COMPOSITIONS AND METHODS FOR IDENTIFYING MAMMALIAN MALONYL COA DECARBOXYLASE INHIBITORS, AGONISTS AND ANTAGONISTS

COMPOSITIONS ET PROCEDES SERVANT A IDENTIFIER DES INHIBITEURS, AGONISTES ET ANTAGONISTES DE MALONYLE COA DECARBOXYLASE MAMMIFERE

English Abstract

The present invention relates to the area of fatty acid oxidation, generally
to compositions and methods of identifying and testing fatty acid oxidation
inhibitors, and in particular, compositions comprising a novel cardiac isoform
of MCD, identified to be a key regulator of fatty acid oxidation in the heart.
Additionally, nucleotide acid sequences of malonyl CoA decarboxylase genes
from the rat pancreas, heart and liver are described. Such sequences and
derived products are useful in screening methods for identifying and testing
agonists and antagonists of the MCD pathway.

French Abstract

L'invention concerne le domaine de l'oxydation des acides gras, des compositions et des procédés servant à identifier et à tester des inhibiteurs d'oxydation d'acides gras et, en particulier, des compositions contenant une nouvelle isoforme cardiaque de MCD, identifiée en tant que régulateur clé de l'oxydation des acides gras dans le coeur. Elle concerne, de plus, des séquences acides de nucléotides de gènes de malonyle CoA décarboxylase provenant du pancréas, du coeur et du foie du rat. Ces séquences et les produits dérivés sont utiles dans des procédés de criblage servant à identifier et à tester des agonistes et des antagonistes du trajet de MCD.

Claims

CLAIMS
1. A method for screening a compound that is an agonist or an
antagonist of malonyl CoA decarboxylase activity, comprising:
a) providing: i) a purified preparation comprising malonyl CoA
decarboxylase, ii) a substrate, and iii) a test compound;
b) mixing said malonyl CoA decarboxylase and said substrate under
conditions such that said malonyl CoA decarboxylase can act on said substrate
to
produce a product, wherein said mixing is done in the presence and absence of
said
test compound; and
c) measuring directly or indirectly the amount of said product
produced in the presence and absence of said test compound.
2. The method of Claim 1, wherein said substrate is malonyl CoA.
3. The method of Claim 1, wherein said preparation is purified from heart
tissue.
4. The method of Claim 1, wherein said product comprises acetyl CoA.
5. The method of Claim 4, wherein said acetyl CoA is measured directly.
6. The method of Claim 4, wherein said acetyl CoA is measured indirectly
by detecting the amount of an indicator.
7. The method of Claim 6, wherein said indicator comprises citrate.
8. The method of Claim 7, wherein said citrate is labelled.
9. The method of Claim 8, wherein said citrate is radiolabelled.
-58-

10. The method of Claim 9, wherein said radiolabelled citrate is [14C]citrate
11. A method for screening a compound that is an agonist or an
antagonist of malonyl CoA decarboxylase activity, comprising:
a) providing: i) a malonyl CoA decarboxylase homologue, ii) a
substrate, and iii) a test compound;
b) mixing said malonyl CoA decarboxylase homologue and said
substrate under conditions such that said malonyl CoA decarboxylase homologue
can act on said substrate to product a product, wherein said mixing is done in
the
presence and absence of said test compound; and
c) measuring directly or indirectly the amount of said product
produced in the presence and absence of said test compound.
12. The method of Claim 11, wherein said substrate is malonyl CoA.
13. The method of Claim 11, wherein said homologue differs from malonyl
CoA decarboxylase purified from heart tissue by an amino acid substitution.
14. The method of Claim 11, wherein said product comprises acetyl CoA.
15. The method of Claim 14, wherein said acetyl CoA is measured directly
16. The method of Claim 14, wherein said acetyl CoA is measured indirectly
by detecting the amount of an indicator.
17. The method of Claim 16, wherein said indicator comprises citrate.
18. The method of Claim 17, wherein said citrate is labelled.
19. The method of Claim 18, wherein said citrate is radiolabelled.
-59-

20. The method of Claim 19, wherein said radiolabelled citrate is [14C]
citrate.
21. A composition comprising isolated and purified DNA having an
oligonucleotide sequence selected from the group consisting of:
a) Heart MCD having the nucleotide sequence of SEQ ID NO:1;
b) Liver MCD having the nucleotide sequence of SEQ ID NO:2;
c) Pancreas MCD having the nucleotide sequence of SEQ ID NO.3;
22. RNA transcribed from the DNA of Claim 21.
23. Protein translated from the RNA of Claim 22.
24. An antibody to a malonyl CoA decarboxylase of Claim 23 said
malonyl CoA decarboxylase having a molecular weight of approximately 52 kDa.
25. Expression constructs comprising DNA of Claim 21.
-60-~

Description

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
COMPOSITIONS AND METHODS FOR IDElIf'TI~YING
MArVJ~VIALIAN MALONYL COA DECARBOXYLASE
LhIHIBTTORS, AGONISTS AND ANTAGONISTS
FIELD OF THE INVENTION
The present invention relates to the area of fatty acid oxidation, generally
to
compositions and methods of identifying and testing fatty acid oxidation
inhibitors, and in
particular; compositions comprising a novel cardiac isoform of Malonyl CoA
decarboxylase
(MCD), identified to ibe a key regulator of fatty acid oxidation in the heart.
Additionally, this
invention relates to compositions comprising the mammalian cDNA sequence of
Malonyl
CoA decarboxylase firom rat pancreatic islet, heart and liver cells as well as
the use of these
sequences and derivatives for use in identifying and testing fatty acid
oxidation agonists and
antagonists.
BACKGROUND OF INVENTION
Most of the energy production in the heart, liver and other organs is known to
be
derived from the oxidation of fatty acids [Bing et al. Am JMed 15:284-296,
(1953)]. The
other important sources of energy are the oxidation of carbohydrates, and to a
lesser extent
ATP production from glycolysis. The contribution of these pathways to overall
ATP
production can vary dramatically, depending to a large extent on the carbon
substrate profile
delivered to the heart or other organ, as well as the presence or absence of
underlying
pathology within the target organ. Despite extensive research devoted to the
study of the
individual pathways of energy substrate metabolism, relatively few studies
have been
conducted examining the integrated regulation between carbohydrate and fatty
acid oxidation
in, for example, the heart.
While the mechanisms by which fatty acids inhibit carbohydrate oxidation
(i.e., the
Randle cycle} have been characterized, much less is known about how
carbohydrates regulate
fatty acid oxidation in the heart. It is clear that an increase in infra-
mitochondrial acetyl CoA
derived from carbohydrate oxidation (via the pyruvate dehydrogenase complex}
can down
regulate ~i-oxidation of fatty acids, but it is not clear how fatty acid acyl
group entry into the
-1-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
mitochondria is down-regulated when carbohydrate axidation increases.
An important )protein known to be involved in the regulation of fatty acid
oxidation in
the heart, liver and pancreas is carnitine palmitoyltransferase 1 (CPT 1 }.
This protein is
located within the outer mitochondria) membrane and is a key regulatory enzyme
involved in
the first committed step of fatty acid oxidation [McGarry and Foster, Aran.
Rev Biochem.
49:395-420 (1980); McGrarry et al., Diabetes 5:271-284 (1989)). Malonyl-CoA,
which is
produced by acetyl-CoA carboxylase (ACC), is a potent inhibitor of CPT1
[McC'rarry and
Foster, Ann. Rev ,8iochem. 49:395-420 (1980); McGarry et al.; J. Biol. Chem.
253:4128-4136 (1978)]. Unlike liver, where a 88 kDa isoform of CPT1
predominates, the
heart predominantly Expresses a 82 kDa isoform of CPTI [Esser et al., J. Biol.
Chem.
268:5810-5816 (199?.)] which is much more sensitive (10 to 50 times) to
inhibition by
malonyl CoA [McCarry and Foster, Ann. Rev Biochem. 49:395-420 (1980); McGany
et al.,
J. Biol. Chem. 253:4128-4136 (1978); McGarry et al., Biochem. J. 214:21-28
(1983)].
Also, it has been obseaved that under conditions in which fatty acid oxidation
can vary widely
the ICso of mitochondria) CPTl for malonyl CoA does not change [Kudo et al.,
J. Bial.
Chem. 270:17513-17520 (1995); Lopaschuk et al., J. Biol. Chem. 269:25871-25878
(1994)j. For instance,, in the post-ischemic rat heart, although fatty acid
oxidation rates are
very high, the sensitivity of CPT1 to malonyl CoA inhibition does not change
[Kudo et al., J.
Biol. Chem. 270:17513-17520 (1:995); Lopaschuk et al., J. Biol. Chem.
269:25871-25878
(1994). Rather, the ;actual levels of malonyl CoA drop, resulting in an
increase in CPT1
activity. Therefore, existing evidence suggests that actual changes in maionyl
CoA levels
appear to be the key factor regulating changes in fatty acid oxidation in the
heart, as opposed
to changes in sensitivity of CPT1 to malonyl CoA inhibition. Current studies
[Kudo et al., J.
Biol. Chem. 270:17513-17520 (1995); Lopaschuk et al., J. Biol. Chem. 269:25871-
25878
(1994); Kudo et al., ,8iochim. Bi~ophys. Acta. 1301:67-75 (1996); Kudo et al.,
Circulation
92:1-771 (1996); Awan and Saggerson, Biochem. J. 295:61-66 (1993)] show that
ACC in
the heart functions as a key regulator of fatty acid oxidation, via the
production of malonyl
CoA [Lopaschuk et cxl., Biochem. Biophys. Acta. 1213:263-276 (1994)]. For
example, in
rabbit hearts the activity of ACC decreases between 1-day and 7-day following
birth
[Lopaschuk et al., J. Biol. Chem. 269:25871-25878 (1994)]. This is accompanied
by a
-2-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA991U0734
dramatic decrease in malonyl CoA levels and an increase in fatty acid
oxidation rates
[Lopaschuk et al., J. Biol. Chem. 269:25871-25878 (1994)]. It is one of the
key enzymes in
a feedback loop that decreases acyl CoA transport into the mitochondria when
carbohydrate
oxidation rates are increased. A('C thus plays an important role in regulating
the balance
between carbohydrate and lipid metabolism in the heart. In the post-ischernic
heart, a
decrease in ACC activity is also accompanied by a decrease in malonyl CoA
levels and an
increase in fatty acid oxidation rates [Kudo et al., J. Biol. Chem. 270:17513-
17520 {1995)].
This increase in fatty acid oxidation rates can provide from 90 to 100 % of
the hearts energy
reQuirements. Unfornanately, this occurs at the expense of glucose oxidation,
which is critical
for normal contractile function of the heart.
Earlier reports indicated that low glucose oxidation rates during reperfusion
of
ischemic hearts contrilbutes to contractile failure, and that by inhibiting
fatty acid oxidation,
glucose oxidation would thereby increase and lessen the severity of ischemic
injury. A
number of clinical trials have confirmed these observations and pharmaceutical
agents that
specifically inhibit fatty acid oxidation, such as ranolazine and
trimetazidine, are presently
being licensed for clinical use. Hence, in pathological situations
characterized by abnormal
fatty acid metabolism, enzymes regulating fatty acid or glucose oxidation
could potentially be
targeted for drug development. Also, fluorooxirane carboxylate as hypoglycemic
agents have
been used as fatty acid oxidation iinhibitors. These fatty acid oxidation
inhibitors operate by
inhibiting CPT1, preventing the transport of the fatty acids into the
mitochondria (See U.S.
Patent No. 4,788,306 incorporated herein by reference). These compounds have
particular
utility in the treatment of glucose and fatty acid metabolism disorders, such
as diabetes and
appear to have significantly reduced potential for impairment of normal
cardiac function.
Although the liver is thought of as mainly a biosynthetic organ, it also
oxidizes fatty
acids as a source of energy [Goodridge, Fatty acid synthesis in eucaryotes.
In: Biochemistry
of lipids, liposomes and membranes. Ed: Vance and Vance. 111-139 (1991)].
Malonyl CoA
is important in this process, since it inhibits carnitine palmitoyltransferase
1 (CPTl), the rate
limiting enzyme involved in the mitochondria) uptake of fatty acids [McGarry
and Brown,
EurJBiochem 244:1-:l4 (1997); Alum and Saggerson, Biochem J334:233-241 (1998);
Bird
and Saggerson, Biochem 222:639-647 (1984)]. By inhibiting CPT1, mitochondria)
uptake of
-3-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
fatty acids is decreased thereby reducing mitochondrial fatty acid oxidation
[Lopaschuk et al.,
J Biol Chem 269:258'71-25878(1994)]. During times of nutritional deficiency or
diabetes,
decreases in malonyl C'.oA may result in limited synthesis of fatty acids, and
an upregulation of
fatty acid oxidation. 7Che question remains as to how malonyl CoA is degraded
in the liver
S during the times when fatty acid synthase is not active.
Kolattukudy and co-workers [Kolattukudy et al., Methods Enzymol 71:150-153
(1981); Jang et al., ~l Biol Cheap 264:3500-3SOS (1989)] have previously
identified an
enzyme in both avian and mammalian tissues which is involved in the
decarboxylation of
malonyl CoA to acetyl CoA. This enzyme, termed malonyl CoA decarboxylase
(MCD), was
first described as being a mitochondria) enzyme which protected certain
mitochondria)
enzymes such as methylmalonyl CoA mutase and pyruvate carboxylase from
inhibition by
mitochondrial derived malonyl CoA [3ang et al., JBial Chem 264:3500-3SOS
(1989)]. In the
mitochondria, propionyi CoA caxboxylase can, at low efficiency, use acetyl CoA
as a
substrate to produce nnalonyl CoA [fang et al., JBiol Chem 264:3500-3SOS
(1989)]. This,
1 S however, would seem to be only a small fraction of total cellular malonyl
CoA produced.
The major source of malonyl CoA is thought to originate from the conversion of
cytosolic
acetyl CoA by ACC. Recently, it has been suggested that MCD is able to
regulate
cytoplasmic as well as, mitochondrial malonyl CaA levels jAlam and Saggerson,
Biochem J
334:233-241 (1998); lDyck et al., Am JPhysiolo~ 27S:H2122-H2129 (1998)]. Our
work
has shown that an increase or maintained MCD activity in conjunction with a
decrease in
ACC activity is probably responsible for the decrease in malonyl CoA levels
and increased
fatty acid oxidation seen in both the post-natal heart and the reperfirsed
ischemic heart [Dyck
et al., Am J Physiolo;~y 27S:H2122-H2129 (1998)]. Similarly, Alam and
Saggerson have
provided indirect evidlence of a cytosolic MCD activity which can alter
cytosolic malonyl
CoA levels in rat skeletal muscle [Alam and Saggerson, Biochem J 334:233-24I
(1998)].
These studies therefore implicate MCD as a regulator of fatty acid oxidation.
Whether the
observed decreases in cytosolic malonyl CoA levels is due to a cytoplasmic
form of MCD or
to some unknown process is not clear.
There is a need for the identification of drugs that modulate MCD pathway
activity
whether in the heart, liver, pancreas or other organ, that do not have any
side-effects. Thus,
-4-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99100734
what is needed are suitable assays to identify targets for pharmacological
intervention that do
not impair cardiac, liver or pancreatic function or confer toxicity as well as
provide cost-
e~ective, high throughput screening of fatty acid oxidation inhibitor
compounds.
S SUMMARY OF THE INVENZTON
The invention generally relates to compositions and methods of identifying and
testing Malonyl CoA decarboxylase (hereinafter "MCD"} inhibitors, and in
particular,
compositions comprising a novel cardiac isoform of the MCD enzyme which is a
key
regulator of fatty acid oxidation. This enzyme is useful for identifying
compounds that will
inhibit the conversion of malonyl CoA to acetyl CoA which is then combined
with 14G-
labeled oxaloacetate to produce "~C-labeled citrate. Additionally, the
invention relates to the
isolation and determination of DNA sequences of the rat heart, liver and
pancreatic genes
encoding MCD.
It is not intended that the present invention be limited to particular MCD
proteins. A
I S variety of closely related vertebrate homologues of MCD are contemplated
that are involved
in the regulation of fatty acid oxidation in various species.
In one embodiment, the MCD enzyme is not the full-length native polypeptide.
Rather, it is a portion of the full-lfength native enzyme. Preferably, this
portion or fragment
contains the active binding site. For example, but not by way of limitation,
the present
invention contempiatea complexes of substrate and MCD enzyme wherein the MCD
is
partially purified. In ;yet another embodiment, the MCD have polypeptides that
is mutated
from the wild-type sequence.
Sinularly, the present invention is not limited to the native sequence of MCD.
Even
where portions or fiwgments are employed, these portions or fragments may have
altered
amino acid sequences. Thus, fhe present invention also contemplates substrate-
enzyme
complexes comprising; MCD or its analogues.
The present invention also contemplates compound screening using a variety of
assay
formats. In one embodiment, the present invention contemplates a method for
compound
screening, comprising;: a) providing: i) a purified preparation comprising
malonyl CoA
decarboxylase, ii) a substrate, and iii) a test compound; b) mixing said
malonyl CoA
-5-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
decarboxylase and said substrate under conditions such that said malonyl CoA
decarboxylase
can act on said substrate to produce product, wherein said mixing is done in
the presence and
absence of said test compound; and c) measuring directly or indirectly the
amount of said
product produced in the presence and absence of said test compound.
Additionally, the present invention generally relates to compositions and
methods of
identifying and testing malonyl CoA decarboxylase pathway agonists and
antagonists.
Furthermore, the invention relates to methods to identify normal or mutant
homologues of
MCD which may be native to other tissue or cell types. The present invention
also relates to
methods of identifying tissues th~.t may harbor homologous or mutant MCD
genes. The
present invention also relates to methods to generate reagents derived from
the invention.
The present invention contemplates as compositions the wild-type rat MCD gene
from heart (SEQ 1D 1'J0:1); liver (SEQ ID N0:2) or pancreas (SEQ ID N0:3). The
present
invention also contemplates employing such sequences in screening methods. In
one
embodiment, the pre;>ent invention contemplates utilizing such genes in the
screening of
compounds that are al;onistic or antagonistic to MCD. In one preferred
embodiment cells are
transfected with constructs containing either sense or anti-sense MCD DNA, or
portions
thereof. Such DNA may readily be inserted into expression constructs and the
present
invention contemplates such constructs as well as their use. Compounds
suspected of being
either agonistic or antagonistic to MCD activity are then added and MCD
activity is
measured by methods known to those in the field. The present invention also
contemplates
RNA transcribed from the above-indicated cDNAs as well as protein (typically
purified
protein) translated from this RNA. Moreover, the present invention
contemplates antibodies
produced from immunizing with this translated protein.
The present invention also contemplates transgenic animals comprising the
above-
indicated DNA (i.e., the "transgene") or portions thereof. In a particular
embodiment, the
transgenic animal of the present invention may be generated with the transgene
contained in
an inducible, tissue specific promotor.
The present invention also contemplates using the above-named compositions in
screening assays. The; present invention is not limited by the particular
method of screening.
In one embodiment mammalian cells may be used. The present invention is not
limited to the
-6-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
nature of the transfection construct. The transfection constructs utilized
will be the optimal
constructs available for the cell line chosen at the time of setting up the
assay. In one
embodiment, the present invention contemplates screening suspected compounds
in a system
utilizing transfected cell lines. In'one embodiment, the cells may be
transfected transiently. In
another embodiment, i:he cells may be stably transfected. Constructs used to
transfect cells
stably may or may not utilize an inducible promoter. In yet another embodiment
translation
products of the invention may be used in a cell-free assay system. In yet
another
embodiment, antibodies generated to the translation products of the invention
may be used in
immunoprecipitation assays.
The present invention may also be used to screen for tumors which manifest
mutations in genes similar to the cDNA encoding MCD. In one embodiment cDNA
encoding MCD may be used in microchip assays. The present invention
contemplates a
method of screening for .tumors, said method comprising: a) providing in any
order: i)
microassay microchips wherein said microchip comprises cDNA encoding at least
a portion
of the oligonucleotide sequence of SEQ 1T3 NOS:1,2 or 3, ii) DNA from at least
one tissue
sample suspected of having mutations in genes similar to SEQ 117 NOS:1, 2 or
3; b)
contacting said microassay microchips with said DNA; and c) detecting
hybridization of said
cDNA with said tissue: sample DNA. Isolated DNA would then be sequenced to
assay for
genetic mutations.
The gene sequences of the present invention may also be used to screen for
homologous. In, one embodiment cDNA encoding MCD may be used in microchip
assays.
The present invention contemplates a method of screening for homologues, said
method
comprising: a) providing in any order: i) microassay microchips wherein said
microchip
comprises cDNA encoding at least a portion of the oligonucleotide sequence of
SEQ ID
NOS:1, 2 or 3, ii) DNA from at least one tissue sample suspected of having a
sequence in
genes that is similar to SEQ ffa NOS:1, 2 or 3; b) contacting said microassay
microchips with
said DNA; and c) detecting hybridization of said cDNA with sample said tissue
DNA.
Isolated DNA would then be sequenced to assay for genetic mutations.
The present invention may also be used to identify novel or mutant
constituents of the
MCD pathway. In one embodiment, antibodies generated to translation products
of the

