to 10
residues up to the entire length of the amino acid
sequence are included. Antigens or immunogenic epitopes
can also include attached tags, adjuvants and carriers, as
described herein. Suitable antigens include the zsig57
polypeptide encoded by SEQ ID N0:2 from amino acid number
16 (Gln) to amino acid number 199 (Gln), or a contiguous 9
to 199 AA amino acid fragment thereof. Other suitable
antigens include the Ig-variable domain, Ig-variable
domain with additional amino acids up to acidic cleavage
sites, cytoplasmic stub, and other domains of zsig57,
described herein. Preferred peptides to use as antigens
are hydrophilic peptides such as those predicted by one of
CA 02331253 2000-12-18
WO 99/66040 PC'f/US99/11337
69
skill in the art from a hydrophobicity plot (See Figure
2). Zsig57 hydrophilic peptides include peptides
comprising amino acid sequences selected from the group
consisting of: (1) amino acid number 96 (Glu) to amino
acid number 101 (Glu) of SEQ ID N0:2; (2) amino acid
number 124 (Pro) to amino acid number 129 (Glu) of SEQ ID
N0:2; (3) amino acid number 125 (Pro) to amino acid number
130 (Glu) of SEQ ID N0:2; (9) amino acid number 185 (Arg)
to amino acid number 190 (Glu) of SEQ ID N0:2; and (5)
amino acid number 186 (Lys) to amino acid number 191 (Ser)
of SEQ ID N0:2. Antibodies from an immune response
generated by inoculation of an animal with these antigens
can be isolated and purified as described herein. Methods
for preparing and isolating polyclonal and monoclonal
antibodies are well known in the art. See, for example,
Current Protocols in Immunology, Cooligan, et al. (eds.),
National Institutes of Health, John Wiley and Sons, Inc.,
1995; Sambrook et al., Molecular Cloning: A Laboratory
Manual, Second Edition, Cold Spring Harbor, NY, 1989; and
Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies-
Techniques and Applications, CRC Press, Inc., Boca Raton,
FL, 1982 .
As would be evident to one of ordinary skill in
the art, polyclonal antibodies can be generated from
inoculating a variety of warm-blooded animals such as
horses, cows, goats, sheep, dogs, chickens, rabbits, mice,
and rats with a zsig57 polypeptide or a fragment thereof .
The immunogenicity of a zsig57 polypeptide can be
increased through the use of an adjuvant, such as alum
(aluminum hydroxide) or Freund's complete or incomplete
adjuvant. Polypeptides useful for immunization also
include fusion polypeptides, such as fusions of zsig57 or
a portion thereof with an immunoglobulin polypeptide or
with maltose binding protein. The polypeptide immunogen
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
can be a full-length molecule or a portion thereof. If
the polypeptide portion is "hapten-like", such portion can
be advantageously joined or linked to a macromolecular
carrier (such as keyhole limpet hemocyanin (KLH), bovine
5 serum albumin (BSA) or tetanus toxoid) for immunization.
As used herein, the term "antibodies" includes
polyclonal antibodies, affinity-purified polyclonal
antibodies, monoclonal antibodies, and antigen-binding
fragments, such as F(ab')2 and Fab proteolytic fragments.
10 Genetically engineered intact antibodies or fragments,
such as chimeric antibodies, Fv fragments, single chain
antibodies and the like, as well as synthetic antigen-
binding peptides and polypeptides, are also included.
Non-human antibodies can be humanized by grafting non-
15 human CDRs onto human framework and constant regions, or
by incorporating the entire non-human variable domains
(optionally "cloaking" them with a human-like surface by
replacement of exposed residues, wherein the result is a
"veneered" antibody). In some instances, humanized
20 antibodies can retain non-human residues within the human
variable region framework domains to enhance proper
binding characteristics. Through humanizing antibodies,
biological half-life can be increased, and the potential
for adverse immune reactions upon administration to humans
25 is reduced.
Alternative techniques for generating or
selecting antibodies useful herein include in vitro
exposure of lymphocytes to zsig57 protein or peptide, and
selection of antibody display libraries in phage or
30 similar vectors (for instance, through use of immobilized
or labeled zsig57 protein or peptide). Genes encoding
polypeptides having potential zsig57 polypeptide binding
domains can be obtained by screening random peptide
libraries displayed on phage (phage display) or on
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
71
bacteria., such as E. coli. Nucleotide sequences encoding
the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. These random peptide display libraries can be
used to screen for peptides which interact with a known
target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al., US
Patent N0. 5,223,409; Ladner et al., US Patent N0.
4,946,778; Ladner et al., US Patent NO. 5,903,489 and
Ladner et al., US Patent NO. 5,571,698) and random peptide
display libraries and kits for screening such libraries
are available commercially, for instance from Clontech
(Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New
England Biolabs, Inc. (Beverly, MA) and Pharmacia LKB
Biotechnology Inc. (Piscataway, NJ). Random peptide
display libraries can be screened using the zsig57
sequences disclosed herein to identify proteins which bind
to zsig57. These "binding proteins" which interact with
zsig57 polypeptides can be used for tagging cells; for
isolating homolog polypeptides by affinity purification;
they can be directly or indirectly conjugated to drugs,
toxins, radionuclides and the like. These binding
proteins can also be used in analytical methods such as
for screening expression libraries and neutralizing
activity. The binding proteins can also be used for
diagnostic assays for determining circulating levels of
polypeptides; for detecting or quantitating soluble
polypeptides as marker of underlying pathology or disease.
These binding proteins can also act as zsig57
"antagonists" to block zsig57 binding and signal
transduction in vitro and in vivo.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
72
Moreover, human antibodies can be produced in
transgenic, non-human animals that have been engineered to
contain human immunoglobulin genes as disclosed in WIPO
Publication WO 98/24893. It is preferred that the
endogenous immunoglobulin genes in these animals be
inactivated or eliminated, such as by homologous
recombination.
Antibodies are considered to be specifically
binding if: 1) they exhibit a threshold level of binding
activity, and 2) they do not significantly cross-react
with related polypeptide molecules. A threshold level of
binding is determined if anti-zsig57 antibodies herein
bind to a zsig57 polypeptide, peptide or epitope with an
affinity at least 10-fold greater than the binding
affinity to control (non-zsig57) polypeptide. It is
preferred that the antibodies exhibit a binding affinity
(Ka) of 106 M 1 or greater, preferably 107 M 1 or greater,
more preferably 108 M 1 or greater, and most preferably
109 M 1 or greater. The binding affinity of an antibody
can be readily determined by one of ordinary skill in the
art, for example, by Scatchard analysis (Scatchard, G.,
Ann. NY Acad. Sci. 51: 660-672, 1949).
Whether anti-zsig57 antibodies do not
significantly cross-react with related polypeptide
molecules is shown, for example, by the antibody detecting
zsig57 polypeptide but not known related polypeptides
using a standard Western blot analysis (Ausubel et al.,
ibid.). Examples of known related polypeptides are those
disclosed in the prior art, such as known orthologs, and
paralogs, and similar known members of a protein family,
(e. g. CMRF35 and SC). Screening can also be done using
non-human zsig57, and zsig57 mutant polypeptides.
Moreover, antibodies can be "screened against" known
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
73
related . polypeptides, to isolate a population that
specifically binds to the zsig57 polypeptides. For
example, antibodies raised to zsig57 are adsorbed to
related polypeptides adhered to insoluble matrix;
antibodies specific to zsig57 will flow through the matrix
under the proper buffer conditions. Screening allows
isolation of polyclonal and monoclonal antibodies non-
crossreactive to known closely related polypeptides
(Antibodies: A Laboratory Manual, Harlow and Lane (eds.),
Cold Spring Harbor Laboratory Press, 1988; Current
Protocols in Immunology, Cooligan, et al. (eds.), National
Institutes of Health, John Wiley and Sons, Inc., 1995).
Screening and isolation of specific antibodies is well
known in the art. See, Fundamental Immunology, Paul
(eds.), Raven Press, 1993; Getzoff et al., Adv. in
Immuno.I. 43: 1-98, 1988; Monoclonal Antibodies:
Principles and Practice, Goding, J.W. (eds.), Academic
Press Ltd., 1996; Benjamin et al., Ann. Rev. Immunol. 2:
67-101, 1984. Specifically binding anti-zsig57 antibodies
can be detected by a number of methods in the art, and
disclosed below.
A variety of assays known to those skilled in
the art can be utilized to detect antibodies which
specifically bind to zsig57 proteins or polypeptides.
Exemplary assays are described in detail in Antibodies: A
Laboratory Manual, Harlow and Lane (Eds.), Cold Spring
Harbor Laboratory Press, 1988. Representative examples of
such assays include: concurrent immunoelectrophoresis,
radioimmunoassay, radioimmuno-precipitation, enzyme-linked
immunosorbent assay (ELISA), dot blot or Western blot
assay, inhibition or competition assay, and sandwich
assay. In addition, antibodies can be screened for
binding to wild-type versus mutant zsig57 protein or
polypeptide.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
74
Antibodies to zsig57 can be used for tagging
cells that express zsig57; for isolating zsig57 by
affinity purification; for diagnostic assays for
determining circulating levels ozsig57 polypeptides; for
detecting or quantitating soluble zsig57 polypeptides as
marker of underlying pathology or disease. These binding
polypeptides can also act as zsig57 "antagonists" to block
zsig57 binding and signal transduction in vitro and in
vivo. These anti-zsig57 binding polypeptides would be
useful for inhibiting zsig57 activity or protein-binding.
Antibodies to zsig57 may be used for tagging
cells that express zsig57; for isolating zsig57 by
affinity purification; for diagnostic assays for
determining circulating levels of zsig57 polypeptides; for
detecting or quantitating soluble zsig57 as marker of
underlying pathology or disease; in analytical methods
employing FACS; for screening expression libraries; for
generating anti-idiotypic antibodies; and as neutralizing
antibodies or as antagonists to block zsig57 activity in
vitro and in vivo. Suitable direct tags or labels include
radionuclides, enzymes, substrates, cofactors, inhibitors,
fluorescent markers, chemiluminescent markers, magnetic
particles and the like; indirect tags or labels may
feature use of biotin-avidin or other complement/anti-
complement pairs as intermediates. Antibodies herein can
also be directly or indirectly conjugated to drugs,
toxins, radionuclides and the like, and these conjugates
used for in vivo diagnostic or therapeutic applications.
Moreover, antibodies to zsig57 or fragments thereof can be
used in vitro to detect denatured zsig57 or fragments
thereof in assays, for example, Western Blots or other
assays known in the art.
Antibodies, binding proteins or polypeptides
herein can also be directly or indirectly conjugated to
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
drugs, toxins, radionuclides and the like, and these
conjugates used for in vivo diagnostic or therapeutic
applications. For instance, polypeptides or antibodies of
the present invention can be used to identify or treat
5 tissues or organs that express a corresponding anti-
complementary molecule (receptor or antigen, respectively,
for instance). More specifically, zsig57 polypeptides or
anti-zsig57 antibodies, or bioactive fragments or portions
thereof, can be coupled to detectable or cytotoxic
10 molecules and delivered to a mammal having cells, tissues
or organs that express the anti-complementary molecule.
Suitable detectable molecules can be directly or
indirectly attached to the polypeptide or antibody, and
include radionuclides, enzymes, substrates, cofactors,
15 inhibitors, fluorescent markers, chemiluminescent markers,
magnetic particles and the like. Suitable cytotoxic
molecules can be directly or indirectly attached to the
polypeptide or antibody, and include bacterial or plant
toxins (for instance, diphtheria toxin, Pseudomonas
20 exotoxin, ricin, abrin and the like), as well as
therapeutic radionuclides, such as iodine-131, rhenium-188
or yttrium-90 (either directly attached to the polypeptide
or antibody, or indirectly attached through means of a
chelating moiety, for instance). Polypeptides or
25 antibodies can also be conjugated to cytotoxic drugs, such
as adriamycin. Fox indirect attachment of a detectable or
cytotoxic molecule, the detectable or cytotoxic molecule
can be conjugated with a member of a complementary/
anticomplementary pair, where the other member is bound to
30 the polypeptide or antibody portion. For these purposes,
biotin/streptavidin is an exemplary complementary/
anticomplementary pair.
In another embodiment, polypeptide-toxin fusion
proteins or antibody-toxin fusion proteins can be used for
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
76
targeted cell or tissue inhibition or ablation (for
instance, to treat cancer cells or tissues).
Alternatively, if the polypeptide has multiple functional
domains (i.e., an activation domain or a ligand binding
domain, plus a targeting domain), a fusion protein
including only the targeting domain may be suitable for
directing a detectable molecule, a cytotoxic molecule or a
complementary molecule to a cell or tissue type of
interest. In instances where the domain only fusion
protein includes a complementary molecule, the anti-
complementary molecule can be conjugated to a detectable
or cytotoxic molecule. Such domain-complementary molecule
fusion proteins thus represent a generic targeting vehicle
for cell/tissue-specific delivery of generic anti-
complementary-detectable/ cytotoxic molecule conjugates.
