Note: Descriptions are shown in the official language in which they were submitted.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
.
A PLANT DISEASE RESISTANCE SIGNALLING GENE:
MATERIALS AND METHODS RELATING THERETO
The present invention relates to a plant disease resistance
signalling gene and to materials and methods relating
thereto. In particular the invention relates to the Rarl
gene of barley and homologues thereof from other species.
Plant resistance to pathogens is known to be associated with
the induction of a battery of defence-related responses
including the production of antimicrobial compounds, the
activation of pathogenesis-related (PR) genes, cross-linking
of the plant cell wall, and the production of reactive oxygen
species (Dixon and Lamb 1990; Hammond-Kosack and Jones 1996).
In most cases resistance is associated with the activation of
a host cell death response at the site of attempted
infection, termed the hypersensitive response (HR). It has
proven difficult, however, to show the significance of a
particular response in arresting growth of the intruder using
biochemical and physiological techniques. In contrast,
genetic studies have defined loci, the R genes, that
contribute key roles in the response to microbial pathogens
carrying corresponding avirulence determinants (Flor 1971).
Therefore knowledge of these resistance gene products and
their signalling pathways promises deeper insights into plant
defence mechanisms. In recent years a large number of R
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
-
2 -
genes have been isolated (Martin et al. 1993; Bent et al.
1994; Jones et al. 1994; Mindrinos et al. 1994; Grant et al.
1995; Lawrence et al. 1995; Song et al. 1995; Anderson et al.
1997; Cai et al. 1997; Ori et al. 1997; Yoshimura et al.
1998). Most R genes isolated from plants.fall into two
classes, encoding either a variable stretch of leucine rich
repeats and a putative nucleotide binding site or encode a
leucine rich repeat domain but no nucleotide binding site. A
third and fourth class, each having only one representative
so far, encode proteins with leucine rich repeats and a
serine-threonine protein kinase domain, or a protein kinase
only. The precise action of R genes and the downstream
pathways they affect, however, are largely unknown.
The complexity of plant defence responses suggested that
other components beside the R gene are involved in resistance
reactions. First genetic evidence for additional components
in race-specific resistance was obtained in the barley-
powdery interaction by the identification of Rar1 and Rar2,
two components required for the action of the R gene Mla-12
(previously designated Nar-1 and Nar-2; Torp and Jmrgensen,
1986; Jrargensen 1988; Freialdenhoven et al. 1994). Later
studies in other plant pathogen interactions revealed similar
observations (Hammond-Kosack et al. 1994; Salmeron et al.
1994; Century et al. 1995; Parker et al. 1996) and two of
these components have recently been isolated in the simpler
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
3
dicot model species Arabidopsis thaliana (unpublished
PCT/GH98/01406; Century et al. 1997). Both of these
Arabidopsis genes, EDS1 and NDR1, are required for the
function of multiple R genes to different pathogens, i.e.
bacterial and fungal pathogens. NDRI encodes a putative
integral membrane protein with unknown biochemical function
whereas EDSI is predicted to encode a putative novel plant
lipase.
l0 To date, evidence indicates that mutants in barley Rar1
suppress most tested powdery mildew race-specific resistance
specificities encoded at the M1a locus on chromosome 1H (Mla-
6, M1a-9, MIa-12, M1a-13, MIa-14, M1a-22, and Mla-23) as well
as resistance specificities to powdery mildew at other loci
(Mlat, Mlh, Mlk, Mlra, and MIg) (J~srgensen 1996; Peterhansel
et al. 1997). However, in some cases, M1a-1, MIa-7 and mlo,
no suppression of a resistance gene function was observed
(J~rgensen, 1996; Peterhansel et al. 1997). Two chemically-
induced allelic mutants in Rarl, designated rarl-1 (mutant
M82) and rarl-2 (mutant M100), have been characterized
(Freialdenhoven et al. 1994). Each of these two recessive
mutant alleles enables the powdery mildew pathogen to
complete its life cycle in the presence of a the above
mentioned powdery mildew R genes. The epidermal single cell
HR, a characteristic early event of the M1a-12 specified
resistance response, is abolished in the presence of rarl-1
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
4 -
or rarl-2. However, at later stages, susceptible infection
phenotypes in the presence of rarl-1 or rarl-2 can be easily
discriminated. In the presence of the former defective
allele less aerial fungal mycelium and less sporulation is
observed, and infection sites are frequently surrounded by
necrotic host tissue. In contrast infection phenotypes in
the presence of rarl-2 are hardly distinguishable from a
fully susceptible barley genotype. The inventors have
interpreted these findings such that the rarl-1 allele
retains residual gene activity and have recently demonstrated
that rarl-2 does too.
The genetic data described above provide strong evidence that
Rarl represents a point of convergence in the signalling of
powdery mildew resistance triggered by a multitude of powdery
mildew R genes.
There is in the literature a lack of any reliable biochemical
test procedures enabling a conventional purification of the
Rarl protein.
The present inventors have succeeded in cloning the Rarl gene
from barley using positional cloning, this despite the fact
that map-based isolation of genes from the highly complex
barley genome (5.3 x 109 bp/haploid genome; (Bennett and Smith
1991)) poses a major experimental challenge primarily due to
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ s
unfavourable ratio of genetic and physical distances and due
to a high percentage of repetitive noncoding DNA sequences.
To date, there has been only one report of a successful map-
based isolation of a barley gene (Biischges et al. 1997).
5
The invention results from the cloning of the Rarl gene and
the provision of homologues and mutant alleles thereof.
In various aspects the invention relates to nucleic acid
encoding a polypeptide with Rarl function. "Rarl function"
refers to the ability of the Rarl gene and polypeptide
expression products thereof to function in the signalling
pathway leading to a plant pathogen defence response and/or
cell death and preferably pathogen resistance effected by the
direct or indirect interaction of R gene products with
pathogen Avr proteins. The term "Rarl function" may be used
to refer to sequences which dictate an Rarl phenotype in a
plant, the term "Rarl mutant function" or "rarl function" may
be used to refer to forms of Rar1 sequences which suppress or
cancel an Rar1 phenotype in a plant. An rarl mutant
phenotype is characterised by the lowering or cancelling of
pathogen resistance and/or plant pathogen defence response.
Rarl function and rarl function can be determined by
assessing the level of defence responses and/or
susceptibility of the plant to a pathogen as described above
or other suitable alternatives known and available to those
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590 j
6
skilled in the art. Test plants may be monocotyledenous or
dicotyledenous. Suitable monocots include any of barley,
rice, wheat, maize or oat, particularly barley. Suitable
dicots include Arabidopsis, tobacco, tomato, Brassicas,
potato and grape vine.
A polynucleotide according to the invention may encode a
polypeptide including the amino acid sequence shown in Figure
1. The coding sequence may be that shown included in Figure
1 or it may be a mutant, variant, derivative or allele of the
sequence shown. The sequence may differ from that shown by a
change which is one or more of addition, insertion, deletion
and substitution of one or more nucleotides of the sequence
shown. Changes to a nucleotide sequence may result in an
amino acid change at the protein level, or not, as determined
by the genetic code. Thus, nucleic acid according to the
present invention may include a sequence different from the
sequence shown in Figure 1 yet encode a polypeptide with the
same amino acid sequence (i.e. the coding sequence may be
"degeneratively equivalent").
A polynucleotide according to the invention may include one
or more sequences identified as an exon in Figure 4.
Also encompassed by the present invention are nucleic acid
molecules which include a nucleotide sequence which encodes a
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
. . ::
7
polypeptide including an amino acid sequence which although
clearly related to a functional Rarl polypeptide (e.g. is
immunologically cross reactive with an Rarl polypeptide
demonstrating Rarl function, or has characteristic sequence
motifs in common with an Rarl polypeptide) no longer has Rarl
function. Thus the present invention provides mutants of
Rar1 which do not promote a plant pathogen defence response
or cell death, and/or pathogen resistance. Plants and plant
cells carrying these mutant forms are susceptible to pathogen
infection.
Thus Rarl mutants, variants, fragments, derivatives, alleles
and homologues of types which raise resistance and of types
which lower resistance may both be of practical value
depending on the situation. In the agronomic situation the
major interest will be one of raising plant resistance to
pathogens.
In particular homologues of the particular Rar1 sequences
provided herein (see e.g. Figure 3) are provided by the
present invention as are mutants, variants, fragments and
derivatives of such homologues (and comments made above in
relation to such mutants etc also apply in relation to
mutants etc of homologues). Such homologues are readily
obtainable by use of the disclosures made herein. Thus the
present invention also extends to nucleic acid molecules
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ _ b
8
which include a nucleic acid sequence encoding an Rar1
homologue obtainable using a nucleotide sequence derived
from, or as shown in Figure 1 or Figure 4, or obtainable
using amino acid sequence shown in Figure 1 or Figure 4. The
Rarl homologue may at the nucleotide level have homology with
a nucleotide sequence of Figure 1, or may encode a
polypeptide which has homology with the polypeptide of which
the amino acid sequence is shown in Figure 1, preferably at
least about 50%, or at least about 55%, or at least about
60%, or at least about 65%, or at least about 70%, or at
least about 75%, or at least about 80% homology, or at least
about 90% homology. Most preferably at least about 95% or
greater homology. (Determination of homology at the amino
acid level is discussed further below.)
In certain embodiments, a polypeptide allele, variant,
derivative, mutant derivative, mutant or homologue of the
specific sequence may show little overall homology, say about
20%, or about 25%, or about 30%, or about 35%, or about 40%
or about 45%, with the specific amino acid sequence of Figure
1. However, in functionally significant domains or regions
the amino acid homology may be much higher. Putative
functionally significant domains or regions can be identified
using processes of bioinformatics, including comparison of
the sequences of homologues. Functionally significant
domains or regions of different polypeptides may be combined
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
_ y
9
for expression from encoding nucleic acid as a fusion
protein. For example, particularly advantageous or desirable
properties of different homologues may be combined in a
hybrid protein, such that the resultant expression product,
with Rarl or Rarl function, may include fragments of various
parent proteins.
Fragments according to further aspects of the present
invention are shown in Figure 5A and Figure 5C, with encoding
nucleotide sequences shown in Figure 5B and Figure 5D
respectively.
Further domains and fragments of the present invention are
shown in Figure 6, with encoding nucleotide sequences shown
in Figure 7. The domains and fragments may be employed in
various aspects and embodiments of the present invention
disclosed herein
Each nucleotide sequence of Figure 7 represents a further
aspect of the present invention, and polynucleotides
comprising a sequence as shown may be employed in various
aspects and embodiments disclosed herein.
Rar1-derived oligonucleotide primers (as authentic or
degenerate sequences) may be used to isolate Rar.l homologues
from many different plants, including monocots and dictors,
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
~ . . s
such as barley, wheat, maize, oats, rice, tomatoes, melons,
cucurbitaceae, Brassicaceae, capsicums, lettuces, grape
vines, ornamentals. Once a corresponding gene is cloned it
may be expressed as an antisense construct to assess its
5 importance in resistance to agronomically important diseases
such as Puccinia hordei (leaf rust), Rhynchosproium secalis
(scald), Pyrenophera teres (net blotch), Heterodera avenge
(barley cereal cyst namatode), Drechslera teres, Powdery
mildew and yellow dwarf virus (e. g. barley yellow dwarf
10 virus) .
The obtaining of homologues is later discussed herein, but
briefly here it should be pointed out that the nucleotide
sequence information provided herein, or any part thereof,
may be used in a data-base search to find homologous
sequences, expression products of which can be tested for
Rar1 (or rarl) function. These may have ability to
complement an Rar1 (or rarl) phenotype in a plant or may,
upon expression in a plant, confer such a phenotype. Thus
the Rar1 cDNA or part of it may be used as a bait in an
interaction trap assay, such as the yeast two-hybrid system,
to isolate other disease resistance signalling components
that are hitherto unknown. These present further targets for
pathway manipulation towards improved disease resistance.
By sequencing homologues, studying their expression patterns
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
11
and examining the effect of altering their expression, genes
carrying out a similar function to Rar1 are obtainable. Of
course, mutants, variants and alleles of these sequences are
included within the scope of the present invention in the
same terms as discussed above for the Barley Rar1 gene,
although
it should be noted that homologue sequences pre-existing on
databases, such as any identified herein including in Figure
3, may be excluded from one or more aspects or embodiments of
the present invention while included in one or more other
aspects.
Homology between the homologues as disclosed herein, may be
exploited in the identification of further homologues, for
example using oligonucleotides (e. g. a degenerate pool)
designed on the basis of sequence conservation or PCR
primers.
Primers useful in aspects of the present invention include
"AtRarl 5"' and "AtRarl 3"', the sequences of which are given
below.
According to a further aspect, the present invention provides
a method of identifying or a method of cloning an Rar1
homologue, e.g. from a species other than Barley, the method
employing a nucleotide sequence derived from that shown in
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
;:
12
Figure 1 or Figure 4. For instance, such a method may
include providing a preparation of plant cell nucleic acid,
providing a nucleic acid molecule having a nucleotide
sequence substantially as shown herein or complementary to a
nucleotide sequence substantially as shown herein, preferably
from within the coding sequence (e.g. a sequence coding for
the amino acid sequence shown in Figure 1) contacting nucleic
acid in said preparation with said nucleic acid molecule
under conditions for hybridisation of said nucleic acid
molecule to any said gene or homologue in said preparation,
and identifying said gene or homologue if present by its
hybridisation with said nucleic acid molecule.
Target or candidate nucleic acid may, for example, include
genomic DNA, cDNA or RNA (or a mixture of any of these
preferably as a library) obtainable from an organism known to
contain or suspected of containing such nucleic acid, either
monocotyledonous or dicotyledonous. Prior to any PCR that is
to be performed, the complexity of a nucleic acid library may
be reduced by creating a cDNA library for example using RT-
PCR or by using the phenol emulsion reassociation technique
(Clarke et al. (1992) NAR 20, 1289-1292) on a genomic
library. Successful hybridisation may be identified and
target/candidate nucleic acid isolated for further
investigation and/or use.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
13
Hybridisation of nucleic acid molecule to a Rarl gene or
homologue may be determined or identified indirectly, e.g.
using a nucleic acid amplification reaction, particularly the
polymerase chain reaction (PCR). PCR requires the use of two
primers to specifically amplify target nucleic acid, so
preferably two nucleic acid molecules with sequences
characteristic of Rarl are employed. However, if RACE is
used only one such primer may be needed. Hybridisation may
be also be determined (optionally in conjunction with'an
amplification technique such as PCR) by probing with nucleic
acid and identifying positive hybridisation under suitably
stringent conditions (in accordance with known techniques).
For probing, preferred conditions are those which are
stringent enough for there to be a simple pattern with a
small number of hybridisations identified as positive which
can be investigated further. It is well known in the art to
increase stringency of hybridisation gradually until only a
few positive clones remain.
Binding of a probe to target nucleic acid (e.g. DNA) may be
measured using any of a variety of techniques at the disposal
of those skilled in the art. For instance, probes may be
radioactively, fluorescently or enzymatically labelled.
Other methods not employing labelling of probe include
examination of restriction fragment length polymorphisms,
amplification using PCR, RNAase cleavage and allele specific
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
14
oligonucleotide probing.
Probing may employ the standard Southern blotting technique.
For instance DNA may be extracted from cells and digested
with different restriction enzymes. Restriction fragments
may then be separated by electrophoresis on an agarose gel,
before denaturation and transfer to a nitrocellulose filter.
Labelled probe may be hybridised to the DNA fragments on the
filter and binding determined. DNA for probing may be
prepared from RNA preparations from cells by techniques such
as reverse-transcriptase-PCR.
Preliminary experiments may be performed by hybridising under
low stringency conditions various probes to Southern blots of
DNA digested with restriction enzymes. For probing,
preferred conditions are those which are stringent enough for
there to be a simple pattern with a small number of
hybridisations identified as positive which can be
investigated further. It is well known in the art to
increase stringency of hybridisation gradually until only a
few positive clones remain. Suitable conditions would be
achieved when a large number of hybridising fragments were
obtained while the background hybridisation was low. Using
these conditions nucleic acid libraries, e.g. cDNA libraries
representative of expressed sequences, may be searched.