CA 02339088 2001-02-08
WO 00109710 PCT/CA99/00734
invention may be used in immunoprecipitation experiments to isolate novel MCD
pathway
constituents or natural mutations thereof. In another embodiment, the
invention may be used
to generate fusion proteins that could also be used to isolate novel MCD
pathway
constituents or natural mutations thereof. In yet another embadiment, screens
may be
conducted using the yeast two-hybrid system. The present invention also
contemplates
screening for homologues using standard molecular procedures. In one
embodiment screens
are conducted using Northern and Southern blotting.
The present invention contemplates a method of screening a compound, said
method
comprising: a) providing in any order: i) a first group of cells comprising a
recombinant
expression vector, wherein said vector comprises at least a portion of the
oligonucleotide
sequence of SEQ ID NOS:l, 2 or 3, ii) a second group of cells comprising a
recombinant
expression vector, wherein said vector comprises the plasmid used above
without any portion
of the oligonucleotide from SEQ ID NOS: I, 2, or 3, and iii) at least one
compound suspected
of having the ability to modulate :MCD pathway activity; b) contacting said
first and second
groups of cells with :>aid compound; and c) detecting inhibition or
enhancement of MCD
activity of said compound.
The present invention also contemplates a method of screening for homologues,
said
method comprising: a) providing in any order: i) first nucleic acid comprising
at least a
portion of the sequence of SEQ ID NOS: l, 2 or 3, and ii) DNA libraries from
cells or tissues
suspected to comprise said homologue; and b) hybridizing said nucleic acid
with said DNA of
said library under conditions such that said DNA suspected of coding for said
homologue is
detected.
The present :invention also contemplates a method of screening for interactive
peptides, said method comprising: a) providing in any order: i) a peptide
comprising at least
a portion of the peptide sequence encoded by SEQ m NOS:1, 2 or 3 (including
but not
limited to portions that are part o:f fusion proteins, i.e., proteins that
contain another portion,
such as a portion useful for protein purification) and b) an extract from
source (e.g., cells or
tissues) suspected of having said interactive peptides; and c) mixing said
peptide with said
extract under conditions such that said interactive peptide is detected.
The present invention contemplates another approach for screening for
interactive
_g_

CA 02339088 2001-02-08
WO 00109710 PCT/CA99/00734
peptides, said method comprising: a) providing in any order: i} antibodies
reactive with (and
usually specific for) at: least a portion of a peptide encoded by SEQ ll7
NOS:1, 2 or 3, and ii}
an extract from a source (e.g., cells or tissues) suspected of having said
interactive peptide(s);
and b) mixing said antibody with said extract under conditions such that said
interactive
peptide is detected.
DESCRIPTION OF THE DRAWINGS
FIGURE 1 shows the biochemical characterization of the rat liver malonyl CoA
decarboxylase (MCD}. {A) is a representative photograph showing the immunoblot
analysis
of rat Iiver MCD (non-denat<xning polyacrylamide gel electrophoresis: lane 1)
and
SDS-polyacrylamide gel electrophoresis: lane 2} with anti MCD antibody and
irrelevant
anti-catalase antibody: lane 3). (I3) is a representative photograph of an
immunoblot analysis
using the anti MCD antibody, and compares MCD from rat liver (lane 1) and rat
heart (lane
2}.
FIGURE 2 graphically depicts Malonyl CoA decarboxylase activity in 1-day and
7-day old rabbit hearts. Values are the mean t S.E. of 8 hearts for both ages
of rabbits.
FIGURE 3 graphically depicts Malonyl CoA decarboxylase activity in aerobic,
ischemic and reperfused ischemic rat hearts. Values are the mean ~ S.E. of 5-
10 hearts for
all groups.
FIGURE 4 i;; a representative photograph of immunoblot analysis using anti MCD
antibody depicting the ievels of malonyl CoA decarboxylase protein in aerobic,
ischemic and
reperfixsed ischemic rat hearts.
FIGURE 5 is a schematic depicting the role of S'AMP-activated protein kinase,
acetyl
CoA carboxylase and malonyl C:oA decarboxylase in the control of fatty acid
oxidation it
newborn (A) and reperfused ischemic hearts (B}. (A) depicts both AMPK and MCD
are
activated during the newborn period. (B) shows ischemia activates AMPK while
MCI;
activity is maintained.
FIGURE 6 shows the DNA sequence encoding rat heart malonyl CoA
decarboxylase, (SEQ ID NO:1).
FIGURE 7 shows the chromatographic purification of rat liver malonyl CoA
-9-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
decarboxylase. 1VT~.tochondrial protein precipitated between 40 and 55 % of
(NHa)aSOa was
loaded onto a Butyl ~iepharose 650 M column and eluted with a gradient of 1 to
0 M of
(NHa)aSOa. (A) shows the fractions containing MCD activity were pooled and
loaded onto a
Phenyl Sepharose HP column arid proteins were eluted with the same gradient as
above. (B}
shows chromatography on a Q Sepharose HP column. (C) shows chromatography on a
SP
Sepharose HP column. (D} 7B and 7C were performed with the bound proteins
being eluted
with a gradient of 0 to 0.3 M and 0 to 0.4 M NaCI, respectively. MCD activity
is expressed
as change in relative fluorescence units/ minute and has not been standardized
to protein
concentration.
I O FIGURE 8 shows the DNA sequence encoding rat liver malonyl CoA
decarboxylase,
{SEQ ID N0:2).
FIGURE 9 shows kinetic properties of purified rat liver malonyl CoA
decarboxylase.
9A, the effect of moony) CoA concentration on the activity of purified rat
liver MCD
(expressed as a percent of maximal MCD activity). 9B, The activity of MCD is
effected by
I 5 altering the pH of the assay buffer.
FIGURE 10 shows the characterization of maionyl CoA decarboxylase antibodies.
(A) the polyclonal antibodies directed against rat liver MCD were tested using
protein from a
rat Iiver mitochondria) fraction. The MCD239 antibodies (lane I) recognized
MCD only,
while MCD240 (lane 2) recognized both eatalase and MCD. MCD and catalase are
indicated
20 at the left. (B) immuno-inhibition studies were performed using both the
MCD antibodies.
The MCD antibody or pre-immune serum mixtures was measured for MCD activity
and
expressed as a % of MCD pre-incubated without serum for an identical period of
time (30
minutes}.
Figure 11 shows the tissue distribution and cellular localization of malonyl
CoA
25 decarboxylase. (A) the protein levels of MCD were measured in a variety of
rat tissues using
MCD240 antibody. :150 ,ug of heart (lane I), skeletal muscle (lane 2), liver
(lane 3), kidney
(lane 4), lung (lane 5), pancreas (lane 6}, brain (lane 7) were boiled in a 2
% SDS gel loading
buffer and subjected to western analysis. (B) a double labeling
immunocytochemical
technique was used to determine cellular localization of MCD in McArdle RH-
7777 rat
30 hepatoma cells. Imal;es from MCD239 antibody (box I} and anti Hsp 60
antibody (box 2)
-10-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
were combined to dei;ermine co-localization (box 3). Similarly, images from
MCD240
antibody (box 4) and A~ito-Tracker Red CMXRos (box 5) were combined to
determine co-
localization (box 6).
FIGURE 12 shows rat liver malonyl CoA decarboxyIase activity and protein
levels in
control and 6 week old streptozotocin rats. MCD activity {A) and MCD protein
quantification (B) was performed on rat livers from 6 week old control rats
and 6 week old
streptozotocin treated rats. MCD protein is located in the bottom panel of
each group and
catalase protein levels are included as loading and transfer controls in the
top panels. The
Western blots underv~ent densitometry analysis and the levels of MCD protein
were
quantified (C).
FIGURE 13 shows rat liver malonyl CoA decarboxylase activity and protein
levels in
control and JCR:LA-corpulent rats. MCD activity {A) and MGD protein
quantification (B)
was performed on rat livers from JCR:LA-corpulent lean controls and Cp/Cp
rats. MCD
protein is located in the; bottom panel of each group and catalase protein
levels are included as
loading and transfer controls in the top panels. The Western blots underwent
densitometry
analysis and the levels of MCD protein were quantified (C).
FIGURE 14 shows rat liver malonyl CoA decarboxylase activity and protein
levels in
control fasted; and ref~ed rats. MCD activity (A) and MCD protein
quantification (B) was
performed on rat livers from control, fasted and refed rats. MCD protein is
located in the
bottom panel of each group and catalase protein levels are included as loading
and transfer
controls in the top panels. The Western blots underwent densitometry analysis
and the levels
of MCD protein were quantified ((:).
FIGURE 15 shows the DNA sequence encoding rat pancreatic malonyl CoA
decarboxylase, {SEQ ID N0:3).
FIGURE 16 shows Northern blot and RT-PCR analysis of MCD mRNA in various
tissues. (A) shows Northern blot analysis of rat tissues with a rat MCD probe
and an 18S
ribosomal RNA cDNA fragment used as a control for RNA loading on the gel. (B)
shows
ethidium bromide stained agarose gels of RT-PCR experiments earned out with
MCD (top)
and ~i-actin (bottom) primers using total RNA isolated from various rat
tissues and sorted
pancreatic islet cells.
_11.

CA 02339088 2001-02-08
WO 00109710 PCTICA99/00734
DEFINITIONS
To facilitate understanding of the invention, a number of terms are defined
below.
The abbreviations used ~ herein are: MCD, Malonyl CoA decarboxylase; ATP,
Adenosine Triphospha~te; FA, Fatty Acid; FAS Fatty Acid Synthase; ACC, acetyl-
CoA
carboxylase; carnitine palmitoyltransferase 1, CPTl
The term "indicator" used herein refers not to the product, but indirectly
indicates the
presence of a product and more preferably the level of product. For e.g., in
one embodiment,
the "indicator" is citrate.
The term "label" as used herein refers to any atom or molecule which can be
used to
provide a detectable preferably quantifiable) signal, and which can be
attached to a nucleic
acid or protein. Labels may provide signals detectable by fluorescence,
radioactivity,
calorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic
activity, and
the like.
The term "substrate" as used herein, refers to molecules on which an enzyme
acts.
For e.g., in one embodiment, the substrate is Malonyl CoA.
The term "homologue" used herein encompasses molecules which difFer from the
parent molecule ar reference molecule in structure but have similar function.
Fox example, a
homologue to an enzyme has the same general enzymatic activity (although the
specificity
and level of activity may be different) but differ in structure (For e.g.,
amino acid
modifications or substitutions). I-fomologues can be generated by a variety of
techniques,
such as by using primers in a PCT reaction, that introduce new bases in the
DNA sequence,
thus resulting in amino acid substitutions. Such primers can be designed to
hybridize with the
cardiac isoform of MCD by ternunal amino acid sequencing of the protein
purified in the
manner set forth herein. Alternatively, primers complementary to the non-human
forms ofthe
enzyme (For e.g., goose MCD [GenBank accession number is J04~182] can be
employed.
The term "gene" refers to a DNA sequence that comprises control and coding
sequences necessary for the production of a polypeptide or its precursor. The
palypeptide
can be encoded by a full length coding sequence or by any portion of the
coding sequence.
The term °'nu<;leic acid sequence of interest" refers to any nucleic
acid sequence the
- 12-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
manipulation of which may be deemed desirable for any reason by one of
ordinary skill in the
art.
The term "wild.-type" when made in reference to a gene refers to a gene which
has the
characteristics of a gene isolated Gam a naturally occurnng source. The term
"wild-type"
when made in reference to a gene product refers to a gene product which has
the
characteristics of a gene product isolated from a naturally occurring source.
A wild-type
gene is that which is most frequently observed in a population and is thus
arbitrarily
designated the "normal" or "wild-type" fon!n of the gene. In contrast, the
term "modified" or
"mutant" when made in reference; to a gene or to a gene product refers,
respectively, to a
gene or to a gene product which displays modifications in sequence and or
functional
properties (i.e., altere;d characteristics) when compared to the wild-type
gene or gene
product. It is noted that naturally-occurring mutants can be isolated; these
are identified by
the fact that they have; altered characteristics when compared to the wild-
type gene or gene
product.
The term "recombinant" when made in reference to a DNA molecule refers to a
DNA
molecule which is comprised of segments of DNA joined together by means of
molecular
biological techniques. The term "recombinant" when made in reference to a
protein or a
polypeptide refers to a protein molecule which is expressed using a
recombinant DNA
molecule.
As used hereir4 the terms °'vector" and "vehicle" are used
interchangeably in reference
to nucleic acid molecules that transfer DNA segments) from one cell to
another.
The term "expression construct", "expression vector" or "expression cassette"
as used
herein refers to a recombinant DNA molecule containing a desired coding
sequence and
appropriate nucleic acid sequences necessary for the expression of the
operably linked coding
sequence in a particular host organism. Nucleic acid sequences necessary for
expression in
prokaryotes usually include a promoter, an operator (optional), and a ribosome
binding site,
often along with other sequences. Eukaryotic cells are known to utilize
promoters, enhancers,
and termination and polyadenylation signals.
The terms "in. operable combination", "in operable order" and "operably
linked" as
used herein refer to the linkage of nucleic acid sequences in such a manner
that a nucleic acid
-13-

