Note: Descriptions are shown in the official language in which they were submitted.
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
TITLE
SCORPION TOXINS
FIELD OF THE INVENTION
This invention is in the field of molecular biology. More specifically, this
invention
pertains to nucleic acid fragments encoding scorpion toxins that are sodium
channel
agonists.
BACKGROUND OF THE INVENTION
Alpha neurotoxins are short, single-chain, polypeptides crosslinked by four
disulfide
bridges, and responsible for insect and mammal poisonings. These neurotoxins
show
variability in their apparent toxicity, in their primary structures, and in
their binding features
to neuronal membrane preparations (Dufton and Rochat (1984) J. Mol. Evol.
20:120-127).
Despite differences in their primary structures and phylogenetic selectivity,
scorpion
neurotoxins affecting sodium (Na) channels are closely related in their
spatial arrangement.
And in their compact globular structure kept rigid by the four disulfide
bridges (Miranda
et al. (1970) Eur. J. Biochem, 16:514-523; and Fontecilla-Camps (1989) J. Mol.
Evol.
29:63-67).
Zilbergberg and coworkers determined that single amino acid residues are
important
for receptor binding and for biological activity of scorpion Na channel toxins
(Zilbergberg
et al. (1997) J. Biol. Chem. 272:14810-14816). As examples, the lysine at
position 8 of
LqhIT was demonstrated to be necessary for binding activity and toxicity
without change in
overall structure. A substantial decrease in biological activity without a
significant change in
structure was found when the aromatic amino acid phenylalanine, at position
17, was
substituted for glycine. Conversely, changes in structure are not necessarily
associated with
differences in toxicity as demonstrated when tyrosine at position 49 was
changed to leucine.
While potassium (K) channels have been shown to be central to heart function,
the role
of chlorine- (Cl) and Na-channels in this activity is less clear (Johnson et
al.. (1998)
J. Neurogent. 12:1-24). Sodium entry hyperpolarizes the cell, producing
indirect, Na-
dependent changes of calcium transport (Friedman (1998) Annu. Rev. Physiol.
60:179-197).
Abnormal influx of calcium is thought to be very important in the pathogenesis
of several
central nervous system disorders in vertebrates, including stroke damage,
epilepsy, and the
neuronal death associated with chronic epilepsy.
Excitatory amino acids, most notably glutamate and aspartate, are the
predominant
excitatory neurotransmitter in the vertebrate (including human) central
nervous system.
These amino acids are released from presynaptic nerve terminals and, after
diffusing across
the synaptic cleft, contact special receptor molecules in the postsynaptic
cell membrane.
These receptors indirectly influence the flow of various ions across the cell
membrane and
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
thus contribute to production of an electrical response to the chemical
message delivered by
neurotransmitter molecules. A number of common and very serious neurological
problems
involve abnormal function of excitatory amino acid synapses. These include
epilepsy,
several degenerative disorders such as Huntington's disease, and neuronal
death following
stroke. Unfortunately, there are very few chemical agents which are potent and
selective
blockers of excitatory amino acid receptors. Na-channel agonists may be used
for these
purposes.
A drug with high affinity for the receptor could be expected to produce
irreversible
blockade of synaptic transmission. When labeled with some tracer molecule,
such a drug
would provide a reliable way of tagging receptors to permit measurement of
their number
and distribution within cells and tissues. These features would have very
valuable
consequences for research on excitatory amino acid neurotransmission and for
the
development of therapeutic agents to treat central nervous system dysfunction
in humans and
animals. Methods for treating heart and neurological diseases by applying
toxins derived
from spiders have been described (U.S. Patent No. 4,925,664).
Arthropod animals, including insects, and certain parasitic worms use
excitatory amino
acids as a major chemical neurotransmitter at their neuromuscular junction and
in their
central nervous system. Because of the damage done by insect pests and the
prevalence of
parasitic worm infections in animals and humans in many countries, there is a
constant need
for potent and specific new pesticides and anthelmintic drugs that are non-
toxic to humans,
pets, and farm animals.
Chemical insecticides are an integral component of modern agriculture, and are
an
effective means for reducing crop damage by controlling insect pests. However,
chemical
agents are under continuous scrutiny due to the potential for environmental
contamination,
selection of resistant populations of agronomic pests, and toxicity to non-
target organisms
such as beneficial insects, aquatic organisms, animals and man. As a result,
alternative
strategies for insect control are being sought that are effective and yet
benign to non-target
populations and the environment. One of these strategies is to use
microorganisms that are
naturally occurnng pathogens of target insect populations. The expression of
scorpion toxins
using baculovirus vectors will be an advantage since these toxins have been
previously
shown to be highly toxic and very specific (Zlotkin et al. (1995) American
Chemical
Society, Symposium on Agrochemicals).
