Note: Descriptions are shown in the official language in which they were submitted.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
Maize Rad50 Orthologue and Uses Thereof
TECHNICAL FIELD
The present invention relates generally to plant molecular biology. More
specifically, it relates to nucleic acids and methods for modulating their
expression in
plants.
BACKGROUND OF THE I1~TVENTION
The RAD50 gene of Saccharomyces cerevisiae plays a crucial role in meiotic
recombination as well as DNA repair during vegetative growth (Kupiec, M. and
Simchen,
G., Mol. Gen. Genet. 193: 525-531, 1984). The yeast RAD50 gene encodes a 153
kDa
protein {Rad50) that contains an ATP- binding site (Walker -B box or P-loop)
in the N-
terminal region and exhibits ATP-dependent DNA binding in vitro (Raymond, W.E.
and
Kleckner, N., Nucleic Acid Res. 16: 3851-3856, 1993). The Rad50 protein also
exhibits
two, 250 amino acid segments of heptad-repeat sequence, which form alpha
helical coiled
coil structures (Alani et al., Genetics 122: 47-57, 1989). In yeast, RAD50
deletion mutants
show a mitotic hyper-recombinational phenotype. The same mutant exhibits
reduced
meiotic double strand break formation and recombination (reviewed in Malkova
et al.,
Genetics 143: 741-754, 1996 and Jeggo, P., Radiation Res. 150: S80-S91, 1998).
Interestingly, similar phenotypes were observed in the deletion mutants for
two
other yeast genes MREl 1 and XRS2, suggesting an involvement of these genes in
double-
strand break repair and homologous recombination (Malkova et al., Genetics
143: 741-
754, 1996; Jeggo, P., Radiation Res. 150: S80-591, 1998). Subsequently,
Jozhuka and
Ogawa demonstrated the interaction of yeast Rad50 and Mrel 1 proteins
(Johzuka, K. and
Ogawa, H., Genetics 139: 1521-1532, 1995). Tsukamoto et al., showed the
involvement of
yeast RAD50, MER11 and XRS2 as well as HDF1 (yeast homologue of Ku70) in
illegitimate or non-homologous end-joining (Tsukamoto, Y. et al., Mol. Gen.
Genet. 255:
543-547, 1997).
Recently, mammalian homologues of yeast RAD50 have been cloned and
characterized extensively (Kim, K, et al., J . Biol. Chem.. 271: 29255-29264,
1996;
Dolganov et al., Mol. Cell. Biol. 16: 4832-4841, 1996; Carney J.P. et al.,
Cell 93: 477-486,
1998; Trujillo, K.M. et al., J. Biol. Chern. 273: 21447-21450, 1998).
Similarly, the
Arabidopsis thaliana chromosome II BACF22D22 region (Accession No. AC006223)
has
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
been found to contain an open reading frame which encodes a protein with
homology to
yeast RAD50 (GI:4263721 ).
Control of homologous recombination or non-homologous end joining by
modulating Rad50 provides the means to modulate the efficiency with which
heterologous
nucleic acids are incorporated into the genomes of a target plant cell.
Control of these
processes has important implications in the creation of novel recombinantly
engineered
crops such as maize. The present invention provides this and other advantages.
SUMMARY OF THE INVENTION
The present invention describes the maize Rad50 protein, which clearly
possesses
features characteristic of other Rad50 proteins, and has a calculated
molecular weight of
152.5 kDa. The maize Rad50 protein is characterized by the presence of an ATP
binding
site in the N-terminal region, a second nucleotide binding site in the C-
terminal region,
putative nuclear localization signals, and heptad-repeats. The presence of
extensive
leucine zipper structures appears to be another striking feature of the Rad50
proteins.
These are also found in the maize Rad50 protein and are indicated in bold in
Figure 1.
The present invention also describes a maize Rad50 polynucleotide sequence.
The maize
Rad50 orthologue of the present invention was used as a probe to map the maize
RADSO
genes) to the short arm of chromosome 4.
Generally, it is the object of the present invention to provide nucleic acids
and
proteins relating to maize Rad50. It is an object of the present invention to
provide: 1)
antigenic fragments of the proteins of the present invention; 2) transgenic
plants
comprising the nucleic acids of the present invention; 3) methods for
modulating, in a
transgenic plant, the expression of the nucleic acids of the present
invention.
Therefore, in one aspect, the present invention relates to an isolated nucleic
acid
comprising a member selected from the group consisting of (a) a polynucleotide
having a
specified sequence identity to a polynucleotide encoding a polypeptide of the
present
invention; (b) a polynucleotide which is complementary to the polynucleotide
of (a); and,
(c) a polynucleotide comprising a specified number of contiguous nucleotides
from a
polynucleotide of (a) or (b). The isolated nucleic acid can be DNA.
In another aspect, the present invention relates to recombinant expression
cassettes,
comprising a nucleic acid of the present invention operably linked to a
promoter.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_;_
In another aspect, the present invention is directed to a host cell into which
has
been introduced the recombinant expression cassette.
In a further aspect, the present invention relates to an isolated protein
comprising a
polypeptide having a specified number of contiguous amino acids encoded by an
isolated
nucleic acid of the present invention.
1n another aspect, the present invention relates to an isolated nucleic acid
comprising a polynucleotide of specified length which selectively hybridizes
under
stringent conditions to a polynucleotide of the present invention, or a
complement thereof.
In some embodiments, the isolated nucleic acid is operably linked to a
promoter.
In another aspect, the present invention relates to a recombinant expression
cassette
comprising a nucleic acid amplified from a library as referred to supra,
wherein the nucleic
acid is operably linked to a promoter. In some embodiments, the present
invention relates
to a host cell transfected with this recombinant expression cassette. In some
embodiments,
the present invention relates to a protein of the present invention that is
produced from this
host cell.
In yet another aspect, the present invention relates to a transgenic plant
comprising
a recombinant expression cassette comprising a plant promoter operably linked
to any of
the isolated nucleic acids of the present invention. The present invention
also provides
transgenic seed from the transgenic plant.
Detnitions
Units, prefixes, and symbols may be denoted in their SI accepted form. Unless
otherwise indicated, nucleic acids are written left to right in 5' to 3'
orientation; amino acid
sequences are written left to right in amino to carboxy orientation,
respectively. Numeric
ranges are inclusive of the numbers defining the range and include each
integer within the
defined range. Amino acids may be referred to herein by either their commonly
known
three letter symbols or by the one-letter symbols recommended by the IUPAC-
IL1B
Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to
by
their commonly accepted single-letter codes. Unless otherwise provided for,
software,
electrical, and electronics terms as used herein are as defined in The New
IEEE Standard
Dictionary of Electrical and Electronics Terms (5'h edition, 1993). The terms
defined
below are more fully defined by reference to the specification as a whole.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-4-
By "amplified" is meant the construction of multiple copies of a nucleic acid
sequence or multiple copies complementary to the nucleic acid sequence using
at least one
of the nucleic acid sequences as a template. Amplification systems include the
polymerase
chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid
sequence
based amplification (NASBA, Cangene, Mississauga, Ontario), Q-Beta Replicase
systems,
transcription-based amplification system (TAS), and strand displacement
amplification
(SDA). See, e.g., Diagnostic Molecular Microbiology: Principles and
Applications, D. H.
Persing et al., Ed., American Society for Microbiology, Washington, D.C.
('1993). The
product of amplification is termed an amplicon.
The term "antibody" includes reference to antigen binding forms of antibodies
(e.g.,
Fab, F(ab)2). The term "antibody" frequently refers to a polypeptide
substantially encoded
by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which
specifically bind and recognize an analyte (antigen). However, while various
antibody
fragments can be defined in terms of the digestion of an intact antibody, one
of skill will
appreciate that such fragments may be synthesized de novo either chemically or
by
utilizing recombinant DNA methodology. Thus, the term antibody, as used
herein, also
includes antibody fragments such as single chain Fv, chimeric antibodies
(i.e., comprising
constant and variable regions from different species), humanized antibodies
(i.e.,
comprising a complementarity determining region (CDR) from a non-human source)
and
heteroconjugate antibodies (e.g., bispecific antibodies).
The term "antigen" includes reference to a substance to which an antibody can
be
generated and/or to which the antibody is specifically immunoreactive. The
specific
immunoreactive sites within the antigen are known as epitopes or antigenic
determinants.
These epitopes can be a linear array of monomers in a polymeric composition -
such as
amino acids in a protein - or consist of or comprise a more complex secondary
or tertiary
structure. Those of skill will recognize that all immunogens (i.e., substances
capable of
eliciting an immune response) are antigens; however some antigens, such as
haptens, are
not immunogens but may be made immunogenic by coupling to a carrier molecule.
An
antibody immunologically reactive with a particular antigen can be generated
irr vivo or by
recombinant methods such as selection of libraries of recombinant antibodies
in phage or
similar vectors. See, e.g., Huse et al., Science 246: 1275-1281 (1989); and
Ward, et al.,
Nature 341: 544-546 (1989); and Vaughan et al.. Nature Biotech. 14: 309-314
(1996).
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-5-
As used herein, "antisense orientation" includes reference to a duplex
polynucleotide sequence that is operably linked to a promoter in an
orientation where the
antisense strand is transcribed. The antisense strand is sufficiently
complementary to an
endogenous transcription product such that translation of the endogenous
transcription
product is often inhibited.
As used herein, "chromosomal region" includes reference to a length of a
chromosome that may be measured by reference to the linear segment of DNA that
it
comprises. The chromosomal region can be defined by reference to two unique
DNA
sequences, i.e., markers.
The term "conservatively modified variants" applies to both amino acid and
nucleic
acid sequences. With respect to particular nucleic acid sequences,
conservatively modified
variants refers to those nucleic acids which encode identical or
conservatively modified
variants of the amino acid sequences. Because of the degeneracy of the genetic
code, a
large number of functionally identical nucleic acids encode any given protein.
For
instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus,
at every position where an alanine is specified by a codon, the codon can be
altered to any
of the corresponding codons described without altering the encoded
polypeptide. Such
nucleic acid variations are "silent variations" and represent one species of
conservatively
modified variation. Every nucleic acid sequence herein that encodes a
polypeptide also, by
reference to the genetic code, describes every possible silent variation of
the nucleic acid.
One of ordinary skill will recognize that each codon in a nucleic acid (except
AUG, which
is ordinarily the only codon for methionine; and UGG , which is ordinarily the
only codon
for tryptophan) can be modified to yield a functionally identical molecule.
Accordingly,
each silent variation of a nucleic acid which encodes a polypeptide of the
present invention
is implicit in each described polypeptide sequence and is within the scope of
the present
mvenrion.
As to amino acid sequences, one of skill will recognize that individual
substitutions, deletions or additions to a nucleic acid, peptide, polypeptide,
or protein
sequence which alters, adds or deletes a single amino acid or a small
percentage of amino
acids in the encoded sequence is a "conservatively modified variant" where the
alteration
results in the substitution of an amino acid with a chemically similar amino
acid. Thus,
any number of amino acid residues selected from the group of integers
consisting of from 1
to 15 can be so altered. Thus, for example, l, 2, 3, 4, 5, 7, or 10
alterations can be made.
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
_c,_
Conservatively modified variants typically provide similar biological activity
as the
unmodified polypeptide sequence from which they are derived. For example,
substrate
specificity, enzyme activity, or ligand/receptor binding is generally at least
30%, 40%,
50%, 60%, 70%, 80%, or 90% of the native protein for its native substrate.
Conservative
substitution tables providing functionally similar amino acids are well known
in the art.
The following six groups each contain amino acids that are conservative
substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
See also, Creighton (1984) Proteins W.H. Freeman and Company.
1 ~ By "encoding" or "encoded", with respect to a specified nucleic acid, is
meant
comprising the information for translation into the specified protein. A
nucleic acid
encoding a protein may comprise non-translated sequences (e.g., introns)
within translated
regions of the nucleic acid, or may lack such intervening non-translated
sequences (e.g., as
in cDNA). The information by which a protein is encoded is specified by the
use of
codons. Typically, the amino acid sequence is encoded by the nucleic acid
using the
"universal" genetic code. However, variants of the universal code, such as are
present in
some plant, animal, and fungal mitochondria, the bacterium Mycoplasma
capricolum, or
the ciliate Macr-onucleus, may be used when the nucleic acid is expressed
therein.
When the nucleic acid is prepared or altered synthetically, advantage can be
taken
of known codon preferences of the intended host where the nucleic acid is to
be expressed.
For example, although nucleic acid sequences of the present invention may be
expressed in
both monocotyledonous and dicotyledonous plant species, sequences can be
modified to
account for the specific codon preferences and GC content preferences of
monocotyledons
or dicotyledons as these preferences have been shown to differ (hurray et al.
Nucl. Acids
Res. 17: 477-498 ( 1989)). Thus, the maize preferred codon for a particular
amino acid may
be derived from known gene sequences from maize. Maize codon usage for 28
genes from
maize plants are listed in Table 4 of hurray et al., supra.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
As used herein "full-length sequence" in reference to a specified
polynucleotide or
its encoded protein means having the entire amino acid sequence of, a native
(non-
synthetic), endogenous, biologically active form of the specified protein.
Methods to
determine whether a sequence is full-length are well known in the art
including such
exemplary techniques as northern or western blots, primer extension, S 1
protection, and
ribonuclease protection. See, e.g., Plant Molecular Biology: A Laboratory
Manual, Clark,
Ed., Springer-Verlag, Berlin (1997). Comparison to known full-length
homologous
(orthologous and/or paralogous) sequences can also be used to identify full-
length
sequences of the present invention. Additionally, consensus sequences
typically present at
the 5' and 3' untranslated regions of mRNA aid in the identification of a
polynucleotide as
full-length. For example, the consensus sequence ANNNNAUGG, where the
underlined
codon represents the N-terminal methionine, aids in determining whether the
polynucleotide has a complete 5' end. Consensus sequences at the 3' end, such
as
polyadenylation sequences, aid in determining whether the polynucleotide has a
complete
3' end.
As used herein, "heterologous" in reference to a nucleic acid is a nucleic
acid that
originates from a foreign species, or, if from the same species, is
substantially modified
from its native form in composition and/or genomic locus by deliberate human
intervention. For example, a promoter vperably linked to a heterologous
structural gene is
from a species different from that from which the structural gene was derived,
or, if from
the same species, one or both are substantially modified from their original
forni. A
heterologous protein may originate from a foreign species or, if from the same
species, is
substantially modified from its original form by deliberate human
intervention.
By "host cell" is meant a cell which contains a vector and supports the
replication
and/or expression of the vector. Host cells may be prokaryotic cells such as
E. coli, or
eukaryotic cells such as yeast, insect, amphibian. or mammalian cells.
Preferably, host
cells are monocotyledonous or dicotyledonous plant cells. A particularly
preferred
monocotyledonous host cell is a maize host cell.
The term "hybridization complex" includes reference to a duplex nucleic acid
structure formed by two single-stranded nucleic acid sequences selectively
hybridized with
each other.
By "immunologically reactive conditions" or "immunoreactive conditions" is
meant
conditions which allow an antibody, reactive to a particular epitope, to bind
to that epitope
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_g_
to a detectably greater degree (e.g., at least 2-fold over background) than
the antibody
binds to substantially any other epitopes in a reaction mixture comprising the
particular
epitope. Immunologically reactive conditions are dependent upon the format of
the
antibody binding reaction and typically are those utilized in immunoassay
protocols. See
Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor
Publications,
New York ( 1988), for a description of immunoassay formats and conditions.
The term "introduced" in the context of inserting a nucleic acid into a cell,
means
"transfection" or "transformation" or "transduction" and includes reference to
the
incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where
the nucleic acid
may be incorporated into the genome of the cell (e.g., chromosome, plasmid,
plastid or
mitochondria) DNA), converted into an autonomous replicon, or transiently
expressed
(e.g., transfected mRNA).
The terms "isolated" refers to material, such as a nucleic acid or a protein,
which is:
( 1 ) substantially or essentially free from components that normally
accompany or interact
1 S with it as found in its naturally occurring environment. The isolated
material optionally
comprises material not found with the material in its natural environment; or
(2) if the
material is in its natural environment, the material has been synthetically
(non-naturally)
altered by deliberate human intervention to a composition and/or placed at a
location in the
cell (e.g., genome or subcellular organelle) not native to a material found in
that
environment. The alteration to yield the synthetic material can be performed
on the
material within or removed from its natural state. For example, a naturally
occurring
nucleic acid becomes an isolated nucleic acid if it is altered, or if it is
transcribed from
DNA which has been altered, by means of human intervention performed within
the cell
from which it originates. See, e.g., Compounds and Methods for Site Directed
Mutagenesis
in Eukaryotic Cells, Kmiec, U.S. Patent No. 5,565,350; In Vivo Homologous
Sequence
Targeting in Eukaryotic Cells; Zarling et al., PCT/US93/03868. Likewise. a
naturally
occurring nucleic acid (e.g., a promoter) becomes isolated if it is introduced
by non-
naturally occurring means to a locus of the genome not native to that nucleic
acid. Nucleic
acids which are "isolated" as defined herein, are also referred to as
"heterologous" nucleic
acids.
Unless otherwise stated, the term "maize Rad50 nucleic acid" is a nucleic acid
of
the present invention and means a nucleic acid comprising a polynucleotide of
the present
invention (a "maize Rad50 polvnucleotide") encoding a maize Rad50 polypeptide.
A
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-9-
"maize Rad50 gene" is a gene of the present invention and refers to a
heterologous
genomic form of a full-length maize Rad50 polynucleotide.
As used herein, "localized within the chromosomal region defined by and
including" with respect to particular markers includes reference to a
contiguous length of a
chromosome delimited by and including the stated markers.
As used herein, "marker" includes reference to a locus on a chromosome that
serves
to identify a unique position on the chromosome. A "polymorphic marker"
includes
reference to a marker which appears in multiple forms (alleles) such that
different forms of
the marker, when they are present in a homologous pair, allow transmission of
each of the
chromosomes of that pair to be followed. A genotype may be defined by use of
one or a
plurality of markers.
As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or
ribonucleotide polymer in either single- or double-stranded form, and unless
otherwise
limited, encompasses known analogues having the essential nature of natural
nucleotides
in that they hybridize to single-stranded nucleic acids in a manner similar to
naturally
occurring nucleotides (e.g., peptide nucleic acids).
By "nucleic acid library" is meant a collection of isolated DNA or RNA
molecules
which comprise and substantially represent the entire transcribed fraction of
a genome of a
specified organism. Construction of exemplary nucleic acid libraries, such as
genomic and
cDNA libraries, is taught in standard molecular biology references such as
Berger and
Kimmel, Guide to Molecular Cloning Techniques. Methods in Enzymology, Vol.
152,
Academic Press, Inc., San Diego, CA (Berger); Sambrook et al., Molecular
Cloning - A
Laboratory Manual, 2nd ed., Vol. 1-3 (1989); and Current Protocols in
Molecular
Biology, F.M. Ausubel et al., Eds., Current Protocols, a joint venture between
Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994).
As used herein "operably linked" includes reference to a functional linkage
between
a promoter and a second sequence, wherein the promoter sequence initiates and
mediates
transcription of the DNA sequence corresponding to the second sequence.
Generally,
operably linked means that the nucleic acid sequences being linked are
contiguous and,
where necessary to join two protein coding regions, contiguous and in the same
reading
frame.
As used herein, the terns "plant" includes reference to whole plants, plant
organs
(e.g., leaves, stems, roots, etc.), seeds and plant cells and progeny of same.
Plant cell, as
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-~o-
used herein includes, without limitation, seeds, suspension cultures, embryos,
meristematic
regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes,
pollen, and
microspores. The class of plants which can be used in the methods of the
invention is
generally as broad as the class of higher plants amenable to transformation
techniques,
including both monocotyledonous and dicotyledonous plants. A particularly
preferred
plant is Zea mays.
As used herein, "polynucleotide" includes reference to a
deoxyribopolynucleotide,
ribopolynucleotide, or analogs thereof that have the essential nature of a
natural
ribonucleotide in that they hybridize, under stringent hybridization
conditions, to
substantially the same nucleotide sequence as naturally occurnng nucleotides
and/or allow
translation into the same amino acids) as the naturally occurring
nucleotide(s). A
polynucleotide can be full-length or a subsequence of a native or heterologous
structural or
regulatory gene. Unless otherwise indicated, the term includes reference to
the specified
sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs
with
backbones modified for stability or for other reasons are "polynucleotides" as
that term is
intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as
inosine, or
modified bases, such as tritylated bases, to name just two examples, are
polynucleotides as
the term is used herein. It will be appreciated that a great variety of
modifications have been
made to DNA and RNA that serve many useful purposes known to those of skill in
the art.
The term polynucleotide as it is employed herein embraces such chemically,
enzymatically or
metabolically modified forms of polynucleotides, as well as the chemical forms
of DNA and
RNA characteristic of viruses and cells, including among other things, simple
and complex
cells.
The terms "polypeptide", "peptide" and "protein" are used interchangeably
herein to
refer to a polymer of amino acid residues. The terms apply to amino acid
polymers in
which one or more amino acid residue is an artificial chemical analogue of a
corresponding
naturally occurring amino acid, as well as to naturally occurnng amino acid
polymers. The
essential nature of such analogues of naturally occurring amino acids is that,
when
incorporated into a protein, that protein is specifically reactive to
antibodies elicited to the
same protein but consisting entirely of naturally occurring amino acids. The
terms
"polypeptide", "peptide" and "protein" are also inclusive of modifications
including, but not
limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid
residues, hydroxylation and ADP-ribosylation. It will be appreciated, as is
well known and
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
-tt -
as noted above, that polypeptides are not always entirely linear. For
instance, polypeptides
may be branched as a result of ubiquitination, and they may be circular, with
or without
branching, generally as a result of posttranslation events, including natural
processing event
and events brought about by human manipulation which do not occur naturally.