CA 02339088 2001-02-08
WO 00109710 PCT/CA99I00734
molecule capable of directing the transcription of a given gene and/or the
synthesis of a
desired protein molecule is produced. The term also refers to the linkage of
amino acid
sequences in such a manner so that a functional protein is produced.
The term "hybridization" 'as used herein refers to any process by which a
strand of
nucleic acid joins with a. complementary strand through base pairing.
As used herein, the terms "complementary" or "complementarity" when used in
reference to polynucleotides refer to polynucleotides which are related by the
base-pairing
rules. For example, for the sequence 5'-AGT-3' is complementary to the
sequence 5'-ACT-3'.
Complementarity may be "partial," in which only some of the nucleic acids'
bases are
matched according to the base pairing rules. Or, there may be
'°complete" or "total"
complementarity between the nucleic acids. The degree of complementarity
between nucleic
acid strands has significant effects on the efficiency and strength of
hybridization between
nucleic acid strands. 7Chis is of particular importance in amplification
reactions, as well as
detection methods which depend upon binding between nucleic acids.
1 f The term "homology" when used in relation to nucleic acids refers to a
degree of
complementarity. There may be partial homology or complete homology (i.e.,
identity). A
partially complementary sequence is one that at least partially inhibits a
completely
complementary sequence from hybridizing to a target nucleic acid is referred
to using the
functional ternn "substantially homologous." The inhibition of hybridization
of the completely
complementary sequence to the target sequence may be examined using a
hybridization assay
(Southern or Northern blot, solution hybridization and the like) under
conditions of low
stringency. A substantially homologous sequence or probe will compete for and
inhibit the
binding (i.e., the hybridization) of a sequence which is completely homologous
to a target
under conditions of low stringency. This is not to say that conditions of low
stringency are
such that non-specific binding is permitted; low stringency conditions require
that the binding
of two sequences to one another be a specific (i.e., selective) interaction.
The absence of
non-specific binding miay be tested by the use of a second target which lacks
even a partial
degree of complementarity {e.g., less than about 30 % identity); in the
absence of non-specific
binding the probe will not hybridize to the second non-complementary target.
3 0 Low stringency conditions when used in reference to nucleic acid
hybridization
- 14-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
comprise conditions equivalent to binding or hybridization at 42 ° C in
a solution consisting of
SX SSPE (43.8 gll NaCI, 6.9 gll NaH2POapHaO and 1.85 g/1 EDTA, pH adjusted to
7.4 with
NaOH), 0.1 % SDS, SX Denhardt's reagent [SOX Denhardt's contains per 500 ml: 5
g Ficoll
(Type 400, Pharmacia), S g BSA (Fraction V; Sigma)] and 100 pg/ml denatured
salmon
sperm DNA followed by washing in a solution comprising SX SSPE, 0.1 % SDS at
42°C
when a probe of about 500 nucleotides in length is employed.
High stringency conditions when used in reference to nucleic acid
hybridization
comprise conditions equivalent to binding or hybridization at 42°C in a
solution consisting of
SX SSPE (43.8 g/1 NaCI, 6.9 g/1 NaHa~'Oa~HaO and 1.85 g/1 EDTA, pH adjusted to
7.4 with
NaOH), O.5 % SDS, SX Denhardt's reagent and 100 pg/ml denatured salmon sperm
DNA
followed by washing in a solution comprising O.1X SSPE, 1.0 % SDS at
42°C when a probe
of about S00 nucleotides in length is employed.
When used in reference to nucleic acid hybridization the art knows well that
numerous equivalent conditions may be employed to comprise either low or high
stringency
conditions; factors such as the length and nature (DNA, RNA, base composition)
of the
probe and nature of the target (DNA, RNA, base composition, present in
solution or
immobilized, etc.} and the concentration of the salts and other components
(e.~:, the presence
or absence of formamide, dextran sulfate, polyethylene glycol) are considered
and the
hybridization solution may be varied to generate conditions of either low or
high stringency
hybridization different from, but equivalent to, the above listed conditions.
~Stringency~ when used in reference to nucleic acid hybridization typically
occurs in
a range from about Tn~-5 ° C (5 ° C below the Tm of the probe)
to about 20 ° C to 25 ° C below
Tm. As will be understood by those of skill in the art, a stringent
hybridization can be used to
identify or detect identical polynucleotide sequences or to identify or detect
similar or related
2S polynucleotide sequences. Under "stringent conditions" a nucleic acid
sequence of interest
will hybridize to its exact complement and closely related sequences.
As used hereon, the term "fission protein" refers to a chimeric protein
containing the
protein of interest (i:e., MCD and fragments thereof) joined to an exogenous
protein
fragment (the fission partner which consists of a non-MCD sequence). The
fission partner
may provide a detectable moiety, may provide an afl'xnity tag to allow
purification of the
-15-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
recombinant fusion protein from the host cell, or both. If desired, the fusion
protein may be
removed from the protein of interest by a variety of enzymatic or chemical
means known to
the art.
As used herE:in, the term "purified" or "to purify" refers to the removal of
contaminants from a sample. The present invention contemplates purified
compositions
(discussed above).
As used herein the term "portion" when in reference to a protein (as in "a
portion of a
given protein") refers to fragments of that protein. The fragments may range
in size from
four amino acid residues to the entire amino acid sequence minus one amino
acid
"Antibody" shall be defined as a glycoprotein produced by B cells that binds
with high
specificity to the agent; {usually, but not always, a peptide), or a
structurally similar agent, that
generated its production. Antibodies may be produced by any of the known
methodologies
and may be either polyclonal or monoclonal.
"Mutant" shall be defined as any changes made to a wild type nucleotide
sequence,
1 S either naturally or artificially, that produces a translation product that
fiznctions with
enhanced or decreased efiieiency in at least one of a number of ways
including, but not
limited to, specificity for various interactive molecules, rate of reaction
and longevity of the
mutant molecule.
GENERAL DESCRIPTION O:E INVENTION
The present invention relates generally to compositions and methods of
identifying
and testing Malonyl CoA decarboxylase {MCD) inhibitors, and in particular,
compositions
comprising a novel c~~rdiac isoform of MCD, identified to be a key regulator
of fatty acid
oxidation in the heart. Additionally, the invention relates to compositions
and methods of
identifying MCD pathway agonists and antagonists, and in particular,
compositions
comprising novel DN.A sequences of rat heart, liver and pancreatic DNA
The Description of the invention involves A) Alterations in Fatty Acid
Oxidation
during Reperfusion of the Heart after Myocardial Ischemia, B) Malonyl CoA in
the Heart and
C) Malonyl CoA in the liver and pancreas.
-16-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
A. Alterations In Fatty Acid Oxidation During Reperfusion
Of The Heart After Myocardial Ischemia
Energy substrate preference of the heart both during and after ischemia is an
important determinant of the degree of functional recovery postischemia. For
instance, high
rates of fatty acid oxidation after ischemia can decrease cardiac function and
efficiency during
reperfixsion. These higlh rates of fatty acid oxidation can be explained by a
decrease in malonyl
coenzyme-A (CoA) levels, a potent inhibitor of mitochondria) fatty acid
uptake. In particular,
activation of 5'-AMP-activated protein kinase and inhibition of acetyl CoA
carboxylase
appear to contribute to this decrease in malonyl CoA. As a result, it is
likely that, inhibition of
5'-AMP-activated protein kinase and/or stimulation of acetyl CoA carboxylase
may be a
pharmacologic approach to inhibiting myocardial fatty acid oxidation during
reperfusion.
Decreasing fatty acid oxidation is accompanied by a parallel increase in
glucose oxidation that
results in an improvement in bath cardiac function and efficiency in the
reperfused ischemic
heart [Lopaschuk, Am JCardiol E~O:11A-16A (1997)].
B. Malonyl CoA In The Heart
High rates of fatty acid oxidation in the post-ischemic heart are primarily
due to a
dramatic drop in myocardial levels of malonyi CoA. Malonyl-CoA is a potent
inhibitor of
carnitine palmitoyltransferase 1 {CPTI) and is important in regulating fatty
acid uptake into
the mitochondria. A decrease in malonyl CoA synthesis is partly responsible
for the drop in
malonyl CoA post-ischemia. Although the synthesis of malonyl CoA in the heart
by a cardiac
specific form of ACC has been well characterized, no information is available
on how malonyl
CoA is degraded in the heart. The present invention shows that the heart has
an active
malonyl CoA decarboxylase (MCD) that converts maloriyl CoA to acetyl CoA. This
was
facilitated by the development of a novel and reliable assay to measure
malonyl CoA
decarboxylase {MCD) activity, that did not require extensive protein
purification. Using this
assay, MCD activity was characterized in rat hearts and identified to play an
important role in
regulating fatty acid oxidation. The MCD enzyme is under phosphorylation
control, and can
be activated under experimental conditions that result in enzyme
dephosphorylation. The
majority of MCD in. the heart is associated with the mitochondria, with
octylglucoside
-I7_

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
treatment of mitochondria resulting in 14 fold increase in MCD activity.
Partial purification
of cardiac MCD revealed a protein of approximately 45 kDa, that runs as a
tetrameric
complex when subjected to polyacrylamide gel electrophoresis. MCD has
previously been
described as a mitochondria) enayme which is involved in protecting certain
mitochondria)
enzymes such as methylmalonyl CoA mutase and propionyl CoA from inhibition by
mitochondrial derived malonyl CoA [Kim and Kolattukudy, Arch. Biochem.
Biophys.
190:234-246 (1978); Scholte, Biochim. Biophys Acta. 178:137-144 (1969);
Landriscina et
al.; Eur. .l. Biocherrr. 19:573-580 (1971); Koeppen et al., Biochemistry
13:3589-3595
(1974)]. While very little is known about mammalian MCD, two isoforms of MCD
have
been identified in the goose uropygial gland [Courchesne-Smith et al., Arch.
Biochem.
Biophys 298:576-58fi (1992)]. 'Chase proteins originate from the same gene
although each
have separate start sites of transcription and translation. These alternate
start sites create two
proteins, one targeted to the mitochondria) matrix and the other to the
cytoplasm. In addition
to the uropygial gland, non-mitochondria) levels of MCD have also been
detected in low
levels in the liver. To date, 1VICD activity and subcellular localization has
not been
characterized in the heart.
The role of MfCD in regulating fatty acid oxidation in the present invention,
was also
studied using isolated perfused hearts from newborn rabbits and adult rats. In
newborn rabbit
hearts, fatty acid oxidation increases dramatically between 1-day and 7-day
following birth,
which is accompanied by a decrease in both ACC activity and malonyl CoA
levels. A parallel
increase in MCD activity also was observed in 7-day old hearts compared to 1-
day old hearts.
If adult rat hearts ~~re aerobically reperfitsed following a 30 minute period
of no-flow
ischemia, levels of malonyl CoA decreased dramatically, which was accompanied
by an
increase in fatty acid oxidation rates. The decrease in malonyl CoA during
reperCusion could
be explained by a dc;crease in ACC activity and a maintained MCD activity.
This data
suggested that the heart has an active MCD that has an important role in
regulating fatty acid
oxidation rates. Also, MCD appears to be a key enzyme which may be responsible
for
reducing malonyl CoA levels following birth in the rabbit heart, or following
myocardial
ischemia in the rat heart. Inhibition of this enzyme has considerable clinical
potential as it
represents a potentially important site for pharmacological intervention in
pathological
-18-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
situations characterized by abnormal fatty acid metabolism. Pharmacological
inhibition of
MCD would result vn an increase in myocardial levels of malonyl CoA in the
reperfused
ischemic heart. This would lower fatty acid oxidation rates, increase glucose
oxidation and
improve contractile function of reperfused ischemic hearts.
C. lVlafonyl CoA In The Liver And Pancreas
The liver is thought of as mainly a biosynthetic organ, however, it also
oxidizes fatty
acids as a source of energy [Goodridge, Fatty acid synthesis in eucaryotes.
In: Biochemistry
of lipids, liposomes and membranes. Ed: Vance and Vance. 111-139 {1991)].
Malonyl CoA
is important in this process, since it inhibits carnitine palmitoyltransferase
1 (CPT1), the rate-
limiting enzyme involved in th:e mitochondrial uptake of fatty acids [McGarry
and Brown,
EurJBiochem 244:1-14 (1997); Alum and Saggerson, Biochem J334:233-241 {I998);
Bird
and Saggerson, Bioch!em 222:639-647 (1984)]. By inhibiting CPT1, mitochondrial
uptake of
fatty acids is decreased, thereby reducing mitochondrial fatty acid oxidation
[; Lopaschuk et
1 S al., J Biol Chem 2~69:25871-2878(1994)]. During times of nutritional
deficiency or
diabetes, decreases in malonyl C;oA may result in limited synthesis of fatty
acids, and an
upregulation of fatty acid oxidation. The question remains as to how malonyl
CoA is
degraded in the liver during the times when fatty acid synthase is not active.
In (3-cells in tlxe pancreas, as in the heart and liver, the malonyl-CoA/CTP 1
interaction
is a central element of a "fuel cross-talk" signaling network and may be
implicated in the short
and/or long term control of insulin secretion in the pancreatic (3-cell [Chen
et al., Diabetes
43:878-883 (1994}; 1'rentki et a1, J Biol Chem 267:5802-5810 (1992}]. The
intracellular
concentration of malonyl-CoA in lipogenic tissues such as liver and adipose
tissue is thought
to result from its rate of formation by acetyl-CoA carboxylase (ACC) and its
usage by fatty-
acid synthase (FAS}. However, other tissues like the pancreatic islet [Bran et
al., Diabetes
45:190-198] express :FAS at very low levels yet show rapid variations in
malonyl-CoA under
a number of experimental conditions which increase or decrease its
concentration. The fate
of malonyi-CoA in tlhe p-cell in unclear and it is attractive to believe that
the intracellular
concentration of this metabolic signaling molecule is controlled by an
additional enzyme, at
least in non-lipogenic; tissue expressing iow FAS. A prime candidate for such
function is
-19-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
MCD.
DETAILED DESCRIPTION OF PREFERRED EMBODI1VVIENTS
Generally, the nomenclature used hereafter and the laboratory procedures in
cell
culture, molecular genetics, and nucleic acid chemistry and hybridization
described below are
those well known and commonly employed iri the art. Standard techniques are
used for
recombinant nucleic ;acid methods, polynucleotide synthesis, and microbial
culture and
transformation (e.g., electroporation, lipofection). Generally enzymatic
reactions and
purification steps arf; performed according to the manufacturer's
specifications. The
techniques and procedures are generally performed according to conventional
methods in the
art and various general references [See, generally, Sambrook et al. Molecular
Cloning: A
Laboratory Manual, 2d ed. (1989) Cotd Spring Harbor Laboratory Press, Cold
Spring
Harbor, N.Y., and Current Protocols in Molexular Biology (199b) John Wiley and
Sons, Inc.,
N.Y.].
Oligonucleotides can be synthesized on an Applied BioSystems oligonucleotide
synthesizer [for detail;> see Sinha et al., Nucleic Acids Res. 12:4539
(1984)], according to
specifications provided by the manufactuu-er. Complementary oligonucleotides
are annealed
by heating them to 90°C in a solution of 10 mM Tris-HCI buffer (pH 8.0)
containing NaCI
(200 ~ and then Glowing them to coot slowly to room temperature. For binding
and
turnover assays, duplex DNA is purified from native polyacrylarnide (15 % w/v)
gels. The
band corresponding to double-stt~anded DNA is excised and soaked overnight in
0.30 M
sodium acetate buffer (pH 5.0) containing EDTA (1 mM). After soaking, the
supernatant is
extracted with phenol/chloroform {1/1 v/v) and precipitated with ethanol. DNA
substrates are
radiolabeled on their 5°-OH group by treatment with [g 32P]ATP and T4
polynucleotide
kinase. Salts and uninc~orporated nucleotides are removed by chromatography on
Sephadex G
columns.
The invention will be useful for, among other things, ( 1 ) the design and
execution of
screens to identify proteins or small molecules that inhibit MCD activity, and
thus activate or
prevent the degradatiion of malonyl CoA to acetyl CoA, {2) the development of
high
throughput screens for rational drug design and (3) the identification of MCD
intro- and
-20-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
interspecific homologues or mutants. Additionally, the present invention
contemplates assays
for dexecting the ability of agents. to inhibit or enhance MCD activity where
high-throughput
screening formats are employed together with large agent hanks (e.g., compound
libraries,
peptide libraries, and the like}' to identify antagonists or agonists. Such
MCD pathway
antagonists and agonists may be further developed as potential therapeutics
and diagnostic or
prognostic tools.
Screening Assays °
The screening; assays of the present invention may utilize isolated or
partially purified
forns of the assay components (or MCD enzyme). "Purified" refers to the enzyme
of the
present invention which have been separated from their native environment
(e.g., a
cytoplasmic or nuclear fraction of a cell, yeast protoplasm, or by recombinant
production). It
is preferred that the enzyme is purified to at least about 10-50 % purity. A
substantially pure
composition includes such MCD enzymes) or complexes that are approaching
homogeneity,
i.e., about 70-90 % pure. A "pure" preparation refers to purity greater than
90 % and more
preferably a purify greater than 95 %. Preferred embodiments include binding
assays which
use cardiac MCD which are produced by recombinant methods or chemically
synthesized. In
one embodiment, the methods of screening employs, in addition to MCD and the
substrate
malonyl CoA, the use of'4C- labeled oxaloacetate to produce 14C-labeled
citrate.
It is contemplated.that the screening assays of the present invention will,
among other
things, identify agents that will inhibit MCD activity. Such inhibitors are
contemplated to be
usefizl in the treatment of ische:mia (e.g., Pharmacological inhibition of MCD
should result in
an increase in myocaurdial levels of malonyl CoA in the reperfused ischemic
heart), as well as
other disorders. Thiis will lower the fatty oxidation rates, increase glucose
oxidation and
improve contractile fixnction of reperfused ischemic hearts.
The present invention contemplates compound screening using a variety of assay
fornats. In one embodiment, the present invention contemplates a method for
compound
screening, comprising: a) providing: i} a purified preparation comprising
malonyl CoA
decarboxylase, ii) a substrate, and iii) a test compound; b) mixing said
malonyl CoA
decarboxylase and said substrate under conditions such that said malonyl CoA
decarboxylase
-21 -