Due to a combination of problems associated with some synthetic insecticides,
including toxicity, environmental hazards, and loss of efficacy due to
resistance, there exists
a continuing need for the development of novel means of invertebrate control,
including the
development of genetically engineered recombinant baculoviruses which express
protein
toxins capable of incapacitating the host more rapidly than the baculovirus
infection per se.
2
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
Scorpion venoms have been identified as possible sources of compounds
providing
insecticidal properties. Two insect-selective toxins isolated from the venom
of the scorpion
Leiurus quinquestriatus and affecting sodium conductance have been reported
previously
(Zlotkin et al. (1985) Arch. Biochem. Biophys. 240:877-87). One toxin, AaIT,
induced fast
excitatory contractive paralysis of fly larvae and the other, LqhIT2, induced
slow depressant
flaccid paralysis suggesting that these two toxins have different chemical and
pharmacological properties (Zlotkin et al. (1971) Biochimie (Paris) 53:1073-
1078). Thus,
other toxins derived from scorpion venom will also have different chemical and
pharmacological properties.
SUMMARY OF THE INVENTION
The present invention relates to isolated polynucleotides comprising a
nucleotide
sequence encoding a first polypeptide of at least 60 amino acids that has at
least 95% identity
based on the Clustal method of alignment when compared to a polypeptide
selected from the
group consisting of a scorpion alpha toxin XIV polypeptide selected from the
group
consisting of SEQ ID NOs:2, 4, and 6, a scorpion neurotoxin I polypeptide of
SEQ ID N0:9,
a scorpion depressant toxin LqhIT2 polypeptide selected from the group
consisting of SEQ
ID NOs:12, 14, and 16. The present invention also relates to an isolated
polynucleotide
comprising the complement of the nucleotide sequences described above.
It is preferred that the isolated polynucleotides of the claimed invention
consist of a
nucleic acid sequence selected from the group consisting of SEQ ID NOs:I, 3,
S, 8, 1 I, 13,
and 15 that codes for the polypeptide selected from the group consisting of
SEQ ID NOs:2,
4, 6, 9, 12, 14, and 16. The present invention also relates to an isolated
polynucleotide
comprising a nucleotide sequences of at least one of 40 (preferably at least
one of 30)
contiguous nucleotides derived from a nucleotide sequence selected from the
group
consisting of SEQ ID NOs:I, 3, 5, 8, 11, 13, 15, and the complement of such
nucleotide
sequences.
The present invention relates to a chimeric gene comprising an isolated
polynucleotide
of the present invention operably linked to suitable regulatory sequences.
The present invention relates to an isolated host cell comprising a chimeric
gene of the
present invention or an isolated polynucleotide of the present invention. The
host cell may
be eukaryotic, such as an insect, a yeast or a plant cell, or prokaryotic,
such as a bacterial cell
or virus. If the host cell is a virus, it is preferably a baculovirus. It is
most preferred that the
baculovirus comprises an isolated polynucleotide of the present invention or a
chimeric gene
of the present invention.
The present invention relates to a process for producing an isolated host cell
comprising a chimeric gene of the present invention or an isolated
polynucleotide of the
present invention, the process comprising either transforming or transfecting
an isolated
compatible host cell with a chimeric gene or isolated polynucleotide of the
present invention.
3
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
The present invention relates to a scorpion toxin polypeptide selected from
the group
of alpha toxin XIV, neurotoxin I, and depressant toxin LqhIT2 of at least 60
amino acids
comprising at least 95% homology based on the Clustal method of alignment
compared to a
polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 9, 12,
14, and 16.
The present invention relates to a method of selecting an isolated
polynucleotide that
affects the level of expression of a sodium channel agonist polypeptide in a
host cell; the
method comprising the steps o~
constructing an isolated polynucleotide of the present invention or an
isolated
chimeric gene of the present invention;
introducing the isolated polynucleotide or the isolated chimeric gene into a
host
cell;
measuring the level a alpha toxin XIV, a neurotoxin I, or a depressant toxin
LqhIT2 polypeptide in the host cell containing the isolated polynucleotide;
and
comparing the level of a alpha toxin XIV, a neurotoxin I, or a depressant
toxin
LqhIT2 polypeptide in the host cell containing the isolated polynucleotide
with the level of a
alpha toxin XIV, a neurotoxin I, or a depressant toxin LqhIT2 polypeptide in a
host cell that
does not contain the isolated poiynucleotide.
