CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
ENGINEERING (3-KETOACYL ACP SYNTHASE FOR NOVEL SUBSTRATE
SPECIFICITY
INTRODUCTION
This application claims the benefit of U.S. Provisional Application Number
60/138,308 filed June 9, 1999.
Technical Field
The present invention is directed to proteins, nucleic acid sequences and
constructs,
and methods related thereto.
Back r
Fatty acids are organic acids having a hydrocarbon chain of from about 4 to 24
carbons. Many different kinds of fatty acids are known which differ from each
other in chain
length, and in the presence, number and position of double bonds. In cells,
fatty acids
typically exist in covalently bound forms, the carboxyl portion being referred
to as a fatty acyl
group. The chain length and degree of saturation of these molecules is often
depicted by the
formula CX:Y, where "X" indicates number of carbons and "Y" indicates number
of double
bonds.
The production of fatty acids in plants begins in the plastid with the
reaction between
acetyl-CoA and malonyl-ACP to produce acetoacetyl-ACP catalyzed by the enzyme,
B-ketoacyl-
ACP synthase III. Elongation of acetyl-ACP to 16- and 18- carbon fatty acids
involves the
2 5 following cycle of reactions: condensation with a two-carbon unit from
malonyl-ACP to form a
B-ketoacyl-ACP (B-ketoacyl-ACP synthase), reduction of the keto-function to an
alcohol (B-
ketoacyl-ACP reductase), dehydration to form an enoyl-ACP (B-hydroxyacyl-ACP
dehydrase),
and finally reduction of the enoyl-ACP to form the elongated saturated acyl-
ACP (enoyl-ACP
reductase). B-ketoacyl-ACP synthase I, catalyzes elongation up to palmitoyl-
ACP (C 16:0),
3 0 whereas B-ketoacyl-ACP synthase II catalyzes the final elongation to
stearoyl-ACP (C 18:0). The
longest chain fatty acids produced by the FAS are typically 18 carbons long.
Additional
1
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
biochemical steps in the cell produce specific fatty acid constituents, for
example through
desaturation and elongation.
(3-ketoacyl synthases, condensing enzymes, comprise a structurally and
functionally
related family that play critical roles in the biosynthesis of a variety of
natural products, including
fatty acids, and the polyketide precursors leading to antibiotics, toxins, and
other secondary
metabolites. ~i-ketoacyl synthases catalyze carbon-carbon bond forming
reactions bycondenisng
a variety of acyl chain precursors with an elongating carbon source, usually
malonyl or methyl
malonyl moieties, that are covalently attached through a thioester linkage to
an acyl carrier
protein. Condensing enzymes can be part of multienzyme complexes, domains of
large,
multifunctional polypeptide chains as the mammalian fatty acid synthase, or
single enzymes as
the (3-ketoacyl synthases in plants and most bacteria.
Condensing enzymes have been identified with properties subject to
exploitation in the
areas of plant oil modification, polyketide engineering, and ultimately design
anti-cancer and
anti-tuberculosis agents. One of the molecular targets of isoniazid, which is
widely used in the
treatment of tuberculosis, is KAS. Cerulinin, a mycotoxin produced by the
fungus
Cephalosporium caerulens, acts as a potent inhibitor of KAS by covalent
modification of the
active cysteine thiol. Condensing enzymes from many other pathways and sources
have all been
shown to be inactivated by this antibiotic with the exception of the synthase
from C. caerulens
and KASIII, the isozyme responsible for the initial condensation of malonyl-
ACP with acetyl-
2 0 CoA in plant and bacterial fatty acid biosynthesis. Inhibition of the KAS
domain of fatty acid
synthase by cerulinin is selectively cytotoxic to certain cancer cells.
SUMMARY OF THE INVENTION
The present invention is directed to ~i-ketoacyl ACP synthase (KAS), and in
particular
to engineered KAS polypeptides and polynucleotides encoding engineered KAS
proteins
having a modified substrate specificity with respect to the native (also
referred to herein as
wild-type) KAS protein. The engineered polypeptides and polynucleotides of the
present
3 0 invention include those derived from plant and bacterial sources.
2
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
In another aspect of the invention polynucleotides encoding engineered
polypeptides,
particularly, polynucleotides that encode a KAS protein with a modified
substrate specificity
with respect to the native KAS protein, are provided.
In a further aspect the invention relates to oligonucleotides derived from the
engineered KAS proteins and oligonucleotides which include partial or complete
engineered
KAS encoding sequences.
it is also an aspect of the present invention to provide recombinant DNA
constructs
which can be used for transcription or transcription and translation
(expression) of an
engineered KAS protein having an altered substrate specificity with respect to
the native KAS
protein. In particular, constructs are provided which are capable of
transcription or
transcription and translation in host cells. Particularly preferred constructs
are those capable
of transcription or transcription and translation in plant cells.
In another aspect of the present invention, methods are provided for
production of
engineered KAS proteins having a modified substrate specificity with respect
to the native
KAS in a host cell or progeny thereof. In particular, host cells are
transformed or transfected
with a DNA construct which can be used for transcription or transcription and
translation of
an engineered KAS. The recombinant cells which contain engineered KAS are also
part of
the present invention.
In a further aspect, the present invention relates to methods of using the
engineered
2 0 polynucleotide and polypeptide sequences of the present invention to
modify the fatty acid
composition in a host cell, as well as to modify the composition and/or
structure of
triglyceride molecules, particularly in seed oil of oilseed crops. Plant cells
having such a
modified triglyceride content are also contemplated herein.
The modified plants, seeds and oils obtained by the expression of the plant
engineered
2 5 KAS proteins are also considered part of the invention.
DESCRIPTION OF THE FIGURES
Figure 1 provides the coordinates of the crystal structure of the E. coli KAS
protein.
The first column provides the Type of atom (N=Nitrogen, O=oxygen, C=Carbon,
CA= alpha
3 0 carbon, CB=beta carbon, CG= gamma carbon, CD= delta carbon, CE= epsilon
carbon, NZ=
zeta nitrogen, NH= amino group), the second column provides the amino acid
residue type
(three letter abbreviation), the third column provides the subunit in which
the amino acid is
3
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
located, the forth column provides the amino acid position in the protein
sequence base don
the mature unprocessed protein, columns seven through nine provide the x, y
and z
coordinates, respectively, of the three dimensional location of the respective
atom in the
crystal structure.
Figure 2 provides the profile of the crystal structure of the E. coli KAS-
cerulenin
complex. The first column provides the Type of atom (N=Nitrogen, O=oxygen,
C=Carbon,
CA= alpha carbon, CB=beta carbon, CG= gamma carbon, CD= delta carbon, CE=
epsilon
carbon, NZ= zeta nitrogen, NH= amino group), the second column provides the
amino acid
residue type (three letter abbreviation), the third column provides the
subunit in which the
amino acid is located, the forth column provides the amino acid position in
the protein
sequence base don the mature unprocessed protein, columns seven through nine
provide the
x, y and z coordinates, respectively, of the three dimensional location of the
respective atom
in the crystal structure.
Figure 3 provides the effects of KAS II mutations on the fatty acid
composition of E.
coli.
Figure 4 shows that mutations I108F, I108L and A193M all cause significant
reduction in the activity of KAS II on 8:0-ACP as compared to 6:0-ACP (38, 31
and 12 fold
reductions respectively), without significantly reducing the activity on 6:0-
ACP,
Figure 5 shows that the combined mutations at I108 and A193 have the effect of
2 0 reducing the activity of I~AS II on 6:0-ACP substrates.
Figure 6 shows that the combined effect of two or more mutations had a greater
effect
on the activity with acyl-ACPs 8:0 and longer ( 14:0) substrates.
Figure 7 shows the complete list of mutations that were generated.
Figure 8 provides the structure of the Cpu KAS I homodimer
2 5 Figure 9 provides the structure of the Cpu KAS IV homodimer
Figure 10 provides the structure of the Cpu KAS Il Cpu KAS IV heterodimer.
Figure 11 provides the sequence differences in the hydrophobic pocket of the
E. coli
KASII and C. pu KASIV.
Figure 12 provides an amino acid sequence alignment of KAS protein sequences
from
3 0 plant (Arabidopsis, Brassica, Cuphea hookeriana and pullcherima, Hordeum,
Riccinus),
bacterial (E. coli, streptococcus, tuberculosis), mammalian (rat, mouse) and
others
(C.elegans).
4
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
Figure 13 provides a bar graph representing the results of fatty acid analysis
of seeds
from transformed Arabidopsis lines containing pCGN 11058, pCGN 11062, pCGN
11041, or
nontransformed control lines (AT002-44). For each line, bars represent, from
left to right,
C 12:0, C 14:0, C 16:0, C 16:1, C I 8:0, C 18:1 (delta 9), C 18:1 (delta 11 ),
C 18:2, C 18:3, C20:0,
C20:1 (delta 11), C20:1 (delta 13), C20:2, C20:3, C22:0, C22:1, C22:2, C22:3,
C24:0, and
C24:1 fatty acids.
Figure 14 provides the nucleotide sequence of the plastid targeting sequence
from
Cuphea hookeriana KASII-7.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the subject invention, engineered nucleotide sequences are
provided which are capable of coding sequences of amino acids, such as, a
protein,
polypeptide or peptide. The engineered nucleotide sequences encode ~i-ketoacyl-
ACP
synthase (KAS) proteins with a modified substrate specificity compared to the
native KAS
protein (also referred to herein as the wild-type KAS protein) under enzyme
reaction
conditions. Such sequences are referred to herein as engineered (3-ketoacyl-
ACP synthase
(also referred to as engineered KAS) proteins. The engineered nucleic acid
sequences find
use in the preparation of constructs to direct their expression in a host
cell. Furthermore, the
2 0 engineered nucleic acid sequences find use in the preparation of plant
expression constructs to
alter the fatty acid composition of a plant cell. By "enzyme reactive
conditions" is meant that
any necessary conditions are available in an environment (for example, such
factors as
temperature, pH, lack of inhibiting substances) which will permit the enzyme
to function.
An engineered ~i-ketoacyl-ACP synthase nucleic acid sequence of this invention
2 5 includes any nucleic acid sequence coding a (3-ketoacyl-ACP synthase
having altered
substrate specificity relative to the native KAS in a host cell, includign but
not limited to, in
vivo, or in a cell-like environment, for example, in vitro. By altered, or
modified, substrate
specificity is meant an alteration in the acyl-ACP substrates elongated by the
KAS enzyme or
an alteration in the elongator molecule used by the KAS to elongate the acyl-
ACP relative to
3 0 the native or unaltered KAS protein. An alteration in the acyl-ACP
substrate elongated by the
KAS enzymes includes, but is not limited to, elongation of an acyl-ACP
substrate not
elongated by the wild-type KAS, the inability to elongate an acyl-ACP
substrate elongated by
5
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
the wild-type KAS, and a preference for elongating acyl-ACP substrates not
normally
preferred by the wild-type KAS. An alteration in the elongator molecule used
by the
engineered KAS for the elongation of the acyl-ACP substrate includes, but is
not limited to,
methyl-malonyl ACP for the production of branched chain fatty acids.
A first aspect of the present invention relates to engineered (3-ketoacyl-ACP
synthase
polypeptides. In particular, engineered KAS II polypeptides are provided.
Preferred peptides
include those found in the hydrophobic fatty acid/cerulenin binding pocket of
the KAS
protein. Such polypeptides include the engineered polypeptides set forth in
the Sequence
Listing, as well as polypeptides and fragments thereof, particularly those
polypeptides which
exhibit a modified substrate specificity with respect to the wild-type KAS
polypeptide.
Particularly preferred polypeptides include those having engineered amino acid
residues 105
to 120, 130-140, 190-200 and 340-400. Most preferred polypeptides include
those having
engineered amino acid residues I108A, I108F, I108G, I108L, L111A, I114A,
F133A,
V134A, V134G, I138A, I138G, A162G, A193G, A193I, A193M, L197A, F202L, F202I,
F202G, L342A, and L342G. Amino acid positions, as used herein, refer to the
amino acid
residue position in the active or processed protein.
Engineered [3-ketoacyl-ACP synthases can be prepared by random (via chemical
mutagenesis or DNA shuffling) or specific mutagenesis of a ~i-ketoacyl-ACP
synthase
encoding sequence to provide for one or more amino acid substitutions in the
translated
2 0 amino acid sequence. Alternatively, an engineered (3-ketoacyl-ACP synthase
can be prepared
by domain swapping between related ~3-ketoacyl-ACP synthases, wherein
extensive regions
of the native (3-ketoacyl-ACP synthase encoding sequence are replaced with the
corresponding region from a different ~i-ketoacyl-ACP synthase.
Altered substrate specificities of an engineered (3-ketoacyl-ACP synthase can
be
2 5 reflected by the elongation of an acyl-ACP substrates of particular chain
length fatty acyl-
ACP groups which are not elongated by the native ~i-ketoacyl-ACP synthase
enzyme. In
addition, altered substrate specificities can be reflected by the in ability
to elongate an acyl-
ACP substrate of particular chain length fatty acyl-ACP groups which are not
normally
preferred by the native ~i-ketoacyl-ACP synthase enzyme. The newly recognized
acyl-ACP
3 0 substrate can differ from native substrates of the enzyme in various ways,
such as by having a
shorter or longer carbon chain length (usually reflected by the addition or
deletion of one or
more 2-carbon units), as well as by degrees of unsaturation.
6
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
Another aspect of the present invention relates to engineered (3-ketoacyl-ACP
synthase polynucleotides. In particular, engineered ~3-ketoacyl-ACP synthase
II
polynucleotides are provided. The polynucleotide sequences of the present
invention include
engineered polynucleotides that encode the polygeptides of the invention
having a deduced
amino acid sequence selected from the group of sequences set forth in the
Sequence Listing.
The invention provides a polynucleotide sequence identical over its entire
length to
each coding sequence as set forth in the Sequence Listing. The invention also
provides the
coding sequence for the mature polypeptide or a fragment thereof, as well as
the coding
sequence for the mature engineered polypeptide or a fragment thereof in a
reading frame with
other coding sequences, such as those encoding a leader or secretory sequence,
a pre-, pro-, or
prepro- protein sequence. The polynucleotide can also include non-coding
sequences,
including for example, but not limited to, non-coding 5' and 3' sequences,
such as the
transcribed, untranslated sequences, termination signals, ribosome binding
sites, sequences
that stabilize mRNA, introns, polyadenyiation signals, and additional coding
sequence that
encodes additional amino acids. For example, a marker sequence can be included
to facilitate
the purification of the fused polypeptide. Polynucleotides of the present
invention also
include polynucleotides comprising a structural gene and the naturally
associated sequences
that control gene expression.
As described herein, analysis of the KAS I1/cerulinin crystal structure
complex is
2 0 performed using modeling software to produce a profile of the complex, as
well as the KAS II
protein alone. Based on comparisons of the two profiles, amino acid residues
are identified,
which when mutagenized, alter the fatty acyl substrate specificities. As
demonstrated herein,
engineering of the nucleic acid sequence to modify the amino acid sequence in
particular
regions of the KAS protein effectively modify the substrate specificity of the
engineered
KAS. Particular ranges for the engineering of the protein include amino acid
residues 105 to
120, 130-140, 190-200 and 340-345. Particularly, engineering of residues 108,
111, 114, 133,
193 and 197 can alter the length of the fatty acids synthesized by the
engineered KAS II
protein. More particularly, engineering of residues 108, 111, 114, 133, 193
and 197 with
variously sized hydrophobic residues will alter the length of the fatty acids
synthesized by the
3 0 engineered KAS Ii protein. Furthermore, engineering the amino acid residue
at position 400
can also have an effect on the substrate specificity.
7
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
As demonstrated more fully in the following examples, the acyl-ACP substrate
specificity of b-ketoacyl-ACP synthases may be modified by various amino acid
changes to
the protein sequence, such as amino acid substitutions, insertions or
deletions in the mature
protein portion of the b-ketoacyl-ACP synthases. Modified substrate
specificity can be
detected by expression of the engineered b-ketoacyl-ACP synthase s in E. coli
and assaying to
detect enzyme activity or by using purified protein in in vitro assays.
Modified substrate specificity can be indicted by a shift in acyl-ACP
substrate
preference such that the engineered b-ketoacyl-ACP synthase is newly capable
of utilizing a
substrate not recognized by the native b-ketoacyl-ACP synthase . The newly
recognized
substrate can vary from substrates of the native enzyme by carbon chain length
and/or degree
of saturation of the fatty acyl portion of the substrate. Additionally,
modified substrate
specificity can be reflected by a shift in the relative b-ketoacyl-ACP
synthase activity on two
or more substrates of the native b-ketoacyl-ACP synthase such that an
engineered b-ketoacyl-
ACP synthase exhibits a different order of preference for the acyl-ACP
substrates.
Furthermore, provided herein are KAS proteins with an altered elongator
molecule
preference. For example, by widening the hydrophobic fatty acid binding
differentelongator
molecules, other than Malonyl-ACP, can be utilized by the KAS protein. For
example
Methyl-malonyl-ACP can be utilized by the engineered KAS resulting in the
synthesis of
branched chained fatty acid. The mutations that lengthen the pocket may to
some degree also
2 0 widen it, in addition mutations A 1936, I 1086, L342A or G, V 134A or
G,F202L,I or G may
well cause widening of the pocket sufficiently to allow Methyl-malonyl-ACP to
be accepted
as an elongator.
As described in more detail herein, alterations in the nucleic acid sequence
of the E.
coli KAS II, particularly, I 108F, I 108L, A 193I, A 193M, as well as
combinations thereof, are
2 5 prepared for the production of shorter chain length fatty acids.
Furthermore, alterations of
I108A, L111A, I114A, F133A, L197A, and combinations thereof, are prepared for
increasing
the length of fatty acids produced by the host cell.
Thus, as the result of modifications to the substrate specificity of b-
ketoacyl-ACP
synthases, it can be seen that the relative amounts of the fatty acids
produced in a cell where
3 0 various substrates are available for hydrolysis rnay be altered.
Furthermore, molecules which
are formed from available free fatty acids, such as plant seed triglycerides,
may also be altered
8
CA 02339517 2001-02-08
WO 00/75343 PCT1US00/16151
as a result of expression of engineered b-ketoacyl-ACP synthase s having
altered substrate
specificities.
It is anticipated that the ranges of mutations provided herein can also be
engineered in
plant KAS proteins as well as to other polyketide synthases. Such plant KAS
proteins are
known in the art, and are described for example in PCT Publication WO
98/46776, and in
U.S. Patent Number 5,475,099, the entireties of which are incorporated herein
by reference.
Plant Constructs and Methods of Use
Of particular interest is the use of the nucleotide sequences, or
polynucleotides, in
recombinant DNA constructs to direct the transcription or transcription and
translation
(expression) of the engineered KAS sequences of the present invention in a
host plant cell.
The expression constructs generally comprise a promoter functional in a host
plant cell
operably linked to a nucleic acid sequence encoding a engineered KAS of the
present
invention and a transcriptional termination region functional in a host plant
cell.
Those skilled in the art will recognize that there are a number of promoters
which are
functional in plant cells, and have been described in the literature.
Chloroplast and plastid
specific promoters, chloroplast or plastid functional promoters, and
chloroplast or plastid
operable promoters are also envisioned.
2 0 One set of promoters are constitutive promoters such as the CaMV35S or
FMV35S
promoters that yield high levels of expression in most plant organs. Enhanced
or duplicated
versions of the CaMV35S and FMV35S promoters are useful in the practice of
this invention
(Odell, et al. ( 1985) Nature 313:810-812; Rogers, U.S. Patent Number 5,378,
619). In
addition, it may also be preferred to bring about expression of the engineered
KAS in specific
2 5 tissues of the plant, such as leaf, stem, root, tuber, seed, fruit, etc.,
and the promoter chosen
should have the desired tissue and developmental specificity.
Of particular interest is the expression of the nucleic acid sequences of the
present
invention from transcription initiation regions which are preferentially
expressed in a plant
seed tissue. Examples of such seed preferential transcription initiation
sequences include
3 0 those sequences derived from sequences encoding plant storage protein
genes or from genes
involved in fatty acid biosynthesis in oilseeds. Examples of such promoters
include the 5'
regulatory regions from such genes as napin (Kridl et al., Seed Sci. Res. l:
209:219 ( 1991 )),
9
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase,
soybean a' subunit
of ~i-conglycinin (soy 7s, (Chen et al., Proc. Natl. Acad. Sci., 83:8560-8564
( 1986))) and
oleosin.
It may be advantageous to direct the localization of proteins to a particular
subcellular
compartment, for example, to the mitochondrion, endoplasmic reticulum,
vacuoles,
chloroplast or other plastidic compartment. For example, where the genes of
interest of the
present invention will be targeted to plastids, such as chloroplasts, for
expression, the
constructs will also employ the use of sequences to direct the gene to the
plastid. Such
sequences are referred to herein as chloroplast transit peptides (CTP) or
plastid transit
peptides (PTP). In this manner, where the protein of interest is not directly
inserted into the
plastid, the expression construct will additionally contain a gene encoding a
transit peptide to
direct the protein of interest to the plastid. The chloroplast transit
peptides may be derived
from the gene of interest, or may be derived from a heterologous sequence
having a CTP.
Such transit peptides are known in the art. See, for example, Von Heijne et
al. (1991) Plant
Mol. Biol. Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550;
della-Cioppa
et al. (1987) Plant Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys.
Res Common.