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
can act on said substrate to produce product, wherein said mixing is done in
the presence and
absence of said test compound; and c) measuring directly or indirectly the
amount of said
product produced in the presence and absence of said test compound. In one
embodiment,
inhibition is measure~3 by detection of acetyl CoA formation as estimated by
reduction of
[14C]citrate levels.
Malonyl CoAI Decarboxylase Assay: To measure MCD activity, a novel MCD assay
was developed in the present invention which detected the product of the MCD
reaction,
acetyl CoA. Acetyl CoA derived from MCD was incubated in the presence of
['4C]oxaloacetate and citrate synthase (0.73 ~cUluL} to form citrate. The
[14C]oxaloacetate
was initially produced) by a 20 minute transamination reaction performed at
room temperature
utilizing L-[14C(L~]a.spartate (2.5 ,uCi/ml) and 2-oxoglutarate (2 mM). One of
the
advantages of the assay was that extensive purification of MCD was not
required prior to
assay, and that in vitro measurements of enzyme activity reflected the rate of
enzyme activity
in vivo. (Also, see Schematic A).
1. Screens To Identify Agonists Of Antagonists Of MCD
There are several different approaches contemplated by the present invention
to look Ili
for substances that specifically nnhibit or enhance the MCD activity. One
approach is to I'I
transfect cells with expression constructs comprising nucleic acid encoding
the MCD and '~
measure changes in MCD activity as compared to controls after the cells have
been exposed I
to the compound suspected of modulating mediating MCD activity. Cells may be
transiently I
transfected or stably transfected with the construct under control of an
inducible promoter. li
Expression of superphysiological levels (superphysiological is defined as
expression levels of
the said gene produW at levels greater than the cell would normally express
without the ~~~
transfection and expression of constructs containing the said gene into the
cell) of MCD may ICI
enhance normal yet subtle cellular MCD interactions significantly to allow for
the'I
investigation of heretofore nonassayable phenomena. Other embodiments would
include
translation of the corresponding RNA and purification of the peptide. The
purified peptide
could then be used to test specific compound:protein interactions.
Additionally, it is possible ~'~I
to generate antibodlies to the translated invention allowing for the
development ofl'i
-22-

CA 02339088 2001-02-08
WO 00/09710 PCTICA991fl0734
immunological assays such as, but not limited to, RTA, ELISA or Western blot.
Furthermore,
transgenic animal could be produced allowing for in vivo assays to be
conducted.
- 23 -

CA 02339088 2001-02-08
w0 00109710 PCT/CA99/00734
Tissue Homogenate (MCD)
Malonyl-CoA -------------------. Acetyl-CoA
(with or without the phosphatase
inhibitors: NaF/NaPPI)
aspartate
aminotransferase
L-[14C]aspartate + 2-oxoglutarate-------------------. ['4C~oxaloacetate + L-
glutamate
citrate synthase
['4C]oxal~oacetate + acetyl-CoA-------------. ['4C~citrate + CoASH
Schematic A
-24-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
A. Transfection Assays
Transfection assays allow for a great deal of flexibility in assay
development.
The wide range of commercially available transfection vectors will permit the
expression
of the MCD genes o~Fthe present invention in a extensive number of cell types.
In one
embodiment, cells are transiently transfected with an expression construct
comprising in
operable combination 1) nucleic acid encoding MCD and 2) an inducible
promotor.
Cells would be exposed to the agent suspected of modulating MCD activity, MCD
expression would be turned on and MCD activity would be measured. Rates of MCD
activity in cells expressing recombinant MCD are compared to rates of MCD
activity in
cells transfected with a control expression vector (e.g., an empty expression
vector).
Rates of MCD activity can be quantitated by any of a number of ways reported
in the
literature and known to those practiced in the art.
In another embodiment, stably transfected cells lines are developed, i.e.,
cell lines
stably expressing the MCD genes of the present invention. The use of an
inducible
promoter would be utilized in these systems. Screening assays for compounds
suspected
of modulating MCD activity would be conducted in the same manner as with the
transient transfection assays. Using stably transfected cell lines would allow
for greater
consistency between experiments and allow for inter-experimental comparisons.
2. Screen To Idlentify Tissues Expressing Similar Or Homologous Gene
Mutations
In one embocliment tissue screens will be constructed using microassay
microchip
techniques. This will allow for the development of a high-through-put screen
for the
identification of tissues expressing mutant genes similar to, or homologous
With, the
sequenced MCD genes.
-25-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
3. Screens To Identify MCD Signal Pathway Constituents
a. In vi~!ro Assays
There are several different approaches to identifying MCD interactive
molecules.
The invention would allow the identification of proteins that may only
associated with
nonactive (or reduced activity) :MCD or canstitutively active MCD molecules.
Such
proteins may regulate MCD function. Techniques that may be used are, but not
limited
to, immunoprecipitation of MCD with antibodies generated to the transcription
product
of the invention. This would also bring down any associated bound proteins.
Another
method is to generate fusion proteins containing the mutant form of MCD
connected to
a generally recognized pull-down protein such as glutathione S-transferase.
Bound
proteins can then be eluded and analyzed.
i) Immunoprecipitation
After the gerneration of antibodies to wild type and mutant MCD, cells
expressing
transfected MCD arcs lysed and then incubated with one of the antibodies.
Antibodies
with the bound MCI) and any associated proteins can then be pulled down with
protein-
A Sepharose or protein-G Sepharose beads, using standard techniques.
ii} Fusion Protein Pull-down
A method similar to immunoprecipitation is to construct fusion proteins of MCD
and glutathione S-transferase (GST). The MCD fusion proteins are then
incubated with
cell extracts and then removed with glutathione Sepharose beads. Any bound,
MCD
proteins are then characterized.
4. Screens To lfdentify MCD Homologues
Standard molecular biological techniques can be used to identify MCD
homologues in rat, human or other species. For example, the present invention
contemplates a variety of approaches including, but are not limited ta, DNA-
DNA
hybridization techniques (e.g., Southern blots) and DNA-RNA hybridization
techniques
-26-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
(e.g., Northern blots.}. Additional techniques may include, for example,
immunoscreening of proteins made from library stocks with antibodies generated
to
translation products of SEQ ID NOS:1, 2 or 3. Furthermore, immunoprecipitation
of
known or suspected interactive proteins of MCD can be followed by the
identification of
possible mutant MC_D homologues with antibodies generated to translation
products of
SEQ ID NOS:1, 2 or 3.
EXPERIMENTAL
The following examples serve to illustrate certain preferred embodiments and
aspects of the present invention and are not to be construed as limiting the
scope thereof
In the experimental disclosure which follows, the following methodology apply.
Methodology
Materials: I: ['4C(U)]aspartate and [9,10-14C]palmitate were purchased from
Mandel, and hyamine hydroxide (methylbenzethonium; 1 M in methanol solution)
was
purchased from iCN. Bovine serum albumin (fraction V) was obtained from
Boehringer
Mannheim, West Germany. Dowex 50W-X8 canon exchange resin { 100-200 mesh
hydrogen form) was obtained from Bio-Rad Laboratories (Richmond, CA). ACS
Aqueous counting scintillant wa.s purchased from Amersham Canada (Oakville,
Ontario).
All other chemicals were reagent grade.
1. Preparation of Rat Heart Malonyl CaA Decarboxylase
Male Sprague-Dawley rats (300-350 g) were anesthetized with sodium
pentobarbitol, and the heart quickly excised. Hearts were then either
immediately
homogenized for measurement of MCD, immediately used for preparation of
mitochondria (see be:low), frozen in liquid Na, or used for isolated working
heart
perfusions. Hearts v~ere also obtained from anesthetized 1-day and 7-day old
New
Zealand White rabbila for isolated heart perfusions and are described as
follows. Fresh or
frozen hearts (10-15 mg of tissue) used for MCD measurements were homogenized
for 2
x 15 seconds in a buiffer consisting of KCl (75 mM); Sucrose (20 mM}, HEPES
(10
-27-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
mM), EGTA (1 mM), with or without NaF (50 mM) and NaPPi (5 mM). A fraction of
this homogenate corresponding to 2 mg of tissue was used in the MCD assay.
Isolation Of Rat Heart .~tochondria And Purif canon Of Malonyl CoA
Decarboxylase: Rat; hearts were excised and separated from their atrias. The
ventricles
were then minced into 1 mm cubes and rinsed with ice cold
mannitol/sucrose/EGTA
(MSE) buffer (225 mM rxrannitol; 75 mM sucrose; 1 mM EGTA, pH 7.5). A ratio of
2:1
of MSE buffer to we,t tissue weight was prepared and then homogenized using 5
strokes
of a glass homogenizer with a teflon pestle. The homogenate was then diluted
with
MSE to 10 mI/g of vvet tissue and centrifuged at 480 x g for 5 minutes. The
supernatant
was filtered through two layers of cheese cloth and then centrifuged at 10,000
x g for 30
minutes. The pellet 'was then resuspended in 10 mM sodium phosphate bui~er, pH
7.6,
containing 0.5 mM dlithioerythritol (DTE) (50 mL/g of wet mitochondria)
pellet}. Triton
X-100 was added to the suspension (0.1 %) and then the slurry was stirred at 4
° C for 16
hours to lyse the mitochondria. The solution was then centrifuged at 24,000 x
g for 10
minutes, the supernatant saturated to 40 % with powdered ammonium sulfate and
stirred
for 1 hour on ice. The precipitated protein was removed by centrifugation at
24,000 x g
for 10 minutes. The supernatant was saturated to 55 % with powdered ammonium
sulfate, stirred for 1 ;hour on ice, and centrifuged at 24,000 x g for 10
minutes. The
pellet was resuspended in a 0.1 M potassium phosphate (ph 7.4), 1 mM DTT and 1
M
ammonium SOa bufl,er.
Chromatography On Buctyl Sepharase 650M.~ The potassium phosphate/1VICD
solution was next loaded onto a 100 mL Butyl-Sepharose 650M previously
equilibrated
with a 0.1 M potassium phosphate buffer {pH 7.4) containing 1 mM DTT and 1 M
ammonium SOa. The column was washed with 3 column volumes of the above buffer
and proteins were eh.rted with a linear gradient of 1 to 0 M Ammonium SOa in a
total
volume of 500 mL ~rith l0 mL fractions being collect. The fractions containing
MCD
activity were pooled and concentrated using ultra~ltration using a Millipore
Ultrafree 15
mL centrifugal frlter device, Biomax 10 I~ NMWL. The resulting 1 mL solution
was
brought to 50 mL in a 0.1 M potassium phosphate (pH7.4), 1 mM DTT and 1 M
ammonium SOa bui~er.
-28-