In another embodiment, zsig57-cytokine fusion
proteins or antibody-cytokine fusion proteins can be used
for enhancing in vivo killing of target tissues (for
example, intestinal, lymphoid, blood and bone marrow
cancers), if the zsig57 polypeptide or anti-zsig57
antibody targets, for example, the hyperproliferative
blood or bone marrow cell (See, generally, Hornick et al.,
Blood 89:4437-47, 1997). They described fusion proteins
enable targeting of a cytokine to a desired site of
action, thereby providing an elevated local concentration
of cytokine. Suitable zsig57 polypeptides or anti-zsig57
antibodies target an undesirable cell or tissue (i.e., a
tumor or a leukemia), and the fused cytokine mediated
improved target cell lysis by effector cells. Suitable
cytokines for this purpose include interleukin 2 and
granulocyte-macrophage colony-stimulating factor (GM-CSF),
for instance.
In yet another embodiment, if the zsig57
polypeptide or anti-zsig57 antibody targets vascular cells
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
77
or tissues, such polypeptide or antibody can be conjugated
with a radionuclide, and particularly with a beta-emitting
radionuclide, to reduce restenosis. Such therapeutic
approach poses less danger to clinicians who administer
the radioactive therapy. For instance, iridium-192
impregnated ribbons placed into stented vessels of
patients until the required radiation dose was delivered
showed decreased tissue growth in the vessel and greater
luminal diameter than the control group, which received
ZO placebo ribbons. Further, revascularisation and stmt
thrombosis were significantly lower in the treatment
group. Similar results are predicted with targeting of a
bioactive conjugate containing a radionuclide, as
described herein.
The bioactive polypeptide or antibody conjugates
described herein can be delivered intravenously,
intraarterially or intraductally, or can be introduced
locally at the intended site of action.
Molecules of the present invention can be used
to identify and isolate receptors to which zsig57
interacts or binds. For example, proteins and peptides of
the present invention can be immobilized on a column and
membrane preparations run over the column (Immobilized
Affinity Ligand Techniques, Hermanson et al., eds.,
Academic Press, San Diego, CA, 1992, pp.195-202).
Proteins and peptides can also be radiolabeled (Methods in
Enzymol., vol. 182, "Guide to Protein Purification", M.
Deutscher, ed., Acad. Press, San Diego, 1990, 721-37) or
photoaffinity labeled (Brunner et al., Ann. Rev. Biochem.
62:483-514, 1993 and Fedan et al., Biochem. Pharmacol.
33:1167-80, 1984) and specific cell-surface proteins can
be identified.
The polypeptides, nucleic acid and/or antibodies
of the present invention can be used in treatment of
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
78
disorders associated with the immune system,
gastrointestinal system, heart, inflammation, lymph
system, bone marrow, blood and bones. The molecules of
w the present invention may used to modulate ox to treat or
prevent development of pathological conditions in such
diverse tissue as small intestine and bone marrow. In
particular, certain syndromes or diseases can be amenable
to such diagnosis, treatment or prevention.
In addition, polypeptides of the present
invention can be used fox their ability to modify
inflammation. Methods to assess proinflammatory or
antiinflammatory qualities of zsig57 are known in the art.
For example, suppression of cAMP production is an
indication of anti-inflammatory effects of the pIgR
secretory component (SC) (Nihei, Y., et al., Arch.
Dermatol. Res., 287:546-552, 1995). Free SC component of
the poly-IgR suppressed cAMP and inhibited ICAM and HLA-Dr
induced by IFN-y in keratinocytes. Moreover, free SC has
been reported to inhibit P1A2 and is believed to act via
the arachadonic acid antiinflammatory cascade. Zsig57,
likewise can exhibit similar anti-inflammatory effects,
and may exert these effects in tissues in which it is
expressed. For example, zsig57 is expressed in the small
intestine, and can be useful in treatment of inflammatory
bowel disease, diverticulitis, inflammation during and
after intestinal surgery, and the like. In addition,
zsig57, expressed in PBLs and bone marrow, can have other
antiinflammatory actions in heart, pelvic inflammatory
disease, (PID), psoriasis, arthritis, and other
inflammatory diseases.
As such, zsig57 polypeptide, or its antagonists,
have potential uses in inflammatory diseases such as
asthma and arthritis. For example, if zsig57 is
proinflammatory antagonists would be valuable in asthma
CA 02331253 2000-12-18
WO 99/66040 PC'T/US99/11337
79
therapy. or other anti-inflammatory therapies where
migration of lymphocytes is damaging. Alternatively,
zsig57 can have an inhibitory or competitive effect on
inflammatory agents and may serve directly as an asthma
therapeutic or anti-inflammatory. In addition, zsig57 can
serve other important roles in lung function, for
instance, bronchodilation, tissue elasticity, recruitment
of lymphocytes in lung infection and damage. Assays to
assess the activity of zsig57 in lung cells are discussed
in Laberge, S. et al., Am. J. Respir. Cell Mol. Biol.
17:193-202, 1997 Rumsaeng, V. et al., J. Immunol.,
159:2904-2910, 1997; and Schluesener, H.J. et al., J.
Neurosci. Res. 44:606-611, 1996. Methods to determine
proinflammatory and antiinflammatory qualities of zsig57
or its antagonists are known in the art. Moreover, other
molecular biological, immunological, and biochemical
techniques known in the art and disclosed herein can be
used to determine zsig57 activity and to isolate agonists
and antagonists.
Moreover, based on high expression in PBLs,
zsig57 may exhibit antiviral functions by inhibiting viral
replication by specific signaling via it's receptors) on
a host cell (e. g. T-cell). Zsig57 may exhibit immune cell
proliferative activity, as disclosed herein, and may
stimulate the immune system to fight viral infections.
Moreover, zsig57 may bind CD4 or another lymphocyte
receptor and exhibit antiviral effects, for example,
against human immunodeficiency virus (HIV) or human T-cell
lymphotropic virus (HTLV). Alternatively, zsig57
polypeptide may compete for a viral receptor or co-
receptor to block viral infection. Zsig57 may be given
parentally to prevent viral infection or to reduce ongoing
viral replication and re-infection (Gayowski, T. et al.,
Transplantation 64:422-426, 1997). Thus, zsig57 may be
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
used as. an antiviral therapeutic, for example, for viral
leukemias (HTLV), AIDS (HIV), or gastrointestinal viral
infections caused by, for example, rotavirus, calicivirus
(e. g., Norwalk Agent) and certain strains of pathogenic
5 adenovirus.
The molecules of the present invention can be
useful for proliferation of cardiac tissue cells, such as
cardiac myocytes or myoblasts; skeletal myocytes or
myoblasts and smooth muscle cells; chrondrocytes;
10 endothelial cells; adipocytes and osteoblasts in vitro.
For example, molecules of the present invention are useful
as components of defined cell culture media, and can be
used alone or in combination with other cytokines and
hormones to replace serum that is commonly used in cell
15 culture. Molecules of the present invention are
particularly useful in specifically promoting the growth
and/or development of myocytes in culture, and may also
prove useful in the study of cardiac myocyte hyperplasia
and regeneration.
20 The polypeptides, nucleic acids and/or
antibodies of the present invention can be used in
treatment of disorders associated with myocardial
infarction, congestive heart failure, hypertrophic
cardiomyopathy and dilated cardiomyopathy. Molecules of
25 the present invention may also be useful for limiting
infarct size following a heart attack, aiding in recovery
after heart transplantation, promoting angiogenesis and
wound healing following angioplasty or endarterectomy, to
develop coronary collateral circulation, for
30 revascularization in the eye, for complications related to
poor circulation such as diabetic foot ulcers, for stroke,
following coronary reperfusion using pharmacologic
methods, and other indications where angiogenesis is of
benefit. Molecules of the present invention may be useful
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
81
for improving cardiac function, either by inducing cardiac
myocyte neogenesis and/or hyperplasia, by inducing
coronary collateral development, or by inducing remodeling
of necrotic myocardial area. Other therapeutic uses for
the present invention include induction of skeletal muscle
neogenesis and/or hyperplasia, kidney regeneration and/or
for treatment of systemic and pulmonary hypertension.
Zsig57 induced coronary collateral development
is measured in rabbits, dogs or pigs using models of
chronic coronary occlusion (Landau et al., Amer. Heart J.
29:929-931, 1995; Sellke et al., Surgery 120(2):182-188,
1996; and Lazarous et al., 1996, ibid.) Zsig57 efficacy
for treating stroke is tested in vivo in rats, utilizing
bilateral carotid artery occlusion and measuring
histological changes, as well as maze performance (Gage et
al., Neurobiol. Aging 9:695-655, 1988). Zsig57 efficacy
in hypertension is tested in vivo utilizing spontaneously
hypertensive rats (SHR) for systemic hypertension (Marche
et al., Clin. Exp. Pharmacol. Physiol. Suppl. 1:S119-116,
1995).
The zsig57 polypeptide is expressed in the small
intestine. Thus, zsig57 polypeptide pharmaceutical
compositions of the present invention can also be useful
in prevention or treatment of digestive disorders in the
GI tract, such as disorders associated with pathological
secretory cell expansion or differentiation. Assays and
animal models are known in the art for monitoring such
expansion or differentiation and for evaluating zsig57
polypeptide, fragment, fusion protein, antibody, agonist
or antagonist in the prevention or treatment thereof.
Moreover, trefoil factors in the intestine are
known to be involved in mucosal stabilization in the gut
and repair processes associated with acute injury,
particularly epithelial restitution (Poulsom, R., Bail.
CA 02331253 2000-12-18
WO 99/66040 PCT/lJS99/11337
82
Clin. Gastro., 10; 113-134, 1996; Sands, B.E., and
Podolsky, D.K., Annu. Rev. Physiol., 58; 253-273, 1996.
Also, trefoil proteins appear to have a role in healing
wounds caused by intestinal inflammatory diseases, and
resisting microbial invasion via mucosal secretion
involvement (Palut, A.G., New Eng. J. Med., 336; 5-6-507,
1997; Playford, R.J., J. Royal Coll. Phys. London, _31; 37-
41, 1997) Epidermal growth factor (EGF) receptor ligands
may play a role in enhancing trefoil activity in the gut;
however, repair of mucosal injury is not dependent in the
main endogenous EGF receptor ligand in the gut, TNF-a,
suggesting a role of other undiscovered ligands (Cook,
G.A., et al., Am. Physiol. Soc., 61540-61549, 1997). For
example, the zsig57 polypeptides can serve as such ligand,
regulatory protein or other factor in the trefoil pathway,
and hence play an important therapeutic role in diseases
and injury associated with the gut and mucosal epithelium.
Also, zsig57 polypeptide is expressed in the
bone marrow and PBLs and can exert its effects in the
vital organs of the body. Activity of zsig57 expressed in
PBLs and bone marrow be independent of gastrointestinal
function. Thus, zsig57 polypeptide pharmaceutical
compositions of the present invention can be useful in
prevention or treatment of pancreatic disorders associated
with pathological regulation of the expansion of
neuroendocrine and exocrine cells in the pancreas, such as
IDDM, pancreatic cancer, pathological regulation of blood
glucose levels, insulin resistance or digestive function.
The zsig57 polypeptide of the present invention
may act in the neuroendocrine/exocrine cell fate decision
pathway and is therefore capable of regulating the
expansion of neuroendocrine and exocrine cells in the
pancreas. One such regulatory use is that of islet cell
regeneration. Also, it has been hypothesized that the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
83
autoimmunity that triggers IDDM starts in utero, and
zsig57 polypeptide is a developmental gene involved in
cell partitioning. Assays and animal models are known in
the art for monitoring the exocrine/neuroendocrine cell
lineage decision, for observing pancreatic cell balance
and for evaluating zsig57 polypeptide, fragment, fusion
protein, antibody, agonist or antagonist in the prevention
or treatment of the conditions set forth above.
Polynucleotides encoding zsig57 polypeptides are
useful within gene therapy applications where it is
desired to increase or inhibit zsig57 activity. If a
mammal has a mutated or absent zsig57 gene, the zsig57
gene can be introduced into the cells of the mammal. In
one embodiment, a gene encoding a zsig57 polypeptide is
introduced in vivo in a viral vector. Such vectors
include an attenuated or defective DNA virus, such as, but
not limited to, herpes simplex virus (HSV),
papillomavirus, Epstein Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), and the like. Defective
viruses, which entirely or almost entirely lack viral
genes, are preferred. A defective virus is not infective
after introduction into a cell. Use of defective viral
vectors allows for administration to cells in a specific,
localized area, without concern that virus will be
produced and the vector transferred to other cells via
infection. Examples of particular vectors include, but
are not limited to, a defective herpes simplex virus 1
(HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as
the,vector described by Stratford-Perricaudet et al., _J.