Those skilled in the art are well able to employ suitable
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ . F
conditions of the desired stringency for selective
hybridisation, taking into account factors such as
oligonucleotide length and base composition, temperature and
so on.
5
For instance, screening may initially be carried out under
conditions, which comprise a temperature of about 37°C or
more, a formamide concentration of less than about 50%, and a
moderate to low salt (e.g. Standard Saline Citrate ('SSC') -
10 0.15 M sodium chloride; 0.15 M sodium citrate; pH 7)
concentration.
Alternatively, a temperature of about 50°C or more and a high
salt (e. g. 'SSPE'= 0.180 mM sodium chloride; 9 mM disodium
15 hydrogen phosphate; 9 mM sodium dihydrogen phosphate; 1 mM
sodium EDTA; pH 7.4). Preferably the screening is carried
out at about 37°C, a formamide concentration of about 20%,
and a salt concentration of about 5 X SSC, or a temperature
of about 50°C and a salt concentration of about 2 X SSPE.
These conditions will allow the identification of sequences
which have a substantial degree of homology (similarity,
identity) with the probe sequence, without requiring the
perfect homology for the identification of a stable hybrid.
Suitable conditions include, e.g. for detection of sequences
that axe about 80-90% identical, hybridization overnight at
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
16
42°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate
and a final wash at 55°C in O.1X SSC, 0.1% SDS. For
detection of sequences that are greater than about 90%
identical, suitable conditions include hybridization
overnight at 65°C in 0.25M Na2HP04, pH 7.2', 6.5% SDS, 10%
dextran sulfate and a final wash at 60°C in O.1X SSC, 0.1%
SDS.
In general, hybridizations may be performed according to the
method of Sambrook et al. (below) using a hybridization
solution comprising: 5X SSC (wherein 'SSC' - 0.15 M sodium
chloride; 0.15 M sodium citrate; pH 7), 5X Denhardt's
reagent, 0.5-1.0% SDS, 100 ~tg/ml denatured, fragmented salmon
sperm DNA, 0.05% sodium pyrophosphate and up to 50%
formamide. Hybridization is carried out at 37-42°C for at
least six hours. Following hybridization, filters are washed
as follows: (1) 5 minutes at room temperature in 2X SSC and
1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1%
SDS; (3) 30 minutes - 1 hour at 37°C in 1X SSC and 1% SDS; (4)
2 hours at 42-65°C in 1X SSC and 1% SDS, changing the solution
every 30 minutes.
One common formula for calculating the stringency conditions
required to achieve hybridization between nucleic acid
molecules of a specified sequence homology is (Sambrook et
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
17
al . ( 198 9 ) ) : Tm = 81 . 5°C + 16 . 6Log [Na+] + 0 . 41 ( % G+C) -
0.63 (% formamide) - 600/#bp in duplex.
As an illustration of the above formula, using [Na+] -
[0.368] and 50-% formamide, with GC content of 42% and an
average probe size of 200 bases, the Tm is 57°C. The Tm of a
DNA duplex decreases by 1 - 1.5°C with every 1% decrease in
homology. Thus, targets with greater than about 75% sequence
identity would be observed using a hybridization temperature
of 42°C. Such a sequence would be considered substantially
homologous to the nucleic acid sequence of the present
invention.
It is well known in the art to increase stringency of
hybridisation gradually until only a few positive clones
remain. Other suitable conditions include, e.g. for detection
of sequences that are about 80-90% identical, hybridization
overnight at 42°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10%
dextran sulfate and a final wash at 55°C in O.1X SSC, 0.1%
SDS. For detection of sequences that are greater than about
90% identical, suitable conditions include hybridization
overnight at 65°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10%
dextran sulfate and a final wash at 60°C in O.1X SSC, 0.1%
SDS.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
18
An alternative, which may be particularly appropriate with
plant nucleic acid preparations, is a solution of 5x SSPE
(final 0.9 M NaCl, 0.05M sodium phosphate, 0.005M EDTA pH
7.7), 5X Denhardt's solution, 0.5% SDS, at 65°C overnight,
(for high stringency, highly similar sequences) or 50°C (for
low stringency, less similar sequences). Washes in 0.2x
SSC/0.1~ SDS at 65°C for high stringency, alternatively at
50-60°C in lx SSC/0.1% SDS for low stringency.
The present invention extends to nucleic acid selectively
hybridisable under high stringency with nucleic acid
identified herein, e.g. the coding sequence of Figure 1, the
sequence of Figure 4 or the sequence of Figure 5C or Figure
5D.
PCR techniques for the amplification of nucleic acid are
described in US Patent No. 4,683,195 and Saiki et al. Science
239: 487-491 (1988). PCR includes steps of denaturation of
template nucleic acid (if double-stranded), annealing of
primer to target, and polymerisation. The nucleic acid
probed or used as template in the amplification reaction may
be genomic DNA, cDNA or RNA. PCR may be used to amplify
specific sequences from genomic DNA, specific RNA sequences
and cDNA transcribed from mRNA. References for the general
use of PCR techniques include Mullis et al, Cold Spring
Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed),
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
l
19
PCR technology, Stockton Press, NY, 1989, Ehrlich et al,
Science, 252:1643-1650, (1991), "PCR protocols; A Guide to
Methods and Applications", Eds. Innis et al, Academic Press,
New York, (1990).
Assessment of whether or not a PCR product corresponds to a
gene able to alter a plant's resistance to a pathogen may be
conducted in various ways, as discussed, and a PCR band may
contain a complex mix of products. Individual products may
be cloned and each screened for linkage to such known genes
that are segregating in progeny that showed a polymorphism
for this probe. Alternatively, the PCR product may be
treated in a way that enables one to display the polymorphism
on a denaturing polyacrylamide DNA sequencing gel with
specific bands that are linked to the gene being preselected
prior to cloning. Once a candidate PCR band has been cloned
and shown to be linked to a known resistance gene, it may be
used to isolate clones which may be inspected for other
features and homologies to Rarl/Rarl or other related gene.
It may subsequently be analysed by transformation to assess
its function on introduction into a disease sensitive variety
of the plant of interest. Alternatively, the PCR band or
sequences derived by analysing it may be used to assist plant
breeders in monitoring the segregation of a useful resistance
gene.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
These techniques are of general applicability to the
identification of genes able to alter a plant's resistance to
a pathogen.
5 Preferred amino acid sequences suitable for use in the design
of probes or PCR primers are sequences conserved (completely,
substantially or partly) between at least two Rar1 peptides
or polypeptides encoded by genes involved in the signalling
of a defence response in a plant. Conserved sequences may be
10 identified using information contained herein, for instance
in Figure 3.
On the basis of amino acid sequence information or nucleotide
sequence information, oligonucleotide probes or primers may
15 be designed (when working from amino acid sequence
information, taking into account the degeneracy of the
genetic code and where appropriate, codon usage of the
organism).
20 A gene or fragment thereof identified as being that to which
a said nucleic acid molecule hybridises, which may be an
amplified PCR product, may be isolated and/or purified and
may be subsequently investigated for ability to alter a
plant's resistance to a pathogen. If the identified nucleic
acid is a fragment of a gene, the fragment may be used (e. g.
by probing and/or PCR) in subsequent cloning of the full
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
21
length gene, which may be a full-length coding sequence.
Inserts may be prepared from partial cDNA clones and used to
screen cDNA libraries. The full-length clones isolated may
be subcloned into expression vectors and activity assayed by
introduction into suitable host cells and/or sequenced. It
may be necessary for one or more gene fragments to be ligated
to generate a full-length coding sequence.
Molecules found to manipulate genes with ability to alter a
plant's resistance to infection may be used as such, i.e. to
alter a plant's resistance to a pathogen. Nucleic acid
obtained and obtainable using a method as disclosed herein is
provided in various aspects of the present invention.
The present application also provides oligonucleotides based
on either an Rar1 nucleotide sequence as provided herein or
an Rar1 nucleotide sequence obtainable in accordance with the
disclosures and suggestions herein. The oligonucleotides may
be of a length suitable for use as primers in an
amplification reaction, or they may be suitable for use as
hybridization fishing probes. Preferably an oligonucleotide
in accordance with the invention, e.g. for use in nucleic
acid amplification, has about 10 or fewer codons (e.g. 6, 7
or 8), i.e. is about 30 or fewer nucleotides in length (e. g.
18, 21 or 24). A probe or primer may be about 20-30
nucleotides in length.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ s
22 -
Nucleic acid molecules and vectors according to the present
invention may be provided in a form isolated and/or purified
from their natural environment, in substantially pure or
homogeneous, or free or substantially free of nucleic acid
and or genes of the species of interest o.r origin other than
the relevant sequence. Nucleic acid according to the present
invention may include cDNA, RNA, genomic DNA and may be
wholly or partially synthetic. The term "isolate" where used
may encompass any of these possibilities.
Nucleic acid as herein provided or obtainable by use of the
disclosures herein, may be the subject of alteration by way
of one or more of addition, insertion, deletion or
substitution of nucleotides with or without altering the
encoded amino acid sequence (by virtue of the degeneracy of
the genetic code). Such altered forms of Rarl nucleotide
sequences as herein provided or obtainable by use of the
disclosures herein can be easily and routinely tested for
both Rarl function and Rarl function in accordance with
standard techniques which basically examine plants or plant
cells carrying the mutant, derivative or variant for a
altered defence response to an appropriate pathogen.
The nucleic acid molecule may be in the form of a recombinant
and preferably replicable vector for example a plasmid,
cosmid, phage or binary vector, e.g. suitable for use with
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
r
23
Agrobacterium. The nucleic acid may be under the control of
an appropriate promoter and regulatory elements for
expression in a host cell such as a microbial, e.g.
bacterial, or plant cell. In the case of genomic DNA, this
may contain its own promoter and regulatory elements and in
the case of cDNA this may be under the control of an
appropriate promoter and regulatory elements for expression
in the host cell. Thus, the nucleotide sequence of Figure 1
(for example) may be placed under the control of a promoter
other than that of the Barley Rar1 gene. Similarly, a Rarl
homologue sequence from another species may be operably
linked to a promoter other than that with which it is
naturally associated. However a vector including nucleic
acid according to the present invention need not include a
promoter, particularly if the vector is to be used to
introduce the nucleic acid into cells for recombination into
the genome.
The nucleic acid as provided by the present invention may be
placed under the control of an inducible gene promoter thus
placing expression under the control of the user.
In a further aspect the present invention provides a gene
construct including an inducible promoter operatively linked
to a nucleotide sequence provided by the present invention.
As discussed, this enables control of expression of the gene.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
24
The invention also provides plants transformed with said gene
construct and methods including introduction of such a
construct into a plant cell and/or induction of expression of
a construct within a plant cell, e.g by application of a
suitable stimulus, such as an effective exogenous inducer.
The term "inducible" as applied to a promoter is well
understood by those skilled in the art. In essence,
expression under the control of an inducible promoter is
"switched on" or increased in response to an applied stimulus
(which may be generated within a cell or provided
exogenously). The nature of the stimulus varies between
promoters. Some inducible promoters cause little or
undetectable levels of expression (or no expression) in the
absence of the appropriate stimulus. Other inducible
promoters cause detectable constitutive expression in the
absence of the stimulus. Whatever the level of expression is
in the absence of the stimulus, expression from any inducible
promoter is increased in the presence of the correct
stimulus. The preferable situation is where the level of
expression increases upon application of the relevant
stimulus by an amount effective to alter a phenotypic
characteristic. Thus an inducible (or "switchable") promoter
may be used which causes a basic level of expression in the
absence of the stimulus which level is too low to bring about
a desired phenotype (and may in fact be zero). Upon
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
application of the stimulus, expression is increased (or
switched on) to a level which brings about the desired
phenotype. One example of an inducible promoter is the
ethanol inducible gene switch disclosed in Caddick et al
5 (1998) Nature Biotechnology 16: 177-180.. Many other examples
will be known to those skilled in the art.
Other suitable promoters may include the Cauliflower Mosaic
Virus 35S (CaMV 35S) gene promoter that is expressed at a
10 high level in virtually all plant tissues (Benfey et al,
(1990) EMBO J 9: 1677-1684); the cauliflower meri 5 promoter
that is expressed in the vegetative apical meristem as well
as several well localised positions in the plant body, e.g.
inner phloem, flower primordia, branching points in root and
I5 shoot (Medford, J.I. (1992) Plant Cell 4, 1029-1039; Medford
et a1, (1991) Plant Cell 3, 359-370) and the Arabidopsis
thaliana LEAFY promoter that is expressed very early in
flower development (Weigel et a1, (1992) Cell 69, 843-859).
20 Those skilled in the art are well able to construct vectors
and design protocols for recombinant gene expression.
Suitable vectors can be chosen or constructed, containing
appropriate regulatory sequences, including promoter
sequences, terminator fragments, polyadenylation sequences,
25 enhancer sequences, marker genes and other sequences as
appropriate. For further details see, for example, Molecular
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
26
Cloning: a Laboratory Manual: 2nd edition, Sambrook et al,
1989, Cold Spring Harbor Laboratory Press. Many known
techniques and protocols for manipulation of nucleic acid,
for example in preparation of nucleic acid constructs,
mutagenesis, sequencing, introduction of DNA into cells and
gene expression, and analysis of proteins, are described in
detail in Current Protocols in Molecular Biology, Second
Edition, Ausubel et al. eds., John Wiley & Sons, 1992. The
disclosures of Sambrook et al. and Ausubel et al. are
incorporated herein by reference. Specific procedures and
vectors previously used with wide success upon plants are
described by Bevan (Nucl. Acids Res. 12, 8711-8721 (1984))
and Guerineau and Mullineaux (1993) (Plant transformation and
expression vectors. In: Plant Molecular Biology Labfax (Croy
RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148).
Selectable genetic markers may be used consisting of
chimaeric genes that confer selectable phenotypes such as
resistance to antibiotics such as kanamycin, hygromycin,
phosphinotricin, chlorsulfuron, methotrexate, gentamycin,
spectinomycin, imidazolinones and glyphosate.
When introducing a chosen gene construct into a cell, certain
considerations must be taken into account, well known to
those skilled in the art. The nucleic acid to be inserted
should be assembled within a construct which contains
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
27
effective regulatory elements which will drive transcription.
There must,be available a method of transporting the
construct into the cell. Once the construct is within the
cell membrane, integration into the endogenous chromosomal
material either will or will not occur. Finally, as far as
plants are concerned the target cell type must be such that
cells can be regenerated into whole plants.
Plants transformed with the DNA segment containing the
sequence may be produced by standard techniques which are
already known for the genetic manipulation of plants. DNA
can be transformed into plant cells using any suitable
technology, such as a disarmed Ti-plasmid vector carried by
Agrobacterium exploiting its natural gene transfer ability
(EP-A-270355, EP-A-0116718, NAR 12(22) 8711 -87215 1984),
particle or microprojectile bombardment (US 5100792, EP-A-
444882, EP-A-434616) microinjection (WO 92/09696, WO
94/00583, EP 331083, EP 175966, Green et al. (1987) Plant
Tissue and Cell Culture, Academic Press), electroporation (EP
290395, WO 8706614) other forms of direct DNA uptake (DE
4005152, WO 9012096, US 4684611), liposome mediated DNA
uptake (e. g. Freeman et al. Plant Cell Physiol. 29: 1353
(1984)), or the vortexing method (e. g. Kindle, PNAS U.S.A.
87: 1228 (1990d) Physical methods for the transformation of
plant cells are reviewed in Oard, 1991, Biotech. Adv. 9; 1-
11.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
28
Thus once a gene has been identified, it may be reintroduced
into plant cells using techniques well known to those skilled
in the art to produce transgenic plants of the appropriate
phenotype.