196:1414-1421; and, Shah et al. { 1986) Science 233:478-481. Additional
transit peptides for
the translocation of the engineered KAS protein to the endoplasmic reticulum
(ER), or
vacuole may also find use in the constructs of the present invention.
2 0 Depending upon the intended use, additional constructs can be employed
containing
the nucleic acid sequence which provides for the suppression of the host
cell's endogenous
KAS protein. Where antisense inhibition of a host cells native KAS protein is
desired, the
entire wild-type KAS sequence is not required.
The skilled artisan will recognize that there are various methods for the
inhibition of
2 5 expression of endogenous sequences in a host cell. Such methods include,
but are not limited
to antisense suppression (Smith, et al. ( 1988) Nature 334:724-726) , co-
suppression (Napoli,
et al. (1989) Plant Cell 2:279-289), ribozymes (PCT Publication WO 97/10328),
and
combinations of sense and antisense Waterhouse, et al. (1998) Proc. Natl.
Acad. Sci. USA
95:13959-13964. Methods for the suppression of endogenous sequences in a host
cell
3 0 typically employ the transcription or transcription and translation of at
least a portion of the
sequence to be suppressed. Such sequences may be homologous to coding as well
as non-
coding regions of the endogenous sequence.
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
Regulatory transcript termination regions may be provided in plant expression
constructs of this invention as well. Transcript termination regions may be
provided by the
DNA sequence encoding the wild-type KAS or a convenient transcription
termination region
derived from a different gene source, for example, the transcript termination
region which is
naturally associated with the transcript initiation region. The skilled
artisan will recognize
that any convenient transcript termination region which is capable of
terminating transcription
in a plant cell may be employed in the constructs of the present invention.
Alternatively, constructs may be prepared to direct the expression of the
engineered
KAS sequences directly from the host plant cell plastid. Such constructs and
methods are
known in the art and are generally described, for example, in Svab, et al. (
1990) Proc. Natl.
Acad. Sci. USA 87:8526-8530 and Svab and Maliga (1993) Proc. Natl. Acad. Sci.
USA
90:913-917 and in U.S. Patent Number 5,693,507.
A plant cell, tissue, organ, or plant into which the recombinant DNA
constructs
containing the expression constructs have been introduced is considered
transformed,
transfected, or transgenic. A transgenic or transformed cell or plant also
includes progeny of
the cell or plant and progeny produced from a breeding program employing such
a transgenic
plant as a parent in a cross and exhibiting an altered phenotype resulting
from the presence of
a engineered KAS nucleic acid sequence.
Plant expression or transcription constructs having an engineered KAS as the
DNA
2 0 sequence of interest for increased or decreased expression thereof may be
employed with a
wide variety of plant life, particularly, plant life involved in the
production of vegetable oils
for edible and industrial uses. Most especially preferred are temperate
oilseed crops. Plants
of interest include, but are not limited to, rapeseed (Canola and High Erucic
Acid varieties),
sunflower, safflower, cotton, soybean, peanut, coconut and oil palms, and
corn. Depending
2 5 on the method for introducing the recombinant constructs into the host
cell, other DNA
sequences may be required. Importantly, this invention is applicable to
dicotyledyons and
monocotyledons species alike and will be readily applicable to new and/or
improved
transformation and regulation techniques.
Of particular interest, is the use of engineered KAS constructs in plants
which have
3 0 been genetically engineered to produce a particular fatty acid in the
plant seed oil, where TAG
in the seeds of nonengineered plants of the engineered species, do not
naturally contain that
particular fatty acid.
11
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
The engineered KA.S constructs of the present invention can also be used to
provide a
means for the production of plants having resistance to plant pathogens.
Engineered KAS
constructs providing for an increased production of particular fatty acids
involved in the
biosynthesis of pathogen response signals or inhibitors. For example,
engineered KAS
constructs providing for the increased production of C:8 fatty acids allows
for the production
of transgenic plants having an increased tolerance to fungal pathogens.
It is contemplated that the gene sequences may be synthesized, either
completely or in
part, especially where it is desirable to provide plant-preferred sequences.
Thus, all or a
portion of the desired structural gene (that portion of the gene which encodes
the engineered
protein) may be synthesized using codons preferred by a selected host. Host-
preferred codons
may be determined, for example, from the codons used most frequently in the
proteins
expressed in a desired host species.
Once the desired engineered KAS nucleic acid sequence is obtained, it may be
manipulated in a variety of ways. Where the sequence involves non-coding
flanking regions,
the flanking regions may be subjected to resection, mutagenesis, etc. Thus,
transitions,
transversions, deletions, and insertions may be performed on the naturally
occurring
sequence. In addition, all or part of the sequence may be synthesized. In the
structural gene,
one or more codons may be modified to provide for a modified amino acid
sequence, or one
or more codon mutations may be introduced to provide for a convenient
restriction site or
2 0 other purpose involved with construction or expression. The structural
gene may be further
modified by employing synthetic adapters, linkers to introduce one or more
convenient
restriction sites, or the like.
The nucleic acid or amino acid sequences encoding an engineered KAS of this
invention may be combined with other non-native, or "heterologous", sequences
in a variety
2 5 of ways. By "heterologous" sequences is meant any sequence which is not
naturally found
joined to the engineered KAS, including, for example, combinations of nucleic
acid
sequences from the same plant which are not naturally found joined together.
The DNA sequence encoding an engineered KAS of this invention may be employed
in conjunction with all or part of the gene sequences normally associated with
the wild-type
3 0 KAS. In its component parts, a DNA sequence encoding engineered KAS is
combined in a
DNA construct having, in the 5' to 3' direction of transcription, a
transcription initiation
12
CA 02339517 2001-02-08
WO 00/75343 PCT/LJS00/16151
control region capable of promoting transcription and translation in a host
cell, the DNA
sequence encoding engineered KAS and a transcription and translation
termination region.
Potential host cells include both prokaryotic and eukaryotic cells. A host
cell may be
unicellular or found in a multicellular differentiated or undifferentiated
organism depending
upon the intended use. Cells of this invention may be distinguished by having
an engineered
KAS foreign to the wild-type cell present therein, for example, by having a
recombinant
nucleic acid construct encoding an engineered KAS therein.
The methods used for the transformation of the host plant cell are not
critical to the
present invention. The transformation of the plant is preferably permanent,
i.e. by integration
of the introduced expression constructs into the host plant genome, so that
the introduced
constructs are passed onto successive plant generations. The skilled artisan
will recognize
that a wide variety of transformation techniques exist in the art, and new
techniques are
continually becoming available. Any technique that is suitable for the target
host plant can be
employed within the scope of the present invention. For example, the
constructs can be
introduced in a variety of forms including, but not limited to as a strand of
DNA, in a
plasmid, or in an artificial chromosome. The introduction of the constructs
into the target
plant cells can be accomplished by a variety of techniques, including, but not
limited to
calcium-phosphate-DNA co-precipitation, electroporation, microinjection,
Agrobacterium
infection, liposomes or microprojectile transformation. The skilled artisan
can refer to the
2 0 literature for details and select suitable techniques for use in the
methods of the present
invention.
Normally, included with the DNA construct will be a structural gene having the
necessary regulatory regions for expression in a host and providing for
selection of
transformant cells. The gene may provide for resistance to a cytotoxic agent,
e.g. antibiotic,
2 5 heavy metal, toxin, etc., complementation providing prototrophy to an
auxotrophic host, viral
immunity or the like. Depending upon the number of different host species the
expression
construct or components thereof are introduced, one or more markers may be
employed,
where different conditions for selection are used for the different hosts.
Where Agrobacterium is used for plant cell transformation, a vector may be
used
3 0 which may be introduced into the Agrobacterium host for homologous
recombination with T-
DNA or the Ti- or Ri-plasmid present in the Agrobacterium host. The Ti- or Ri-
plasmid
containing the T-DNA for recombination may be armed (capable of causing gall
formation)
13
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
or disarmed (incapable of causing gall formation), the latter being
permissible, so long as the
vir genes are present in the transformed Agrobacterium host. The armed plasmid
can give a
mixture of normal plant cells and gall.
In some instances where Agrobacterium is used as the vehicle for transforming
host
plant cells, the expression or transcription construct bordered by the T-DNA
border regions)
will be inserted into a broad host range vector capable of replication in E.
coli and
Agrobacterium, there being broad host range vectors described in the
literature. Commonly
used is pRK2 or derivatives thereof. See, for example, Ditta, et al., (Proc.
Nat. Acad. Sci.,
U. S.A. ( 1980) 77:7347-7351 ) and EPA 0 120 515, which are incorporated
herein by reference.
Alternatively, one may insert the sequences to be expressed in plant cells
into a vector
containing separate replication sequences, one of which stabilizes the vector
in E. coli, and
the other in Agrobacterium. See, for example, McBride and Summerfelt (Plant
Mol. Biol.
( 1990) 14:269-276), wherein the pRiHRI (Jouanin, et al., Mol. Gen. Genet. (
1985) 201:370
374) origin of replication is utilized and provides for added stability of the
plant expression
vectors in host Agrobacterium cells.
Included with the expression construct and the T-DNA will be one or more
markers,
which allow for selection of transformed Agrobacterium and transformed plant
cells. A
number of markers have been developed for use with plant cells, such as
resistance to
chloramphenicol, kanamycin, the aminoglycoside 6418, hygromycin, or the like.
The
2 0 particular marker employed is not essential to this invention, one or
another marker being
preferred depending on the particular host and the manner of construction.
For transformation of plant cells using Agrobacterium, explants may be
combined and
incubated with the transformed Agrobacterium for sufficient time for
transformation, the
bacteria killed, and the plant cells cultured in an appropriate selective
medium. Once callus
2 5 forms, shoot formation can be encouraged by employing the appropriate
plant hormones in
accordance with known methods and the shoots transferred to rooting medium for
regeneration of plants. The plants may then be grown to seed and the seed used
to establish
repetitive generations and for isolation of vegetable oils.
There are several possible ways to obtain the plant cells of this invention
which
3 0 contain multiple expression constructs. Any means for producing a plant
comprising a
construct having a DNA sequence encoding the engineered KAS of the present
invention, and
at least one other construct having another DNA sequence encoding an enzyme
are
14
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
encompassed by the present invention. For example, the expression construct
can be used to
transform a plant at the same time as the second construct either by inclusion
of both
expression constructs in a single transformation vector or by using separate
vectors, each of
which express desired genes. The second construct can be introduced into a
plant which has
already been transformed with the engineered KAS expression construct, or
alternatively,
transformed plants, one expressing the engineered KAS construct and one
expressing the
second construct, can be crossed to bring the constructs together in the same
plant.
Other Constructs and Methods of Use
The invention also relates to vectors that include a polynucleotide or
polynucleotides
of the invention, host cells that are genetically engineered with vectors of
the invention and
the production of polypeptides of the invention by recombinant techniques.
Cell free
translation systems can be employed to produce such protein using RNAs derived
from the
DNA constructs of the invention.
For recombinant production, host cells can be genetically engineered to
incorporate
expression systems or portions thereof or polynucleotides of the present
invention.
Introduction of a polynucleotide into a host cell can be effected by methods
described in
many standard laboratory manuals, such as Davis et al., Basic Methods in
Molecular Biology,
( 1986) and Sambrook et al, Molecular Cloning: A Laboratory Manual, ~'d
Edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor NY (1989). Such methods
include, but
are not limited to, calcium phosphate transfection, DEAE dextran mediated
transfection,
transvection, microinjection, cationic lipid-mediated transfection,
electroporation,
transduction, scrape loading ballistic introduction and infection.
Representative examples of appropriate hosts include bacterial cells, such as
2 5 streptococci, staphylococci, enterococci, E. coli, streptomyces, and
Bacillus subtilis cells;
fungal cells, such as yeast cells andAspergillus cells; insect cells, such as
Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293
and
Bowes melanoma cells; and plant cells as described above.
A variety of expression systems can be used to produce the polypeptides of the
3 0 invention. Such vectors include, but are not limited to, chromosomal,
episomal, and virus
derived vectors, for example vectors from bacterial plasmids, bacteriophage,
transposons,
yeast episomes, insertion elements, yeast chromosomal elements, viruses such
as
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
bacuioviruses, papova viruses, such as SB40, vaccinia viruses, adenoviruses,
fowl pox
viruses, pseudorabies viruses and retroviruses, and vectors derived from
combinations of such
viruses, such as those derived from plasmid and bacteriophage genetic
elements, such as
cosmids and phagemids. The expression system constructs may contain control
regions that
regulate as well as engender expression. Generally, any system or vector which
is suitable to
maintain, propagate or express polynucleotides and/or to express a polypeptide
in a host can
be used for expression. The appropriate DNA sequence can be inserted into the
chosen
expression by any of a variety of well-known and routine techniques, such as,
for example,
those set forth in Sambrook et al, Molecular Cloning, A Laboratory Manual,
(supra).
Appropriate secretion signals, either homologous or heterologous, can be
incorporated
into the expressed polypeptide to allow the secretion of the protein into the
lumen of the
endoplasmic reticulum, the periplasmic space or the extracellular environment.
The polypeptides of the present invention can be recovered and purified from
recombinant cell cultures by any of a number of well known methods, including,
but not
limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation
exchange chromatography, phosphocellulose chromatography, hydrophobic
interaction
chromatography, affinity chromatography, hydroxylapatite chromatography, and
lectin
chromatography. It is most preferable to use high performance liquid
chromatography
(HPLC) for purification. Any of the well known techniques for protein
refolding can be used
2 0 to regenerate an active confirmation if the polypeptide is denatured
during isolation and/or
purification.
The engineered KAS polynucleotides and polypeptides of the present invention
find
use in a variety of applications.
The engineered KAS polynucleotides and polypeptides as well as the constructs
2 5 containing such engineered KAS polynucleotides and polypeptides find use
in the alteration
of fatty acid composition. Furthermore, the engineered KAS polynucleotides and
polypeptides of the present invention find use in the production of particular
fatty acid
components. For example, an engineered KAS having a preference for elongating
6, 8, 10,
and 12 carbon acyl-ACP substrates can be used in the production of medium
chain fatty acids.
3 0 Such engineered KAS polynucleotides and polypeptides can also be used with
additional
sequences for the production of medium chain fatty acids, including, but not
limited to,
medium chain specific thioesterases (see for example USPN 5,512,482).
16
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
The present invention further provides methods for the engineering of
polyketides and
for the identification of molecules useful in cancer therapy,
immunosuppressants, anti-
parasite, and antibiotic production.
Thus, the present invention permits the use of molecular design techniques to
design,
select and synthesize chemical entities and compounds, including inhibitory
compounds,
capable of binding to the active site or substrate binding site of KAS, in
whole or in part.
A first approach enabled by this invention, is to use the structure
coordinates of KAS
to design compounds that bind to the enzyme and alter the physical properties
of the
compounds in different ways, e.g., solubility. For example, this invention
enables the design
of compounds that act as competitive inhibitors of the KAS enzyme by binding
to, all or a
portion of, the active site of KAS. This invention also enables the design of
compounds that
act as uncompetitive inhibitors of the KAS enzyme. These inhibitors may bind
to, all or a
portion of, the substrate binding site of KAS already bound to its substrate
and may be more
potent and less non-specific than known competitive inhibitors that compete
only for the
KAS active site. Similarly, non-competitive inhibitors that bind to and
inhibit KAS whether
or not it is bound to another chemical entity may be designed using the
structure coordinates
of KAS of this invention. Additionally, reversible and irreversible inhibitors
can also be
designed.
A second design approach is to probe KAS with molecules composed of a variety
of
2 0 different chemical entities to determine optimal sites for interaction
between candidate ICE
inhibitors and the enzyme. For example, high resolution X-ray diffraction data
collected from
crystals saturated with solvent allows the determination of where each type of
solvent
molecule sticks. Small molecules that bind tightly to those sites can then be
designed and
synthesized and tested for their KAS inhibitor activity. Travis, J., Science,
262, p. 1374
(1993).
This invention also enables the development of compounds that can isomerize to
short-lived reaction intermediates in the chemical reaction of a substrate or
other compound
that binds to KAS, with KAS. Thus, the time-dependent analysis of structural
changes in
KAS during its interaction with other molecules is enabled. The reaction
intermediates of
3 0 KAS can also be deduced from the reaction product in co-complex with KAS.
Such
information is useful to design improved analogues of known KAS inhibitors or
to design
novel classes of inhibitors based on the reaction intermediates of the KAS
enzyme and KAS-
17
CA 02339517 2001-02-08
WO 00175343 PCT/US00116151
inhibitor co-complex. This provides a novel route for designing KAS inhibitors
with both
high specificity and stability.
Another approach made possible and enabled by this invention, is to screen
computationally small molecule data bases for chemical entities or compounds
that can bind
in whole, or in part, to the KAS enzyme. In this screening, the quality of fit
of such entities or
compounds to the binding site may be judged either by shape complementarity or
by
estimated interaction energy. Meng, E. C. et al., J. Comp. Chem., 13, pp. 505-
524 ( 1992).
The invention now being generally described, it will be more readily
understood by
reference to the following examples which are included for purposes of
illustration only and
are not intended to limit the present invention.
EXAMPLES
Example 1: Determination of the KAS II-Cerulenin Complex Structure
The KASII-cerulenin complex was prepared as described previously (Edwards, et
al.
( 1997) FEES Lett. 402:62-66). Crystals of the complex were grown by the
hanging drop
method. Droplets consisting of equal amounts of protein solution (6 mg ml-~,
21 protein, 0.3
M NaCI, 25 mM Tris, pH 8.0, 5 mM imidazole, and 10% v/v glycerol) and
reservoir solution
2 0 were equilibrated against 26% w/v polyethylene glycol 8000 and 0.1 % v/v 2-
mercaptoethanol
in water. Data from two crystals were collected at 298 K at the synchrotron in
MAX-lab,
beamline I711, in Lund. The data was processed with DENZO (Otwinowski (1993)
Proceedings of the Collaborative Computating Project 4 Study Weekend: Data
Collection
and Processing (Sawyer, L., Isaacs, N., and Bailey, S.S., eds.) pp 56-62, SERC
Daresbury
Laboratory, Warrington) and programs from the Collaborative Computating
Project 4 Suite
(Collaborative Computating Project 4 ( 1994) Acta Crystallagr. Sect. D Biol.
Crystallogr.
50:760-763) and the two data sets were scaled together in SCALA (Eavans, (
1993)
Proceedings of the Collaborative Computating Project 4 Study Weekend: Data
Collection
and Processing (Sawyer, L., Isaacs, N., and Bailey, S.S., eds.) pp 56-62, SERC
Daresbury
3 0 Laboratory, Warrington). The crystals are very radiation-sensitive, but
cannot be frozen in a
cryostream. Due to non-isomorphism, data of only two crystals could be merged.
The crystals
of the complex have space group P3.21 with similar cell dimensions as the
native enzyme.
18
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/1b151
The coordinates of the native enzyme (Huang, et al. (1998) EMBO J. 17:1183-
1191) were
used to calculate initial electron density maps with SIGMAA (Read ( 1986) Acta
Crystallogr.
42:140-149). All data were used in the refinement; no sigma cutoff was
applied. After an
initial cycle of positional refinement, the model was rebuilt and a model of
cerulenin was
included. Further cycles of refinement of the complex were carried out using
the program
REFMAC (Murshudov, et al. (1997) Acta Crystallagr. Sect. D Biol. Crystallogr
53:240-253)
including a bulk solvent correction, interspersed with inspection and
correction of the model
using O (Jones, et al. ( 1991 ) Acta Crystallagr. Sect. A 47:100-119), OOPS
(Kleywegt, et
al. (1996) Acta Crystallagr. Sect. D Biol. Crystallogr 52:829-832), and
PROCHECK
(Laskawski, et al. ( 1993) J. Appl. Crystallogr. 26:282-291 ). Structure
comparisons were
performed using O (Jones, et al. ( 1991 ) supra) with default parameters.
The complex of KASII from E. coli with cerulenin crystallized in space group
P3, 21
isomorphously with the native enzyme (Huang, et al. ( 1998) supra), and the
crystal structure
was determined to 2.65-A resolution by difference Fourier methods. The final
protein model
after refinement (R-factor 5 0.213 and R~5 0.270 with good stereochemistry)
contains 411
out of the 412 residues of the subunit; no electron density for the N-terminal
residue was
found. The overall real-space correlation coefficient (Jones, et al. ( 1991 )
supra) is 0.92, and
there is well defined electron density for the polypeptide chain except for
some side chains on
the molecular surface. The inhibitor molecule is well defined by the electron
density.
2 0 However, there is weaker than average electron density for the amide group
and no electron
density for the last carbon atom of the hydrocarbon tail, indicating
considerable flexibility for
the terminal methyl group.
The overall structure of the KAS dimer is unchanged upon binding of cerulenin;
the
root mean square deviations for the 411 Ca atoms of the subunit is 0.23 ~
between the two
2 5 structures. These differences are mainly localized in the active site, in
particular in the loop
comprising residues 398-X01. The main differences in structure between the
native enzyme
and the cerulenin complex are in the conformation of the side chains of Phe-
400 (which was
anticipated already from the native structure) and of Ile-108, which have
completely new
rotamer conformations, and in the positions of the side chains of Cys-I63, His-
340, and Leu-
3 0 342, which also have moved substantially. These conformational changes
provide access for
cerulenin to the active site cysteine and open a hydrophobic pocket for the
hydrophobic tail of
the inhibitor. From the initial Fo 2 F~ electron density map these structural
changes could be
19
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
readily seen as well as the binding site for the inhibitor). Cerulenin is
bound covalently
through its C2 carbon atom to the Cys-163 Syatom. Its hydrocarbon tail fits in
a hydrophobic
pocket formed at the dimer interface. The structure of the adduct of cerulenin
and cysteine,
isolated by tryptic digestion of the cerulenin-fatty acid synthase complex,
has been
determined by NMR and mass spectroscopy (Funabashi, et al. (1989) J.