Circular,
S branched and branched circular polypeptides may be synthesized by non-
translation natural
process and by entirely synthetic methods, as well. Further, this invention
contemplates the
use of both the methionine-containing and the methionine-less amino terminal
variants of
the protein of the invention.
As used herein "promoter" includes reference to a region of DNA upstream from
the start of transcription and involved in recognition and binding of RNA
polymerase and
other proteins to initiate transcription. A "plant promoter" is a promoter
capable of
initiating transcription in plant cells whether nor not its origin is a plant
cell. Exemplary
plant promoters include, but are not limited to, those that are obtained from
plants, plant
viruses, and bacteria which comprise genes expressed in plant cells such
Agrobacterium or
Rhizobium. Examples of promoters under developmental control include promoters
that
preferentially initiate transcription in certain tissues, such as leaves,
roots, or seeds. Such
promoters are referred to as "tissue preferred". Promoters which initiate
transcription only
in certain tissue are referred to as "tissue specific". A "cell type" specific
promoter
primarily drives expression in certain cell types in one or more organs, for
example,
vascular cells in roots or leaves. An "inducible" or "repressible" promoter is
a promoter
which is under environmental control. Examples of environmental conditions
that may
effect transcription by inducible promoters include anaerobic conditions or
the presence of
light. Tissue specific, tissue preferred, cell type specific, and inducible
promoters
constitute the class of "non-constitutive" promoters. A "constitutive"
promoter is a
promoter which is active under most environmental conditions.
The term "maize Rad50 polypeptide" is a polypeptide of the present invention
and
refers to one or more amino acid sequences, in glycosylated or non-
glycosylated form. The
term is also inclusive of fragments, variants, homologs, alleles or precursors
(e.a.,
preproproteins or proproteins) thereof. A "maize Rad50 protein" is a protein
of the present
invention and comprises a maize Rad50 polypeptide.
As used herein "recombinant" includes reference to a cell or vector, that has
been
modified by the introduction of a heterologous nucleic acid or that the cell
is derived from
a cell so modified. Thus, for example, recombinant cells express genes that
are not found
CA 02333434 2001-O1-10
WO 00168404 PCT/US00/11086
_>?_
in identical form within the native (non-recombinant) form of the cell or
express native
genes that are otherwise abnormally expressed, under-expressed or not
expressed at all as a
result of deliberate human intervention. The term "recombinant" as used herein
does not
encompass the alteration of the cell or vector by naturally occurring events
(e.g.,
spontaneous mutation, natural transformation/transduction/transposition) such
as those
occurring without deliberate human intervention.
As used herein, a "recombinant expression cassette" is a nucleic acid
construct,
generated recombinantly or synthetically, with a series of specif ed nucleic
acid elements
which permit transcription of a particular nucleic acid in a host cell. The
recombinant
expression cassette can be incorporated into a plasmid, chromosome,
mitochondria) DNA,
plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant
expression
cassette portion of an expression vector includes, among other sequences, a
nucleic acid to
be transcribed, and a promoter.
The term "residue" or "amino acid residue" or "amino acid" are used
interchangeably herein to refer to an amino acid that is incorporated into a
protein,
polypeptide, or peptide (collectively "protein"). The amino acid may be a
naturally
occurring amino acid and, unless otherwise limited, may encompass non-natural
analogs of
natural amino acids that can function in a similar manner as naturally
occurring amino
acids.
The term "selectively hybridizes" includes reference to hybridization, under
stringent hybridization conditions, of a nucleic acid sequence to a specified
nucleic acid
target sequence to a detectably greater degree (e.g., at least 2-fold over
background) than
its hybridization to non-target nucleic acid sequences and to the substantial
exclusion of
non-target nucleic acids. Selectively hybridizing sequences typically have
about at least
80% sequence identity, preferably 90% sequence identity, and most preferably
100%
sequence identity (i.e., complementary) with each other.
The term "specifically reactive", includes reference to a binding reaction
between
an antibody and a protein having an epitope recognized by the antigen binding
site of the
antibody. This binding reaction is determinative of the presence of a protein
having the
recognized epitope amongst the presence of a heterogeneous population of
proteins and
other biologics. Thus, under designated immunoassay conditions, the specified
antibodies
bind to an analyte having the recognized epitope to a substantially greater
degree (e.g., at
CA 02333434 2001-O1-10
WO 00/68404 PCT~'US00/11086
_13_
least 2-fold over background) than to substantially all analytes lacking the
epitope which
are present in the sample.
Specific binding to an antibody under such conditions may require an antibody
that
is selected for its specificity for a particular protein. For example,
antibodies raised to the
polypeptides of the present invention can be selected from to obtain
antibodies specifically
reactive with polypeptides of the present invention. The proteins used as
immunogens can
be in native conformation or denatured so as to provide a linear epitope.
A variety of immunoassay formats may be used to select antibodies specifically
reactive with a particular protein (or other analyte). For example, solid-
phase ELISA
immunoassays are routinely used to select monoclonal antibodies specifically
immunoreactive with a protein. See Harlow and Lane, Antibodies, A Laboratory
Manual,
Cold Spring Harbor Publications, New York (1988), for a description of
immunoassay
formats and conditions that can be used to determine selective reactivity.
The term "stringent conditions" or "stringent hybridization conditions"
includes
reference to conditions under which a probe will hybridize to its target
sequence, to a
detectably greater degree than to other sequences (e.g., at least 2-fold over
background).
Stringent conditions are sequence-dependent and will be different in different
circumstances. By controlling the stringency of the hybridization and/or
washing
conditions, target sequences can be identified which are 100% complementary to
the probe
(homologous probing). Alternatively, stringency conditions can be adjusted to
allow some
mismatching in sequences so that lower degrees of similarity are detected
(heterologous
probing). Generally, a probe is less than about 1000 nucleotides in length,
optionally less
than 500 nucleotides in length.
Typically, stringent conditions will be those in which the salt concentration
is less
than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration
(or other
salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for
short probes (e.g., 10
to SO nucleotides) and at least about 60°C for long probes (e.g..
greater than 50
nucleotides). Stringent conditions may also be achieved with the addition of
destabilizing
agents such as formamide. Exemplary low stringency conditions include
hybridization
with a buffer solution of 30 to 35% formamide, 1 M NaCI, 1 % SDS (sodium
dodecyl
sulphate) at 37°C, and a wash in 1 X to 2X SSC (20X SS(: = 3.0 M
NaC1/0.3 M trisodium
citrate) at 50 to 55°C. Exemplary moderate stringency conditions
include hybridization in
to 45% formamide, 1 M NaCI, 1% SDS at 37°C, and a wash in O.SX to 1X
SSC at 55 to
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
60°C. Exemplary high stringency conditions include hybridization in SO%
formamide, 1
M NaCI, 1% SDS at 37°C, and a wash in O.1X SSC at 60 to
65°C.
Specificity is typically the function of post-hybridization washes, the
critical factors
being the ionic strength and temperature of the final wash solution. For DNA-
DNA
hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl,
Anal.
Biochem., 138:267-284 (1984): Tm = 81.5 °C + 16.6 (log M) + 0.41 (%GC} -
0.61 (%
form) - 500/L; where M is the molarity of monovalent cations, %GC is the
percentage of
guanosine and cytosine nucleotides in the DNA, % form is the percentage of
formamide in
the hybridization solution, and L is the length of the hybrid in base pairs.
The Tm is the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target
sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1
°C for each
1 % of mismatching; thus, Tm, hybridization andior wash conditions can be
adjusted to
hybridize to sequences of the desired identity. For example, if sequences with
>90%
identity are sought, the Tm can be decreased 10 °C. Generally,
stringent conditions are
selected to be about 5 °C lower than the thermal melting point (Tm) for
the specific
sequence and its complement at a defined ionic strength and pH. However,
severely
stringent conditions can utilize a hybridization and/or wash at l, 2, 3, or 4
°C lower than
the thermal melting point (Tr"); moderately stringent conditions can utilize a
hybridization
and/or wash at 6, 7, 8, 9, or 10 °C lower than the thermal melting
point (Tm); low
stringency conditions can utilize a hybridization and/or wash at 11, 12, 13,
14, 15, or 20 °C
lower than the thermal melting point (Tm). Using the equation, hybridization
and wash
compositions, and desired Tm, those of ordinary skill will understand that
variations in the
stringency of hybridization and/or wash solutions are inherently described. If
the desired
degree of mismatching results in a Tm of less than 4~ °C (aqueous
solution) or 32 °C
(formamide solution} it is preferred to increase the SSC concentration so that
a higher
temperature can be used. An extensive guide to the hybridization of nucleic
acids is found
in Tijssen, . -Laboraton~ Technigues in Biochemistrw and Molecular Biology--
Hybridization
with Nucleic Acid Probes. Part I, Chapter 2 "Oven~iew of principles of
hybridization and
the strategy of nucleic acid probe assays", Elsevier. New York ( 1993); and
Current
Protocols in Molecular Biologh, Chapter 2, Ausubel. et al., Eds., Greene
Publishing and
Wiley-Interscience, New York (1995).
As used herein, "transgenic plant" includes reference to a plant which
comprises
within its genome a heterologous polynucleotide. Generally, the heterologous
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
-[S-
polynucleotide is stably integrated within the genome such that the
polynucleotide is
passed on to successive generations. The heterologous polynucleotide may be
integrated
into the genome alone or as part of a recombinant expression cassette.
"Transgenic" is used
herein to include any cell, cell line, callus, tissue, plant part or plant,
the genotype of which
has been altered by the presence of heterologous nucleic acid including those
transgenics
initially so altered as well as those created by sexual crosses or asexual
propagation from
the initial transgenic. The term "transgenic" as used herein does not
encompass the
alteration of the genome (chromosomal or extra-chromosomal) by conventional
plant
breeding methods or by naturally occurnng events such as random cross-
fertilization, non-
recombinant viral infection, non-recombinant bacterial transformation, non-
recombinant
transposition, or spontaneous mutation.
As used herein, "vector" includes reference to a nucleic acid used in
transfection of
a host cell and into which can be inserted a polynucleotide. Vectors are often
replicons.
Expression vectors permit transcription of a nucleic acid inserted therein.
The following terms are used to describe the sequence relationships between
two or
more nucleic acids or polynucleotides: (a) "reference sequence", (b)
"comparison
window", (c) "sequence identity", (d) "percentage of sequence identity", and
(e)
"substantial identity".
(a) As used herein, "reference sequence" is a defined sequence used as a basis
for
sequence comparison. A reference sequence may be a subset or the entirety of a
specified
sequence; for example, as a segment of a full-length cDNA or gene sequence, or
the
complete cDNA or gene sequence.
(b) As used herein, "comparison window" includes reference to a contiguous and
specified segment of a polynucleotide/polypeptide sequence, wherein the
polynucleotide/polypeptide sequence may be compared to a reference sequence
and
wherein the portion of the polynucleotide/polypeptide sequence in the
comparison window
may comprise additions or deletions (i.e., gaps) compared to the reference
sequence (which
does not comprise additions or deletions) for optimal alignment of the two
sequences.
Generally, the comparison window is at least 20 contiguous nucleotides/amino
acids
residues in length, and optionally can be 30, 40, 50, 100, or longer. Those of
skill in the art
understand that to avoid a high similarity to a reference sequence due to
inclusion of gaps
in the polynucleotide/polypeptide sequence, a gap penalty is typically
introduced and is
subtracted from the number of matches.
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
_w _
Methods of alignment of sequences for comparison are well-known in the art.
Optimal alignment of sequences for comparison may be conducted by the local
homology
algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); by the
homology
alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); by
the
search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. 85:
2444
(1988); by computerized implementations of these algorithms, including, but
not limited
to: CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View,
California;
GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software
Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wisconsin,
USA;
the CLUSTAL program is well described by Higgins and Sharp, Gene 73: 237-244
(1988);
Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al., Nucleic Acids
Research
16: 10881-90 (1988); Huang, et al., Computer Applications in the Biosciences
8: 155-65
(1992), and Pearson, et al., Methods in Molecular Biology 24: 307-331 (1994).
The BLAST family of programs which can be used for database similarity
searches
includes: BLASTN for nucleotide query sequences against nucleotide database
sequences;
BLASTX for nucleotide query sequences against protein database sequences;
BLASTP for
protein query sequences against protein database sequences; TBLASTN for
protein query
sequences against nucleotide database sequences; and TBLASTX for nucleotide
query
sequences against nucleotide database sequences. See, Current Protocols in
Molecular
Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-
Interscience, New
York ( 1995 ).
Software for performing BLAST analyses is publicly available, e.g., through
the
National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
This
algorithm involves first identifying high scoring sequence pairs (HSPs) by
identifying short
words of length W in the query sequence, which either match or satisfy some
positive-
valued threshold score T when aligned with a word of the same length in a
database
sequence. T is referred to as the neighborhood word score threshold. These
initial
neighborhood word hits act as seeds for initiating searches to find longer
HSPs containing
them. The word hits are then extended in both directions along each sequence
for as far as
the cumulative alignment score can be increased. Cumulative scores are
calculated using,
for nucleotide sequences, the parameters M (reward score for a pair of
matching residues;
always > 0) and N (penalty score for mismatching residues; always < 0). For
amino acid
sequences, a scoring matrix is used to calculate the cumulative score.
Extension of the
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
t~-
word hits in each direction are halted when: the cumulative alignment score
falls off by the
quantity X from its maximum achieved value; the cumulative score goes to zero
or below,
due to the accumulation of one or more negative-scoring residue alignments; or
the end of
either sequence is reached. The BLAST algorithm parameters W, T, and X
determine the
sensitivity and speed of the alignment. The BLASTN program (for nucleotide
sequences)
uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of
100, M=5,
N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP
program
uses as defaults a wordlength (W) of 3, an expectation {E) of 10, and the
BLOSUM62
scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA
89:10915).
In addition to calculating percent sequence identity, the BLAST algorithm also
performs a statistical analysis of the similarity between two sequences (see,
e.g., Karlin &
Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5877 (1993)). One measure of
similarity
provided by the BLAST algorithm is the smallest sum probability (P(N)), which
provides
an indication of the probability by which a match between two nucleotide or
amino acid
sequences would occur by chance.
BLAST searches assume that proteins can be modeled as random sequences.
However, many real proteins comprise regions of nonrandom sequences which may
be
homopolymeric tracts, short-period repeats, or regions enriched in one or more
amino
acids. Such low-complexity regions may be aligned between unrelated proteins
even
though other regions of the protein are entirely dissimilar. A number of low-
complexity
filter programs can be employed to reduce such low-complexity alignments. For
example,
the SEG (Wooten and Federhen, Comput. Chem., 17:149-163 (1993)) and XNU
{Claverie
and States, Comput. Chent., 1?:191-201 (1993)) low-complexity filters can be
employed
alone or in combination.
GAP can also be used to compare a polynucleotide or polypeptide of the present
invention with a reference sequence. GAP uses the algorithm of Needleman and
Wunsch
(J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete
sequences that
maximizes the number of matches and minimizes the number of gaps. GAP
considers all
possible alignments and gap positions and creates the alignment with the
largest number of
matched bases and the fewest gaps. It allows for the provision of a gap
creation penalty
and a gap extension penalty in units of matched bases. GAP must make a profit
of gap
creation penalty number of matches for each gap it inserts. If a gap extension
penalty
greater than zero is chosen. GAP must, in addition, make a profit for each gap
inserted of
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_m_
the length of the gap times the gap extension penalty. Default gap creation
penalty values
and gap extension penalty values in Version 10 of the Wisconsin Genetics
Software
Package for protein sequences are 8 and 2, respectively. For nucleotide
sequences the
default gap creation penalty is 50 while the default gap extension penalty is
3. The gap
creation and gap extension penalties can be expressed as an integer selected
from the group
of integers consisting of from 0 to 200. Thus, for example, the gap creation
and gap
extension penalties can each independently be: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 1 S, 20, 30, 40,
S0, 60, 65 or greater.
GAP presents one member of the family of best alignments. There may be many
members of this family, but no other member has a better quality. GAP displays
four
figures of merit for alignments: Quality, Ratio, Identity, and Similarity. The
Quality is the
metric maximized in order to align the sequences. Ratio is the quality divided
by the
number of bases in the shorter segment. Percent Identity is the percent of the
symbols that
actually match. Percent Similarity is the percent of the symbols that are
similar. Symbols
I S that are across from gaps are ignored. A similarity is scored when the
scoring matrix value
for a pair of symbols is greater than or equal to 0.50, the similarity
threshold. The scoring
matrix used in Version 10 of the Wisconsin Genetics Software Package is
BLOSUM62
(see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. I~SA 89:10915).
Unless otherwise stated, sequence identity/similarity values provided herein
refer to
the value obtained using the BLAST 2.0 suite of programs using default
parameters
(Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997; Altschul et al., J.
Mol. Bio. 21 ~:
403-410, 1990) or to the value obtained using the GAP program using default
parameters
{see the Wisconsin Genetics Software Package, Genetics Computer Group (GCG),
575
Science Dr., Madison, Wisconsin, USA).
(c) As used herein, "sequence identity" or "identity" in the context of two
nucleic
acid or polypeptide sequences includes reference to the residues in the two
sequences
which are the same when aligned for maximum correspondence over a specified
comparison window. When percentage of sequence identity is used in reference
to
proteins it is recognized that residue positions which are not identical often
differ by
conservative amino acid substitutions, where amino acid residues are
substituted for other
amino acid residues with similar chemical properties (e.~. charge or
hydrophobicity) and
therefore do not change the functional properties of the molecule. Where
sequences differ
in conservative substitutions, the percent sequence identity may be adjusted
upwards to
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-~9-
correct for the conservative nature of the substitution. Sequences which
differ by such
conservative substitutions are said to have "sequence similarity" or
"similarity". Means for
making this adjustment are well-known to those of skill in the art. Typically
this involves
scoring a conservative substitution as a partial rather than a full mismatch,
thereby
increasing the percentage sequence identity. Thus, for example, where an
identical amino
acid is given a score of 1 and a non-conservative substitution is given a
score of zero, a
conservative substitution is given a score between zero and 1. The scoring of
conservative
substitutions is calculated, e.g., according to the algorithm of Meyers and
Miller, Computer
Applic. Biol. Sci., 4: 11-17 (1988) e.g., as implemented in the program
PC/GENE
(Intelligenetics, Mountain View, California, USA).
(d) As used herein, "percentage of sequence identity" means the value
determined
by comparing two optimally aligned sequences over a comparison window, wherein
the
portion of the polynucleotide sequence in the comparison window may comprise
additions
or deletions (i.e., gaps) as compared to the reference sequence (which does
not comprise
additions or deletions) for optimal alignment of the two sequences. The
percentage is
calculated by determining the number of positions at which the identical
nucleic acid base
or amino acid residue occurs in both sequences to yield the number of matched
positions,
dividing the number of matched positions by the total number of positions in
the window
of comparison and multiplying the result by 100 to yield the percentage of
sequence
identity.
(e) (i) The term "substantial identity" of polynucleotide sequences means that
a
polynucleotide comprises a sequence that has at least 70% sequence identity,
preferably at
least 80°io, more preferably at least 90% and most preferably at least
95%, compared to a
reference sequence using one of the alignment programs described using
standard
parameters. One of skill will recognize that these values can be appropriately
adjusted to
determine corresponding identity of proteins encoded by two nucleotide
sequences by
taking into account codon degeneracy, amino acid similarity, reading frame
positioning
and the like. Substantial identity of amino acid sequences for these purposes
normally
means sequence identity of at least 60°ro, more preferably at least
70%, 80°,%, 90°ro, and
most preferably at least 95%.
Another indication that nucleotide sequences are substantially identical is if
two
molecules hybridize to each other under stringent conditions. However, nucleic
acids
which do not hybridize to each other under stringent conditions are still
substantially
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
-zo-
identical if the polypeptides which they encode are substantially identical.
This may occur,
e.g., when a copy of a nucleic acid is created using the maximum codon
degeneracy
permitted by the genetic code. One indication that two nucleic acid sequences
are
substantially identical is that the polypeptide which the first nucleic acid
encodes is
immunologically cross reactive with the polypeptide encoded by the second
nucleic acid.
(e) (ii) The terms "substantial identity" in the context of a peptide
indicates that a
peptide comprises a sequence with at least 70% sequence identity to a
reference sequence,
preferably 80%, more preferably 85%, most preferably at least 90% or 95%
sequence
identity to the reference sequence over a specified comparison window.
Optionally,
optimal alignment is conducted using the homology alignment algorithm of
Needleman
and Wunsch, J. Mol. Biol. 48: 443 (1970). An indication that two peptide
sequences are
substantially identical is that one peptide is immunologically reactive with
antibodies
raised against the second peptide. Thus, a peptide is substantially identical
to a second
peptide, for example, where the two peptides differ only by a conservative
substitution.
Peptides which are "substantially similar" share sequences as noted above
except that
residue positions which are not identical may differ by conservative amino
acid changes.