Agrobacterium transformation is widely used by those skilled
in the art to transform dicotyledonous species. Production
of stable, fertile transgenic plants in almost all
economically relevant monocot plants is also now
routine:(Toriyama, et al. (1988) Bio/Technology 6, 1072-1074;
Zhang, et al. (1988) Plant Cell Rep. 7, 379-384; Zhang, et
al. (1988) Theor App1 Genet 76, 835-840; Shimamoto, et al.
(1989} Nature 338, 274-276; Datta, et al. (1990)
Bio/Technology 8, 736-740; Christou, et al. (1991)
Bio/Technology 9, 957-962; Peng, et al. (1991) International
Rice Research Institute, Manila, Philippines 563-574; Cao, et
al. (1992) Plant Cell Rep. 11, 585-591; Li, et al. (1993)
Plant Cell Rep. 12, 250-255; Rathore, et al. (1993) Plant
Molecular Biology 21, 871-884; Fromm, et al. (1990)
Bio/Technology 8, 833-839; Gordon-Kamm, et al. (1990) Plant
Cell 2, 603-618; D'Halluin, et al. (1992) Plant Cell 4, 1495-
1505; Walters, et al. (1992) Plant Molecular Biology 18, 189-
200; Koziel, et al. (1993) Biotechnology 11, 194-200; Vasil,
I. K. (1994) Plant Molecular Biology 25, 925-937; Weeks, et
al. (1993) Plant Physiology 102, 1077-1084; Somers, et al.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
29
(1992) Bio/Technology 10, 1589-1594; W092/14828). In
particular, Agrobacterium mediated transformation is now a
highly efficient alternative transformation method in
monocots (Hiei et al. (199.4) The Plant Journal 6, 271-282).
The generation of fertile transgenic plants has been achieved
in the cereals rice, maize, ~niheat, oat, and barley (reviewed
in Shimamoto, K. (1994) Current Opinion in Biotechnology 5,
158-162.; Vasil, et al. (1992) Bio/Technology 10, 667-674;
20 Vain et al., 1995, Biotechnology Advances 13 (4): 653-671;
Vasil, 1996, Nature Biotechnology 14 page 702). Wan and
Lemaux (1994) Plant Physiol. 104: 37-48 describe techniques
for generation of large numbers of independently transformed
fertile barley plants.
Microprojectile bombardment, electroporation and direct DNA
uptake are preferred where Agrobacterium is inefficient or
ineffective. Alternatively, a combination of different
techniques may be employed to enhance the efficiency of the
transformation process, e.g. bombardment with Agrobacterium
coated microparticles (EP-A-486234) or microprojectile
bombardment to induce wounding followed by co-cultivation
with Agrobacterium (EP-A-486233).
Following transformation, a plant may be regenerated, e.g.
from single cells, callus tissue or leaf discs, as is
CA 02337861 2001-O1-16
WO 00/08160 PCTlGB99/02590
_ s
standard in the art. Almost any plant can be entirely
regenerated from cells, tissues and organs of the plant.
Available techniques are reviewed in Vasil et al., Cell
Culture and Somatic Cell Genetics of Plants, Vo1 I, II and
5 III, Laboratory Procedures and Their Applications, Academic
Press, 1984, and Weissbach and Weissbach, Methods for Plant
Molecular Biology, Academic Press, 1989.
The particular choice of a transformation technology will be
10 determined by its efficiency to transform certain plant
species as well as the experience and preference of the
person practising the invention with a particular methodology
of choice. It will be apparent to the skilled person that
the particular choice of a transformation system to introduce
15 nucleic acid into plant cells is not essential to or a
limitation of the invention, nor is the choice of technique
for plant regeneration.
The invention further encompasses a host cell transformed
20 with a vector as set forth above, especially a plant or a
microbial cell. Thus, a host cell, such as a plant cell,
including a nucleotide sequence as herein indicated is
provided. Within the cell, the nucleotide sequence may be
incorporated within the chromosome.
Also according to the invention there is provided a plant
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
31
cell having incorporated into its genome a nucleotide
sequence, particularly a heterologous nucleotide sequence, as
provided by the present invention under operative control of
a regulatory sequence for control of expression. The coding
sequence may be operably linked to one or more regulatory
sequences which may be heterologous or foreign to the gene,
such as not naturally associated with the gene for its
expression. The nucleotide sequence according to the
invention may be placed under the control of an externally
inducible gene promoter to place expression under the control
of the user. A further aspect of the present invention
provides a method of making such a plant cell involving
introduction of nucleotide sequence or a suitable vector
including the sequence of nucleotides into a plant cell and
causing or allowing recombination between the vector and the
plant cell genome to introduce the sequence of nucleotides
into the genome. The invention extends to plant cells
containing a nucleotide sequence according to the invention
as a result of introduction of the nucleotide sequence into
an ancestor cell.
The term ~~heterologous~~ may be used to indicate that the
gene/sequence of nucleotides in question have been introduced
into said cells of the plant or an ancestor thereof, using
genetic engineering, ie by human intervention. A transgenic
plant cell, i.e. transgenic for the nucleotide sequence in
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ . t
32 .
question, may be provided. The transgene may be on an extra-
genomic vector or incorporated, preferably stably, into the
genome. A heterologous gene may replace an endogenous
equivalent gene, ie one which normally performs the same or a
similar function, or the inserted sequence may be additional
to the endogenous gene or other sequence. An advantage of
introduction of a heterologous gene is the ability to place
expression of a sequence under the control of a promoter of
choice, in order to be able to influence expression according
to preference. Furthermore, mutants, variants and
derivatives of the wild-type gene, e.g. with higher or lower
activity than wild-type, may be used in place of the
endogenous gene. Nucleotide sequences heterologous, or
exogenous or foreign, to a plant cell may be non-naturally
occurring in cells of that type, variety or species. Thus, a
nucleotide sequence may include a coding sequence of or
derived from a particular type of plant cell or species or
variety of plant, placed within the context of a plant cell
of a different type or species or variety of plant. A
further possibility is for a nucleotide sequence to be placed
within a cell in which it or a homologue is found naturally,
but wherein the nucleotide sequence is linked and/or adjacent
to nucleic acid which does not occur naturally within the
cell, or cells of that type or species or variety of plant,
such as operably linked to one or more regulatory sequences,
such as a promoter sequence, for control of expression. A
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ _ a
33
sequence within a plant or other host cell may be
identifiably heterologous, exogenous or foreign.
Plants which include a plant cell according to the invention
are also provided, along with any part or. propagule thereof,
seed, selfed or hybrid progeny and descendants. Particularly
provided are transgenic crop. plants, which have been
engineered to carry genes identified as stated above.
Examples of suitable plants include tobacco, cucurbits,
carrot, vegetable brassica, melons, capsicums, grape vines,
lettuce, strawberry, oilseed brassica, sugar beet, wheat,
barley, maize, rice, soyabeans, peas, sorghum, sunflower,
tomato, potato, pepper, chrysanthemum, carnation, poplar,
eucalyptus and pine.
A plant according to the present invention may be one which
does not breed true in one or more properties. Plant
varieties may be excluded, particularly registrable plant
varieties according to Plant Breeders' Rights. It is noted
that a plant need not be considered a "plant variety" simply
because it contains stably within its genome a transgene,
introduced into a cell of the plant or an ancestor thereof.
In addition to a plant, the present invention provides any
clone of such a plant, seed, selfed or hybrid progeny and
descendants, and any part of any of these, such as cuttings,
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
34
seed. The invention provides any plant propagule, that is
any part which may be used in reproduction or propagation,
sexual or asexual, including cuttings, seed and so on. Also
encompassed by the invention is a plant which is a sexually
or asexually propagated off-spring, clone or descendant of
such a plant, or any part or propagule of said plant, off-
spring, clone or descendant..
The present invention also encompasses the polypeptide
expression product of a nucleic acid molecule according to
the invention as disclosed herein or obtainable in accordance
with the information and suggestions herein. Also provided
are methods of making such an expression product by
expression from a nucleotide sequence encoding therefore
under suitable conditions in suitable host cells e.g. E.coli.
Those skilled in the art are well able to construct vectors
and design protocols and systems for expression and recovery
of products of recombinant gene expression.
A preferred polypeptide includes the amino acid sequence
shown in Figure 1. A polypeptide according to the present
invention may be an allele, variant, fragment, derivative,
mutant or homologue of a polypeptide as shown in Figure 1.
The allele, variant, fragment, derivative, mutant or
homologue may have substantially the Rarl function of the
amino acid sequence shown in Figure 1 or may be a rarl
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
Y
mutant.
Also encompassed by the present invention are polypeptides
which although clearly related to a functional Rarl
5 polypeptide (e. g. they are immunologicall.y cross reactive
with an Rarl polypeptide demonstrating Rarl function, or they
have characteristic sequence motifs in common with an Rar1
polypeptide) no longer have Rarl function. Thus the present
invention provides variant forms of Rarl polypeptides, such
10 as those resulting from the rarl-1 and rarl-2 mutations
identified herein. Plants and plant cells carrying these
mutant forms are susceptible to pathogen ingress.
"Homology" in relation to an amino acid sequence may be used
15 to refer to identity or similarity, preferably identity. As
noted already above, high level of amino acid identity may be
limited to functionally significant domains or regions, e.g.
any of the domains identified herein (e.g. see Figure 6).
20 In particular homologues of the particular Rarl polypeptide
sequences provided herein are provided by the present
invention, as are mutants, variants, fragments and
derivatives of such homologues. Such homologues are readily
obtainable by use of the disclosures made herein. Thus the
25 present invention also extends to polypetides which include
an amino acid sequence with Rarl function obtainable using
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ -
36 -
sequence information as provided herein. The Rarl homologue
may at the amino acid level have homology with the amino acid
sequence of Figure 1, preferably at least about 50%, or at
least about 55%, or at least about 60%, or at least about
65%, or at least about 70%, or at least about 75%, or at
least about 80% homology, or at least about 85 %, or at least
about 88% homology, or at least about 90% homology. Most
preferably at least about 95% or greater homology.
20 In certain embodiments, an allele, variant, derivative,
mutant derivative, mutant or homologue of the specific
sequence may show little overall homology, say about 20%, or
about 25%, or about 30%, or about 35%, or about 40% or about
45%, with the specific sequence. However, in functionally
significant domains or regions, the amino acid homology may
be much higher. Putative functionally significant domains or
regions can be identified using processes of bioinformatics,
including comparison of the sequences of homologues.
Functionally significant domains or regions of different
polypeptides may be combined for expression from encoding
nucleic acid as a fusion protein. For example, particularly
advantageous or desirable properties of different homologues
may be combined in a hybrid protein, such that the resultant
expression product, with Rarl or Rarl function, may include
fragments of various parent proteins.
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
- _
37
Individual domains and fragments of Rarl polypeptide are
shown in Figure 6 and these, also derivatives, variants and
homologues as noted, are useful in various aspects and
embodiments of the invention, for instance in the activation
of cell death and/or downstream resistance responses.
Similarity of amino acid sequences may be as defined and
determined by the TBLASTN program, of Altschul et al. (1990)
J. Mol. Biol. 215: 403-10, which is in standard use in the
art. In particular, TBLASTN 2.0 may be used with Matrix
BLOSUM62 and GAP penalties: existence: 11, extension: 1.
Another standard program that may be used is BestFit, which
is part of the Wisconsin Package, Version 8, September 1994,
(Genetics Computer Group, 575 Science Drive, Madison,
Wisconsin, USA, Wisconsin 53711). BestFit makes an optimal
alignment of the best segment of similarity between two
sequences. Optimal alignments are found by inserting gaps to
maximize the number of matches using the local homology
algorithm of Smith and Waterman (Adv. Appl. Math. (1981) 2:
482-489). Other algorithms include GAP, which uses the
Needleman and Wunsch algorithm to align two complete
sequences that maximizes the number of matches and minimizes
the number of gaps. As with any algorithm, generally the
default parameters are used, which for GAP are a gap creation
penalty = 12 and gap extension penalty = 4. Alternatively, a
gap creation penalty of 3 and gap extension penalty of 0.1
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
.
38
may be used. The algorithm FASTA (which uses the method of
Pearson and Lipman (1988) PNAS USA 85: 2444-2448) is a
further alternative.
Use of either of the terms "homology" and "homologous" herein
does not imply any necessary evolutionary relationship
between compared sequences, in keeping for example with
standard use of terms such as "homologous recombination"
which merely requires that two nucleotide sequences are
sufficiently similar to recombine under the appropriate
conditions. Further discussion of polypeptides according to
the present invention, which may be encoded by nucleic acid
according to the present invention, is found below.
Purified Rarl polypeptides and mutants, variants, fragments,
derivatives, alleles and homologues thereof e.g. produced
recombinantly by expression from encoding nucleic acid
therefor, may be used to raise antibodies employing
techniques which are standard in the art. Antibodies and
polypeptides including antigen-binding fragments of
antibodies may be used in identifying homologues of the
sequences specifically provided herein as discussed further
below.
Methods of producing antibodies include immunising a mammal
(e.g. human, mouse, rat, rabbit, horse, goat, sheep or
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
39
monkey) with the protein or a fragment thereof. Antibodies
may be obtained from immunised animals using any of a variety
of techniques known in the art, and might be screened,
preferably using binding of antibody to antigen of interest.
For instance, Western blotting techniques or
immunoprecipitation may be used (Armitage et al, 1992, Nature
357: 80-82). Antibodies may be polyclonal or monoclonal.
As an alternative or supplement to immunising a mammal,
antibodies with appropriate binding specificity may be
obtained from a recombinantly produced library of expressed
immunoglobulin variable domains, e.g. using lambda
bacteriophage or filamentous bacteriophage which display
functional immunoglobulin binding domains on their surfaces;
for instance see W092/01047.
Antibodies raised to a polypeptide or peptide can be used in
the identification and/or isolation of homologous
polypeptides, and then the encoding genes. Thus, the present
invention provides a method of identifying or isolating a
polypeptide with Rarl function or Rarl function (in
accordance with embodiments disclosed herein), including
screening candidate peptides or polypeptides with a
polypeptide including the antigen-binding domain of an
antibody (for example whole antibody or a fragment thereof)
which is able to bind an Rarl or Rarl peptide, polypeptide or
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ . c
fragment, variant or variant thereof or preferably has
binding specificity for such a peptide or polypeptide, such
as having an amino acid sequence identified herein. Specific
binding members such as antibodies and polypeptides including
5 antigen binding domains of antibodies that bind and are
preferably specific for a Rarl or Rarl peptide or polypeptide
or mutant, variant or derivative thereof represent further
aspects of the present invention, as do their use and methods
which employ them.
Candidate peptides or polypeptides for screening may for
instance be the products of an expression library created
using nucleic acid derived from an plant of interest, or may
be the product of a purification process from a natural
source.
A peptide or polypeptide found to bind the antibody may be
isolated and then may be subject to amino acid sequencing.
Any suitable technique may be used to sequence the peptide or
polypeptide either wholly or partially (for instance a
fragment of a polypeptide may be sequenced). Amino acid
sequence information may be used in obtaining nucleic acid
encoding the peptide or polypeptide, for instance by
designing one or more oligonucleotides (e. g. a degenerate
pool of oligonucleotides) for use as probes or primers in
hybridisation to candidate nucleic acid, or by searching
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
_ r
41
computer sequence databases, as discussed further below.
The invention further provides a method of promoting cell
death and/or a plant pathogen defence response in a plant
which includes expressing a heterologous nucleic acid
sequence with Rar1 function as discussed, within cells of the
plant.
The invention further provides a method of raising pathogen
resistance in a plant which includes expressing a
heterologous nucleic acid sequence with Rarl function as
discussed, within cells of the plant.
Such methods may be achieved by expression from a nucleotide
sequence encoding an amino acid sequence conferring an Rarl
function within cells of a plant (thereby producing the
encoded polypeptide?, following an earlier step of
introduction of the nucleotide sequence into a cell of the
plant or an ancestor thereof. Such a method may raise the
plant's resistance to pathogen.