CA 02339088 2001-02-08
WO 00109710 PCT/CA99/00734
Chromatography On Phenyl Sepharose HP.~ The enzyme solution was next
loaded onto a 2S mI, Phenyl Sepharose HP column previously equilibrated with a
0.1 M
potassium phosphate; buffer {pH 7.4) containing 1 mM DTT and 1 M ammonium SOa
buffer. The column was washed with 3 column volumes of the above buffer and
proteins
were eluted with a linear gradient of 1 to 0 M ammonium SOa in a total volume
of 500
mL with 10 mL fraci;ions being collected. The fractions containing MCD
activity were
pooled and concentrated using ultrafiltration as above. The resulting 1 mL,
solution was
brought to 50 mL in a 20 mM Bis-Tris, pH 7 buffer containing 1 mM DTT:
Chromatography On ~ Sepharose HP.~ The enzyme solution was next applied
to a 10 mL Q Sepharose HP column previously equilibrated with a 20 mM Bis-
Tris, pH
7 buffer containing 1 mM DTT. The column was washed with 3 column volumes of
the
same buffer and bound proteins were eluted with a linear gradient of 0 to 0.3
M NaCI in
a total volume of 10~) mL. S mL fractions were collected and the fractions
containing
MCD activity were pooled and concentrated as above. The concentrated pool was
1 S resuspended in SO rriL of a SO m~M malonate (pH 5.6) buffer containing 1
mM DTT.
Chromatography On SP Sepharose HP.~ The enzyme solution was next applied
to a S mL SP Sepharose HP column previously equilibrated with a SO mM malonate
{pH
S.6) buffer containing 1 n~lVl D'fT. The column was washed with 3 column
volumes of
the same buffer and bound proteins were eluted with a linear gradient of 0 to
0.3 M NaCI
in a total volume of 50 mL. 2 mL fractions were collected and the fractions
containing
MCD activity were f>ooled, neutralized to pH 7.0, and concentrated as above.
The
concentrated pool was resuspended in 5 mL of SO mM malonate (pH S.6) buffer
containing 1 mM DTT.
Malonyl CoA Affinity Elution From SP Sepharose HP: The enzyme solution
2S was next reapplied to a 0.5 mL SP Sepharose HP column previously
equilibrated as
above. The column was washed to remove unbound proteins and then eluted with a
SO
mM malonate (pH 5..7) buffer containing 1 mM DTT and IO p,M malonyl CoA. This
allowed for highly specific elution of MCD. The eluted protein fraction form
the second
SP Sepharose HP column was resolved on a IO % SDS- polyacrylamide gel and
stained
for visualization using a Coomassie solution. The MCD band of protein was
excised
-29-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
from the gel and subjiected to an "in the gel" tryptic digest. Once digested,
the tryptic
peptides were separated on a microbore HPLC and selected peptides were
subjected to
Edman degradation for protein sequencing.
Malonyl C'o~l Decarbo~ylase Assay: To measure MCD activity, a novel MCD
assay was developed in the present invention, which detected the product of
the MCD
reaction, acetyl CoA. Acetyl CoA derived from MCD was incubated in the
presence of
[laC]oxaloacetate amd citrate synthase (0.73 ,uU/,uL) to form citrate. The
[i'C]oxaloacetate ways initially produced by a 20 minute transamination
reaction
performed at room temperature utilizing L-[i°C{U)]aspartate (2.5
,uCi/ml) and
2-oxoglutarate (2 mM}. One of the advantages of the assay was that extensive
purification of MCD was not required prior to assay, and that in vitro
measurements of
enzyme activity reflected the rate of enzyme activity in vivo.
To initiate the MCD assay, heart homogenates or mitochondrial preparations
were incubated in a ~! 10 p,I reaction mixture (0.1 M Tris, pH 8.0; 0.5 mM
dithiothreitol;
i 5 1 mM malonyl CoA) for .l0 minutes at 37 ° C, in the presence or
absence of NaF {50
mM) and NaPPi (5 n~. The reaction was stopped by the addition of 40 ,ul of
perchloric acid (0.5 rnM), neutralized with 10 ~cL of 2.2 M KHCOs (pH 10) and
centrifuged at 10,00() x g for 5 .minutes to remove precipitated proteins. The
incubation
of the heart sample with malonyl CoA allowed for the conversion of malonyl CoA
to
acetyl CoA which was then combined with ['4C]oxaloacetate {0.17 ~eCilml) to
produce
['4C]citrate. Unreact:ed [14C]oxaloacetate was then removed from the reaction
mixture
by the addition of sodium glutamate (6.8 ~ and aspartate aminotransferase
(0.533
~U/~cl), followed by a 20 minute incubation at room temperature. This allowed
for
transanunation of un~reacted [14~;]oxaloacetate back to [14C]aspartate. The
resulting
solution was then stirred in a 1:2 suspension of Dowex SOW-8X (100-200 mesh)
and
centrifuged at 400 x g for 10 minutes. The pelleted Dowex fraction removed
[14C]aspartate, while the supernatant contained ['4C]citrate. The supernatant
fraction
was then counted for 14C present in the form of [14C]citrate. The amount of
acetyl CoA
produced by MCD was then quantified by comparison to acetyl CoA standard
curves
which had been subjected to the identical assay conditions as described above.
A
-30-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
standard acetyl CoA concentration curve was run with each experiment. These
curves
were always found tp be linear (r = 0.99).
Determination Of CoA Esters: CoA esters were extracted from powdered
tissue into 6 % perch~loric acid and measured using the modified high
performance liquid
chromatography (HfLC) procedure described earlier [Lopaschuk et al., J. Biol.
Chem.
269:25871-25878 (1994)]. Essentially, each sample (100 ~cl each) was run
through a
precolumn cartridge (C18, size 3 cm, 7 icm) and a Microsorb short-one column
(type
C 18, particle size 3 ,gem, size 4.6 x 100 mm) on a Beckman System Gold HPLC.
Absorbance was set at 254 mM and flow rate at 1 ml/minute. A gradient was
initiated
using buffer A (0.2 M NaH2POa, pH 5.0) and buffer B (0.25 M NaH2POa and
acetonitriie, pH 5.0) in a ratio of 80:20 (v/v). Initial conditions (97 % A
and 3 % B)
were maintained for 2.5 minutes and were changed thereafter to 18 % B over 5
minutes
using Beckman's curve 3. At 15 minutes the gradient was changed linearly to 37
% B
over 3 minutes and subsequently to 90 % B over 17 minutes. At 42 minutes the
composition was returned linearly back to 3 % B over 0.5 minutes, and at 50
minutes
column equilibration was complete. Peaks were integrated by Beckman System
Gold
softwaxe package.
Acetyl CoA (.arboxylase Assay: Approximately 200 mg of frozen heart tissue
was homogenized, cc;ntrifuged and dialyzed as previously described [Lopaschuk
et al., J.
Biol. Chem. 269:25871-25878 (1994)] 25 ,ul of dialyzate was added to a
reaction
mixture (final voIumc~ 160 ,ul) containing 60.6 mM Tris acetate, pH 7.5; 1
mg/ml bovine
serum albumin; 1.32 ,uM [3-mercaptoethanol; 2.I2 mM ATP; 1.06 mM acetyl CoA;
5.0
mM magnesium acetate; 18.2 mM NaHCOs; and 10 mM magnesium citrate. Samples
were incubated at 37°C for either 0, 1, 2, 3, or 4 minutes and the
reaction stopped by the
addition of 25 ,u1 of ll0 % perchloric acid. Samples were then spun for 2
minutes at 13,
000 rpm and the mal~onyl CoA concentration in the supernatant measured using
the
HPLC procedure described above.
Western Bloi' Analysis: Samples were subjected to either non-denaturing
polyacrylamide gel electrophoresis or to SDS-polyacrylamide gel
electrophoresis and
transferred to nitrocellulose as described [Lopaschuk et al., J. Biol. Chem.
-31-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
269:ZS871-25878 (1'994)]. Membranes were immunoblotted with either rat anti-
MCD
antibody or to bovinf; anti-catalase antibody (Chemican) in 1 % milk powder.
The
antibodies were visualized using the Amersham Enhanced Chemiluminescence
Western
blotting and Detection System as described by the manufacturer.
S Heart Perfusions: Isolated perfused hearts were obtained either from newborn
New Zealand White rabbits (1-day and 7-days following birth) or from adult
Sprague-Dawley rats. One-day old rabbit hearts were isolated and perfused, as
described previously, at a coronary perfusion pressure of 30 mm Hg [Lopaschuk
et al.,
J. Biol. Chem. 269:ZS871-25878 (1994)]. Seven-day old hearts were perfused, as
described previously, at a 7.5 mm Hg left atrial preload and 30 mm Hg aortic
afterload
[Lopaschuk et al., J. Biol. Chem. 269:25871-25878 (1994)]. Rat hearts were
perfused
at a 11.5 mm Hg left atrial preload and 80 mm Hg aortic afterload [Lopaschuk
et al., J.
Biol. Chem. 269:ZS871-25878 (1994)].
The newborn rabbit hearts were perfused with Krebs'-Henseleit solution
1S containing 3 % bovine serum albumin, 0.4 mM j9,10-'4CJpalmitate, 11 mM
glucose and
100 ~cU/ml of insulin. Hearts were perfused for a 40 minute period and fatty
acid
oxidation was measured as described below. The rat hearts were perfused with
Krebs'-Henseliet solu.tian containing 11 mM glucose, 1.2 mM palmitate, and 100
,uU/ml
insulin. Hearts were perfused for either a 60 minute aerobic period, a 30
minute aerobic
and 30 minute global ischemic period, or a 30 minute aerobic, 30 minute global
ischemia
and 60 minute reperfusion period.
At the end of all perfusions, hearts were frozen with tongs cooled to the
temperature of liquid Na. Frozen ventricular tissue from perfused hearts was
weighed
and powdered in a mortar and pestle coated to the temperature of liquid Na. A
portion
2S of the powdered tissue was used to deternune the dry-to-wet weight ratio of
the
ventricles. The aerial tissue remaining on the cannula was removed, dried in
an oven for
12 hours at 100°C, a.nd weighed. With the dried atrial tissue, total
frozen ventricular
weight, and the ventricular dry-to-wet weight ratio, the total dry weight of
the heart was
determined.
Measurement Of Palmitate Oxidation: Steady state rates of palmitate oxidation
-32-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
were measured in both newborn rabbit hearts and in aerobic and reperfused
ischemic
hearts by quantitatively collecting l4COa produced from hearts perfused with
~-14C almitate a roximatel SO 000 d m/ml buffer Collection of 14C02 released
as
]p ( pp Y ~ p ).
gas in the oxygenation chamber and the l4COa trapped in the NaHC03 in the
perfusate
was performed as described previously [Lopaschuk et al., J. Biol. Chem.
269:25871-25878 (1994)].
Statistical Analysis: The unpaired t-test was used for the determination of
statistical difference of two group means. For groups of three, analysis of
variance
followed by the Nemine-Keels test was used. A value of p < 0.05 was considered
significant. All data presented are represented as mean ~ standard error of
the mean
(S.E.M.).
2. Preparation Of Rat LivcrlPancreas Malonyl CoA Decarboxylase
Male Sprague-Dawley rats (300-350 g) were anesthetized with sodium
pentobarbitol, and the liver/pancreas were quickly excised. 50 rat livers were
minced
into 1 mm cubes and rinsed with ice cold MSE buffer (225 mM mannitol; 75 mM
sucrose; 1 mM EGT.~1, pH 7.5). A ratio of 2:1 of MSE buffer to tissue was used
per
liver and then homogenized using 5 strokes of a glass homogenizer with a
teflon pestle.
The homogenate wa:> then diluted with MSE to 10 ml/g of wet tissue and
centrifuged at
480 x g for 5 minutes. The supernatant was filtered through two layers of
cheese cloth
and then centrifuged at 10,000 x g for 30 minutes. The pellet was then
resuspended in
10 mM sodium phosophate bui~e~-, pH 7.6, containing 0.5 mM dithioerythritol
(DTE) (5
mL/g of wet mitochondria) pellet). Triton X-100 was added to the suspension
(0.1 %)
and then the slurry was stirred at 4°C for 16 hours to lyse the
mitochondria. The
solution was then centrifuged at 24,000 x g for 10 minutes, the supernatant
saturated to
40 % with (NHa)zSOa and stirred for 1 hour on ice. The precipitated proteins
were
removed by centriful;ation at 24,000 x g for 10 minutes. The supernatant was
saturated
to SS % with (NHa)aSOa, stirred for 1 hour on ice, and centrifuged at 24,000 x
g for 10
minutes. The pellet, enriched in MCD activity, was resuspended in a 0.1 M
potassium
phosphate (pH 7.4), 1 mM DTT and 1 M (NHa)aSOa buffer in preparation for the
first
- 33 -

CA 02339088 2001-02-08
w0 00/09710 PCT/CA99/00734
column.
Malonyl CoA Decarboxylase Assay: A fluorometric assay which follows the
formation of acetyl CoA from malonyl CoA in a coupled assay using citrate
synthase and
maIate dehydrogenase was used to measure MCD activity. Reaction mixtures of
1.4 mL
contained 0.1 M Tris-HCL, pH 8.0, 1 mM DTE, 0.01 M malic acid, 0.17 mM NAD~,
0.136 mM malonyl CoA, 11 U malate dehydrogenase, 0.44 U citrate synthase. The
reaction was initiated by the addition of varying amounts of MCD depending on
enzyme
activity (10 - 50 ,uL). The reaction measured the formation of NADH from NAD+
over
a 4 minute time period using a Slhimazdu spectrafluorometer RF-5000. The
formation of
NADH was measured at an excitation wavelength of 340 nm and an emission
wavelength of 460 nnn [Sherwin and Natelson, Clin Chem 21:230-234 ( I975)].
-34-

CA 02339088 2001-02-08
WO 00/09710 ~ PCTICA99/00734
A radiometric MCD assay was also used for MCD activity measurements in
whole tissue [Dyke ert al., Am .l Physiology 275:H2122-H2129 ( 1998)]. Acetyl
CoA
derived from MCD was incubated in the presence of [~4C]oxaloacetate and
citrate
synthase (0.73 ~cUluL) to formi citrate. The [14C]oxaloacetate was initially
produced by
a 20 minute transami.nation reaction performed at room temperature utilizing L-
['4C{U)]aspartate (2.5 ~cCi/ml) and 2-oxoglutarate (2 mM). To initiate the MCD
assay,
preparations were incubated in a 210 pl reaction mixture (0.1 M Tris, pH 8;
0.5 mM
dithiothreitol {DTT); 1 mM malonyl CoA) for 10 minutes at 3 7 ° C, iri
the presence or
absence of NaF (50 mM} and NaPPi (5 mM). The reaction was stopped by the
addition
of 40 ~d of perchloric acid (0.5 mM), neutralized with 10 ,uL of 2.2 M KHC03
(pH 10}
and centrifuged at 10,000 x g for 5 minutes to remove precipitated proteins.
The
incubation of the heart sample with malonyl CoA allowed for the conversion of
malonyl
CoA to acetyl CoA which was then combined with [14C]oxaloacetate (0.17
~cCi/ml) to
produce [14C]citrate. All reactions were carried out in the presence ofN-
ethylmaleimide
which removes excess CoA remaining in the latter stages of the reaction so
that the
citrate present cannot generate non-MCD derived acetyl CoA. Unreacted
[laC]oxaloacetate was removed from the reaction mixture by the addition of
sodium
glutamate (6.8 ~ and aspartate aminotransferase {0.533 ,uUl~cl}, followed by a
20
minute incubation at room temperature. This allowed for transamination of
unreacted
['4C]oxaloacetate back to [14C]aspartate. The resulting solution was then
stirred in a 1:2
suspension of Dowe:~c SOW-8X (100-200 mesh) and centrifuged at 400 x g for 10
minutes. The pelleted Dowex fraction removed [i4C]aspartate, while the
supernatant
contained [14C]citrate. The supernatant fraction was then counted for 1''C
present in the
form of [14C]citrate. The amount of acetyl CoA produced by MCD was then
quantified
by comparison to acetyl CoA standard curves which had been subjected to the
identical
assay conditions as dLescribed above. A standard acetyl CoA concentration
curve was
run with each experiment. These curves were always found to be linear (r =
0.99} (data
not shown).
-35-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
Chromatography On Butyl Sepharose 6SONL~ The MCD solution adjusted to 1
M (NHa)aSOawas loaded onto a 100 mL Butyl-Sepharose 650 M column ( 2.6 cm x 40
cm) previously equililbrated with a 0.1 M potassium phosphate buffer (pH 7.4)
containing
1 mM DTT and 1 M {NHa)aSOa. The column was washed with 3 column volumes of the
above buffer and protteins were eluted with a gradient of 1 to 0 M {NHa)zSOa
in a total
volume of 150 mL with 9 mL fractions being collected. The fractions containing
MCD
activity were pooled .and brought to 100 mL in a 0.1 M potassium phosphate (pH
7.4), 1
mM DTT and 1 M (hJHa)aSOa buffer.
Chromatography On Phenyl Sepharose HP: The enzyme solution was loaded
onto a 25 mL Phenyl Sepharose HP column (2.6 cm x 20 cm) previously
equilibrated
with a 0.1 M potassium phosphate buffer (pH 7.4) containing 1 mM DTT and 1 M
(NHa)ZSOa buffer. The column was washed with 3 column volumes of the above
buffer
and proteins were eluted with a gradient of 1 to 0 M (NHa)aSOa in a total
volume of 175
mL with 9 mL fractions being collected. The fractions containing MCD activity
were
pooled and concentrated by ultrafiltration. The resulting 1 mL solution was
brought to
50 mL in a 20 mM Biis-Tris, pH 7 buffer containing 1 mM DTT
Chromatography On Q Sepharose HP: The enzyme solution was applied to a
10 mL Q Sepharose IjP column ( 1.5 cm x 20 cm) previously equilibrated with a
20 mM
Bis-Tris, pH 7 buffer containing 1 mM DTT. The column was washed with 3 column
volumes of the same buffer and bound proteins were eluted with a gradient of 0
to 0.3 M
NaCI in a total volume of 80 mL. 4 mL fractions were collected and the
fractions
containing MCD activity were pooled and concentrated by ultrafiltration. The
concentrated pool ways resuspended in 50 mL of a 50 mM MES {pH S.S} buffer
containing 1 mM DT'T.
Chromatogracphy On SP Sepharose HP: The enzyme solution was applied to a
5 mL SP Sepharose HP column (1.5 cm x 20 cm) previously equilibrated with a 50
mM
MES (pH 5.6) buffer containing 1 mM DTT. The column was washed with 3 column
volumes of the same buffer and bound proteins were eluted with a linear
gradient of 0 to
0.4 M NaCI in a total volume of 1 SO mL,. 4 mL fractions were collected and
the
fractions containing MCD activity were pooled, neutralized to pH 7.0, and
concentrated
-36-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/fl0734
by ultrafiitration. The concentrated pool was resuspended in 5 mL of 50 mM
malate {pH
5.6) buffer containing I mM DTT.
Malanyl Coil Affinity ~'lution From SP Sepharose I~P.~ The enzyme solution
was re-applied to a 0.5 mL SP sepharose HP column (0.5 cm x 10 cm) previously
equilibrated as above;. The column was washed with 50 mM malate (pH 5.6)
buffer
containing 1 mM DT'T to remove unbound proteins and then eluted with a 50 mM
malate (pH 5.6) buffer containing 1 mM DTT and 10 ,uM malonyl CoA. The eluted
fractions were neutralized to pH 7Ø The affinity elution protocol allowed
for highly
specific elution of MCD.,
Protein Sequencing: The amity eluted protein fraction from the second SP
Sepharose HP column was resolved on a 9 % SDS- polyacrylamide gel and stained
for
visualization using a Coomassie blue solution. The major protein of
approximately 52
kDa was thought to be MCD and was excised from the get and subjected to an
endoLys
C digest. The protein digest was subjected to HPLC and the appropriate
peptides
I 5 underwent amino acid N-terminal sequencing. The amino acid sequences of
two internal
peptides were obtained. Protein digestion, and amino acid N-terminal
sequencing was
performed by Eastern Quebec Peptide Sequencing Facility (Quebec, Canada).
Antibody Pra~duction Against Rat Liver MCD: The protein which was affinity
eluted from the SP-sc~pharose column was subjected to SDS-PAGE, Coomassie
stained
and the 52 kDa band was cut from the gel. The protein (3 ,ug) was eluted from
the gel
fragment and injected into rabbits. Similarly, another fraction from the
affinity elution of
the S-sepharose colwmn protein (6 beg) was injected into rabbits without
undergoing the
gel separation step. 'the rabbits were injected at 2 week intervals for 2
months before
the serum was used.
-37-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
3. Probe Synthesis, Library Screening And DNA Sequencing Of Rat
Pancreatic ~-cell MCD
RT-PCR was made on I1VS-1 cells total mRNA with the Superscript reverse
transcriptase and Taq polymerasf; (GIBCO} according to the supplier's
protocols. The
annealing temperature; was 55 °C.. For PCR, degenerated
oligonucleotides were designed
from the goose MCD sequence [.Tang et al., JBiol Chem 264:3500-3505 (1989)].
The
sense primer positioned at base 547 of the goose sequence was
5'GANTSTGARGCTGTGCAYCCTGT3' (SEQ >D N0:4); the antisense primer, starting
I O at base I 102 was 5'TACARRTACCAGGCRCACARYCTCAT3' (SEQ D) NO:S}. The
580 base pair fragment was subcloned in pBluescript (Stratagene), sequenced,
restriction-enzyme digested and purified to be used as a probe.
-38-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
A pancreatic »i (INS) cell cDNA library [Bonny et al., JBiol Chem 273:1843-
1846 (1998)] constrc.cted in Lambda ZAPExpress (Stratagene) was screened using
the
purified 580 by PCR fragment labeled with oc-[32P]-dCTP by random priming.
After two
rounds of screening, :four clones were in vivo excised and assayed for MCD
activity in
293 cells 24 h after DiNA transfection (5 pg/106 cells) with the calcium
phosphate
precipitate technique [24]. The one bearing the highest enzymatic activity was
sequenced in both directions using the deletion technique (Erase-a-Base,
Promega) and
the dye-primer sequencing strategy (Autoread Sequencing Kit and ALF DNA
sequencer
from Pharmacia). The size of the DNA was 2020 bp. An additional positive clone
was
IO sequenced to confirms the sequence obtained with that bering high enzymatic
activity
upon transfection in 293 cells. DNA transfection of the (3-galactosidase gene
under the
control of the CMV promoter served as a negative control for MCD activity and
as
positive control for the efficiency of transfection (about 20 %). Ins-1 cells
[Asfarai et
al., Endocrinology 1:30:167-178 (1992)]and human kidney 293 cells [Becker et
al., J
Biol Chem 269:21234-21238 (1994)] were cultured as described in the quoted
references.
-39-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
,l3-cell MCD rnRNA Measurements: Northern blot analysis was carried out
using standard techniques for the gel preparation and transfer [Sambrook et
al.,
Molecular Cloning, Cold Spring Harbor Laboratory Press, New York (1989)].
Briefly,
20 p,g of total mRNA, per lane were separated on a 1 % agarose gel in the
presence of
formaldehyde, transferred by capillarity onto Zeta probe QT membrane (Biorad),
fixed
with UV light, prehybridized, hybridized in the presence of the labeled 580 by
MCD
cDNA fragment described above, and washed according to the supplier's
protocol. The
signals were revealed with a Fuji phosphorimager. Control hybridization with
an 18S
ribosomal precursor probe {0.77 kb EcoRl-BamHl fragment, position 1-1780, of
mouse
18S ribosomal rRNA cDNA subcloned in pUC830) was done on the same membrane
confirming the ethidiutn bromide staining of the RNA. RT-PCR was performed
using
total RNA obtained from rat tissues by the guanidinium isothiocyanate acidic
phenol
technique [Chomczinsky and Sacchi, Anal. Biochem 162:156-I60 (1987)]. Reverse
transcription was done with 5 pg RNA as described above. cDNAs from sorted
pancreatic a- and [3-cells were prepared as described in reference [Heimberg
et al., Proc
Nat Acad Sci USA 93'~:7036-704:1 (1996)]. PCR reactions were performed with
one third
of the RT reaction using the same primers and conditions as described above.
The
conditions were compared to PCR made on the same material with rat (3-actin
oligonucleotides primers [Heimberg et al., Proc Nat Acad Sci USA 93:7036-7041
(1996)]. Reactions were monitored after 15, 25 and 35 cycles and analyzed on 1
agarose gels stained with ethidium bromide.
Cloning Of fiat LiverlHeart MCD: Oligonucleotides based on the cloned
sequence of the rat j3~-cell MCD [Voilley et al., Biochem J Submitted (1999)]
were
designed to amplify a 900 base pair product of MCD from rat liver cDNA using
polymerase chain reaction {PCR). The forward primer, PMCDF 1
{5'TGGTCGACGGC'.TTCCTGAACCTG; SEQ ID N0:6) was used with the reverse
primer, PMCDR (5'T'CCCTAGAGTTTGCTGTTGCTCTG; SEQ ID N0:7) in a PCR
reaction. This 900 by fragment was used as a probe for screening a Superscript
rat liver
cDNA library (Gibco, Life Technologies). The full length cDNA clone was
sequenced in
both directions using internal primers and compared to the rat islet cDNA
sequence. Rat
-40-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
heart MCD DNA wa.s cloned in a similar manner using techniques known to those
skilled
in the art.
Immunocytochemistry: To determine the cellular localization of MCD, a double
labeling immunocytochemical technique was used. McArdle RH-7777 hepatoma cells
, were grown on sterilized glass coverslips (60 % confluency) in a-MEM
supplemented
with 20 % Fetal Bovine Serum, pH 7.4 and incubated in a humidified atmosphere
supplemented with 5 % COa at 37°C. Anti-MCD antibody raised in rabbit
was used
against the MCD antigen and anti-heat shock protein (Hsp) 60 antibody, raised
in mouse,
was used against the Hsp 60 antigen. The Hsp 60 is predominantly a
mitochondria)
specific matrix chaperon protein [Stuart et al., Trends Biochem Sci 19:87-92 (
1994}j.
At 60 % confluency, the coverslips were washed 3 times in 1 x phosphate
buffered saline
(PBS), pH 7.4 followed by fixation in 4 % paraformaldehyde for 10 minutes. The
fixation reaction was terminated by replacing the fixative with 100 mM giycine
in 1 x
PBS for 15 minutes. The cells were then washed with two changes of 0.1 %
Triton-X
100 and 0.1 % BSA iin 1 x PBS (TA-PBS) for 1 minute each, and then
permeabilized by
incubating in the same medium for 30 minutes. The coverslips were then washed
with 3
changes of TA-PBS and then blacked in 5 % fetal bovine serum for 20 minutes to
prevent non-specific binding of antibodies of choice. Following 3 washes in TA-
PBS,
coverslips were incubated for 2 hours at room temperature (RT) with rabbit
polyclonal
anti- MCD antibody (dilution 1:100). At the end of this reaction, the
coverslips were
washed with 3 changes of TA-PBS and incubated in mouse monoclonal anti Hsp 60
antibody (dilution 1: li 000; Stress Gen Biotechnologies Corp., Canada} far 1
hr at RT.
Following this, coverslips were washed 3 times with 1 x PBS, pH 7.4 and
reacted with
goat anti-mouse rhodlamine (Rh; 3ackson Immuno Research Laboratories, U.S.A.)
conjugate (dilution 1:200) and goat anti-rabbit fluorescein isothiocyanate
(FITC; Jackson
Immuno Research Laboratories, U.S.A.) conjugate (dilution 1:200) for 1 hour at
RT. At
the end of the secondary antibodies reaction, the cover slips were washed in 1
x PBS, pH
7.4 and mounted in 50 % glycerol containing 1 % propyl gallate, an anti-
fluorescence
photobleacher, on microscope slides and stored in the dark. All slides were
examined
with an Olympus fluorescent microscope and/ or with a laser confocal
microscope
-41 -