The present invention relates to a method of obtaining a nucleic acid fragment
encoding a substantial portion of a alpha toxin XIV, a neurotoxin I, or a
depressant toxin
LqhIT2 polypeptide gene, preferably a scorpion alpha toxin XIV, a neurotoxin
I, or a
depressant toxin LqhIT2 polypeptide gene, comprising the steps of:
synthesizing an
oligonucleotide primer comprising a nucleotide sequence of at least one of 40
(preferably at
least one of 30) contiguous nucleotides derived from a nucleotide sequence
selected from the
group consisting of SEQ ID NOs:l, 3, 5, 8, 1 I, 13, 15, and the complement of
such
nucleotide sequences; and amplifying a nucleic acid fragment (preferably a
cDNA inserted in
a cloning vector) using the oligonucleotide primer. The amplified nucleic acid
fragment
preferably will encode a portion of an alpha toxin XIV, a neurotoxin I, or a
depressant toxin
LqhIT2 amino acid sequence.
The present invention also relates to a method of obtaining a nucleic acid
fragment
encoding all or a subsantial portion of the amino acid sequence encoding an
alpha toxin
XIV, a neurotoxin I, or a depressant toxin LqhIT2 polypeptide comprising the
steps of:
probing a cDNA or genomic library with an isolated polynucleotide of the
present invention;
identifying a DNA clone that hybridizes with an isolated polynucleotide of the
present
invention; isolating the identified DNA clone; and sequencing the cDNA or
genomic
fragment that comprises the isolated DNA clone.
Another embodiment of the instant invention pertains to a method for
expressing a
gene encoding a alpha toxin XIV, a neurotoxin I, or a depressant toxin LqhIT2
in the
genome of a recombinant baculovirus in insect cell culture or in viable
insects wherein said
4
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
insect cells or insects have been genetically engineered to express an alpha
toxin XIV, a
neurotoxin I, or a depressant toxin LqhIT2.
The present invention relates to an expression cassette comprising at least
one
nucleic acid of Claim 1 operably linked to a promoter.
The present invention relates to a method for positive selection of a
transformed cell
comprising the steps of transforming a plant cell with a chimeric gene of the
present
invention or an expression cassette of the present invention; and growing the
transformed
plant cell under conditions allowing expression of the polynucleotide in an
amount sufficient
to induce insect resistance to provide a positive selection means.
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING
The invention can be more fully understood from the following detailed
description
and the accompanying drawings and Sequence Listing which form a part of this
application.
Figure 1 shows a comparison of the amino acid sequences of the alpha toxin XIV
of
the instant invention (SEQ ID NOs:2, 4 and 6) with the sequence of alpha toxin
XIV from
Buthus occitanus (NCBI General Identifier No. 1041278; SEQ ID N0:7). The
conserved
cysteine residues probably involved in intrachain disulfide bridges are boxed.
The first
amino acid of the mature toxin is marked by an arrow above the top row.
Figure 2 shows a comparison of the amino acid sequences of the neurotoxin I of
the
instant invention (SEQ ID N0:9) with the sequence of neurotoxin I from Buthus
occitanus
tunetanus (NCBI General Identifier No. 134335; SEQ ID NO:10). The conserved
cysteine
residues probably involved in intrachain disulfide bridges are boxed. The
first amino acid of
the mature toxin is marked by an arrow above the top row.
Figure 3 shows a comparison of the amino acid sequences of the depressant
toxin
LqhIT2 of the instant invention (SEQ ID NOs:12, 14 and 16) with the sequence
of the
depressant toxin LqhIT2 from Leiurus quinquestriatus (NCBI General Identifier
No. 102796; SEQ ID N0:17). The conserved cysteine residues probably involved
in
intrachain disulfide bridges are boxed. The first amino acid of the mature
toxin is marked by
an arrow above the top row.