Manipulation of expression of the Rar1 transcript or Rar1
protein may be used to enhance resistance to a broad spectrum
of pathogens in different plants. This may be achieved by
over expression using a highly active plant promoter such as
the CaMV-35S promoter. Alternatively, Rarl may be attached
CA 02337861 2001-O1-16
. WO 00/08160 PCT/GB99/02590
_ y
42
to a pathogen-inducible promoter (see discussion below),
allowing greater expression in challenged cells. Increased
disease resistance may occur in the absence of a
hypersensitive response (HR) that may have possible
deleterious effects to the plant in terms. of general vigour
and yield.
A gene stably incorporated into the genome of a plant is
passed from generation to generation to descendants of the
plant, cells of which descendants may express the encoded
polypeptide and so may have enhanced pathogen resistance or
pathogen susceptibility. Pathogen resistance may be
determined by assessing compatibility of a pathogen as
earlier mentioned.
The invention further provides a method which includes
expression from a nucleic acid encoding the amino acid
sequence of Figure 1 or a mutant, allele or derivative of the
sequence (which may have Rarl function) within cells of a
plant (thereby producing the encoded polypeptide), following
an earlier step of introduction of the nucleic acid into a
cell of the plant or an ancestor thereof. Such a method may
raise the plant's resistance to one or more pathogens. The
method may be used in combination with an avr gene according
to any of the methods described in W091/15585 {Mogen) or,
more preferably, PCT/GB95/01075 (published as WO 95/31564),
CA 02337861 2001-O1-16
WO 00/08160 PCTJGB99/02590
43
or any other gene involved in conferring pathogen resistance.
In the present invention, alteration of resistance may be
achieved by introduction of the nucleotide sequence in a
sense orientation. Thus, the present invention provides a
method of modulation of a defence response in a plant, the
method including causing or allowing expression of nucleic
acid according to the invention within cells of the plant.
Generally, it will be desirable to promote the defence
response, and this may be achieved by allowing Rar1 gene
function.
In order to down-regulate resistance signalled by Rar.2,
under-expression of endogenous Rar1 gene may be achieved
using anti-sense technology or "sense regulation".
The use of anti-sense genes or partial gene sequences to
down-regulate gene expression is now well-established.
Double-stranded DNA is placed under the control of a promoter
in a "reverse orientation" such that transcription of the
"anti-sense"' strand of the DNA yields RNA which is
complementary to normal mRNA transcribed from the "sense"
strand of the target gene. The complementary anti-sense RNA
sequence is thought then to bind with mRNA to form a duplex,
inhibiting translation of the endogenous mRNA from the target
gene into protein. Whether or not this is the actual mode of
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ _
44
action is still uncertain. However, it is established fact
that the technique works. See, for example, Rothstein et al,
1987; Smith et al,(1988) Nature 334, 724-726; Zhang et
aI,(1992) The Plant Cell 4, 1575-1588, English et al., (1996)
The Plant Cell 8, 179-188. Antisense technology is also
reviewed in Bourque, 1995, and Flavell, 1994. Antisense
constructs may involve 3'end or 5'end sequences of Rar1 or
homologues. In cases where several Rar1 homologues exist in
a plant species, the involvement of 5'- and 3'-end
untranslated sequences in the antisense constructs will
enhance specificity of silencing. Constructs may be
expressed using the natural promoter, by a constitutively
expressed promotor such as the CaMV 35S promotor, by a
tissue-specific or cell-type specific promoter, or by a
promoter that can be activated by an external signal or
agent. The CaMV 35S promoter but also the rice actinl and
maize ubiquitin promoters have been shown to give high levels
of reporter gene expression in rice (Fujimoto et al., (1993)
Bio/Technology 11, 1151-1155; Zhang, et al., (1991) Pant
Cell 3, 1155-1165; Cornejo et al., (1993) Plant Molecular
Biology 23, 567-581).
The complete sequence corresponding to the coding sequence in
reverse orientation need not be used. For example fragments
of sufficient length may be used. It is a routine matter for
the person skilled in the art to screen fragments of various
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
s
sizes and from various parts of the coding sequence to
optimise the level of anti-sense inhibition. It may be
advantageous to include the initiating methionine ATG codon,
and perhaps one or more nucleotides upstream of the
5 initiating codon. A suitable fragment may have about 14-23
nucleotides, e.g. about 15, 16 or 17.
Thus, the present invention also provides a method of
downwardly modulating Rarl expression in a plant, the method
10 including causing or allowing anti-sense transcription from
nucleic acid according to the invention within cells of the
plant. Rar1 down-regulation may reduce a defence response.
This may be appropriate in certain circumstances e.g. as an
analytical or experimental approach.
For use in anti-sense regulation, nucleic acid including a
nucleotide sequence complementary to a coding sequence of an
Rar1 gene (i.e. including homologues), or a fragment of a
said coding sequence suitable for use in anti-sense
regulation of expression, is provided. This may be DNA and
under control of an appropriate regulatory sequence for anti-
sense transcription in cells of interest.
When additional copies of the target gene are inserted in
sense, that is the same, orientation as the target gene, a
range of phenotypes is produced which includes individuals
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ s
46
where over-expression occurs and some where under-expression
of protein from the target gene occurs. When the inserted
gene is only part of the endogenous gene the number of under-
expressing individuals in the transgenic population
increases. The mechanism by which sense regulation occurs,
particularly down-regulation (or "silencing"), is not well-
understood. However, this technique is also well-reported in
scientific and patent literature and is used routinely for
gene control. See, for example, van der Krol et al., (1990)
The Plant Cell 2, 291-299; Napoli et al., (1990) The Plant
Cell 2, 279-289; Zhang et al., (1992) The Plant Cell 4, 1575-
1588. Further refinements of the gene silencing or co-
suppression technology may be found in W095/34668
(Biosource); Angell & Baulcombe (1997) The EMBO Journal 16,
12:3675-3684; and Voinnet & Baulcombe (1997) Nature 389: pg
553.
Suitable fragments may be about 50, 100, 150, 200, 250, 300,
350, 400, 450, 500, 550, 600, 650 or 700 nucleotides in
length.
Thus, the present invention also provides a method of
downwardly modulating Rarl function in a plant, the method
including causing or allowing expression from nucleic acid
according to the invention within cells of the plant to
suppress endogenous Rarl expression.
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
47
Modified versions of Rarl may be used to down-regulate
endogenous Rarl function. For example mutants, variants,
derivatives etc., may be employed.
Reduction of Rarl wild type activity may be achieved by using
ribozymes, such as replication ribozymes, e.g. of the
hammerhead class (Haseloff and Gerlach, 1988, Nature 334:
585-591; Feyter et al. Mol., 1996, Gen. Genet. 250: 329-
338) .
Another way to reduce Rarl function in a plant employs
transposon mutagenesis (reviewed by Osborne et al., (1995)
Current Opinion in Cell Biology 7, 406-413). Inactivation of
genes has been demonstrated via a 'targeted tagging' approach
using either endogenous mobile elements or heterologous
cloned transposons which retain their mobility in alien
genomes. Rarl alleles carrying any insertion of known
sequence could be identified by using PCR primers with
binding specificities both in the insertion sequence and the
Rarl homologue. 'Two-element systems' could be used to
stabilize the transposon within inactivated alleles. In the
two-element approach, a T-DNA is constructed bearing a non-
autonomous transposon containing selectable or screenable
marker gene inserted into an excision marker. Plants bearing
these T-DNAs are crossed to plants bearing a second T-DNA
expressing transposase function. Hybrids are double-selected
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
48
for excision and for the marker within the transposon
yielding F2 plants with transposed elements.
Embodiments and examples relating to the present invention
are now described by way of example only with reference to
the following figures.
Brief Description of the Figures
Figure 1 shows the nucleotide and deduced amino acid
sequences of the barley Rarl cDNA. The nucleotide and the
deduced amino acid sequence are based on the combined data of
RT-PCR and RACE obtained from experiments using RNA of
cultivar Ingrid Rarl. The stop codon is marked by an
asterisk and the detected termini of RACE products are
indicated by arrows above the sequence.
Figure 2 illustrates the Rarl gene structure. The structure
of the barley Rar1 gene is given schematically. Exons are
highlighted by black boxes. Positions of introns and exons
were identified by comparison of RT-PCR products with genomic
sequences. Positions of mutational events are indicated fox
mutants rarl-1 and rarl-2.
Figure 3 shows an alignment of deduced peptide sequences in
genes from various species indicating relatedness to barley
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
49
Rarl. Regions of homology are highlighted in black
(identity), dark grey (highly conservative exchange) or light
grey (conservative exchange). Sequence data were analyzed
with the Genetics Computer Group, Wisconsin Program, version
8 (GCG; Devereux, 1984). Display of aligned deduced amino
acid sequences were carried out by using the "prettybox"
option in the extended GCG software. Numbers on the left
indicate GenBank accession mumbers of each peptide sequence.
Figure 4 shows 10,000 nucleotides of the Rarl genomic gene
sequence, including coding exons and introns. The rarl-1 and
rarl-2 mutations (both G->A) are marked. Underlined
sequences represent Rarl exon sequences and nucleotides in
bold represent 5' and 3' consensus splice sequences.
Figure 5A shows the amino acid sequence of a N-terminal
fragment of the Rarl polypeptide of Figure 1.
Figure 5B shows a nucleotide sequence encoding the Rarl
polypeptide fragment of Figure 5A.
Figure 5C shows the amino acid sequence of a C-terminal
fragment of the Rarl polypeptide of Figure 1.
Figure 5D shows a nucleotide sequence encoding the Rarl
polypeptide fragment of Figure 5C.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
Figure 6 shows the amino acid sequence of fragments and
domains I, II and III of the Barley Rarl protein,
representing particular aspects of the present invention.
5 Figure 7 shows nucleotide sequences encoding the fragments
and domains I, II and III of Figure 6, polynucleotides with
these sequences, and polynucleotides comprising these
sequences, representing further aspects of the present
invention.
Figure 8A shows AtRarl cDNA sequence, including coding
sequence.
Figure 8B shows the AtRarl protein sequence (also shown in
Figure 3 as ab010074).
Figure 8C shows the encoding nucleotide sequence for an
AtRarl protein N-terminal fragment.
Figure 8D shows the ArRarl protein N-terminal fragment
encoded by the nucleotide sequence of Figure 8D.
Figure 8E shows the encoding nucleotide sequence for an
AtRarl protein internal fragment.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
51
Figure 8F shows the ArRarl protein internal fragment encoded
by the nucleotide sequence of Figure 8E.
Figure 8G shows the encoding nucleotide sequence for an
AtRar1 protein C-terminal fragment.
Figure 8H shows the ArRarl protein C-terminal fragment
encoded by the nucleotide sequence of Figure 8G.
Figure 9 shows alignment of various "CHORD" sequences
("Cysteine and Histidine Rich Domain"} and a consensus
sequence.
All documents cited herein are incorporated by reference.
EXAMPLE 1
Cloning and Characterisation of Rarl From Barley and
Homologues From Other Species
High resolution genetic mapping of Rarl
A previous low resolution interval mapping procedure located
Rarl on barley chromosome 2, flanked by RFLP loci cMWG694 and
MWG503 within a 5 cM interval (Freialdenhoven et al. 1994).
Because 1 cM in barley corresponds to approximately 3 Mb we
decided as a first step towards the isolation of Rarl to
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
r
52
establish a local high resolution genetic map. We aimed at a
resolution of approximately 0.01 cM which corresponds to an
average physical distance of 30 kb.
Due to the low frequency of DNA polymorphism especially in
spring types (Russel et al. 1997), we reasoned that the
availability of alternative crosses would be advantageous
because it increased the likelihood to find a polymorphism
with a given probe. Therefore both mutants were crossed with
three M1a-12 backcross (BC) lines (M1a-12 BC Ingrid, M1a-12
BC Pallas, M1a-12 BC Siri; (Freialdenhoven et al. 1994;
Ke~lster et al. 1986; Kralster and Stralen 1987) representing
different genetic backgrounds of barley spring types.
The stages of the high resolution mapping were, in outline:
Using the initial RFLP map which was based on 50 plants
(Freialdenhoven et al. 1994), the CAPS markers MWG876, MWG892
and MWG2123 were integrated into the genetic map. A
phenotypic screen was used to analyse 1040 plants for
recombination events between Ant2 and Rarl. The observed
recombinants were used to reveal that MWG892 maps distal in
relation to Rarl. A subsequent CAPS-based recombinant screen
of 1063 additional plants was performed in the marker
interval MWG892 - cMWG694. Analysis of the observed
recombinants positioned MWG876 proximal in relation to Rarl.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
t
53
Finally another 2207 plants were investigated in the marker
interval MWG892 - MWG876. Two AFLPs 825/48 and A25/43 were
identified and tested on DNA of pool individuals. 825/48 was
identified in resistant bulked segregants. PCR products were
analysed on a 4.5% denaturing polyacrylamide gel. Presence
of the linked AFLP signal was found in one of the susceptible
pool individuals, indicating a recombination event between
the AFLP locus 825/48 and Rarl, which was not displayed in
the susceptible pool (Bs). The two recombinants identified
with 825/48 and A25/43 revealed cosegregation of Rar1 and
MWG876, thus both AFLP loci must be located distal from
MWG876. Genetic distances (cM) were calculated on the basis
of two-point estimates.
In more detail:
RFLP markers MWG503 and cMWG694 which define an approximately
5 cM interval containing Rarl (Freialdenhoven et al. 1994)
were sequenced, oligonucleotides for amplification of the
corresponding loci were derived and polymorphisms between the
susceptible (rarl-1, rarl-2) and resistant parents (Mla-12 BC
Ingrid, Mla-12 BC Pallas, MIa-12 BC Siri) were determined.
This involved display on ethidium bromide stained 2.5~
agarose gel of restriction enzyme digested amplification
products using M82, M100, Mla-I2 BC Ingrid, MIa-12 BC Pallas
and Mla-12 BC Siri as template DNA. Amplification and
CA 02337861 2001-O1-16
WO 00/08160 PCT/G899/02590
54
digestion were carried out as described below in relation to
Table 2. The displayed CAPS markers corresponded to RFLP
loci MWG87, MWG503, cMWG694, MWG876, and MWG2123. PCR-
primers for locus MWG892 enabled allele-specific
discrimination of PCR products without subsequent restriction
digestion. Minor bands were due to incomplete BclI digests
of the PCR amplicons.
To increase marker density adjacent to Rarl, we selected
three further RFLP markers which map close to the above
mentioned RFLP loci from a general RFLP map (MWG876, MWG892
and MWG2123 [Graver, 1991]. Each of these RFLPs was
converted to a cleavable amplifiable polymorphic sequence
(CAPS) and was mapped relative to Rarl based on a population
of 50 segregants. In this population MWG876 and MWG892
showed cosegregation with Rar1 whereas MWG2123 was positioned
distal to cMWG694.
Recombinant screen
Cultivar Sultan-5 (Mla-12, Rarl) from which both Rarl mutants
(rarl-1, rarl-2) are derived, contains an anthocyanin
pigmentation deficiency (ant2) whereas the three resistant
M1a-I2 BC lines used for mapping (Mla-12 BC Ingrid, Mla-12 BC
Pallas, Mla-12 BC Siri) carry the Ant2 wild type allele. The
a
Ant2 locus was previously shown to map at a distance of
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
- -
approximately 0.5 cM proximal to Rarl (Freialdenhoven et al.
1994). To identify rare recombinants in the small interval
between Rar1 and Ant2 we selected 1,040 susceptible FZ
individuals (rarl/rarl) and screened for presence of the
5 anthocyanin wild type allele Ant2. A total of 14
recombinants were found and these were tested for alleles in
MWG87, MWG876, and MWG892. Analysis of the 14 recombinants
showed cosegregation of Rarl, MWG87 and MWG876. Marker
MWG892 was positioned between Ant2 and Rarl, separated from
10 the former by two recombination events. The different
crosses between the two allelic Rarl mutants and the three
M1a-12 BC lines did not reveal significantly different
recombination frequencies. Therefore we restricted our
search for further recombinants to one cross only (M100 x
15 M1a-12 BC Ingrid). This enabled us also to use the
identified recombinants ajacent to Rar1 for a targeted AFLP-
based marker screen described below.