Clin. Invest. 90:626-30, 1992; and a defective adeno-
associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8,
1989) .
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
84
In another embodiment, a zsig57 gene can be
introduced in a retroviral vector, e.g., as described in
Anderson et al., U.S. Patent No. 5,399,396; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol. 62:1120, 1988; Temin et al.,
U.S. Patent No. 5,129,263; International Patent
Publication No. WO 95/07358, published March 16, 1995 by
Dougherty et al.; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection
in vivo using liposomes. Synthetic cationic lipids can be
used to prepare liposomes for in vivo transfection of a
gene encoding a marker (Felgner et al., Proc. Natl. Acad.
Sci. USA 89:7413-7, 1987; Mackey et al., Proc. Natl. Acad.
Sci. USA 85:8027-31, 1988). The use of lipofection to
introduce exogenous genes into specific organs in vivo has
certain practical advantages. Molecular targeting of
liposomes to specific cells represents one area of
benefit. More particularly, directing transfection to
particular cells represents one area of benefit. For
instance, directing transfection to particular cell types
would be particularly advantageous in a tissue with
cellular heterogeneity, such as the pancreas, liver,
kidney, and brain. Lipids can be chemically coupled to
other molecules for the purpose of targeting. Targeted
peptides (e. g., hormones or neurotransmitters), proteins
such as antibodies, or non-peptide molecules can be
coupled to liposomes chemically.
It is possible to remove the target cells from
the body; to introduce the vector as a naked DNA plasmid;
and then to re-implant the transformed cells into the
body. This method is particularly useful for bone marrow
and PBLs, in which zsig57 is normally expressed. Naked
DNA vectors for gene therapy can be introduced into the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
desired. host cells by methods known in the art, e.g.,
transfection, electroporation, microinjection,
transduction, cell fusion, DEAF dextran, calcium phosphate
precipitation, use of a gene gun or use of a DNA vector
5 transporter. See, e.g., Wu et al., J. Biol. Chem.
267:963-7, 1992; Wu et al., J. Biol. Chem. 263:14621-4,
1988.
Alternatively, zsig57 can be used as a receptor
for delivering gene therapy or other therapeutic molecules
10 to target cells and tissues. In acting as a transporter,
zsig57 can be used to deliver a polynucleotide encoding a
polypeptide, or alternatively, a chemotherapeutic agent,
to tissues in which it is expressed, for example bone
marrow or PBLs, or intestine. For example, a DNA carrier,
15 consisting of an Fab portion of an anti-zsig57 antibody
can be constructed to introduce a plasmid that contains a
cDNA encoding a functional polypeptide , e.g., a cDNA
encoding a polypeptide of therapeutic interest. The cDNA
encoding a functional polypeptide would generally be
20 selected to provide, upon expression within the cell, a
functional polypeptide where a defective or non-functional
polypeptide is present. Such an anti-zsig57 antibody,
upon binding to the zsig57 molecule on the cell surface
will be endocytosed or otherwise transported into the
25 cell, wherein the functional polypeptide is expressed
within the cell. See, e.g., Ferkol, T. et al., Am. Soc.
Clin. Invest. 95:493-502, 1995; Ferkol, T. et al., Gene
Therapy 3:669-678, 1996. Moreover, chemical moieties can
be cross-linked to anti-zsig57 antibodies for chemical
30 delivery to cells in the same manner and used, for
example, to deliver chemotherapeutic agents to tumor
cells. Coupling of chemicals to antibodies is well known
in the art and described herein. As such, this zsig57
therapy delivery system can be used in vivo or ex v.ivo as
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
86
described above (See, e.g., Wu et al., su ra). In
addition, tissues receptive to delivery of such zsig57-
mediated therapy include bone marrow, PBLs, and intestine,
and other tissues and cells in which zsig57 is normally
expressed, or where zsig57 is introduced by methods known
in the art.
Antisense methodology can be used to inhibit
zsig57 gene transcription, such as to inhibit cell
proliferation in vivo. Polynucleotides that are
complementary to a segment of a zsig57-encoding
polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID N0:1) are designed to bind to zsig57-encoding mRNA and
to inhibit translation of such mRNA. Such antisense
polynucleotides are used to inhibit expression of zsig57
polypeptide-encoding genes in cell culture or in a
subject.
The present invention also provide s reagents
which will find use in diagnostic applications. For
example, the zsig57 gene, a probe comprising zsig57 DNA or
RNA or a subsequence thereof can be used to determine if
the zsig57 gene is present on chromosome 6 or if a
mutation has occurred. Zsig57 is located at the 6p21.1-
p21.2 region of chromosome 6 (see, Example 3). Detectable
chromosomal aberrations at the zsig57 gene locus include,
but are not limited to, aneuploidy, gene copy number
changes, insertions, deletions, restriction site changes
and rearrangements. Such aberrations can be detected
using polynucleotides of the present invention by
employing molecular genetic techniques, such as
restriction fragment length polymorphism (RFLP) analysis,
short tandem repeat (STR) analysis employing PCR
techniques, and other genetic linkage analysis techniques
known in the art (Sambrook et al., ibid.; Ausubel et. al.,
ibid.; Marian, Chest 108:255-65, 1995).
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/I 1337
87
The precise knowledge of a gene's position can
be useful for a number of purposes, including: 1)
determining if a sequence is part of an existing contig
and obtaining additional surrounding genetic sequences in
various forms, such as YACs, BACs or cDNA clones; 2)
providing a possible candidate gene for an inheritable
disease which shows linkage to the same chromosomal
region; and 3) cross-referencing model organisms, such as
mouse, which can aid in determining what function a
particular gene might have.
The zsig57 gene is located within the major
histocompatability (MHC) locus, which encodes proteins
involved with antigen presentation to T-cells. Proteins
and polypeptides are processed and then complexed with MHC
molecules followed by transport to the cell surface for
presentation to T-cells. A number of accessory molecules
are encoded in the MHC locus that are essential for
antigen processing and presentation. For example, TAP
transporters and tapasin function to transport and
assemble peptides plus MHC respectively (Herberg, J.A., et
al., Eur. J. Immunol., 28:459-467, 1998). In a similar
manner, zsig57 polypeptide may be involved in antigen
presentation, as a chaparone, transporter, trafficking
element, or other processing and presentation function.
Antigen presentation can be measured in
standard assays known in the art: for example, antigen
presentation for cytotoxic T-cells, such as the chromium
release assay (Hosken, N.A., and Bevan, M.J., J. Exp. Med.
175:719-729, 1992); and proliferation and IL-2 production
by T-cells in response to antigen presenting cells
(Rudensky, A.Y., et al., Nature 353:660-662, 1991;
Roosnek, E., and Lanzavecchia, J. Exp. Med. 173:487-489,
1991 ) .
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
88
Mice engineered to express the zsig57 gene,
referred to as "transgenic mice," and mice that exhibit a
complete absence of zsig57 gene function, referred to as
"knackout mice," may also be generated (Snouwaert et al.,
Science 257:1083, 1992; Lowell et al., Nature 366:740-42,
1993; Capecchi, M.R., Science 249: 1288-1292, 1989;
Palmiter, R.D. et al. Annu Rev Genet. 20: 465-999, 1986) .
For example, transgenic mice that over-express zsig57,
either ubiquitously or under a tissue-specific or tissue-
restricted promoter can be used to ask whether over-
expression causes a phenotype. For example, over-
expression of a wild-type zsig57 polypeptide, polypeptide
fragment or a mutant thereof may alter normal cellular
processes, resulting in a phenotype that identifies a
tissue in which zsig57 expression is functionally relevant
and may indicate a therapeutic target fox the zsig57, its
agonists or antagonists. For example, a preferred
transgenic mause to engineer is one that over-expresses
the mature zsig57 polypeptide (approximately amino acids
18 (Ile) or residue 16 (Gln) to residue 199 (Gln) of SEQ
ID N0:2). Moreover, such over-expression may result in a
phenotype that shows similarity with human diseases.
Similarly, knockout zsig57 mice can be used to determine
where zsig57 is absolutely required in vivo. The
phenotype of knockout mice is predictive of the in vivo
effects of that a zsig57 antagonist, such as those
described herein, may have. The human zsig57 cDNA can be
used to isolate murine zsig57 mRNA, cDNA and genomic DNA,
which are subsequently used to generate knockout mice.
These mice may be employed to study the zsig57 gene and
the protein encoded thereby in an in vivo system, and can
be used as in vivo models for corresponding human
diseases. Moreover, transgenic mice expression of zsig57
antisense polynucleotides or ribozymes directed against
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
89
zsig57,, described herein, can be used analogously to
transgenic mice described above.
For pharmaceutical use, the proteins of the
present invention are formulated for parenteral,
particularly intravenous or subcutaneous, delivery
according to conventional methods. Intravenous
administration will be by bolus injection or infusion over
a typical period of one to several hours. In general,
pharmaceutical formulations will include a zsig57 protein
in combination with a pharmaceutically acceptable vehicle,
such as saline, buffered saline, 5$ dextrose in water or
the like. Formulations can further include one or more
excipients, preservatives, solubilizers, buffering agents,
albumin to prevent protein loss on vial surfaces, etc.
Methods of formulation are well known in the art and are
disclosed, for example, in Remington: The Science and
Practice of Pharmacy, Gennaro, ed., Mack Publishing Co.,
Easton, PA, 19th ed., 1995. Therapeutic doses will
generally be in the range of 0.1 to 100 ~,g/kg of patient
weight per day, preferably 0.5-20 mg/kg per day, with the
exact dose determined by the clinician according to
accepted standards, taking into account the nature and
severity of the condition to be treated, patient traits,
etc. Determination of dose is within the level of
ordinary skill in the art. The invention is further
illustrated by the following non-limiting examples.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
EXAMPLES
Example 1
- Identification of zsi 57
5 A. Using an EST Sequence to Obtain Full-length zsig57
Scanning of translated pancreas, liver, lung and
breast library DNA databases using a signal trap as a
query resulted in identification of an expressed sequence
tag (EST) sequence found to be homologous to a human
10 secretory signal sequence.
Confirmation of the EST sequence was made by
sequence analyses of the cDNA from which the EST
originated. This cDNA was contained in a plasmid, and was
sequenced using the following primers: ZC976 (SEQ ID
15 N0:4), ZC16,495 (SEQ ID N0:5), ZC 16,494 (SEQ ID N0:6),
and ZC 447 (SEQ ID N0:7). The clone appeared to be full
length.
Oligonucleotide primers were designed from the
sequence of the identified EST. The primers were used for
20 priming internally within the EST to identify tissues from
which a full-length clone could be isolated. To obtain a
full-length cDNA, a PCR amplification reaction was
performed on Marathon-ready cDNA (Clontech) from a variety
of tissues: Brain, Liver, placenta, monocytes, bone
25 marrow and spleen. A PCR reaction was run using
oligonucleotides ZC 16,174 (SEQ ID N0:8) and ZC 16,175
(SEQ ID N0:9) as primers. This PCR reaction was run as
follows : 1 cycle at 94°'.~ for 1 . 5 minutes; 35 cycles at 94°'
for 15 seconds, then 62°:' 20 seconds, then 72= for 30
30 seconds; followed by 72°:: for 10 minutes; then a 4°:: hold.
The resulting DNA products were electrophoresed
on a 1.5~ agarose gel, and an expected band at
approximately 200 by was seen in reactions using the bone
marrow, monocyte and spleen cDNA libraries as a template .
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
91
The DNA .band from the bone marrow sample was gel purified
using a commercially available kit (QiaexIITM; Qiagen) and
sequenced. Sequence analyses of the subclone confirmed
that the PCR product included the EST DNA sequence.
Example 2
Tissue Distribution
Northern blot analysis was performed using Human
Multiple Tissue Blots (MTN I, MTN II, and MTN III)
(Clontech). The 200 by PCR product from bone marrow,
described in Example 1, was purified using a commercially
available kit (QiaexIITM; Qiagen) and then radioactively
labeled with 32P-dCTP using Prime-It II, a random prime
labeling system (Stratagene Cloning Systems), according to
the manufacturer's specifications. The probe was then
purified using a Nuc-TrapTM column (Stratagene) according
to the manufacturer's instructions. ExpressHybTM
(Clontech) solution was used for prehybridization and as a
hybridizing solution for the Northern blots.