Table 1 lists the polypeptides that are described herein, the designation of
the cDNA
clones that comprise the nucleic acid fragments encoding polypeptides
representing all or a
substantial portion of these polypeptides, and the corresponding identifier
(SEQ ID NO:) as
used in the attached Sequence Listing. The sequence descriptions and Sequence
Listing
attached hereto comply with the rules governing nucleotide and/or amino acid
sequence
disclosures in patent applications as set forth in 37 C.F.R. ~1.821-1.825.
S
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
TABLE 1
Scorpion Sodium Channel Agonists
SEQ ID NO:
Protein Clone Designation(Nucleotide)
(Amino
Acid)
Scorpion Alpha Toxin XIV lst.pk0004.e12 1 2
Scorpion Alpha Toxin XIV lst.pk0016.c5.f 3 4
Scorpion Alpha Toxin XIV lst.pk0015.h11 5 6
Scorpion Neurotoxin I lst.pk0013.f1 8 9
Scorpion Depressant Toxinlst.pk0004.c8 11 12
LqhIT2
Scorpion Depressant Toxinlst.pk0013.c9 13 14
LqhIT2
Scorpion Depressant Toxinlst.pkpk0004.e8 1 S 16
LqhIT2
The Sequence Listing contains the one letter code for nucleotide sequence
characters
and the three letter codes for amino acids as defined in conformity with the
IUPAC-IUBMB
standards described in Nucleic Acids Research 13:3021-3030 (1985) and in the
Biochemical
Journal 219 (No. 2):345-373 ( 1984) which are herein incorporated by
reference. The
symbols and format used for nucleotide and amino acid sequence data comply
with the rules
set forth in 37 C.F.R. ~ 1.822.
DETAILED DESCRIPTION OF THE INVENTION
In the context of this disclosure, a number of terms shall be utilized. As
used herein, a
"polynucleotide" is a nucleotide sequence such as a nucleic acid fragment. A
polynucleotide
may be a polymer of RNA or DNA that is single- or double-stranded, that
optionally
contains synthetic, non-natural or altered nucleotide bases. A polynucleotide
in the form of
a polymer of DNA may be comprised of one or more segments of cDNA, genomic
DNA, or
synthetic DNA. An isolated polynucleotide of the present invention may include
at least one
of 40 contiguous nucleotides, preferably at least one of 30 contiguous
nucleotides, most
preferably one of at least 15 contiguous nucleotides, of the nucleic acid
sequence of the SEQ
ID NOs: l, 3, 5, 8, 11, 13 and 15.
"NPV" stands for Nuclear Polyhedrosis Virus, a baculovirus. "Polyhedrosis"
refers to
any of several virus diseases of insect larvae characterized by dissolution of
tissues and
accumulation of polyhedral granules in the resultant fluid. "PIBs" are
polyhedral inclusion
bodies. "AcNPV" stands for the wild-type Autographa californica Nuclear
Polyhedrosis
Virus.
As used herein, "substantially similar" refers to nucleic acid fragments
wherein
changes in one or more nucleotide bases results in substitution of one or more
amino acids,
but do not affect the functional properties of the polypeptide encoded by the
polynucleotide
sequence. "Substantially similar" also refers to modifications of the nucleic
acid fragments
of the instant invention such as deletion or insertion of one or more
nucleotides that do not
6
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
substantially affect the functional properties of the resulting protein
molecule. It is therefore
understood that the invention encompasses more than the specific exemplary
sequences.
Moreover, substantially similar nucleic acid fragments may also be
characterized by
their ability to hybridize. Estimates of such homology are provided by either
DNA-DNA or
DNA-RNA hybridization under conditions of stringency as is well understood by
those
skilled in the art (Names and Higgins, Eds. (1985) Nucleic Acid Hybridisation,
IRL Press,
Oxford, U.K.). Stringency conditions can be adjusted to screen for moderately
similar
fragments, such as homologous sequences from distantly related organisms, to
highly similar
fragments, such as genes that duplicate functional enzymes from closely
related organisms.
Post-hybridization washes determine stringency conditions. One set of
preferred conditions
uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for
15 min,
then repeated with 2X SSC, 0.5% SDS at 45°C for 30 min, and then
repeated twice with
0.2X SSC, 0.5% SDS at 50°C for 30 min. A more preferred set of
stringent conditions uses
higher temperatures in which the washes are identical to those above except
for the
temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased
to 60°C.
Another preferred set of highly stringent conditions uses two final washes in
O.1X SSC,
0.1% SDS at 65°C.