CA 02339088 2001-02-08
WD 00/09710 PCT/CA99/00734
{Leica) connected to a Silicon Graphics computer.
In other experiments, Mito-Tracker Red CMXRos (Molecular Probes), a novel
mitochondria-selective dye, was used to label mitochondria in cultured cells.
At 60
confluency, the medium was replaced with prewarmed medium {37°C)
containing 200
nM of Mito-Tracker :Eted CMXIkos and incubated for 20 min in a humidified
atmosphere
supplemented with S % CUa at 37°C. The cells were then washed in 1 x
PBS and fixed
in 4 % paraformaldehyde for 10 min and processed for probing with anti-MCD
antibodies to localize MCD within the cell as described above.
Western Blot Analysis: Samples were subjected to SDS-polyacrylamide gel
electrophoresis and transferred to nitrocellulose as described [Dyck et al.,
Am J
Physiology 275:H21~:2-H2129 (1998)]. Membranes were immunoblotted with anti-
MCD antibodies ( 1:500 dilution) in 1 % milk powder. The antibodies were
visualized
using the Pharmacia l~nhanced Chemiluminescence Western blotting and Detection
System.
Statistical Analysis: The unpaired t-test was used for the determination of
statistical difference of two group means. For groups of three, analysis of
variance
followed by the Neunnan-Keuls test was used. A value of p < 0.05 was
considered
significant. All data are presented as mean t standard error of the mean
{S.E.M.}:
EXAMPLE 1
In this example, MCD was characterized in the rabbit heart. Use of previously
described assays, such as the spectrophotometric assay to study the activity
of heart
MCD activity proved to be extremely variable, and high background values were
obtained with heart tissues [Kolattukudy et al., Meth. Enzymol. 71:1 SO-163
(1981)].
The assay also did not have the sensitivity to accurately measure MCD in the
heart
tissue, with the spectrophotometric readings routinely being very close to
high
background absorbance values. Also, the radiotracer assay which utilizes 14C-
malonyl
CoA is an expensive assay. Hence, a new assay was developed which quantified
the
amount of acetyl CoA formed by MCD (see Methodology section). The assay was
optimized for use in heart homogenates, as well as for isolated mitochondrial
-42-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
preparations. A tissuE; protein standard curve using heart homogenates
demonstrated that
2 mg of tissue produced MCD activity which was linear for up to 20 minutes of
incubation. Similarly., a time course standard curve using a 10 minute
incubation time
produced rates that were linear when 0 to 10 mg of tissue were used. Therefore
2 mg of
tissue homogenate and a 10 minute incubation period was used. This gave acetyl
CoA
values that were in the middle of the acetyl CoA standard curve. Similar
experiments for
time and protein dependence were also performed for the isolated mitochondria)
preparations.
Using the MCD assay, the existence of MCD activity was identified in heart
homogenates obtained from rats (Table 1). Rates ofMCD activity were found to
be
significantly higher than previously observed rates of ACC [Lopaschuk et al.,
J. Biol.
Chem. 269:25871-25878 {1994)]. Since malonyl CoA synthesis from ACC is under
phosphorylation control, experiments were also performed to determine if MCD
was
under phosphorylation control. lfsolation of tissue under conditions that
preserved the
phosphorylated state of the enzyme did not alter rates of MCD activity
compared to
enzyme isolated under conditions which did not attempt to preserve the
phosphorylation
state seen in vivo (Table 1). However, incubation of heart homogenates in
vitro with
alkaline phosphatase resulted in an increase in MCD activity. This suggested
that MCD
is under phosphorylation control, with phosphorylation of the enzyme resulting
in a
decrease in enzyme activity.
Crude homogenates, isolated mitochondria or the post mitochondria) supernatant
were also assayed for MCD activity (see Table 2). Measurable levels of MCD
activity
were detected in all these heart fractions. To determine whether the levels of
MCD
activity observed in these fractions was due to the MCD being localized to the
mitochondria) matrix as previously suggested [Jang, S-H. et al., J. Biol.
Chem.
264:3500-3505 (1989)], the same fractions were treated with octylglucoside.
With the
addition of octylglucoside, the relative level of MCD activity
- 43 -

