Note: Descriptions are shown in the official language in which they were submitted.
CA 02339255 2002-O1-16
WO 00/75376 PCTlUS00/15313
HEPG2 CELLS STABLY TRANSFECTED WITH HCV
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority, in part, under 35 U.S.C. ~119 based upon
U.S. Provisional Patent Application No. 60/137,531, filed June 3, 1999.
FIELD OF THE INVENTION
The present invention relates to the fields of molecular biology and virology
and to a cell line facilitating study of a virus and identification of
efficacious
antiviral agents and, more particularly, to HepG2 cells which are stably
transfecte~i
with the hepatitis C virus and to use of a cell line for effective study of
the hepatitis
C virus or a hepatitis C virus mutant and for identification of efficacious
therapeutic
agents for such viruses or mutant viruses.
BACKGROUND OF THE INVENTION
HCV is a major cause of post-transfusion and community acquired non-A,
non-B hepatitis worldwide. Even with widespread anti-HCV testing, there are
nearly 4 million chronically infected people in the U.S., with 28,000 new
infectionslyear, and 8,000-10,000 HCV related deaths annually. There are an
estimated 170 million chronically infected people worldwide who are at high
risk
for the development of hepatitis, cirrhosis and hepatocellular carcinoma
(FiCC).
A major problem in studying virus replicarion, in elucidating host-virus
relationships, and in screening far anti-viral drugs in vitro, is the lack of
a stable
tissue culture system. Primary human and chimpanzee hepatocytes are
susceptible
to HCV, and replicate the virus, but primary hepatocytes are difficult to
obtain, and
CA 02339255 2002-O1-16
WO OOI75376 2 PCTNS00115313
usually survive less than two weeks in culture. The same restrictions apply
when
hepatocytes are harvested from already infected individuals. Several cell
lines that
appear to be susceptible to HCV infection have not consistently generated
stable
baseline levels of virus. Full length HCV RNA has been successfully
transfected
S into a number of cell lines, but replicative levels are not stable and
become
undetectable within a few weeks. More recently, subgenomic regions of HCV have
been cloned and expressed at high levels in minireplicons, but none of these
minireplicons support virus replication. Hence, there is still a need for the
development of one or more systems capable of stably supporting HCV
replication.
The present invention relates to HepG2 cells stably transfected with a clone
of full
length HCV cDNA.
SUMMARY OF TIl~ DWENTION
The present invention relates to a cell line stably expressing a wild type
hepatitis C virus.
Another aspect of the present invention is a method of identifying a
therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus
replication, comprising: contacting a cell line stably expressing said
hepatitis C
virus with said therapeutic agent and measuring changes in said hepatitis C
virus
replication.
Yet another aspect of the present imrention is a method of identifying
a therapeutic agent efficacious in inhibiting or preventing a hepatitis C
virus
maturation, comprising: contacting a cell line stably expressing said
hepatitis C
virus with said therapeutic agent and measuring changes in said hepatitis C
virus
maturation.
Another aspect of the present invention is a method of identifying an
efficacy of a cloned therapeutic agent, comprising: inserting a therapeutic
gene
sequence into a stably producing hepatitis C virus cell line and measuring
viral
replication and maturation.
Another aspect of the present invention is a cell Iine stably expressing a
CA 02339255 2002-O1-16
wo oons~~6 3 rc~rnrsoonm3
mutated hepatitis C virus.
Yet another aspect of the present invention is a method of studying viral
replication and maturation, comprising: a) growing said cell line of claim 5
wherein
said mutated hepatitis C virus is expressed; b) growing said cell line of
claim I
wherein said wild type hepatitis C virus is expressed; c) determining an
amount of
viral replication and maturation in step a); d) determining an amount of viral
replication and maturation in step b); and e) analyzing an effect of a
mutation in
said mutated hepatitis C virus by comparing said viral replication and
maturation of
said mutated hepatitis C virus determined in step c) to that of wild type
hepatitis C
virus determined in step d).
DESCRIPTION OF THE DRAWINGS
Figure 1. Construction and characterization of HepG2-HCV [+) cells.