Hybridization took place overnight at 65' using 5 x 106
cpm/ml of labeled probe. The blots were then washed in 2X
SSC/lo SDS at 65° , followed by a wash in O.1X SSC/0.1°s
SDS
at 55°:. A transcript was detected at approximately 1.4 kb
in PBLs and bone marrow. A transcript was detected at
approximately 2 kb in small intestine. No signals were
apparent in other tissues represented on the blots.
Dot Blots were also performed using Human RNA
Master BlotsTM (Clontech). The methods and conditions for
the Dot Blots are the same as for the Multiple Tissue
Blots disclosed above. Strong signal intensity was
present in small intestine, liver and kidney.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
92
Example 3
PCR-Based Chromosomal Ma ping of the zsiq57 Gene
Zsig57 was mapped to chromosome 6 using the
commercially available "GeneBridge 4 Radiation Hybrid
Panel" (Research Genetics, Inc., Huntsville, AL). The
GeneBridge 9 Radiation Hybrid Panel contains DNAs from
each of 93 radiation hybrid clones, plus two control DNAs
(the HFL donor and the A23 recipient). A publicly
available WWW server (http://www-genome.wi.mit.edu/cgi-
bin/contig/rhmapper.pl) allows mapping relative to the
Whitehead Institute/MIT Center for Genome Research's
radiation hybrid map of the human genome (the "WICGR"
radiation hybrid map) which was constructed with the
GeneBridge 4 Radiation Hybrid Panel.
For the mapping of zsig57 with the "GeneBridge 4
RH Panel", 20 ul reactions were set up in a 96-well
microtiter plate (Stratagene, La Jolla, CA) and used in a
"RoboCycler Gradient 96" thermal cycler (Stratagene). Each
of the 95 PCR reactions consisted of 2 ul lOX KlenTaq PCR
reaction buffer (Clontech Laboratories, Inc., Palo Alto,
CA), 1.6 ul dNTPs mix (2.5 mM each, Perkin-Elmer, Foster
City, CA), 1 ul sense primer, ZC16,950, (SEQ ID N0:10), 1
ul antisense primer, ZC 16,951 (SEQ ID N0:11), 2 ul
"RediLoad" (Research Genetics, Inc., Huntsville, AL), 0.4
ul 50X Advantage KlenTaq Polymerase Mix (Clontech), 25 ng
of DNA from an individual hybrid clone or control and
ddH20 for a total volume of 20 ul. The reactions were
overlaid with an equal amount of mineral oil and sealed.
The PCR cycler conditions were as follows: an initial 1
cycle 5 minute denaturation at 95°C; 35 cycles of a 1
minute denaturation at 95°C, 1 minute annealing at 60°C,
and 1.5 minute extension at 72°C; followed by a final 1
cycle extension of 7 minutes at 72°C. The reactions were
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/1133?
93
separated by electrophoresis on a 2~ agarose gel (Life
Technologies).
The results showed that zsig57 maps 2.12 cR 3000
from the framework marker AFM165YD12 on the chromosome 6
WICGR radiation hybrid map. Proximal and distal framework
markers were AFM165YD12 and WI-6092, respectively. The use
of surrounding markers positions zsig57 in the 6p21.1-
p21.2 region on the integrated LDB chromosome 6 map (The
Genetic Location Database, University of Southhampton, WWW
server: http://cedar.genetics.soton.ac.uk/public html/).
Example 4
Creation of baculovirus ex ression vectors
zSG57NE and zSG57CE
Two expression vectors were prepared to express
zsig57 polypeptides in insect cells: zSG57NE, designed to
express a zsig57 polypeptide with a N-terminal Glu-Glu tag
(SEQ ID N0:12), and zSG57CE designed to express a zsig57
polypeptide with a C-terminal Glu-Glu tag (SEQ ID N0:13).
Recombinant baculovirus stocks were made for each.
Preparation of the baculovirus transfer vectors
for ligation
Baculovirus expression vectors derived from the
transfer vector, pFastBaclT"" (Life Technologies), were
prepared as follows. Approximately l0ug of the vector DNA
was digested with BamHI and XbaI (Boerhinger-Mannheim) for
2 hours according to manufacturer's instructions. The
entire digest was then subjected to electrophoresis on a
1.25 SeaPlaque Agarose (in 1XTAE) gel. The linearized
vector fragment was excised from the gel and gel purified
using a commercially available kit (QiaexIITM; Qiagen).
A. Construction of zSG57NE
A zsig57 DNA fragment having a N-terminal Glu-
Glu tag was generated by PCR. A 354 by PCR-generated
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
94
zsig57 DNA fragment was created using ZC17,115 (SEQ ID
N0:14) and ZC17,228 (SEQ ID N0:15) as PCR primers and the
plasmid containing zsig57, described in Example 1, as a
template. The 100 ~,1 PCR reaction was run as follows: 94°C
for 2 minutes; then 25 cycles of 95°C for 50 seconds, 50°C
for 1 minute, and 72°C for 2 minutes; then 1 cycle at 72°C
for 10 minutes; followed by a 10°C hold. The PCR product
was then run on a 1~ agarose/TAE gel confirming the
presence of the expected 354 by PCR product.
Approximately 1/2 of the PCR product was digested for 2 h
with BamHI and XbaI (Boerhinger-Mannheim) according to
manufacturer's instructions, and the digest run on a to
SeaPlaque/lo NuSieve agarose gel. The band was excised,
diluted to 0.5e agarose with 2 mM MgCl2, melted at 68°C and
ligated into a BamHI/XbaI digested baculovirus expression
vector described above.
Approximately 30 nanograms of the restriction
digested zsig57NE insert and approximately 141 ng of the
BamHI/XbaI digested transfer vector were ligated with T9
DNA ligase (New England Biolabs) according to
manufacturer's instructions. The ligation reaction was
started at 37°C, and immediately transferred to a bucket
containing room temperature water and stored overnight at
4°C. The ligation mix was diluted 3 fold in TE (10 mM
Tris-HC1, pH 7.5 and 1 mM EDTA) and subsequently incubated
at 70°C for 5 minutes to inactivate the ligase.
Transformation of ligation into Library
Efficiency DHSa competent cells
Approximately 1 fmol of the diluted ligation mix
was transformed into DHSa Library Efficiency competent
cells (Gibco-BRL, Gaithersburg, MD) according to
manufacturer's direction by heat shock for 45 seconds in a
42°C water bath. The ligated DNA was diluted in 450 ml SOC
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
media (2~ Bacto Tryptone, 0.5~ Bacto Yeast Extract, 10 ml
1M NaCl, 1.5 mM KCl, 10 mM MgCl2, 10 mM MgS09 and 20 mM
glucose), and the culture shaken at 250 rpm for 1 h at
37°C. Approximately 100 ml of the culture was plated onto
5 LB plates containing 100 mg/ml ampicillin. The plates
were incubated overnight at 37oC. 6 colonies (clones)
were picked from these plates and 2 ml cultures (LB + 100
mg/ml ampicillin) grown at 37°C overnight, with shaking at
250 rpm. Plasmid DNA was prepared using the QiaVac
10 Miniprep8 system (Qiagen) according the manufacturer's
directions. The clones were screened by restriction
digest with DraI (Boerhinger-Mannheim).
DNA sequence analysis was used to verify the
zsig57NE sequence of the 6 clones. The sequencing primers
15 were ZC16,084 (SEQ ID N0:16) and ZC7,350 (SEQ ID N0:17),
which recognize the vector DNA.
Transformation of mini re DNA into Maximum
Efficiency DHlObac cells
One microliter of each of the zSG57NE plasmid
20 DNAs, described above, was used to independently transform
20 ml DHlOBac MaxTM Efficiency competent cells (Gibco-BRL)
according to manufacturer's instruction, by heat shock at
42°C for 45 seconds. The transformants were then diluted
in an appropriate volume (180 ~1) of SOC media, incubated
25 for 4 hours at 37°C on a rotator. Volume was increased to
1 ml with SOC and 50 ~,1 plated on to Luria Agar plates
containing 50 mg/ml kanamycin, 7 mg/ml gentamycin, 10
mg/ml tetracycline, 40 mg/ml IPTG and 200 mg/ml Bluo GalT"'.
The cells were incubated for 2 to 3 days at 37°C until blue
30 and white colonies were distinguished. This color
selection was used to identify those cells containing
virus that had incorporated into the plasmid (referred to
as a "bacmid"). Those colonies, which were white in
color, were picked for analysis.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
96
. Bacmid DNA was isolated from positive colonies
from each plate and screened for the correct insert. 2
white colonies from each plate were picked and grown up in
2m1 cultures of 50$ LB, 50% Terrific Broth (TB), 50 ug/ml
kanamycin, 7ug/ml gentamycin, l0ug/mL tetracycline. These
incubated overnight at 37°C on a rotator. Plasmid DNA was
prepared using the QiaVac Miniprep8 system (Qiagen) as
described above. The clones were screened by restriction
digest with DraI (Boerhinger-Mannheim), as described
above. DNA sequence analysis was used to verify the
zsig57NE sequences in the "bacmid" clones. Bacmid DNA
from clone zSG57NE(e), having the correct insert, was used
to transfect Spodoptera frugiperda (Sf9) cells as
described below.
Transfection of Bacmid DNA into SF9 Insect Cells
and Production of Recombinant Virus.
Sf9 cells were seeded into a standard 6-well
plate, at a density of 9 x 105 cells per 35 mm well, and
allowed to attach for 1 h at 27°C. In separate tubes, 5
~1 of bacmid DNA was diluted with 100 ~1 Sf-900 II SFM
media (Gibco-BRL); and approximately 6 ~tl of CelIFECTINTM
Reagent (Gibco-BRL) was diluted with 100 ~1 Sf-900 II SMF.
The bacmid DNA and lipid solutions were gently mixed and
incubated for approximately 45 min. at room temperature,
to form a lipid-DNA complex. 0.8 ml of Sf-900 II SFM was
then added to the lipid-DNA complex (transfection
mixture). The growth media was aspirated from the cells,
and the transfection mixture was then applied to the cells
and incubated at room temperature, on a rocker, for 2 h,
and then at 27°C for 2 additional hours. The transfection
mixture was aspirated off of the cells and fresh SF900II
SMF media was applied. The cultures were incubated for 4
days and the media was then harvested (now containing
CA 02331253 2000-12-18
WO 99166040 PCT/US99/11337
97
recombinant zSG57NE(e) virus particles) from the cells and
stored at 4°C until ready for primary amplification.
Primary Amplification of Recombinant Baculovirus
- Sf9 cells were grown in 50 ml Sf-900 II SFM in a
50 ml shake flask to an approximate density of about 5 x
105 cells/ml. They were then transfected with 0.200 ml of
the zSG57NE(e) virus stock from above and incubated at
27oC for about 3 days after which time the virus was
harvested. Cells were spun down and the supernatant 0.2
micron filtered. The supernatant was stored at 4°C and
the pellet was frozen at -20°C.
The cell pellet was thawed and lysed under
hypotonic conditions to determine if there was any protein
which was: a) produced but staying in the cell (i.e.,
detergent extractable) or b) insoluble. The Hypotonic
Lysis Procedure is as follows: (1) Thaw cell pellets; (2)
Add 2.5m1 hypotonic lysis buffer (HLB) to each pellet and
resuspend. HLB contains 20 mM Tris-HC1 (pH 8.3), 1 mM
EDTA, 1 mM DTT, 1 mM PefablocT"' (Boerhinger-Mannheim) , 0.5
~,M aprotinin (Boerhinger-Mannheim), 4 ~M
leupeptin(Boerhinger-Mannheim), 4 ~tM E-64 (Boerhinger-
Mannheim), 1~ NP-40 in H20; (3) Transfer 1 ml of the lysate
to an Eppendorf tube and mix on rotator for 20 min. at 4oC
(centrifuge and freeze the remaining 1.5 ml lysate); (4)
Centrifuge at 10,000 rpm for 10 min. at 4oC, and transfer
the supernatant to a new tube. This new tube contains
detergent extractable proteins (detergent extractable
fraction); (5) Add 1 ml HLB to the pellet and resuspend.
This tube contains insoluble proteins (insoluble
fraction).
A Western blot was performed on the following
samples: the zSG57NE(e) culture supernatant, the
zSG57NE(e) detergent extractable fraction, the zSG57NE(e)
insoluble fraction. The antibody, made in house, used for
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
98
detection was a mouse anti-Glu-Glu, HRP conjugated
antibody (3mg/mL), used at a 1:2000 dilution (l.5ug/mL).
90~ of the zSG57NE protein was in the culture supernatant,
with very small amounts in the detergent extractable and
insoluble fractions.