To increase the genetic resolution in the vicinity of the
20 target locus another 1,063 F2 plants were screened for
recombination events flanking Rarl by utilising CAPS makers
MWG892 and cMWG694. Subsequent investigation of MWG87 and
MWG876 alleles revealed complete linkage for MWG87 and Rarl
but one recombination event between MWG876 and the target
25 gene, positioning this RFLP distal to Rarl.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
56
We attempted to separate MWG87 genetically from Rarl by
testing a further 2,207 FZ plants for recombination events in
the marker interval MWG876 - MWG892 by CAPS analysis.
However, investigation of the observed recombinant plants
still revealed cosegregation of Rarl and MWG87. The tight
genetic linkage of MWG87, MWG876 and Rar1 may indicate small
physical distances between these loci but could also be a
result of a low recombination frequency in this genomic
segment. To investigate these possibilities and to enrich
the interval with additional DNA markers, we initiated an
AFLP-based marker search. If the tight genetic linkage of
Rarl, MWG87 and MWG876 is caused by a suppression of
recombination, then the large physical interval would be
expected to reveal a large number of linked AFLP markers in
the target region.
Targeted AFLP marker search
We employed the AFLP technology (Vos et al. 1995) in
conjunction with a bulked segregant analysis (Giovannoni,
1991; Michelmore et al. 1991) by using selected F2 progenies
of the cross rarl-2 x Mla-I2 BC Ingrid. To minimise
detection of AFLP markers which are not tightly linked to
Rarl we used DNA marker-selected recombinants for the
construction of DNA pools which we identified in the CAPS-
based recombinant screen described above. Both DNA pools
CA 02337861 2001-O1-16
_ - WO 00/08160 PCT/GB99/02590
_ _ s
57
comprised each 10 Fz plants. At the time we initiated the
AFLP marker screen we had analysed only 500 Fz individuals in
the marker interval MWG892-cMWG694 and the recombinant
between MWG876 and Rar1 had not yet been identified. In
consequence, MWG876 could not be used to. select suitable
recombinants. The susceptible pool (rarT-2/rarl-2) contained
three individuals with a recombination between cMWG694 and
Rarl, four individuals with a recombination between MWG892
and Rarl and three susceptible individuals without a
recombination event in the investigated marker interval. The
selection of recombinants for the resistant pool was based on
DNA markers only. By using plants which show the allelic
pattern of the resistant parent for cMWG694 and MWG892 we
could ensure homozygosity in the corresponding genetic
interval. Therefore linked AFLP markers are expected in
traps and cis. To narrow down the target interval of the
resistant pool we employed plants carrying a recombination
event between MWG503 and MWG892 (two plants) or cMWG694 and
MWG2123 (two plants). In addition to the recombinant
individuals we used six plants without a detectable
recombination event in the investigated marker interval.
The genome-wide frequency of AFLP-polymorphisms between M100
and Mla-12 BC Ingrid was found to be 7~. Each AFLP primer
combination displayed, on average, 100 DNA fragments.
Therefore, using seven PstI + 2- and 56 MseI + 3-primers in
CA 02337861 2001-O1-16
WO 00/08160 PCTlGB99/02590
58 -
392 combinations, approximately 40,000 loci were inspected.
Only two primer combinations identified AFLP markers linked
to Rarl in the DNA pools. Analysis of these on individuals
of each pool revealed that they are separated from the target
gene by one (R25/45) and two (A25/46) recombination events
and map distal relative to Rarl.
The small amount of identified AFLP markers linked to Rarl is
certainly influenced by the way we assembled the DNA pools.
It may also indicate that the small genetic interval in which
we searched for DNA markers is physically not excessively
large. To obtain more precise estimates on the relationship
of genetic and physical distances, we performed PFGE Southern
analysis in combination with rare cutting restriction enzymes
and RFLP probes linked to Rarl.
Long range physical mapping
Fragment sizes after restriction with seven different rare
cutting restriction endonucleases were determined using the
cosegregating probe MWG87 and flanking probes MWG892 and
MWG876. The analysis revealed a single co-migrating MluI
restriction fragments hybridising to MWG87 and MWG876
(Table 1). This may indicate a maximal physical distance of
550 kb between MWG876 and MWG87. Fragments of common size
were also detected using the probe/restriction enzyme
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
F
59
combinations MWG876/NotI, SalI and SmaI (90 kb) and
MWG87/SfiI and SmaI (I00 kb). These fragments of common size
using one probe and different endonucleases are possibly
caused by a clustering of restriction sites which has been
reported before in vertebrates (Bickmore.et al. 1992; Larsen
et al. 1992).
Physical delimitation of Rar.I on barley yeast artificial
chromosomes (YACs)
Screening of a barley YAC library
Significant in the high resolution genetic mapping of Rarl
was the identification of a 0.7 cM interval bordered by loci
MWG892 and MWG876 encompassing the target locus. Locus MWG87
was found to cosegregate with the target on the basis of more
than 8,000 meiosis. This provided a rationale to initiate a
screening of a barley YAC library to isolate large insert
genomic clones containing MWG87. PCR-based screening with
the cleaved amplified polymorphic sequence (CAPS) MWG87
resulted in the identification of five yeast clones, each
generating the expected PCR product. To confirm that the
obtained amplicons represented the MWG87 locus, we sequenced
each PCR product and found identical sequences in all YAC-
derived fragments. Two of the five YACs also contained the
CAPS marker MWG876 which maps 0.015 centimorgan (cM) distal
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
_ D
to Rarl.
YAC insert analysis by PFGE and inverse PCR (IPCR)
5 We used the probe MWG87 in PFGE Southern analysis to
determine the insert sizes of the isolated YACs; 680 kb
(Y18), 340 kb (Y30), 1,100 kb (Y31), 720 kb (Y73) and 300 kb
(Y113) respectively. Two independent Southern analyses
showed a significantly reduced signal intensity for YAC Y113
10 indicating disturbed inheritance of this yeast artificial
chromosome. To establish a local contig with the identified
YACs, we isolated their left (L) and right (R) termini by
IPCR and determined their nucleotide sequence. Sequence
analysis of those YAC ends revealed that the YAC terminus
15 Y31L has about 95~ identity to the barley BARE-1
retrotransposon, a highly repetitive sequence which comprises
about 6.7~ of the barley genome (Suoniemi et al. 1996).
Further sequence stretches with high relatedness to the BARE-
1 retrotransposon were found in Y18R, Y18L, and Y73L. In
20 addition, the YAC end Y31R revealed about 64~ sequence
identity to the maize retrotransposon Opie-2 (SanMiguel et
al. 1996) indicating a novel element which has so far not
been described in barley.
25 Overlap analysis of YAC inserts
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
61 -
End probes from each yeast clone were tested against all YACs
to determine their relationship. Based on the results of the
nucleotide blast, YAC-end specific oligonucleotides were
designed in sequence stretches representing supposedly non-
repetitive DNA. This was not possible for YAC end Y31L which
comprises multicopy DNA only. Subsequently, PCR analysis was
employed to determine the presence or absence of these
sequences in the respective yeast clones (Table 2). Two
anonymous YACs (Y1, Y2) were included to uncover primer pairs
which still recognised repetitive DNA. Amplification
products corresponding to YAC terminus Y31L in yeast clones
Y1 and Y2 corroborated the multicopy character of this YAC
end. YAC end Y113L gave rise to amplification products in
YAC Y73 and Y113. However the length of the PCR product in
Y73 was different from the expected size which was detected
in Y113. Therefore we concluded that the locus corresponding
to Y113L was not present in YAC Y73. All other YAC-end
specific primers detected clear absence/presence
polymorphisms on the different YAC clones and did not amplify
fragments in Yl or Y2, indicating their suitability for YAC
contig analysis.
If all YAC inserts are colinear with the source DNA, each end
probe should detect the yeast clone it was derived from plus
any YAC covering this area. For two YAC termini, marking the
ends of the contig, only the yeast clone they were derived
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
Y
62
from should be detected. These end probes define now the
termini of the YAC contig. Since we determined four YAC ends
which are not amplified in any YAC, but the one they are
derived from, at least two of the four YAC ends must be
derived from chimeric YACs. However based on this
information, it remained uncertain which two of the four YACs
are chimeric. Genetic mapping of the YAC ends could resolve
this lack of clarity but is only possible if the end probes
are single or low copy markers.
Copy number of YAC ends
With the exception of Y31L all YAC end specific markers
proved suitable for contig establishment based on YAC DNA.
Next, we determined whether the YAC-end derived
oligonucleotides amplified single loci from barley genomic
DNA, a prerequisite for genetic mapping. We performed PCR
analysis with the respective YAC-end specific primer pairs
using genomic DNA of cultivar Ingrid, the source DNA of the
YAC library. Primers corresponding to Y113L revealed
multiple amplicons of different lengths matching to non-
specific PCR products also observed in YAC Y73. In contrast,
oligonucleotides corresponding to YAC termini Y18L, Y18R,
Y30L, Y30R, Y31R, Y73R and Y113R (Table 3) resulted in the
amplification of uniformly sized fragments. However, cloning
and sequencing of the PCR products (three independent clones
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
. . _ F
63
for each YAC end) revealed that the oligonucleotides
corresponding to Y30L and Y73L generated at least three
different amplicons which show about 5~ sequence divergence.
This indicated that primers corresponding to Y30L and Y73L
recognise multiple loci with high degree. of sequence
similarity. The sequence analysis was used for the selection
of endonucleases recognising nucleotide stretches which are
polymorphic between the three characterised subclones and the
YAC-end derived sequence. Restriction digest of the PCR
products with these diagnostic endonucleases resulted in a
more complex banding pattern than predicted for an amplicon
derived from a single locus of known sequence. Therefore
endonuclease based analysis of the PCR products from genomic
DNA confirmed heterogeneity of the amplification products
corresponding to Y30L and Y73L and may be in general a useful
tool to determine if a certain marker detects a single copy
locus. Sequence analysis of the subclones corresponding to
YAC termini Y18L, Y18R, Y30R, Y31R and Y113R indicated that
these amplicons are homogenous.
Assignment of YAC ends to barley chromosomes
To determine the chromosomal location of the isolated YAC
ends we used the wheat/barley diteleosomic addition lines,
each containing a known chromosome arm of the barley cultivar
Betzes (Shepherd and Islam 1981; Islam 1983). The
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
64
diteleosomic wheat/barley addition lines facilitate a rapid
assignment of a given barley sequence to its corresponding
chromosome arm if barley specific signals can be
discriminated from wheat specific signals. We used PCR
primers derived from the barley cultivar.Ingrid to assign
Y18R and Y18L to barley chromosome 2HL, Y31R to chromosome
5HS and Y73R to chromosome 6HS. This indicated chimerism of
YAC Y31 and Y73. YAC end Y113R could not be mapped since the
primers derived from cultivar Ingrid did not amplify a
fragment from cultivar Betzes, the barley DNA donor for the
addition lines. Similarly the YAC terminus Y30R could not be
assigned because it generated fragments of identical size in
wheat and barley.
High-resolution genetic mapping of YAC ends
The wheat/barley diteleosomic addition lines facilitate
identification of chimeric YACs but high-resolution genetic
mapping is necessary to define the position of the YAC ends
in relation to the target locus. A prerequisite for genetic
mapping of the YAC termini is a sequence polymorphism between
the parental genotypes of the mapping population. We used a
PCR-based approach to search for possible sequence
polymorphisms. Oligonucleotides corresponding to Y30R gave
rise to amplification products of different size in the
resistant (Rarl) and susceptible (rarl) parents whereas the
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
primer pair corresponding to Y113R amplified DNA fragments
only in each of the resistant parents. PCR products derived
from the resistant and susceptible parents for the marker
loci Y18L and Y18R were analysed for DNA polymorphisms by
5 direct sequencing. Comparative sequence.analysis revealed a
polymorphic HinfI site in the case of Y18R whereas in Y18L,
no DNA polymorphism was detected over about 2.7 kb. A copy
of a BARE-1 retrotransposon within the Y18L sequence made it
impossible to further extend this sequence by IPCR to search
l0 for polymorphisms. Genetic mapping of the polymorphic YAC
ends positioned Y30R and Y113R proximal to Rarl, separated by
eleven and three recombinants respectively from the target
locus. Marker Y18R was found to cosegregate with Rarl.
15 YAC con ti g a t Rarl
Based on information obtained by (i) presence/absence mapping
on the YACs, (ii) chromosome assignment via wheat/barley
addition lines and (iii) high-resolution genetic mapping, we
20 deduced a YAC contig. YAC Y18 is likely to be the only YAC
containing a non-chimeric insert which is colinear to the
source DNA, since both termini map to chromosome 2HL. In
contrast, YAC Y30 has probably undergone a rearrangement
leading to an internal deletion including the marker Y113R.
25 This conclusion is based on (i) the genetic mapping of Y113R
between MWG87 and Y30R and (ii) absence of marker Y113R in
a
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
a
66
YAC Y30 (Table 2). A previous detailed characterisation of
the YAC library by PFGE Southern analysis revealed multiple
YAC-derived fragments due to instabilities of about 30% of
the clones (Simons et al. 1997). However, the recovery of an
individual clone harbouring only the largest insert was
usually possible. To determine if the library still
contained a Y30 corresponding clone which also contained the
Y113R locus, we analysed the pools of yeast DNA which were
initially used to identify the YAC clones. We were unable to
find Y113R specific amplicons in the pool DNA corresponding
to YAC Y30, indicating that the internal deletion in YAC Y30
has occurred at an early stage during construction of the
library.
Chimerism of YAC inserts was concluded for YAC Y31, Y73 and
Y113. In the case of YACs Y31 and Y73 this assumption is
based on assignment of Y3IR and Y73R to chromosome 5HS and
6HS respectively. In contrast evidence for chimerism in YAC
Y113 was based on absence of all markers distal from MWG87
and the fact that Y113L was detected in YAC Y113 only (Table
2). Alternatively, the YAC end Y113L could be located distal
from YAC terminus Y31L implying that the area between the
loci Y18R and Y30L has been deleted in YAC Y113 during clone
propagation.
In summary, the genomic area containing Rarl is genetically
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
_ s
67
delimited by Y113R (proximal) and MWG876 (distal). Since the
presented YAC contig covers this interval physically by YAC
clones Y18 and Y113 in proximal (two fold redundancy), and
YAC clones Y30 and Y31 in distal orientation (two fold
redundancy), we have physically delimited the Rarl locus.
Construction of a BAC contig at Rarl
Next we established two HindIII BAC sublibraries in vector
pBelo BAC11 from YAC clone Y18 and YAC clone Y30. We aimed
at an average insert size of 50 kb and an approximately five-
fold redundancy for each sublibrary.
Five BACs, derived from YACs Y30 and Y18, were initially
isolated with CAPS MWG87, cosegregating with Rar1 (BAC 12,
BAC 1J6, BAC 4C20, BAC 1612, and BAC 3H6). PCR primers for
marker Y113R were used to isolate BAC 1H1. Insert sizes of
the identified BACs were determined by PFGE. End fragments
of each BAC insert were isolated by inverse PCR and
subsequently sequenced. Based on terminal sequences of
BAC 4C20 we derived a new co-dominant DNA marker, designated
EDDA (Table 4), detecting a sequence polymorphism between the
parental genotypes of the mapping population. Analysis of
the four recombinants within interval MWG876 - Y113R,
positioned EDDA proximal to Rarl. Since BAC 4C20 contains
each of the three loci MWG87, Y18R, and EDDA, we have
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
_ b
68
physically delimited Rar1 in direction to the centromere on a
single BAC clone.