DETAILED DESCRIPTION OF THE INVENTION
Overview
The present invention provides, among other things, compositions and methods
for
modulating (i.e., increasing or decreasing) the level of polynucleotides and
polypeptides of
the present invention in plants. In particular, the polynucleotides and
polypeptides of the
present invention can be expressed temporally or spatially, e.g., at
developmental stages, in
tissues, and/or in quantities, which are uncharacteristic of non-recombinantly
engineered
plants. Thus, the present invention provides utility in such exemplary
applications as in
the control of recombination efficiency or transformation efficiency in
plants.
The present invention also provides isolated nucleic acid comprising
polynucleotides of sufficient length and complementarity to a gene of the
present invention
to use as probes or amplification primers in the detection, quantitation, or
isolation of gene
transcripts. For example, isolated nucleic acids of the present invention can
be used as
probes in detecting deficiencies in the level of mRNA in screenings for
desired transgenic
plants, for detecting mutations in the gene (e.g., substitutions, deletions,
or additions), for
monitoring upregulation of expression or changes in enzyme activity in
screening assays of
CA 02333434 2001-O1-10
WO 00/68404 PCT~'US00/11086
-21 -
compounds, for detection of any number of allelic variants (polymorphisms),
orthologs, or
paralogs of the gene, or for site directed mutagenesis in eukaryotic cells
(see, e.g., U.S.
Patent No. 5,565,350). The isolated nucleic acids of the present invention can
also be used
for recombinant expression of their encoded polypeptides, or for use as
immunogens in the
S preparation and/or screening of antibodies. The isolated nucleic acids of
the present
invention can also be employed for use in sense or antisense suppression of
one or more
genes of the present invention in a host cell, tissue, or plant. Attachment of
chemical
agents which bind, intercalate, cleave and/or crosslink to the isolated
nucleic acids of the
present invention can also be used to modulate transcription or translation.
The present invention also provides isolated proteins comprising a polypeptide
of
the present invention (e.g., preproenzyme, proenzyme, or enzymes). The present
invention
also provides proteins comprising at least one epitope from a polypeptide of
the present
invention. The proteins of the present invention can be employed in assays for
enzyme
agonists or antagonists of enzyme function, or for use as immunogens or
antigens to obtain
antibodies specifically immunoreactive with a protein of the present
invention. Such
antibodies can be used in assays for expression levels, for identifying and/or
isolating
nucleic acids of the present invention from expression libraries, for
identification of
homologous polypeptides from other species, or for purification of
polypeptides of the
present invention.
The isolated nucleic acids and polypeptides of the present invention can be
used
over a broad range of plant types, particularly monocots such as the species
of the family
Gramineae including Hordeum, Secale, Triticum, Sorghum {e.g., S. bicolor),
Orvza,
Avena, and Zea (e.g., Z. mat's). The isolated nucleic acid and proteins of the
present
invention can also be used in species from the genera: Cucurbita, Rosa, Vitis,
Juglans,
Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonellcr, Vigna, Citrus,
Linum.
Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa,
Capsicum, Datura, Hyoscvamus, Lycopersicon, Nicotiana, Solanunt, Petunia,
Digitalis,
Majorana, Ciahorium, Helianthus, Lactuca, Bronrus, Asparagus, Antirrhinum,
Heter-ocallis, Nemesis. Pelargonium, Panieurn, Pennisetum, Ranunculacs,
Senecio,
Salpiglossis, Cucumis, Browaalia, Glycine, Pisum. Phaseolus, and Lolium.
CA 02333434 2001-O1-10
WO 00168404 PCT/US00/11086
Nucleic Acids
The present invention provides, among other things, isolated nucleic acids of
RNA,
DNA, and analogs and/or chimeras thereof, comprising a polynucleotide of the
present
mvenrion.
S A polynucleotide of the present invention is inclusive of:
(a) a polynucleotide encoding a polypeptide of SEQ m NO: 2 and conservatively
modified and polymorphic variants thereof, including exemplary polynucleotides
of SEQ
m NO: 1; the polynucleotide sequence of the invention also includes the maize
RADSO
polynucleotide sequence as contained in a plasmid deposited with American Type
Culture
Collection (ATCC) and assigned Accession Number 207194.
(b) a polynucleotide which is the product of amplification from a Zea mays
nucleic
acid library using primer pairs which selectively hybridize under stringent
conditions to
loci within the polynucieotide of SEQ m NO: 1, or the sequence as contained in
ATCC
deposit assigned Accession No. 207194, wherein the polynucleotide has
substantial
sequence identity to the polynucleotide of SEQ >D NO: 1; or the sequence as
contained in
ATCC deposit assigned Accession No. 207194.
(c) a polynucleotide which selectively hybridizes to a polynucleotide of (a)
or (b);
(d) a polynucleotide having a specified sequence identity with polynucleotides
of
(a), (b), or (c);
(e) a polynucleotide encoding a protein having a specified number of
contiguous
amino acids from a prototype polypeptide, wherein the protein is specifically
recognized by
antisera elicited by presentation of the protein and wherein the protein does
not detectably
immunoreact to antisera which has been fully immunosorbed with the protein;
(f) complementary sequences of polynucleotides of (a), (b), (c), (d), or (e);
and
(g) a polynucleotide comprising at least a specific number of contiguous
nucleotides from a polynucleotide of (a), (b), (c), (d), (e), or (fJ.
The polynucleotide of SEQ >D NO: 1 is contained in a plasmid deposited with
American Type Culture Collection (ATCC) on April 6,1999 and assigned Accession
Number 207194. American Type Culture Collection is located at 10801 University
Blvd.,
Manassas, VA 20110-2209.
The ATCC deposit will be maintained under the terms of the Budapest Treaty on
the International Recognition of the Deposit of Microorganisms for the
Purposes of Patent
Procedure. The deposit is provided as a convenience to those of skill in the
art and is not
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_~z_
an admission that a deposit is required under 35 U.S.C. Section 112. The
deposited
sequence, as well as the polypeptide encoded by the sequence, is incorporated
herein by
reference and controls in the event of any conflict, such as a sequencing
error, with
description in this application.
A. Polvnucleotides Encoding A Polypeptide of the Present Invention or
Conservatively
Modified or Polymorphic variants Thereof
As indicated in (a), above, the present invention provides isolated nucleic
acids
comprising a polynucleotide of the present invention, wherein the
polynucleotide encodes
a polypeptide of the present invention, or conservatively modified or
polymorphic variants
thereof. Accordingly, the present invention includes polynucleotides of SEQ ID
NO: 1,
and the sequence as contained in ATCC deposit assigned Accession No. 207194,
and silent
variations of polynucleotides encoding a polypeptide of SEQ >D NO: 2. The
present
invention further provides isolated nucleic acids comprising polynucleotides
encoding
conservatively modified variants of a polypeptide of SEQ ID NO: 2.
Conservatively
modified variants can be used to generate or select antibodies immunoreactive
to the non-
variant polypeptide. Additionally, the present invention further provides
isolated nucleic
acids comprising polynucleotides encoding one or more allelic (polymorphic)
variants of
polypeptides/polynucleotides. Polymorphic variants are frequently used to
follow
segregation of chromosomal regions in, for example, marker assisted selection
methods for
crop improvement.
B. Polvnucleotides Amplified from a Zea mans Nucleic Acid Libraw
As indicated in (b), above, the present invention provides an isolated nucleic
acid
comprising a polynucleotide of the present invention, wherein the
polynucleotides are
amplified from a Zea mars nucleic acid library. Zea mat's lines B73, PHRE1,
A632, BMS-
P2#10, W23, and Mol l are known and publicly available. Other publicly known
and
available maize lines can be obtained from the Maize Genetics Cooperation
(Urbana, IL).
The nucleic acid library may be a cDNA library, a genomic library, or a
library generally
constructed from nuclear transcripts at any stage of intron processing. cDNA
libraries can
be normalized to increase the representation of relatively rare cDNAs. In
optional
embodiments, the cDNA library is constructed using a full-length cDNA
synthesis method.
Examples of such methods include Oligo-Capping (Maruyama, K. and Suaano, S.
Gene
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-24-
138: 171-174, 1994), Biotinylated CAP Trapper (Carninci, P., Kvan, C., et al.
Genomics
37: 327-336, 1996), and CAP Retention Procedure (Edery, E., Chu, L.L., et al.
Molecular
and Cellular Biolo~~ 15: 3363-3371, 1995). cDNA synthesis is often catalyzed
at SO-
55°C to prevent formation of RNA secondary structure. Examples of
reverse
S transcriptases that are relatively stable at these temperatures are
SUPERSCRIPT II Reverse
Transcriptase (Life Technologies, Inc.), AMV Reverse Transcriptase (Boehringer
Mannheim) and RETROAMP Reverse Transcriptase (Epicentre). Rapidly growing
tissues,
or rapidly dividing cells are preferably used as mRNA sources.
The present invention also provides subsequences of the polynucleotides of the
present invention. A variety of subsequences can be obtained using primers
which
selectively hybridize under stringent conditions to at least two sites within
a polynucleotide
of the present invention, or to two sites within the nucleic acid which flank
and comprise a
polynucleotide of the present invention, or to a site within a polynucleotide
of the present
invention and a site within the nucleic acid which comprises it. Primers are
chosen to
selectively hybridize, under stringent hybridization conditions, to a
polynucleotide of the
present invention. Generally, the primers are complementary to a subsequence
of the
target nucleic acid which they amplify. As those skilled in the art will
appreciate, the sites
to which the primer pairs will selectively hybridize are chosen such that a
single
contiguous nucleic acid can be formed under the desired amplification
conditions. In
optional embodiments, the primers will be constructed so that they selectively
hybridize
under stringent conditions to a sequence {or its complement) within the target
nucleic acid
which comprises the codon encoding the carboxy or amino terminal amino acid
residue
(i.e., the 3' terminal coding region and 5' terminal coding region,
respectively) of the
polvnucleotides of the present invention. Optionally within these embodiments,
the
primers will be constructed to selectively hybridize entirely within the
coding region of the
target polynucleotide of the present invention such that the product of
amplification of a
cDNA target will consist of the coding region of that cDNA. The primer length
in
nucleotides is selected from the group of integers consisting of from at least
15 to 50.
Thus, the primers can be at least 1 ~, 18, 20, 25, 30, 40, or SO nucleotides
in length. Those
of skill will recognize that a lengthened primer sequence can be employed to
increase
specificity of binding (i.e., annealing) to a target sequence. A non-annealing
sequence at
the Send of a primer (a "tail") can be added, for example, to introduce a
cloning site at the
terminal ends of the amplicon.
CA 02333434 2001-O1-10
WO 00/68404 PCT.~IJS00/11086
_Z;_
The amplification products can be translated using expression systems well
known
to those of skill in the art and as discussed, infra. The resulting
translation products can be
confirmed as polypeptides of the present invention by, for example, assaying
for the
appropriate catalytic activity (e.g., specific activity and/or substrate
specificity), or
verifying the presence of one or more linear epitopes which are specific to a
polypeptide of
the present invention. Methods for protein synthesis from PCR derived
templates are
known in the art and available commercially. See, e.g., Amersham Life
Sciences, Inc,
Catalog '97, p.354.
Methods for obtaining 5' and/or 3' ends of a vector insert are well known in
the art.
See, e.g., RACE (Rapid Amplification of Complementary Ends) as described in
Frohman,
M. A., in PCR Protocols: A Guide to Methods and Applications, M. A. Innis, D.
H.
Gelfand, J. J. Sninsky, T. J. White, Eds. (Academic Press, Inc., San Diego),
pp. 28-38
(1990)); see also, U.S. Pat. No. 5,470,722, and Current Protocols in Molecular
Biology°,
Unit 15.6, Ausubel, et al., Eds, Greene Publishing and Wiley-Interscience, New
York
1 S ( 1995); Frohman and Martin, Techniques 1:165 ( 1989).
C. Polynucleotides Which Selectively Hybridize to a Polynucleotide of (A) or
(B)
As indicated in (c), above, the present invention provides isolated nucleic
acids
comprising polynucleotides of the present invention, wherein the
polynucleotides
selectively hybridize, under selective hybridization conditions, to a
polynucleotide of
sections (A) or (B) as discussed above. Thus, the polynucleotides of this
embodiment can
be used for isolating, detecting, and/or quantifying nucleic acids comprising
the
polynucleotides of (A) or (B). For example, poiynucleotides of the present
invention can
be used to identify, isolate, or amplify partial or full-length clones in a
deposited library. In
some embodiments, the polynucleotides are genomic or cDNA sequences isolated
or
otherwise complementary to a cDNA from a dicot or monocot nucleic acid
library.
Exemplary species of monocots and dicots include, but are not limited to:
corn, canola,
soybean, cotton, wheat, sorghum, sunflower, oats, sugar cane, millet, barley.
and rice.
Optionally, the cDNA library comprises at least 80% full-length sequences,
preferably at
least 85% or 90% full-length sequences, and more preferably at least 95% full-
length
sequences. The cDNA libraries can be normalized to increase the representation
of rare
sequences. Low stringency hybridization conditions are typically, but not
exclusively,
employed with sequences having a reduced sequence identity relative to
complementary
CA 02333434 2001-O1-10
WO 00/68404 PC'TNS00/11086
-~c,-
sequences. Moderate and high stringency conditions can aptionally be employed
for
sequences of greater identity. Low stringency conditions allow selective
hybridization of
sequences having about 70% sequence identity and can be employed to identify
orthologous or paralogous sequences.
D. Polvnucleotides .Having a Specific Sequence Identity with the
Polvnucleotides of (A),
(B) on (Cl
As indicated in (d), above, the present invention provides isolated nucleic
acids
comprising polynucleotides of the present invention, wherein the
polynucleotides have a
specified identity at the nucleotide level to a polynucleotide as disclosed
above in sections
(A), (B), or (C), above. The percentage of identity to a reference sequence
is.at least 60%
and, rounded upwards to the nearest integer, can be expressed as an integer
selected from
the group of integers consisting of from 60 to 99. Thus, for example, the
percentage of
identity to a reference sequence can be at least 70%, 75%, 80%, 81%, 82%, 83%,
84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98°,~0
or 99%.
Optionally, the polynucleotides of this embodiment will encode a polypeptide
that
will share an epitope with a polypeptide encoded by the polynucleotides of
sections (A),
(B), or (C). Thus, these polynucleotides encode a first polypeptide which
elicits
production of antisera comprising antibodies which are specifically reactive
to a second
polypeptide encoded by a polynucleotide of (A), (B), or (C). However, the
first
polypeptide does not bind to antisera raised against itself when the antisera
has been fully
immunosorbed with the first polypeptide. Hence, the polynucleotides of this
embodiment
can be used to generate antibodies for use in, for example, the screening of
expression
libraries for nucleic acids comprising polynucleotides of (A), (B), or (C), or
for purification
of, or in immunoassays for, polypeptides encoded by the polynucleotides of
(A), (B), or
(C). The polynucleotides of this embodiment embrace nucleic acid sequences
which can
be employed for selective hybridization to a polvnucleotide encoding a
polypeptide of the
present invention.
Screening polypeptides for specific binding to antisera can be conveniently
achieved using peptide display libraries. This method involves the screening
of large
collections of peptides for individual members having the desired function or
structure.
Antibody screening of peptide display libraries is well known in the art. The
displayed
peptide sequences can be from 3 to 5000 or more amino acids in length,
frequently from 5-
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
,_
100 amino acids long, and often from about 8 to 15 amino acids long. In
addition to direct
chemical synthetic methods for generating peptide libraries, several
recombinant DNA
methods have been described. One type involves the display of a peptide
sequence on the
surface of a bacteriophage or cell. Each bacteriophage or cell contains the
nucleotide
S sequence encoding the particular displayed peptide sequence. Such methods
are described
in PCT patent publication Nos. 91/17271, 91/18980, 91/19818, and 93/08278.
Other
systems for generating libraries of peptides have aspects of both in vitro
chemical synthesis
and recombinant methods. See, PCT Patent publication Nos. 92/05258, 92/14843,
and
96/19256. See also, U.S. Patent Nos. 5,658,754; and 5,643,768. Peptide display
libraries,
vectors, and screening kits are commercially available from such suppliers as
Invitrogen
(Carlsbad, CA).
E. Polynucleotides Encoding a Protein Having a Subsequence from a Prototype
Polypeptide and is Cross-Reactive to the Prototype Polypeptide
As indicated in (e), above, the present invention provides isolated nucleic
acids
comprising polynucleotides of the present invention, wherein the
polynucleotides encode a
protein having a subsequence of contiguous amino acids from a prototype
polypeptide of
the present invention such as are provided in (a), above. The length of
contiguous amino
acids from the prototype polypeptide is selected from the group of integers
consisting of
from at least 10 to the number of amino acids within the prototype sequence.
Thus, for
example, the polynucleotide can encode a polypeptide having a subsequence
having at
least 10, 15, 20, 25, 30, 35, 40, 45, or 50, contiguous amino acids from the
prototype
polypeptide. Further, the number of such subsequences encoded by a
polynucleotide of the
instant embodiment can be any integer selected from the group consisting of
from 1 to 20,
such as 2, 3, 4, or 5. The subsequences can be separated by any integer of
nucleotides from
1 to the number of nucleotides in the sequence such as at least 5, 10, 1 ~,
2~, ~0, 100, or
200 nucleotides.
The proteins encoded by polynucleotides of this embodiment, when presented as
an
immunogen, elicit the production of polyclonal antibodies which specificaliv
bind to a
prototype polypeptide such as but not limited to, a polypeptide encoded by the
polynucleotide of (a) or (b), above. Generally. however, a protein encoded by
a
polynucleotide of this embodiment does not bind to antisera raised against the
prototype
polypeptide when the antisera has been fully immunosorbed with the prototype
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_?a _
polypeptide. Methods of making and assaying for antibody binding
specificity/affinity are
well known in the art. Exemplary immunoassay formats include ELISA,
competitive
immunoassays, radioimmunoassays, Western blots, indirect immunofluorescent
assays and
the like.
In a preferred assay method, fully immunosorbed and pooled antisera which is
elicited to the prototype polypeptide can be used in a competitive binding
assay to test the
protein. The concentration of the prototype polypeptide required to inhibit
50% of the
binding of the antisera to the prototype polypeptide is determined. If the
amount of the
protein required to inhibit binding is less than twice the amount of the
prototype protein,
then the protein is said to specifically bind to the antisera elicited to the
immunogen.
Accordingly, the proteins of the present invention embrace allelic variants,
conservatively
modified variants, and minor recombinant modifications to a prototype
polypeptide.
A polynucleotide of the present invention optionally encodes a protein having
a
molecular weight as the non-glycosylated protein within 20% of the molecular
weight of
the full-length non-glycosylated polypeptides of the present invention.
Molecular weight
can be readily determined by SDS-PAGE under reducing conditions. Optionally,
the
molecular weight is within 1 S% of a full length polypeptide of the present
invention, more
preferably within 10% or S°io, and most preferably within 3%, 2%, or 1
% of a full length
polypeptide of the present invention.
Optionally, the polynucleotides of this embodiment will encode a protein
having a
specific enzymatic activity at least 50%, 60%, 80°~0, or 90% of a
cellular extract
comprising the native, endogenous full-length polypeptide of the present
invention.
Further, the proteins encoded by polynucleotides of this embodiment will
optionally have a
substantially similar affinity constant (Km ) and/or catalytic activity (i.e.,
the microscopic
rate constant, k~at) as the native endogenous, full-length protein. Those of
skill in the art
will recognize that k~~,/Kn, value determines the specificity for competing
substrates and is
often referred to as the specificity constant. Proteins of this embodiment can
have a
l:~at/Km value at least 10°~0 of a full-length polypeptide of the
present invention as
determined using the endogenous substrate of that polypeptide. Optionally. the
k~a,/K~,
value will be at least 20°'~. 30°io, 40%. SU°io, and most
preferably at least 60°,r, 70°ro, 80°ro.
90%, or 95°ro the k~al/Km value of the full-length polypeptide of the
present invention.
Determination of k~a~, K~, , and k~a,/K", can be determined by any number of
means well
known to those of skill in the art. For example, the initial rates (i.e., the
first 5% or less of
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
the reaction) can be determined using rapid mixing and sampling techniques
(e.g.,
continuous-flow, stopped-flow, or rapid quenching techniques}, flash
photolysis, or
relaxation methods (e.g., temperature jumps) in conjunction with such
exemplary methods
of measuring as spectrophotometry, spectrofluorimetry, nuclear magnetic
resonance, or
radioactive procedures. Kinetic values are conveniently obtained using a
Lineweaver-Burk
or Eadie-Hofstee plot.
F. Polvnucleotides Complementary to the Polynucleotides of (A)-(E)
As indicated in (f), above, the present invention provides isolated nucleic
acids
comprising polynucleotides complementary to the polynucleotides of paragraphs
A-E,
above. As those of skill in the art will recognize, complementary sequences
base-pair
throughout the entirety of their length with the polynucleotides of sections
(A)-(E) (i.e.,
have 100% sequence identity over their entire length). Complementary bases
associate
through hydrogen bonding in double stranded nucleic acids. For example, the
following
base pairs are complementary: guanine and cytosine; adenine and thymine; and
adenine
and uracil.
G. Polynucleotides Which are Subsequences of the Polvnucleotides of (A)-(F)
As indicated in (g), above, the present invention provides isolated nucleic
acids
comprising polynucleotides which comprise at least 15 contiguous bases from
the
polynucleotides of sections (A) through (F) as discussed above. The length of
the
polynucleotide is given as an integer selected from the group consisting of
from at least 15
to the length of the nucleic acid sequence from which the polvnucleotide is a
subsequence
of. Thus, for example, polynucleotides of the present invention are inclusive
of
polvnucieotides comprising at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75. 80,
85, 90, 95, or 100 contiguous nucleotides in length from the polynucleotides
of (A)-(F).