Figure 2. RTIPCR using in vitro generated HCV RNA template with strand
specific
primers.
Figure 3. Strand specific RT/PCR for HCV in HepG2-HCV cell lysates
Figure 4. HCV RNA in cesium chloride density gradient fractions from HepG2
cells stably transfected with HCV cDNA.
Figure 5. Stable production of HCV RNA in HepG2 cells over time.
Figure 6. The presence of HCV RNA in the blood of immunodcficient mice
injected with HepG2-HCV or control cells.
Figure 7. Effect of actinomycin D treatment upon steady state levels of HCV
RNA
compared to cellular RNA
Figure 8. Protection of putative HCV RNA from Rnase A in the serum of severe
combined immunodeficient (SCID) mice injected with HepG2-HCV cells.
Figure 9. Detection of RNA for HCV or neo in gradient fractions from serum of
severe combined immunodeficient injected with HepG2-HCV cells
Figure 10. Evidence for expression of NSSB polymerase in HepG2-HCV cells.
CA 02339255 2001-07-26
WO 00/75376 PGTIUSOOI15313
4
DESCRIPTION OF THE INVENTION
Construction and characterization of HepG2-HCV [+~ cells
The 3' end 98 base pair sequence was added to a near full length clone of
HCV cDNA (pRc/CMVIHCV9.4, Takehara, T., et al., Heparology 21:746-751,
1995) to make it full length, and then the sequence of the entire cDNA
confirmed.
In this plasmid, HCV expression is under control of the CMV early-intermediate
promoter. To express HCV from its endogenous promoters, full length HCV
cDNA was excised from pRcICMV/HCV with HindIII. The insert (9.6 kb) was
then subcloned into pZErO-1.1 (InVitrogen), which is a vector that lacks the
CMV
promoter. The sequence of the HCV clone was identical to that reported earlier
(Takehara, T., et al., Hepatology 21:746-751, 1995). The full length clone in
pRc/CMV/HCV or pZErO-1.1 was then stably transfected into HepG2 cells
(Figure 1), and the cultures selected for 3 weeks in 6418 or zeocin,
respectively.
No zeocin resistant colonies were recovered. 6418 resistant cultures were
assayed
for the presence of HCV production.
Strand specific PCR discriminates the detection of minus strand RNA
Full length HCV cDNA was used as a template to produce plus strand RNA
or minus strand RNA by in vitro transcription (Figure Z). Each reaction was
then
treated with RNase free DNase. An equivalent amount of each RNA was serially
diluted 10-fold. The reverse transcription step was initiated with each
dilution of
RNA by adding a plus strand "tagged" primer TAG-MF7 (5'
TCATGGTGGCGAATAA'~GTCTTCACGCAGAAAGCGTCTAGCCAT"g 3',
SEQ. ID. NO: 1). The "tag" is 16 nucleotides that are unrelated to the HCV
sequence (underlined sequences in SEQ. ID. NO: 1), so that following reverse
transcription the cDNA generated has a tag sequence at the extreme 5' end.
Following RNase digestion, PCR was conducted by addition of the plus strand
"tagg~" primer and a minus strand primer MF8 (5'
~°CGAGACCTCCCGGGCACTCGCAAGCACCC3" 3'. SEQ. ID. NO: 2) to
each reaction. The results show that about 10' copies of plus strand HCV RNA
are
CA 02339255 2002-O1-16
wo oor~s~~b 5 pcr~soons3i3
required to form enough product for ethidium bromide staining (Figure 2A)
while
only 10 copies of minus strand are required (Figure 2B). These results show
that
the strand specific PCR discriminates about a million fold the detection of
minus
(specific) over plus (nonspecific) strand. The inverse experiment, using a
mimes
S strand tagged primer in the reverse transcription step, shows similar
results.
Strand specific RTIPCR for HCV in HepG2-HCV cell lysates.