Titer the recombinant virus in the culture
The culture supernatant was titered to determine
the number of plaque forming units/ml (pfu/ml). SF9 cells
were plated into standard 6 well plates with 2.4m1/well at
a cell density of about 5.2 X 105 cells/ml. The cells were
allowed to attach to the well for about 30 minutes. The
zSG57NE(e) virus stock was diluted 10-9 and 10-6 in lml
total volume in SF900II SMF media. The growth media was
removed from the cells and the diluted virus stock was
added, and incubated on a rocker at room temperature for 3
hours. Meanwhile, a solution of 1.3% Agarose, 0.9X
SF900II SMF media was prepared and allowed to cool to
35°C. After the 3 hour incubation, the diluted virus
stock was aspirated from the cells and 2.5m1 of the 35°C
agarose solution was gently overlaid and allowed to
harden. These plates were then incubated for 3 days at
27°C.
After 3 days, viral plaques were identified and
counted to determine virus titer. About 1 ml of a viable
stain solution (0.85 Agarose, 0.02 Neutral Red, and 99.2
SF900 media at 35°C) was overlaid upon each well and
allowed to harden. The virus create plaques of lysed
cells which do not take up the neutral red, whereas
surrounding uninfected cells do. The plates were
incubated at 27°C for 3 hours and the plaques were
counted. The zSG57NE virus titer was 1.82 X 108 pfu/ml.
B. Construction of ZSG57CE
A zsig57 DNA fragment having a C-terminal Glu-
Glu tag was generated by PCR, as described above, using
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
99
ZC17,116.(SEQ ID N0:18) and ZC17,479 (SEQ ID N0:19) as PCR
primers and the plasmid containing zsig57, described in
Example l, as a template. The 100 ~.1 PCR reaction was run
as described above. The PCR product was verified on an
agarose gel, digested, and gel isolated, as described
above. The DNA band was, diluted to 0.5% agarose with 2
mM MgCl2, melted at 68°C and ligated into a BamHI/XbaI
digested baculovirus expression vector, described above.
Approximately 49 nanograms of the restriction digested
zsig57CE insert and approximately 229 ng of the BamHI/XbaI
digested transfer vector were ligated as described above.
DHSa, transformation was performed, as described
above. 5 colonies (clones) were picked and plasmid DNA
was prepared as described above The clones were screened
as described above. DNA sequence analysis, as described
above, was used to verify the zsig57CE sequence of the 5
clones.
DHlObac transformation was performed as
described above. Bacmid DNA from clone zSG57CE(c), having
the correct insert, was used to transfect Spodoptera
frugiperda (Sf9) cells as described above.
Amplification, hypotonic lysis, Western blot and
titer of zSG57CE(c) virus stock was performed as described
above. A Western blot, using the antibody described
above, showed no apparent zSG57CE protein in the cell
supernatant, about 10$ of the zSG57CE protein in the
detergent extractable fraction, and about 90g of the
zSG57CE protein in the insoluble fractions.
The zSG57CE virus titer was 6.6 X 10' pfu/ml.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
100
Example 5
Construction of zsig57 Amino Terminal Glu-Glu Ta
gqed and
Carboxy Terminal Glu-Glu Ta ed Yeast Expression Vectors
Expression of zsig57 in Pichia methanolica
utilizes the expression system described in co-assigned
WIPO publication WO 97/17450. An expression plasmid
containing all or part of a polynucleotide encoding zsig57
was constructed via homologous recombination. An
expression vector was built from pCZR204 to express N-
terminal (NEE) and C-terminal (CEE) Glu-Glu-tagged zsig57
polypeptides.
The pCZR204 vector contains the AUG1 promoter,
followed by the aFpp leader sequence, N-terminal peptide
tag (Glu-Glu), followed by a blunt-ended SmaT restriction
site, a carboxy-terminal peptide tag (Glu-Glu), a
translational stop codon, followed by the AUG1 terminator,
the ADE2 selectable marker, and finally the AUG1 3'
untranslated region. Also included in this vector are the
URA3 and CEN-ARS sequences required for selection and
replication in S. cerevisiae, and the AmpR and colEl on
sequences required for selection and replication in E.
coli. The zsig57 sequence inserted into these vectors
begins at residue 16 (Gln) of the zsig57 amino acid
sequence (SEQ ID N0:2).
For each construct a PCR-generated zsig57
fragment containing either NEE or CEE tag was prepared as
described below, and were homologously recombined into the
yeast expression vectors described above.
AConstruction of the NEE-to ed-Zsi 57 plasmid
An NEE-tagged-zsig57 plasmid was made by
homologously recombining 100 ng of the SmaI-digested
pCZR204 acceptor vector, and 1 ~.g of NEE-zsig57 DNA donor
fragment, described below, in S. cerevisiae.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
101
. The NEE-zsig57 donor fragment was synthesized by
a PCR reaction. To a final reaction volume of 100 ~1 was
added 100 pmol of each primer ZC17, 019 (SEQ ID N0:20) and
ZC17,021 (SEQ ID N0:21), approximately 10 pmol template
DNA (plasmid from Example 1), and 10 ~,1 of lOX PCR buffer
(Boerhinger Mannheim), 1 ~,1 Pwo Polymerase (Boerhinger
Mannheim), 10 ~1 of 0.25 mM nucleotide triphosphate mix
(Perkin Elmer) and dH20 to 100 ul. The PCR reaction was
run as follows: 30 cycles at 94°C for 30 seconds, 50°C for
1 minute, and 72°C for 1 minute; followed by 1 cycle at
72°C for 6 minutes. The resulting 420 by double stranded,
NEE-tagged zsig57 fragment is disclosed in SEQ ID N0:22.
B. Construction of the CEE-zsig57 lasmid
An CEE-tagged-zsig57 plasmid was made by
homologously recombining 100 ng of the SmaI-digested
pCZR204 acceptor vector, and 1 ~,g of zsig57-CEE DNA donor
fragment, described below, in S. cerevisiae.
The zsig57-CEE donor fragment was made via a PCR
reaction, as described above, using oligonucleotides
ZC17,022 (SEQ ID N0:23) and ZC17,020 (SEQ ID N0:24). The
resulting 420 by double stranded, zsig57-CEE fragment is
disclosed in SEQ ID N0:25.
One hundred microliters of competent yeast cells
(S. cerevisiae) was independently combined with 10 ~l of
the various DNA mixtures from above and transferred to a
0.2 cm electroporation cuvette. The yeast/DNA mixtures
were electropulsed at 0.75 kV (5 kV/cm), o0 ohms, 25 uF.
To each cuvette was added 600 ul of 1.2 M sorbitol and the
yeast was plated in two 300 ul aliquots onto two URA D
plates and incubated at 30°C.
After about 48 hours the Ura+ yeast
transformants from a single plate were resuspended in 2.5
ml H20 and spun briefly to pellet the yeast cells. The
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
102
cell pellet was resuspended in 1 ml of lysis buffer (2%
Triton X-100, l~ SDS, 100 mM NaCl, 10 mM Tris, pH 8.0, 1
mM EDTA). Five hundred microliters of the lysis mixture
was added to an Eppendorf tube containing 300 ul acid
washed glass beads and 200 ul phenol-chloroform, vortexed
for 1 minute intervals two or three times, followed by a 5
minute spin in a Eppendorf centrifuge as maximum speed.
Three hundred microliters of the aqueous phase was
transferred to a fresh tube and the DNA precipitated with
600 ul ethanol (EtOH), followed by centrifugation for 10
minutes at 4°C. The DNA pellet was resuspended in 100 ul
H20.
Transformation of electrocompetent DH10B E. coli
cells (Gibco BRL) was done with 0.5-2 ml yeast DNA prep
and 40 ~tl of DH10B cells. The cells were electropulsed at
2.0 kV, 25 ~,F and 400 ohms. Following electroporation, 1
ml SOC (2~S BactoT'" Tryptone (Difco, Detroit, MI), 0.5$
yeast extract (Difco), 10 mM NaCl, 2.5 mM KC1, 10 mM MgCl2,
10 mM MgS09, 20 mM glucose) was plated in 250 ul aliquots
on four LB AMP plates (LB broth (Lennox), 1.8$ BactoTM Agar
(Difco), 100 mg/L Ampicillin).
Individual clones harboring the correct
expression construct for both NEE and CEE tagged zsig57
were identified by restriction digest with EcoRI
(Boerhinger-Mannheim) to verify the presence of the zsig57
insert and to confirm that the various DNA sequences had
been joined correctly to one another. The DNA from clones
with correct inserts were subjected to sequence analysis
to verify the sequence of the NEE-zsig57 and zsig57-CEE
constructs. Larger scale plasmid DNA was isolated using
the QiagenTM Maxi kit (Qiagen) according to manufacturer's
instruction and the DNA was digested with Not I to
liberate the Pichia-zsig57 expression cassette from the
remaining vector. The Not I-restriction digested DNA
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
103
fragment, was then transformed into the Pichia methanolica
expression host, PMAD16. This was done by mixing 100 ~l
of prepared competent PMAD16 cells with 10 ~g of Not I
restriction digested zsig57 and transferred to a 0.2 cm
electroporation cuvette. The yeast/DNA mixture was
electropulsed at 0.75 kV, 25 ~F, infinite ohms. To the
cuvette was added 1 ml of 1X Yeast Nitrogen Base and 500
ml aliquots were plated onto two ADE DS (0.0560 -Ade -Trp
-Thr powder, 0.670 yeast nitrogen base without amino
acids, 2% D-glucose, 0.5~ 200X tryptophan, threonine
solution, and 18.22% D-sorbitol) plates for selection and
incubated at 30°C. The transformed yeast cells were plated
on ADE DS plates for selection. Clones were picked and
screened via Western blot for high-level zsig57 expression
and subjected to fermentation. These isolated clones are
considered cloned yeast strains, which express the NEE-
and CEE-tagged zsig57 polypeptides disclosed herein. The
resulting NEE-tagged-zsig57 strain was designated
PMADI6::pSDH125.1.8 and PMADI6::pSDH125.1.13 and the CEE-
tagged-zsig57 plasmid containing strain was designated
PMADI6::pSDH126.2.19 and PMADI6::pSDH126.2.29.
Example 6
Generation of untag ed zsig57 Recombinant Adenovirus
A. Preparation of DNA construct for eneration of
Adenovirus
The protein coding region of zsig57 was
amplified by PCR using primers that added FseI and AscI
restriction sties at the 5' and 3' termini respectively.
PCR primers ZC17529 (SEQ ID N0:26) and ZC17530 (SEQ ID
N0:27) were used with template plasmid containing the
full-length zsig57 cDNA (Example 1) in a PCR reaction as
follows: one cycle at 95°C for 5 minutes; followed by 15
cycles at 95°C for 1 min., 58°C for 1 min., and 72°C for
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
104
1 . 0 min.,; followed by 72°C for 7 min. ; followed by a 9°C
soak. The PCR reaction product was loaded onto a 1.2
(low melt) SeaPlaque GTG (FMC, Rockland, ME) gel in TAE
buffer. The zsig57 PCR product was excised from the gel
and purified using the QIAquickT"" PCR Purification Kit gel
cleanup kit(Qiagen) as per kit instructions. The PCR
product was then digested with FseI-AscI,
phenol/chloroform extracted, EtOH precipitated, and
rehydrated in 20m1 TE (Tris/EDTA pH 8). The 600 by zsig57
fragment was then ligated into the FseI-AscI sites of the
transgenic vector pMTl2-8 (See, Example 8) and transformed
into DH10B competent cells by electroporation. Clones
containing zsig57 were identified by plasmid DNA miniprep
followed by digestion with FseI-AscI. A positive clone
was sent to the sequencing department to insure there are
no deletions or other anomalies in the construct. The
sequence of zsig57 cDNA was confirmed. Qiagen Maxi Prep
protocol (Qiagen) is used to generate DNA to continue our
process described below.
The 600 by zsig57 cDNA was released from the
TG12-8 vector using FseI and AscI enzymes. The cDNA was
isolated on a 1~ low melt SeaPlaque GTGT"" (FMC, Rockland,
ME) gel and was then excised from the gel and the gel
slice melted at 70°C, extracted twice with an equal volume
of Tris buffered phenol, and EtOH precipitated. The DNA
was resuspended in 101 H20.
The zsig57 cDNA was cloned into the FseI-AscI
sites of pAdTrack CMV (He, T-C. et al., PNAS _95:2509-2514,
1998) in which the native polylinker was replaced with
FseI, EcoRV, and AscI sites. Ligation was performed using
the Fast-LinkT"' DNA ligation and screening kit (Epicentre
Technologies, Madison, WI). In order to linearize the
plasmid, approximately 5 ~g of the pAdTrack CMV zsig57
plasmid was digested with PmeI. Approximately 1 ~g of the
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
105
lineariz.ed plasmid was cotransformed with 200ng of
supercoiled pAdEasy (He et al., su ra.) into BJ5183 cells.