Optionally, the number of such subsequences encoded by a polynucleotide of the
instant
embodiment can be any integer selected from the group consisting of from 1 to
20, such as
2, 3, 4, or 5. The subsequences can be separated by any integer of nucleotides
from 1 to
the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50,
100, or 200
nucleotides.
The subsequences of the present invention can comprise structural
characteristics of
the sequence from which it is derived. Alternatively, the subsequences can
lack certain
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
structural characteristics of the larger sequence from which it is derived
such as a poly (A)
tail. Optionally, a subsequence from a polynucleotide encoding a polypeptide
having at
least one linear epitope in common with a prototype polypeptide sequence as
provided in
(a), above, may encode an epitope in common with the prototype sequence.
Alternatively,
the subsequence may not encode an epitope in common with the prototype
sequence but
can be used to isolate the larger sequence by, for example, nucleic acid
hybridization with
the sequence from which it's derived. Subsequences can be used to modulate or
detect
gene expression by introducing into the subsequences compounds which bind,
intercalate,
cleave and/or crosslink to nucleic acids. Exemplary compounds include
acridine, psoralen,
phenanthroline, naphthoquinone, daunomycin or chloroethylaminoaryl conjugates.
Construction of Nucleic Acids
The isolated nucleic acids of the present invention can be made using (a)
standard
recombinant methods, (b) synthetic techniques, or combinations thereof. In
some
embodiments, the polynucleotides of the present invention will be cloned,
amplified, or
otherwise constructed from a monocot. In preferred embodiments the monocot is
Zea
mays.
The nucleic acids may conveniently comprise sequences in addition to a
polynucleotide of the present invention. For example, a multi-cloning site
comprising one
or more endonuclease restriction sites may be inserted into the nucleic acid
to aid in
isolation of the polynucleotide. Also, translatable sequences may be inserted
to aid in the
isolation of the translated polynucleotide of the present invention. For
example, a hexa-
histidine marker sequence provides a convenient means to purify the proteins
of the
present invention. A polynucleotide of the present invention can be attached
to a vector,
adapter, or linker for cloning and/or expression of a polynucleotide of the
present
invention. Additional sequences may be added to such cloning andlor expression
sequences to optimize their function in cloning and.-or expression, to aid in
isolation of the
polynucleotide, or to improve the introduction of the polvnucleotide into a
cell. Typically.
the length of a nucleic acid of the present invention less the length of its
polynucleotide of
the present invention is less than 20 kilobase pairs. often less than 15 kb,
and frequently
less than 10 kb. Use of cloning vectors, expression vectors, adapters, and
linkers is well
known and extensively described in the art. For a description of various
nucleic acids see,
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
for example, Stratagene Cloning Systems, Catalogs 1995, 1996, 1997 (La Jolla,
CA); and,
Amersham Life Sciences, Inc, Catalog '97 (Arlington Heights, IL).
A. Recombinant Methods for Constructing Nucleic Acids
The isolated nucleic acid compositions of this invention, such as RNA, cDNA,
genomic DNA, or a hybrid thereof, can be obtained from plant biological
sources using any
number of cloning methodologies known to those of skill in the art. In some
embodiments,
oligonucleotide probes which selectively hybridize, under stringent
conditions, to the
polynucleotides of the present invention are used to identify the desired
sequence in a
cDNA or genomic DNA library. While isolation of RNA, and construction of cDNA
and
I O genomic libraries is well known to those of ordinary skill in the art, the
following
highlights some of the methods employed.
Al. mRNA Isolation and Purification
Total RNA from plant cells comprises such nucleic acids as mitochondria) RNA,
chloroplastic RNA, rRNA, tRNA, hnRNA and mRNA. Total RNA preparation typically
involves lysis of cells and removal of organelles and proteins, followed by
precipitation of
nucleic acids. Extraction of total RNA from plant cells can be accomplished by
a variety
of means. Frequently, extraction buffers include a strong detergent such as
SDS and an
organic denaturant such as guanidinium isothiocyanate, guanidine hydrochloride
or phenol.
Following total RNA isolation, poly(A)+ mRNA is typically purified from the
remainder
RNA using oligo(dT) cellulose. Exemplary total RNA and mRNA isolation
protocols are
described in Plant Molecular Biologn: A Labor-atow Manual, Clark, Ed.,
Springer-Verlag,
Berlin (1997); and, Cztrrent Protocols in Molectrlar Bioloy, Ausubel, et al.,
Eds., Greene
Publishing and Wiley-Interscience, New York (1995). Total RNA and mRNA
isolation
kits are commercially available from vendors such as Stratagene (La ,Tolla,
CA), Clonetech
(Palo Alto, CA), Pharmacia (Piscataway, NJ), and 5'-3' (Paali Inc., PA). See
also, U.S.
Patent Nos. 5,614,391; and, 5,459,253. The mRNA can be fractionated into
populations
with size ranges of about 0.5, 1.0, 1.5, 2.0, 2.5 or 3.0 kb. The cDNA
synthesized for each
of these fractions can be size selected to the same size range as its mRNA
prior to vector
insertion. This method helps eliminate truncated cDNA formed by incompletely
reverse
transcribed mRNA.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
ii_
A?. Construction of a cDNA Libraw
Construction of a cDNA library generally entails five steps. First, first
strand
cDNA synthesis is initiated from a poly(A)j mRNA template using a poly(dT)
primer or
random hexanucleotides. Second, the resultant RNA-DNA hybrid is converted into
double
stranded cDNA, typically by reaction with a combination of RNAse H and DNA
polymerase I {or Klenow fragment). Third, the termini of the double stranded
cDNA are
ligated to adaptors. Ligation of the adaptors can produce cohesive ends for
cloning.
Fourth, size selection of the double stranded cDNA eliminates excess adaptors
and primer
fragments, and eliminates partial cDNA molecules due to degradation of mRNAs
or the
I O failure of reverse transcriptase to synthesize complete first strands.
Fifth, the cDNAs are
ligated into cloning vectors and packaged. cDNA synthesis protocols are well
known to
the skilled artisan and are described in such standard references as: Plant
Molecular-
Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin ( 1997);
and, Current
Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and
Wiley-
Interscience, New York (1995). cDNA synthesis kits are available from a
variety of
commercial vendors such as Stratagene or Pharmacia.
A number of cDNA synthesis protocols have been described which provide
substantially pure full-length cDNA libraries. Substantially pure full-length
cDNA
libraries are constructed to comprise at least 90%, and more preferably at
least 93% or 95%
full-length inserts amongst clones containing inserts. The length of insert in
such libraries
can be from 0 to 8, 9, 10, 1 l, 12, 13, or more kilobase pairs. Vectors to
accommodate
inserts of these sizes are known in the art and available commercially. See,
e.g.,
Stratagene's lambda ZAP Express {cDNA cloning vector with 0 to 12 kb cloning
capacity).
An exemplary method of constructing a greater than 95% pure full-length cDNA
library is described by Carninci et al.. Genofnics, 37:327-336 (1996). In that
protocol, the
cap-structure of eukaryotic mRNA is chemically labeled with biotin. By using
streptavidin-coated magnetic beads, only the full-length first-strand
cDNA/mRNA hybrids
are selectively recovered after RNase I treatment. The method provides a high
yield library
with an unbiased representation of the starting mRNA population. Other methods
for
producing full-length libraries are known in the art. See, e.~., Edery et al.,
tLTol. Cell
Biol.,l5(6):3363-3371 (1995); and, PCT Application WO 96.'34981.
CA 02333434 2001-O1-10
WO 00/68404 PCT:~1JS00/11086
-3?-
A3. Normalized or Subtracted cDNA Libraries
A non-normalized cDNA library represents the mRNA population of the tissue it
was made from. Since unique clones are out-numbered by clones derived from
highly
expressed genes their isolation can be laborious. Normalization of a cDNA
library is the
process of creating a library in which each clone is more equally represented.
A number of approaches to normalize cDNA libraries are known in the art. One
approach is based on hybridization to genomic DNA. The frequency of each
hybridized
cDNA in the resulting normalized library would be proportional to that of each
corresponding gene in the genomic DNA. Another approach is based on kinetics.
If
cDNA reannealing follows second-order kinetics, rarer species anneal less
rapidly and the
remaining single-stranded fraction of cDNA becomes progressively more
normalized
during the course of the hybridization. Specific loss of any species of cDNA,
regardless of
its abundance, does not occur at any Cot value. Construction of normalized
libraries is
described in Ko, Nucl. Acids. Res., 18(19):5705-5711 (1990); Patanjali et al.,
Proc. Natl.
Acad. U.S.A., 88:1943-1947 (1991); U.S. Patents 5,482,685, and 5,637,685. In
an
exemplary method described by Soares et al., normalization resulted in
reduction of the
abundance of clones from a range of four orders of magnitude to a narrow range
of only 1
order of magnitude. Proc. Natl. Acad. Sci. USA, 91:9228-9232 (1994).
Subtracted cDNA libraries are another means to increase the proportion of less
abundant cDNA species. In this procedure, cDNA prepared from one pool of mRNA
is
depleted of sequences present in a second pool of mRNA by hybridization. The
cDNA:mRNA hybrids are removed and the remaining un-hybridized cDNA pool is
enriched for sequences unique to that pool. See, Foote et czl. in, Plant
Molecular Bioloy
A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997); Kho and
Zarbl,
Technique, 3(2):58-63 (1991 ); Sive and St. 3ohn. Ni~cl. Acids Res.,
16(22):10937 ( 1988);
Current Protocols in Molecular Biologt°, Ausubel, et al., Eds., Greene
Publishing and
Wiley-Interscience, New York (1995); and, Swaroop et al.. Nucl. Acids Res.,
19)8):1954
( 1991 ). cDNA subtraction kits are commercially available. See, e.a., PCR-
Select
(Clontech, Palo Alto, CA).
A4. Construction of a Genomic Library
To construct genomic libraries, large segments of genomic DNA are generated by
fragmentation, e.g. using restriction endonucleases. and are ligated with
vector DNA to
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
is
forn~ concatemers that can be packaged into the appropriate vector.
Methodologies to
accomplish these ends, and sequencing methods to verify the sequence of
nucleic acids are
well known in the art. Examples of appropriate molecular biological techniques
and
instructions sufficient to direct persons of skill through many construction,
cloning, and
screening methodologies are found in Sambrook, et al., Molecular Cloning: A
Labor-atow
Manual, 2nd Ed., Cold Spring Harbor Laboratory Vols. 1-3 (1989), Methods in
Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Berger and
Kimmel,
Eds., San Diego: Academic Press, Inc. (1987), Current Protocols in
MolecularBiologt~~,
Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York
(1995); Plant
Molecular Biologt : A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (
1997).
Kits for construction of genomic libraries are also commercially available.
AS. Nucleic Acid Screening and Isolation Methods
The cDNA or genomic library can be screened using a probe based upon the
sequence of a polynucleotide of the present invention such as those disclosed
herein.
Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate
homologous genes in the same or different plant species. Those of skill in the
art will
appreciate that various degrees of stringency of hybridization can be employed
in the
assay; and either the hybridization or the wash medium can be stringent. As
the conditions
for hybridization become more stringent, there must be a greater degree of
complementarity between the probe and the target for duplex formation to
occur. The
degree of stringency can be controlled by temperature, ionic strength, pH and
the presence
of a partially denaturing solvent such as formamide. For example, the
stringency of
hybridization is conveniently varied by changing the polarity of the reactant
solution
through manipulation of the concentration of forn~amide within the range of
0°i° to 50°r~.
The degree of complementarity (sequence identity) required for detectable
binding will
vary in accordance with the stringency of the hybridization medium and/or wash
medium.
The degree of complementarity will optimally be 100 percent; however, it
should be
understood that minor sequence variations in the probes and primers may be
compensated
for by reducing the stringency of the hybridization and/or wash medium.
The nucleic acids of interest can also be amplified from nucleic acid samples
using
amplification techniques. For instance, polvmerase chain reaction (PCR)
technology can
be used to amplify the sequences of polynucleotides of the present invention
and related
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-3~-
genes directly from genomic DNA or cDNA libraries. PCR and other in vitro
amplification methods may also be useful, for example, to clone nucleic acid
sequences
that code for proteins to be expressed, to make nucleic acids to use as probes
for detecting
the presence of the desired mRNA in samples, for nucleic acid sequencing, or
for other
purposes. Examples of techniques sufficient to direct persons of skill through
in vitro
amplification methods are found in Bergen Sambrook, and Ausubel, as well as
Mullis et
al., U.S. Patent No. 4,683,202 (1987); and, PCR Protocols A Guide to Methods
and
Applications, Innis et al., Eds., Academic Press Inc., San Diego, CA (1990).
Commercially available kits for genomic PCR amplification are known in the
art. See, e.g.,
Advantage-GC Genomic PCR Kit (Clontech). The T4 gene 32 protein (Boehringer
Mannheim) can be used to improve yield of long PCR products.
PCR-based screening methods have also been described. Wilfinger et al.
describe a
PCR-based method in which the longest cDNA is identified in the first step so
that
incomplete clones can be eliminated from study. BioTechniques, 22(3): 481-486
(1997).
In that method, a primer pair is synthesized with one primer annealing to the
5' end of the
sense strand of the desired cDNA and the other primer to the vector. Clones
are pooled to
allow large-scale screening. By this procedure, the longest possible clone is
identified
amongst candidate clones. Further, the PCR product is used solely as a
diagnostic for the
presence of the desired cDNA and does not utilize the PCR product itself. Such
methods
are particularly effective in combination with a full-length cDNA construction
methodology, above.
B. Svnthetic Methods for Constructing Nucleic Acids
The isolated nucleic acids of the present invention can also be prepared by
direct
chemical synthesis by methods such as the phosphotriester method of Narang et
al., Meth.
Enzvmol. 68: 90-99 ( 1979); the phosphodiester method of Brown et al., Meth.
Enzymol.
68: 109-151 (1979); the diethylphosphoramidite method of Beaucage et al.,
Tetra. Lett. 22:
1859-1862 (1981); the solid phase phosphoramidite triester method described by
Beaucage
and Caruthers, Tetra. Letts. 22(20): 1859-1862 (1981), e.g., using an
automated
synthesizer, e.g., as described in Needham-VanDevanter et al., Nucleic Acids
Res., 12:
6159-6168 (1984); and, the solid support method of U.S. Patent No. 4,458,066.
Chemical
synthesis generally produces a single stranded oligonucleotide. This may be
converted into
double stranded DNA by hybridization with a complementary sequence, or by
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
polymerization with a DNA polymerise using the single strand as a template.
One of skill
will recognize that while chemical synthesis of DNA is best employed for
sequences of
about 100 bases or less, longer sequences may be obtained by the ligation of
shorter
sequences.
Recombinant Expression Cassettes
The present invention further provides recombinant expression cassettes
comprising a nucleic acid of the present invention. A nucleic acid sequence
coding for the
desired polypeptide of the present invention, for example a cDNA or a genomic
sequence
encoding a full length polypeptide of the present invention, can be used to
construct a
recombinant expression cassette which can be introduced into the desired host
cell. A
recombinant expression cassette will typically comprise a polynucleotide of
the present
invention operably linked to transcriptional initiation regulatory sequences
which will
direct the transcription of the polynucleotide in the intended host cell, such
as tissues of a
transformed plant.
For example, plant expression vectors may include (1) a cloned plant gene
under the transcriptional control of 5' and 3' regulatory sequences and (2) a
dominant selectable marker. Such plant expression vectors may also contain, if
desired, a
promoter regulatory region (e.g., one confernng inducible or constitutive,
environmentally-
or developmentally-regulated, or cell- or tissue-specific/selective
expression), a
transcription initiation start site, a ribosome binding site, an RNA
processing signal, a
transcription termination site, and/or a polyadenylation signal.
A plant promoter fragment can be employed which will direct expression of a
polynucleotide of the present invention in all tissues of a regenerated plant.
Such
promoters are referred to herein as "constitutive" promoters and are active
under most
environmental conditions and states of development or cell differentiation.
Examples of
constitutive promoters include the cauliflower mosaic virus (CaMV) 35S
transcription
initiation region, the 1'- or 2'- promoter derived from T-DNA of Agrobacterium
tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol
dehydrogenase promoter (U.S. Patent No. 5,683,439), the Nos promoter, the pEmu
promoter, the rubisco promoter, the GRP 1-8 promoter, and other transcription
initiation
regions from various plant genes known to those of skill. One exemplary
promoter is the
CA 02333434 2001-O1-10
WO 00/68404 PCT/tJS00/11086
ubiquitin promoter, which can be used to drive expression of the present
invention in
maize embryos or embryogenic callus.
Alternatively, the plant promoter can direct expression of a polynucleotide of
the
present invention in a specific tissue or may be otherwise under more precise
environmental or developmental control. Such promoters are referred to here as
"inducible" promoters. Environmental conditions that may effect transcription
by
inducible promoters include pathogen attack, anaerobic conditions, or the
presence of light.
Examples of inducible promoters are the Adhl promoter which is inducible by
hypoxia or
cold stress, the Hsp70 promoter which is inducible by heat stress, and the
PPDK promoter
which is inducible by light.
Examples of promoters under developmental control include promoters that
initiate
transcription only, or preferentially, in certain tissues, such as leaves,
roots, fruit, seeds, or
flowers. Exemplary promoters include the anther specific promoter 5126 (U.S.
Patent Nos.
5,689,049 and 5,689,051), glob-1 promoter, and gamma-zein promoter. The
operation of a
promoter may also vary depending on its location in the genome. Thus, an
inducible
promoter may become fully or partially constitutive in certain locations.
Both heterologous and non-heterologous (i.e., endogenous) promoters can be
employed to direct expression of the nucleic acids of the present invention.
These
promoters can also be used, for example, in recombinant expression cassettes
to drive
expression of antisense nucleic acids to reduce, increase, or alter
concentration andlor
composition of the proteins of the present invention in a desired tissue.
Thus, in some
embodiments, the nucleic acid construct will comprise a promoter functional in
a plant
cell, such as in Zea mans, operably linked to a polynucleotide of the present
invention.
Promoters useful in these embodiments include the endogenous promoters driving
expression of a polypeptide of the present invention.
In some embodiments, isolated nucleic acids which serve as promoter or
enhancer
elements can be introduced in the appropriate position (generally upstream) of
a non-
heterologous form of a polynucleotide of the present invention so as to up or
down regulate
expression of a polynucleotide of the present invention. For example,
endogenous
promoters can be altered irr vivo by mutation, deletion, and/or substitution
(see, Kmiec,
U.S. Patent 5,565,350; Zarling et al., PCT/LJS93/03868), or isolated promoters
can be
introduced into a plant cell in the proper orientation and distance from a
gene of the present
invention so as to control the expression of the gene. Gene expression can be
modulated
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
-=F-
under conditions suitable for plant growth so as to alter the total
concentration and/or alter
the composition of the polypeptides of the present invention in plant cell.
Thus, the present
invention provides compositions, and methods for making, heterologous
promoters and/or
enhancers operably linked to a native, endogenous (i.e., non-heterologous)
form of a
polynucleotide of the present invention.
Methods for identifying promoters with a particular expression pattern, in
terms of,
e.g., tissue type, cell type, stage of development, and/or environmental
conditions, are well
known in the art. See, e.g., The Maize Handbook, Chapters 114-115, Freeling
and Walbot,
Eds., Springer, New York (1994); Corn and Corn Improvement, 3~d edition,
Chapter 6,
Sprague and Dudley, Eds., American Society of Agronomy, Madison, Wisconsin
(1988).
A typical step in promoter isolation methods is identification of gene
products that are
expressed with some degree of specificity in the target tissue. Amongst the
range of
methodologies are: differential hybridization to cDNA libraries; subtractive
hybridization;
differential display; differential 2-D protein gel electrophoresis; DNA probe
arrays; and
isolation of proteins known to be expressed with some specificity in the
target tissue. Such
methods are well known to those of skill in the art. Commercially available
products for
identifying promoters are known in the art such as Clontech's (Palo Alto, CA)
Universal
GenomeWalker Kit.
For the protein-based methods, it is helpful to obtain the amino acid sequence
for at
least a portion of the identified protein, and then to use the protein
sequence as the basis
for preparing a nucleic acid that can be used as a probe to identify either
genomic DNA
directly, or preferably, to identify a cDNA clone from a library prepared from
the target
tissue. Once such a cDNA clone has been identified, that sequence can be used
to identify
the sequence at the 5' end of the transcript of the indicated gene. For
differential
hybridization, subtractive hybridization and differential display, the nucleic
acid sequence
identified as enriched in the target tissue is used to identify the sequence
at the 5' end of
the transcript of the indicated gene. Once such sequences are identified,
starting either
from protein sequences or nucleic acid sequences, any of these sequences
identified as
being from the gene transcript can be used to screen a genomic library
prepared from the
target organism. Methods for identifying and confirming the transcriptional
start site are
well known in the art.
In the process of isolating promoters expressed under particular environmental
conditions or stresses, or in specific tissues, or at particular developmental
stages, a
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
39 -
number of genes are identified that are expressed under the desired
circumstances, in the
desired tissue, or at the desired stage. Further analysis will reveal
expression of each
particular gene in one or more other tissues of the plant. One can identify a
promoter with
activity in the desired tissue or condition but that does not have activity in
any other
common tissue.