Subsequently, terminal sequences of BAC 12, BAC 3H6, and
BAC 1B2 were employed to derive markers OK1114, OK3236, and
OK5558, respectively (Table 3}. The co-dominant marker
OK1114 was found to cosegregate with Rarl by inspection of
genomic DNA derived from the four recombinants within target
interval MWG876 - Y113R. Markers OK3236 and OK5558 detected
l0 polymorphisms between the parental genotypes Sultan5/M1a-
12 BC Pallas and Sultan5/Mla-12 BC Ingrid but we failed to
detect a polymorphism for this locus between Sultan5/Mla-
12 BC Siri. Therefore, only three of the four recombinants
in the target MWG876 - Y113R could be tested to locate the
recombination events. Analysis of the DNA of these three
recombinants revealed cosegregation of markers OK3236 and
OK5558 with Rarl. The insert lengths of the BACs, the
presence and absence of each of the above described markers,
and their genetic orientation relative to Rarl was the basis
to deduce a high-resolution genetic map at the Rar1 locus.
Rarl was physically delimited on the BAC level in centromeric
orientation and the identification of a minimal cosegregating
interval bordered by markers Y18R and OK5558.
A contiguous 66 kb DNA stretch at the Rarl locus
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
~ - . F
69
We decided to assemble a contiguous genomic DNA sequence of
the DNA interval bordered by markers MWG87 and OK5558.
Inserts of BAC 1B2 and BAC 12, covering this area, were
subjected to DNA sequencing by means of randomly chosen
clones derived from plasmid sublibraries.of each BAC into
vector pBluescript II Ks+ A 49 by gap between BAC B2 and
BAC 12 was closed by using primers specific for terminal end
sequences of each BAC on template DNA of BAC 3H6 and
subsequent direct sequencing of the amplicon.
A search for candidate genes
Next we initiated a search for candidate genes in the
contiguous 66 kb DNA stretch at the Rar1 locus using the
BLAST algorithm and all available data bases including
anonymous ESTs and genomic as well as known gene and protein
sequences. We identified three distinct regions containing
highly significant homologous sequences to various entries in
the databases (Table 5). We have designated these three
intervals I1, I2, and I3 (corresponding to positions 43,500
to 45,000, 45,001 to 46,500, 56,000 to 61,000 in the 66 kb
sequence contig). Intervals Il and I2 are sequence related
to each other (59~ nucleotide identity) and were identified
by the same class of ESTs in the databases (Table 5), each
showing similarity to aquaporin genes [Maurel, 1997]. Thus,
intervals I1 and I2 represent two putative barley aquaporin
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
a
genes arranged in head to tail orientation. Interval I3
shows high sequence similarity ro rice EST C28356 and may
represent another coding region in the 66 kb strech.
5 Identification of mutational events in Rarl candidate genes
Next we compared the DNA sequences of genomic amplicons from
genotypes Rarl Sultans, rarl-1 Sultan5, and rarl-2 Sultan5
each covering intervals I1, I2, and I3. We failed to detect
10 any sequence polymorphism between the three genotypes in
intervals I1 and I2. However, two single nucleotide
substitutions were discovered in interval I3 at positions
56,764 and 58,562 bp. The G->A substitutions correspond to
unique sequence alterations in genotypes rarl-1 and rarl-2,
15 respectively. The finding of mutational events in I3 then
prompted us to perform reverse transcriptase-polymerse chain
reactions (RT-PCR) with total leaf RNA derived from cultivar
Ingrid using a series of primers deduced from the I3 sequence
(both YAC and BAC recombinant clones contain genomic DNA from
20 cultivar Ingrid).
Sequencing of the largest RT-PCR products revealed a single
extensive open reading frame of 696 by (Figure 1). 5' and 3'
ends of the gene transcript were identified using rapid
25 amplification of cDNA ends (RACE) technology.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
71
The deduced protein of 232 amino acids has a molecular weight
of approximately 25.5 kDa. No significant homologies were
found to any other characterised protein in the various
databases.
A comparison of the genomic and RT-PCR-derived sequences
revealed six exons, each flanked by the consensus splice site
sequences (Figure 2 and Table 6). Notable is exon 2
consisting of only three bp, flanked by consensus splice site
sequences, encoding a glycine residue.
The G->A DNA substitution identified in genotype rarl-
1 Sultans results in a Cys24->Tyr substitution in the
putative 25.5 kDa protein (Cyst' represents one of the few
invariant amino acids in Rarl homologous proteins; see
below). In contrast, the G->A DNA substitution identified in
genotype rarl-2 Sultan5 disrupts the 3' splice site consensus
sequence of intron 2. The G nucleotide of the splice site
consensus is known to be essential for effective splicing of
primary mRNA transcripts in both plant and mammalian species
[Goodall, 1991]. RT-PCR analysis of the rarl-2 genotype
revealed that the mutation leads to utilisation of a cryptic
splice site in exon 3, a phenomenon documented in numerous
human herditary diseases caused by point mutations [Krawczak,
1992] [Brown, 1996]. Use of this cryptic splice site leads
to a shift of the reading frame, creating a new stop codon,
CA 02337861 2001-O1-16
- WO 00/OSI60 PCT/GB99/02590
. .
72
and consequently a truncation of the deduced 25.5 kDa
protein.
The finding of single base substitutions in genotypes rarl-1
and rarl-2 is consistent with the proposed mode of action of
sodiumazide, the mutagen originally utilized for mutagenesis
of cultivar Sultan5. The chemically mutagenized population
used to identify rarl-1 and rarl-2 revealed mutants with
functional defects in single genes at a frequency of 0.5 x 10-
' (Torp and Jr~rgensen 1986), comparable to the average
efficiency of chemical mutagenesis in barley. The
probability to identify two point mutations in a single gene
both compromising its function in two independent mutants is
therefore approximately 0.25 x 10-6. In conclusion, the
finding of two mutational events in genotypes rarl-I and
rarl-2 which lead either to the substitution of an invariant
single amino acid or splice site detect of the candidate gene
in the physically delimited target interval provides good
indication that we have isolated Rarl.
Homologues of barley Rarl
DNA sequencing of the anonymous rice EST 028356 revealed a
single extensive open reading frame of 699 by encoding a
putative Rarl homologous protein of 233 amino acids revealing
75~ DNA and 86% amino acid similarity with barley Rarl
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
73
(Figure 3) (GCG program GAP with gap creation penalty = 3 and
gap extension penalty = 0.1). Furthermore, searches of the
Arabidopsis thaliana genomic databases revealed a genomic
interval on chromosome 5 exhibiting significant sequence
relatedness to barley and rice Rarl. The sequence homologous
stretches are limited to the exons identified in barley Rar1
and their order in the Arabidopsis genome matches those
identified in barley. Each of the sequence homologous
stretches in Arabidopsis is flanked by consensus splice site
sequences. This enabled us to deduce a putative homologous
Arabidopsis Rarl protein of 226 amino acids sharing 67~
identical and 75~ similarity with barley Rarl (GCG program
GAP with gap creation penalty = 3 and gap extension penalty =
0.1). We designate the corresponding rice and Arabidopsis
genes OsRarl-hI and AtRarI-hl respectively.
Primers AtRarl 5' - ACTCCTACCTTCTCAATTCGTCCG - and AtRarl 3'
- TATCAGACCGCCGGATCAGG - corresponding to AtRarl-hl enabled
us to isolate the cognate cDNA which confirmed the predicted
intron-exon structure.
Finally, we identified a number of EST entries representing
expressed genes of unknown function from man, mouse,
Drosophila, Caenorabditis elegans, Aspergillus and the like,
revealing significant homologies only at the deduced amino
acid level. The relatedness found between the deduced
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
74
proteins corresponding to these ESTs and barley Rarl are
listed in Table 7 and an alignment of the deduced sequences
is shown in Figure 3. Apparently, barley Rarl uncovers a
novel protein domain shared among multicellular organisms.
Interestingly Cys=' of barley Rarl, substituted to Tyr in
mutant rar.I-1, represents one of the few strictly conserved
amino acids in all identified sequence related proteins.
DISCUSSION
We have described here the molecular isolation of barley Rarl
by a map-based cloning approach. The gene is predicted to
encode a novel 22.5 kDa intracellular protein. This finding
needs to be interpreted in the context of genetic data
indicating that Rar1 is essential for a number of powdery
mildew resistance reactions triggered by different race-
specific resistance genes (R genes). It is now generally
accepted that plant resistance to particular pathogens
involves specific recognition events, triggered by
corresponding R genes in the host and avirulence genes (Avr)
in the pathogen. Many effector components have been
implicated in pathogen arrest of pathogens, including the
generation of reactive oxygen species, phytoalexins,
activation of host cell death, the accumulation of
pathogenesis-related proteins, and cross-linking of the plant
cell wall. Most of these responses were also shown to be
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
_ F
activated in barley/powdery mildew interactions. The
requirement of Rar1 for several R-gene triggered resistance
reactions and the multitude of effector components activated
in a resistance response leads us to propose that the Rarl
5 protein acts "downstream" of R gene recognition but
"upstream" of the execution of the response. Thus Rarl is
likely to represent a point 'of convergence in the signalling
of R gene triggered resistance.
10 A close inspection of the Rarl protein sequence and a
comparison to the rice and Arabidopsis homologues reveals a
striking tripartite structure (designated domain I, II, and
III - Figure 6). Interestingly domain I and III, each
approximately 60 as long and located close to the amino- and
15 carboxy-terminal ends of Rar1 respectively, are structurally
related to each other. Remarkable is a strictly conserved
pattern of cysteine and histidine residues in domains I and
III.
20 The domain signature is not only conserved among plant Rarl
homologues but it is also found in each of the other related
peptide stretches identified in proteins from Aspergillus,
Drosophila, Caenorhabditis, mouse, and man. we have
designated this novel protein domain "CHORD" (the example in
25 domain I of Rarl being termed "CHORD1" and the example in
domain III being "CHORD2". Apart from the characteristic
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
76
string of cysteine and histidine residues, CHORD contains few
other invariant amino acids, G1y23, Phe", and Trps' as well as
a negatively charged residue in position 49 and a positively
charged residue at position 52 (numbering refers to the amino
terminal CHORD domain in barley Rarl). The conservation of
CHORD in such diverse phyla is indicative of a selective
pressure to maintain a similar three dimensional structure in
which cysteine and histidine residues play a major role.
Conserved strings of Cysteine and Histidine residues in
intracellular protein domains have been frequently shown to
be involved in binding zinc ions. However, the pattern of
these residues in CHORD is distinct from any previously
described zinc-binding domain in which zinc ions have a
structural role to stabilize small, autonomously folding and
functional protein domains (e.g. the TFIIIa zinc finger, the
GAL4 zinc finger, the zinc binding domain in the oestrogen
receptor, the LIM domain, the RING finger domain, and the
GATA-1 finger domain) .
The CHORD domain (e.g. CHORDl and CHORD2) can be signified as
C-X4 C X10-13-C XZ H X6 yl X6-7 C2 X15-C-X4-5-H
and may be
C X4 C X13 C XZ H X6 H X7 CZ X15 C X4 H .
In particular, a CHORD domain according to the present
invention may conform to the formula:
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
_ . t
77
C x3 G C x3 Al-xs-9-C-xz-H-xs-F-Y1-Az-xl-z-Aa-xl-W-xl-C-C-X~s-C-x,_s-H
wherein:
C, G, F and W are the single letter code for Cys, Gly, Phe
and Trp, respectively,
A1 is an aromatic amino acid, and may be.selected from Phe,
Trp and Tyr,
Az is a negatively charged residue, and may be selected from
Glu and Asp,
A3 is a positively charged residue, and may be selected from
Arg, His and Lys,
yl is H or any amino acid, and is preferably His or Arg, and X
may be any amino acid (with the numbers indicating the number
of amino acids),
subject to the structural constraints on the spatial
relationship of the cysteines and histidines required for
zinc binding.
Domain III in plant Rarl-like proteins appears to contain
another set of cysteine and histidine residues providing a
domain according to the present invention: C-xz-C-xs-C-xz-H.
This binds the protein encoded by the Arabidopsis homologue
of the yeast SGT1 gene (Kitagawa et al (1999) Mo1 Cell 1: 21-
34 ) .
The molecular isolation of barley Rarl and the finding of
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ ;
78
related genes in rice and the dicot Arabidopsis thaliana
makes it likely to be a component of all higher plant
genomes. The extent of sequence conservation among plant
Rarl homologues makes it likely that they share also related
functions. A modest 2-3 fold overexpression of the
Arabidopsis thaliana NPR1 gene, a key regulator in systemic
aquired resistance, resulted in complete resistance to the
pathogens Peronospora parasitica and Pseudomonas syringae
[Cao, 1998], providing indication that modulating steady
state levels of Rarl mRNA or protein may be used to alter
speed and pathogen spectrum of the resistance response.
Redirecting Rar1 expression by fusing the gene to promoters
from pathogenesis-related genes (PR genes) may also be used
to broaden the spectrum of Rar1 mediated pathogen resistance.
This approach~may be particularly attractive in combination
with the expression of derivatives of the Rarl protein. For
example, modified versions of the Rarl protein may be
identified which decouple its activation from R genes and
retain their activation of downstream responses (PR gene
activation, HR). The identified tripartite domain structure
of the plant Rarl proteins may serve in guiding these
experiments.
ADDITIONAL MATERIALS AND METHODS FOR HIGH-RESOLUTION GENETIC
AND PHYSICAL MAPPING
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
d
79
Plant Material
Seeds of doubled-haploid barley (Hordeum vulgare) line
Sultan-5 and Sultan-5 derived mutants M82 (rarl-1) and M100
(rarl-2) were as described in Torp and Jr~rgensen 1986.
Sultan-5 and the mutants contain the macroscopically visible
marker gene ant2. (anthocyanin deficiency in the leaf
sheath). The MIa-12 backcross (BC) lines in cultivars Siri
and Pallas were as described in Kralster et al. 1986; Kmlster
and Stmlen 1987.
The M1a-12 BC line in cultivar Ingrid was generated through
seven backcrosses with H. vulgare cv Ingrid followed by at
least seven selfings. Each of the mutants M82 and M100 were
pollinated with pollen derived from the M1a-12 BC line
cultivars, F1 plants from each cross were grown to maturity
providing the various segregating FZ populations.
A segregating FZ population of 186 individuals derived from
the cross Nipponbare x Kasalath (Kurata et al. 1994) was used
for mapping in rice. The map position of locus MWG876 in
rice was independently tested in a second segregating F2
population of 123 individuals derived from the cross IR20 x
63-83 (Quarrie et al. 1997).
Tests for Resistance
CA 02337861 2001-O1-16
WO 00/08160 PCT/G899/02590
_ . t
Tests for resistance were carried out as described in
Freialdenhoven et al. 1994. The phenotype of the
recombinants was determined after selfing and subsequent
inoculation experiments in F3 and F4 families comprising at
5 least 25 individuals. F3 individuals were tested by cleavable
amplifiable polymorphic sequence analysis (CAPS) to identify
homozygous recombinants. These plants were again selfed and
subjected to resistance tests in F9 families. Plants were
scored for resistance/susceptibility seven days after
10 inoculation.
Pulsed-field Gel Electrophoresis (Pfge) and Southern Analysis
High molecular weight DNA of barley was~isolated from leaf
15 material of 5-7 day old seedlings using a procedure according
to Siedler and Graner (1990). DNA was digested with six
rare-cutting restriction enzymes (ClaI, MluI, SalI, NotI,
SfiI, SgfI, SmaI) using the protocol of Ganal and Tanksley
(1989). For size fractionation a 1.2~ agarose gel was run in
20 an LKB Pulsaphort"" apparatus (Pharmacia Biotech, Upsala,
Sweden} at 180 V with pulse times from 10-60 s (linear
interpolation) for 25 h in 0.5 x TBE (50 mM Tris-HC1, 50 mM
boric acid, 1 mM EDTA, pH 8.3) at 12°C. Capillary transfer
and non-radioactive Southern hybridisation was performed as
25 described in Lahaye et al. (1996).