RNA was extracted from HepG2 cells and then mRNA further purified using
an oligo-dT column. The isolated mRNA was then treated with RNase free DNase,
followed by RTIPCR. For RT/PCR, a specific minus (SEQ. ID. NO: 2) or plus
~~. pier MF7 (5' ~GTCTTCACGCAGAAAGCGT~CTAGCCAT"e 3', SEQ.
1D. NO: 3) within the 5' untranslated region (nts 92-118) was used initially
for
asym~tric single strand synthesis at high temperature (55°C). In
addition to HCV
specific sequences, this primer had a 5' extension of HCV unrelated (tag)
sequences
( 16 nt) so that the single stranded cDNA generated had tag sequences at the
extreme
5' end. Ten percent of the cDNA was then transferred to a fresh tube
containing a
complementary HCV primer. The plus scnse primer MF7 for the plus sense RNA
(SEQ. ID. NO: 3) and the minus sense primer MF8 for the minus sense RNA (SEQ.
ID. NO: 2) and a primer containing only the tag sequences (5'
TCATGGTGGCGAATAA 3', SEQ. ID. NO: 4). The latter primer was used to
direct PCR amplification exclusively to the single stranded cDNA. These
samples
were. then pCR amplified, and the products analyzed by agarose gel
.electrophoresis.
and Southern blot hybridization using an HCV specific (S'-GAGAGC
CATAGTGGTCTGCGGAACCGGTGAGTACAC-3', SEQ. ID. NO: 5) probe
(Figure 3). Lane 1 is the reaction starting with minus strand primer without
reverse
transcriptase. Lane 2 is the same reaction with reverse transcriptase. The
results
reflect the presence of plus strand HCV RNA. When the same experiment was
performed with a tagged plus strand primer in the reverse transcriptase step,
the
results without (Figure 3, lane 3) or with (Figure 3, lane 4) reverse
transcriptase
yielded RTIPCR products that reflect the presence of HCV minus strand RNA.
When these reactions were carried out in HCV negative HepG2 cells, there was
no
plus or minus strand HCV RNA detected. The results in lane 5 are for the plus
CA 02339255 2002-O1-16
wo nons3~6 6 Pc~rnrsoonsm3
strand reaction. Strand specificity was confirmed by using primers from
several
regions of the HCV RNA to reduce self or random priming. Overall, these
results
imply the presence of HCV minus and plus strand RNA in HepG2-HCV cells.
They also show that the PCR products are not the result of traasgene
amplification,
nor the result of random priming, since no product was detected in the absence
of
reverse transcription (Figure 3, lane 1).
HepG2 cells stably transfected with HCV cDNA.
Lysates were prepared from an equal number of HCV plus [+] and minus [-]
HepG2 cells by gentle disruption using Dounce homogenization. The lysates were
clarified and layered on top of preformed CsCI gradients (1.05-1.40 gms/rnl)
in 5
ml heat sealable tubes, and the samples centrifuged to equilibrium at
10°C, for ?0
hrs at 68,000 rprn in a table top ultracentrifuge (Beckman) (Figure 4). RNA
was
extracted from aliquots of each fraction and subjected to RTIPCR using primers
from the 5' untianslated region spanning nucleotides 62-91 (MF16: 5'
~CCATAGATCACTCCCCTGTGAGGAAC'I'~' 3', SEQ. ID. NO: 6) ) and 431-414
(MF17: 5' "'TTAACGTCCTGTGGGCGGCGGTTGGTG'"' 3', SEQ. ID. NO: 7).
The products were then analyzed by agarose gel electrophoresis and Southern
blot
hybridization under stringent conditions using an HCV DNA probe (SEQ. ID. NO:
5) spanning sequences within the 5' untranslated region amplicon. The probe
was
made by PCR that incorporated biotinylated bases into the products.
Hybridization
-was detected by ahe:.addition of horseradish peroxidase conjugated
streptavidin,~and
finally by addition of the enhanced chemiluminescense (ECL) reagent (Amersham)
(Figure 4).