To identify the promoter sequence, the 5' portions of the clones described
here are
analyzed for sequences characteristic of promoter sequences. For instance,
promoter
sequence elements include the TATA box consensus sequence (TATAAT), which is
usually an AT-rich stretch of 5-10 by located approximately 20 to 40 base
pairs upstream
of the transcription start site. Identification of the TATA box is well known
in the art. For
example, one way to predict the location of this element is to identify the
transcription start
site using standard RNA-mapping techniques such as primer extension, S 1
analysis, and/or
RNase protection. To confirm the presence of the AT-rich sequence, a structure-
function
analysis can be performed involving mutagenesis of the putative region and
quantification
of the mutation's effect on expression of a linked downstream reporter gene.
See, e.g., The
Maize Handbook, Chapter 114, Freeling and Walbot, Eds., Springer, New York,
(1994).
In plants, further upstream from the TATA box, at positions -80 to -100, there
is
typically a promoter element (i.e., the CART box) with a series of adenines
surrounding
the trinucleotide G (or T) N G. J. Messing et al., in Genetic Engineering in
Plants,
Kosage, Meredith and Hollaender, Eds., pp. 221-227 (1983). In maize, there is
no well
conserved CART box but there are several short, conserved protein-binding
motifs
upstream of the TATA box. These include motifs for the trans-acting
transcription factors
involved in light regulation, anaerobic induction, hormonal regulation, or
anthocyanin
biosynthesis, as appropriate for each gene.
Once promoter and/or gene sequences are known, a region of suitable size is
selected from the genomic DNA that is S' to the transcriptional start, or the
translational
start site, and such sequences are then linked to a coding sequence. If the
transcriptional
start site is used as the point of fusion, any of a number of possible 5'
untranslated regions
can be used in between the transcriptional start site and the partial coding
sequence. If the
translational start site at the 3' end of the specific promoter is used, then
it is linked
directly to the methionine start codon of a coding sequence.
If polypeptide expression is desired, it is generally desirable to include a
polyadenylation region at the 3'-end of a polvnucleotide coding region. The
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-40-
polyadenylation region can be derived from the natural gene, from a variety of
other plant
genes, or from T-DNA. The 3' end sequence to be added can be derived from, for
example, the nopaline synthase or octopine synthase genes, or alternatively
from another
plant gene, or less preferably from any other eukaryotic gene.
An intron sequence can be added to the 5' untranslated region or the coding
sequence of the partial coding sequence to increase the amount of the mature
message that
accumulates in the cytosol. Inclusion of a spliceable intron in the
transcription unit in both
plant and animal expression constructs has been shown to increase gene
expression at both
the mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol.
8: 4395-
4405 (1988); Callis et al., Genes Dev. l: 1183-1200 (1987). Such intron
enhancement of
gene expression is typically greatest when placed near the 5' end of the
transcription unit.
Use of maize introns Adhl-S intron I, 2, and 6, the Bronze-1 intron are known
in the art.
See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds.,
Springer,
New York ( 1994).
The vector comprising the sequences from a polynucleotide of the present
invention will typically comprise a marker gene which confers a selectable
phenotype on
plant cells. Usually, the selectable marker gene will encode antibiotic
resistance, with
suitable genes including genes coding for resistance to the antibiotic
spectinomycin (e.g.,
the aada gene), the streptomycin phosphotransferase (SPT) gene coding for
streptomycin
resistance, the neomycin phosphotransferase (NPTII) gene encoding kanamycin or
geneticin resistance, the hygromycin phosphotransferase (HPT) gene coding for
hygromycin resistance, genes coding for resistance to herbicides which act to
inhibit the
action of acetolactate synthase (ALS), in particular the sulfonylurea-type
herbicides (e.g.,
the acetolactate synthase (ALS) gene containing mutations leading to such
resistance in
particular the S4 and/or Hra mutations), genes coding for resistance to
herbicides which act
to inhibit action of glutamine synthase, such as phosphinothricin or basta
(e.g., the bar
gene), or other such genes known in the art. The bar gene encodes resistance
to the
herbicide basta, the nptll gene encodes resistance to the antibiotics
kanamycin and
geneticin, and the ALS gene encodes resistance to the herbicide chlorsulfuron.
Typical vectors useful for expression of genes in higher plants are well known
in
the art and include vectors derived from the tumor-inducing (Ti) plasmid of
Agrobacterium
tumefaciens described by Rogers et al., Meth. In Enzymol., 153:253-277 (1987).
These
vectors are plant integrating vectors in that on transformation, the vectors
integrate a
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-41 -
portion of vector DNA into the genome of the host plant. Exemplary A.
tumefaciens
vectors useful herein are plasmids pKYLX6 and pKYLX7 of Schardl et al., Gene,
61:1-11
(1987) and Berger et al., Proc. Natl. Acad. Sci. U.S.A., 86:8402-8406 (1989).
Another
useful vector herein is plasmid pBI101.2 that is available from Clontech
Laboratories, Inc.
(Palo Alto, CA).
A polynucleotide of the present invention can be expressed in either sense or
anti-
sense orientation as desired. It will be appreciated that control of gene
expression in either
sense or anti-sense orientation can have a direct impact on the observable
plant
characteristics. Antisense technology can be conveniently used to inhibit gene
expression
in plants. To accomplish this, a nucleic acid segment from the desired gene is
cloned and
operably linked to a promoter such that the anti-sense strand of RNA will be
transcribed.
The construct is then transformed into plants and the antisense strand of RNA
is produced.
In plant cells, it has been shown that antisense RNA inhibits gene expression
by preventing
the accumulation of mRNA which encodes the enzyme of interest, see, e.g.,
Sheehy et al.,
Proc. Nat'l. Acad. Sci. (USA) 85: 8805-8809 (1988); and Hiatt et al., U.S.
Patent No.
4,801,340.
Another method of suppression is sense suppression. Introduction of nucleic
acid
configured in the sense orientation has been shown to be an effective means by
which to
block the transcription of target genes. For an example of the use of this
method to
modulate expression of endogenous genes see, Napoli et al., The Plant Cell 2:
279-289
(1990) and U.S. Patent No. 5,034,323.
Catalytic RNA molecules or ribozymes can also be used to inhibit expression of
plant genes. It is possible to design ribozymes that specifically pair with
virtually any
target RNA and cleave the phosphodiester backbone at a specific location,
thereby
functionally inactivating the target RNA. In carrying out this cleavage, the
ribozvme is not
itself altered, and is thus capable of recycling and cleaving other molecules,
making it a
true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers
RNA-
cleaving activity upon them, thereby increasing the activity of the
constructs. The design
and use of target RNA-specific ribozvmes is described in Haseloff et al.,
Nature 334: 585-
591 (1988).
A variety of cross-linking agents, alkylating agents and radical generating
species
as pendant groups on polynucleotides of the present invention can be used to
bind, label,
detect, and/or cleave nucleic acids. For example, Vlassov, V. V., et al.,
Nucleic Acids Res
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
- 42 -
(1986) 14:406-4076, describe covalent bonding of a single-stranded DNA
fragment with
alkylating derivatives of nucleotides complementary to target sequences. A
report of
similar work by the same group is that by Knon:e, D. G., et al., Biochimie
(1985) 67:785-
789. Iverson and Dervan also showed sequence-specific cleavage of single-
stranded DNA
mediated by incorporation of a modified nucleotide which was capable of
activating
cleavage (JAm Chem Soc (1987) 109:1241-1243). Meyer, R. B., et al., JAm Chem
Soc
(1989) 111:8517-8519, effect covalent crosslinking to a target nucleotide
using an
alkylating agent complementary to the single-stranded target nucleotide
sequence. A
photoactivated crosslinking to single-stranded oligonucleotides mediated by
psoralen was
disclosed by Lee, B. L., et al., Biochemistry (1988) 27:3197-3203. Use of
crosslinking in
triple-helix forming probes was also disclosed by Home, et al., JAm Chem Soc
(1990)
112:2435-2437. Use ofN4, N4-ethanocytosine as an alkylating agent to crosslink
to
single-stranded oligonucleotides has also been described by Webb and
Matteucci, JAm
Chem Soc (1986) 108:2764-2765; Nucleic Acids Res (1986) 14:7661-7674; Feteritz
et al.,
J. Am. Chem. Soc. 113:4000 ( 1991 ). Various compounds to bind, detect, label,
and/or
cleave nucleic acids are known in the art. See, for example, U.S. Patent Nos.
5,543,507;
5,672,593; 5,484,908; 5,256,648; and, 5,681941.
Proteins
The isolated proteins of the present invention comprise a polypeptide having
at
least 10 amino acids encoded by any one of the polynucleotides of the present
invention as
discussed more fully, above, or polypeptides which are conservatively modified
variants
thereof. The proteins of the present invention or variants thereof can
comprise any number
of contiguous amino acid residues from a polypeptide of the present invention,
wherein
that number is selected from the group of integers consisting of from 10 to
the number of
residues in a full-length polypeptide of the present invention. Optionally,
this subsequence
of contiguous amino acids is at least 15, 20, 25, 30, 35, or 40 amino acids in
length, often
at least 50, 60, 70, 80, or 90 amino acids in length. Further, the number of
such
subsequences can be any integer selected from the group consisting of from 1
to 20, such
as2,3,4,or~.
The present invention further provides a protein comprising a polypeptide
having a
specified sequence identity with a polypeptide of the present invention. The
percentage of
sequence identity is an integer selected from the group consisting of from 50
to 99.
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
Exemplary sequence identity values include 60%, 65%, 70%, 75%, 80%, 81%,
82°~0, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and
99%. Sequence identity can be determined using, for example, the GAP or BLAST
algorithms.
As those of skill will appreciate, the present invention includes
catalytically active
polypeptides of the present invention (i.e., enzymes). Catalytically active
polypeptides
have a specific activity of at least 20%, 30%, or 40%, and preferably at least
50%, 60%, or
70%, and most preferably at least 80%, 90%, or 95% that of the native (non-
synthetic),
endogenous polypeptide. Further, the substrate specificity (k~ac/Km) is
optionally
substantially similar to the native (non-synthetic), endogenous polypeptide.
Typically, the
Km will be at least 30%, 40%, or 50%, that of the native (non-synthetic),
endogenous
polypeptide; and more preferably at least 60%, 70%, 80%, or 90%. Methods of
assaying
and quantifying measures of enzymatic activity and substrate specificity
(lc~at/Km), are well
known to those of skill in the art.
Generally, the proteins of the present invention will, when presented as an
immunogen, elicit production of an antibody specifically reactive to a
polypeptide of the
present invention. Further, the proteins of the present invention will not
bind to antisera
raised against a polypeptide of the present invention which has been fully
immunosorbed
with the same polypeptide. Immunoassays for determining binding are well known
to
those of skill in the art. A preferred immunoassay is a competitive
immunoassay as
discussed, infra. Thus, the proteins of the present invention can be employed
as
immunogens for constructing antibodies immunoreactive to a protein of the
present
invention for such exemplary utilities as immunoassays or protein purification
techniques.
Expression of Proteins in Host Cells
Using the nucleic acids of the present invention, one may express a protein of
the
present invention in a recombinantly engineered cell such as bacteria, yeast,
insect,
mammalian, or preferably plant cells. The cells produce the protein in a non-
natural
condition (e.g., in quantity, composition, location, and/or time), because
they have been
genetically altered through human intervention to do so.
It is expected that those of skill in the art are knowledgeable in the
numerous
expression systems available for expression of a nucleic acid encoding a
protein of the
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/1108G
present invention. No attempt to describe in detail the various methods known
for the
expression of proteins in prokaryotes or eukaryotes will be made.
In brief summary, the expression of isolated nucleic acids encoding a protein
of the
present invention will typically be achieved by operably linking, for example,
the DNA or
cDNA to a promoter (which is either constitutive or regulatable), followed by
incorporation into an expression vector. The vectors can be suitable for
replication and
integration in either prokaryotes or eukaryotes. Typical expression vectors
contain
transcription and translation terminators, initiation sequences, and promoters
useful for
regulation of the expression of the DNA encoding a protein of the present
invention. To
obtain high level expression of a cloned gene, it is desirable to construct
expression vectors
which contain, at the minimum, a strong promoter to direct transcription, a
ribosome
binding site for translational initiation, and a transcription/translation
terminator. One of
skill would recognize that modifications can be made to a protein of the
present invention
without diminishing its biological activity. Some modifications may be made to
facilitate
the cloning, expression, or incorporation of the targeting molecule into a
fusion protein.
Such modifications are well known to those of skill in the art and include,
for example, a
methionine added at the amino terminus to provide an initiation site, or
additional amino
acids (e.g., poly His) placed on either terminus to create conveniently
located purification
sequences. Restriction sites or termination codons can also be introduced.
A. Expression in Prokan~otes
Prokaryotic cells may be used as hosts for expression. Prokaryotes most
frequently
are represented by various strains of E. toll; however, other microbial
strains may also be
used. Commonly used prokaryotic control sequences which are defined herein to
include
promoters for transcription initiation, optionally with an operator, along
with ribosome
binding site sequences, include such commonly used promoters as the beta
lactamase
(penicillinase) and lactose (lac) promoter systems (Chang et al., Nature
198:1056 (1977)),
the tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res.
8:4057 ( 1980))
and the lambda derived P L promoter and N-gene ribosome binding site
(Shimatake et al.,
Nature 292:128 (1981)). The inclusion of selection markers in DNA vectors
transfected in
E. toll is also useful. Examples of such markers include genes specifying
resistance to
ampicillin, tetracycline, or chloramphenicol.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
- 4~ -
The vector is selected to allow introduction into the appropriate host cell.
Bacterial
vectors are typically of plasmid or phage origin. Appropriate bacterial cells
are infected
with phage vector particles or transfected with naked phage vector DNA. If a
plasmid
vector is used, the bacterial cells are transfected with the plasmid vector
DNA. Expression
systems for expressing a protein of the present invention are available using
Bacillus sp.
and Salmonella (Palva, et al., Gene 22: 229-235 (1983); Mosbach, et al.,
Nature 302: 543-
545 (1983)).
B. Expression in Eukarl~otes
A variety of eukaryotic expression systems such as yeast, insect cell lines,
plant and
mammalian cells, are known to those of skill in the art. As explained briefly
below, a
polynucleotide of the present invention can be expressed in these eukaryotic
systems. In
some embodiments, transformedltransfected plant cells, as discussed infra, are
employed
as expression systems for production of the proteins of the instant invention.
Synthesis of heterologous proteins in yeast is well known. Sherman, F., et
al.,
Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1982) is a well
recognized
work describing the various methods available to produce the protein in yeast.
Two widely
utilized yeast for production of eukaryotic proteins are Saccharomyces
cerevisiae and
Pichia pastoris. Vectors, strains, and protocols for expression in
Saccharomyces and
Pichia are known in the art and available from commercial suppliers {e.g.,
Invitrogen).
Suitable vectors usually have expression control sequences, such as promoters,
including
3-phosphoglycerate kinase or alcohol oxidase, and an origin of replication,
termination
sequences and the like as desired.
A protein of the present invention, once expressed, can be isolated from yeast
by
lysing the cells and applying standard protein isolation techniques to the
lysates. The
monitoring of the purification process can be accomplished by using Western
blot
techniques or radioimmunoassay of other standard immunoassay techniques.
The sequences encoding proteins of the present invention can also be ligated
to
various expression vectors for use in transfecting cell cultures of, for
instance, mammalian,
insect, or plant origin. Illustrative of cell cultures useful for the
production of the peptides
are mammalian cells. Mammalian cell systems often will be in the form of
monolayers of
cells although mammalian cell suspensions may also be used. A number of
suitable host
cell lines capable of expressing intact proteins have been developed in the
art, and include
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-46-
the HEI~?93, BHK21, and CHO cell lines. Expression vectors for these cells can
include
expression control sequences, such as an origin of replication, a promoter
(e.g., the CMV
promoter, a HSV tk promoter or pgk (phosphoglycerate kinase) promoter), an
enhancer
(Queen et al., Immunol. Rev. 89: 49 (1986)), and necessary processing
information sites,
such as ribosome binding sites, RNA splice sites, polyadenylation sites (e.g.,
an SV40
large T Ag poly A addition site), and transcriptional terminator sequences.
Other animal
cells useful for production of proteins of the present invention are
available, for instance,
from the American Type Culture Collection.
Appropriate vectors for expressing proteins of the present invention in insect
cells
are usually derived from the SF9 baculovirus. Suitable insect cell lines
include mosquito
larvae, silkworm, armyworm, moth and Drosophila cell lines such as a Schneider
cell line
(See, Schneider, J. Embrvol. Exp. Morphol. 27: 353-365 (1987).
As with yeast, when higher animal or plant host cells are employed,
polyadenlyation or transcription terminator sequences are typically
incorporated into the
vector. An example of a terminator sequence is the polyadenlyation sequence
from the
bovine growth hormone gene. Sequences for accurate splicing of the transcript
may also
be included. An example of a splicing sequence is the VP1 intron from SV40
(Sprague, et
al., J. Virol. 45: 773-781 (1983)). Additionally, gene sequences to control
replication in
the host cell may be incorporated into the vector such as those found in
bovine papilloma
virus type-vectors. Saveria-Campo, M., Bovine Papilloma Virus DNA a Eukaryotic
Cloning Vector in DNA Cloning Vol. II a Practical Approach, D.M. Glover, Ed.,
IRL
Press, Arlington, Virginia pp. 213-238 (1985).
Transfection/Transformation of Cells
The method of transformation/transfection is not critical to the instant
invention;
various methods of transformation or transfection are currently available. As
newer
methods are available to transform crops or other host cells they may be
directly applied.
Accordingly, a wide variety of methods have been developed to insert a DNA
sequence
into the genome of a host cell to obtain the transcription and/or translation
of the sequence
to effect phenotypic changes in the organism. Thus, any method which provides
for
effective transformation/transfection may be employed.
CA 02333434 2001-O1-10
WO 00168404 PCTlUS00/11086
-47-
A. Plant Transjormation
A DNA sequence coding for the desired polypeptide of the present invention,
for
example a cDNA or a genomic sequence encoding a full length protein, will be
used to
construct a recombinant expression cassette which can be introduced into the
desired plant.
Isolated nucleic acids of the present invention can be introduced into plants
according to techniques known in the art. Generally, recombinant expression
cassettes as
described above and suitable for transformation of plant cells are prepared.
The isolated
nucleic acids of the present invention can then be used for transformation. In
this manner,
genetically modified plants, plant cells, plant tissue, seed, and the like can
be obtained.
Transformation protocols may vary depending on the type of plant cell, i.e.
monocot or
dicot, targeted for transformation. Suitable methods of transforming plant
cells include
microinjection (Crossway et al. (1986) Biotechniques 4:320-334),
electroporation (Riggs
et al ( 1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium mediated
transformation (see for example, Zhao et al. U.S. Patent 5,981,840; Hinchee et
al. (1988)
Biotechnology 6:915-921 ), direct gene transfer (Paszkowski et al ( 1984) EMBO
J. 3:2717-
2722), and ballistic particle acceleration (see, for example, Sanford et al.
U.S. Patent
4,945,050; Tomes et al. "Direct DNA Transfer into Intact Plant Cells via
Microprojectile
Bombardment" In Gamborg and Phillips (Eds.) Plant Cell, Tissue and Organ
Culture:
Fundamental Methods, Springer-Verlag, Berlin ( 1995); and McCabe et al. (
1988)
Biotechnolog~.~ 6:923-926). Also see, Weissinger et al. (1988) Annual Rev.
Genet. 22:421-
477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion);
Christou
et al. (1988) Plant Phisiol. 87:671-674 (soybean); McCabe et al. (1988)
BiolTechnologv~
6:923-926 (soybean); Datta et al. (1990) Biotechnolog~~ 8:736-740 (rice);
Klein et al.
(1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988)
Biotechnoloas 6:559-563 (maize); Tomes et al. "Direct DNA Transfer into Intact
Plant
Cells via Microprojectile Bombardment" In Gamborg and Phillips (Eds.) Plant
Cell, Tissue
and Organ Culture: Fundamental Methods, Springer-Verlag, Berlin (1995)
(maize); Klein
et al. (1988) Plant Physiol. 91:440-444 (maize) Fromm et al. (1990)
Biotechrtologv 8:833-
839 (maize); Hooykaas-Van Slogteren & Hooykaas ( 1984) Nature (London) 311:763-
764;
Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De
Wet et al.
(1985) In The Experimental Manipulation of Ovule Tissues ed. G.P. Chapman et
al. pp.
197-209. Longman, NY (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-
418;
and Kaeppler et al. ( 1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
transformation); D'Halluin et al. ( 1992) Plant Cell 4:1495-1505
(electroporation); LI et al.
(1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of
Botany
75:745-750 (maize via Agrobacterium tumefaciens~; all of which are herein
incorporated
by reference.
The cells which have been transformed may be grown into plants in accordance
with conventional ways. See, for example. McCormick et al. (1986) Plant Cell
Reports,
5:81-84. These plants may then be grown, and either pollinated with the same
transformed
strain or different strains, and the resulting hybrid having the desired
phenotypic
characteristic identified. Two or more generations may be grown to ensure that
the subject
phenotypic characteristic is stably maintained and inherited and then seeds
harvested to
ensure the desired phenotype or other property has been achieved.