Biochem.(Tokyo)
105:751-755). This study revealed that the inhibitor reacts at its C2-epoxide
carbon with the
SH group of cysteine and that cerulenin formed a hydroxylactam ring. The
electron density
observed in the KASII-~erulenin complex is not consistent with this structure.
It was not
possible to model bound cerulenin in the closed ring form but the open form of
the inhibitor
could readily be fitted to the electron density map. The hydroxylactam ring,
which is formed
preferably in protic solvents (Funabashi, et al. ( 1989) supra), is not
present in the
hydrophobic environment of the protein.
In the KASII~erulenin complex, the inhibitor amide carbonyl oxygen is within
hydrogen bond distance to the NE atoms of the side chains of His-340 and His-
303, while the
amide NHZ group does not make any close interactions. It is, however, not
possible from the
structure to exclude the opposite conformation and interactions for the amide
group. The
hydroxyl group at C3 forms a hydrogen bond to the main chain NH of Phe-400.
The carbonyl
oxygen at C4 does not form any polar interactions, in fact, it is located in a
very hydrophobic
pocket formed by side chains Phe-400, Phe-202, and Val-134 from the other
subunit in the
2 0 dimer. The binding site for the hydrophobic part of the inhibitor is also
lined with
hydrophobic residues: Ala-162, Gly-107, Leu-342, Phe-202, Leu-111, Ile-108,
Ala-193, Gly-
198; and from the second subunit in the dimer, Ile-138, Val-134, and Phe-133.
The two
double bonds with trans configuration give the hydrophobic tail a shape that
fits to the
hydrophobic groove once residue Ile-108 has changedrotamer. In comparison,
binding of
2 5 tetrahydrocerulenin would cost entropy, and as expected it shows more than
2 orders of
magnitude less inhibitory activity (D'Agnolo, et al.(1973) Biochim. Biophys.
Acta 326:155-
156). The influence of the length of the hydrocarbon chain, maintaining the
double bond
positions, has been studied using fatty acid synthase from Saccharomyces
cerevisiae
(Morisaki, et al. (1993) J. Biol. Chem. 211:111-115). Cerulenin (12 carbons)
had the highest
3 0 inhibitory activity, with slightly decreasing binding strength upon
increase in chain length.
However, when increasing the length from 16 to 18 carbon atoms, the inhibition
decreased by
2 orders of magnitude. The size of the hydrophobic pocket in KASII, which
binds the
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
hydrocarbon tail of cerulenin, suggests that there is space for a longer
hydrophobic tail only if
the side chains of Leu-11 l and of Phe-133 in the second subunit change their
conformation.
Thus, possible differences in the sensitivity of condensing enzymes toward
cerulenin might
be controlled by the size of this cavity.
The structure of the cerulenin complex can be considered to mimic the
intermediate
formed upon reaction of KAS with the acyl-ACP. In such a complex the
hydrophobic cavity
would harbor the hydrocarbon tail of the acyl intermediate. The acyl
hydrophobic tails will
not be restricted by two double bonds (as in the case of cerulenin), and this
will allow longer
acyl chains to be buried in this pocket. Inspection of the active site cavity
suggests that it
would not be possible to harbor a linear acyl chain longer than 14 carbon
atoms without
structural changes. Such conformational changes must occur since KASII is able
to elongate
16:1 to 18:1 (Garwin, et al. (1980) J. Biol. Chem. 255:3263-3265).
Coordinates for the KAS II crystal structure as well as the KAS-cerulenin
complex
were produced and are presented in Figures 1 and 2 respectively.
Example 2: Engineering KAS II Proteins
The structure of the E.coli KAS II-cerulenin complex was analyzed using the
Swiss Pdb
Viewer (SPV) modeling program, and by stereo viewing of printouts of the
structure in different
2 0 orientations. Using SPV each of the hydrophobic residues surrounding the
bound cerulenin
residue were changed to all the possible larger hydrophobic residues, and each
of the rotamers for
the mutant amino acids were examined for steric clashes (SPV rotamer score)
with adjacent
amino acids and the bound cerulenin molecule. The identified amino acids were
targeted for
mutagenesis for decreasing the fatty acid chain length specificity of the KAS
II protein. The
2 5 candidate chain length shortening mutations chosen were those that made
the least steric clashes
with neighboring amino acids while having the most clashes with the end 1 to 6
carbons of
cerulenin.
The structure of the E.coli KAS II / cerulenin complex was studied as
described above
and the hydrophobic amino acid residues near the end of the cerulenin binding
"pocket" were
3 0 identified. These amino acids were identified for mutagenesis for the
increase in fatty acid
chain length recognition. The large hydrophobic residues positioned beyond the
end of the
21
CA 02339517 2001-02-08
WO OOI75343 PCT/US00/16151
cerulenin potentially preventing longer fatty acids from occupying this pocket
were chosen
for mutagenesis to smaller (alanine) residues.
PCR site-directed mutagenesis was performed using the Quick-ChangeTM site-
directed
mutagenesis kit (Stratagene) following the manufacturers protocol. For the
preparation of the
specific mutations listed in Table 1, the following oligonucleotide primers
were used in the
reactions.
Table 1
11U8F Sense 5'-GTGCCGCAATTGGATCCGGGTTTGGCGGCCTCGGAC (SEQ ID NO:1)
Antisense 5'-GTCCGAGGCCGCCAAACCCGGATCCAATTGCGGCAC (SEQ ID N0:2)
I108L SenseS'-GTGCCGCAATTGGCTCCGGGCTTGGAGGCCTCGGACTGATCG (SEQ ID N0:3)
Antisense5'-CGATCAGTCCGAGGCCTCCAAGCCCGGAGCCAATTGCGGCAC (SEQ ID N0:4)
A 193I Sense 5'-GCAGGTGGCGCCGAGAAAATCAGTACGCCGCTGGGC (SEQ ID NO:S)
Antisense 5'-GCCCAGCGGCGTACTGATTTTCTCGGCGCCACCTGC (SEQ ID N0:6}
A 193M Sense 5'-GGTGGCGCAGAGAAAATGAGTACTCCGCTGGGCGTTG(SEQ ID N0:7)
Antisense 5'-CAACGCCCAGCGGAGTACTCATTTTCTCTGCGCCACC(SEQ ID N0:8)
I108A, L111A, I114A
Sense 5'-GCAATTGGCTCCGGGGCTGGCGGCGCCGGACTGGCCGAAG
AAAACCACAC(SEQ ID N0:9)
Antisense 5'-GTGTGGTTTTCTTCGGCCAGTCCGGCGCCGCCAGCCCCGG AGCCAATTGC (SEQ
IDNO:10)
L111A Sense 5'-GGGATTGGCGGCGCCGGACTGATCGAAG(SEQ ID NO:11)
Antisense 5'-CTTCGATCAGTCCGGCGCCGCCAATCCC(SEQ ID N0:12)
3 0 F133A Sense 5'-GATCAGCCCATTCGCGGTACCGTCAACGATTGTG(SEQ ID N0:13)
Antisense 5'-CACAATCGTTGACGGTACCGCGAATGGGCTGATC(SEQ ID N0:14)
1197A Sense 5'-GAGAAAGCCAGTACTCCGGCGGGCGTTGGTGG(SEQ ID NO:IS)
Antisense 5'-CCACCAACGCCCGCCGGAGTACTGGCTTTCTC(SEQ ID N0:16)
Example 3: Construct Preparation
4 0 3A. E. cnli Expression Constructs
A series of constructs are prepared to direct the expression of the engineered
KAS
sequences in E. coli.
A series of constructs are prepared to direct the expression of the various
engineered
KAS sequences in host plant cells.
22
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
The construct pCGN 10440 contains the I108F mutant expressed from the pQE30
(Qiagen) vector for expression in a host E. coli cell.
The construct pCGN 10441 contains the I108L mutant expressed from the pQE30
(Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10442 contains the A193I mutant expressed from the pQE30
(Qiagen) vector for expression in a host E. coli cell.
The construct pCGN 10443 contains the I108F, A 193I mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN 10444 contains the I108L, A 193I mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10445 contains the A193M mutant expressed from the pQE30
(Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10446 contains the I108F, A193M mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10447 contains the I108L, A193M mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10448 contains the L111A mutant expressed from the pQE30
(Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10449 contains the F133A mutant expressed from the pQE30
2 0 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10450 contains the Ll 11A, F133A mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN 10451 contains the I108A, L 11 A, I 114A mutant expressed
from
the pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10452 contains the F133A, L197A mutant expressed from the
pQE30 (Qiagen) vector for expression in a host E. coli cell.
The construct pCGN10453 contains the I108A, L11A, I114A, F133A, L197A mutant
expressed from the pQE30 (Qiagen) vector for expression in a host E. coli
cell.
The construct pCGN 10454 contains the L 197A mutant expressed from the pQE30
3 0 (Qiagen) vector for expression in a host E. coli cell.
3B. Preparation of Plant Expression Constructs
23
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
A series of constructs are prepared to direct the expression of the engineered
KAS
sequences in plant host cells, both alone and in combination with additional
sequences
encoding proteins involved in fatty acid biosynthesis.
A plasmid containing the napin cassette derived from pCGN3223 (described in
USPN
5,639,790, the entirety of which is incorporated herein by reference) was
modified to make it
more useful for cloning large DNA fragments containing multiple restriction
sites, and to
allow the cloning of multiple napin fusion genes into plant binary
transformation vectors. An
adapter comprised of the self annealed oligonucleotide of sequence
CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAA
AT (SEQ ID NO: ) was ligated into the cloning vector pBC SK+ (Stratagene)
after digestion
with the restriction endonuclease BssHII to construct vector pCGN7765. Plamids
pCGN3223 and pCGN7765 were digested with NotI and Iigated together. The
resultant
vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific
expression cassette from pCGN3223.
A binary vector for plant txansformation, pCGN5139, was constructed from
pCGN1558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14:269-276).
The
poiylinker of pCGN1558 was replaced as a HindIII/Asp718 fragment with
apolylinker
containing unique restriction endonuclease sites, AscI, PacI, XbaI, SwaI,
BamHI, and NotI.
2 0 The Asp718 and HindIII restriction endonuclease sites are retained in
pCGN5139.
A binary vector, pCGN8642 was constructed to allow for the rapid cloning of
various
expression cassettes into the vector for use in plant transformation. The
construct contains a
multiple cloning region located between the right and left borders of
theAgrobacterium
transfer DNA. The construct also contains the Tn5 gene expressed from the 35S
promoter
2 5 between the multiple cloning site and the left border for selection of
transformed plants on
kanamycin.
A 354 by BgIII fragment containing the Cuphea hookeriana KASII-7 plastid
targeting
sequence (Figure 14) (SEQ ID NO: ) was cloned into the BamHI site of the
various pQE30
constructs containing the E. coli KASII (FabF) wild type or mutant KAS
sequences. The
3 0 resultant chimeric KAS II targeting sequence/FabF encoding sequence were
cloned as
HindIlill SaII fragments into filled-in Sal1/XhoI sites of the napin
expression cassette,
24
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
pCGN7770. The resulting napin/KAS cassettes were cloned as NotI fragments into
the NotI
sites of various plant binary constructs as described below.
A napin cassette containing the coding sequence of the Cuphea hookeriana FatB2
protein (described in PCT Publication WO 98/46776, the entirety of which is
incorporated
herein by reference) was cloned as a NotI fragment into the NotI site of
pCGN8642 to create
pCGN 11000.
A napin cassette containing the coding sequence of the Garm FatAl protein
(described in PCT Publication WO 97/12047, the entirety of which is
incorporated herein by
reference) was cloned into the NotI site of pCGN8642 to create pCGNl 1003.
A napin cassette containing the native (wild-type) E. coli KAS II coding
sequence was
cloned into the NotI site of pCGN 11003 to create pCGN 11040.
A napin cassette containing the native (wild-type) E. coli KAS II coding
sequence was
cloned into the NotI site of pCGN 11003 to create pCGN 11040.
A napin cassette containing the native (wild-type) E. coli KAS II coding
sequence was
cloned into the NotI site of pCGN8642 to create pCGN 11041.
A napin cassette containing the native (wild-type) E. coli KAS II coding
sequence was
cloned into the NotI site of pCGN 11000 to create pCGN 11042.
A napin cassette containing the L111A KAS II mutant coding sequence was cloned
into the NotI site of pCGNl 1003 to create pCGNI 1045.
A napin cassette containing the L11 lA KAS II mutant coding sequence was
cloned
into the NotI site of pCGN8642 to create pCGN 11046.
A napin cassette containing the F133A KAS II mutant coding sequence was cloned
into the NotI site of pCGN 11003 to create pCGN 11049.
A napin cassette containing the F133A KAS II mutant coding sequence was cloned
2 5 into the NotI site of pCGN 11003 to create pCGN 11050.
A napin cassette containing the L111A, F133A KA,S II double mutant coding
sequence was cloned into the NotI site of pCGN 11003 to create pCGN 11053.
A napin cassette containing the L111A, F133A KAS II double mutant coding
sequence was cloned into the NotI site of pCGN8642 to create pCGN 11054.
3 0 A napin cassette containing the I108A, L111A, I114A KAS II triple mutant
coding
sequence was cloned into the NotI site of pCGN 11003 to create pCGN 11057.
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
A napin cassette containing the I108A, LI 11A, Il 14A KAS II triple mutant
coding
sequence was cloned into the NotI site of pCGN8642 to create pCGN11058.
A napin cassette containing the I108A, L111A, II 14A, F133A, L197A KAS II
multiple mutant coding sequence was cloned into the NotI site of pCGN 11003 to
create
pCGN 11061.
A napin cassette containing the I108A, L111A, I114A, F133A, L197A KAS II
mulitple mutant coding sequence was cloned into the NotI site of pCGN8642 to
create
pCGN 11062.
A napin cassette containing the I108F KAS II mutant coding sequence was cloned
into
the NotI site of pCGN 11000 to create pCGN 11065.
A napin cassette containing the I108F KAS II mutant coding sequence was cloned
into
the NotI site of pCGN8642 to create pCGN 11066.
A napin cassette containing the II08F, A193I KAS II double mutant coding
sequence
was cloned into the NotI site of pCGN 11000 to create pCGN 11069.
A napin cassette containing the I 108F, A 193I KAS II double mutant coding
sequence
was cloned into the NotI site of pCGN8642 to create pCGN 11070.
A napin cassette containing the A193M KAS II mutant coding sequence was cloned
into the NotI site of pCGN 11000 to create pCGN 11073.
A napin cassette containing the A 193M KAS II mutant coding sequence was
cloned
2 0 into the NotI site of pCGN$642 to create pCGN 11074.
Example 4: Analysis of Engineered KAS II Proteins Expression in E. coli
Figure 7 shows the complete list of mutations that were generated in E.coli
KAS II using
2 5 the Stratagene Quick-ChangeTM site-directed mutagenesis kit, and confirmed
by DNA
sequencing. The mutant KAS II genes cloned behind an IPTG inducible TS
promoter (pQE30
vector, Qiagen) were transformed into E.coli strain MIS/pREP4. The effect of
the expression
of these KAS II mutants on the fatty acid composition ofE.coli is shown in
Figure 3. E.coli
M I S/pREP4 strains containing no vector (-Vec), vector without insert (+Vec),
or vectors
3 0 expression wild-type KAS I or II or single or multiple engineered forms of
KASII were grown
to mid-log phase in LB media at 30°C. Expression was induced for 2
hours with IPTG (0.75
mM), cells were harvested, lyophilzed, and the lipids were extracted into
toluene and
26
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
derivatized by sodium methoxide and analyzed for fatty acid content by GC FAME
analysis
as described in Dehesh, et al. ( 1998) Plant J. 15:383-390.
The mutations prepared to increase the length of the end product fatty acids
lead to the
accumulation of abnormally long fatty acids inE.coli (Figure 3). Wild-
typeE.coli
membranes contain no stearic acid and barely detectable levels of 20:0 and 20:
I . Whereas
L197, F133A and L111A all resulted in further elongation of the normal
membrane
components 16:0, and 18:1 resulting in the accumulation of 4, 7 and 13% 18:0
respectively,
and 1 to 3% 20:0 and 20:1. KAS II/L111A produced the highest level of 18:0
(13%) while
KAS I1/L111A-F133A accumulated the highest levels of 20:0 and 20:1 (2 and 4%
respectively). Mutations I108A and I114A appeared to decrease the long chain
fatty acid
accumulation due to L111A and F133A.
The KAS II mutants prepared to shorten the maximum fatty acids were analyzed
in
vitro for the ability to utilize various chain length acyl-ACP substrates.
Results of the in
vitro assays (Figures 4, 5, and 6) demonstrates that the mutants I108F, I108L,
A193M, and
A193I have a reduced ability to utilize C8-ACP and longer substrates for
condensation.
However, these mutations are able to utilize C6-ACP substrates for elongation
to produce C8
fatty acids. Furthermore, at least one mutation, A 193M, had an increased
ability to utilize
C6-ACP substrates compared to the wild-type KAS for elongation.
The data showing the effect of mutations I108F, I108L, A 193I and A 193M
(together
2 0 or separately) on the enzymatic activity of KAS II are summarized in
figures 4, 5 and 6.
Figure 4 shows that mutations I108F, I108L and A193M all cause significant
reduction in the
activity of KAS II on 8:0-ACP as compared to 6:0-ACP (38, 31 and 12 fold
reductions
respectively), without significantly reducing the activity on 6:0-ACP. In
other words they
have effectively changed KAS II into an enzyme capable of making fatty acids
up to a
2 5 maximum of 8 carbons in length. Mutation A 193I only causes a 1.8 fold
decrease in activity
on 8:0-ACP as compared to 6:0-ACP. Figure 5 shows that the combined mutations
at I108
and A 193 have the effect of reducing the activity of ICAS II on 6:0-ACP
somewhat, but figure
6 shows that the combined effect was much greater effect on the activity with
acyl~lCPs 8:0
and longer ( 14:0). Consequently the double mutants are even more specific for
the synthesis
3 0 of 8 carbon fatty acids. The most specific is KAS II I108F/A193 KAS II
which is 90X more
active on 6:0-ACP than it is on 8:0-ACP suggesting that it is now an enzyme
highly specific
for the synthesis of fatty acids only up to 8 carbons in Length.
27
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
Example 5: Structural Comparisons of a Plant Medium-Chain specific KAS
with E.coli KAS II
To further characterize the structure-function relationships of KAS fatty acid
binding
pockets the modeled structure of a plant medium-chain (8:0, 10:0) specific KAS
[Cuphea.
pulcherrima, (C.pu) KASIV] (Dehesh et al. (1998) Plant J. 15:383-390) was
compared with
the crystal structure of E.coli KAS II. Figure 8 shows that Gpu KAS I is
predicted to share
essentially the same folding pattern as E.coli KAS II with the exception of a
few loop regions,
as might be expected given the structural similarity between KAS enzymes.
Furthermore,
Cpu KAS IV also has a similar structure (Figure 9). The general structure for
the KAS family
of proteins follows the a-(3-a-~3-a folding pattern. Indeed at the amino acid
sequence level,
all but 7 of the 55 highly conserved residues among KAS enzymes are identical
(87%
identity). However there is only 60% identity in hydrophobic fatty acid
binding pocket
region with 8 of the 20 amino acids being different consistent with this
region of the protein
being responsible for the differences in the enzymes specificity. Furthermore
the model
shows no stearic hinderance in the formation of KASI and KASIV heterodimer
(Figure 10).
In addition, amino acid sequence comparisons between plant, mammalian,
bacterial
Example 6: Plant Transformation and Analysis
The expression constructs described in Example 3B above were used to transform
Arabidopsis thaliana (Columbia) and/or Columbia mutants fabl, fael-l, and fael-
2.
2 5 Seeds from transformed Arabidopsis lines were analyzed for fatty acid
composition
and are provided in Table 2 below and shown in Figure 13. Fatty acid methyl
esters (FAME)
extracted in hexane were resolved by gas chromatography {GC) on a
HewlettPackard model
6890 GC.
28
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
M ~M
O U I~ ~ M
M cV --
r ~ N
N
. w0 ~'1 '-' .--~
N V1 M 'ct vG
N U .-: ~: dv oo ~ .-~
r., ~ .-r
N O O O
O
M Two
00
O o0 l~
O N
N N N N
CV
p O N d'
M N l~ N . 00
o0
e f p~ d;
N ,-, ...
O O O
O
00 ~ r.
00
.-~ N
.-~ .--i
N N V1 ~D
N
op O vo O
M
_ M
N M ~
N N N N O
O ~ O
~ O
.-I~ d'
-i-~ 00
00 U M M N
M .-~
~ .--i
N
M
~ N O
~ N
p~,M' GOOO
~,~o
p
.-. U ,
~ o ~n
M
o ~ vwo
vo
d; ~''~ .-i t~j
.-i .-i
M N M
M
~' O "",
N N N ~ N p
N ~T
M
p O O N O O O
O O
O ~7 O M
~O
00 M V1 M
'-"' b' ~
ue
c~ v~ O Q M d
oo Ov '
N ,
O fV
O O
O O O
O
N OO M
lT
O~ N l~ O M V7
~O VD
N N '
.-r ,--~ .~i (Wj
.r .-i
O O O
O
O~ O~
00 Cv -~ 00
Ov
Np N N N N
N
0 0 g
H H ~ H H ~'
H H
'
N d Q ~ ~ Q
'~ ~ Q
N
'C !o ~ b oo N
O O ~ ~ WD
O O
~ V
N wd ~~a~ wa ~~d~
29
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
T2 pooled seeds from transgenic Arabidopsis lines containing pCGNl 1041 (
11041-
AT002-9) expressing the native E. coli KAS II protein in the seed tissue
demonstrated nearly
the same fatty acid composition as the nontransformed control Arabidopsis
plants (AT002-
44).