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
TABLE I
Malonyl CoA Decarboxylase Activity In Aerobically Perfused Rat Hearts
y Y :: .::: ::::: :: . ., ~..~.~.~..~""...
'~:::':;::. ...... ...: . .. .~, .... . <_.............
::: ::: :: :: x..: ~ ::..:.::.::::...... . ... .... ...
....... .... ......, .... . ... .... ,.......r............
.. .,.. .....5 '.... .... .. .. ...n . ... ...,........
...... .... .... .:.. ...,..:'..,.........:..:< :..." .. ....
... .. i ..~' . ...
...... ...... .. .. ~....H .................. . 3
:.......<..............,..
. . .... ..... ....:.. ...... .. . .... ....: .....k
..... ,.,. ..... .....,.;x.....w .. .. ... .............
....e, ....5 .... ....'i.. :.~.~:::..;..:,.,.s...,.r .. . ..,z.ix
.... ;,:,. ;,,., ..::::::::::.:..v:::~.u..<....
:::::.:::::. ::...;:::......: ~::.:;.;:::::.~:,.r:.:::::.:::.....
>.. ..,......a.:v:...~>:::::: ...........#.....
...... .,.: -:: ,..::.s-...;,<.:~:.::... ........ ............
. s.... .... :. ........
.. . .. ....y.... .... ... % .
... .... ~ ... 1 .
....k~.... >.. 5 .. : : ..:
.;.. .
;:, ~..........
.,...:... .
... .
> ,
. ::
:~ ~
::. .;::: f
::
:
a~
.
'~
~
t
s~
l
.. ........,
............ .. . ....
.... ....... . .
... .: .
;::: ,.;.,:.......... . ..
::.~::. . .
: , ;:::.
,.:.. ".."r,.,.
: ..... ::
:. ! .. y.;;..... ,.s
. :::::~::>.S
. ' a . .. .. ,
;..... ..:. .............,.. . - ............,
.:: . .::.:.::. .; : .
...:..:.. ......:.......... . .
....:.. :..::::::::
.:::::, W
.::::x.;:::~:.::w::::f,.,~~ '
:....:.......,....3 .:....::..:..::.,
:.::::.::::.::.~. <,,..::~::.;.,...,,
.. .. . ..... ... .....:93...........
...............~'~.'. .3 ......
'...L:n.::::::.!.: .:
......,e...
:
.::
:
~ -
.::::y::
M.:
:~~:
:~
:::::
~::
:
::::
-~
'
, ........,."....., .
. ~ , ..
. .:::.-:::::..
,. ;.,.....
. ............. ... .. . . i :C~::::.::
. . ~:..:,
. .... .. . . ........ . ...:..
.. ...........:n.::.. . , v . . ,
.................
, ................... ........;. .....
.~.~: . .:. .. >. .........
. ...............................,.,
. ~ : .,.........: . ..
::::::::: v~: ,. . .;: . .; , ...:.
:: :..,.:::,.,.;::::........ ...........>.....
.... : : .w :: ~: .... ;...
F,.... :, f:::::::?:::. :.;: . n ..... , n.:y~.
.. ::::.>>.... ................. '?'.............
.....,.:.: ..~: f;.:<..~: . .:.::.:f :.. ...
.::: : ...,.. . ...........:.
. ..........: ...o.......: ..:
... .... . ~ c......;.,..: . .. .. .. .; . v:~.
.;: .; . ;..., ............ ... ... ...... .r................
...... ...., f, .., . f
....."... .. ........ ...5.. ~ ~
. ....: ,..... ..:... ..:.
v :..,. .....>,.... .... ....... u.
p.... .
v ::;:.r: ::: :.,:~.; .....:
.... ; . .. .....;. .. .....
...:.::.:.~ ~.:~:: >..; ;.
.... ,.......,.....~.
.~.... ....5:.....:::: ~: ~
~:: f . ......... ~....
. ,:.:.. :::: a::::: . ....
.
.... ........ .....<. :
,.. :..~:.::...s...,................
....".,... .....:....:.:..::~
:
.:,p..:;~ ..~::x... ..... .
, .... . ......,:: . ..::
:.:.~:::::::::. ~::..,..;:.
..............5..... ,
<>.
.
~
a
x
~~
'N
....:f..,.............. .n,....:;..::::,:; .:.:.;
. ..:;............:.Y:. .
, ;.'~:.:..:::i::
... .... :::. .;::::::r,~~:~>:
:: x.::.:.... >:
::::.>.:::: ., : :.: _.X~:.
:: ' .. .,.:~:::.sq:.......
r,.n' ,.:~.:.
~.. ..... :.. r,:: , .. c .... ~
...~ ::: . ~ :.
a~...::w.. .... .....r.,...
......".'.::::>::.~>,<:::>a.:::%::
.... ~:; ..
.b .~....,>v.,~.. . . :
:
~ ~:>
. :'. 'n<: a
. ,yrr. ~- ...y~:. . Y. s
,_ .
..k 6na:.k;~
Control 7176 1269
(+ NaF, + NaPPi) (n = 5)
UnconUrdlled 7672 1311
(- NaF, - NaPPi)
(n = 5)
Uncontrolled 12433 914*
(- NaF, - NaPPi, + ~;aline (n = 4)
phosphatase)
Values are the mean ~ S.E.. of at least 4 hearts. Heart homogenates were
assayed for MCD activity in
the presence or absence of NaF and NaPPi and with or without alkaline
phosphatase treatment.*,
indicates signiRcant differences between groups of hearts.
TABLE 2
Malonyl Co~A Content, Acetyl CoA Carboxylase Activity And Palmitate
Oxidation Rates In 1 Day And 7 Day Old Isolated Perfused Rabbit Hearts
x'~>x.. .r.Y.:..: S _
..~~':. .'...... $
...~.:.:..:.:~ ., a>
~:'.'5$'.':::;;::::.n.:::~:.:;~;.....
:::. , ...... . >.''r;fv.~'.'::'.'>si'. :.~:w,.">.
:.:..::,..v;.....,:.,..,5:','.!.... .. t e~ N
;.:.. :,.:Y.. , ..~.,..... F ..
...................:.,::,...:::. ~... v:~:...,.., ~ :..........
.;:.:.......:...,-.~"
.....,....~', ' ::::~::5 , ....n. .. .:. ..
:::..:.:...........::::...::........,.. ..:,.:t..H:..y.. ., .::
.::':..::::.,;.,
::.: ' -r' - ...:..:.......:..::.. . ..:::...:::.:..............
:.::~:,.-~v:.y:x~.::: . ::.:::::::- '~F . .v.. . . .., :4...
i: ...,~ ...~.....w::;:.........~ 1, ...
>:: .. - v.<..::::. .. ,>. .. ....:.>.,... .: :...
.C..:.:::..v;:..:..
:,:.::~ ....... . ..e<.... , y,.;... .,: y~~:: ~::. >.
~::::': ~< .........::::::: :::.;:.a:, .::...,..,.; . .. ..,.v.
i: .,,.< i . ,, .. ..:.:..... <.. .... ...v..
:: c.. ... ,~' ; ~ . . ?. .., ..
. . . .n~:..:.v.,.;,
. : ~; : i::'Jr:::' .
~:: : ' ! :.i::!i:!. ::' ,. ' ~ '
.. . . :'
y:. .. :4: '~
. a:fi:::::W~~
~ ~
~ ~: ' . . ~
> > ~~~
?
~,
.
.. ...
~.::::,:.::::::::.~:,v::::....y.. ;
:.~ : ~:. :.o.<.
.......................... >y. . .,
....,...........,......: ... .: ,
..., .....; :::::.:~:::.~:....... ..:....
....................., s> > ....
.......v.. . ... .::..... . ..
:,. > :. .........k.<. ~
:......,:,;:::::o .v . ... - .~ ,...w:
:~:.~.!. . ..................>.....>..
::. ................... ... ... ... .....
- .... ..................
.... , v: ~~. . ..., <.
.. s. ~::.~::a....... .. ....
...... .. .. ... ...............o
:: ,. .....:...-,....,.<
::: .: . ..,.,..n...>.,...
.,n : :::::x.,... ,...............
; .:. . ........::::
. .. ::.~:::::: =r::::::
,::. ......................... ~ .;5>'": .::~
:n .. ~ ::........
.........., . :: :v:::::?~:::
... .,. ::. . . .....::.~.~:::::.~...
.......... . ~.:.,:..1
... :. :
.. ..:. :
~... .. ~
. .... ~
: .......... ~
. ........ .
......... .. !
;X....~o ..
........ .
.. :
.. ...
.v .
.......... :.
.....,.,...... ,:
. .;..,....
.. .........:
.::.~::::::y .
~::::.~~:v::::,. :.
... ..:.~#.:
. r.
r.... .
; .
........... .:
::: ..,..
~........e ~,
:~x::f.:YV:.~:::::... ..
. J:
~ .
;: x>.A
~::::: ......
: 'x'..:,
.
..,.
!
.,~
.
.
~
.
.
~.
2
:
t
~~~
~
f
:.:........:. .~::::>:... . ........
............,.:..::::::.~:.~..>..;.. ........ .. ,
.......
...................,.".!Sy.......v: : : : ..... ::
:::::::::::.::
........................~..,..::.: :........: : :.,
..........,....... .. .:::.... . ...... .:. : :.:
:.. . ~...:...7.... : ..........:,.. ,. :;
...r:...... . ...-~!..:...............,.. x ,
". .. .::.~: ... .......... .....:
. : F : ... ................. ~" . .;::: :......
:.. ~..: .. .. :. :...:.,
.... <>... .........:...a........::::::.~:.:~:::
..5..~.....r. ...............r. .
. C:. ... ... .........,..............>.
.. ......... .: ......:.:~.~::
..... ....:.. ... . ..,...............~:5;.:.::...
. ... . .................
. ~ , - . ..........,...............
: ......... .......
~'
, . .. ................
.... ...,..... ............ ... . ...................,.
.............,... ....:.........:...n...> >..~. ...............,.
. .... ...... ................. ... .....
:: . ~:::.:::.~:.... .... .....,...................<.
...............,...:.
.......................,f.l................... .. ....... .
........:.,..... ..........;....5 . n. ..... .........
.......... .:.:.~.~:: ............: :.~::: . ::..........,L
.............,. ... :.:........................:........o, .....s..
.... ,.M.... :..e. . x .... . ........
.........,..,....... :. ...... :.:.~:::.~:.~:v.;.. .
...... ,....... :. .,. :.: ...............:: ..... :..::::
::: ...:..:. :....... :::..:. :: xf:.,:$
:.:..:....k.... :..-. :.
.................,...:..::..:::::::::::::;.. ..., .. L....
..:. ,.... : ..: .. ... ., ....... ,:;
... . .. ...................;......... . ...:
.......... .. .........................:.,::.: ....,~... ..
... . ...........................................,..... ..
.: ...:;....:
.: . .................................................:...
..
.. . ... .. . ... . .3 .
;.. ....:. ....... : - . .... ........r
....... ... . .:::..... ... .s
.. .. . ~::::>.. .... .,.........
.,.,.. . . .. ..... .
, .. ....r
. .......:
.....:.e:. .~....~
..::. ..
. :
. ..
.. .
....... ..
..
.,...
:v:
~.
v
:
.
......
...
....
~~....
.
..
.
.
::::::~..,
...
...............
,.
...
:...
.........
....
...............
...
..
......
-.
.
.
'
... ............ ....:. . .
..:.: ...... .... ...:. ... ..
: .................. ~...:: . . .
. ...............................:................................ .
...., .........
...: ..........,....... ......: ..... ,... .: ... . ..._.
...:.:: ..,...,............. . ......:.:. . 5. .5. . ...
. ................................ : >...........
.......y. ..,........ . : .. :.........: . ... ... . ..
.. ............... ....._............. ........................ ..
...., ..
..".. .......................... :...... .... ......,
.. ........,.......... . .......:...:. .:. :: .. . .....
., ...... :... .. .............:........................ .......
.. ...
......... ... .................. .... .,..............<......
. .............,.............. ..............: .,
.. .... ...
.:...........................~...:,...................SL.... :
....x............."
.:..... .........,....................,. ....~~'..... w
....,..,.....
...:. ....n. :... :.. .. ... .......:
.:......:.,. ........ :: : ..;......,......,:.. .
..................,.>,
,$ ................... ................,. ................,.
.. ....:, ..... ... . . .
.... :: ...... .....................
..: ........ ... ............ .. ............
. ..................> ... ,. ,.........~..... ......... .:.:..
:. .,....... ....~f'~ ......................<..
...'!~ ....,...'k............ . . . . ... <.............
.. , ............ . . ,
... . . .............................
.........................,i..
. : ?..... .: .....
.. .: ........ .g
...., ............. ...
r. ".......>,.................. .
e. .... .. : .
............,.... ....... :
..> ............k ~
e. ..... ................. ~
.....,.. ..: .. :.......
...,... ,r
..<,.>..................... ~
~
...,~.............. . ........... ... . ....
:......5 ....... . <: .............:".r ,...
. . ......,"...... ..................:>.................... .
. ................. .:. :... : .
. .............................. .. ............ .........
rte, ~..-~..........:......... .
:.........>........................,.:...::...................
r.. .... ... .:.-...... . :......................
.... ,.,...,..,..... ... , .:.................: ...... ,
...,.<. ...........................".:.::::..
......,..........................................
....... ........ .~ .,. . . ..................
~>..~... .....; .:..;................::::... ..............,......,.
. .................,........... .. ......................
..................z
.< ..... . . . .... .. . :.....................
....,...... ..... .
:~:::::::......_~......,..............:.....::........ >..
. ......... . . :::.~:.~:::::
<...,., , . ..: . ., y ::::.:........:.:.::..... ............
.. :.:::.:::. ,.~a..,....,..".
..... xh..~. .~.. :: :.::::::::::
....>..........> . . : :.:: ~4~
.....:... x~ ~
... ... ": ::...;...:...:.
:.... ..,.........>.,
.. a .........
.
' , . ,
1 108.5 0.208 +_ 0.057* 4.7 1.0*
Day 2.5*
(n=5)
7 3.6 (l.25 0.036 0.003 46.7 15.7
Day
{n=5)
Values are the mean ~ S.E. The malonyl CoA content and ACC activity were
measured as described
previously (7) and the palmitate oxidation rates were determined as outlined
in the "Methods" section.
*, indicates significant differences between appropriate groups.
44
SUBSTITUTE SHEET (RULE 26~

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
"
"
'
,'~.~n
.
U
~''v v U
~d
~
.
~ b ~
c
i o a-n
s
M
-
l.z."~~'":.M
~
~ ;'fi
-.,::..:.,:::"'
' "
~ Q
x a .~
~..>::~~
w:
.:<
~
~~ ~HN
'
o ,::: ~ w v
~~
.~ >
r
:
'
'
a.,;<:>;:' ...,
c ' iF ~ U .0~.
v ~.
:~;i~
'
.;~
.
~
~
~ . ~ ,
d y ... ..
tr
.:.:::
'C~ ,r.~ *:
~ ~
, y ..
" ~
t~ r~ ~ 00 N ~ ~ ~
~ ~, v
:::;ww~N!N::v~~ ...1V)
x O :11~; ~
H 'vr~ ~U ~" "
~
y
nww cCJ .~
r~
U v ''
.d ~ U ' '>
;:
% ':ii'..~
r
:
::
' ~ o
:~''
'
o ' ... ~ ~
,:: o
":
~:~_:.;.,c.;
;
o, :~::~ ~ v 3
yr
~f
r,. U ~ N
'~ a d: a d a~ ~ ~u
x y ~
;:~',r~..:;:~:::::;:.:
,:::: o
::v::r';:+i *' j ~
II II ~
O ; '. V) . t
wr.<~F~;.'.;wr ~r a~
~ ~ ~ U
::
.
,
~ 3 .-~.~~.::,:>;.a~ ~,:
ca .
_ M ~ ~ ftf
V
~~ "
.S"~
~....ar ~
'O ~ .
'
~ F
cHC .':::: .
U ;::., O ~
ix. O 'G csi
~ ~
;
:
:
'
:
;:
.
.
:
~
U ;: ., m
:;: E'
x~
~t~:
:
:
:
~.s.
o ~
. 'O U t'e'
a
U ~
~" H
N .
_ w ,x, 0 .~
1~' .~.i'.M 0 U
>~
, ~ O ,..,,Q U
U '~ rw N ~
"~,. N
~ ~
O
'>~
v ~
O ~~ M
~ O r
N
~ O ~ N "d >3'
a:..~ II
' gi
~ ~
:~ n
:,p:.''F N .
:.:~~'::r,Y:z's ~ i" p,
U 0., ,. o ~ o ~,
.; 0
~'~;
.;., .o :: ," ~ a.
t
;;::x,:::.:,-.:.:::~ o, ~
d ~
'~z<~
o ~,;
,
w . t .~ ~ .~
::-:Y ~
'
_
Ri : !1 Ny n-~ O CC
,~A
.::v
~
~
~'~'
.. vi C7 O ..""'..
; N N H
.~ ~ ~ U
~
. ~. +i +I (,~
,, ~ ~
~
~,
~"rC o ~ uj ~~ II
Y.
~ C~ ~ ~ o O
M ~
N '~
'~' f3~
:
o w; a
~ o
. c
~ a
n
U V w..i bD
y
O CC LJ
H
v ~ o
d '~, ~ '~ ,~
H
<-:.: ~ ~
:~ H
:rs '
,
:.: p"
: ~ ca
..
......
45
S(JBSTITUTE SHEET (RULE 26)

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
in the crude homogenate increased approximately 6 fold. In isolated
mitochondria)
fractions a 14 fold increase in MCD activity was seen compared to the
untreated isolated
mitochondria) fractions. This increase in MCD activity strongly suggested that
the
solubilization of the mitochondtial membrane allows the MCD to be released
from the
matrix or exposed to the extra-mitochondria) space. This confirmed that a
large
proportion of the heau~t MCD is localized to the mitochondria) matrix.
To characterize the physical properties of MCD, Western blot analysis was
performed using an MCD antibody [Kim and Kolattukudy, Arch. Biochem. Biophys.
190:234-246 {1978)]',. In rat heart and liver tissue, this antibody cross
reacted with high
amity with at least one other protein. Since this other protein was found to
be catalase,
the results were further clarified with the MCD antibody using an antibody
directed
against catalase. Rat liver MCD was partially purified using the procedure
described
above. The partially purified protein was loaded onto two Ianes of a non-
denaturing gel
and subjected to electrophoresis. After electrophoresis, one lane was
transferred to
nitrocellulose and blotted with MCD antibody, while the other lane was stored
in water
for future use. In Western blots from a non-denaturing gel (see Figure lA),
the MCD
antibody reacted with one large band which is approximately 160-190 kDa as
predicted
by Kim and Kolattukudy, Arch. .Biochem. Biophys. 190:234-246 (1978). The
position
of the band was aligned with the non transferred lane of the non-denatured gel
and the
region containing MCD was extracted from the gel. The protein from the gel
slice was
eluted (so as to create a substantially pure preparation) and either assayed
for MCD
activity or subjected to SDS-PAGE, transferred to nitrocellulose, and blotted
with the
anti-MCD antibody (see Figure lA, lane 2). The eluted protein exhibited quite
large
MCD activity and when subjected to Western analysis, reacted with the MCD
antibody.
The blot was then stripped and re-probed with anti catalase antibody to
ascertain which
band corresponded to the catalase proteins) (Figure 1, lane 3). This
experiment
determined that the molecular v~reight of rat liver MCD is approximately 45
kDa. This
result is consistent with previous conclusions that the native enzyme is a
tetramer Kim
and Kolattukudy, Arch. Biochem. Biophys. 190:234-246 (1978). Western blot
analysis
was also performed an denatured semi-purified heart samples (see Figure 1B).
Under
-46-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
these conditions the 45 kDa band was identified in both liver and heart tissue
samples
(Figure 1B, lanes 1 and 2). If samples were treated with alkaline phosphatase
and then
subjected to SDS-PAGE and western blot analysis, there was no shift in
molecular
weight of the protein.
This example clearly demonstrates MCD activity in control hearts, and
identifies
a cardiac isoform of 1VICD, of approximately 45 kDa in size, that can be
phosphorylated
and inhibited by a yet unidentified kinase.
EXAMPLE 2
In this example, the role of MCD in regulating fatty acid oxidation is
described.
Previous studies have; demonstrated that myocardial fatty acid oxidation
increases
dramatically between 1-day and 7-day rabbit hearts [Lopaschuk et al., J. Biol.
Chem.
269:25871-25878 (i!a94)]. As shown in Table 3, a significant increase in fatty
acid
oxidation rates is seen following birth in the 7-day old hearts compared to 1-
day old
hearts. This was accompanied by a decrease in malonyl CoA levels and an
decrease in
ACC activity. However, to decrease malonyl CoA levels in the heart, a
decreased rate of
synthesis would have to be accompanied by a simultaneous degradation of
malonyl CoA
or metabolic utilization. MCD activity was therefore measured in 1-day and 7-
day old
rabbit hearts. As shown in Figure 2, the MCD activity in 7-day old rabbit
hearts was
significantly elevated compared to 1-day old hearts. In light of the amount of
malonyl
CoA present, these high rates of MCD activity suggested a rapid turnover of
malonyl
CoA. If heart extracts were dephosphorylated in vitro with alkaline
phosphatase no
change in MCD activity was observed. This suggested that unlike adult rat
hearts, MCD
activity is not under the same degree of phosphorylation control as seen in
newborn
rabbit hearts.
Reperfusion of adult rat hearts following a 30 minute period of global no-flow
ischemia (global no-flow ischemia shall be defined as the cessation of blood
flow to all
parts of the rat heart for the specified time period) resulted in a dramatic
drop in malonyl
CoA levels (data not shown). A parallel decrease in ACC activity was observed
as well
as a slight increase in fatty acid oxidation rates. However, since cardiac
work is
-4'7-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
significantly inhibited during reperfusion of ischemic hearts, a large
increase in fatty acid
oxidation per unit work was observed. Measurement of MCD activity in aerobic,
ischemic and reperfused ischemic; hearts is graphically shown in Figure 3.
Levels of
MCD activity were maintained af: the end of ischemia and/or reperfusion:
Treatment of
S samples with alkaline phosphatase also resulted in an increase in MCD in all
groups.
Figure 4 shows the MCD protein levels in samples extracted from aerobic,
ischemic and ischemic;/reperfused rat hearts. Levels of MCD protein were not
altered
during the perfusion protocols, nor did the molecular weights of the MCD shift
between
the different groups, suggesting that MCD is not modified post-translationally
by
phosphorylation. Also, when whole heart extracts were used for Western
analysis,
another protein of a slightly larger molecular weight was detected than that
seen with
semi-purified MCD from mitochondria (see Figure 4, lanes 3-8). It is likely
that samples
which contain cytopla~smic extracts, instead of purely mitochondria) extracts,
may also
possess the cytoplasrruc form of MCD. In the goose uropygial gland, the
cytoplasmic
1 S form of MCD is approximately SS kDa while the mitochandrial form is
processed
post-translationally into a 50 kDa molecular weight protein [Courchesne-Smith
et al,
Arch. Biochem. Biopltys. 298:576-586(1992)]. Western blot analysis suggested
that
similar processing may occur in the rat heart.
EXAMPLE 3
In this example, based on the results shown in Figure 3, a model which may
contribute to enhanced myocardial ischemic injury has been proposed in Figure
SB.
During ischemia AMI'K is activated thereby inactivating ACC upon reperfusion,
resulting in a decrease in malonyl CoA synthesis [Lopaschuk et al., J. Biol.
Chem.