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
81 -
AFLP/CAPS Analysis
Genomic DNA for CAPS and AFLP analysis was isolated according
to Stewart and Via (1993). Primer PCR conditions and the
respective restriction enzymes used for CAPS marker display
are shown in Table 1. CAPS analysis was performed in a
volume of 20 ~C1 (100 pmole of each primer, 200 ~M dNTPs, 10
mM Tris-HC1 pH 8.3, 2 mM MgClz, 50 mM KC12, 0.5 U Taq
Polymerase (Boehringer) using 50 ng of barley genomic
template DNA. The digested PCR products were subsequently
size-fractionated on 2% agarose gels. AFLP analysis (Vos et
al. 1995) was performed on bulked DNA samples of resistant
and susceptible plants (Giovannoni et al. 1991; Michelmore et
al. 1991) using PstI and MseI restriction enzymes, PstI and
MseI adapters, and a set of primers corresponding to the PstI
and MseI adapters with two or three selective nucleotides at
the 3'-end, respectively. Utilising seven PstI + 2 (2
selective bases) - and 56 MseI + 3 (3 selective bases) -
primers 392 combinations were analysed in total.
ADDITIONAL MATERIALS AND METHODS FOR ANAL YSIS OF YACS
Barley YAC Library Screening
DNA of 428 YAC pools each representing 96 yeast clones
(Simons et al. 1997) was screened using CAPS marker MWG87.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
82 -
YAC pools positive for the MWG87 amplicon were further
analysed by colony PCR for the identification of single yeast
clones. The observed amplicons were size separated on an
agarose gel, excised and purified with the Quiaquick gel
extraction kit (Quiagen GmbH, Dizsseldorf, Germany). The
purified PCR products were subjected to dye terminator
sequencing (Perkin Elmer Corp., Norwalk, CT, USA) to confirm
that the generated amplicons correspond to the MWG87 single
copy locus. The observed individual YAC clones were
subsequently investigated with CAPS marker MWG876. Cycling
conditions and employed primers for CAPS markers MWG87 and
MWG876 were as described herein. The initial denaturation
step was elongated from two to four minutes for colony PCR
analysis.
Plant Material
Seeds of diteleosomic wheat/barley addition lines were as
described in Shepherd and Islam 1981; Islam 1983.
CAPS Analysis
Plant DNA for PCR-based analysis was extracted according to
(Stewart and Via 1993). Primer and PCR conditions for YAC
end specific markers are listed in Table 4. PCR was
performed in a volume of 20 ~,1 (100 pmole of each primer, 200
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
_ _ 1
83
~.M dNTPs, 10 mM Tris-HC1 pH 8.3, 2 mM MgClz, 50 mM KC12, 0.5 U
Taq Polymerase (Boehringer Mannheim, Mannheim, Germany) using
200/50 ng of wheat/barley genomic template DNA. Amplicons
corresponding to the different YAC ends were cloned into
pGEM-T vector (Promega, Southampton, United Kingdom) and
three independent clones of each PCR product were subjected
to dye terminator cycle sequencing (Perkin Elmer).
PFGE Southern Analysis of YACS
Individual YAC clones were grown for 2 days at 30°C in 100 ml
synthetic dextrose (SD) minimal medium lacking uracil and
tryptophan (Rose et al. 1990). High molecular weight yeast
DNA was prepared in low melting point agarose as described by
Carle et al. (1985). Separation of yeast chromosomes was
performed by a 1.2% agarose gel (SeakemT"" LE; FMC BioProducts,
Rockland, ME, USA) in an LKB PulsaphorT'" apparatus (Pharmacia
Biotech, Uppsala, Sweden) at 180 V with pulse times from 10-
80 s (linear interpolation) for 30 h in 0.5x TBE (50 mM Tris-
HC1, 50 mM boric acid, 1 mM EDTA, pH 8.3) at 12°C. MWG87 was
used subsequently as a probe for Southern hybridisation as
described in Lahaye et al. (1996) to determine the size of
the YAC inserts.
Isolation of YAC Terminal Sequences
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
. - . s
84 _
Terminal sequences of YAC inserts were isolated by inverse
PCR (IPCR) according to Silverman et al. (1989). The
observed amplicons were size separated on an agarose gel,
excised, purified with the Quiaquick gel extraction kit
(Quiagen) and subjected to dye terminator sequencing (Perkin
Elmer). For further elongation of YAC ends by an additional
IPCR new oligonucleotides have been deduced based on the
sequencing information of the respective YAC end.
Database Searches
Analysis of YAC end sequences was done using programs of the
Genetics Computer Group (GCG) and the STADEN software package
for Unix users (fourth edition, 1994).
EXAMPLE 2
Activation in barley of Rarl Dependent Host Cell Death
Independent of An R Gene Trigger.
The over-expression of full length and truncated Rarl gene
derivatives in barley downstream of the known maize ubiquitin
promoter (Ubil promoter) flanked by the Ubil-intron 1 (Wan
and Lemaux 1994) is carried out by delivering a suitable
construct obtained using standard gene cloning methods
(Sambrook et al. 1989).
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
Briefly, the vector pUBI-GFP (Carlsberg Research Laboratory,
Copenhagen, Denmark) is modified by deleting GFP and
inserting the RAR-1 gene of interest in place thereof (such
as the whole RAR-1 gene, or a sequence encoding an N terminal
5 portion or a C terminal portion thereof,.e.g. as shown in
Figure 5A and Figure 5C, encoded for instance by the
sequences of Figure 5B and Figure 5D respectively). Following
the cloning of the constructs, they are administered to
prepared 7-day old plant leaf sections from barley using a
10 suitable transient tranforrnation protocol.
Plant Material for transient transformation
Seeds of Hordeum vulgare cv. Golden Promise are sterilized by
15 incubation in 70% ethanol for one min, washing three times in
Milli-Q water followed by incubation in 1.5% sodium
hypochlorite for 10 min and 5 times washing in sterile Milli-
Q water. Seeds are sown in magentas (15 seeds/sample)
containing 2 cm vermiculite supplied with 30 ml 1/2-strength
20 MS basal medium (Sigma) supplemented with 2% sucrose, and
cultured at 22 C (16 h light/8h darkness).
Primary leaves of 7-day-old seedlings are excised above the
coleoptile and cut into two 3cm sections. Specimens are
25 incubated for 3h in Petri dishes on 3 ml 10% sucrose, which
leaves the plant material floating. Thereafter the sucrose
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
s
86
solution is removed and the plant material is air-dried for 5
min prior to particle bombardment.
Procedure for Transient Transformation
The transformation process uses a particle inflow gun (PIG)
(Vain et al. 1992). The constructs are precipitated onto
gold particles (l,um, Bio Rad) according to the method of
Klein et al. 1988 introducing l,ug of Quiagen-purified plasmid
per bombardment. The plant material is placed 9cm below the
particle outlet and covered with a steel grid with 0.4 mm
pore size. Bombardment conditions are: acceleration of the
particle with 2735 mbar Helium gas at an air pressure of 100
mbar. Immediately after delivery of the DNA, approx. 4m1 of
sterile 1/2 strength MS basal medium, supplied with 3~
sucrose and 1mM benzimidazol, is added to the sample which is
then incubated at 24°C in the dark for 24h.
RESULTS
The appearance of cell death clusters is confirmed by trypan
blue staining. Leaf specimens are stained by boiling for
8min in alcoholic lactophenol (96~ ethanol-lactophenol 1:1
[v/v] containing O.lmg/ml trypan blue (Sigma) and cleared in
a chloral hydrate solution (2.5 mg/ml) overnight.
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
_ iY
87
Rarl constructs activating host cell death in the transient
assay are selected for further modification in transgenic
plants.
EXAMPLE 3
The Expression in Barley of Cell Death Activating Rar-1
Derivatives by Fusions to Promoters From Pathogenesis-related
Genes (Pr Genes) .
PR genes are known to be activated at high levels surrounding
the sites of attempted pathogen attack.
Cell death activating Rar-1 derivatives are fused to 2 kb
promoter sequences of barley genes HvPRl-a and HvPRl-b
(Bryngelsson et al. 1994). These genes are known to be
activated in leaf tissue in response to attack from different
pathogens including powdery mildew, Drechslera teres, and
Puccinia hordei (Reiss and Bryngelsson 1996).
Fusions of HvPRl-a and HvPRl-b promoters to cell death
activating Rarl derivatives as provided herein are cloned
into vector pAHC25 (Wan and Lemaux 1994) by replacing both
the uidA reporter gene and the maize ubiquitin promoter of
pAHC25, following standard cloning procedures (Sambrook et
al. 1989). Transgenic barley plants of cultivar Golden
Promise are generated using the selectable marker gene bar in
CA 02337861 2001-O1-16
WO 00/08160 PC'T/GB99/02590
88
pAHC25 following the procedures described in Wan and Lemaux
1994.
Transgenic lines are tested for broad spectrum resistance
following inoculations with different isolates of powdery
mildew, Puccinia hordei, and Drechslera teres spores. Plants
displaying resistance to the described isolates are observed.
Ac ti va ti on of Rar1 Dependen t Hos t Cel l Dea th Independen t of
An R Gene Trigger.
The over-expression of full length and truncated Rarl gene
derivatives in barley downstream of the known maize ubiquitin
promoter (Ubil promoter) flanked by the Ubil-intron 1 (Wan
and Lemaux 1994) is carried out by delivering constructs
which are obtained using standard gene cloning methods
(Sambrook et al. 1989). Briefly, the vector pU-Mlo
(constructed by replacing GFP in pUBI-GFP with the 1.8 kb Mlo
cDNA (Buschges et al. 1997; Shirasu K. et al., 1999, Plant
J., 17(3): 293-299) is modified by deleting Mlo and inserting
the RAR-1 gene of interest in place thereof (such as the
whole RAR-1 gene, or a sequence encoding an N terminal
portion or a C terminal portion thereof, e.g. as shown in
Figure 5A and Figure 5C, encoded for instance by the
sequences of Figure 5B and Figure 5D respectively).
Following the cloning of the constructs, they are
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
89 -
administered to prepared 7-day old plant leaf sections from
barley using a suitable transient tranformation protocol (for
which see Example 2).
RESULTS
The appearance of cell death clusters is confirmed by trypan
blue staining. Leaf specimens are stained by boiling for
8min in alcoholic lactophenol (96% ethanol-lactophenol 1:1
[v/v] containing O.lmg/ml trypan blue (Sigma) and cleared in
a chloral hydrate solution (2.5 mg/ml) overnight.
Rarl constructs activating host cell death in the transient
assay are selected for further modification in transgenic
plants.
EXAMPLE 4
The Expression in Dicots of Cell Death Acti eating Rar-I
Deri va ti ves
This is achieved both independently of an R gene trigger (as
in Example 2 for barley) and by means of fusions to promoters
from pathogenesis-related genes (Pr Genes) (as in Example 3
for barley).
Preparation of plant material is carried out as described
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99102590
s
above for barley using surface-sterilized Arabidopsis
(ecotype Columbia) and tomato seeds (cultivar Moneymaker).
Leaves of 4 week old plants are infiltrated with
5 Agrobacterium strain C58 containing p35S.-Rarl constructs in
which Rarl derivatives are driven by the 35S CaMV promoter in
a T-DNA vector, pBINl9 (Bevan, 1984).
RESULTS
The appearance of cell death clusters is confirmed by trypan
blue staining. Leaf specimens are stained by boiling for
8min in alcoholic lactophenol (96% ethanol-lactophenol 1:1
[v/v] containing O.lmg/ml trypan blue (Sigma) and cleared in
a chloral hydrate solution (2.5 mg/ml) overnight.
Rarl constructs activating host cell death in the transient
assay are selected for further modification in transgenic
plants.
EXAMPLE 5
Expression in Arabidopsis of Cell Death Activating At-Rarl
Deri va ti ves
The glucocorticoid-mediated transcriptional induction system
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
91
(Aoyama and Chua, 1997, Plant Journal 11, 605-612.) is
employed in inducible over-expression of full length and
truncated AtRar1 gene derivatives in Arabidopsis.
The vector pTA231 (The Rockefeller University, New York, USA)
is modified by inserting the AtRarl sequence of interest
selected from those shown in Figures 8A to 8H, i.e, the whole
AtRarl gene, a sequence encoding an N-terminal portion, an
internal portion, or a C-terminal portion thereof, using the
XhoI and SpeI cloning sites. Primers used to amplify AtRarl
gene fragments are:
OK228 5'-CCTCGAGACTCCTACCTTCTCAATTCGTCCG-3' and
OK232 5'-AACTAGTATCAGACCGCCGGATCAGG-3' for whole AtRarl,
OK228 and OK229 5'-AACTAGTCAGGCCAGAACTGGTTTCTCAGTTGT-3' for
the N-terminal portion,
OK230 5'-AACTAGTCAAGCCTTTTGTACTGGAGGCGC-3' and
OK231 5'-ACTCGAGATGGCCAAATCGGTTCCAAAACATC-3' for the internal
portion, and
OK233 5'-ACTCGAGATGGCTGTGATAGACATTAATCAACCGC-3' and OK232 for
the C-terminal portion.
Arabidopsis plants are transformed with Agrobacterium strain
C58 containing above constructs by a standard Arabidopsis
transformation protocol (Clough and Bent, 1998, Plant Journal
16, 735-743).
CA 02337861 2001-O1-16
- WO 00/08160 PCT/GB99/02590
92
REFERENCES
Anderson et al. (1997). The Plant Cell 9, 641-651.
Bennett, M. D., and Smith, J. B. (1991). Nuclear DNA amounts
in angiosperms. In Philosophical Transactions of the Royal
Society Of London B Biological Sciences (London: Royal
Society), pp. 309-345.
Bent et a1. (1994). Science 265, 1856-1860.
Bevan M. Nucleic Acids Research, 1984, Vol. 12, No.22,
pp.8711-8721
Bickmore, W. A., and Bird, A. P. (1992). Methods In
Enzymology 216, 224-244.
Brown, J. W. S. (1996). The Plant Journal 10, 771-780.
Bryngelsson T. et al., Molecular Plant-Microbe Interactions,
1994, Vol.7, No.2, pp.267- 275
Buschges et a1. (1997). Cell 88, 695-705.
Cai et a1. (1997). Science 275, 832-834.
Cao et al. (1998). Proc. Natl. Acad. Sci. USA 95, 6531-6536.
Carle et a1. (1985) Proc. Natl. Acad. Sci. USA 82, 3756-3760.
Century et al. (1995). Proceedings of the National Academy of
Sciences, USA 92, 6597-6601.
Century et al. (1997). Science 278, 1963-1965.
Devereux et a1. (1984). Nucleic Acids Res. 12, 387-395.
Dixon, R. A., and Lamb, C. J. (1990). Annual Review Of Plant
Physiology and Plant Molecular Biology 41, 339-367.
Flor, H. H. (1971). Annual Review of Phytopathology 9, 275-
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
s
93
296.
Freialdenhoven et al. (1994). The Plant Cell 6, 983-994.
Giovannoni et al. (1991). Nucleic Acids Res 19, 6553-6558.
Goodall, G.J., and Filipowicz, W. (1991). EMBO Journal 10,
2635-2644.
Graner et a1. (1991). Theor Appl Genet 83, 250-256.
Grant et a1. (1995). Science 269, 843-846.
Hammond-Kosack et al. (1994). The Plant Cell 6, 361-374.
Hammond-Kosack, K. E., and Jones, J. D. G. (1996). Plant Cell
8, 1773-1791.
Islam, A. K. M. R. (1983). Ditelosomic Additions Of Barley
Chromosomes To Wheat. In Proc. 6th International Wheat
Genetics, Kyoto, Japan, pp. 233-238.
Jones et al. (1994). Science 266, 789-793,
J~rgensen, J. H. (1996). Genome 39, 492-498.
JOrgensen, J. H. (1988). Genome 30, 129-132.