T2 pooled seeds from transgenic Arabidopsis var Columbia containing the
construct
pCGN11058 demonstrated the ability to synthesize longer carbon chain fatty
acids compared
to the nontransformed control plants as well as transgenic plants containing
the wild-type E.
coli KAS II protein. Particular increases in the production of 18:1 cl l, 20:1
c13, 24:0 and
24:1 are observed in transgenic plants containing pCGN 11058. Increases of
18:1 c 11, 20:1
c 13, 24:0 and 24:1 of 2 to 3 fold are obtained compared to nontransformed
control plants.
The fact that these levels were not higher may be due to the fact that there
are many
enzymatic steps downstream from the condensation step catalyzed by KAS enzymes
which
affect the longer chain acyl-ACPs produced incorporation into triglycerides.
T2 pooled seeds from transgenic Arabidopsis var Columbia containing the
construct
pCGN 11062 also demonstrated the ability to synthesize longer chain fatty
acids compared to
nontransformed control plants and transgenic plants containing the wild-type
E. coli KAS II
protein construct. The T2 pooled seeds of 11062 transgenic lines were found to
have a 3 to 4
fold increase in 22:1 as well as increased amounts of 20:2, 20:3 and 22:3,
consistent with the
presence of a KAS II protein being present in the plastid.
The above results demonstrate the ability to modify ~i-ketoacyl-ACP synthase
sequences such that engineered (3-ketoacyl-ACP synthases having altered
substrate specificity
may be produced. Such (3-ketoacyl-ACP synthases may be expressed in host cells
to provide
a supply of the engineered (3-ketoacyl-ACP synthase and to modify the existing
pathway of
2 5 fatty acid synthesis such that novel compositions of fatty acids are
obtained. In particular, the
engineered ~i-ketoacyl-ACP synthases may be expressed in the seeds of oilseed
plants to
provide a natural source of desirable TAG molecules.
All publications and patent applications mentioned in this specification are
indicative
3 0 of the level of skill of those skilled in the art to which this invention
pertains. All
publications and patent applications are herein incorporated by reference to
the same extent as
CA 02339517 2001-02-08
WO 00/75343 PCT/US00/16151
if each individual publication or patent application was specifically and
individually indicated
to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious that
certain changes and modifications may be practiced within the scope of the
appended claims.
31
CA 02339517 2001-02-08
r,~y. . .
.~.L.~.2
SEQUENCE LISTING
<llo> CALGENE LLC
<120> Engineering Heta Ketoacyl ACP Synthase fox Novel Substrate
Specificity
<130> 15597/00/WO
<140> PCT/U5 00/16151
<141> 2000-06-09
<150> US 60/138,308
<151> 1999-06-09
c160> 46
<170> PatentIn version 3.0
<210> 1
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> () .. ()
<223> Oligonucleotide Primer I108F Sense
<400> 1
gcgccgcaat tggatccggg tttggcggcc tcggao 36
<210> 2
<211> 36
<212> DNA
c213> Artificial Sequence
<220>
<221> miec_feature
<222> () .. ()
<223> Oligoaucleotide Primer i108F Antisense
c400> 2
gtccgaggcc gccaaacccg gatccaattg cggcac 36
<210> 3
<211> 42
c212> DNA
<213> Artificial Sequence
<220>
c221> misc_feature
<222> () .. ()
c223> Oligonucleotide Primer 2108L Sense
c400> 3
gtgccgcaat tggctccggg cttggaggcc tcggactgat cg 42
<210> 4
CA 02339517 2001-02-08
3 ~3
<zll> a2
c212> DNA
<213> Artificial sequence
<220>
<221> misc_featuze
<222> ( ) , . f )
<223> Oligonucleotide Primer I108L Antisense
<900> 9
cgatcagtcc gaggcctcca agcccggagc caattgcggc ac 42
c210> 5
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
c221> misc_feature
<222> () .. ()
<223> Oligonucleotide Primer A193I Sense
<400> S ,
gcaggtggcg ccgagaaaat cagtacgccg ctgggc 36
<210> 6
<211> 3S
<212> DNA
<213> Artificial Sequence
<220>
c221> misc_feature
<222> () .. ()
c223> Oligonucleotide Primer A193I Antisense
<A00> 6
gcccagcggc gtactgattt tctcggcgcc acctg 35
c210> 7
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<223> () .. ()
<223> Oligonucleotide Primer A193M Sense
c400> 7
ggtggegcag agaaaaegag tactccgctg ggcgttg 37
<210~ 8
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc feature
CA 02339517 2001-02-08
<222> () -- ()
<223> Oligonucleotide Primer A193M Antisense
<a00> A
caacgcccag cggagtactc attttctctg cgccacc 37
<210> 9
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<221> miec_~eaCure
<222> () .. ()
<223> Oligonucleotide Primer i108A,L111A, I114A Sense
<400> 9
gcaattggct ccggggctgg cggcgccgga ctggccgaag aaaaccacac SO
<210> 10
<211> SO
<212> DNA .
<213> Artificial Sequence
<220>
<221> misc_feature
<222> () .. ()
<223> Oligonucleotide Primer z108A,~,111A, z114A Antiaense
<400> 10
gtgtggtttt cttcggccag tccggcgccg ccagccccgg agccaattgc 50
<210> 11
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> () .. ()
<223> Oligonucleotide Primer L111A Sense
<400> 11
gggattggcg gcgccggact gatcgaag , 28
<210> 12
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> () .. ()
<223> Oligonucleotide Primer L111A Antiaease
<400> 12
cttcgatcag tccggcgccg ccaatccc 2B
,~ CA 02339517 2001-02-08
i
<210> 13 '
<211> 39 f
<212> DNA
<213> Artificial Sequence
<220>
<221> miac_fenture
<222> () . . ()
<223> Oligonuclcotide Primer ~~133A Sense
<400> 13
gatcagccca ttcgcggtac cgtcaacg~t tgtg 34
<zlo> 1 g4
<211> 34
<212> DNA
<213> Artificial Sequence
. <220>
<221> misc feature
<222> () .. ~)
<223> Oligonucleotide Primer F133A Antiaense
l
<400> 14
cacaatcgtt gacggtaccg cgaatggg~t gate 34
t
c
<210> IS
c211a 32
<212> DNA
<213> Artificial Sequence
<220> ;
<221> rnisc_feature 4
<222> (1..()
<223> Oligonucleotide Primer LI97A Senee
<400> 15
gagaaagcca gtactccggc gggcgttggt gg 32
<210> 16
c211> 32
<212> DNA
<213> Artificial Sequence '
<220>
<221> misc_feature
<222> () . . ()
<223> Oligonucleotide Primer L197A Antisense
c400> 16
ccaccaacgc ccgccggagt actggctttc tc 32
<210> 17
<211> 56
<212> DNA
<213> Artificial sequence
<220>
CA 02339517 2001-02-08
.tll
~2
<z21~ miec_~eaturc
<222> () . . ()
<223> Self annealed oligonucleotide primer
<400> 17
cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaaat . 56
<210>
18
<211>
366
<212>
DNA
<213>
Cuphea
hookerisna
<400>
18
ctgagatctgtcgacatggcgaccgcttctcgcatggttgcgtcccctttctgtacgtgg60
ctcgtagctgcatgcatgcccacttcatccgacaacgacccacgttccctttcccacaag120
cggctccgcctctcccgtcgccggaggactctcccctcccattgctccctccgcggatcc160
accttccaatgcctcgatccttgcaaccagcaacgcttcctcggggataacggattcgct240
tccctcttcggatccaagcctcttcgttcaaatcgcggccacctgaggctcggccgcact300
tcccattccggggaggtcatggctgtggctatgcaacctgcacaggaagtctccacaaga360 ,
tctgtc 366
<210> 19
e211> 431
<212> PRT
<213> Arabidopais thaliana
<400> 19
Ile Ser Ala Ser Ala Ser Thr Val Ser Ala Pro Lys Arg Glu Thr Asp
1 S 10 15
Pro Lys Lys Arg Val Val Ile Thr Gly Met Gly Leu Val Ser Val Cys
ZO ~ ZS 30
Gly Asn Asp Val Asp Ala Tyr Tyr Glu Lys Leu Leu Ser Gly Glu Ser
35 40 45
Gly Ile Ser Leu Ile Asp Arg Phe Asp Ala Ser Lys Phe Pro Thr Arg
50 55 60
Phe Gly Gly Gln Ile Arg Gly Phe Ser Ser Glu Gly Tyr Ile Asp Gly
65 70 75 80
Lys Asn Glu Arg Arg Leu Aap Aap Cya Leu Lye Tyr Cys Ile Val Ala
B5 90 95
Gly Lys Lys Ala Leu Glu Ser Ala Asn Leu Gly Gly Asp Lys Leu Asn
100 105 110
Thr Ile Aep Lys Arg Lys Ala Gly Val Leu vat Gly Thr Gly Met Gly
115 120 125
Gly Leu Thr Val Phe Ser Glu Gly Val Gln Asn Leu Ile Glu Lye Gly
130 135 190
Hie Arg Arg Ile Sex Pro Phe Phe Ile Pro Tyz Ala Ile Thr Asn Met
145 150 155 160
CA 02339517 2001-02-08
i-f~t2-.
Gly Scr Ala Lcu Lcu Ala Ilc Aap Lcu Gly Leu Met Gly Pro Asn Tyr
165 170 175
Sex Ile Ser Thr Ala Cys Ala Thr Ser Aen Tyr Cys Phe Tyr Ala Ala
180 185 190
Ala Asn His Aan His Arg Gly Glu Ala Asp Met Met Ile Ala Gly Gly
195 200 205
Thr Glu Ala Ala Ile Ile Pro Ile Gly Leu Gly Gly Phe Val Ala Cys
210 Z15 220
Arg Ala Leu Ser Gln Arg Asn Asp Asp Pro Gln Thr Ala Ser Arg Pro
225 230 235 240
Trp Asp Lys Ala Arg Asp Gly Phe val Met Gly Glu Gly Ala Gly Val
245 250 255
Leu val Met Glu Ser Leu Glu His Ala Met Lys Arg Gly Ala Pro Ile
260 265 270
val Ala Glu Tyr Leu Gly Gly Ala val Asn Cys Asp Ala His His Met
275 280 285
Thr Asp Pro Arg Ala Asp filly Leu G1y val Ser Ser Cys Ile Glu Arg
290 295 300 ,
Cys Leu Glu Asp Ala Gly val Ser Pro Glu Glu Val Asn Tyr Ile Asa
305 310 315 320
Ala His Ala Thr Ser Thr Leu Ala Gly Asp Leu Ala Glu Ile Asn Ala
32S 330 335
Ile Lys Lys Val Phe Lye Ser Thr Ser Gly Ile Lye Ile Asa Ala Thr
340 345 350
Lys Ser Met Ile Gly His Cys Leu Gly Ala Ala Gly Gly Leu Glu Ala
355 360 365
ile Ala Thr Val Lys Ala Ile Aen Thr Gly Trp Leu Hie Pro Ser Ile
370 375 380
Asn Gln Fhe Asn Pro Glu Gln Ala val Aap Phe Asp Thr Val Pro Asn
385 390 395 900
Glu Lys Lys Gln His Glu Val Asp val Ala Ile Sex Asn Sex Phe Gly
405 410 415
Phe Gly Gly His Asn Ser val val Ala Phe Ser Ala Phe Lys~Pro
920 425 430
<210> 20
c211> 429
<212> PRT
<213> Braeeica napus
<400> 20
Ala Sex Sex Ser Ala Val Ser Ala Pro Lys Arg G1u Thr Asp Pzo Lys
1 5 10 15
Lys Arg Val Val Ile Thr Gly Met Gly Leu Val Sex val Phe Gly Asn
20 25 30
Asp val Asp Ala Tyr Tyr Glu Lys Leu Leu Ser Gly Glu Ser Gly Ile
35 40 45
CA 02339517 2001-02-08
?~
Ser Leu Ilc Aop Arg Phe Aap Ala Sex Lye Phe Pro Thr Arg Phe Gly
50 55 60
Gly Gln Ile Arg Gly Phe Ser Ser Glu Gly Tyr Ile Asp Gly Lys Asn
65 70 75 80
Glu Arg Arg Leu Aap Asp Cys Leu Lye Tyr Cys Ile val Ala Gly Lys
85 90 95
Lys Ala Leu Glu Ser Ala Asn Leu Gly Gly Asp Lys Leu Asn Thr Ile
loo los llo
Asp Lys Oln Lys Ala Gly val Leu val Gly Thr Gly Met Gly Gly Leu
115 120 125
Thr val Phe Ser Asp Gly Val Gln Ala Leu Ile Olu Lys Gly His Arg
130 135 140
Arg Ile Ser Pro Phe Phe Ile Pro Tyr Ala Ile Thr Asn Mec Gly Ser
145 150 155 160
Ala Leu Leu Ala Ile Asp Leu Gly Leu Met Gly Pro Aen Tyr Sex i1e
165 170 175
Ser Thr Ala Cys Ala Thr Ser Asn Tyr Cys Phe Tyr Ala Ala Ala Asn
180 185 190 ,
His Ile Arg Arg Gly Glu Ala Aep Met Met Ile Ala Gly Gly Thr Glu
195 200 205
Ala Ala Ile Ile Pro Ile Gly Leu Gly Gly Phe val Ala Cys Arg Ala
210 215 220
Leu Ser Gln Arg Asn Asp Asp Pro Gln Thr Ala Ser Arg Pro Trp Aep
22,5 230 235 240
Lys Gln Arg Asp Gly Phe Val Met Gly Glu Gly Ala Gly Val Leu val
2A5 250 255
Met Glu Ser Leu Glu Hie Ala Met Lys Arg Gly Ala Pro Ile Val Ala
260 265 270
Glu Tyr Leu Gly Gly Ala val Aen Cys Asp Ala Hie His Met Thr Asp
275 2B0 2A5
Pro Arg Ala Asp Gly Leu Gly val 9er Ser Cys Ile Glu Ser Cys Leu
290 295 300
Glu Asp Ala Gly Val Sex Pzo Glu Glu Val Aen Tyr Ile Asn Ala His
305 310 315 320
Ala Thr Ser Thr Leu Ala Gly Aap Leu Ala Glu Ile Asn Ala Ile Lys
325 330 335
Lys Val Phe Lys Ser Thr Ser Gly Ile Lys Ile Asn Ala Thr Lys Ser
390 345 350
Met Ilc Gly His Cys Leu Gly Ala Ala Gly Gly Leu Glu A1a Ile Ala
355 360 365
Thr Val Lys Ala Ile Asn Thr Gly Trp Leu His Pro Ser Ile Asn Glen
370 375 380
Phe Asn Pro Glu Pro Ala Val Asp Phe Asp Thr Val Ala Asn Glu Lys
385 390 395 400
CA 02339517 2001-02-08
Lys Gln »is Glu Val Asn val Ala Ile Ser Aen Ser Phe Gly Phe Gly
405 410 415
Gly His Asn Ser Val Val Ala Phe Ser Ala Phe Lye Pro
420 425
<210> 21
<211> 350
<212~ PRT
<213> Cuphea hookeriana
<400> 21
Ser Ser Thr Ala Val Ala Ala Ala Leu Glu Leu Val Asp Pro Pro Gly
1 s l0 15
Cys Arg Asn Ser Ala Arg Ala Aep Leu Gly Ala Asp Arg Leu Ser Lys
20 25 30
Ile Asp Lya Olu Arg Ala Gly Val Leu Val Gly Thr Gly Met Gly Gly
35 40 45
Leu Thr Val Phe Ser Aap Gly val Gln Ser Leu Ile Glu Lys Gly Hie
50 5S 60
Arg Lya Ile Thr Pro Phe Phe Ile Pro Tyr Rla Ile Thr Asn Met Gly .
65 70 75 80
Ser Ala Leu Leu Ala Ile Glu Phe Gly Leu Met Gly Pro Aen Tyr Ser
85 90 95
Ile Ser Thr Ala Cys Ala Thr 5er Aan Tyr Cys Phe His Ala Ala Ala
100 105 110
Aan His Ile Arg Arg Gly Glu Ala Asp Leu Met Ile Ala Gly Gly Thr
115 120 125
Glu Ala Ala Ile Ile Pro Ile Gly Leu Gly Gly Phe Val Ala Cys Arg
130 135 140
Ala Leu SEr Gln Arg Asn Asp Asp Pro Gln Thr Ala Sex Arg pro Trp
145 150 155 160
Asp Lys Asp Arg Aap Gly She Val Met Gly Glu Gly Ala Gly Val Leu
165 170 175
Val Met Glu Sex Leu Glu His Ala Met Arg Arg Gly Ala Pro Ile Ile
1B0 185 190
Ala Glu Tyr Leu Gly Gly Ala Ile Asn Cys Asp Ala Tyr His Met Thr
195 200 205
Asp Pro Arg Ala Asp Gly Leu Gly Val Ser Ser Cya Ile Glu Ser Ser
210 215 220
Leu Glu Asp Ala Gly Val Sex Pro Glu Glu Val Asn Tyr Ile Asn Ala
225 230 235 240
His Ala Thr Ser Thr Leu Ala Gly Aap Leu Ala Glu Ile Asn Ala Ile
245 250 255
Lys Lys Val Phe Lys Asn Thr Lys Asp Ile Lye Ile Rsn Ala Thr Lys
260 265 2ZO
Ser Met Ile Gly His Cys Leu Gly Ala Ser Gly Gly Leu Glu Rla Ile
275 280 285
CA 02339517 2001-02-08
i
~~ 5
9-/'92
Ala Thr Ile Lys Oly Ilc Asn Thr Gly Trp Leu Hie Pro 5er Ile Asn
290 295 300
Gln Phe Asn Pro Glu Pro Sex val Glu Phe Asp Thr val A1a Aan Lys
305 310 315 320
Lys Gln Gln His Glu val Asn val Ala Ile Ser Asn ser Phe Gly Phe
325 330 335
Gly Gly His Asn Ser val val Ala Phe Ser Ala Phe Lye Pro
340 345 350
<210> 22
c211> 441
c212> PRT
<213> Cuphea hookeriana
<220>
<221> miec_feature
<222> (15) .(15)
<223~ Xaa at position 15 is unknown.