HCV RNA is encapsidated
To test for encapsidated HCV RNA, cell lysates were prepared in non-ionic
buffer containing 0.1 °~ NP40 + 0.1 ~ Tween 20, clarified by
centrifugation and
then centrifuged to equilibrium in CsCI gradients, as described supra. When
gradient fractions were assayed for HCV RNA by RTIPCR, signals were observed
only at a density characteristic of HCV (1.1 gmslml), implying encapsidation
(Figure 4). The HCV RNA in these fractions was RNase resistant. Anti-HCV
CA 02339255 2002-O1-16
wo oons~~6 Pcrrusoonm3
E 11E2 immunoprecipitated material from the expected gradient fractions and
upon
amplification yielded RTIPCR products for HCV. These experiments imply that
human liver cells encapsidate HCV RNA into virions with the appropriate
density
and immunochemical characteristics. Intracellular virus production has been
consistent at levels of 1-5 x 10' virus geaome equivalents / 106 cells, for
more than
1 year, implying a stable baseline of HCV production (Figure S).
Stable production of HCV RNA in HepG2 cells over time
Cultures of HepG2-HCV cells were passaged every 4-5 days. Cell lysates
were prepared at 3, 6, 9, and 12 months (Figure 5) and equal quantities of
extracted
RNA subjected to RT/PCR analysis for HCV using primers from the 5'
untranslated
region of the genome (SEQ. ID. NO: 1 and 2). Equal quantities of RNA were
amplified with increasing known amounts of template (spike) containing the
same
sequences as the amplicon save an internal deletion of 100 by (spans the HCV
sequence from nucleotides 62 through 162 fused to nucleotides 163 through
414).
The latter permitted separation of the amplicon from the sample (upper band)
from
that of the spike (lower band) by agarose gel electrophoresis (Figure 5).
Figure 5
shows the competitive RT/PCR analysis of samples collected on 3, 6, 9, and 12
months of culture on ethidium bromide stained gels (lower portion of figure),
and
after gel scanning, in graphic form (upper portion of figure). The results
imply
consistent production of stable levels of HCV RNA in HepG2-HCV cultures. The
.,- present invention provides .cell lines deri~!ed..~rotn these stably
producing HepG2- ,~, . , _ , .-.,
HCV cultures. The stable baseline of virus production in these cells provides
an
important tool for the screening of antiviral compounds. These results also
demonstrate that the integrated HCV cDNA clone serves as a template for the
consistent production of virus.
Demonstration of HCV RNA in the serum of SC1D mice
SCID mice were injected subcutaneously with HepG2-HCV or an equal
number of HepG2-vector transfected cells. Mice were bled every 10 days
postinjection, and the serum samples tested for HCV RNA by semiquantitative
RTIPCR (Figure 6). Randomly chosen positive and negative control samples were
CA 02339255 2002-O1-16
WO OOI75396 Pf:TII1S00/15313
8
analyzed by CsCI density equilibrium centrifugation, as described supra. The
results show the presence of HCV RNA at a density (D) of roughly 1.I gmlml in
animals injected with HCV plus [+J but not HCV minus [-] cells. The signal was
resistant to pretreatment with RNase. Together, these results imply that HCV
virions are secreted into tl~ blood of SCID puce injected with HepG2-HCV
cells.
HCV RNA is secreted
To test for virus secretion, aliquots of tissue culture supernatants were
analyzed
by RT/PCR amplification, but the initial results were not consistently
positive.
However, when cells were injected into immunodeficient mice, where they grew
out
_ _ _ ~ subcutaneous tumors, 6 att of 6 mice i~ected heame RT/PCR positive for
HCV
RNA in their blood (Figure 6,). This had the appropriate density on CsCI
gradients
for HCV of 1.1 gmlml. Semi-quantitation by RT/PCR showed that the
concentrations of HCV in vivo reached 105 to 106 virus genome equivalentslml
of
blood in individual mice by day 40 postinjection (Table 1). These results
imply that
virus is secreted and is stable in vivo. These signals were resistant to RNase
and
DNase pretreatment. The putative viral polymcrase, NSSB, was detected by
immunopr~ipitation of radiolabeled cell lysates with anti-NSSB. Therefore, HCV
stably replicates in HepG2 cells, and provides a long term culture of HCV
suitable
for a large variety of basic and applied studies.