B. Transfection of Prokaryotes, Lower Eukan~otes, and Animal Cells
Animal and lower eukaryotic (e.g., yeast) host cells are competent or rendered
competent for transfection by various means. There are several well-known
methods of
introducing DNA into animal cells. These include: calcium phosphate
precipitation, fusion
of the recipient cells with bacterial protoplasts containing the DNA,
treatment of the
recipient cells with liposomes containing the DNA, DEAE dextran,
electroporation,
biolistics, and micro-injection of the DNA directly into the cells. The
transfected cells are
cultured by means well known in the art. Kuchler, R.J., Biochemical Methods in
Cell
Culture and Virology, Dowden, Hutchinson and Ross, lnc. (1977).
Synthesis of Proteins
The proteins of the present invention can be constructed using non-cellular
synthetic methods. Solid phase synthesis of proteins of less than about 50
amino acids in
length may be accomplished by attaching the C-terminal amino acid of the
sequence to an
insoluble support followed by sequential addition of the remaining amino acids
in the
sequence. Techniques for solid phase synthesis are described by Barany and
Merrifield,
Solid-Phase Peptide Synthesis, pp. 3-284 in The Peptides: Analysis, Synthesis,
Biolog~~.
Vol. 2: Special Methods in Peptide Synthesis. Part,-1.; Mernfield, et al., J.
Am. Cltem. Soc.
85: 2149-2156 (1963), and Stewart et al., Solid Phase Peptide Synthesis, 2nd
ed.. Pierce
Chem. Co., Rockford, Ill. ( 1984). Proteins of greater length may be
synthesized by
condensation of the amino and carboxy termini of shorter fragments. Methods of
forming
CA 02333434 2001-O1-10
WO 00168404 PCT/US00111086
-49-
peptide bonds by activation of a carboxy terminal end (e.g., by the use of the
coupling
reagent N,N'-dicycylohexylcarbodiimide)) is known to those of skill.
Purification of Proteins
The proteins of the present invention may be purified by standard techniques
well
known to those of skill in the art. Recombinantly produced proteins of the
present
invention can be directly expressed or expressed as a fusion protein. The
recombinant
protein is purified by a combination of cell lysis (e.g., sonication, French
press) and affinity
chromatography. For fusion products, subsequent digestion of the fusion
protein with an
appropriate proteolytic enzyme releases the desired recombinant protein.
The proteins of this invention, recombinant or synthetic, may be purified to
substantial purity by standard techniques well known in the art, including
detergent
solubilization, selective precipitation with such substances as ammonium
sulfate, column
chromatography, immunopurification methods, and others. See, for instance, R.
Scopes,
Protein Purification: Principles and Practice, Springer-Verlag: New York
(1982);
Deutscher, Guide to Protein Purification, Academic Press (1990). For example,
antibodies may be raised to the proteins as described herein. Purification
from E. coli can
be achieved following procedures described in U.S. Patent No. 4,511,503. The
protein
may then be isolated from cells expressing the protein and further purified by
standard
protein chemistry techniques as described herein. Detection of the expressed
protein is
achieved by methods known in the art and include, for example,
radioimmunoassays,
Western blotting techniques or immunoprecipitation.
Trans~enic Plant Regeneration
Plants cells transformed with a plant expression vector can be regenerated,
e.g.,
from single cells, callus tissue or leaf discs according to standard plant
tissue culture
techniques. It is well known in the art that various cells, tissues, and
organs from almost
any plant can be successfully cultured to regenerate an entire plant. Plant
regeneration
from cultured protoplasts is described in Evans et al., Protoplasts Isolation
acrd Culture,
Handbook ojPlant Cell Culture, Macmillilan Publishing Company, New York, pp.
124-
176 {1983); and Binding, Regeneration ojPlants, Plant Protoplasts, CRC Press,
Boca
Raton, pp. 21-73 ( 1985 ).
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
;o -
The regeneration of plants containing the foreign gene introduced by
Agrobacterium from leaf explants can be achieved as described by Horsch et
al., Science,
227:1229-1231 (1985). In this procedure, transformants are grown in the
presence of a
selection agent and in a medium that induces the regeneration of shoots in the
plant species
S being transformed as described by Fraley et al., Proc. Natl. Acad. Sci.
(U.S.A.), 80:4803
(1983). This procedure typically produces shoots within two to four weeks and
these
transformant shoots are then transferred to an appropriate root-inducing
medium
containing the selective agent and an antibiotic to prevent bacterial growth.
Transgenic
plants of the present invention may be fertile or sterile.
Regeneration can also be obtained from plant callus, explants, organs, or
parts
thereof. Such regeneration techniques are described generally in Klee et al.,
Ann. Rev. of
Plant Phvs. 38: 467-486 (1987). The regeneration of plants from either single
plant
protoplasts or various explants is well known in the art. See, for example,
Methods for
Plant Molecular Biology, A. Weissbach and H. Weissbach, eds., Academic Press,
Inc., San
Diego, Calif. (1988). This regeneration and growth process includes the steps
of selection
of transformant cells and shoots, rooting the transformant shoots and growth
of the
plantlets in soil. For maize cell culture and regeneration see generally, The
Maize
Handbook, Freeling and Walbot, Eds., Springer, New York (1994); Corn and Corn
Improvement, 3rd edition, Sprague and Dudley Eds., American Society of
Agronomy,
Madison, Wisconsin (1988).
One of skill will recognize that after the recombinant expression cassette is
stably
incorporated in transgenic plants and confirmed to be operable, it can be
introduced into
other plants by sexual crossing. Any of a number of standard breeding
techniques can be
used, depending upon the species to be crossed.
In vegetatively propagated crops, mature transgenic plants can be propagated
by the
taking of cuttings or by tissue culture techniques to produce multiple
identical plants.
Selection of desirable transgenics is made and new varieties are obtained,and
propagated
vegetatively for commercial use. In seed propagated crops, mature transgenic
plants can
be self crossed to produce a homozygous inbred plant. The inbred plant
produces seed
containing the newly introduced heterologous nucleic acid. These seeds can be
grown to
produce plants that would produce the selected phenotype.
Parts obtained from the regenerated plant, such as flowers, seeds, leaves,
branches,
fruit, and the like are included in the invention, provided that these parts
comprise cells
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/I 1086
s~
comprising the isolated nucleic acid of the present invention. Progeny and
variants, and
mutants of the regenerated plants are also included within the scope of the
invention,
provided that these parts comprise the introduced nucleic acid sequences.
Transgenic plants expressing the selectable marker can be screened for
transmission of the nucleic acid of the present invention by, for example,
standard
immunoblot and DNA detection techniques. Transgenic lines are also typically
evaluated
on levels of expression of the heterologous nucleic acid. Expression at the
RNA level can
be determined initially to identify and quantitate expression-positive plants.
Standard
techniques for RNA analysis can be employed and include PCR amplification
assays using
oligonucleotide primers designed to amplify only the heterologous RNA
templates and
solution hybridization assays using heterologous nucleic acid-specific probes.
The RNA-
positive plants can then analyzed for protein expression by Western immunoblot
analysis
using the specifically reactive antibodies of the present invention. In
addition, in situ
hybridization and immunocytochemistry according to standard protocols can be
done using
heterologous nucleic acid specific polynucleotide probes and antibodies,
respectively, to
localize sites of expression within transgenic tissue. Generally, a number of
transgenic
lines are usually screened for the incorporated nucleic acid to identify and
select plants
with the most appropriate expression profiles.
A preferred embodiment is a transgenic plant that is homozygous for the added
heterologous nucleic acid; i.e., a transgenic plant that contains two added
nucleic acid
sequences, one gene at the same locus on each chromosome of a chromosome pair.
A
homozygous transgenic plant can be obtained by sexually mating (selfing) a
heterozygous
transgenic plant that contains a single added heterologous nucleic acid,
germinating some
of the seed produced and analyzing the resulting plants produced for altered
expression of
a polynucleotide of the present invention relative to a control plant (i.e.,
native, non-
transgenic). Back-crossing to a parental plant and out-crossing with a non-
transgenic
plant are also contemplated.
Modulating Polypeptide Levels and/or Composition
The present invention further provides a method for modulating (i.e.,
increasing or
decreasing) the concentration or ratio of the polypeptides of the present
invention in a plant
or part thereof. Modulation can be effected by increasing or decreasing the
concentration
and/or the ratio of the polypeptides of the present invention in a plant. The
method
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
_>?.
comprises introducing into a plant cell with a recombinant expression cassette
comprising
a polynucleotide of the present invention as described above to obtain a
transformed plant
cell, culturing the transformed plant cell under plant cell growing
conditions, and inducing
or repressing expression of a polynucleotide of the present invention in the
plant for a time
sufficient to modulate concentration and/or the ratios of the polypeptides in
the plant or
plant part.
In some embodiments, the concentration and/or ratios of polypeptides of the
present invention in a plant may be modulated by altering, in vivo or in
vitro, the promoter
of a gene to up- or down-regulate gene expression. In some embodiments, the
coding
regions of native genes of the present invention can be altered via
substitution, addition,
insertion, or deletion to decrease activity of the encoded enzyme. See, e.g.,
Kmiec, U.S.
Patent 5,565,350; Zarling et al., PCT/LJS93/03868. And in some embodiments, an
isolated
nucleic acid (e.g., a vector) comprising a promoter sequence is transfected
into a plant cell.
Subsequently, a plant cell comprising the promoter operably linked to a
polynucleotide of
the present invention is selected for by means known to those of skill in the
art such as, but
not limited to, Southern blot, DNA sequencing, or PCR analysis using primers
specific to
the promoter and to the gene and detecting amplicons produced therefrom. A
plant or
plant part altered or modified by the foregoing embodiments is grown under
plant forming
conditions for a time sufficient to modulate the concentration and/or ratios
of polypeptides
of the present invention in the plant. Plant forming conditions are well known
in the art
and discussed briefly, supra.
In general, concentration or the ratios of the polypeptides is increased or
decreased
by at least 5%, 10%, 20%, 30%, 40%, 50%, 60°ro. 70%, 80%, or 90%
relative to a native
control plant, plant part, or cell lacking the aforementioned recombinant
expression
cassette. Modulation in the present invention may occur during and/or
subsequent to
growth of the plant to the desired stage of development. Modulating nucleic
acid
expression temporally and/or in particular tissues can be controlled by
employing the
appropriate promoter operably linked to a polynucleotide of the present
invention in. for
example, sense or antisense orientation as discussed in greater detail, supra.
Induction of
expression of a polynucleotide of the present invention can also be controlled
by
exogenous administration of an effective amount of inducing compound.
Inducible
promoters and inducing compounds which activate expression from these
promoters are
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
;;_
well known in the art. In preferred embodiments, the polypeptides of the
present invention
are modulated in monocots, particularly maize.
Molecular Markers
The present invention provides a method of genotyping a plant comprising a
Rad50
polynucleotide of the present invention. Preferably, the plant is a monocot,
such as maize
or sorghum. Genotyping provides a means of distinguishing homologs of a
chromosome
pair and can be used to differentiate segregants in a plant population.
Molecular marker methods can be used for phylogenetic studies, characterizing
genetic relationships among crop varieties, identifying crosses or somatic
hybrids,
localizing chromosomal segments affecting monogenic traits, map based cloning,
and the
study of quantitative inheritance. See, e.g., Plant Molecular Biology: A
Laboraton°
Manual, Chapter 7, Clark, Ed., Springer-Verlag, Berlin (1997). For molecular
marker
methods, see generally, The DNA Revolution by Andrew H. Paterson 1996 (Chapter
2) in:
Genome Mapping in Plants (ed. Andrew H. Paterson) by Academic Press/R. G.
Landis
Company, Austin, Texas, pp.7-21:
The particular method of genotyping in the present invention may employ any
number of molecular marker analytic techniques such as, but not limited to,
restriction
fragment length polymorphisms (RFLPs). RFLPs are the product of allelic
differences
between DNA restriction fragments resulting from nucleotide sequence
variability. As is
well known to those of skill in the art, RFLPs are typically detected by
extraction of
genomic DNA and digestion with a restriction enzyme. Generally, the resulting
fragments
are separated according to size and hybridized with a probe; single copy
probes are
preferred. Restriction fragments from homologous chromosomes are revealed.
Differences in fragment size among alleles represent an RFLP. Thus, the
present invention
further provides a means to follow segregation of Rad50 genes of the present
invention as
well as chromosomal sequences genetically linked to Rad50 genes using such
techniques
as RFLP analysis. Linked chromosomal sequences are within 50 centiMorgans
(eM), often
within 40 or 30 cM, preferably within 20 or 10 cM, more preferably within 5,
3, 2, or 1 cM
of a Rad50 gene of the present invention.
In the present invention, the nucleic acid probes employed for molecular
marker
mapping of plant nuclear genomes selectively hybridize, under selective
hybridization
conditions, to a gene encoding a Rad50 polynucleotide. In preferred
embodiments, the
CA 02333434 2001-O1-10
WO 00/68404 PCTNS00/11086
probes are selected from polynucleotides of the present invention. Typically,
these probes
are cDNA probes or restriction-enzyme treated (e.g., Pst I) genomic clones. In
the present
invention probes can be made from the polynucleotide of SEQ 1D NO: 1. The
length of
the probes is discussed in greater detail, supra, but are typically at least
15 bases in length,
more preferably at least 20, 25, 30, 35, 40, or 50 bases in length. Generally,
however, the
probes are less than about 1 kilobase in length. Preferably, the probes are
single copy
probes that hybridize to a unique locus in a haploid chromosome complement.
Some
exemplary restriction enzymes employed in RFLP mapping are EcoRI, EcoRv, and
Sstl.
As used herein the term "restriction enzyme" includes reference to a
composition that
recognizes and, alone or in conjunction with another composition, cleaves at a
specific
nucleotide sequence.
The method of detecting an RFLP comprises the steps of (a) digesting genomic
DNA of a plant with a restriction enzyme; (b) hybridizing a nucleic acid
probe, under
selective hybridization conditions, to a sequence of a polynucleotide of the
present of said
genomic DNA; (c) detecting therefrom a RFLP.
Other methods of differentiating polymorphic (allelic) variants of
polynucleotides
of the present invention can be had by utilizing molecular marker techniques
well known
to those of skill in the art including such techniques as: 1 ) single stranded
conformation
analysis (SSCA); 2) denaturing gradient gel electrophoresis (DGGE); 3) RNase
protection
assays; 4) allele-specific oligonucleotides (ASOs); S) the use of proteins
which recognize
nucleotide mismatches, such as the E. coli mutS protein; and 6) allele-
specific PCR. Other
approaches based on the detection of mismatches between the two complementary
DNA
strands include clamped denaturing gel electrophoresis (CDGE); heteroduplex
analysis
(HA); and chemical mismatch cleavage (CMC). Thus, the present invention
further
provides a method of genotyping comprising the steps of contacting, under
stringent
hybridization conditions, a sample suspected of comprising a Rad~O
polynucleotide with a
nucleic acid probe. Generally, the sample is a plant sample; preferably, a
sample suspected
of comprising a maize polynucleotide of the present invention (e.g., gene,
mRNA). The
nucleic acid probe selectively hybridizes, under stringent conditions, to a
subsequence of a
Rad50 polynucleotide comprising a polymorphic marker. Selective hybridization
of the
nucleic acid probe to the polymorphic marker nucleic acid sequence yields a
hybridization
complex. Detection of the hybridization complex indicates the presence of that
CA 02333434 2001-O1-10
WO 00/68404 PCTIUS00/11086
polymorphic marker in the sample. In preferred embodiments, the nucleic acid
probe
comprises a polynucleotide of the present invention.
UTRs and Colon Preference
In general, translational efficiency has been found to be regulated by
specific
sequence elements in the 5' non-coding or untranslated region (5' UTR) of the
RNA.
Positive sequence motifs include translational initiation consensus sequences
(Kozak,
Nucleic Acids Res.15:8125 (1987)) and the 7-methylguanosine cap structure
(Drummond
et al., Nucleic Acids Res. 13:7375 (1985)). Negative elements include stable
intramolecular 5' UTR stem-loop structures (Muesing et al., Cell 48:691
(1987)) and AUG
sequences or short open reading frames preceded by an appropriate AUG in the
5' UTR
(Kozak, supra, Rao et al., Mol. and Cell. Biol. 8:284 (1988)). Accordingly,
the present
invention provides 5' and/or 3' UTR regions for modulation of translation of
heterologous
coding sequences.
Further, the polypeptide-encoding segments of the polynucleotides of the
present
invention can be modified to alter colon usage. Altered colon usage can be
employed to
alter translational efficiency and/or to optimize the coding sequence for
expression in a
desired host such as to optimize the colon usage in a heterologous sequence
for expression
in maize. Colon usage in the coding regions of the polynucleotides of the
present
invention can be analyzed statistically using commercially available software
packages
such as "Colon Preference" available from the University of Wisconsin Genetics
Computer Group (see Devereaux et al., Nucleic Acids Res. 12: 387-395 (1984))
or
MacVector 4.1 (Eastman Kodak Co., New Haven, Conn.). Thus, the present
invention
provides a colon usage frequency characteristic of the coding region of at
least one of the
polynucleotides of the present invention. The number of polynucleotides that
can be used
to determine a colon usage frequency can be any integer .from 1 to the number
of
polynucleotides of the present invention as provided herein. Optionally, the
polynucleotides will be full-length sequences. An exemplary number of
sequences for
statistical analysis can be at least l, ~, 10, 20, 50, or 100.
Seguence Shuffling
The present invention provides methods for sequence shuffling using
polynucleotides of the present invention, and compositions resulting
therefrom. Sequence
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
shuffling is described in PCT publication No. WO 97/20078. See also, Zhang, J.-
H., et al.
Proc. Natl. Acad. Sci. USA 94:4504-4509 ( 1997). Generally, sequence shuffling
provides
a means for generating libraries of polynucleotides having a desired
characteristic which
can be selected or screened for. Libraries of recombinant polynucleotides are
generated
from a population of related sequence polynucleotides which comprise sequence
regions
which have substantial sequence identity and can be homologously recombined in
vitro or
in vivo. The population of sequence-recombined polynucleotides comprises a
subpopulation of polynucleotides which possess desired or advantageous
characteristics
and which can be selected by a suitable selection or screening method. The
characteristics
can be any property or attribute capable of being selected for or detected in
a screening
system, and may include properties of: an encoded protein, a transcriptional
element, a
sequence controlling transcription, RNA processing, RNA stability, chromatin
conformation, translation, or other expression property of a gene or
transgene, a replicative
element, a protein-binding element, or the like, such as any feature which
confers a
selectable or detectable property. In some embodiments, the selected
characteristic will be
a decreased Km and/or increased K~a~ over the wild-type protein as provided
herein. In other
embodiments, a protein or polynculeotide generated from sequence shuffling
will have a
ligand binding affinity greater than the non-shuffled wild-type
polynucleotide. The
increase in such properties can be at least 110%, 120%, 130%, 140% or at least
150% of
the wild-type value.
Generic and Consensus SeQUences
Polynucleotides and polypeptides of the present invention further include
those
having: (a) a generic sequence of at least two homologous polynucleotides or
polypeptides,
respectively, of the present invention; and. (b) a consensus sequence of at
least three
homologous polynucleotides or polypeptides, respectively, of the present
invention. The
generic sequence of the present invention comprises each species of
polypeptide or
polynucleotide embraced by the generic polypeptide or polynucleotide,
sequence,
respectively. The individual species encompassed by a polynucleotide having an
amino
acid or nucleic acid consensus sequence can be used to generate antibodies or
produce
nucleic acid probes or primers to screen for homologs in other species,
genera, families,
orders, classes, phylums, or kingdoms. For example, a polynucleotide having a
consensus
sequences from a gene family of Zea mans can be used to generate antibody or
nucleic acid
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
probes or primers to other Gramineae species such as wheat, rice, or sorghum.
Alternatively, a polynucleotide having a consensus sequence generated from
orthologous
genes can be used to identify or isolate orthologs of other taxa. Typically, a
polynucleotide
having a consensus sequence will be at least 9, 10, 1 S, 20, 25, 30, or 40
amino acids in
length, or 20, 30, 40, 50, 100, or 150 nucleotides in length. As those of
skill in the art are
aware, a conservative amino acid substitution can be used for amino acids
which differ
amongst aligned sequence but are from the same conservative substitution group
as
discussed above. Optionally, no more than 1 or 2 conservative amino acids are
substituted
for each 10 amino acid length of consensus sequence.
Similar sequences used for generation of a consensus or generic sequence
include
any number and combination of allelic variants of the same gene, orthologous,
or
paralogous sequences as provided herein. Optionally, similar sequences used in
generating
a consensus or generic sequence are identified using the BLAST algorithm's
smallest sum
probability {P(N)). Various suppliers of sequence-analysis software are listed
in chapter 7
of Current Protocols in Molecular Biology, F.M. Ausubel et al., Eds., Current
Protocols, a
joint venture between Greene Publishing Associates, Inc. and John Wiley &
Sons, Inc.
(Supplement 30). A polynucleotide sequence is considered similar to a
reference sequence
if the smallest sum probability in a comparison of the test nucleic acid to
the reference
nucleic acid is less than about 0.1, more preferably less than about 0.01, or
0.001, and most
preferably less than about 0.0001, or 0.00001. Similar polynucleotides can be
aligned and
a consensus or generic sequence generated using multiple sequence alignment
software
available from a number of commercial suppliers such as the Genetics Computer
Group's
(Madison, WI) PILEUP software, Vector NTI's (North Bethesda, MD) ALIGN?, or
Genecode's (Ann Arbor, MI) SEQUENCHER. Conveniently, default parameters of
such
2~ software can be used to generate consensus or generic sequences.