c400> 22 -
Lys Leu Thr Leu Thr Lys Gly Asn Lye Sex Txp Ser Ser Thr Xaa Val ,
1 5 10 15
Ala Ala Ala Leu Glu Leu Val Asp Pro Pro Gly Cye Arg Asn Ser Ala
20 25 30
Arg Ala Gly Met Gly Leu val Ser Val Phe Gly Ser Asp Val Asp Set
35 80 45
Tyr Tyr Glu Lys Leu Leu Ser Gly Glu Ser Gly Ile Ser Leu Ile Asp
50 SS 60
Arg Phe Asp Ala Ser Lye phe nro Thr Arg phe Giy Giy Gin Ile Arg
65 70 75 80
Gly Phe Asn Ala Thr Gly Tyr Ile Asp Gly Lys Asn Asp Arg Arg Leu
BS 90 95
Asp Asp Cys Leu Arg Tyr Cys Ile Val Ala Gly Lye Lys~Ala Leu Glu
100 105 110
Aen Sex Asp Leu Gly Giy Glu Sex Leu Sex Lys Ile Asp Lys Glu Arg
11S 120 125
Ala Gly Val Leu Val Gly Thr Gly Met Gly Gly Leu Thx val Phe Ser
i30 135 140
Asp Gly Val Gln Asn Leu Ile Glu Lye Gly Hie Arg Lys Ile Ser Pro
145 150 155 160
Phe Phe Ile Pro Tyr Ala Ile Thr Asn Met Gly Ser Ala Leu Leu Ala
165 170 175
Ile Asp Leu Gly Leu Met Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cys
180 l8S 190
Ala Thr Ser Asn Tyr Cys Phe Tyr Ala Ala Ala Asn His Ile Arg Arg
195 200 205
Gly Glu Ala Asp Leu Met Ile Ala Gly Gly Thr Glu Ala Ala Ile Ile
210 215 220
CA 02339517 2001-02-08
,~b
l~htZ
Pro xle Gly Lcu Gly Gly Phe val Ala Cys Arg Ala Leu Ser Gln Arg
225 230 235 240
Asn Asp Asp Pro Gln Thr Ala 5er Arg Pro Trp Aap Lys Asp Arg Asp
245 250 255
Gly Phe val Met Gly Glu Gly Ala Gly Val Leu val Met Glu Ser Leu
260 265 270
Glu His Ala Met Lys Arg GIy Ala Pro ile Ile Ala Glu Tyr Leu Gly
27S 280 285
Gly Ala val Asn Cys Asp Ala Tyr His Met Thr Asp Pro Arg Ala Asp
290 295 300
Gly Leu Gly Val Ser Ser Cys Ile Glu Ser Ser Leu Glu Asp Ala Gly
305 310 315 320
vat Ser Pro Glu Glu val Asn Tyr Ile Asn Ala His Ala Thr Ser Thr
325 330 335
Leu Ala Gly Asp Leu Ala Glu Ile Asn Ala Ile Lys Lys Val Phe Lys
340 345 350
Asn Thr Lya Glu Ile Thr Ile Aan Alrz Thr Lys Ser Met Ile Gly His
355 360 365
Cys Leu Gly Ala Ser Gly Gly Leu Glu Ala Ile Ala Thr Ile Lys Gly
370 375 380
Ile Thr Thr Gly Trp Leu His Pro Ser Ile Asn Gln Phe Asn Pro Glu
385 390 395 400
Pro Ser val Glu Phe Aep Thr Val Ala Asn Lye Lya Gln Gln His Glu
905 410 415
val Asn val Ala I1e Ser Aen Sex Phe Gly Phe Gly Gly His Asn Ser
420 925 430
val val Ala Phe Ser Ala Phe Lys Pro
435 440
<210> 23
<211> 430
<212> PRT
<213> Cuphea pullcherima ,
<400> 23
Arg Ala Ala Ser Pro Thr Val Ser Ala Pro Lys Arg Glu Thr Asp Pro
1 5 7.0 15
Lys Lys Arg Val val Ile Thr Gly Met Gly Leu val Ser Val Phe Gly
20 25 30
Ser Asp Val Asp Ala Tyr Tyr Asp Lys Leu Leu Ser Gly Glu Ser Gly
35 40 45
Ile Gly Pro Ile Asp Arg Phe Aap Ala Ser Lys Phe Pro Thr Arg Phe
50 55 60
Gly Gly Gln Ile Arg Gly Phe Asn Ser Met Gly Tyr Ile Asp Gly Lys
65 70 75 80
Aen Asp Arg Arg Leu Aap Asp Cys Leu Arg Tyr Cys Ile Val Ala Gly
es ' so s5
CA 02339517 2001-02-08
._
1~2
Lys Lys Ser Leu Glu Asp Ala Asp Leu G1y Ala Asp Arg Leu Ser Lye
100 105 110
Ile Asp Lys Olu Arg Ala Gly Val Leu Val Gly Thr Gly Met Gly Gly
115 7.20 125
Leu Tbr Val Phe Ser Asp Gly Val Gln Ser Leu Ile Glu Lye Gly His
130 135 140
Arg Lys Ile Thr Pro Phe Phe Ile Pro Tyr Ala Ile Thr Aan Met Gly
145 150 155 160
Ser Ala Leu Leu Ala Ile alu Leu Gly Leu Met Gly Pro Aan Tyr Ser
165 170 175
Ile Ser Thr Ala Cys Ala Thr Ser Asn Tyr Cys Phe His Ala Ala Ala
180 185 190
Asn His Ile Arg Arg Gly Glu Ala Asp Leu Met Ile Ala Gly Gly Thr
195 200 205
Glu A1a Ala Ile Ile Pro Ile Gly Leu Gly Gly Phe Val Ala Cys Arg
210 215 220
Ala Leu Ser Gln Arg Asn Asp Asp Pro Gln Thr Ala Ser Arg Pro Trp
225 230 235 240 ,
Asp Lys Asp Arg Asp Gly Phe val Met Gly Glu Gly Ala Gly val Leu
245 250 255
val Leu Glu Ser Leu Glu His Ala Met Lys Arg fly Ala Pro Ile Ile
260 265 270
Ala Glu Tyr Leu Gly Gly Ala Ile Asn Cys Asp Ala Tyr His Met Thr
275 280 285
Asp Pro Arg Ala Asp Gly Leu Gly val Ser Ser Cys Tle Glu Ser Sex
290 295 300
Leu Glu Asp Ala Gly Val Ser Pro Glu Glu Val Aen Tyr Ile Aan Ala
305 310 315 330
His Ala Thr Ser Thr Leu Ala Gly Asp Leu Ala Glu Ile Asn Ala Ile
325 330 335
Lys Lya Val Phe Lys Asn Thr Lye ASp I1e Lys Ile Asn Ala Thr Lys
340 345 350
Ser Met Ile Gly Hie C~e Leu Gly Ala Ser Gly Gly Leu Glu Ala Ile
355 360 365
Ala Thr Ile Lys Gly Ile Asn Thr Gly Trp Leu His Pro Ser Ile Asn
370 375 380
Gln Phe Asn Pro Glu Pro Ser Val Glu Phe Asp Thr Val Ala Aan Lys
385 390 395 400
Lys Gln Gln His Glu Vai Asn val Ala Ile Ser Asn Ser Phe Gly Phe
405 410 415
Gly Gly His Asn Ser Val Val Ala Phe Ser Ala Phe Lys Pro
420 425 930
<210> 24
<211> 928
<212> PRT
CA 02339517 2001-02-08
!t' ~
<213> Cuphea pullcherima
<900> 24
Arg Ala Ala Thr Ala Ser Ala Pro Lye Arg Glu Ser Asp Pro Lye Lye
1 5 10 15
Arg Val val ile Thr Gly Met aly Leu Val Sex Val Phe Gly Ser Asp
20 25 30 '
val Asp Ala Tyr Tyr Aep Lys Leu Leu Ser Gly olu Ser Gly ile Ser
35 80 45
Leu Ile Asp Arg Phe Asp Ala Ser Lye Phe Pro Thr Arg Phe Ala Gly
SO 55 60
Gln Ile Arg Gly Phe Asn Ala Thr Gly Tyr Ile Asp Gly Lys Aen Asp
65 70 7S 80
Arg Arg Leu Asp Asp Cys Leu Arg Tyr Cys Ile Val Ala Gly Lys Lys
g5 90 95
Ala Leu Glu Asp Ala Asp Leu Ala Gly Gln Ser Leu Ser Lys Ile Asp
100 105 110 _
Lys Glu Arg Ala Gly Val Leu Val Gly Thr Gly Met Gly Gly Leu Thr
115 120 125
Val Phe Ser Aep c3ly Val Gln Asn Leu Ile Glu Lys Gly Hie Arg Lys
130 135 140
ile Ser Pro Phe Phe Ile Pzo Tyr Ala Ile Thr Asn Met Gly Sex Ala
145 150 155 1fi0
Leu Leu Ala Ile Asp Leu Gly L~u Met Gly Pro Aen Tyr Ser Ile Ser
165 170 175
Thr Ala Cys Ala Thr Ser Asn Tyr Cys Phe Tyr Ala Ala Ala Asn Xis
180 185 190
Ile Arg Arg Gly Glu Ala Asp Leu Met Ile Ala Gly Gly Thz Glu Ala
195 200 205
Ala Val Ile Pro ile Gly Leu Oly Oly Phe Val Ala Cys Arg Ala Leu
210 215 220
Ser Gln Arg Asn Asp Asp Pro Gln Thr Ala Ser Arg Pro Trp Asp Lys
225 230 235 ado
Asp Arg Asp Gly Phe Val Met Gly Glu Oly Ala Gly Val Leu Val M2t
245 250 255
Glu Ser Leu Glu His Ala Met Lys Arg Gly Ala Pro Ile Ile Ala Glu
260 265 270
Tyr Leu Gly Gly Ala Val Asn Cys Aep Ala Tyr His Met Thr Asp Pro
275 2A0 285
Arg Ala Aap Gly Leu Gly val Ser Sex Cys Ile Glu Ser Ser Leu Glu
290 295 300
Aep Ala Gly Val Ser Pro Glu Glu Val Asn Tyr Ile Aen Ala His Ala
305 310 315 320
Thr Ser Thr Leu Ala Gly Asp Leu Ala Glu Ile Asn Ala Ile Lys Lys
325 330 335
CA 02339517 2001-02-08
"",, __
CL 9
13f~12
Val Phe Lye Asn Thr Lys Olu Ile Lys Ile Asr1 Ala Thr Lya Ser Met
390 345 350
Ile Gly Kis Cys Leu Gly Ala Ser Gly Gly Leu Glu Ala Ile Ala Thr
355 360 365
Ile Lys Gly Ile Thr Thr Gly ?rp Leu His Pro Ser ile Asn Gln Phe
370 375 380
Asn Pro Olu Pro Ser Val Asp Phe Asn Thr Val Ala Aen Lys Lys Gla
385 390 395 400
Gln His Glu Val Asn Val Ala Ile Sex A9n Sex Phe Gly Phe Gly Gly
405 410 415
His Asn Ser Val Val Ala Phe Ser Ala Phe Lys Pro
420 925
<210> 25
<211> 427
<212> PRT
<213> Hordeum vulgare
<400> 25
Thr Sez Ala Ala Pro Gln Arg Glu Thr Asp Pro Arg Lys Arg Val Val ,
1 5 10 i5
Ile Thr Gly Met Gly Leu Ala Ser Val Phe Gly Ser Asp Val Asp Thx
20 25 30
Phe Tyr Asp Arg Leu Leu Ala Gly Olu Ser Gly Val Gly Pro Ile Asp
35 40 a5
Azg Phe Asp Ala Ser Ser Phe Pro Thr Arg Phe Ala Gly c3ln Ile Arg
50 55 60
Gly Phe Ser Ser Glu Gly Tyr Ile Asp Gly Lys Asn Aep Arg Arg Leu
65 70 75 80
Asp Asp Cys Ile Arg Tyr Cys Ile Leu Sex Gly Lye Lys Ala Leu Glu
85 90 95
Ser Ala Gly Leu Gly Ala Gly Sez Asp Ala His Val Lys Leu Asp Val
100 105 110
Gly Arg Ala Gly Val Leu val Gly Thr Gly Met Gly Gly Leu Ser Val
115 120 125
Phe Ser Asp Gly Val Gln Asn Leu Ile Glu Lys Gly Tyr Arg Lys Ile
130 135 140
Ser Pro Phe Phe Ile Pro Tyr Ala Ile Thr Asn Met Gly Ser Ala Leu
145 150 155 160
Leu Ala Ile Asp Val Gly Phe Met Gly Pro Asn Tyr Ser Ile Ser Thr
165 170 175
Ala Cys Ala Thr Ser Asn Tyr Cys Phe Tyz Ala Ala Ala Asn His Ile
180 185 190
Arg Arg Gly Glu Ala Asp Ile Ile Val Ala Gly Gly Thr Glu Ala Ala
195 200 205
Ile Ile Pro Ile Gly Leu Gly Gly Phe Val Ala Cys Arg Ala Leu Ser
210 215 220
CA 02339517 2001-02-08
~a
Gln Arg Aen Aap Asp Pro Ile Thr Ala Cys Arg Pro Trp Asp iry~ Glu
225 230 235 240
Arg Asp Gly Phe Val Met Gly Glu Gly Ala Gly val Leu Val Met Glu
245 250 255
Ser Leu Glu His Ala Met Lys Arg Asp Ala Pro Ile Ile Ala Glu Tyr
260 265 270
Leu Gly Gly Ala Val Asn Cys Asp Ala Tyr His Met Thr Asp Pro Arg
275 280 285
Ala Asp Gly Leu oly val Ser Ser Cye I1e Thr Met Ser Leu Arg Aap
290 295 300
Ala Gly val Ala Pro Glu Glu Val Asn Tyr Ile Asn Ala Hie Ala Thr
305 310 315 320
Ser Thr Leu Ala Gly Asp Leu Ala Glu val Arg Ala Ile Lys Gln Val
325 330 335
Phe Lys Asn Pro Ser Glu Ile Lys Ile Asn Ser Thr Lya Ser Met Ile
Sao 345 350
Gly His Cys Leu Gly Ala Ala Gly Gly Leu Glu Ala Ile Ala Thr Ile
355 360 365
Lys Sex Ile Thr Thr Oly Trp Val His Pro Thr Ile Aan Gln Phe Asn
370 375 380
Pro Glu Pro Glu Val Asp Phe Aep Thr val Ala Asn Glu Lys Lys Gln
385 390 395 400
His Glu Val Asn val Gly Ile Ser Asn Ser Phe Gly Phe Gly Gly Hie
405 410 915
Aen Ser val val val Phe Ala Pro Phe Lys Pro
420 425
<210> 26
c211> 428
c212> PRT ,
<213> Ricinus communis
<a00> 26
Asn Asn Asn Thr Thr Ile Ser Ala Pro Lys Arg Glu Lys Asp Pro Arg
1 5 10 15
Lys Arg val Val Ile Thr Gly Thr Gly Leu Val Ser val Phe Gly Asn
20 25 30
Asp val Asp Thr Tyr Tyr Asp Lys Leu Leu Ala Gly Glu Ser Gly Ile
35 40 45
Gly Leu Ile Asp Arg Phe Asp Ala Ser Lys Phe Pro Thr Arg Phe Gly
50 55 60
Gly Gln Ile Arg Gly Phe Asn Ser Gln Gly Tyr Ile Asp Gly Lye Asn
65 70 75 80
Asp Arg Arg Leu Asp Asp Cys Leu Arg Tyr CyB Ile Val Ala Gly Lys
85 90 95
Lys Ala Leu Glu His Ala Aep Leu Gly Gly Asp Lye Leu Ser Lya Ile
100 105 110
CA 02339517 2001-02-08
1
Asp Lys Glu Arg Ala Gly val Leu val Gly Thr Gly Met Gly Gly Leu
115 120 125
Thr Val Phe Ser Aep Gly val Gln Ala Leu Ile Glu Lys Gly His Arg
130 135 140
Lys Ile Thr Pro Phe Phe Ile Pro Tyr Ala Ile Thr Asn Met Gly Ser
145 150 155 160
Ala Leu Leu Ala ile Glu Leu Gly Leu Met Gly Pro Asn Tyr Ser Ile
165 170 175
Ser Thr Ala Cys Ala Thr Ser Asn Tyr Cys Phe Tyr Ala Ala Ala Asn
180 185 190
~iie Ile Arg Arg Gly Glu Ala Glu Leu Met Ile Ala Gly Gly T'hr Glu
198 200 205
Ala Ala Ile Ile Pro Ile Gly Leu Gly Gly Phe val Ala Cys Arg Ala
210 215 220
Leu Ser Gln Arg Asn Asp Asp Pro Gln Thr Ala 5er Arg Pro Trp Asp
225 230 Z35 240
Lys Asp Arg Asp Gly Phe Val Met Gly Glu Gly Ala Gly val Leu val
295 250 255 ,
Met Glu Ser Leu Glu His Ala Met Lys Arg Gly Ala Pro Ile Ile Ala
260 265 270
Glu Tyr Leu Gly Gly Ala Val Asn Cys Asp Ala Tyr His Met Thr Asp
275 280 285
Pro Arg Ala Asp Gly Leu Gly Val Ser Ser Cys Ile Glu Arg Ser Leu
290 295 300
Glu Asp Ala Gly Val Ser Pro Glu Glu Val Aen Tyr Ile Asn Ala His
305 310 315 320
Ala Thr Ser Thr Leu Ala Gly Asp Leu Ala Glu Ile Asn Ala Ile Lys
325 330 335
Lys Val Phe Lye Aen Thr Ser Asp Ile Lys Ile Asn Ala Thr Lys Ser
340 395 350
Met Ile Gly His Cys Leu Gly Ala Ala Gly Gly Leu Glu Ala Ile Ala
355 360 365
Cys Val Lys Ala Ile Thr Thr Gly Trp Leu His Pro Thr Ile Asn Gln
370 375 380
Phe Asn Pro G1u Pro Ser val Glu Phe Asp Thr Val Ala Asn Lys Lys
385 390 395 400
Gln Gln His Glu val Aen Val Ala ile Ser Asn 5er Phe Gly Phe Gly
405 410 415
Gly His Asn Ser val Val Ala Phe Ser Ala Phe Lys
420 425
<210> 27
<211> 420
<212> PRT
<213> Capsicum ehinense
<400> 27
CA 02339517 2001-02-08
~,rr
5~Z-.
1~-f~t2
Zayo Asg Glu Thr Aep Pro Lys Lye Arg Ile Val Ile Thr Gly Met Gly
1 s to is
Leu Val Ser Val Phe Gly Ser Aap Ile Asp Aan Phe Tyr Asn Lys Leu
20 2S 30
Leu Glu Gly Gln Ser Gly Ile Ser Leu Ile Asp Arg Phe Asp Ala Ser
35 40 45
Ser Tyr Thr Val Arg Phe Ala Gly Gln Ile Arg Asp Phe Ser Sex Glu
50 55 60
Gly Tyr Ile Asp Gly Lys Asn Asp Arg Arg Leu Asp Asp Cye Trp Arg
65 70 75 BO
Tyr Cys Leu Val Ala Gly Lya Arg Ala Leu Glu Asp Ala Asn Leu Gly
85 90 95
Gln Gln val Leu Aep Thr Met Asp Lye Thz Arg Ile Gly Val Leu Val
100 105 110
Gly Ser Ser Met Gly Gly Ser Lys Val Phe Ala Asp Ala Val Glu l~la
115 120 125
Leu val Gln Arg Gly Tyr Lys Lya Ile Aan Pro Phe Phe Ile Pro Tyr
130 135 140 ,
Ser Ile Thr Asn Met Gly Ser Ala Leu Leu Ala Ile Asp Thr Gly Leu
195 150 155 160
Met Gly Pro Thr Tyr Ser Ile Ser Thr Ala Cys Ala Thr Ala Asn Tyr
165 170 175
Cys Phe Tyr Ala Ser Ala Aan Hie Ile Arg Arg Gly Olu Ala Asp Ile
180 185 190
Met Val Ala Gly Gly Thr Asp Ala Phe Ile Ser Ala Ile Gly Val Gly
195 200 205
Gly Leu Ile Ala Cys Arg Ala Leu Sex Gln Arg Aan Asp Glu Tyr Glu
210 215 220
Lys Ala Ser Arg Pro Trp Asp Arg Aan Arg Aep Gly Phe val Ile Gly
225 230 235 240
Glu Gly Ser Gly Val Leu Val Met Glu Asn Leu Glu Hie A.la Leu Lys
245 250 255
Arg Gly Ala Pro Ile Ile Ala Glu Tyr Leu Gly Gly Ala Ile Thr Cys
260 265 270
Asp Ala Hie His Ile Thr Asp Pro Arg Ala Aap Gly Leu Gly Val Ser
275 280 285
Ser Cya Ile Val Met Ser Leu Val Asp Ala Gly Val Sex Pro Glu Glu
290 295 300
val Asn Tyr Ile Asn Ala His Ala Thr Ser Thr Leu Ala G1y Asp Leu
305 310 315 320
Ala Glu Val Asn Ala Ile Lya Lye Val Phe Lye Aap Thr Ser Glu Ile
32S 330 335
Lys Met Aan Gly Thr Lya Ser Met Ile Gly His Gly Leu Gly Ala Ser
340 345 350
CA 02339517 2001-02-08
2~7'~t'Z
Gly Gly Leu Glu A1a I1e Ala Thr Ile Lys Ale Ile Thr 'Ihr Gly 'rrp
355 360 36S
Leu His Pro Thr Ile Asn Gln Tyr Asp Leu Glu Pro Gln Val Thr Ile
370 375 380
Asp Thr Val Pro Asn val Lys Lys Gln His Glu val Asn Val Gly Ile
385 390 395 400
ser Asn Ser Phe Gly Phe Gly Gly htis Aen Ser val Val val Phe Ala
405 410 415
Pro Tyr Lys Pro
420
c2i0> 28
<211> 420
c212> PRT
c213> Cuphea hookeriana
c400> 28
Lye Lye Lye Pro Ser Ile Lye Gln Arg Arg val Val Val Thr Gly Met
1 5 10 15
Gly val val Thr Pro Leu Gly His Asp Pro Asp Val Phe Tyr Asn Asn
20 25 30
Leu Leu Asp Gly Thr Ser Gly Ile Ser Glu Ile Glu Thr Phe Asp Cys
35 40 45
Ala Gln Phe Pro Thr Arg Ile Ala Gly Glu Ile Lys Ser Phe Ser Thr
50 55 60
Asp Gly Trp val Ala Pro Lys Leu Ser Lys Azg Met Asp Lye Phe Met
65 ?0 75 80
Leu Tyr Met Leu Thr Ala Gly Lys Lys Ala Leu Thr Asn Gly Gly Ile
85 90 95
Thr Glu Asp val Met Lys Glu Leu Asp Lys Arg Lys Cys Gly Val Leu
100 105 110
Its Gly Ser Ala Mct Gly Gly Met Lys Val Phe Aen Asp Ala Ile Glu
115 120 125
Ala Leu Arg Ile Ser Tyr Lys Lys Met Aan Pro Phe Cys Val Pro Phe
130 135 140
Ala Thr Thr Asn Met Gly Ser Ala Met Leu Ala Met Asp Leu Gly Trp
145 150 15S 160
Met Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cys Ala Thr Ser Asn Phe
165 170 175
Cys Ile Leu Aari Ala Ala Asn His Ile Ile Arg Gly Glu Ala Asp val
180 185 190
Met Leu Cys Gly Gly Ser Aap Ala Val Ile Ile Pro Ile Gly Met Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Ser Gln Arg Aen Ala Asp Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp Ser Asn Arg Asp Gly Phe Val Met Gly
22S 230 235 240
CA 02339517 2001-02-08
rr
5 !r=.