Effect bf Actinomycin~ treatment on steady state levels of HCV -RNA
Cultures of 7 x 106 HepG2-HCV cells were trued for 72 hrs. with 0.4, 0.7,
or 1.0 pg/ml with actinomyein D (Fygure 7). Whole cell RNA was then extracted
and subjected to semiquantitative HCV specific RTIPCR (Figure 7A). RNA from
the same extractions were subjected to northern blot analysis with a G3PDH
specific
probe (Figure 9B). The results show a roughly 10-fold decrease in G3PDH
mRNA, but no detectable decrease in HCV RNA. G3PDH mRNA, which is of
cellular origin, is sensitive to inhibition by actinomycin D. The relative
resistance
of HCV RNA implies that some of the viral RNA derives fmm the action of the
HCV poiymerase, which is resistant to actinomycin D.
CA 02339255 2002-O1-16
WO 00175376 9 PCT/US00/15313
Protection of HCV RNA from RNase A in the serum of SCID mice
SCID mice were each injected with S x 106 HepG2-pRc/CMV-HCV cells or
control HepG2-pRcICMV cells. The mice were bled once every 10 days post
injection for a total of 30 days. Some serum samples were pretreated with
RNase,
and after inactivation, the RNA was extracted and subjected to RT/PCR, and
finally
analyzed on 1.4~ agarose gels (Figure $). The spike (1 x 10' copies) added
just
prior to RT/PCR consisted of HCV sequences containing an internal deletion
that
permitted faster migration on agarose gels relative to the viral amplicon. The
gel
containing the indicated sat~tles was ethidium bromide stained.
D~don of RNA for HCV in the serum of SCID mice infected with HepG2-HCV
CsCI density equilibrium centrifugation was performed with serum samples
obtained from SCID mice injected with HepG2-HCV cells 40 post injection prior
to
bleeding. RNA was extracted from each gradient fraction, and subjected to
RT/PCR using primers (SEQ. ID. NO: 1 and 2) that spanned the 5' untranslated
region of HCV (Figure 9, top gel) or primers that amplified the downstream nea
gene in the pRc/CMV plasmid into which the full length HCV cDNA was cloned.
The results show the presence of HCV, but not nee sequences, at a density of
1.1
gmlml, implying that viral but not downstream plasmid sequences are
transcribed
and packaged.
Expression of NSSB irt~I~epG2-HCV cells , . . ~:.. ,
HepG2-pRc/CMV and HepG2-pRc/CMV-HCV cells were radiolabeled with
100 pCi/ml each of "S-cysteine plus 'SS-methionine for 3 hours. Cell lysates
were
prepared in standard RIPA buffer (4°C for 10 min), clarified, and
immunoprecipitated with anti-NSSB or control serum, followed by protein G-
agarose beads (Santa Cruz Biotech). The resulting material was washed 4X,
collected by centrifugation ( 1004 x g for 5 min. at 4°C), and analyzed
by
SDS/PAGE arid autoradiography (Figure 10). The results show the expected band
at 68 kDa in HCV [+] (Figure 10, lane 2) but not HCV [-]cells (Figure 10, lane
1), implying the presence of the HCV RNA dependent RNA polymerise in infected
cells only. This observation is consistent with virus replication.
CA 02339255 2002-O1-16
WO 00175376 PCTIUS00l15313
Uses of HepG2-HCV cells
The present invention relates to the stable integration of HCV into HepG2
cells, thereby allowing for the stable production of hepatitis C virus. In one
5 embodiment of the present invention, this stable HCV producing cell line is
used to
study viral replication and maturation.
Mutations to the genome in the original wild-type hepatitis C virus clone are
made using methodologies well known to those skilled in the art. These mutated
viruses are then stably integrated into cells, as described supra, thereby
producing
10 cells that stably express a mutated virus genome. In one embodiment of the
present
invention, a mutation in a specific viral pratein is introduced into the viral
genome
and the role of that viral protein in the replication or maturation of virus
particles is
determined. The present invention it~ludes, but is not limited to, mutations
in the
active site of an enzyme, for example the NSST polymerase or the NS3 protease.