Assays for Compounds that Modulate Enzymatic Activity or Expression
The present invention also provides means for identifying compounds that bind
to
(e.g., substrates), and%or increase or decrease (i.e., modulate) the enzymatic
activity of,
catalytically active polypeptides of the present invention. The method
comprises
contacting a polypeptide of the present invention with a compound whose
ability to bind to
or modulate enzyme activity is to be determined. The polypeptide employed will
have at
least 20°~0, preferably at least 30% or 40°,%, more preferably
at least 50% or 60°~0. and most
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
preferably at least 70°io or 80% of the specific activity of the
native, full-length polypeptide
of the present invention (e.g., enzyme). Generally, the polypeptide will be
present in a
range sufficient to determine the effect of the compound, typically about 1 nM
to 10 ~M.
Likewise, the compound will be present in a concentration of from about 1 nM
to 10 ~M.
Those of skill will understand that such factors as enzyme concentration,
ligand
concentrations (i.e., substrates, products, inhibitors, activators), pH, ionic
strength, and
temperature will be controlled so as to obtain useful kinetic data and
determine the
presence of absence of a compound that binds or modulates polypeptide
activity. Methods
of measuring enzyme kinetics is well known in the art. See, e.g., Segel,
Biochemical
Calculations, 2n'~ ed., John Wiley and Sons, New York (1976).
Although the present invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious that
certain changes and modifications may be practiced within the scope of the
appended
claims.
Examine 1
This example describes the construction of the eDNA libraries.
Total RNA Isolation
The RNA for SEQ >D NO: 1 was isolated from premeiotic ear shoot tissue from
maize line A632. Total RNA was isolated from corn tissues with TRIZOL Reagent
(Life
Technology Inc. Gaithersburg, MD) using a modification of the guanidine
isothiocyanate/acid-phenol procedure described by Chomczynski and Sacchi
(Chomczynski, P., and Sacchi, N. Anal. Biochenr. 162, 1~6 (1987)). In brief,
plant tissue
2~ samples were pulverized in liquid nitrogen before the addition of the
TRIZOL Reagent,
and then were further homo;enized with a mortar and pestle. Addition of
chloroform
followed by centrifugation was conducted for separation of an aqueous phase
and an
organic phase. The total RNA was recovered by precipitation v~ith isopropyl
alcohol from
the aqueous phase.
Poly(A)+ RNA Isolation
The selection of polv(A)+ RNA from total RNA was performed using
POLYATTRACT system (Promega Corporation. Madison, Vl%I). In brief,
biotinylated
CA 02333434 2001-O1-10
WO 00/68404 PCTIUS00/11086
_;',_
oligo(dT) primers were used to hybridize to the 3' poly(A) tails on mRNA. The
hybrids
were captured using streptavidin coupled to paramagnetic particles and a
magnetic
separation stand. The mRNA was washed at high stringency conditions and eluted
by
RNase-free deionized water.
cDNA Library Construction
cDNA synthesis was performed and unidirectional cDNA libraries were
constructed using the SUPERSCRIPT Plasmid System (Life Technology Inc.
Gaithersburg,
MD). The first stand of cDNA was synthesized by priming an oligo(dT) primer
containing
a Not I site. The reaction was catalyzed by SUPERSCRIPT Reverse Transcriptase
II at
45°C. The second strand of cDNA was labeled with alpha-''P-dCTP and a
portion of the
reaction was analyzed by agarose gel electrophoresis to determine cDNA sizes.
cDNA
molecules smaller than 500 base pairs and unligated adapters were removed by
SEPHACRYL-S400 chromatography. The selected cDNA molecules were ligated into
pSPORTI vector in between of Not I and Sal I sites.
Example 2
This example describes cDNA sequencing and library subtraction.
Sequencing Template Preparation
Individual colonies were picked and DNA was prepared either by PCR with M 13
forward primers and M13 reverse primers, or by plasmid isolation. All the cDNA
clones
were sequenced using M13 reverse primers.
Q-bot Subtraction Procedure
cDNA libraries subjected to the subtraction procedure were plated out on 22 x
22
cm' agar plate at density of about 3,000 colonies per plate. The plates were
incubated in a
37°C incubator for 12-24 hours. Colonies were picked into 384-well
plates by a robot
colony picker, Q-bot (GENETIX Limited). These plates were incubated overnight
at 37"C.
Once sufficient colonies were picked, they were pinned onto 22 x 22 cm- nylon
membranes using Q-bot. Each membrane contained 9,216 colonies or 36,864
colonies.
These membranes were placed onto agar plate with appropriate antibiotic. The
plates were
incubated at 37°C for overnight.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-c,o-
After colonies were recovered on the second day, these filters were placed on
filter
paper pre-wetted with denaturing solution for four minutes, then were
incubated on top of
a boiling water bath for additional four minutes. The filters were then placed
on filter
paper pre-wetted with neutralizing solution for four minutes. After excess
solution was
removed by placing the filters on dry filter papers for one minute, the colony
side of the
filters were place into Proteinase K solution, incubated at 37°C for 40-
50 minutes. The
filters were placed on dry filter papers to dry overnight. DNA was then cross-
linked to
nylon membrane by L7V light treatment.
Colony hybridization was conducted as described by Sambrook,J., Fritsch, E.F.
and
Maniatis, T., (in Molecular Cloning: A laboratory Manual, 2"d Edition). The
following
probes were used in colony hybridization:
t . First strand cDNA from the same tissue as the library was made from to
remove the
most redundant clones.
2. 48-192 most redundant cDNA clones from the same library based on previous
sequencing data.
3. 192 most redundant cDNA clones in the entire corn sequence database.
4. A Sal-A20 oligo nucleotide: TCG ACC CAC GCG TCC GAA AAA AAA AAA AAA
AAA AAA, listed in SEQ )Z7 NO: 3, removes clones containing a poly A tail but
no
cDNA.
5. cDNA clones derived from rRNA.
The image of the autoradiography was scanned into computer and the signal
intensity and
cold colony addresses of each colony was analyzed. Re-arraying of cold-
colonies from 384
well plates to 96 well plates was conducted using Q-bot.
Example 3
This example describes identification of the gene from a computer homology
search.
Gene identities were determined by conducting BLAST (Basic Local Alignment
Search Tool; Altschul, S. F.. et al., ( 1990) J. Mol. Biol. 215:403-410; see
also
www.ncbi.nlm.nih.gov/BLAST/) searches under default parameters for similarity
to
sequences contained in the BLAST "nr" database (comprising all non-redundant
GenBank
CDS translations, sequences derived from the 3-dimensional structure
Brookhaven Protein
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
Data Bank, the last major release of the SWISS-PROT protein sequence database,
EMBL,
and DDBJ databases). The cDNA sequences were analyzed for similarity to all
publicly
available DNA sequences contained in the "nr" database using the BLASTN
algorithm.
The DNA sequences were translated in all reading frames and compared for
similarity to
all publicly available protein sequences contained in the "nr" database using
the BLASTX
algorithm (Gish, W. and States, D. J. Nature Genetics 3:266-272 (1993))
provided by the
NCBI. In some cases, the sequencing data from two or more clones containing
overlapping segments of DNA were used to construct contiguous DNA sequences. ,
Example 4
This example displays structural motifs of the maize Rad50 protein sequence.
The
highlighted areas indicate nucleotide binding sites. The N-terminal binding
site, the
Walker-A motif, is known to bind ATP. The putative nuclear localization
signals are
identified by italics and the bolding indicates the leucine zipper motifs.
Structural motifs of Maize Rad50 protein seauence (SEQ ID NO: 2)
1 MSTVDKMLIK GIRSFDPDNK NVITFFKPLT LIVGPNGAGK TTIIECLKLS
2O 51 CTGELPPNSR SGHTFVHDPK VAGETETKGQ IKLRFKTAAG KDWCIRSFQ
101 LTQKASKMEF KAIESVLQTI NPHTGEKVCL SYRCADMDRE IPALMGVSRA
151 VLENVIFVHQ DESNWPLQDP STLKKKFDDI FSATRYTKAL EVIRRLHKDQ
2J
201 MQEIKTFRLK LENLQTVKDQ AHKLRENIAQ DQEKSDASKS QMEQLKEKIC
251 GTEREILQME TSLDELRRLQ GQIDIKATER STLLTQQHEK LAALSEENED
3O 301 TDEELMEWQT KFEERIALLE TRISRLVRDM DDEASYSSVL SKQNSELTHE
351 IGRLQASADA HLTMKHERDS DIKNICTKHN LGPVPEHPFT NDVAMNLTNR
401 IRARLSSLEN DLLDKKKSNE DQLDVLWKHY LKINARYSEV DGQIQSKIES
3~
451 MSGILRRRKD KEKERDAAEV ELSKFNLSRI DERERHMQIE VERKTLALGE
501 RDYDSIISQK RTEVYSLEQK IKVLLREKDI INRNADERVK LGLRRDALES
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
-G'_-
551 SRDRLNEIVN EHKDKIKKVL RGRNPFEKDM KKEINQAFWP VDKEYNELRS
601 KSQEAEQELK FTQSKVTDAR EQLTKLRRDM DAKRRFLDSR LQSILQISAN
S 651 VDMFPKVLQD AMNKRDEQKR LENFANGMRE MLAPFEHLAR KNHVCPCCER
701 AFTPDEEDEF VKKQRMQNSS TAERSKALAM ESSNAEALFQ QLDRLRTIYD
751 AYVKLVEETI PLAEKNLNQH LADESQKAQA FDDLLGVLAH VQMDRDAVEA
BO1 LLQPTDTIDR HVHEIQQLVR EVEDLEYALD SSGRGVKSLE EIQLELNFLQ
851 RTRDTLIVEV DDLRDQHRML NEDMSSAQVR WHNAREEKVK ASSILERFQK
IS 901 SEEELVLLAE EREQLIVERK LLEESLDPLS REKESLLQEY NALRQRLDEE
951 YHQLAERKRE FQQELDALGR LNMRIRGYLD SRRNERLKEL QGRHVLCHSQ
1001 LQSCMAKQQR ISAELNRSRE LLQGQGQLRR NIDDNLKYRK TKADVEQLTR
1051 DIESLEERLL SIGSLSAIEA DLKRHSQEKE RLNSEFNRWQ GTLSVYQSNI
1101 SKHKQELKLS QYKDIEKRYT NQFLQLKTTE MANKDLDRYY TALDKALMRF
2S 1151 HSMKMEEINK IIKELWQQTY RGQDIDYISI NSDSEGAGTR SYSYRVVMQT
1201 GDAELEMRGR CSAGQKVLAS LIIRLALAET FCLNCGILAL DEPTTNLDGP
1251 NAESLAAALL RIMEARKGQE NFQLIVITHD ERFAHLIGQR QLAEKYYRVS
1301 KDENQHSIIE SQEIFD*
The above examples are provided to illustrate the invention but not to limit
its
3S scope. Other variants of the invention will be readily apparent to one of
ordinary skill in
the art and are encompassed by the appended claims. All publications, patents,
patent
applications, and computer programs cited herein are hereby incorporated by
reference.
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
1
SEQUENCE LISTING
<110> Pioneer Hi-Bred International, Inc.
<120> Maize Rad50 Orthologue and Uses Thereof
<130> 1116-PCT
<150> 60/132,575
<151> 1999-05-05
<160> 3
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4492
<212> DNA
<213> Zea mays
<220>
<221> CDS
<222> (292)...(4239)
<400>
1
aattcggcacgagtggatccattagcacccatagccgtacaaaaccctaagaaccctaac60
cggtacaaaaccctaaaaaccctaacgccgctgaagactccaaaaaaacgcgattttctc120
ctccactgcccctccttttctctttccaatcgttttgcaatcactacgagcgtaatgaat180
agaagttgatagggagatagcatccgcaatctaggtttggggcaatcgctctggccagac240
tggatcggagtgcaagtcgtagagggaggcacttggggctcgtggggcaag atg agc 297
Met Ser
1
acc gtt gac aag atg ctg atc aag ggg att cgg agc ttc gat ccg gac 345
Thr Val Asp Lys Met Leu Ile Lys Gly Ile Arg Ser Phe Asp Pro Asp
10 15
aat aag aac gtc atc acc ttc ttc aag ccg ctc acc ctc atc gtt ggc 39..
Asn Lys Asn Val Ile Thr Phe Phe Lys Pro Leu Thr Leu Ile Val Gly
20 25
ccc aac ggt get ggc aag acc acg atc atc gag tgc ctg aag ctt tct 44,~
Pro Asn Gly Ala Gly_ Lys Thr Thr Ile Ile Glu Cys Leu Lys Leu Ser
35 40 45 50
tgc acc ggc gag ctg ccc ccc aac tcc cgc tct ggc cac acc ttc gtc 489
Cys Thr Gl=r Glu Leu Pro Pro Asn Ser Arg Ser Gi~_.- His Thr Phe Val
55 6U 65
cac gac ccc aag gta act ggc gag acg gaa aca aaa gga caa att aag 53-
His Asp Pro Lys Vai Ala Gl_,: Glu Thr Glu Thr Lv_-s Gly Gln Ile Lys
70 75 8C
ttg cgg ttt aag act gca gca gga aag gat gtg gig tgc atc cgg tcc 58
Leu Arg Phe Lys Th~_- Ala Ala Glv Lys Asp Val Vat Cvs Ile Arg Ser
85 90 95
ttc cag ctt acc caa aag gca tca aag atg gag tit aag gca att gaa 633
Phe Gln Leu Thr Gln Lw_s Ala Ser Lv_s Men. Glu Phe Lv_s Ala Ile Glu
100 105 1'1 ,
CA 02333434 2001-O1-10
WO 00!68404 PCT/IJS00/11086
2
agc gtc ctc cag act ata aat cca cac aca ggg gag aaa gtc tgc ctc 681
Ser Val Leu Gln Thr Ile Asn Pro His Thr Gly Glu Lys Val Cys Leu
115 120 125 130
agc tac aga tgt get gac atg gat aga gag att cct gcc tta atg ggt 729
Ser Tyr Arg Cys Ala Asp Met Asp Arg Glu Ile Pro Ala Leu Met Gly
135 140 145
gtt tcg aag gcc gta ctg gag aat gtt ata ttt gtt cac caa gat gaa 777
Val Ser Lys Ala Val Leu Glu Asn Val Ile Phe Val His Gln Asp Glu
150 155 160
tcc aat tgg cca ttg cag gac ccg tca aca ctt aag aag aag ttc gat 825
Ser Asn Trp Pro Leu Gln Asp Pro Ser Thr Leu Lys Lys Lys Phe Asp
165 170 175
gac atc ttc tct gcc aca cgc tat acg aaa get ctt gaa gtc ata aag 873
Asp Ile Phe Ser Ala Thr Arg Tyr Thr Lys Ala Leu Glu Val Ile Lys
180 185 190
aaa ctt cac aag gat caa atg caa gag atc aag act ttt agg tta aag 921
Lys Leu His Lys Asp Gln Met Gln Glu Ile Lys Thr Phe Arg Leu Lys
195 200 205 210
ctg gag aac ctt cag act gta aaa gac caa gca cat aag ctg cgt gaa 969
Leu Glu Asn Leu Gln Thr Val Lys Asp Gln Ala His Lys Leu Arg Glu
215 220 225
aat att get caa gat caa gaa aag tca gat gcc tca aaa tct cag atg 1017
Asn Ile Ala Gln Asp Gln Glu Lys Ser Asp Ala Ser Lys Ser Gln Met
230 235 240
gag caa ctg aag gaa aag atc tgt ggt acc gag aga gaa atc ctg caa 1065
Glu Gln Leu Lys Glu Lys Ile Cys Gly Thr Glu Arg Glu Ile Leu Gln
245 250 255
atg gaa aca agt ttg gat gaa ctg aga aga ctt cag gga caa att gac 1113
Met Glu Thr Ser Leu Asp Glu Leu Arg Arg Leu Gln Gly Gln Ile Asp
260 265 270
atc aag gca aca gag aga agt aca tta ctt acg cag cag cat gaa aag 1161
Ile Lys Ala Thr Glu Arg Ser Thr Leu Leu Thr Gln Gln His Glu Lys
275 280 285 290
ctt get gca ctt tct gag gaa aat gaa gat acc gat gag gaa cta atg 1209
Leu Ala Ala Leu Ser Glu Glu Asn Glu Asp Thr Asp Glu Glu Leu Met
295 300 305
gaa tgg caa aca aaa ttt gaa gaa agg att gcg tta cta gaa aca aaa 1257
Glu Trp Gln Thr Lys Phe Glu Glu Arg Ile Ala Leu Leu Glu Thr Lys
310 315 320
atc agt aaa ctt gta aga gat atg gat gat gaa gca tct tat agc tcc 1305
Ile Ser Lys Leu Val Arg Asp Met Asp Asp Glu Ala Ser Tyr Ser Ser
325 330 335
gtt ctg tcc aaa caa aat tct gaa tta aca cat gaa att gga aag ctc 1353
Val Leu Ser Lys Gln Asn Ser Glu Leu Thr His Glu Ile Gly Lys Leu
340 345 350
cag gca gaa get gat get cac ctg act atg aag cat gaa cga gac tca 1401
Gln Ala Glu Ala Asp Ala His Leu Thr Met Lys His Glu Arg Asp Ser
CA 02333434 2001-O1-10
WO 00/68404 3 PCTNS00/11086
355 360 365 370
gac ata aaa aat ata tgc act aaa cat aat ctt ggg ccg gtt cct gaa 1449
Asp Ile Lys Asn Ile Cys Thr Lys His Asn Leu Gly Pro Val Pro Glu
375 380 385
cat ccc ttt acg aat gat gtt get atg aac ctt aca aac agg att aaa 1497
His Pro Phe Thr Asn Asp Val Ala Met Asn Leu Trr Asn Arg Ile Lys
390 395 400
gcg aga cta tca agt ctt gag aat gat ttg ctg gat aag aag aaa tcc 1545
Ala Arg Leu Ser Ser Leu Glu Asn Asp Leu Leu Asp Lys Lys Lys Ser
405 410 415
aat gaa gat cag tta gat gtt ttg tgg aaa cac tat ctt aaa ata aat 1593
Asn Glu Asp Gln Leu Asp Val Leu Trp Lys His Tyr Leu Lys Ile Asn
420 425 430
get cgc tac tcc gaa gtt gat ggt cag ata caa tct aag att gaa tcc 1641
Ala Arg Tyr Ser Glu Val Asp Gly Gln Ile Gln Ser Lys Ile Glu Ser
435 440 445 450
atg tca ggc att tta aga cgg aga aaa gat aaa gag aaa gaa cgc gat 1689
Met Ser Gly Ile Leu Arg Arg Arg Lys Asp Lys Glu Lys Glu Arg Asp
455 460 465