alu Lily Ala Gly Val Leu Leu Leu Glu Glu Leu C3lu Iiie Ala Lya Lya
295 250 255
Arg G1y Ala Thr Ile Tyr Ala Glu Phe Leu Gly Gly Ser Phe Thr Cys
260 265 270
Asp Ala Tyr Hze Met Thr G1u Pro Hia Pro Asp Gly Ala Gly vai Iie
275 280 285
Leu Cys Ile Glu Lys Ala Leu Ala Gln Ser Gly Val Ser Arg Glu Asp
290 295 300
Val Asn Tyr Ile Asa Ala His Ala Thr Ser Thr Pro Ala Gly Aap ile
305 310 315 320
Lys Glu Tyr Glz~ Ala Leu Ile His Cys Phe Gly Gln Asn Aen Glu Leu
325 330 335
Lys Val Asn Ser Thr Lys 5er Met Ile Gly His Leu Leu Gly Ala Ala
340 345 350
Gly Gly Val Glu Ala Val Ser Val Val Gln Ala Ile Arg Thr Gly Trp
355 360 365
Ile His Pro Aen Ile Aen Leu Glu Aer~ Pro Aep Olu Gly Val Asp Thr
370 375 380
Lys Leu Leu Val Gly Pro Lys Lys Glu Arg Leu Aert Ile Lys val Gly
38S 390 395 400
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Asa Ser Sex Ile Leu Phe
405 d10 415
Ala Pro Tyr Asn
420
<210> 29
c211> 420
<212> PRT
c213> Cuphea hookeriana
c400> 29
Asn Lys Lys Pro Ala Thr Lys Gln Arg Arg Val val val Thr Gly Met
1 5 10 15
Gly Val Val Thr Pro Leu Gly His Asp Pro Asp Val Tyr Tyr Asn Asn
20 25 30
Leu Leu Asp Gly Ile Ser Gly Ile Ser Glu Ile Giu Asn Phe Aep Cye
35 40 45
Ser Gln Phe Pro Thr Arg Ile Ala Gly Glu Ile Lys Ser Phe Ser Thr
50 55 60
Asp Gly Trp Val Ala Pro Lys Phe Ser Glu Arg Met Asp Lys Phe Met
65 70 75 80
Leu Tyr Met Leu Thr Ala Gly Lys Lys Ala Leu Ala Aep Gly Gly Ile
85 90 95
Thr Glu Asp Ala Met Lys Glu Leu Asn Lys Arg Lys Cye Gly Val Leu
100 105 110
Ile Gly Ser Gly Leu Gly Gly Met Lys Val Phe Ser Asp Ser Ile Glu
115 120 125
,~, CA 02339517 2001-02-08
1~
l~lw Leu Arg Thr sar Tyr Lya Lya Ile Ser Pro Phe Cye val pro phe
130 135 140
Ser Thr Thr Asn Met Gly Ser Ala Ile Leu Ala Met Asp Leu Gly Trp
195 150 155 160
Met Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cys Ala Thr Ser Asn Phe
165 170 175
Cys ile Leu Asn Ala Ala Asn Hia Ile Ile Lys Gly c~lu Ala Asp Met
180 185 190
Met Leu Cys Gly Gly Ser Asp Ala Ala Val Leu Pro Val Gly Leu Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Ser Gln Arg Asn Asn Asp Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp Ser Asn Arg Asp c3ly Phe Val Met Gly
225 230 235 240
Glu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Glu Hie Ala Lys Lys
245 250 255
Arg Gly A1a Thr Ile Tyr Ala Glu Phe Leu Gly Gly Ser Phe Thr Cys
260 265 270 ,
Asp Ala Tyr His Met Thr Glu Pro His Pro Glu Gly Ala Gly Val Ile
275 280 285
Leu Cys Ile Glu Lys Ala Leu Ala Gln Ser Gly Val Ser Arg Glu Asp
290 295 300
Val Asn Tyr Ile Asn Ala His Ala Thr Ser Thr Pro Ala Gly Asp ile
305 310 315 320
Lys Glu Tyr Gln Ala Leu Ala His Cys Phe (ily Gln Asn Ser Glu Leu
325 330 335
Arg Val Asn Ser Thr Lys Ser Met Ile Gly His Leu Leu Gly Gly Ala
340 395 350
Gly Gly Val Glu Ala Val Ala Val Val Gln Ala Ile Arg Thr Giy Trp
355 360 365
Ile His Pro Asn Ile Aea Leu Glu Aap Pro Aep Glu Gly Val Asp Ala
370 375 380
Lys Leu Leu Val Gly Pro Lye Lys Glu Lys Leu Lys Val Lys Val Gly
385 390 395 400
Leu Ser Asn Sex Phe Gly Phe Gly Gly His Asn Ser Ser Ile Leu Phe
a05 410 415
Ala Pro Cys Asn
a20
c210> 30
<211> 420c212> PRT
<213> Cuphea pullcherima
<400> 30
Lye Lys Lys P=o Ser Ile Lys Gln Arg Arg Val Val Val Thr Gly Met
1 6 10 15
CA 02339517 2001-02-08
Gly vat vat Thr Pro Leu Gly His Asp Pro Asp val Phe Tyr Aen Asn
20 25 30
Leu Leu Asp Gly Thr Ser Gly Ile Ser Glu Ile Glu Thr Phe Asp Cys
35 90 d5
A1a Gla Phe Pro Thr Arg ile Ala Gly Glu Ile Lys Ser Phe Ser Thr
50 55 60
Asp Gly Trp Val Ala Pzo Lys Leu Ser Lys Arg Met Asp Lys Phe Met
65 70 75 80
Leu Tyr Met Leu Thr Ala Gly Lys Lye Ala Leu Thr Asp Gly Gly Ile
85 90 95
Thr Glu Asp Val Met Lys Glu Leu Asp Lys Arg Lys Cys Gly Val Leu
100 105 110
Ile Gly Ser Ala Met Gly Gly Met Lys Val Phe Asn Asp Ala Ile Glu
115 120 7.25
Ala Leu Arg Ile Ser Tyr Lye Lys Met Asn Pro Phe Cys val Pro Phe
130 135 la0
Ala Thr Thr Asn Met Gly Ser Ala Met Leu Ala Met Asp Leu Gly Trp
145 150 155 160 ,
Met Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cys Ala Thr Ser Asn Phe
165 170 175
Cys Ile Met Asn Ala Ala Asn His Ile Ile Arg Gly Glu Ala Aap val
180 185 190
Met Leu Cys Gly Gly Ser Asp Als Val Ile Ile Pro Ile Gly Met Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Sex Gln Arg Asn Ser Asp Fro Thr
210 215 220
Lys Ala Ser Arg Pro Tzp Asp Sex Asn Ar9 Asp Gly Phe val Met Gly
225 230 235 240
Glu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Glu His A1a Lys Lys
245 250 255
Arg Gly Ala Thr Ile Tyr A1a G1u Phe Leu Gly Gly Ser Phe Thr Cys
260 265 270
Asp Ala Tyr His Met Thr Glu Pro His Pro Asp Gly Ala Gly Val Ile
275 280 285
Leu Cys Ile Glu Lys Ala Leu Als Gln Sex Gly val Ser Arg Glu Aap
290 295 300
val Aan Tyr Ile Asn Ala His Ala Thr Ser Thr Pro Ala Gly Asp Ile
305 310 315 320
Lys Glu Tyr Gln Ala Leu Ile His Cys Phe Gly Gln Asn Arg Glu Leu
325 330 335
Lys val Asn Ser Thr Lys Ser Met Ile Gly His Leu Leu Gly Ala Ala
3a0 345 350
Gly Gly Val Glu Ala Val Ser Val Val Gln Ala Ile Arg Thr Gly Trp
355 360 365
CA 02339517 2001-02-08
S
2~
I1e Hie Pzo Aan Ile Aan Leu Glu Asn Pro Asp alu Gly Val Aep Thr
370 375 3A0
Lya Leu Leu Val Gly Pro Lys Lys Glu Arg Leu Asn Val Lye Val Gly
385 390 395 400
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Asn Ser Sex Ile Leu Phe
405 410 415 '
Ala Pro Tyr Ile
420
c210> 31
<211> 421
<212> PRT
<213> Cuphea wrightii
<400> 31
Lys Lya Lys Pro Val Ile Lys Gln Arg Arg Val Val Val Thr Gly Met
1 5 10 15
Gly Val Val Thr Pro Leu Gly His Glu Pro Asp Val Phe Tyr Asn Aen
20 25 30
Leu Leu Asp Gly Val Ser Gly Ile Ser Glu Ile Glu Thr Phe Asp Cye ,
35 i0 45
Thr Gln Phe Pro Thr Arg Ile Ala Gly Glu Ile Lye Sex Phe Ser Thr
50 55 60
Asp Gly Trp Val Ala Pro Lys Leu Ser Lys Arg Met Asp Lys Phe Met
65 70 75 AO
Leu Tyr Leu Leu Thr Ala Gly Lya Lys Ala Leu Ala Asp Gly Gly Ile
85 90 95
Thr Asp Glu Val Met Lys Glu Leu Asp Lys Arg Lys Cya Gly Val Leu
l00 105 110
Ile Gly Ser Gly Met Gly aly Met Lye val Phe Aen Aap Ala Ile Glu
115 120 125
Ala Leu Arg Val Ser Tyr Lys Lya Met Aan Pro Phe Cys Val Pro Phe
130 135 140
Ala Thr Thr Asn Met Gly Ser Ala Met Leu Ala Met Asp Leu Gly Trp
195 150 155 160
Met Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cya Ala Thr Ser Asn Phe
165 170 175
Cys Ile Leu Asn Ala Ala Asn His ile Ile Arg Gly Glu Ala Aap Met
190 185 190
Met Leu Cya Gly Gly Ser Asp Ala Val Ile Ile Pro Ile Gly Leu Gly
195 200 205
Gly Phe val Ala Cys Arg Ala Leu Ser Gln Arg Aen Ser Asp Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp Ser Asn Arg Asp Gly Phe Val Met Gly
225 230 235 240
Glu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Glu His Ala Lys Lys
245 250 255
CA 02339517 2001-02-08
5~
2214 2
Arg Gly A1a Tnr Ile Tyr Ala Glu Phe Leu Oly Gly Ser Phe Thr Cys
260 265 270
Asp Ala Tyr His Met Thr Glu Pro His Pro Glu Gly Ala Gly Val Ile
275 280 285
Leu Cys Ile Glu Lys Ala Leu Ala Gln Ala Gly val Ser Lys Glu Asp
290 295 300
val Asn Tyr Ile Asn Ala His Ala Thr 5er Thr Ser Ala oly Asp Ile
305 310 315 320
Lys Glu Tyr Gln Ala Leu Ala Arg Cys Phe Gly Gln Asn Ser Glu Leu
325 330 335
Arg val Asn Ser Thr Lys Ser Met Ile Gly His Leu Leu Gly Ala Ala
390 34S 350
Gly Gly val Glu Ala Val Thr Val val Gln Ala Ile Arg Thr Gly Trp
355 360 365
Ile His Pro Aen Leu Asn Leu Glu Asp Pro Asp Lys Ala Val Aep Ala
370 375 380
Lys Leu Leu val Gly Pro Lys Lys Glu Arg Leu Asn Val Lye val Gly
385 390 395 400
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Aen Ser Ser Ile Leu Phe
405 410 415
Ala Pro Cys Asn Val
420
<210> 32
<211> 420
<212> PRT
<213> Cuphea wzightii
c400> 32
Lye Lys Lys Pro val Thr Lys Gln Arg Arg Val val Val Thr Gly Met
1 5 10 15
Gly Val Val Thr Pro Leu Gly His Asp Pro Aep Val Phe T'yr Aan Asn
20 25 30
Leu Leu Asp Gly Val Ser Gly Ile Ser Glu Ile Glu Thr Phe Asp Cys
3S 40 45
Thz Gla Phe Pro Thr Arg Ile Ala Gly Glu Ile Lys Ser Phe ser Thr
50 55 60
Asp Gly Trp Val Ala Pro Lys Leu 5er Lys Arg Met Asp Lye Phe Met
65 ~0 75 80
Leu Tyr Met Leu Thr Ala Gly Lys Lys Ala Leu Ala Asp Ala Gly ile
85 90 95
Thr Glu Asp Val Met Lys Glu Leu Aep Lys Arg Lys Cys Gly Val Leu
100 105 110 ,
Ile Gly Ser Gly Met Gly Gly Met Lye Leu Phe Asn Asp Ser Ile Glu
115 120 12S
Ala Leu Arg Ile Ser Tyr Lys Lys Met Asn Pro Phe Cys Val Pro Phe
130 135 140
CA 02339517 2001-02-08
i
E~
Ala Thr Thr Asn Met Gly 5er Ala Met Leu Ala Met Asp Leu dly Trp
145 150 155 160
Mct Gly Pro Asn Tyr Ser Ile Ser Thr Ala Cya Ala Thr Ser Asn Phe
165 170 175
Cys Ile Leu Asn Ala Ala Asn His Ile Ile Arg Gly Glu Ala Asp Met
180 185 190
Met Leu Cya Gly Gly Ser Asp Ala Ala Ile Ile Pro Ile Gly Leu Gly
195 200 205
Gly Phe val Ala Cys Arg Ala Leu Ser Gln Arg Asn Aan Aep Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp Ser Asn Arg Aep Giy Phe~ Val Met Gly
225 230 235 240
Olu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Olu His Ala Lys Lys
2a5 250 255
Arg Gly Ala Thr Ile Tyr Ala Glu Phe Leu Gly Gly Ser Phe Thr Cys
260 265 270
Asp Ala Tyr His Met Thr Glu Pxo Fiie Pro filu Gly Ala Gly Val ile
275 280 285 ,
Leu Cys ile Glu Arg Ala Leu Ala Gln Sex G1y Val Ser Lys Glu Asp
290 295 300
Val Asn Tyr Ile Asn Ala His Ala Thr Ser Thr Pro Ala Gly Asp Ile
305 310 315 320
Lya Glu Tyr Gln Ala Leu Ala Arg Ile Phe Ser Gln Asn Ser Glu Leu
325 330 335
Arg Val Aan Ser Thr Lys Ser Met Ile Gly His Leu Leu Oly Ala Ala
340 34S 350
Gly Gly Val Glu Ala Val Thr Val Val Gln Ala ile Arg Thr Gly Trp
355 360 365
Ile His Pro Asn Ile Asn Leu Glu Asn Pro Asp Aap Gly Val Asp Ala
370 375 380
Lys Leu Leu val Gly Pro Lys Lys Glu Lys Leu Lye val Lys Val Gly
385 390 39S 900
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Asn Sex Ser Ile Leu Phe
405 410 415
Ala Pro Cys Asn
420
<210> 33
<211> 920
<212> PRT
<213a Hordeum wlgare
<400> 33
Lys Lys Arg Pro Aap Val Lys Gln Arg Arg val Val Val Thr Gly Met
1 5 10 15
Gly val val Thr Pro Leu Gly Hie Aep Pro Asp Val Phe Tyr Thr Asn
20 25 30
CA 02339517 2001-02-08
Leu Leu Aop Gly His Ser Gly Its Ssr Glu Ile Glu Thr Qhe Asp Cys
35 40 45
5er Lys Phe Pro Thr Arg Ile Ala Gly Glu Ile Lys Ser Phe Ser Thr
50 55 60
Glu Gly Trp Val val Pro Lys Leu Ser Lys Arg Met Asp Lys Phe Met
65 70 75 80
Leu Tyr Leu Ile Thr Ala Gly Lys Lys Ala Leu Glu Asn Gly Gly Leu
85 90 95
Thr Glu Glu val Arg Asn Glu Leu Asp Lye Thr Arg Cys Gly Val Leu
100 105 110
Ile G1y Ser Ala Met Gly Gly Met Lys Val Phe Asn Asp Ala Ile Glu
11s 120 12s
A1a Leu Arg Val Ser Tyr Arg Lys Met Asn Pro Phe Cye Val Pro Phe
130 13S 140
Ala Thr Thr Asn Met Gly Sex Ala Ile Leu Ala Met Asp Leu Gly Trp
145 150 iS5 160
Met Gly Pro Aan Tyr Ser Ile Ser Thr Ala Cys Ala Thr Ser Asn Phe
165 170 175
Cys Ile Leu Aan Ala Ala Asn His Ile Arg Arg Gly Glu Ala Asp Val
180 185 190
Met Leu Cys Gly Gly Sex Aep Ala Pro Leu Ile Pro Ile Gly Leu Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Ser Oln Arg Asn Ser Asp Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp Met Asp Arg Asp Oly Phe Val Met Gly
225 230 235 240
Glu Gly Ala Gly val Leu Val Lsu Glu Glu Leu Glu His Ala Lys Gln
295 250 2S5
Arg Gly Ala Thr Ile Tyr Ala Glu Phe Leu Gly Gly Ser Phe Thr Cys
260 265 270
Asp Ala Tyr His Met Thr Glu Pro His Pro Glu aly Thr Gly Ile Thr ,
275 280 285
Leu Cys Ile Glu Lys Ala Leu Ala Asp Ser Gly Val Ala Arg Glu Glu
290 ~ 295 300
Ile Asn Tyr Val Asn Ala His Ala Thr Ser Thr Gln Ser Gly Asp Leu
305 310 315 320
Lys Glu Tyr Glu Ala Ile Val Arg Cys Phe Gly Gln Asn Pro Gln Leu
325 330 335
Arg Val Aen Ser Thr Lys Ser Met Thr Gly His Leu Ile Gly Ala Ala
340 395 350
Gly Gly Ile Glu Ala Val Ala Cys Val Gln Ala Ile Arg Thr Gly Trp
35S 360 365
Val His Pro Asn Leu Asn Leu Glu Aen Pro Glu Lys Val Val Asp Val
370 375 380
CA 02339517 2001-02-08
2~f4z
Gly Val Leu val oly Ser Glu Lys Olu Arg Cys Glu Val Lys Val Ala
385 390 39S 400
Leu Ser Aan Set Phe Gly Phe Gly Gly His Asn Ser Ser Ile Leu Phe
4os 4zo 415
Ala Pro Phe Lye
420
<210> 34
<211> 419
<212> PRT
<213> Hordeum vulgate
<400> 34
Asn Asn Lye Ser Glu Thr Lys Gln Arg Arg Val Val Val Thr Gly Met
1 5 10 15
Gly Val Val Thr Pzo Leu Gly Hie Glu Pro Asp Glu Phe Tyr Asn Asn
20 25 30
Leu Leu Gln Gly Vai Ser Gly Val Ser Glu Ile Glu Ala Phe Aep Cye
35 40 45
Sex Ser Tyr Pro Thr Arg Ile A1a Gly Glu 21e Lye Ser Phe Ser Thr .