The HCV polymerase is necessary for replication of the viral genome and the
protease is necessary for the processing of the virus polyprotein into mature,
biologically active polypeptides. Replication and maturation of wild type
virus in
HepG2-HCV cells is used as a base line for replicative capacity, as well as
for
maturation of wild type hepatitis C virus. The replicative capacity and
maturation
of the stably integrated mutated hepatitis C virus is then determined and
compared
to the wild type. Assessing the effects of specific mutations upon replication
and/or
maturation of virus particle,~~, will allow the roles) of the respective viral
proteins to.,.__
be elucidated. The present invention identifies which proteins, and sites
within
these proteins, are most relevant targets for anti-viral intervention.
Hepatitis C virus RNA replication in the cell lines stably expressing
hepatitis
C virus is determined by Northern blot analysis of viral RNA extracted from
purified intracellular core particles, as is well known to those skilled in
the art. The
same technique is used to determine mutated hepatitis C viral replication in
celt
lines expressing a mutated RNA genome of the hepatitis C virus.
Cells stably expressing the hepatitis C virus, or a hepatitis C virus with a
mutation in a gene, are lysed at 4.degree C by the addition of 500 .p1 of a
mixture
containing TNE, 1 ~ Nonidet P-40 (NP40) and protease inhibitors (Boehringer
CA 02339255 2002-O1-16
WO OOI75376 ~ ~ PCT/USOOI15313
Mannheim Corp., Indianapolis, Ind.). The cell lysates are cleared of nuclei
and
cellular debris by centrifugation at 10,000×g for 1 min. Cell lysates
are mixed
with Laemmli sample buffer, boiled for 5 min, and electrophoresed through a
1596
SDS-polyacrylamide gel (Protogel, National Diagnostics, Atlanta, Ga.). The
separated proteins are then transferred onto Immobilon-PT.TM. membrane
(Millipore Co., Bedford, Mass.) (Harlow and Lane, Antibodies: A Laboratory
Manual, Cold Spring Harbor, Cold Spring Harbor, N.Y. 1988). Hepatitis C viral
proteins are detected using peptide antisera raised against specific viral
proteins, as
is standard methodology. This antibody is used for immunoprocipitation of the
protein, which is then analyzed by Western blot analysis. The same antibody is
used for both immunoprecipiGztion and Western blot analysis. Bound antibody
was
revealed by a chemiluminescence method utilizing horseradish peroxidase-
labeled
goat anti-rabbit or anti-mouse IgG antibodies (SuperSignal.TM., Pierce,
Rockford,
III.).
Screening of andviral compounds
Cell lines expressing the hepatitis C virus are used to evaluate antibodies,
peptides, or other molecules with therapeutic value in hepatitis C infections.
Screening of organic or peptide libraries with cell lines expressing the
hepatitis C
virus are useful for identification of therapeutic molecules that function to
inhibit or
prevent viral replication and/or viral mattuation. Synthetic and naturally
occurring
" , products are screened in a number Af ,W,ays deez~d routine to those
skilled in the . , ....
art. In general, these methodologies involve contacting the therapeutic agent
with
the cell line expressing the hepatitis C virus and measuring the efficacy of
inhibiting
or preventing viral replication or maturation.
In another embodiment of the presem invention, viral based expression
systems, specifically a retrovirus, adenovirus, or adeno-associated virus, are
utilized. In cases where an adenovirus is used as an expression vector, a
cloned
therapeutic agent, including but not limited to, any cytokine, (such as
interferon or
interleukin), antisense molecule, ribozyme or anti-viral antibody fragment
(sFv), is
ligated to an adenovirus transcription/translation control complex, e.g., the
late
promoter and tripartite leader sequence. This chimeric gene is then inserted
in the
CA 02339255 2002-O1-16
WO OOI753~6 ~ 2 PCTNS00I15313
adenovitvs genome by recombination. Insertion in a non-essential region of the
viral
genome (e.g., region E1 or E3) will result in a recombinant virus that is
viable and
capable of expressing the cloned therapeutic agent in the stably producing
hepatitis
C virus cell line. (e.g., see Logan & Shenk, 1984, Proc. Natl. Acad. Sci.