Klein T.M. et al. (1988). Proc. Natl. Acad. Sci. USA 85,
4305-4309
Kolster et al. (1986). Crop Science 26, 903-907.
K0lster, P., and Stslen, O. (1987). Plant Breeding 98, 79-82.
Krawczak et al. (1992). Human Genetic 90, 41-54.
Kurata et al. (1994). Nature Genetics 8, 365-372.
Lahaye et al. (1996). BioTechniques 21, 1067-1072.
Larsen et al. (1992). Genetic Analysis Techniques and
Applications 9, 80-85.
Lawrence et al. (1995). The Plant Cell 7, 1195-1206.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
94
Martin et al. (1993). Science 262, 1432-1436.
Maurel, C. (1997). Annual Reviews of Plant Physiology and
Plant Molecular Biology 48, 399-429.
Michelmore et a1. (1991). Proceedings of the National Academy
of Sciences, USA 88, 9828-9832.
Mindrinos et a1. (1994). Cell 78, 1089-1099.
Ori et al. (1997). The Plant Cell 9, 521-532.
Parker et al. (1996). The Plant Cell 8, 2033-2046.
Peterhansel et a1. (1997). Plant Cell 9, 1397-1409.
Quarrie et al. (1997). Plant Mol Biol 35, 155-165.
Reiss E. & Bryngelsson T. Physiological and Molecular Plant
Pathology, 1996, Vo1.49, No. S, pp.331-341.
Rose et a1. (1990) Methods in Yeast Genetics. Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York, USA.
Russel et al. (1997). Theoretical and Applied Genetics 95,
714-722.
Salmeron et a1. (1994). The Plant Cell 6, 511-520.
SanMiguel et a1. (1996). Science 274, 765-768.
Shepherd, K. W., and Islam, A. K. M. R. {1981). Wheat: Barley
Hybrids - The First Eighty Years. In Wheat science - today
and tomorrow, L. T. Evans and W. J. Peacock, eds. (Cambridge:
Cambridge University Press), pp. 107-128.
Silverman et a1. (1989). Proc. Natl. Acad. Sci. USA 86, 7485-
7489.
Simons et a1. (1997). Genornics 44, 61-70.
Song et a1. (1995). Science 270, 1804-1806.
CA 02337861 2001-O1-16
_ WO 00/08160 PCT/GB99/02590
Suoniemi et al. (1996). Plant Molecular Biology 30, 1321-
1329.
Torp, J., and Jmrgensen, J. H. (1986). Canadian Journal of
Genetics and Cytololgy 28, 725-731.
5 Vain, P. et al., (1993). Plant Cell Tissue and Organ Culture
33,237-246.
Vos et al. (1995). Nucleic Acids Research 23, 4407-4414.
Yoshimura et al. (1998). Proceedings of the National Academy
of Sciences, USA 95, 1663-1668.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
96
Table 1 Size of PFGE-separated restriction
fragments (in kb) detected by Southern
analysis in cultivar Sultan-S
probe
MWG876 MWG87 MWG892
CIaI 350 50 110
MIuI 550 S50 260
NotI 90 530 170
SaII 90 240 310
SfiI 120 100 140
Sgfl 580 165 ND
Smal 90 100 80
ND, not determined
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
97
Table 2 YAC overlap analysis
YACend specific markers
Y18 Y18 Y30 Y30 Y31 Y31 Y73 Y73 Y113 Y113
barley L R L R L R L R L R
YACs
Y1 - _ _ _ + _ _ _ _ _
Y2 - _ _ _ + _ _ _ _
Y18 + + - + + _ _ _ _
Y30 - + + + + - + _ _ _
Y31 - + + _ + + + - - _
Y73 - + _ _ + _ + + _ _
Y113 - - - - + - - - + +
Aplus sign (+) indicates that a YAC was positive by PCR analysis for the
respective marker
listed above. Absence of a marker is indicated by a minus sign (-).
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
s
98
Table 3 PCR-based YAC end specific markers
Marker Primer PCR
conditions
Y18L 5'-TCCCTCGTTCTATGGTCACGGTTG 94C,
lOs
5'-CATGCCCAGCCTGATGCATTG 60C,
20s
72C,
90s
Y18R 5'-GAATGATGTGCCCGTGCGTGC 94C,
lOs
5'-GCGACGCTTCCCACCTGCAG 60C,
20s
72C,
40s
Y30L 5'-CGATAGGTGGTAGATl'ITI'GACATCTTCAG 94C,
lOs
5'-GCTCATCCAGCTACAGAATGCTTTATG 60C,
20s
?2C,
40s
Y30R 5'-GGTGAGCTGCAGGAAACGGTCC 94C,
lOs
5'-AGGCCAGAGTACTCCGATCGAATGG 60C,
20s
72C,
30s
Y31L 5'-CGCCTTCTTGATCTAGCAAGAGACACG 94C,
lOs
5'- GCGGAGTACATGGCTGCCTTGG 60C,
20s
72C,
60s
Y31R 5'-TATGCTGACTACTGCACTCCTGATGAGG 94C,
lOs
5'-GAGGCTGTGAGGACTGTGGTGCTG 60C,
20s
72C,
60s
Y73L 5'-TGGTATCAGAGCAGTACCGACCTGG 94C,
lOs
5'-GAGATAACTTCAACGCTCCGGATCG 60C,
20s
72C,
90s
Y73R 5'-GCGGCAGTCGCTCGGGCGCACAGG 94C,
lOs
5'-CTCAGGAAATCAGAAAATGTTCACG 60C,
20s
72C,
90s
Y113L5'-CAGCGGCTGGACGTCCGAC 94C,
lOs
5'-GGACGTCCAAGGGCCGGAC 60C,
20s
72C,
30s
YII3R5'-CAGGGGAGATTI'ITTACAATCACG 94C,
lOs
5'-CCATTACCTGGGCTGGCCCAT 58C,
20s
72C,
60s
YAC ends which have been employed for high-resolution genetic mapping are
shown in italics. All PCR reactions start with an initial denaturation step of
2
minutes at 94°C. Subsequently 35 cycles ofthe conditions indicated were
performed.
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
99
Table 4 CAPS marker linked to the Rarl locus
Marker Primer PCR Restriction
conditions enzyme
cMWG694 5'-AGTATCAGATGCTACCATGCCTGG 94C, 10 s HaeIII
5'-CTCTGGAGGAGCCGAGTGTCAGC 60C, 20 s
72C. 30 s
MWG87 5'-ATCAAACCAAGCAAAGGTCCCTTG 94C, 10 s TruI
5'-CTGCAGGCGCACTTTAGGGGAAC 58C, 20 s
72C. 30 s
NfWG503 S'-CGTCAGAGCCCACGCCACACGTAG 94C, 10 s Hin6I
S'-GCCGAACGTGCTCCAAGCGGCAAC 60C, 20 s
72C. 40 s
MWG876 5'-GTGGTCAAGGGCTTGTAGACTGGGTAC 94C, 10 s MvaI
5'-GCCCATCGGTGGTCGCCGTAGTCGCG 60C, 20 s
72C. 30 s
MWG892 5'-GGAATCTTCCAGTGGGCTGGATGAG 94C, 10 s -
5'-CAACCGGCCACTAGGCGTAAAGG 60C, 20 s
72C. 30 s
MWG2123 S'-CTGCGGCGAGAGCTTGAGAGCAGT 94C, 10 s BcII
S'-GTGTGCATGGTCTCTTCCGCCCCG 60C, 20 s
72C. 60 s
OK1114 S'-CCATGTCTTGTCCATGATGCACC 94C, IOs HindIII
S'-GCCATCTAGCTACTAACTATGGACCCG 60C, 30s
72C, 90s
OK3236 S'-GACAGTAGCAGAGTGGTTGCACCG 94C, lOs -
5'-CCACATGCACACAAGTATATGCACAC 62C, 30s
72C, 60s
OK5558 5'-GCGATATGGAGATCAAAACCCTCA 94C, lOs -
5'-CACGAAATGCCTATGAACCATTCG 64C, 30s
72C, 90s
Edda 5'-ACTTTAAACTTGCTGGCGACAAGAGAC 94C, lOs Hinfl
S'-GGAGTTGGCTTACTTACCGTATCACATAC 64C, lOs
72C, 30s
For all CAPS markers after an initial denaturation
step of 2 minutes at 94C, 35 cycles
were performed as indicated. Amplification
products corresponding to the ItFLP locus
MWG892, reveal different lengths in the Rarl
mutants and the Mlal2 BC lines Ingrid,
Pallas and Siri which makes an analytical
digestion after PCR superfluous. RFLP loci
OK
3236 and OK5558 reveal different lengths in
the Rarl mutants and the Mlal2 BC lines
Ingrid and Pallas only
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
_ s
100
00
M d' O~ ~O O ~ ~ I~ ~O ~D V~ N ~-r .-~ .-~ '.-~ .--m--~ O ~ M
U ~ N M M M N N N N N ~ ~-~ ~ ~ ~ ~ ~ ~ ~ O N
W W W W W W W W W W W W W W W W W W W W W o0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
O O O O O O O O O O O O O O O O O O O O O O
W ~ '...~ ,-. .-~ ~ .~ N w V' ~D ~D ~-~ ~ N N N N N N M ~-~ N O
v .~ p ~ ~ ~ can M N N N N O oo ~O ~D ~O ~ ~D ~O N O O O
C/~ ~ N ~ ~f' N ~-r ~-, .~ .-r .--m-. .-. ~--i Ov f~ I~ t~ ~ t~ I~ (~ I~ I~ .-
~ V1
cdrn
N
U
d 'b .a~ d
o ,-, ~ .~. ,-..~. .~ ~-~ .-. .-
~d o ~~,d'~ddddddddddd d~
C~, ~--~ M ~", N ~--~ '"' N r., N '"' ~ .-, .-r I
I a' a~ . ~ I a~ I I I I I I I i I I I . ~ I '~ "b
M O .sC W n ~ D\ ~O 'd' u1 M d' V1 t~ O .--~ d' .rr ~O
O ~O -~ ~~ ~y M ~ ~ N N M ~ .-< <n ,--mh ~ .-~ O ~y o0
~. O '~ ~ ' 00 A~ O ~n ~Y o0 O d' O O N O Ov ~ V1 ° a~
td ° ~ ~ ~ ..-~ ~ .-i M m--~ O (~ V'1 N N M ~ M ~ H
~ yr yr
U p, cd N N N U U N N N U N N U ~ N U ~
U ~ U_ U p., U U U U U U' U U U U U U U
,"._, ~.,"~~~CiG'G', .~,G'.C~~'bGa''G: .~r~f~C."O
N~~~NNE~NUNUUUNUU WN.--~UU~O
O O'' b0 .,.~ O" tT CT' D"' CT' C Q' CT' CT' Q'' O' Cf'' O O'' O''
°
p H w
c~dw~ d~~~ dc~~ dc~c~~
o .~ ~ ~ a. ~ ~
f.~~ b GZ. 4~ ~3. A. A. O. C1. C~. Cl. A, Q. G~. ~L ,..~, O. t~.
a, d'' ~ ~ ° a,'' ~ ~' ~,'' a,'' d'' ~,'' ~' ~,'' d'' d~ ~' ~' a, ~,''
d'' ~
.° ~,z~ ~ ~z zzzzzzzzzzz ~,zz
c~. ~ A ~s '~ ~ A ~ A A A A A A A A A A A ~ A A U
U ~ ~ ~ U U U U U U U U U U U U ~ U U '~
U U U U U U U U N U O N U N N N U O N
V ~ ~ ~U U ~ ~U U U U U U U U U U U U U ~ ,U U H
A N P~ p: ~', N t~ c~ ~ P~, ~ f~..~ ~ f~ P~ c~, f~ P~ i~ N ~ t~ Pa
v~
M
oO p vD O O d' ~ 1~ 00 0 00 ~1 N O Wit' N ~ ~ twp vl
.", tad'y~~Ot~~Md'O~'"~O~~hMO~.-r.~ONI~O~Y1~
U v»!1 t~ O N M O V1 .-~ .-~ 00 O t~ d' Ov N ~-~ O tt' Vl ~ M
p V O M p O O O ~!1 N ""'~ Ov O M O ~-~ O V1 N ~-~ O ~ Op (w
N oo ~f' N t~ d' M V N d~ d' d' N d' ~t' ~' N M
.o c~ ~ ~A~~C~AAvAAAAAAAAAA~Ava
o ,°~ °o
0
W v ° o °o
a
r~ ~ A
CA 02337861 2001-O1-16
WO 00/08160 PCT/GB99/02590
c
101
Table G Primers used for amplifying genomic and cDNA of Rarl
Primer Sequence
OK94 5'-GTGCGCCTGCAGTTACTTGTAGC
OK96 S'-TCTTATGCTGCTGCACTTGTGGG
OK97 5'-GTATGTTGACAAGTGATCCTCCACTG
OK98 5'-GCCTCCTCTCATTCTAGACCACAGTG
OK99 5'-CTCAGAGCTCACCCAAGCAGCAG
OK100 S'-CTGCAGGACCTGGATGGTAATCG
OK101 S'-CATAGGCTGCGACGCCATG
OK102 5'-CTGGTTTCTCAGTTGTATGCTTCCC
OK103 S'-GGTAGTGGCAGGAGCATCGG
OK104 5'-GCTTGCAACAGCTCCACTCTTTC
OK105 5'-GGAGAAGGATAACCATGATGCTGC
OK106 S'-GGGAAGGATACAACTGAGAAACCAG
OK109 S'-GACTCAGCAGCTGTCCCGATTC
OK110 S'-CAACCCCGATGGCTCCTGCCACTACCAC
OK1I1 S'-GCAGGACCTGGATGGTAATCGCATGCAGC
OK112 5'-CCTGCATTAAGATCACGGCACTC
CA 02337861 2001-O1-16
WO 00108160 PCT/GB99/02590
r
102
Table 7 Gene Bank Acessions with similarity to barley Rarl
Gene GeneBank by Organism tblastn 2.0
designationaccession
no.
AtRarl-hlAB010074 Arabidopsis thaliana324
OsRarl-hlc28356 424 Oryza sativa 158
BrRarl-hlL37995 367 Brassica rapes 92
AA134808 452 Homo sapiens 77
W92190 435 Homo Sapiens 59
AA249751 291 Homo Sapiens 71
AA216041 352 Homo sapiens 70
AA313760 416 Homo Sapiens 42
AA346843 399 Homo Sapiens 69
AA382946 314 Homo sapiens 85
AA31I950 431 Homo Sapiens 84
AA385686 347 Homo Sapiens 82
AA313823 520 Homo Sapiens 79
W20519 460 Homo Sapiens 77
AA581174 385 Homo Sapiens 75
AA333125 276 Homo Sapiens 71
AA355517 240 Homo Sapiens 61
AA333321 251 Homo Sapiens 45
AA249829 370 Homo Sapiens 75
AA249107 205 Homo Sapiens 61
AA222387 430 Mus musculus 74
AAl 17998466 Mus musculus 58
AA049028 473 Mus musculus 85
W83076 463 Mus musculus 85
AA268197 506 Mus musculus 83
AA896237 430 Mus musculus 78
AA409037 328 Mus musculus 78
AA959286 374 Mus musculus 80
AA050833 373 Mus musculus 80
W12728 439 Mus musculus 80
AA571713 349 Mus musculus 78
W70829 418 Mus musculus 78
AA052424 449 Mus musculus 77
AA240093 479 Mus musculus 77
AA171338 274 Mus musculus 77
W83689 454 Mus musculus 77
W10223 277 Mus musculus 73
W41418 336 Mus musculus 48
W98189 500 Mus musculus 80
BmRarl-hlAA509002 307 Brugia malayi 79
DmRarl-hlAA141981 566 Drosophila melanogaster75
TgRarl-hlN81452 430 Toxoplasmagonti 74
TbRarl-hlW06674 330 Trypanosomes bruei 68
EnRarl-hlAA965935 339 Emericella nidulans47
CeRarl-hlY110A7.90 Caenorhabditis elegans190