50 55 60
Asp Gly Trp Val Ala Pro Lys Leu Ala Lye Arg Met Asp Lys Phe Met
6S ~0 '75 80
Gln Tyr Leu Ile Val Ala Gly Lys Lys Ala Leu Asp Asn Gly Gly Val
85 90 95
Thr Glu Asp Ile Met Aen Glu Leu Asp Lys Ser Arg Cys Gly val Leu
100 105 110
Ile Gly Ser Gly Mct Gly Gly Met Lye Val Phe Ser Asp Ala Ile Glu
115 120 125
Ala Leu Arg Val Ser Tyr Axg Lys Met Aan Pro Phe Cys Val Pro Phe
13 0 7.35 140
Ala Thr Thr Asn Met Gly Ser Ala Val Leu Ala Met Asp Leu Gly Trp
145 1S0 155 160
Met Gly Pro Asn Tyr Ser ile Ser Thr Ala Cys Ala Thr Ser Asn Fhe
165 170 175
Cys Ile Leu Sex Alu Ala Asn His Ile Met Arg Gly Glu Thr Asp Leu
180 19S 190
Met Leu Cys Gly Gly Ser Aep Als Pro Ile Ile Pro ile Gly Leu Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Ser oln Arg Asn Ser Asp Pro Thr
210 215 220
Lys Ala Ser Arg Pro Trp Asp val Asp Arg Asp Gly Phe Val Met Gly
225 230 235 240
Glu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Glu His Ala Lys Gln
245 250 255
Arg Gly Ala Glu Ile Tyr Ala Glu Phe Leu Gly Gly Asn Phe Thr Cys
260 265 270
CA 02339517 2001-02-08
Asp Ala Tyr His Met Thr Olu Pro His Pro Glu Gly Lye Gly val Ile
275 280 Z85
Leu Cys Val Glu Asn Ala Leu Ala Asp Ala Gly Val Thr Arg Gln Asp
290 295 300
Ile Asn Tyr Val Aan Ala His Ala Thr Ser Thr Gln Leu Gly Asp Leu
305 310 315 320
Lya Glu Phe Glu Ala Leu Arg Arg Cys Phe Gly Gln Asn Pro Gln Leu
325 330 335
Arg Val Aan Ser Thr Lye Ser Met Thr Gly His Leu Leu Gly Ala Ala
340 345 350
Gly Gly Ile Glu Ala val Ala Ala Ile Gln Ala ile Arg Thr Gly Trp
355 360 365
Ile His Pro A&a Ile Asn Leu Asn Aan Pro Glu Lya Aan Val Asp Val
370 375 380
Ser Leu Leu val Gly Ser Gln Lys Glu Arg Cys Asp Val Lys Val Ala
3A5 390 395 400
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Aen 5er Ser Ile Leu Phe
405 410 415 ,
Ala Pro Phe
<210> 35
c211> 420
<212> PRT
<213> Ricinus commuz~is
<400> 35
Asn Lye Lys Pro Leu Met Lya Gln Arg Arg Val Val val Thr Gly Met
1 5 10 15
Gly Val val Ser Pro Leu Gly His Aep Ile Aep Val Tyr Tyr Aan Asn
20 25 30
Leu Leu Asp Gly Ser Ser Gly Ile Ser Gln Ile Asp Ser Fhe Asp Cys
35 40 45
Ala Gln Phe Pro Thr Arg Ile Ala Gly Glu Ile Lye Ser Phe Ser Thr
50 55 60
Asp Gly Trp Va1 Ala Pro Lye Leu Sex Lys Arg Met Aap Lys Phe Met
65 70 75 80
Leu Tyr Met Leu Thr Ala Gly Lys Lys Ala Leu Ala Aep Gly Gly Ile
85 90 95
Thr Glu Asp Met Mec Asp Glu Leu Aap Lya Ala Arg Cya Gly Val Leu
100 105 110
Ile Gly Ser Ala Met Gly Gly Met Lys Val Phe Asn Aap Ala Ile Glu
115 120 lZ5
Ala Leu Arg Ile Ser Tyr Arg Lys Met Asn Pro Phe Cys Val Pro Phe
130 135 190
Ala Thr Thr Asn Met Giy Ser Ala Met Leu Ala Met Asp Leu Gly Trp
145 150 155 7.60
CA 02339517 2001-02-08
~._'_>
2~f42
Met Gly Pro Asn Tyr Ser Ilc Ser Thr Ala Cye Ala Thr Ser Aen Phe
165 170 175
Cye Ile Leu Asn Ala Ala Asn His Ile Ile Arg Gly Glu Ala Asp I:Le
1B0 185 190
Met Leu Cys oly Gly Ser Asp Ala Ala Ile Ile Pro Ile Gly Leu Gly
195 200 205
Gly Phe Val Ala Cys Arg Ala Leu Ser Gln Ar9 Aen Asp Asp Pro Thr
210 215 220
Lye Ala Ser Arg Pro Trp Asp Met Asn Arg Asp Gly Phe Val Met Gly
225 230 235 240
Glu Gly Ala Gly Val Leu Leu Leu Glu Glu Leu Glu His Ala Lys Lys
245 250 255
Arg Giy Ala Aen Ile Tyr Rla Glu Phe Leu Oily Gly Ser PhE Thr Cys
260 265 270
Asp Ala Tyr His Met Thr Glu Pro Arg Pro Asp Oly Val Gly Val Ile
275 280 285
Leu Cys Ile Glu Lys Ala Leu Ala Ar9 Ser Gly Val Ser Lye Glu Glu
290 295 300
Val Asa Tyr Ile Aen Ala His Ala Thr Ser Thr Pro Ala Gly Asp Leu
305 310 ~ 315 320
Lys Glu Tyr Glu Rla Leu Met Arg Cye Phe Ser Gln Asn Pro Asp Leu
325 330 335
Arg Val Asn Ser Thr Lys Ser Met Ile Gly His Leu Leu Gly Ala Ala
340 345 350
Gly Ala Val Glu Ala Ile Ala Thr Ile Gln Ala Ile Arg Thr Gly Trp
355 360 365
val His Pro Asn Ile Asn Leu Glu Asn Pro Glu Glu Gly Val Asp Thr
370 375 380
Lys Val Leu Val Gly Pro Lys Lys Glu Arg Leu Asp ile Lys Val Rla
3B5 390 395 400
Leu Ser Asn Ser Phe Gly Phe Gly Gly His Asn Ser Ser Ile Ile Phe
405 410 415
Ala Pro Tyr Lys
420
<210> 36
<211> 413
<212> PRT
<213> CaEnorhabditis elegana
<220>
<2z1> mist feature
<222> (53) .(531
<223> Xaa in position 53 in unknown.
<400> 36
Met Lys Leu Lys Ile Aen Lys Asn Phe Glu Met His Arg Val Val Ile
1 . S 10 15
--~ CA 02339517 2001-02-08
C c/
2a~s-a
Thr Gly Met Gly Ala ile Ser Pro Phe Gly val Thr vai Aen Ala Leu
20 25 30
Arg Asn Gly Leu Asn Glu Gly Arg Ser Gly Leu Lys Tyr Asp Glu Ile
35 40 45
Leu Lys Phe Val Xaa Gly Ala val Pro Gly Glu Arg Val Glu Asp Arg
SO 5S 60
Trp Ser Thx Gly Gln Gln Arg Glu Met Ser Lys Ala Ser Met Phe Val
65 70 75 80
Leu Ala Ala Ser Glu Glu Ala Leu Lys Gln Ala Lys Ala Glu Asp Val
85 90 95
Aep His Asn Glu Thr Leu Val Asn Ile c3ly Thr Cys Met Ser Asp Leu
100 IOS 1I0
Glu His Ile Gly Glu Thr Ala Gln Lys val Ser Glu Gly Gln Ser Azg
115 120 125
Arg val Ser Pro Tyr Phe Val Pro Arg Ile Leu Asn Aea Leu Pro Ala
130 135 Ia0
Oly Tyr Val Ala Met Lys Tyr Lys Met Arg Gly Gly val Glu Ser Thr
145 150 155 160
Ser Thr Ala Cys Ala Thr Gly Leu Hie Cys Ile Gly Aan Ser Phe Arg
165 1~0 175
Sex Ile Arg Tyz Gly Asp Ser Arg Arg Ala Leu Ala Gly Ala Val Glu
180 185 190
Cys Ala Leu Aan Pro Ile Ala Leu Ala Gly Phe Asp Arg Met Arg Ala
195 200 205
Leu Ala Arg Gly Asp Gln Pro Aan Ile Ser Arg Pro Phe Asp Lys Lys
210 21S 220
Arg Ala Gly Phe Val Men Ser Glu Gly val Gly Leu Val Phe Met Glu
225 230 235 240
Arg Leu Glu Asp Ala Gln Ala Arg Gly Ala Gln Ile Leu Ala Glu val
245 250 255
Val Gly Tyr Gly Ile Ser Ser Aep Cys Tyr His Ile Ser Thx Pro Aap .
260 265 270
Pro Ser Ala Ile Gly Ala Val Leu Ser Met Asn Arg Ala Ile Gly Asn
275 280 285
Ala His Leu Glu Pro Lys Asp Ile Gly Tyr Val Asn Ala His Ala Thr
290 295 300
Ser Thr Pro Asn Gly Asp Ser Val Glu Ala Glu Ala Val Arg Gln val
305 310 315 320
Phe Pro Glu Gln Asn Ile Ala Val Ser Ser Val Lys Gly His Ile Gly
325 330 335
His Leu Leu Gly Ala Ala Gly Ser Val Glu Ala Ile Ala Thr Ile Phe
340 345 350
Ala Met Aan Asp Aap val Leu Pro Ala Asn Arg Asn Leu Glu Glu Thr
355 360 365
CA 02339517 2001-02-08
.r
(~ S
2~9~-4'2
Asp Giu Oly Asn Gly Leu Asn Leu x,eu Arg Glu Aan Gin Lyo Trp Sex
370 375 380
Asp Val Ser Gly Aan Lys Ser Arg Ile Ser Ile Cys Aan Ser Phe Gly
3H5 390 395 Q00
Phe Gly Ala Thr Asn Ala 5er Leu Ile Leu Lye Gln Phe
405 410
<210> 37
<211> 442
<212> PRT
<213> Saccharomyces cerevieiae
<400> 37
Met Ser Arg Arg Val Val Ile Thr Gly Leu Gly Cys Val Thr Pro Leu
5 10 IS
Gly Arg Ser Leu Ser Glu Ser Trp Gly Asn Leu Leu Ser Ser Lys Asn
20 25 30
Giy Leu Thr Pro Ile Thr Ser Leu Pro Asn Tyr Aen Glu Asp Tyr hys
35 40 45
Leu Arg Glu Lys Ser Ile Pro Ser Thr Ile Thr Val Gly Lye Ile Pro ,
50 55 60
Glu Asn Phe Gln Asn Glu Asn Sex Ala Ile Asn Lys Leu Leu Phe Thr
65 70 75 80
Ser Gln Aap Glu Arg Arg Thr Ser Ser Phe Ile Lys Leu Ala Leu Arg
85 90 95
Thr Thr Tyr Glu Ala Leu Isis Asn Ala Gly Leu Leu Aen Pro Asn Asp
100 105 110
Ile Thr Ile Asn Thr Sex Leu Cys Asn Leu Asp His Phe Gly Cys heu
115 120 125
ile Gly Sex Gly Ile Gly Ser Ile Gln Asp Ile Tyr Gln Thr Ser Leu
130 135 140
Gla Phe Hia Aen Aep Asn Lys Arg Ile Asn Pro Tyr Phe VaI Pro Lys
145 150 155 160
ile Leu Thr Asn Met Ala Ala Gly Asn Val Ser Ile Lys Phe Asn Leu
165 170 175
Arg Gly Leu Sex Hie Ser val Ser Thr Ala Cys Ala Thr Gly Asn Asn
180 185 190
Ser Ile Gly Asp Ala Phe Asn Phe Ile Arg Leu Gly Met Gln Asp Ile
195 200 205
Cys val Ala Gly Ala Ser Glu Thr Ser Leu His Pro Leu Ser Leu Ala
210 215 220
Gly Phe Ile Arg Ala Lys Ser Ile Thr Thr Asn Gly Ile Sex Arg Pro
22S 230 235 240
Phe Asp Thr Gln Arg Ser Gly Phe Val Leu Gly Glu Gly Cys Gly Met
245 250 255
Ile Val Met Glu Ser Leu Glu Hia Ala Gln Lys Arg Asn Ala Asn Ile
260 265 270
CA 02339517 2001-02-08
3Uy42
Ile 5er Glu Leu Vai Gly Tyr Gly Leu Ser Ser Asp Ala Cys xis ITe
275 280 285
Thr Sex Pro Pro Ala Asp Gly Asn Gly Ala Lys Arg Ala Ile Glu Met
290 295 300
Ala Leu Lys Met A1a Arg Leu Glu Pro Thr Asp Val Asp Tyr Val Asn
305 310 315 320
Ala His Ala Thr Ser T.hr Leu Leu Gly Aep Lya Ala Glu Cye Leu Ala
32S 330 335
val Ala Ser Ala Leu Leu Pro Gly Arg Ser Lys Ser Lys Pro Leu Tyr
340 345 3S0
Ile Ser Sex Asn Lys Gly Ala Ile Gly His Leu Leu Gly Ala Ala Gly
3S5 360 36S
Ala Val Glu Ser Ile Phe Thr Ile Cye Ser Leu Lys Asp Asp Lys Met
370 375 380
Pxo His Thr Leu Asn Leu Asp Asn Val Leu Thr Leu Glu Aan Asn Glu
385 390 395 400
Ala Asp Lys Leu His Phe Ile Arg Asp Lye Pro Ile Val Gly AIa Asn
405 410 415
Pro Lys Tyr Ala Leu Cys Asn Sex Phe Gly Phe Gly Gly Val Asn Thr
420 425 430
Ser Leu Leu Phe Lys Lys Trp Glv Gly Ser
435 440
<210> 38
c211> 410
<212> PRT
<213> Escherichia coli
<400> 38
Met Ser Lys Arg Arg Val Va1 Val Thr Gly Leu Gly Met Leu Ser Pro
1 S 10 15
Val Gly Asn Thr Val Glu Ser Thr Trp Lys Ala Leu Leu Ala Gly Gln
20 25 30
Sex Gly Ile Ser Leu Ile Asp His Phe Asp Thr Ser Ala Tyr Ala Thr
35 90 45
Lys Phe Ala Gly Leu Val Ly5 Asp Phe Aen Cys Glu Asp Ile Ile Ser
SO 55 60
Arg Lys Glu Gln Arg Lys Met Asp Ala Phe Ile Gln Tyr Gly Ile Val
65 70 75 80
Ala Gly Val Gln Ala Met Gln Asp Ser Gly Leu Glu Ile Thr Glu Glu
85 90 95
Asn Ala Th.r Arg Ile Gly Ala Ala Ile Giy Ser Gly i1e Gly Gly Leu
loo los ilo
Gly Leu Ile Glu Glu Asn His Thr Ser Leu Met Asn Gly Gly Pro Arg
115 120 125
Lys Ile Ser Pro Phe Phe Val Pro Ser Thr Ile Val Aea Met Val Ala
130 135 140
CA 02339517 2001-02-08
3',x/4 2
G1y His Leu Thr ile Met Tyr Giy Leu Arg Giy Pro Ser zle Ser =1~e
145 150 155 160
A1a Thr Ala Cys Thr Ser Gly Val His Asn Ile G1y His Ala Ala Arg
165 170 17S
Ile Ile Ala Tyr Gly Asp Ala Asp val Met val Ala Gly Gly Ala Gl.u
180 185 190
Lys Ala Ser Thr Pro Leu Gly Val Gly Gly Phe Gly Ala Ala Arg Ala
195 200 205
Leu Ser Thr Arg Asn Aap Aen Pro Gln Ala Ala Ser Arg Pro Trp Asp
210 215 220
Lys Glu Arg Asp Gly Phe Val Leu Gly Asp Gly Ala Gly Met Leu val
225 230 235 240
Leu Glu Glu Tyr Glu His Ala Lys Lys Arg Gly Ala Lye Ile Tyr Ala
245 250 255
Glu Leu Val Gly Phe GIy Met Ser Ser Asp Ala Tyr His Met Thr Sex
260 265 270
Pro Pro Glu Asn Gly Ala Gly Ala Ala Leu Ala Met Ala Asn AIa Leu
275 280 285 ,
Arg Asp Ala Gly Ile Glu Ala Ser Gln Zle Gly Tyr Val Asn Ala His
290 295 300
Gly Thr Ser Thr Pro Ala Gly Asp Lys Ala Glu Ala Gln Ala Val Lye
305 310 31S 320
Thr Ile Phe GIy Glu Ala Ala Ser Arg Val Leu Val Ser Ser Thr Lys
325 330 335
Ser Met Thr Gly Hie Leu Leu Gly Ala Ala Gly Ala Val Glu Ser Ile
390 345 350
Tyr Sex Ile Leu Ala Leu Arg Asp GIn Ala Val Pro Pro Thr Ile Asn
355 360 365
Leu Asp psn Pro Asp Glu Gly Cys Asp Leu Aep Phe vat Pro His Glu
370 375 380
Ala Arg Gln Val Ser Gly Met Glu Tyr Thr Leu Cys Aen Ser phe Gly
385 390 395 400
Phe Gly Gly Thr Asn Gly Ser Leu Ile Phe
405 410
<210> 39
<211> 906
<212> PRT
<213> Escherichia cola
<400> 39
Met Lys Arg Ala Val Ile Thr GIy Leu Gly.Ile Val Ser Ser Ile Gly
1 5 10 15
Asn Asn Gln Gln Glu Val Leu Ala Ser Leu Arg Glu Gly Arg Ser Gly
20 25 30
Ile Thr Phe Ser Gln Glu Leu Lys Asp Sex Gly Met Arg Ser His Val
35 40 45
_. . __ ~.". "" ",
CA 02339517 2001-02-08
32~i 2
Trp Giy ASn Va1 Lye Leu Aep Thr Thr Gly Leu Ile Asp Arg Lye val
50 55 60
Val Arg Phe Met Ser Asp Ala Ser Ile Tyr Ala Phe Leu Ser Met Glu
65 70 75 80
Gln Ala Ile Ala Aep Ala Gly Leu Ser Pro Glu Ala Tyr Gln Asn Asn
85 90 95
Pro Arg Val Gly Leu Ile Ala Gly Ser Gly Gly Gly 5er Pro Arg Phe
100 105 110
Gln val Phe Gly Ala Asp Ala Met Arg Gly Pro Arg Gly Leu Lys Ala
115 120 125
Val Gly Pro Tyr Val Val Thr Lys Ala Met Ala Ser Gly Val Ser Ala
130 135 140
Cys Leu Ala Thr Pro Phe Lys Ile His Gly Val Aen Tyr Ser Ile 5er
lay 150 155 160
Ser A1a Cys Ala Thr Ser Ala His Cys Ile Gly Aan Ala Val Glu Gln
165 170 175
Ile Gln Leu Gly Lye Gla Asp Ile val Phe Ala Gly Gly Gly Glu Glu
180 185 190
Leu Cye Trp Glu Met Ala Cys Glu Phe Asp Ala Met Gly Ala Leu Ser
195 200 20S
Thr Lys Tyr Asn Asp Thr Pro Glu Lys Ala Ser Arg Thr Tyr Asp Ala
210 2l5 220
His Arg Aep Gly Phe Val Ile Ala Gly Gly Gly Gly Met Val Val Val
225 230 235 290
Glu Glu Leu Glu Hie Ala Leu Ala Arg Gly A1a His Ile Tyr Ala Glu
245 250 255
Ile Val Gly Tyr Gly Ala Thr Ser Asp Gly Ala Asp Met Val Ala Pro
260 265 270
5er Gly Glu Gly Ala Val Arg Cys Met Lye Met Ala Met His Gly Val
275 280 285
Aep Thr Pro Ile Asp Tyr Leu Asn Ser His Gly Thr Ser Thr Pro Val .