U.S.A.
S 81:3655-3659). Insertion of a therapeutic gene sequence into the stably
producing
hepatitis C virus cell line allows for therapeutic efficacy of gene therapy to
be
determined. The efficacy of the cloned therapeutic agent is assessed by its
effect on
viral replication and maturation. Efficacious agents are then used as gene
therapy
to treat individuals having hepatitis C infections.
Oligonucleotide sequences, that include antisense RNA and DNA molecules
a~ ribozymes that function to inhibit the translation of a viral mRNA are
within the
scope of the invention. "Antisense" as used herein refers to a nucleic acid
capable
of hybridizing to a portion of the hepatitis C virus RNA (preferably mRNA) by
virtue of some sequence complementariry. Antisense RNA and DNA molecules act
to directly block the translation of mRNA by binding to targeted mRNA and
preventing protein translation. In regard to antisense DNA,
oligodeoxyribonucleotides derived from the translation initiation site, e.g.,
between
-10 and + 10 regions of a hepatitis C virus nucleotide sequence, are
preferred. The
present invention provides for an antisense molecule comprising a nucleotide
sequence complementary to at least a pan of the coding sequence of a hepatitis
C
virus protein which is hybridizable to a hepatitis C virus mRNA. The present
invention also provides for an antisense molecule comprising a nucleotide
sequence
complementary to at least a pan of a non-coding sequence.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA. The mechanism of ribozyme action involves sequence specific
hybridization of the ribozyme molecule to complementary target RNA, followed
by
an endonucleolytic cleavage. Within the scope of the invention are engineered
hammerhead motif ribozyme molecules that specifically and efficiently catalyze
endonucleolytic cleavage of HCV RNA sequences.
Specific ribozyme cleavage sites within any potential RNA target are initially
identified by scanning the target molecule for ribozyme cleavage sites which
include
the following sequences: GUA, GUU and GUC. Once identified, short RNA
CA 02339255 2002-O1-16
WO OOI75376 ~ 3 PCT/IJS00/15313
sequences of between 15 and 20 ribonucleotides corresponding to the region of
the
target gene containing the cleavage site are evaluated for predicted
structural
features such as secondary structure that may render the oligonucleotide
sequence
unsuitable. The suitability of candidate targets is also evaluated by testing
their
accessibility to hybridization with complementary oligonucleotides by using
ribonuclease protection assays.
Screening therapeutic agents for their efficacy in inhibiting or preventing
hepatitis C virus replication or maturation is carri~l out by titrating the
amount of
therapeutic agent added to the stably producing hepatitis C virus cells. Viral
replication and/or maturation is then measured by aay of a variety of commonly
..knQwn.methods. These methods include, but are not limited to, measuring
changes
in viral RNA transcription, levels of virus particles secreted, or changes in
viral
protein levels.
CA 02339255 2001-07-26
13/1
SEQUENCE LISTING
<110> Thomas Jefferson University
<120> HepG2 Cells Stably Transfected with HCV
<130> 08-890256CA
<140> 2,339,255
<141> 2000-06-02
<150> 60/137,531
<151> 1999-06-03
<160> 7
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 1
tcatggtggc gaataagtct tcacgcagaa agcgtctagc cat 43
<210> 2
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 2
cgagacctcc cgggcactcg caagcaccc 29
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 3
gtcttcacgc agaaagcgtc tagccat 27
<210> 4
<211> 16
<212> DNA
CA 02339255 2001-07-26
13/2
<213> Artificial Sequence
<220>
<223> PCR primer
<400> 4
tcatggtggc gaataa 16
<210> 5
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 5
gagagccata gtggtctgcg gaaccggtga gtacac 36
<210> 6
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 6
ccatagatca ctcccctgtg aggaact 27
<210> 7
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primers
<400> 7
ttaacgtcct gtgggcggcg gttggtg 27