The co-transformation was done using a Bio-Rad Gene Pulser
at 2.5kV, 200 ohms and 25mFa. The entire co-
y transformation was plated on 4 LB plates containing 25
~g/ml kanamycin. The smallest colonies were picked and
expanded in LB/kanamycin and recombinant adenovirus DNA
identified by standard DNA miniprep procedures. Digestion
of the recombinant adenovirus DNA with FseI-AscI confirmed
the presence of zsig57. The recombinant adenovirus
miniprep DNA was transformed into DH10B competent cells
and DNA prepared using a Qiagen maxi prep kit as per kit
instructions.
B. Transfection of 293a Cells with Recombinant DNA
Approximately 5 ~tg of recombinant adenoviral DNA
was digested with Pacl enzyme (New England Biolabs) for 3
hours at 37°C in a reaction volume of 100 ~tl containing 20-
30U of PacI. The digested DNA was extracted twice with an
equal volume of phenol/chloroform and precipitated with
ethanol. The DNA pellet was resuspended in 101 distilled
water. A T25 flask of QBI-293A cells (Quantum
Biotechnologies, Inc. Montreal, Qc. Canada), inoculated
the day before and grown to 60-70% confluence, were
transfected with the PacI digested DNA. The PacI-digested
DNA was diluted up to a total volume of 50u1 with sterile
HBS (150mM NaCl, 20mM HEPES). In a separate tube, 20 ~1
DOTAP (Boehringer Mannheim, lmg/ml) was diluted to a total
volume of 100~t1 with HBS. The DNA was added to the DOTAP,
mixed gently by pipeting up and down, and left at room
temperature for 15 minutes. The media was removed from
the 293A cells and washed with 5 ml serum-free MEMalpha
(Gibco BRL) containing 1mM Sodium Pyruvate (GibcoBRL), 0.1
mM MEM non-essential amino acids (GibcoBRL) and 25mM HEPES
buffer (GibcoBRL). 5 ml of serum-free MEM was added to
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
106
the 293A.cells and held at 37°C. The DNA/lipid mixture was
added drop-wise to the T25 flask of 293A cells, mixed
gently and incubated at 37°C for 4 hours . After 4 h the
media containing the DNA/lipid mixture was aspirated off
and replaced with 5 ml complete MEM containing 5o fetal
bovine serum. The transfected cells were monitored for
Green Fluorescent Protein (GFP) expression and formation
of foci, i.e., viral plaques.
Seven days after transfection of 293A cells with
the recombinant adenoviral DNA, the cells expressed the
GFP protein and started to form foci. These foci are
viral "plaques" and the crude viral lysate was collected
by using a cell scraper to detach all of the 293A cells.
The lysate was transferred to a 50m1 conical tube. To
release most of the virus particles from the cells, three
freeze/thaw cycles were done in a dry ice/ethanol bath and
a 37° waterbath.
C. Amplification of Recombinant Adenovirus (rAdV)
The crude lysate was amplified (Primary (1°)
amplification) to obtain a working "stock" of zsig57 rAdV
lysate. Ten lOcm plates of nearly confluent (80-900) 293A
cells were set up 20 hours previously, 200m1 of crude rAdV
lysate added to each lOcm plate and monitored for 48 to 72
hours looking for CPE under the white light microscope and
expression of GFP under the fluorescent microscope. When
all of the 293A cells showed CPE (Cytopathic Effect) this
1° stock lysate was collected and freeze/thaw cycles
performed as described under Crude rAdV Lysate.
Secondary (2°) Amplification of zsig57 rAdV was
obtained as follows: Twenty l5cm tissue culture dishes of
293A cells were prepared so that the cells were 80-900
confluent. All but 20 mls of SoMEM media was removed and
each dish was inoculated with 300-500m1 1° amplified rAdv
lysate. After 48 hours the 293A cells were lysed from
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
107
virus production and this lysate was collected into 250 ml
polypropylene centrifuge bottles and the rAdV purified.
D. AdV/cDNA Purification
NP-40 detergent was added to a final
concentration of 0.5~ to the bottles of crude lysate in
order to lyse all cells. Bottles were placed on a
rotating platform for 10 min. agitating as fast as
possible without the bottles falling over. The debris was
pelleted by centrifugation at 20,000 X G for 15 minutes.
The supernatant was transferred to 250 ml polycarbonate
centrifuge bottles and 0.5 volumes of 20~PEG8000/2.5M NaCl
solution added. The bottles were shaken overnight on ice.
The bottles were centrifuged at 20,000 X G for 15 minutes
and supernatant discarded into a bleach solution. The
white precipitate in two vertical lines along the wall of
the bottle on either side of the spin mark is the
precipitated virus/PEG. Using a sterile cell scraper, the
precipitate from 2 bottles was resuspended in 2.5 ml PBS.
The virus solution was placed in 2 ml microcentrifuge
tubes and centrifuged at 19,000 X G in the microfuge for
10 minutes to remove any additional cell debris. The
supernatant from the 2ml microcentrifuge tubes was
transferred into a 15m1 polypropylene snapcap tube and
adjusted to a density of 1.39g/ml with cesium chloride
(CsCl). The volume of the virus solution was estimated and
0.55 g/ml of CsCl added. The CsCl was dissolved and 1 ml
of this solution weighed 1.39 g. The solution was
transferred polycarbonate thick-walled centrifuge tubes
3.2m1 (Beckman #362305) and spin at 80,OOOrpm (348,000 X
G) for 3-4 hours at 25°C in a Beckman Optima TLX
microultracentrifuge with the TLA-100.4 rotor. The virus
formed a white band. Using wide-bore pipette tips, the
virus band was collected.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
108
The virus from the gradient has a large amount
of CsCl which must be removed before it can be used on
cells. Pharmacia PD-10 columns prepacked with Sephadex G-
25M (Pharmacia) were used to desalt the virus preparation.
The column was equilibrated with 20 ml of PBS. The virus
was loaded and allowed it to run into the column. 5 ml of
PBS was added to the column and fractions of 8-10 drops
collected. The optical densities of 1:50 dilutions of
each fraction was determined at 260 nm on a
spectrophotometer. A clear absorbance peak was present
between fractions 7-12. These fractions were pooled and
the optical density (OD) of a 1:25 dilution determined. A
formula is used to convert OD into virus concentration:
(OD at 260nm) (25) (1.1 x 1012) - virions/ml. The OD of a
1:25 dilution of the zsig57 rAdV was 0.114, giving a virus
concentration of 3.1 X 1012 virions/ml.
To store the virus, glycerol was added to the
purified virus to a final concentration of 15~, mixed
gently but effectively, and stored in aliquots at -80°G.
E. Tissue Culture Infectious Dose at 50o CPE (TCID 50)
Viral Titration Assay
A protocol developed by Quantum Biotechnologies,
Inc. (Montreal, Qc. Canada) was followed to measure
recombinant virus infectivity. Briefly, two 96-well
tissue culture plates were seeded with 1X10° 293A cells per
well in MEM containing 2$ fetal bovine serum for each
recombinant virus to be assayed. After 24 hours 20-fold
dilutions of each virus from 1X10 2 to 1X10 19 were made in
MEM containing 2$ fetal bovine serum. 100,1 of each
dilution was placed in each of 20 wells . After 5 days at
37°C, wells were read either positive or negative for
Cytopathic Effect (CPE) and a value for "Plaque Forming
Units/ml" (PFU) is calculated.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
109
TCIDSO formulation used was as per Quantum
Biotechnologies, Inc., above. The titer (T) is determined
from a plate where virus used is diluted from 10 2 to 10-14,
and read 5 days after the infection. At each dilution a
ratio (R) of positive wells for CPE per the total number
of wells is determined.
To Calculate titer of the undiluted virus
sample: the factor, "F" = 1+d(S-0.5); where "S" is the sum
of the ratios (R); and "d" is LoglO of the dilution
series, for example, "d" is equal to 1 for a ten-fold
dilution series. The titer of the undiluted sample is T =
10 ~1+F~ _ TCIDSO/ml . To convert T~IDso/ml to pfu/ml, 0 . 7 is
subtracted from the exponent in the calculation for titer
(T) .
The zsig57 adenovirus had a titer of 5.6 X 109
pfu/ml.
Example 7
Purification of zsig57 CEE and NEE from pichia methanolica
conditioned medium
A. Purification of zsicr57 CEE from baculovirus-infected
Sf9 cell media.
Unless otherwise noted, all operations were
carried out at 4°C. A mixture of protease inhibitors was
added to a 3000 ml sample of conditioned media from pichia
cultures (Example 5) to final concentrations of 2.5 mM
ethylenediaminetetraacetic acid (EDTA, Sigma Chemical Co.
St. Louis, MO), 0.001 mM leupeptin (Boehringer-Mannheim,
Indianapolis, IN), 0.001 mM pepstatin (Boehringer-
Mannheim) and 0.4 mM Pefabloc (Boehringer-Mannheim).
The pH of the media was adjusted to 7.2 with a
concentrated solution of NaOH (Sigma Chemical Co., St.
Louis) following the addition of potassium phosphate
(Sigma Chemical Co.) to a final concentration of 0.05M.
The sample was centrifuged at 18,000 x g for 30 min at 4°C
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
110
in a Beckman JLA-10.5 rotor (Beckman Instruments, Palo
Alto, CA) in a Beckman Avanti J25I centrifuge (Beckman
Instruments) to remove cell debris. To the supernatant
fraction was added a 50.0 ml sample of anti-EE Sepharose,
prepared as described below, and the mixture was gently
agitated on a Wheaton (Millville, NJ) roller culture
apparatus for 18.0 h at 4°C.
The mixture was then poured into a 5.0 x 20.0 cm
Econo-Column (Bio-Rad, Laboratories, Hercules, CA) and the
gel was washed with 30 column volumes of phosphate
buffered saline (PBS). The unretained flow-through
fraction was discarded. Once the absorbence of the
effluent at 280 nM was less than 0.05, the flow through
the column was reduced to zero and the anti-EE Sepharose
gel was eluted batchwise with 2.0 column volumes of PBS
containing 0.4 mg/ml of EE peptide (AnaSpec, San Jose,
CA). The EE peptide used for bothe CEE and NEE zsig57
constructs has the sequence GluTyrMetProValAsp (SEQ ID
N0:28). After 1.0 h at 4°C, flow was resumed and the
eluted protein was collected. This fraction was referred
to as the peptide elution fraction. The anti-EE Sepharose
gel was then washed with 2.0 column volumes of O.1M
glycine, pH 2.5, and the glycine wash was collected
separately. The pH of the glycine-eluted fraction was
adjusted to 7.0 by the addition of a small volume of lOX
PBS and stored at 4°C for future analysis if needed.
The peptide elution fraction was concentrated to
5.0 ml using a 3,000 molecular weight cutoff membrane
concentrator (Millipore, Bedford, MA) according to the
manufacturer's instructions. The pure zsig57 NEE or CEE
protein in the peptide elution fraction was separated from
contaminating free peptide by chromatography of the
peptide elution fraction on a 1.5 x 50 cm Sephadex G-50
(Pharmacia, Piscataway, NJ) column equilibrated in PBS at
a flow rate of 1.0 ml/min using a BioCad Sprint HPLC
(PerSeptive BioSystems, Framingham, MA). Two-ml fractions
were collected and the absorbance at 280 nM was monitored.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
111
The first peak of material absorbing at 280 nM and eluting
near the void volume of the column was collected. This
fraction was pure zsig57 NEE or zsig57 CEE. The pure
material was concentrated as described above, analyzed by
SDS-PAGE and Western blotting with anti-EE antibodies, and
samples were taken for amino acid analysis and N-terminal
sequencing. The remainder of the sample was aliquoted,
and stored at -80°C according to our standard procedures.
The protein concentration of the purified zsig57 NEE was
0.5 mg/ml and that of zsig57 CEE was 0.46 mg/ml.
On Coomassie Blue-stained SDS-PAGE gels, the
zsig57 NEE preparation contained one major band of
apparent molecular weight 14,000. The mobility of this
band was the same in the presence and absence of reducing
agents and was visible on western blots with anti-EE
antibodies. The zsig57 CEE purified protein also showed
one major band at 14,000 Da on Coomassie-Blue stained SDS-
PAGE gels. Western blotting with anti-EE antibodies
showed one major band of cross-reactive material at 14,000
Da. The mobility of the 14,000 Da band on western blots
was not changed by the presence or absence of reducing
agents.
B. Purification of zsiq57 NEE from baculovirus-infected
Sf9 cell media.