290 295 300
Gly Asp Val Lye Glu Leu Ala Ala Ile Axg Glu vat Phe Gly Asp Lys
305 310 315 320
Ser Pro Ala Ile Ser Ala Thr Lys Ala Met Thr Gly His Ser Leu Gly
325 330 335
Ala Ala Gly Val Gln Glu Ala Ile Tyr Ser Leu Leu Met Leu Glu Hie
340 345 350
Gly Phe Ile Ala Pro Ser ile Asn Ile Glu Glu Leu Asp Glu Gln Ala
355 360 365
Ala Gly Leu Asn Ile val Thr Glu Thr Thr Asp Arg Glu Leu Thr Thr
370 375 380
Val Met Ser Asn Ser Phe Gly Phe Gly Gly Thr Asn Ala Thr Leu Val
385 390 395 400
_ ....._.._... "._ . . .,~. ~~ i nn, nn_,n
CA 02339517 2001-02-08
r.r
33'T'4 2
Met Arg Lys Leu Lye Asp
405
<210> 40
c211> 416
<212> PRT
<213> Mycobacterium tuberculosis
c400> 40
Met Ser Gln Pro Ser Thr Ala Asn Gly Gly Phe Pro Ser Val Val Val
1 5 10 15
Thr Ala Val Thr Ala Thr Thr Ser Ile Ser Pro Asp Ile Glu Ser Thr
20 25 30
Trp Lys Gly Leu Leu Ala Gly Glu Ser Gly Ile His Ala Leu Glu Asp
35 40 AS
Glu Phe val Thr Lys Trp Asp Leu Ala Val Lys Ile Gly Gly His Leu
50 55 60
Lys Asp Pro Val Asp Ser His Met Gly Arg Leu Aep Met Arg Arg Met
65 70 75 80
Sex Tyr Val Gln Arg Met Gly Lys Leu Leu Gly Gly Gln Leu Trp Glu ,
85 90 95
Ser Ala Gly Sex Pro Glu Val Aep Pro Asp Arg Phe A1a Val Val Val
100 105 110
Gly Thr Gly Leu Gly Gly Ala Glu Arg Tle Val Glu Sex Tyr Asp Leu
115 120 125
Met Aen Ala Gly Gly Pro Arg Lye val Ser Pro Leu Ala Val Gln Met
130 135 140
Tle Met Pro Asn Gly Ala Ala Ala Val Tle Gly Leu Gln Leu Gly Ala
145 150 155 160
Arg Ala Gly Val Met Thr Pro Val Ser Ala Cys Ser Ser Gly Ser Glu
165 170 175
Ala Ile Ala Hie Ala Trp Arg Gln Ile val Met aly Aap Ala Aap val
1B0 185 190
Ala val Cys Gly Gly Val Glu Gly Pro Ile Glu Ala Leu Pro Ile Ala
195 200 205
Ala Phe Sex Met Met Arg Ala Met Sex Thr Arg Asn Asp Glu Fro Glu
210 215 220
Arg Ala Ser Arg Pro Phe Asp Lys Asp Arg Asp Gly Phe Val Phe Gly
225 230 235 240
Glu Ala Gly Ala Leu Met Leu Ile Glu Thr Glu Glu His Ala Lys Ala
245 250 255
Arg Gly Ala Lys Pro Leu Ala Arg Leu Leu Gly Ala Gly Ile Thr Ser
260 265 Z~0
Asp Ala Phe His Met Val Ala Pro Ala Ala Aap Gly Va1 Arg Ala Gly
275 280 285
Arg Ala Met Thr Arg Ser Leu Glu Leu Ala Gly Leu Ser Pro Ala Asp
290 295 300
CA 02339517 2001-02-08
7d
3.4-f 4 2
zle Aep Hia Val Acn Als Hie Gly Thr Ala Thx Dro Ile Gly Aep Ala
305 310 31S 320
Ala Glu Ala Asn Ala Ile Arg Val~Ala Gly Cys Asp Gln Ala Ala Val
325 330 335
Tyr Ala Pro Lys Ser Ala Leu Gly His Scr Ile Gly Ala Val Gly Ala
340 345 350
Leu Glu Ser Val Leu Thr Val Leu Thr Leu Arg Asp Gly Val ile Pro
355 360 365
Pro Thr Leu Asn Tyr Glu Thr Pro Asp Pro Glu Ile Aep Leu Asp Val
370 375 380
Val Ala Gly Glu Pro Arg Tyr Gly Asp Tyr Arg Tyr Ala Val Asn Asn
385 390 395 400
Ser Phe Gly Phe aly Gly His Asn Val Ala Leu Ala Phe Gly Arg Tyr
405 410 415
e210> 41
<211> 438
<212> PRT
c213> Mycobacterium tuberculosis
<400> 41
Met Gly Val Pro Pro Leu Ala Gly Ala Ser Arg Thr Asp Met Glu Gly
1 S 10 15
Thr Phe Ala Arg Pro Met Thr Glu Leu Val Thr Oly Lys Ala Phe Pro
20 25 30
Tyr Val val val Thr Gly Ile Ala Met Thr Thr Ala Leu Ala Thr Asp
35 40 95
Ala Glu Thr Thr Trp Lys Leu Leu Leu Asp Arg Gln Ser Gly Ile Arg
50 55 60
Thr Leu Asp Asp Pro Phe Val Glu Glu Phe Aap Leu Pro Val Arg Ile
65 70 7S 80
Gly Gly His Leu Leu Glu Glu Phe Asp His Gln Leu Thr Arg Ile Glu
85 90 95
Leu Arg Arg Met Gly Tyr Leu Gln Arg Met Ser Thr Val Leu Ser Arg
100 105 110
Arg Leu Trp Cilu Asn Ala Gly Ser Pro Glu Val Asp Thr Asn Arg Leu
115 120 125
Met Val Ser Ile Gly Thr Gly Leu Gly Ser Ala Glu Glu Leu Val Phe
130 135 140
Sex Tyr Asp Asp Met Arg Ala Arg Gly Met Lys Ala Val Ser Pro Leu
145 150 155 160
Thr val Gln Lys Tyr Met Pro Aan Gly A1a Ala Ala Ala Val Gly Leu
165 1~0 175
Glu Axg His Ala Lys Ala Gly Val Met Thr Pro Val Sex Ala Cys Ala
180 185 190
Ser Gly Ala Glu Ala Ile Ala Arg Ala Trp Gln Gln Ile vai Leu Gly
195 200 205
CA 02339517 2001-02-08
~~
35-x'42
alu Ala Asp Ala Ala Ile Cye Gly Gly Val flu Thr Arg =le Glu Ala
210 215 220
val Pro Ile Ala Gly Phe Ala Gln Met Arg Tle Val Met Ser Thr Aen
22S 230 235 240
Asn Asp Aep Pro Ala oly Ala Cys Arg Pro Phe Asp Arg Aap Arg Asp
245 250 255
Gly Phe Val Phe Gly Glu Gly Gly Ala Leu Leu Leu Ile Glu Thr Glu
260 265 270
Glu liie Ala Lys Ala Arg Gly Ala Asn Ile Leu Ala Arg Ile Met Gly
275 280 285
Ala Ser Ile Thr Ser Asp Gly Phe Hia Met Val Ala Pro Aap Pro Asn
290 295 300
Gly Glu Arg Ala Gly His Ala Tle Thr Arg Ala Ile Gln Leu Ala Gly
305 310 315 320
Leu Ala Pro Gly Asp Ile Asp Aie Val Asn Ala His Ala Thr Gly Thr
325 330 335
Gln Val Gly Asp Leu Ala Glu Gly Arg Ala Ile Aen Aan Ala Leu Gly
340 315 350
Gly Aan Arg Pro Ala Val Tyr Ala Pro Lya Ser Ala Leu Gly His Ser
355 360 365
Val Gly Ala Val Gly Ala Val Glu Ser Ile Leu Thr Val Leu Ala Leu
370 375 380
Arg Aep Gln Val Ile Pro Pro Thr Leu Aen Leu Val Asn Leu Asp Pro
385 390 395 400
Glu Ile Asp Leu Asp Val Val Ala Gly Glu Pro Arg Pro Gly Asn Tyr
405 410 415
Azg Tyr Ala Ile Asn Asn Ser Phe Gly Phe Gly Gly His Asn Val Ala
420 425 930
Ile Ala Phe Gly Arg Tyr
435
<210> 42
<211> 418
<212> PRT
<213> Rattua norvegicus
c400> 42
Ser Arg Ala Ser Azg Gln Arg Arg Ala Met Glu Glu val Val =le Ala
1 5 10 15
Gly Met Ser Gly Lys Leu Pro Glu Ser Glu Asn Leu Gln Glu Phe Trp
20 25 30
Ala Asn Leu Ile Gly Gly Val Asp Met Val Thr Aap Asp Asp Arg Arg
35 40 45
Trp Lys Ala Gly Leu Tyr Gly Leu Pro Lys Arg Ser Gly Lye Leu Lys
50 55 60
Asp Leu Ser Lys Phe Asp Ala Ser Phe Phe Gly Val His Pro Lys Gln
65 70 75 80
CA 02339517 2001-02-08
Z
36.~~
Ala His Thr Met Asp Pro Gln Leu Arg Leu Leu Leu Glu val Ser xyr
85 90 95
Glu Ala ile Val Asp Gly Gly Ile Asn Pro Ala Ser Leu Arg Gly Thr
100 105 110
Asn Thr Gly Val Trp Val Gly val SEr Gly Ser Glu Ala Ser Glu Ala
115 120 125
Leu Ser Azg Aep Pro Glu Thr Leu Leu Gly Tyr Ser Met val Gly Cys
130 135 140
Gln Arg Ala Met Met Ala Asn Arg Leu Ser Phe Phe Phe Asp Phe Lys
145 150 155 160
Gly Pro Ser Ile Ala Leu Asp Thr Ala Cye Ser Ser Ser Leu Leu Ala
165 170 175
Leu Gln Asn Ala Tyr Gln Ala Ile Arg Ser Gly Glu Cys Pro Ala Ala
180 185 190
Ile val Gly 01y Ile Aen Leu Leu Leu Lys Pro Asn Thr Ser Val Gln
195 200 205
Phe Met Lys Leu Gly Met Leu Ser Pro Asp Gly Thr Cy9 Arg Ser Phe
210 215 220 ,
Asp Asp Ser Gly Asn Gly Tyr Cys Arg Ala Glu Ala Val Val AIa Val
225 230 235 240
Leu Leu Thr Lye Lys Ser Leu Ala Arg Arg Val Tyr Ala Thr Ile Leu
245 250 255
Asn Ala Gly Thr Asn Thr Aep Gly Cys Lys 01u Gln Gly Val Thr Phe
260 265 270
Pro Ser Gly Glu Ala Gln Glu Gln Leu ile Arg Ser Leu Tyr Gln Pro
275 280 2B5
Gly Gly Val Ala Pro Glu Ser Leu Glu Tyr Ile Glu Ala His Gly Thr
290 295 300
Gly Thr Lys Val Gly Aap Pro Gln Glu~Leu Asn Gly Ile Thr Arg Ser
30S 310 315 320
Leu Cys A1a Phe Arg Gln Ser Pro Leu Leu Ile Gly Ser Thr Lys Ser
325 330 335
Asa Met Gly His Pro Glu Pro Ala Sex Giy Leu Ala Ala Leu Thr Lys
340 345 350
val Leu Leu Ser Leu Glu Asn Gly val Trp Ala Pro Asn Leu His Phe
355 360 36S
His Asn Pro Asn Pro Glu Ile Pro Ala Leu Leu Asp Gly Arg Leu Gln
370 375 380
Val Val Asp Arg Pro Leu Pro Val Arg Gly Gly Ile val Gly Ile Asn
385 390 395 400
Ser Phe Gly Phe Gly Gly Ala Asn val His val Zle Leu Gln Pro Asn
405 410 415
Ala Ser
,~, CA 02339517 2001-02-08
3~~-~2
<210> 43
<211> 401
<212> PRT
<213> Rhizobium sp. Modulation Protein E
c400> 43
Met Asp Arg Arg Val Val Ile Thr Gly Ile Gly Gly Leu Cys Gly Leu
1 5 10 15
Gly Thr Asn Ala Ala Ser Ile Trp Lys Glu Met Arg Glu aly Pro Sex
20 25 30
Ala Ile Ser Pro Ile Ile Thr Thr Asp Leu Tyr Asp Leu Glu Gly Thr
35 40 45
Val Gly Leu Glu ile Lys Ala Ile Pro Glu His Aep Ile Pro Arg Lys
50 55 60
Gln Leu Val Ser Met Asp Arg Phe Ser Leu Leu Ala Val Ile Ala Ala
65 70 75 80
Thr Glu Ala Met Lys GIn Ala Gly Leu Ser Cys Asp Glu Gln Asn Ala
85 90 95
His Arg Phe Gly Ala Ala Met Gly Leu Gly Gly Pro Gly Trp Aep Thr
I00 lOS 110
Ile Glu Glu Thr Tyr Arg Ser Ile Leu Leu Asp Gly Val Thr Arg Ala
115 120 125
Arg Ile Phe Thr Ala Pro Lys Gly Met Pro Ser Ala Ala Ala Gly His
130 135 140
Val Ser Ile Phe Leu Gly Leu Arg Gly Pro val Phe Gly Val Thr Ser
145 150 155 160
Ala Cys Ala Ala Gly Asn His Ala ile Ala Ser Ala Val Asp Gln Ile
165 170 175
Arg Leu Gly Arg AIa Asp Val Met Leu Ala Gly Gly Ser Asp Ala Pro
180 185 190
Leu Thr Trp Gly Vai Leu Lys Ser Trp Glu Ala Leu Arg Val Leu Ala
I95 200 205
Pro Asp Thr Cys Arg Pro Phe Ser Ala Asp Arg Lys Gly Val val Leu
210 215 220
Gly Glu Gly Ala Gly Met AIs Val Leu Glu Ser Tyr GIu His Ala Ala
225 230 235 240
AIa Arg Gly Ala Thr Met Leu Ala Glu Val Ala Gly Ile Gly Leu Ser
245 250 255
GIy Asp Ala Tyr Asp Ile Val Met Pro Ser Ile Glu Gly Pro Glu Ala
260 265 270
Ala Met Arg Ser Cys Leu Ala Aap Ala Glu Leu Asn Pro Asp Asp Val
275 280 285
Asp Tyz Leu Asn Ala His Gly Thr Gly Thr Val Ala Asn Aep Glu Met
290 295 300
Giu Thr Ala Ala Ile Lys Arg Val Phe Gly Asp His Ala Phe Gln Met
305 310 31S 320
"r CA 02339517 2001-02-08
--~ G:.
Ser Val Ser Ser Thr Lys Ser Met Ai$ Ala His Cya Leu Gly Ala Ala
325 330 335
Ser Ala Leu Glu Met Ile Ala Cys val Met Ala Ile Gln Glu Gly Val
390 345 350
Ile Pro Pro Thr Ala Asn Tyr Arg Glu Pro Asp Pro Gln Cys Asp Leu
355 360 365
Asp VaI Thr Pro Asn Val Pro Arg Glu Gln Arg Cys Gly Ser Met Ser
370 375 380
Asn Ala Phe Ala Met Gly Gly Thr Asn Ala Val Leu Ala Phe Arg Gln
385 390 395 400
val
<210> 44
<211> 419
c212> PRT
<213> Streptomyces polyketide synthase
<400> 44 _
val Aen Arg Arg Ile Val Ile Thr Gly Ile Gly Val Val Ala Fro Gly
1 5 10 15
Ala Val Gly Thr Lys Pro Phe Trp Glu Leu Leu Leu Ser Gly Thr Thr
20 25 30
Ala Thr Arg Ala Ile Ser Thr Phe Asp Ala Thr Pro Phe Arg Ser A~
35 a0 45
Ile Ala Ala Glu Cys Asp Phe Asp Pro Vai Ala Ala Gly Leu Sex Ala
SO 55 60
Glu Gln Ala Arg Arg Leu Asp Arg Ala Gly Gln Phe Ala Leu val Ala
65 70 75 80
Gly Gla Glu Ala Leu Ala Asp Ser Gly Leu Arg Ile Asp Glu Asp 5er
85 90 95
Ala His Arg Val Gly val Cys Val Gly Thr Ala Val Gly Cys Thr Gln
100 105 110
Lys Leu Glu Ser Glu Tyr Val Ala Leu Ser Ala Gly Gly Ala His Trp
115 120 125
val val Asp Pro Gly Arg Gly Sex Pro Glu Leu Tyr Aep Tyr Phe val
130 135 140
Pro Ser Ser Leu Ala Ala Glu Val Ala Trp Leu Ala Gly Ala Glu Gly
145 150 155 160
Pro Val Asn Ile Val Ser Ala Gly Cys Thr Sex Oly Ile Asp Ser Ile
165 170 175
G1y Tyr Ala Cye Glu Leu Ile Arg Glu Gly Thr Val Aap Ala Met Val
180 185 190
Ala Gly Gly Val Asp Ala Pro Ile Ala Pro Ile Thr Val Ala Cys Phe
7.95 200 205
Asp Ala Ile Arg Ala Thr Ser Asp His Asn Asp Thr Pro Glu Thr Ala
210 215 220
i
CA 02339517 2001-02-08
~r ...-
i
3-~r42
9cr Arg Pro ehe ser Arg Ser Arg Asn Gly Phe val Leu Gly Glu Gly
225 230 235 240
Gly Ala Ile Val Val Leu Glu Glu Ala Glu Ala Ala Val Arg Arg Gly
245 250 255
Ala Arg Ile Tyr Ala Glu Ile Gly Gly Tyr Ala Ser Arg Gly Asn Ala
260 265 270
Tyr His Met Thr Gly Leu Arg Ala Aep Gly Ala Glu Met Ala Ala Ala
275 280 285
Ile Thr Ala Ala Leu Aep Glu Ala Arg Arg Asp Pro Ser Asp val Asp
290 295 300
Tyr Val Asn Ala His Gly Thr Ala Thr Lys Gln Aen Asp Arg His Glu
305 310 315 320
Thr Ser Ala Phe Lys Arg Ser Leu Gly Glu Hie Ala Tyr Axg Val Pro
325 330 335
I1e Ser Ser ile Lye Sex Met Ile Gly His Ser Leu Gly Ala Val Gly
340 345 350
Ser Leu Glu val Ala Ala Thr Ala Leu Ala Val Glu Tyr Gly Val Ile
355 360 , 365
Pro Pro Thr Ala Asn Leu His Asp Pro Asp Pro Glu Leu Asp Leu Asp
370 375 380
Tyr val Pro Leu Thr Ala Arg Glu Lys Arg val Arg His Ala Leu Thr
385 390 395 900
Val Oly Ser Gly Phe Gly Gly Phe Gln Ser Ala Met Leu Leu Ser Arg
905 410 415
Leu Cilu Arg
<210> 45
<Z11> 416
<212> PRT
<213> Synechocystis sp.
<400> 45
Met Ala Aan Leu Glu Lys Lys Arg Val Val Val Thr Gly Leu Gly Ala
1 5 10 15
Ile Thr Pro Ile Gly Asn Thr Leu Gln Asp Tyr Trp Gln Gly Leu Met
20 25 30
Glu Gly Arg Asn Gly Ile Gly fro Ile Thr Arg Phe Asp Ala Ser Asp
35 40 45
Gln Ala Cys Arg Phe Gly Gly Glu val Lys Asp Phe Asp Ala Thr Gln
50 SS 60
Phe Leu Asp Arg Lys Glu Ala Lys Arg Met Asp Arg Phe Cy~s His Phe
65 70 75 80
Ala val Cys Ala Ser Gln Gln Ala Ile Asn Asp Ala Lys Leu Val Ile
85 90 95
Asn Glu Leu Asn Ala Asp Glu ile Gly Val Leu Ile Gly Thr Gly Ile
100 105 110
CA 02339517 2001-02-08
9972
Gly Giy Leu Lye Val Lcu Glu Aop Gln aln Thr Ile Leu Leu Aap Lya
115 120 125
Gly Pro Ser Arg Cys Ser Pro Phe Met Ile Pro Met Met Ile Ala Asn
130 135 140
Met Ala Ser Gly Leu Thr Ala Ile Asn Leu Gly Ala Lys Gly Pro Asn
145 150 155 160
Asn Cys Thr val Thr Ala Cys Ala Ala Gly Ser Aan Ala Ile Gly Aep
165 170 175
Ala Phe Arg Leu Val Gln Asn Gly Tyr Ala Lys Ala Met Ile Cys Gly
180 185 190
Gly Thr Glu Ala Ala Ile Thr Pro Leu Ser Tyr Ala Gly Phe Ala Ser
195 200 205
Ala Arg Ala Leu Ser Phe Arg Asn Asp Asp Pro Leu His Ala Ser Arg
210 215 220
Pro Phe Asp Lys Asp Arg Asp Gly Phe Val Met Gly Glu Gly Ser Gly
225 230 235 240
Ile Leu Ile Leu Glu Olu Leu Glu Ser Ala Leu Ala Arg Gly Ala Lys
295 250 255
Ile Tyr Gly Glu Met Val Gly Tyr ASa M2C Thr Cys Asp Ala Tyr His
260 265 270
Ile Thr Ala Pro Val Pro Asp Gly Arg Gly Ala Thr Arg Ala Ile Ala
275 280 285
Trp Ala Leu Lys Asp Ser Gly Leu Lye Pro Glu Met Val Ser Tyr Ile
290 295 300
Asn Ala Hie Gly Thr Ser Thr Pro Ala Aan Asp Val Thr Glu Thr Arg
305 310 ~ 315 320
Ala Ile Lys G1n Ala Leu Gly Asn His Ala Tyr Asn Ile Ala val Ser
325 330 335
Ser Thr Lys 5er Met Thr Gly His Leu Leu Gly Gly Set Gly Gly Ile
340 395 350
Glu Ala Val Ala Thr val Mec Ala Ile Ala Glu Asp Lys Val Pro Pro
355 360 365
Thr Ile Asn Leu Glu Asn Pro Asp Pro Glu Cys Asp Leu Asp Tyr Val
370 375 380
Pro Gly Gln Sex Arg Ala Leu Ile Val Asp Val Ala Leu Ser Asn Ser
385 390 395 400
Phe Gly Phe Gly Gly His Asn Val Thr Leu Ala Phe Lys Lys Tyr Gln
405 410 915
<210> 46
<211> 941
<212> PRT
<213> Vibrio harveyi
<400> 96
Ser Asp Tyr His Asn His Phe Ile Asn Vai Lys Ala Val Ala Arg Pro
1 5 to is
CA 02339517 2001-02-08
7 7
4?~2
Leu Phe Phe Cys Leu Phe Trp Arg Thr Ser val Ala Asn Aan Arg Arg
20 25 30
Val Val Ile Thr Gly Leu Gly Ile Val Ser Pro Val Gly Asn Thr Val
35 40 45
Ala Thr Ala Trp Glu Ala Ile Lys Ser Gly Ile Ser Gly Ile Glu Asn
50 55 60
ile Glu His Phe Asp Thr Thr Asn Phe Ser Thr Lys Phe Ala Gly Leu
65 70 75 80
val Asn Asp Ph2 Asp Ala Glu Ser Val Gly Ile Asn Arg Lys Asp Cys
85 90 95
Arg Lys Met Asp Leu Phe Ile Gln Tyr Gly Ile Ala Ala Ala Glu Gln
100 105 110
Ala Leu Thr Asp Ser Gly Leu Glu ile Thr Glu Gln Asn Ala Thr Arg
115 120 125
Ile Gly Thr Ala ile Gly Ser Gly Ile Gly Gly Leu Gly Leu Ile Glu
130 135 140
Gln Asn Val His Ser Phe Val Lys Gly Gly Ala Arg Lys Val Ser Pro
145 150 155 160
Phe Phe val Pro Ala Thr Ile vsl ASn Met Val Ala Gly His Val Ser
165 170 175
Ile Arg Asn Asn Leu Lys Gly Pro Asn Ile Ala Ile Ala Thr Ala Cya
180 185 190
Thr Ser Gly Thr His Cys ile Gly Gln Ser Ala Arg Met Ile Ala Tyr
195 200 205
Gly Asp Ala Asp Val Met Val Ala Gly Gly Ala Glu Lys Ala Ser Thr
210 215 220
Glu Met Gly Leu Ala Gly Phe Gly Ser Ala Lys AIa Leu Ser Thr Arg
225 230 235 240
Asn Asp Asp pro Gln Lya Ala Ser Arg Pro Trp Asp Lys Aep Arg Aap
245 250 2S5
Gly Phe Val Leu Gly Asp Gly Ala Gly val Leu val Met Glu Glu Tyr
260 265 270
Glu His Ala Val Ala Arg Gly Ala Thr Ile Tyr Ala Glu Leu Ala Gly
275 280 2H5
Phe Gly Met 5er Gly Asp Ala Phe His Met Thr Ser Pro Pro Glu Asp
290 295 300
Gly Ala Gly Ala Ala Leu Sez Met Asn Asn Ala Ile Ala Asp Ala Gly
305 310 315 320
ile Thr Ala Asp Lys Val Gly Tyr Va1 Asn Ala His Gly Thr Ser Thr
325 330 335
Pro Ala Gly Asp Lys Ala GIu Thr Ala Ala Val Lye Ser Val Phe Gly
340 345 350
Glu Hie Ala Tyr Thr Leu Ala Val Ser Ser Thr Lys Ser Met Thr Gly
355 360 365
CA 02339517 2001-02-08
92j~42
His Leu Leu Gly Ala Ala Gly Ala Ile G1u Ala Ile Qhe Thr Ile Lou
370 3'7S 3B0
Ala Leu Lys Asp G1n Ile Leu Pro Pro Thr I1e Aan Leu alu Aan Pro
39S 390 395 400
Ser Glu Gly Cys Asp Leu Aap Tyr val Thr Asp Gly Ala Arg Pro Val
405 410 415
Asn Met Glu Tyr Ala Leu Ser Asn Ser Phe Gly Phe Gly Gly Thr Asn
420 425 430
Gly Ser Leu Leu Phe Lys Lys Ala Aep
435 440