2S 269:25871-25878 (1994)]. In the presence of a maintained MCD activity a
reduction of
malonyl CoA levels occurs in the heart. With the fall in malonyl CoA levels,
CPT1
becomes more active due to the removal of its inhibitor. This results in an
increase in
fatty acid oxidation rcites, which leads to an enhanced ischemic injury. This
model
implicates MCD as being an important contributing factor to injury during
reper~usion of
ischemic hearts. As av result, pharmacological modification of MCD may also
prove to
-48-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
be a beneficial approach to treating ischemic heart disease.
Thus, the present invention demonstrates that the heart expresses a 45 kDa
isoform of MCD which is important in regulating myocardial malonyl CoA levels.
An
increase or maintained MCD activity in conjunction with a decrease in ACC
activity can
result in a decrease in malonyl CaA levels and an increase in fatty acid
oxidation in the
heart. It is contemplated that drug screening by using the novel MCD
composition and
assay of the present invention will help to identify such potential compounds.
Such
inhibitors axe contemplated to be useful in the treatment of ischemia.
EXAMPLE 4
In this example a purification scheme for rat liver MCD was developed which is
substantially different from that originally described by Kolattukudy et al.
[Kolattukudy
et al., JBiol Chem 71:150-163 (1981)]. The butyl sepharose and the phenyl
sepharose
columns are hydrophobic resins which will separate proteins based on
hydrophobicity.
1 S Since MCD is eluted from the column quite late, it suggests that the
interaction between
the column and MCD is quite strong. The Q-sepharose column is a strong anion
exchange resin and as the salt gradient is increased two peaks of MCD activity
separate
at different ionic strengths (Figure 7B). The MCD contained in these two peaks
possess
identical kinetic characteristics but are distinctly separated. Since our goal
was to purify
large enough quantitic;s of MCD for specific down stream applications, we
pooled all the
active fractions from both peaks to run on the next column. These fractions
were
applied to a SP-sepharose ration exchange column. In this case, MCD eluted
relatively
early in the salt gradient, indicating that the interaction with the resin was
weak (Figure
7C). Due to this weak interaction with the SP-sepharose column, MCD could
easily be
eluted from this resin by its negatively charged substrate, malonyl CoA. This
presumably
altered the conformation and/or l:he net charge of MCD such that it could no
longer
associate with the SP-sepharose resin at pH 5.5. A summary of the purification
scheme
is shown in Figure 7.
This newly designed scheme allowed MCD to be purified more than 1200 fold
from the initial 55 % ammonium sulfate pellet (Table 4). Due to the inability
of our
-49-

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99/00734
fluoromertric assay to detect MCD activity from whole cell extracts the
purification
profile only represents the increase in purity beginning from the
mitochondria)
preparation. For this reason we are confident that we have actually purified
MCD
activity to a much grE;ater extent than we have indicated. When pooled
fractions from
the columns were subjected to S.DS-PAGE analysis and stained using a sensitive
Coomassie dye, we detected two proteins with molecular weights of 52 and 65
kDa.
Previous work on mammalian MCD has suggested that the 52 kDa protein we
observed
was MCD [Dyck et al., Am JPhysiology 275:H2122-H2129 (1998}; Voilley et al.,
Biochem J Submitted (1999}]. Irnmunoblotting experiments revealed that the
second
protein (which co-purifies with MCD} was catalase, suggesting that our initial
mitochondria) isolation also contained peroxisomes.
EXAMPLE S
In this example oligonucleotides based on the cloned sequence of rat islet MCD
cDNA [Voilley et al., Biochem J Submitted (1999}] where designed to amplify a
900
base pair product of MCD from rat liver cDNA using PCR. This 900 by fragment
was
used as a probe in the. screening of a rat liver cDNA library. A full length
(2.2 Kb) clone
was obtained, sequenced in both directions and compared to the rat islet MCD
sequence.
The cDNA sequence encoding rat liver MCD is shown in Figure 8. Sequence
comparison between liver and islet forms of MCD reveals that the two forms are
identical (not shown). The potential phosphorylation sites are still present
{Figure 8)
along with the potential peroxisomal targeting sequence (SKL). The two peptide
sequences obtained from amino acid sequence analysis are numbered and
underlined in
bold. A leucine zipper motif has also been identified (underlined and black
dots) which
may be responsible for the protein-protein interaction required for MCD
tetrameric
structure similar to phenylalanine hydroxylase [Hufton et al., Biochem Biophys
Acta
1382:295-304 (I998)].
EXAMPLE 6
In this example rat liver MCD was characterized. The fractions from the
affinity
-SO-

CA 02339088 2001-02-08
WO 00/09710 ~ PCT/CA99/00734
elution of the SP-sepharose column which demonstrated the highest MCD specific
activity were pooled and aliquoted. The first aliquot was subjected to SDS-
PAGE. The
52 kDa band was cut from the gel, digested with endoLys C, subjected to HPLC
and the
appropriate peptides underwent' amino acid N-terminal sequencing. The amino
acid
sequences of two internal peptides were obtained and compared to the cDNA
sequence
obtained from the rat liver cDNA clone for confirmation. The second aliquot
was used
for kinetic analysis. MCD activity was measured at various concentrations of
malonyl
CoA to determine the Km. Figure 9A demonstrates that two Km's may exist, one
at
approximately 1-2 ,uM and the other at 30-40 ,uM as determined by a Lineweaver-
Burke
plot. This latter value, is similar to the published Km obtained from a crude
rat liver
MCD preparation [Kim and Kolattukudy, Arch Biochem Biophys 190:234-246
(1978)].
A pH dependence curve was also performed to determine the optimum pH at which
liver
MCD is most active (Figure 9B). In our fluorometric assay the optimum pH is
between
7 and 8. Both these results are similar to the existing information available
on rat liver
MCD [Kim and Kolataukudy, Arch Biochem Biophys 190:234-246 {1978)].
Our earlier work has indicated that cardiac MCD is under phosphorylation
control [Dyck et crl., Am JPhysiology 275:H2122-H2129 (1998)]. Using our
purified
liver MCD and a wide; variety of kinases and phosphatases we were only able to
identify
alkaline phosphatase ;~s a potential regulator of MCD activity {Table 5).
Similar
experiments were performed which dephosphorylated and activated MCD using
alkaline
phosphatase and then tried to inactivate the enzyme using various kinases. All
of these
experiments proved to be unsuccessful. The kinases or phosphatases tested were
casein
kinase II, cyclic AMP dependent protein kinase protein kinase C; 5'AMP-
activated
protein kinase, protein phosphatase 2A and protein phosphatase 2C.
Another group of pooled fractions from the affinity elution of the SP-
sepharose
column was subjected to SDS-PAGE, coomassie stained and the 52 kDa band was
cut
from the gel. The protein was eluted from the gel fragment and injected into
rabbits for
the generation of MC:D antibodies. Similarly; another fraction from the
affinity elution of
the S-sepharose column was injected into rabbits without undergoing the gel
separation
step. This procedure could ensure that we obtained antibodies which were
generated
-S1-

CA 02339088 2001-02-08
WO 00109710 PCTICA99100734
against both a denatur ed and a non-denatured MCD protein. Western blot
analysis using
rat liver mitochondria revealed that both antibodies recognized a protein with
a
molecular weight of 52 kDa (Figure l0A). The antibody generated using non-
denatured
MCD (MCD240) also recognized catalase, while the antibody raised against
denatured
MCD (MCD239) appeared to be more specific for MCD (Figure 1 OA). MCD 240 could
immunoprecipitate a protein with a molecular weight of 52 kDa, although, MCD
activity
could not be detected in this immunoprecipitate.
To confirm that the antibodies raised against purified MCD were indeed able to
recognize MCD in sollution, we performed immuno-inhibition studies (Figure 1
OB).
Purified rat liver MCI) activity was measured using the fluorometric MCD assay
described in the Methods section. The purified MCD was pre-incubated with
either
MCD239, MCD240 or the appropriate pre-immune serum: After 30 minutes, the
mixture was measured for MCD activity and expressed as a percent of MCD pre-
incubated without serum for an identical period of time. Figure l OB indicates
that only
MCD240 was able to inhibit MCD activity. Since MCD240 inhibits MCD activity,
the
results would seem to~ explain why MCD240 can immunoprecipitate MCD while not
demonstrating MCD activity in the precipitated pellet.
EXAMPLE 7
In this example, using Western blot analysis and the MCD240 antibody, the
distribution of MCD in a variety of rat tissues was determined. All tissues
tested
expressed relatively high levels of MCD protein. Oxidative tissues such as
liver and
heart express the highest levels of MCD protein supporting the concept that
MCD may
play a role in controlling fatty acid oxidation [Dyck et al., Am JPhysiolo,~y
275:H2122-
H2129 (1998)]. The:>e experiments used detergent solubilized whole tissue
homogenate
to measure total MCD levels. This prevented a loss of MCD protein based on
cellular
localization.
To determine the subcellular localization of liver MCD we performed double
labeling immunocytochemistry on rat hepatoma McArdle RH-7777 cells using two
separate approaches. First, antibodies directed against either MCD or a
mitochondria)
-52-

CA 02339088 2001-02-08
WO 00/09710 PCTICA99/00734
matrix specific protein, Hsp 60 [Stuart et al., ?'rends Biochem Sci 19:87-92
{1994)]
were used. Both fluorescent and confocal analysis showed that MCD co-localized
with
Hsp 60 (Figure 11B, 1-3). Similar studies using a mitochondrial specific dye
(MitoTracker Red Cr~os) arid MCD antibody confirmed these results (Figure 11B,
4-
S 6). It is not clear whE;ther MCD is localized to other organelles other than
the
mitochondria. It is clear, however, that the much of the liver MCD is
mitochondria) in
nature.
EXAMPLE 8
In this example MCD expression and activity were measured in three animal
models where alterations in fatty acid metabolism have been previously
characterized.
Two of these are diabetic models where hepatic fatty acid biosynthesis is
inhibited {6
week old streptozotocin diabetic rats) or elevated (JCR:LA-corpulent insulin
resistant
rats). Table 6 shows the changes seen in both plasma glucose and fatty acid
levels in the
1 S various rat models. Serum levels of fatty acids rose 3 fold in the 6 week
old
streptozotocin diabetic rat and 1.75 fold in the JCR:LA-corpulent rat (Cp/Cp)
as
compared to their lean control groups. Similarly, in the 6 week old
streptozotocin
diabetic rat, serum glucose levels increased 2.2 fold above their controls.
Contrary to
this, the levels of glucose in the serum were unaltered in the Cp/Cp rat as
compared to
the lean controls. These changes in glucose and fatty acid levels in the serum
are
consistent with the pathophysiology of these animals [Russell et al.,
Metabolism 43:538-
543 (1994); Topping and Targ, Horm Res 6:129-137 (1975); Mathe Diabete Metab
21:106-111 (1995)].
MCD activity rose approximately 2 fold in the 6 week old streptozotocin
diabetic
2S animal as compared to control rats (Figure 12) while MCD activity was
unaltered in the
Cp/Cp rats {Figure 13). To determine if changes in activity were due to
dephosphorylation of MCD and/or to an increase in the relative abundance of
the
enzyme, western blot analysis was performed using our MCD antibody. The Level
of
MCD protein increased approximately 2 fold in the 6 week streptozotocin
diabetic rat
livers over control livers, while no changes were observed in the levels of
MCD in the
- S3 -

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
livers of the Cp/Cp rats (Figure 1.3). Catalase antibody was used as a control
to
demonstrate that similar amounts of protein were loaded and transferred in all
lanes.
Western blot analysis, however, does not reveal any alterations in the level
of MCD
protein in the Cp/Cp rat (Figure 13}. This suggests that changes seen in MCD
activity in
the Cp/Cp rat rnay be due to alterations in the phosphorylation state of the
enzyme and
not to the amount of protein.
Both phospharylation control and increased MCD protein levels seem to be
involved in regulating, MCD activity in the diabetic rat liver. When liver MCD
from both
6 week old streptozotocin and Cp/Cp rats are treated with alkaline phosphatase
we
demonstrated an incrf;ased activity of the enzyme for all groups (Table 5).
Alkaline
phosphatase treatment of liver MCD appears to consistently produce MCD enzyme
activity at approxirnat:ely 11,000 - 15,000 nmol/g dry wfl/miri', indicating
that alkaline
phosphatase treatment is sul~cient to produce a maximally active enzyme. Only
the
streptozotocin diabetic animals have higher MCD activity, which is probably
due to a 2-
fold increase in MCD protein expression.
Another well established protocol for altering fatty acid biosynthesis and
oxidation in the liver its to fast and refeed rats [Porter and Swenson, Mol
Cell Biochem
53:307-325 (1983); C;larke et al., JNut~~ 120:218-224 (1990); Witters et al.,
Arch
Biochem Biophys 308:413-419 (1994)]. Table 6 demonstrates the significant
decrease in
glucose and the increase in serum fatty acid levels at this time. Similarly,
MCD activity
was also increased duxing the 48 hour fasted period (Figure 14A). When rats
have been
deprived of food for 48 hours and then refed for 72 hours, there was a
decrease in MCD
activity (Figure 14A}. The levels of MCD activity begin to approach that of
control rats
which have not undergone the same fasting or refeeding protocol (Figure 14A).
Although MCD activity was altered during these various nutritional states, the
level of
MCD protein was not significantly altered (compare to Figure 12}. Once again
this
suggest that the activity of MCD is under past-translational regulation, most
probably
via phasphorylation.
EXAMPLE 9
_54_

CA 02339088 2001-02-08
WO 00109710 PCT/CA99/00734
The cloning of the rat pancreatic ~3-cell cDNA was performed in a two step
approach using degenerated oligonucleotides. One of the selected pairs tested
on INS
cells mRNA generated a single product of an expected size of 580 by as
predicted by
comparison with the ;goose cDN.A (Figure 15). Sequencing of this fragment
indicated
67% identity with the. goose nucleotide sequence and no match with any other
sequence
available on the blast server. This fragment was then used as a probe to
screen an INS-1
cell cDNA library. Among the 4 in. vivo-excised clones, only one showed
substantial
MCD activity after transfection into 293 cells. 293 cells did not express the
enzyme at a
detectable level either under untransfected conditions or following
transfection with the
j3-galactosidase gene. Sequencing of this clone of 2020 by revealed an open
reading
frame of 1473 bases corresponding to an amino acid sequence of 491 residues
and a
predicted protein of about 52 KDa. A poly-A tail with a polyadenylation signal
at the
end of the 3' non-coding region was also present. Previous studies with the
MCD
enzymes) purified from various mammalian tissues evaluated a global molecular
weight
of about 170 KDa suggesting that the enzyme might multimerize in vivo. The
deduced
rat protein sequence shows 69 % identity with the goose sequence from amino
acid 39, a
methionine, to the end. The nucleotide sequence surrounding this methionine
(AGCGCCATGG; SIEQ m N0:8) fairly fits a Kozak consensus site
(GCCA/GCCATGG; SEQ m N0:9), suggesting that it may be a_ site of translation
initiation. A sequence of 38 amino acids in-the same reading frame is present
on the N-
terminal side of this nnethiorune. The first amino acids of this sequence
(MRGL), which
starts with a methioniine, are identical to the goose sequence. However the
remaining
part of this sequence shows relatively little homology with the goose sequence
from
amino acid 5 to 3 8. 'Chis portion of the rat protein has the features of a
mitochondria)
targeting sequence since it is rich in positively charged (8 arginines) and
hydroxylated
amino acids and lacks acidic amino acids. Therefore, it is likely a cIeavable
NHa-terminal
targeting sequence bf;longing to a larger MCD precursor. No common cleavage
site
(R/K-R-A-X-S-S/T; SEQ m NO:10) in the presequence is present around Met39.
However another cleavage-site motif (PRLCSG; SEQ )D NO:11), as defined by Y.
Gavel is predicted around position 31, suggesting that the presequence may be
removed
-55-

CA 02339088 2001-02-08
WO 00109710 PCT/CA99/00734
by matrix proteases and that (3 (INS) cell MCD is, at least in part,a
mitochondria) matrix
enzyme. Motif analysis of rat MCD done with the web PSORT and PROSITE programs
revealed interesting fi~atures. In addition to the NHa-mitochondria) matrix
targeting
sequence, the C-terminal part of the enzyme ends with a peroxisomal targeting
motif
characterized by the SKL, signature. Potential protein kinase C and casein
Kinase II
phosphorylation sites (3 and 7, respectively) are present along the protein.
Thus, MCD
might be regulated by (de)phosphorylation reactions since both kinases are
present in
mitochondria. Rat MCD does not contain acylation sites {N-myristoylation,
glycosylphosphatidylinositol, isoprenylation, farnesylation) excluding MCD as
a potential
membrane-bound protein modified by one of these lipid anchors.
EXAMPLE 1.0
Tissue distribuation of MCD mRNA was investigated by Northern blot analysis
and complemented by a semi-quantitative RT-PCR study (Figure 16). A mRNA of
I5 about 2.2 kb is present in all tested rat tissues and is expressed at
relatively high levels in
liver, kidney, heart arid adipose tissues. The diffuse signal obtained is due
to the fact that
the MCD transcript ca-migrates with the 18S-ribosomal RNA. To confirm this
ubiquitary distribution, we performed RT-PCR on the same tissues and on sorted
pancreatic oc- and (3-cells. After 25 cycles of PCR, the relative signals
among tissues
were similar to that at 35 cycles except that the band intensities were
weaker.
Comparisons were made possible thanks to a (3-actin control PCR on the same
samples.
A control PCR of nom-reverse transcripted material gave no signal, excluding
genomic
DNA contamination of the RNA preparations. Thus, the RT-PCR results confirm
the
Northern blot analysis and furthermore indicate that MCD mRNA is expressed
also in
the oc- and ~i-cells of islet tissue no an extent similar to that of ~3(INS)
cells.
EXAMPLE 11
The presence of the active enzyme was measured in tissue extracts. The results
show a broad range of activities from high levels in liver, heart and
pancreatic (3-(INS)-
cells to low activity in the brain and spleen as well as undetectable MCD
activity in the
- 56 -

CA 02339088 2001-02-08
WO 00/09710 PCT/CA99100734
duodenum, untransfected 293 cells and 293 cells transfected with RSV-j3gal.
The tissue
distribution of MCD mRNA (Fig. 15) did not closely correlate with enzymatic
activity
measurements. This discrepancy may be explained by differences among tissues
in the
translationai control of the MCD gene. Another possibility to consider is that
MCD is an
allosteric enzyme regulated by covalent modifications) and that the enzyme is
differentially phosphorylated in various tissues. Consistent with this view,
the rat MCD
sequence shows many potential phosphorylation sites and alkaline phosphatase
treatment
of tissue extracts prior to performing the activity assay resulted in higher
MCD activity.
-57-