Unless otherwise noted, all operations were
carried out at 4°C. A mixture of protease inhibitors was
added to a 2000 ml sample of conditioned media from
baculovirus-infected Sf9 cells (Example 4) to final
concentrations of 2.5 mM ethylenediaminetetraacetic acid
(EDTA, Sigma Chemical Co. St. Louis, MO), 0.001 mM
leupeptin (Boehringer-Mannheim, Indianapolis, IN), 0.001
mM pepstatin (Boehringer-Mannheim) and 0.4 mM Pefabloc
(Boehringer-Mannheim). The sample was centrifuged at
10,000 rpm for 30 min at 4°C in a Beckman JLA-10.5 rotor
(Beckman Instruments, Palo Alto, CA) in a Beckman Avanti
J25I centrifuge (Beckman Instruments) to remove cell
debris. To the supernatant fraction was added a 50.0 ml
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
112
sample of anti-EE Sepharose (prepared as described below),
and the mixture was gently agitated on a Wheaton
(Millville, NJ) roller culture apparatus for 18.0 h at
4°C. The mixture was then processed as described above for
zsig57 NEE from Pichia methanolica. The pure material was
concentrated as described above, analyzed by SDS-PAGE and
Western blotting with anti-EE antibodies, and samples were
taken for amino acid analysis and N-terminal sequencing.
The remainder of the sample was aliquoted, and stored at -
80°C according to our standard procedures. The
concentration of the purified zsig57 NEE was 0.3 mg/ml.
Electrophoresis on SDS-PAGE gels in the absence
of reducing agents showed two Coomassie Blue stained bands
of apparent molecular weights 14,000 and 28,000. Each of
these bands showed cross-reactivity on western blots with
anti-EE IgG. In the presence of reducing agents, in
contrast, only one Coomassie Blue-stained band of 14,000
Da was observed and this band was the only protein that
showed cross-reactivity with anti-EE antibodies on Western
blots.
C. Preparation of anti-EE IctG Sepharose
A 100 ml bed volume of protein G-Sepharose
(Pharmacia, Piscataway, NJ) was washed 3 times with 100 ml
of PBS containing 0.02% sodium azide using a 500 ml
Nalgene 0.45 micron filter unit. The gel was washed with
6.0 volumes of 200 mM triethanolamine, pH 8.2 (TEA, Sigma,
St. Louis, MO). and an equal volume of EE antibody
solution containing 900 mg of antibody was added. After
an overnight incubation at 4°C, unbound antibody was
removed by washing the resin with 5 volumes of 200 mM TEA
as described above. The resin was resuspended in 2
volumes of TEA, transferred to a suitable container, and
dimethylpimilimidate-2HC1 (Pierce, Rockford, IL),
dissolved in TEA, was added to a final concentration of 36
mg/ml of gel. The gel was rocked at room temperature for
min and the liquid was removed using the filter unit as
described above. Nonspecific sites on the gel were then
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
113
blocked by incubating for 10 min at room temperature with
volumes of 20 mM ethanolamine in 200 mM TEA. The gel
was then washed with 5 volumes of PBS containing 0.02%
sodium azide and stored in this solution at 4°C.
5
Example 8
Construct for generating zsig57 Transgenic Mice
Oligonucleotides were designed to generate a PCR
fragment containing a consensus Kozak sequence and the
exact zsig57 coding region. These oligonucleotides were
designed with an FseI site at the 5' end and an AscI site
at the 3' end to facilitate cloning into pMTl2-8, our
standard transgenic vector. PMT12-8 contains the mouse
MT-1 promoter and a 5' rat insulin II intron upstream of
the FseI site.
PCR reactions were carried out with 200 ng
zsig57 plasmid template (Example 1) and oligonucleotides
ZC17,529 (SEQ ID N0:26) and ZC17,530 (SEQ ID N0:27) as
primers. PCR reaction conditions were as follows: 95°C for
5 minutes, wherein Advantage~ cDNA polymerase (Clontech)
was added; 15 cycles of 95°C for 60 seconds, 62°C for 60
seconds, and 72°C for 90 seconds; and 72°C for 7 minutes.
PCR products were separated by agarose gel electrophoresis
and purified using a QiaQuickT"" (Qiagen) gel extraction
kit. The isolated, 599 bp, DNA fragment was digested with
FseI and AscI (Boerhinger-Mannheim), ethanol precipitated
and ligated into pMTl2-8 that was previously digested with
FseI and AscI. The pMTl2-8 plasmid, designed for
expression of a gene of interest in transgenic mice,
contains an expression cassette flanked by 10 kb of MT-1
5' DNA and 7 kb of MT-1 3' DNA. The expression cassette
comprises the MT-1 promoter, the rat insulin II intron, a
polylinker for the insertion of the desired clone, and the
human growth hormone poly A sequence.
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
114
About one microliter of the ligation reaction
was electroporated into DH10B ElectroMaxT"" competent cells
(GIBCO BRL, Gaithersburg, MD) according to manufacturer's
- direction and plated onto LB plates containing 100 ~g/ml
ampicillin, and incubated overnight. Colonies were picked
and grown in LB media containing 100 ~g/ml ampicillin.
Miniprep DNA was prepared from the picked clones and
screened for the zsig57 insert by restriction digestion
with EcoRI, and subsequent agarose gel electrophoresis.
Maxipreps of the correct pMT-zsig57 construct were
performed. A SalI fragment containing with 5' and 3'
flanking sequences, the MT-1 promoter, the rat insulin II
intron, zsig57 cDNA and the human growth hormone poly A
sequence was prepared to be used for microinjection into
fertilized murine oocytes.
From the foregoing, it will be appreciated that,
although specific embodiments of the invention have been
described herein for purposes of illustration, various
modifications may be made without deviating from the
spirit and scope of the invention. Accordingly, the
invention is not limited except as by the appended claims.
CA 02331253 2000-12-18
WO 99/b6040 PCT/US99/1133?
1
SEQUENCE LISTING
- <110> ZymoGenetics, Inc,
1201 Eastlake Avenue East
Seattle. Washington 98102
United States of America
<120> IMMUNDMODULATOR POLYPEPTIDE, ZSIG57
<130> 98-23PC
<150> 09/099.600
<151> 1998-06-18
<160> 30
<170> FastSEQ for Windows Version 3.0
<210>1
<211>1218
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (64)...(660)
<400> 1
gaattcggct cgagtgcatc agtgcccagg caagcccagg agttgacatt tctctgccca 60
gcc atg ggc ctc acc ctg ctc ttg ctg ctg ctc ctg gga cta gaa ggt 108
Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly
1 5 10 15
cag ggc ata gtt ggc agc ctc cct gag gtg ctg cag gca ccc gtg gga 156
Gln Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly
20 25 30
agc tcc att ctg gtg cag tgc cac tac agg ctc cag gat gtc aaa get 204
Ser Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala
35 40 45
cag aag gtg tgg tgc cgg ttc ttg ccg gag ggg tgc cag ccc ctg gtg 252
Gln Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val
CA 02331253 2000-12-18
WO 99/66040 PCTNS99/11337
2
50 55 60
tcc tca get gtg gat cgc aga get cca gcg ggc agg cgt acg ttt ctc 300
Ser Ser Ala Val Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu
65 70 75
aca gac ctg ggt ggg ggc ctg ctg cag gtg gaa atg gtt acc ctg cag 348
Thr Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln
80 85 90 95
gaa gag gat get ggc gag tat ggc tgc atg gtg gat ggg gcc agg ggg 396
Glu Glu Asp Ala Gly Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly
100 105 110
ccc cag att ttg cac aga gtc tct ctg aac ata ctg ccc cca gag gaa 444
Pro Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Glu
115 120 125
gaa gaa gag acc cat aag att ggc agt ctg get gag aac gca ttc tca 492
Glu Glu Glu Thr Nis Lys Ile Gly Ser Leu Ala Glu Asn Ala Phe Ser
130 135 140
gac cct gca ggc agt gcc aac cct ttg gaa ccc agc cag gat gag aag 540
Asp Pro Ala Gly Ser Ala Asn Pro Leu Glu Pro Ser Gln Asp Glu Lys
145 150 155
agc atc ccc ttg atc tgg ggt get gtg ctc ctg gta ggt ctg ctg gtg 588
Ser Ile Pro Leu Ile Trp Gly Ala Val Leu Leu Val Gly Leu Leu Val
160 165 170 175
gca gcg gtg gtg ctg ttt get gtg atg gcc aag agg aaa caa gaa tcc 636
Ala Ala Val Val Leu Phe Ala Ual Met Ala Lys Arg Lys Gln Glu Ser
180 185 190
ctc ctc agt ggt cca cca cgt cag tgactctgga ccggctgctg aattgccttt 690
Leu Leu Ser Gly Pro Pro Arg Gln
195
ggatgtaccacacattaggcttgactcaccaccttcatttgacaataccacctacaccag750
cctacctcttgattccccatcaggaaaaccttcactcccagctccatcctcattgccccc810
tctacctcctaaggtcctggtctgctccaagcctgtgacatatgccacagtaatcttccc870
gggagggaacaagggtggagggacctcgtgtgggccagcccagaatccacctaacaatca930
gactccatccagctaagctgctcatcacactttaaactcatgaggaccatccctaggggt990
tctgtgcatccatccagccagctcatgccctaggatccttaggatatctgagcaaccagg1050
gactttaagatctaatccaatgtcctaactttactagggaaagtgacgctcagacatgac1110
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
3
tgagatgtct tggggaagac ctccctgcac ccaactcccc cactggttct tctaccatta 1170
cacactgggc taaataaacc ctaataatga tgtgcaaaaa aaaaaaaa 1218
<210>2
<211>199
<212>PRT
<213>Homo sapiens
<400> 2
Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly Gln
1 5 10 15
Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser
20 25 30
Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln
35 40 45
Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser
50 55 60
Ser Ala Ual Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr
65 70 75 80
Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu
85 90 95
Glu Asp Ala Gly Glu Tyr Gly Cys Met Ual Asp Gly Ala Arg Gly Pro
100 105 110
Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Glu Glu
115 120 125
Glu Glu Thr His Lys Ile Gly Ser Leu Ala Glu Asn Ala Phe Ser Asp
130 135 140
Pro Ala Gly Ser Ala Asn Pro Leu Glu Pro Ser Gln Asp Glu Lys Ser
145 150 155 160
Ile Pro Leu Ile Trp Gly Ala Val Leu Leu Ual Gly Leu Leu Val Ala
165 170 175
Ala Val Ual Leu Phe Ala Val Met Ala Lys Arg Lys Gln Glu Ser Leu
180 185 190
Leu Ser Gly Pro Pro Arg Gln
195
<210> 3
<211> 597
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate polynucleotide sequence for zsig57
<221> misc feature
CA 02331253 2000-12-18
WO 99/66040 PC'f/US99/11337
4
<222> (I)...(597)
<223> n = A,T,C or G
<400>
3
atgggnytnacnytnytnytnytnytnytnytnggnytngarggncarggnathgtnggn60
wsnytnccngargtnytncargcnccngtnggnwsnwsnathytngtncartgycaytay120
mgnytncargaygtnaargcncaraargtntggtgymgnttyytnccngarggntgycar180
ccnytngtnwsnwsngcngtngaymgnmgngcnccngcnggnmgnmgnacnttyytnacn240
gayytnggnggnggnytnytncargtngaratggtnacnytncargargargaygcnggn300
gartayggntgyatggtngayggngcnmgnggnccncarathytncaymgngtnwsnytn360
aayathytnccnccngargargargargaracncayaarathggnwsnytngcngaraay420
gcnttywsngayccngcnggnwsngcnaayccnytngarccnwsncargaygaraarwsn480
athccnytnathtggggngcngtnytnytngtnggnytnytngtngcngcngtngtnytn540