get gca gaa gtg gag ctt tca aaa ttt aat cta tcc cgt atc gat gag 1737
Ala Ala Glu Val Glu Leu Ser Lys Phe Asn Leu Ser Arg Ile Asp Glu
470 475 480
agg gag aga cat atg caa att gaa gtc gag agg aag aca ctt gcg ctt 1785
Arg Glu Arg His Met Gln Ile Glu Val Glu Arg Lys Thr Leu Ala Leu
485 490 495
gga gaa aga gac tat gat tca att'ata agt cag aaa cga aca gaa gta 1833
Gly Glu Arg Asp Tyr Asp Ser Ile Ile Ser Gln Lys Arg Thr Glu Val
500 505 51.0
tat agt ttg gaa cag aaa ata aaa gtg ctt ctg cgg gag aaa gat ata 1881
Tyr Ser Leu Glu Gln Lys Ile Lys Val Leu Leu Arg Glu Lys Asp Ile
515 520 525 530
ata aat aga aat get gat gaa aga gta aaa ctg ggt ttg aag aag gat 1929
Ile Asn Arg Asn Ala Asp Glu Arg Val Lys Leu Gly Leu Lys Lys Asp
5 540 545
gca ttg gaa agc agc aag gac aag ctc aat gag ata gtt aat gag cat 1977
Ala Leu Glu Ser Ser Lys Asp Lys Leu Asn Glu I.l.e Val Asn Glu His
550 555 560
aag gat aaa atc aaa aag gta ctt agg ggg agg aat cct ttt gag aag 202
Lys Asp Lys Ile Lys Lys Val Leu Arg G1y Arg Asn Pro Phe Glu Lys
565 570 575
gat atg aag aag gag atc aat caa gcc ttt tgg cct gtg gac aag gaa 2073
Asp Met Lys Lys Glu Ile Asn G1n Ala Phe Trp Pro Val Asp Lys Glu
580 585 590
tac aat gag tta aga tca aaa tcc cag gaa gca gag caa gag ctt aaa 2121
Tyr Asn Glu Leu Arg Ser Lys Ser Gln Glu Ala Glu Gln Glu Leu Lys
595 600 605 610
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
4
ttt act cag agc aaa gta act gat get aga gaa caa ttg aca aaa ctt 2169
Phe Thr Gln Ser Lys Val Thr Asp Ala Arg Glu Gln Leu Thr Lys Leu
615 620 625
cga aga gat atg gat gca aaa aga aga ttc ctg gac tcg aaa ctt caa 2217
Arg Arg Asp Met Asp Ala Lys Arg Arg Phe Leu Asp Ser Lys Leu Gln
630 635 640
tct att tta cag ata tct get aat gtt gac atg ttt ccc aaa gtt cta 2265
Ser Ile Leu Gln Ile 5er Ala Asn Val Asp Met Phe Pro Lys Val Leu
645 650 655
caa gac gcc atg aac aaa aga gat gaa cag aaa aga tta gag aat ttc 2313
Gln Asp Ala Met Asn Lys Arg Asp Glu Gln Lys Arg Leu Glu Asn Phe
660 665 670
gca aat gga atg cgg gaa atg ctt gca cct ttt gaa cat ttg get cgg 2361
Ala Asn Gly Met Arg Glu Met Leu Ala Pro Phe Glu His Leu Ala Arg
675 680 685 690
aag aat cat gta tgc cca tgc tgt gaa cgt get ttc aca cct gat gag 2409
Lys Asn His Val Cys Pro Cys Cys Glu Arg Ala Phe Thr Pro Asp Glu
695 700 705
gag gat gag ttc gtg aag aaa caa agg atg caa aac tca agt act gca 2457
Glu Asp Glu Phe Val Lys Lys Gln Arg Met Gln Asn Ser Ser Thr Ala
710 715 720
gag aga tct aaa get ctg gca atg gaa tca tca aat get gaa get ctt 2505
Glu Arg Ser Lys Ala Leu Ala Met Glu Ser Ser Asn Ala Glu Ala Leu
725 730 735
ttt cag caa ttg gat aaa ctt cgg act atc tat gat get tat gtg aag 2553
Phe Gln Gln Leu Asp Lys Leu Arg Thr Ile Tyr Asp Ala Tyr Val Lys
740 745 750
ctg gta gaa gaa acc ata cct cta gca gag aaa aac ttg aat caa cat 2601
Leu Val Glu Glu Thr Ile Pro Leu Ala Glu Lys Asn Leu Asn Gln His
755 760 765 770
ttg gcg gat gaa agt cag aag gcg cag gca ttt gat gat ctt ttg ggt 2649
Leu Ala Asp Glu Ser Gln Lys Ala Gln Ala Phe Asp Asp Leu Leu Gly
775 780 785
gtt ctt gcc cat gtt caa atg gac agg gat gca gtg gaa gcc tta tta 2697
Val Leu Ala His Val Gln Met Asp Arg Asp Ala Val Glu Ala Leu Leu
790 795 800
caa ccc act gat act att gac agg cat gta cat gaa att caa cag cta 2745
Gln Pro Thr Asp Thr Ile Asp Arg His Val His Glu Ile Gln Gln Leu
805 810 815
gtc aaa gaa gta gaa gat ctt gaa tat gca ctt gat tct agt ggc cga 2793
Val Lys Glu Val Glu Asp Leu Glu Tyr Ala Leu Asp Ser Ser Gly Arg
820 825 830
ggt gtc aag tct ttg gag gaa att caa ctg gag ctg aac ttt ctg cag 2841
Gly Val Lys Ser Leu Glu Glu Ile Gln Leu Glu Leu Asn Phe Leu Gln
835 840 845 850
aga aca agg gac aca ttg att gtc gaa gtg gat gat ctt aga gat caa 2889
Arg Thr Arg Asp Thr Leu Ile Val Glu Val Asp Asp Leu Arg Asp Gln
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
855 860 865
cat aga atg cta aat gaa gat atg tca agt get cag gtg aga tgg cac 2937
His Arg Met Leu Asn Glu Asp Met Ser Ser Ala Gln Val Arg Trp His
870 875 880
aat get cgg gaa gag aaa gtg aaa get tct agc ata ttg gaa aga ttc 2985
Asn Ala Arg Glu Glu Lys Val Lys Ala Ser Ser Ile Leu Glu Arg Phe
885 890 895
caa aaa tct gaa gag gaa ttg gtg ctt cta get gag gaa aaa gaa caa 3033
Gln Lys Ser Glu Glu Glu Leu Val Leu Leu Ala Glu Glu Lys Glu Gln
900 905 910
ctg att gta gaa aag aag ctt tta gaa gag tct ctt gat cca ttg tcc 3081
Leu Ile Val Glu Lys Lys Leu Leu Glu Glu Ser Leu Asp Pro Leu Ser
915 920 925 930
aaa gag aaa gag agc ttg ttg caa gag tat aat get ttg aag caa aag 3129
Lys Glu Lys Glu Ser Leu Leu Gln Glu Tyr Asn Ala Leu Lys Gln Lys
935 940 945
ctg gat gaa gag tat cat cag ctt gca gaa aga aaa agg gag ttc cag 3177
Leu Asp Glu Glu Tyr His Gln Leu Ala Glu Arg Lys Arg Glu Phe Gln
950 955 960
caa gaa ctt gat get ctt gga aga ctt aat atg aag ata aaa ggg tac 3225
Gln Glu Leu Asp Ala Leu Gly Arg Leu Asn Met Lys Ile Lys Gly Tyr
965 970 975
ttg gat tcc aag aaa aac gaa aag ctt aag gaa ttg cag gga agg cat 3273
Leu Asp Ser Lys Lys Asn Glu Lys Leu Lys Glu Leu Gln Gly Arg His
980 985 990
gtt ctt tgc cat tct cag tta cag agt tgc atg gca aaa cag caa aga 3321
Val Leu Cys His Ser Gln Leu Gln Ser Cys Met Ala Lys Gln Gln Arg
995 1000 1005 1010
ata tca get gag tta aac aag agc aaa gaa cta ctg cag ggc cag ggc 3369
Ile Ser Ala Glu Leu Asn Lys Ser Lys Glu Leu Leu Gln Gly Gln Gly
1015 1020 1025
cag ttg aaa aga aac att gat gac aat ctc aag tac agg aaa aca aag 3417
Gln Leu Lys Arg Asn Ile Asp Asp Asn Leu Lys Tyr Arg Lys Thr Lys
1030 1035 1040
get gat gtg gaa caa ctt act cgt gat ata gaa tca ctt gaa gaa agg 3465
Ala Asp Val Glu Gln Leu Thr Arg Asp Ile Glu Ser Leu Glu Glu Arg
1045 1050 1055
ctg ctt tca ata ggt agc ttg tct get ata gaa get gat ctg aaa cgc 3513
Leu Leu Ser Ile Gly Ser Leu Ser Ala Ile Glu Ala Asp Leu Lys Arg
1060 1065 1070
cat tct caa gaa aaa gag agg ctt aat tca gaa ttt aac agg tgg caa 3561
His Ser Gln Glu Lys Glu Arg Leu Asn Ser Glu Phe Asn Arg Trp Gln
1075 1080 1085 1090
gga aca ctt tct gtt tat caa agt aat att tca aag cac aaa caa gag 3609
Gly Thr Leu Ser Val Tyr Gln Ser Asn Ile Ser Lys His Lys Gln Glu
1095 1100 1105
CA 02333434 2001-O1-10
WO 00/68404 PCT/iJS00/11086
6
ctt aaa ctg tca cag tac aag gat atc gag aag cga tat act aat caa 3657
Leu Lys Leu Ser Gln Tyr Lys Asp Ile Glu Lys Arg Tyr Thr Asn Gln
1110 1115 1120
tttctccag cttaagacaact gaaatg gcaaac aaggacttg gacaga 3705
PheLeuGln LeuLysThrThr GluMet AlaAsn LysAspLeu AspArg
1125 1130 1135
tattatact getttagacaag getctt atgcgg ttccacagc atgaag 3753
TyrTyrThr AlaLeuAspLys AlaLeu MetArg PheHisSer MetLys
1140 1145 1150
atggaggag ataaataaaata atcaag gaactg tggcaacag acatac 3801
MetGluGlu IleAsnLysIle IleLys GluLeu TrpGlnGln ThrTyr
1155 1160 1165 1170
agaggccag gatattgattac ataagc ataaat tctgattct gagggt 3849
ArgGlyGln AspIleAspTyr IleSer IleAsn SerAspSer GluGly
1175 1180 1185
get ggc act cga tca tac agc tac cgc gtt gtt atg caa act ggt gat 3897
Ala Gly Thr Arg Ser Tyr Ser Tyr Arg Val Val Met Gln Thr Gly Asp
1190 1195 1200
get gag ctg gaa atg cga ggg cgc tgc agt get ggt cag aag gtt ctt 3945
Ala Glu Leu Glu Met Arg Gly Arg Cys Ser Ala Gly Gln Lys Val Leu
1205 1210 1215
get tct ctt ata atc aga cta gca ctt gcg gaa act ttc tgc ctg aac 3993
Ala Ser Leu Ile Ile Arg Leu Ala Leu Ala Glu Thr Phe Cys Leu Asn
1220 1225 1230
tgc ggt ata ttg get ttg gat gag cca act acg aat cta gat ggg cca 4041
Cys Gly Ile Leu Ala Leu Asp Glu Pro Thr Thr Asn Leu Asp Gly Pro
1235 1240 1245 1250
aat gca gag agt ctt get get gcg ctg ttg aga ata atg gaa gcc agg 4089
Asn Ala Glu Ser Leu Ala Ala Ala Leu Leu Arg Ile Met Glu Ala Arg
1255 1260 1265
aaa ggg cag gag aac ttc cag ttg att gta atc act cat gat gag aga 4137
Lys Gly Gln Glu Asn Phe Gln Leu Ile Val Ile Thr His Asp Glu Arg
1270 1275 1280
ttt gcc cat ctt atc ggt caa agg cag ctt get gag aag tac tat cga 4185
Phe Ala His Leu Ile Gly Gln Arg Gln Leu Ala Glu Lys Tyr Tyr Arg
1285 1290 1295
gtc tcc aag gat gag aac cag cac agc ata att gaa tcc caa gag ata 4233
Val Ser Lys Asp Glu Asn Gln His Ser Ile Ile Glu Ser Gln Glu Ile
1300 1305 1310
ttt gac taagggtgtt ctaggaggct gtagcacgca ctcgtttgct agtcgaatcc 4289
Phe Asp
1315
agttaattta tgccaagtac tggtgccaga gcaatgttaa caagctttag gaggctctgt 4349
tacgccgtta cgtcagttgc gtgaaaccta tccttcgttg ttgtatactt atttaatctg 4409
gccagaggat ggaatgtgtg cactgggtga tggatgtttc acgacatcaa tgaatgtttc 4469
acaatctagc atcaaaaaaa aaa 4492
<210> 2
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
7
<211> 1316
<212 > PRT
<213> Zea mays
<400> 2
Met Ser Thr Val Asp Lys Met Leu Ile Lys Gly Ile Arg Ser Phe Asp
1 5 10 15
Pro Asp Asn Lys Asn Val Ile Thr Phe Phe Lys Pro Leu Thr Leu Ile
20 25 30
Val Gly Pro Asn Gly Ala Gly Lys Thr Thr Ile Ile Glu Cys Leu Lys
35 40 45
Leu Ser Cys Thr Gly Glu Leu Pro Pro Asn Ser Arg Ser Gly His Thr
50 55 60
Phe Val His Asp Pro Lys Val Ala Gly Glu Thr Glu Thr Lys Gly Gln
65 70 75 80
Ile Lys Leu Arg Phe Lys Thr Ala Ala Gly Lys Asp Val Val Cys Ile
85 90 95
Arg Ser Phe Gln Leu Thr Gln Lys Ala Ser Lys Met Glu Phe Lys Ala
100 105 110
Ile Glu Ser Val Leu Gln Thr Ile Asn Pro His Thr Gly Glu Lys Val
115 120 125
Cys Leu Ser Tyr Arg Cys Ala Asp Met Asp Arg Glu Ile Pro Ala Leu
130 135 140
Met Gly Val Ser Lys Ala Val Leu Glu Asn Val Ile Phe Val His Gln
145 150 155 160
Asp Glu Ser Asn Trp Pro Leu Gln Asp Pro Ser Thr Leu Lys Lys Lys
165 170 175
Phe Asp Asp Ile Phe Ser Ala Thr Arg Tyr Thr Lys Ala Leu Glu Val
180 185 190
Ile Lys Lys Leu His Lys Asp Gln Met Gln Glu Ile Lys Thr Phe Arg
195 200 205
Leu Lys Leu Glu Asn Leu Gln Thr Val Lys Asp Gln Ala His Lys Leu
210 215 220
Arg Glu Asn Ile Ala Gln Asp Gln Glu Lys Ser Asp Ala Ser Lys Ser
225 230 235 240
Gln Met Glu Gln Leu Lys Glu Lys Ile Cys Gly Thr Glu Arg Glu Ile
245 250 255
Leu Gln Met Glu Thr Ser Leu Asp Glu Leu Arg Arg Leu Gln Gly Gln
260 265 270
Ile Asp Ile Lys Ala Thr Glu Arg Ser Thr Leu Leu Thr Gln Gln His
275 280 285
Glu Lys Leu Ala Ala Leu Ser Glu Glu Asn Glu Asp Thr Asp Glu Glu
290 295 300
Leu Met Glu Trp Gln Thr Lys Phe Glu Glu Arg Ile Ala Leu Leu Glu
305 310 315 320
Thr Lys Ile Ser Lys Leu Val Arg Asp Met Asp Asp Glu Ala Ser Tyr
325 330 335
Ser Ser Val Leu Ser Lys Gln Asn Ser Glu Leu Thr His Glu Ile Gly
340 345 350
Lys Leu Gln Ala Glu Ala Asp Ala His Leu Thr Met Lys His Glu Arg
355 360 365
Asp Ser Asp Ile Lys Asn Ile Cys Thr Lys His Asn Leu Gly Pro Val
370 375 380
Pro Glu His Pro Phe Thr Asn Asp Val Ala Met Asn Leu Thr Asn Arg
385 390 395 400
Ile Lys Ala Arg Leu Ser Ser Leu Glu Asn Asp Leu Leu Asp Lys Lys
405 410 415
Lys Ser Asn Glu Asp Gln Leu Asp Val Leu Trp Lys His Tyr Leu Lys
420 425 430
Ile Asn Ala Arg Tyr Ser Glu Val Asp Gly Gln Ile Gln Ser Lys Ile
435 440 445
Glu Ser Met Ser Gly Ile Leu Arg Arg Arg Lys Asp Lys Glu Lys Glu
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
8
450 455 460
Arg Asp Ala Ala Glu Val Glu Leu Ser Lys Phe Asn Leu Ser Arg Ile
465 470 475 480
Asp Glu Arg Glu Arg His Met Gln Ile Glu Val Glu Arg Lys Thr Leu
485 490 495
Ala Leu Gly Glu Arg Asp Tyr Asp Ser Ile Ile Ser Gln Lys Arg Thr
500 505 510
Glu Val Tyr Ser Leu Glu Gln Lys Ile Lys Val Leu Leu Arg Glu Lys
515 520 525
Asp Ile Ile Asn Arg Asn Ala Asp Glu Arg Val Lys Leu Gly Leu Lys
530 535 540
Lys Asp Ala Leu Glu Ser Ser Lys Asp Lys Leu Asn Glu Ile Val Asn
545 550 555 560
Glu His Lys Asp Lys Ile Lys Lys Val Leu Arg Gly Arg Asn Pro Phe
565 570 575
Glu Lys Asp Met Lys Lys Glu Ile Asn Gln Ala Phe Trp Pro Val Asp
580 585 590
Lys Glu Tyr Asn Glu Leu Arg Ser Lys Ser Gln Glu Ala Glu Gln Glu
595 600 605
Leu Lys Phe Thr Gln Ser Lys Val Thr Asp Ala Arg Glu Gln Leu Thr
610 615 620
Lys Leu Arg Arg Asp Met Asp Ala Lys Arg Arg Phe Leu Asp Ser Lys
625 630 635 640
Leu Gln Ser Ile Leu Gln Ile Ser Ala Asn Val Asp Met Phe Pro Lys
645 650 655
Val Leu Gln Asp Ala Met Asn Lys Arg Asp Glu Gln Lys Arg Leu Glu
660 665 670
Asn Phe Ala Asn Gly Met Arg Glu Met Leu Ala Pro Phe Glu His Leu
675 680 685
Ala Arg Lys Asn His Val Cys Pro Cys Cys Glu Arg Ala Phe Thr Pro
690 695 700
Asp Glu Glu Asp Glu Phe Val Lys Lys Gln Arg Met Gln Asn Ser Ser
705 710 715 ?20
Thr Ala Glu Arg Ser Lys Ala Leu Ala Met Glu Ser Ser Asn Ala Glu
725 730 735
Ala Leu Phe Gln Gln Leu Asp Lys Leu Arg Thr Ile Tyr Asp Ala Tyr
740 745 750
Val Lys Leu Val Glu Glu Thr Ile Pro Leu Ala Glu Lys Asn Leu Asn
755 760 765
Gln His Leu Ala Asp Glu Ser Gln Lys Ala Gln Ala Phe Asp Asp Leu
770 775 780
Leu Gly Val Leu Ala His Val Gln Met Asp Arg Asp Ala Val Glu Ala
785 790 795 800
Leu Leu Gln Pro Thr Asp Thr Ile Asp Arg His Val His Glu Ile Gln
805 810 815
Gln Leu Val Lys Glu Val Glu Asp Leu Glu Tyr Ala Leu Asp Ser Ser
820 825 830
Gly Arg Gly Val Lys Ser Leu Glu Glu Ile Gln Leu Glu Leu Asn Phe
835 840 845
Leu Gln Arg Thr Arg Asp Thr Leu Ile Val Glu Val Asp Asp Leu Arg
850 855 860
Asp Gln His Arg Met Leu Asn Glu Asp Met Ser Ser Ala Gln Val Arg
865 870 875 880
Trp His Asn Ala Arg Glu Glu Lys Val Lys Ala Ser Ser Ile Leu Glu
885 890 895
Arg Phe Gln Lys Ser Glu Glu Glu Leu Val Leu Leu Ala Glu Glu Lys
900 905 910
Glu Gln Leu Ile Val Glu Lys Lys Leu Leu Glu Glu Ser Leu Asp Pro
915 920 925
Leu Ser Lys Glu Lys Glu Ser Leu Leu Gln Glu Tyr Asn Ala Leu Lys
930 935 940
Gln Lys Leu Asp Glu Glu Tyr His Gln Leu Ala Glu Arg Lys Arg Glu
CA 02333434 2001-O1-10
WO 00/68404 PCT/US00/11086
9
945 950 955 960
Phe Gln Gln Glu Leu Asp Ala Leu Gly Arg Leu Asn Met Lys Ile Lys
965 970 975
Gly Tyr Leu Asp Ser Lys Lys Asn Glu Lys Leu Lys Glu Leu Gln Gly
980 985 990
Arg His Val Leu Cys His Ser Gln Leu Gln Ser Cys Met Ala Lys Gln
995 1000 1005
Gln Arg Ile Ser Ala Glu Leu Asn Lys Ser Lys Glu Leu Leu Gln Gly
1010 1015 1020
Gln Gly Gln Leu Lys Arg Asn Ile Asp Asp Asn Leu Lys Tyr Arg Lys
1025 1030 1035 1040
Thr Lys Ala Asp Val Glu Gln Leu Thr Arg Asp Ile Glu Ser Leu Glu
1045 1050 1055
Glu Arg Leu Leu Ser Ile Gly Ser Leu Ser Ala Ile Glu Ala Asp Leu
1060 1065 1070
Lys Arg His Ser Gln Glu Lys Glu Arg Leu Asn Ser Glu Phe Asn Arg
1075 1080 1085
Trp Gln Gly Thr Leu Ser Val Tyr Gln Ser Asn Ile Ser Lys His Lys
1090 1095 1100
Gln Glu Leu Lys Leu Ser Gln Tyr Lys Asp Ile Glu Lys Arg Tyr Thr
1105 1110 1115 1120
Asn Gln Phe Leu Gln Leu Lys Thr Thr Glu Met Ala Asn Lys Asp Leu
1125 1130 1135
Asp Arg Tyr Tyr Thr Ala Leu Asp Lys Ala Leu Met Arg Phe His Ser
1140 1145 1150
Met Lys Met Glu Glu Ile Asn Lys Ile Ile Lys Glu Leu Trp Gln Gln
1155 1160 1165
Thr Tyr Arg Gly Gln Asp Ile Asp Tyr Ile Ser Ile Asn Ser Asp Ser
1170 1175 1180
Glu Gly Ala Gly Thr Arg Ser Tyr Ser Tyr Arg Val Val Met Gln Thr
1185 1190 1195 1200
Gly Asp Ala Glu Leu Glu Met Arg Gly Arg Cys Ser Ala Gly Gln Lys
1205 1210 1215
Val Leu Ala Ser Leu Ile Ile Arg Leu Ala Leu Ala Glu Thr Phe Cys
1220 1225 1230
Leu Asn Cys Gly Ile Leu Ala Leu Asp Glu Pro Thr Thr Asn Leu Asp
1235 1240 1245
Gly Pro Asn Ala Glu Ser Leu Ala Ala Ala Leu Leu Arg Ile Met Glu
1250 1255 1260
Ala Arg Lys Gly Gln Glu Asn Phe Gln Leu Ile Val Ile Thr His Asp
1265 1270 1275 1280
Glu Arg Phe Ala His Leu Ile Gly Gln Arg Gln Leu Ala Glu Lys Tyr
1285 1290 1295
Tyr Arg Val Ser Lys Asp Glu Asn Gln His Ser Ile Ile Glu Ser Gln
1300 1305 1310
Glu Ile Phe Asp
1315
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide based upon an adaptor
used for cDNA library construction and poly(dT) to
remove clones which have a poly(A) tail but no
cDNA insert.
<400> 3
tcgacccacg cgtccgaaaa aaaaaaaaaa aaaaaa 36