ttygcngtnatggcnaarmgnaarcargarwsnytnytnwsnggnccnccnmgncar 597
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC976
<400> 4
cgttgtaaaa cgacggcc 18
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16495
<400> 5
caggcgtacg tttctcacag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16494
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
<400> 6~
ggtttattta gcccagtgtg 20
<210> 7
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC447
<400> 7
taacaatttc acacagg 17
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16174
<400> 8
aagaaccggc accacacctt ct 22
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16175
<400> 9
ggcaagccca ggagttgaca tt 22
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16950
<400> 10
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
6
aggcgtacgt ttctcaca lg
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16951
<400> 11
ctcgccagca tcctcttc lg
<210> 12
<211> 138
<212> PRT
<213> Artificial Sequence
<220>
<223> Zsig57 polypeptide with N-terminal Glu-Glu tag
<400> 12
Met Thr Ile Leu Cys Trp Leu Ala Leu Leu Ser Thr Leu Thr Ala Val
1_ 5 10 15
Asn Ala Gly Glu Tyr Met Pro Met Glu Gly Ser Gln Gly Ile Val Gly
20 25 30
Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser Ser Ile Leu Val
35 40 45
Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln Lys Val Trp Cys
50 55 60
Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser Ser Ala Val Asp
65 70 75 80
Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr Asp Leu Gly Gly
85 90 95
Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu Glu Asp Ala Gly
100 105 110
Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly Pro Gln Ile Leu His
115 120 125
Arg Val Ser Leu Asn Ile Leu Pro Pro Glu
130 135
<210> 13
<211> 134
<212> PRT
<213> Artificial Sequence
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
7
<220>
<223> zsig57 polypeptide with C-terminal Glu-Glu tag
<400> 13
Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly Gln
1 5 10 15
Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser
20 25 30
Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln
35 40 45
Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser
50 55 60
Ser Ala Val Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr
65 70 75 gp
Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu
85 90 g5
Glu Asp Ala Gly Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly Pro
100 105 110
Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Gly Leu
115 120 125
Glu Tyr Met Pro Met Asp
130
<210> 14
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17115
<400> 14
ttaggatccc agggcatagt tggcagc 27
<210> 15
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17228
<400> 15
taatctagat tactctgggg gcagtatgtt caga 34
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
8
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC16084
<400> 16
gtcgaatgca aagcgtaaaa 20
<210> 17
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC7350
<400> 17
cctctacaaa tgtggtatgg c 21
<210> 18
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17116
<400> 18
ttaggatcca tgggcctcac cctgctc 27
<210> 19
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17479
<400> 19
gggtctcttc tagaccctct gggggcagta tgttcagaga 40
CA 02331253 2000-12-18
WO 99/bb040 PCT/US99/11337
9
<210> 20
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17019
<400> 20
ctcaaaaatt ataaaaatat ccaaacaggc agccgaattc tactctgggg gcagtatgtt 60
cagag 65
<210> 21
<211> 64
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17021
<400> 21
ttggacaaga gagaagaaga atacatgcca atggaaggtg gtcagggcat agttggcagc 60
ctcc 64
<210> 22
<211> 417
<212> DNA
<213> Artificial Sequence
<220>
<223> NEE-tagged zsig57 fragment
<400>
22
ttggacaagagagaagaagaatacatgccaatggaaggtggtcagggcatagttggcagc 60
ctccctgaggtgctgcaggcacccgtgggaagctccattctggtgcagtgccactacagg 120
ctccaggatgtcaaagctcagaaggtgtggtgccggttcttgccggaggggtgccagccc 180
ctggtgtcctcagctgtggatcgcagagctccagcgggcaggcgtacgtttctcacagac 240
ctgggtgggggcctgctgcaggtggaaatggttaccctgcaggaagaggatgctggcgag 300
tatggctgcatggtggatggggccagggggccccagattttgcacagagtctctctgaac 360
atactgcccccagagtagaattcggctgcctgtttggatatttttataatttttgag 417
<210> 23
<2I1> 64
<212> DNA
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17022
<400> 23
attgctgcta aagaagaagg tgtaagcttg gacaagagag aacagggcat agttggcagc 60
ctcc 64
<210> 24
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17020
<400> 24
atactaggaa ttctactcca taggcatata ctcctcgcct ccctctgggg gcagtatgtt 60
cagag
<210> 25
<211> 417
<212> DNA
<213> Artificial Sequence
<220>
<223> CEE-tagged zsig57 fragment
<400>
25
attgctgctaaagaagaaggtgtaagcttggacaagagagaacagggcatagttggcagc 60
ctccctgaggtgctgcaggcacccgtgggaagctccattctggtgcagtgccactacagg 120
ctccaggatgtcaaagctcagaaggtgtggtgccggttcttgccggaggggtgccagccc 180
ctggtgtcctcagctgtggatcgcagagctccagcgggcaggcgtacgtttctcacagac 240
ctgggtgggggcctgctgcaggtggaaatggttaccctgcaggaagaggatgctggcgag 300
tatggctgcatggtggatggggccagggggccccagattttgcacagagtctctctgaac 360
atactgcccccagagggaggcgaggagtatatgcctatggagtagaattcctagtat 417
<210> 26
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17529
CA 02331253 2000-12-18
WO 99/66040 PCTNS99/11337
11
<400> 26
gtatacggcc ggccaccatg ggcctcaccc tg 32
<210> 27
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC17530
<400> 27
cgtatcggcg cgcctcactg acgtggtgga cc 32
<210> 28
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> EE peptide
<400> 28
Glu Tyr Met Pro Val Asp
1 5
<210>29
<211>224
<212>PRT
<213>Homo Sapiens
<400> 29
Met Thr Ala Arg Ala Trp Ala Ser Trp Arg Ser Ser Ala Leu Leu Leu
1 5 10 15
Leu Leu Val Pro Gly Tyr Phe Pro Leu Ser His Pro Met Thr Val Ala
20 25 30
Gly Pro Val Gly Gly Ser Leu Ser Val Gln Cys Arg Tyr Glu Lys Glu
35 40 45
His Arg Thr Leu Asn Lys Phe Trp Cys Arg Pro Pro Gln Ile Leu Arg
50 55 50
Cys Asp Lys Ile Val Glu Thr Lys Gly Ser Ala Gly Lys Arg Asn Gly
65 70 75 80
Arg Val Ser Ile Arg Asp Ser Pro Ala Asn Leu Ser Phe Thr Val Thr
85 90 g5
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
12
Leu Glu Asn Leu Thr Glu Glu Asp Ala Giy Thr Tyr Trp Cys Gly Val
100 105 110
Asp Thr Pro Trp Leu Arg Asp Phe His Asp Pro Ile Val Glu Val Glu
115 120 125
Val Ser Val Phe Pro Ala Gly Thr Thr Thr Ala Ser Ser Pro Gln Ser
130 135 140
Ser Met Gly Thr Ser Gly Pro Pro Thr Lys Leu Pro Ual His Thr Trp
145 150 155 160
Pro Ser Ual Thr Arg Lys Asp Ser Pro Glu Pro Ser Pro His Pro Gly
165 170 175
Ser Leu Phe Ser Asn Val Arg Phe Leu Leu Leu Val Leu Leu Glu Leu
180 185 190
Pro Leu Leu Leu Ser Met Leu Gly Ala Val Leu Trp Val Asn Arg Pro
195 200 205
Gln Arg Ser Ser Arg Ser Arg Gln Asn Trp Pro Lys Gly Glu Asn Gln
210 215 220
<210> 30
<211> 764
<2I2> PRT
<213> Homo sapiens
<400> 30
Met Leu Leu Phe Val Leu Thr Cys Leu Leu Ala Val Phe Pro Ala Ile
1 5 10 15
Ser Thr Lys Ser Pro Ile Phe Gly Pro Glu Glu Val Asn Ser Val Glu
20 25 30
Gly Asn Ser Val Ser Ile Thr Cys Tyr Tyr Pro Pro Thr Ser Val Asn
35 40 45
Arg His Thr Arg Lys Tyr Trp Cys Arg Gln Gly Ala Arg Gly Gly Cys
50 55 60
Ile Thr Leu Ile Ser Ser Glu Gly Tyr Ual Ser Ser Lys Tyr Ala Gly
65 70 75 80
Arg Ala Asn Leu Thr Asn Phe Pro Glu Asn Gly Thr Phe Ual Val Asn
85 90 95
Ile Ala Gln Leu Ser Gln Asp Asp Ser Gly Arg Tyr Lys Cys Gly Leu
100 105 110
Gly Ile Asn Ser Arg Gly Leu Ser Phe Asp Val Ser Leu Glu Val Ser
115 120 125
Gln Gly Pro Gly Leu Leu Asn Asp Thr Lys Val Tyr Thr Ual Asp Leu
130 135 140
Gly Arg Thr Val Thr Ile Asn Cys Pro Phe Lys Thr Glu Asn Ala Gln
145 150 155 160
Lys Arg Lys Ser Leu Tyr Lys Gln Ile Gly Leu Tyr Pro Val Leu Ual
165 170 175
CA 02331253 2000-12-18
WO 99/66040 PCT/US99/11337
13
Ile Asp Ser Ser Gly Tyr Val Asn Pro Asn Tyr Thr Gly Arg Ile Arg
180 185 190
Leu Asp Ile Gln Gly Thr Gly Gln Leu Leu Phe Ser Val Val Ile Asn
195 200 205
Gln Leu Arg Leu Ser Asp Ala Gly Gln Tyr Leu Cys Gln Ala Gly Asp
210 215 220
Asp Ser Asn Ser Asn Lys Lys Asn Ala Asp Leu Gln Val Leu Lys Pro
225 230 235 240
Glu Pro Glu Leu Val Tyr Glu Asp Leu Arg Gly Ser Val Thr Phe His
245 250 255
Cys Ala Leu Gly Pro Glu Val Ala Asn Val Ala Lys Phe Leu Cys Arg
260 265 270
Gln Ser Ser Gly Glu Asn Cys Asp Val Val Val Asn Thr Leu Gly Lys
275 280 285
Arg Ala Pro Ala Phe Glu Gly Arg Ile Leu Leu Asn Pro Gln Asp Lys
290 295 300
Asp Gly Ser Phe Ser Val Val Ile Thr Gly Leu Arg Lys Glu Asp Ala
305 310 315 320
Gly Arg Tyr Leu Cys Gly Ala His Ser Asp Gly Gln Leu Gln Glu Gly
325 330 335
Ser Pro Ile Gln Ala Trp Gln Leu Phe Val Asn Glu Glu Ser Thr Ile
340 345 350
Pro Arg Ser Pro Thr Val Val Lys Gly Val Ala Gly Ser Ser Val Ala
355 360 365
Val Leu Cys Pro Tyr Asn Arg Lys Glu Ser Lys Ser Ile Lys Tyr Trp
370 375 380
Cys Leu Trp Glu Gly Ala Gln Asn Gly Arg Cys Pro Leu Leu Val Asp
385 390 395 400
Ser Glu Gly Trp Val Lys Ala Gln Tyr Glu Gly Arg Leu Ser Leu Leu
405 410 415
Glu Glu Pro Gly Asn Gly Thr Phe Thr Val Ile Leu Asn Gln Leu Thr
420 425 430
Ser Arg Asp Ala Gly Phe Tyr Trp Cys Leu Thr Asn Gly Asp Thr Leu
435 440 445
Trp Arg Thr Thr Val Glu Ile Lys Ile Ile Glu Gly Glu Pro Asn Leu
450 455 460
Lys Val Pro Gly Asn Val Thr Ala Val Leu Gly Glu Thr Leu Lys Val
465 470 475 480
Pro Cys His Phe Pro Cys Lys Phe Ser Ser Tyr Glu Lys Tyr Trp Cys
485 490 495
Lys Trp Asn Asn Thr Gly Cys Gln Ala Leu Pro Ser Gln Asp Glu Gly
500 505 510
Pro Ser Lys Ala Phe Val Asn Cys Asp Glu Asn Ser Arg Leu Val Ser
515 520 525
Leu Thr Leu Asn Leu Val Thr Arg Ala Asp Glu Gly Trp Tyr Trp Cys
CA 02331253 2000-12-18
WO 99!66040 PC'f/US99/11337
14
530 ~ 535 540
Gly Val Lys Gln Gly His Phe Tyr Gly Glu Thr Ala Ala Val Tyr Val
545 550 555 560
Ala Ual Glu Glu Arg Lys Ala Ala Gly Ser Arg Asp Ual Ser Leu Ala
565 570 575
Lys Ala Asp Ala Ala Pro Asp Glu Lys Val Leu Asp Ser Gly Phe Arg
580 585 590
Glu Ile Glu Asn Lys Ala Ile Gln Asp Pro Arg Leu Phe Ala Glu Glu
595 600 605
Lys Ala Val Ala Asp Thr Arg Asp Gln Ala Asp Gly Ser Arg Ala Ser
610 615 620
Val Asp Ser Gly Ser Ser Glu Glu Gln Gly Gly Ser Ser Arg Ala Leu
625 630 635 640
Val Ser Thr Leu Val Pro Leu Gly Leu Val Leu Ala Ual Gly Ala Val
645 650 655
Ala Val Gly Val Ala Arg Ala Arg His Arg Lys Asn Val Asp Arg Val
660 665 670
Ser Ile Arg Ser Tyr Arg Thr Asp Ile Ser Met Ser Asp Phe Glu Asn
675 680 685
Ser Arg Glu Phe Gly Ala Asn Asp Asn Met Gly Ala Ser Ser Ile Thr
690 695 700
Gln Glu Thr Ser Leu Gly Gly Lys Glu Glu Phe Val Ala Thr Thr Glu
705 710 715 720
Ser Thr Thr Glu Thr Lys Glu Pro Lys Lys Ala Lys Arg Ser Ser Lys
725 730 735
Glu Glu Ala Glu Met Ala Tyr Lys Asp Phe Leu Leu Gln Ser Ser Thr
740 745 750
Ual Ala Ala Glu Ala Gln Asp Gly Pro Gln Glu Ala
755 760