Substantially similar nucleic acid fragments of the instant invention may also
be
characterized by the percent identity of the amino acid sequences that they
encode to the
amino acid sequences disclosed herein, as determined by algorithms commonly
employed by
those skilled in this art. Suitable nucleic acid fragments (isolated
polynucleotides of the
present invention) encode polypeptides that are 90% identical to the amino
acid sequences
reported herein. Most preferred are nucleic acid fragments that encode amino
acid sequences
that are 95% identical to the amino acid sequences reported herein. Suitable
nucleic acid
fragments not only have the above homologies but typically encode a
polypeptide having at
least 50 amino acids, preferably 100 amino acids, more preferably 150 amino
acids, still
more preferably 200 amino acids, and most preferably 250 amino acids. Sequence
alignments and percent identity calculations were performed using the Megalign
program of
the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, WI).
Multiple alignment of the sequences was performed using the Clustal method of
alignment
(Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP
PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5
and DIAGONALS SAVED=5.
A "substantial portion" of an amino acid or nucleotide sequence comprises an
amino
acid or a nucleotide sequence that is sufficient to afford putative
identification of the protein
or gene that the amino acid or nucleotide sequence comprises. Amino acid and
nucleotide
sequences can be evaluated either manually by one skilled in the art, or by
using computer-
7
CA 02341062 2001-02-28
WO 00/24772 PCTNS99/24922
based sequence comparison and identification tools that employ algorithms such
as BLAST
(Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see
also www.ncbi.nlm.nih.govBLASTn. In general, a sequence of ten or more
contiguous
amino acids or thirty or more contiguous nucleotides is necessary in order to
putatively
identify a polypeptide or nucleic acid sequence as homologous to a known
protein or gene.
Moreover, with respect to nucleotide sequences, gene-specific oligonucleotide
probes
comprising 30 or more contiguous nucleotides may be used in sequence-dependent
methods
of gene identification (e.g., Southern hybridization) and isolation (e.g., in
situ hybridization
of bacterial colonies or bacteriophage plaques). In addition, short
oligonucleotides of 12 or
more nucleotides may be used as amplification primers in PCR in order to
obtain a particular
nucleic acid fragment comprising the primers. Accordingly, a "substantial
portion" of a
nucleotide sequence comprises a nucleotide sequence that will afford specific
identification
and/or isolation of a nucleic acid fragment comprising the sequence. The
instant
specification teaches amino acid and nucleotide sequences encoding
polypeptides that
comprise one or more particular plant proteins. The skilled artisan, having
the benefit of the
sequences as reported herein, may now use all or a substantial portion of the
disclosed
sequences for purposes known to those skilled in this art. Accordingly, the
instant invention
comprises the complete sequences as reported in the accompanying Sequence
Listing, as
well as substantial portions of those sequences as defined above.
"Codon degeneracy" refers to divergence in the genetic code permitting
variation of
the nucleotide sequence without effecting the amino acid sequence of an
encoded
polypeptide. Accordingly, the instant invention relates to any nucleic acid
fragment
comprising a nucleotide sequence that encodes all or a substantial portion of
the amino acid
sequences set forth herein. The skilled artisan is well aware of the "codon-
bias" exhibited
by a specific host cell in usage of nucleotide codons to specify a given amino
acid.
Therefore, when synthesizing a nucleic acid fragment for improved expression
in a host cell,
it is desirable to design the nucleic acid fragment such that its frequency of
codon usage
approaches the frequency of preferred codon usage of the host cell.
"Synthetic nucleic acid fragments" can be assembled from oligonucleotide
building
blocks that are chemically synthesized using procedures known to those skilled
in the art.
These building blocks are ligated and annealed to form larger nucleic acid
fragments which
may then be enzymatically assembled to construct the entire desired nucleic
acid fragment.
"Chemically synthesized", as related to nucleic acid fragment, means that the
component
nucleotides were assembled in vitro. Manual chemical synthesis of nucleic acid
fragments
may be accomplished using well established procedures, or automated chemical
synthesis
can be performed using one of a number of commercially available machines.
Accordingly,
the nucleic acid fragments can be tailored for optimal gene expression based
on optimization
of nucleotide sequence to reflect the codon bias of the host cell. The skilled
artisan
8
CA 02341062 2001-02-28
WO 00/24772 PCTNS99/24922
appreciates the likelihood of successful gene expression if codon usage is
biased towards
those codons favored by the host. Determination of preferred codons can be
based on a
survey of genes derived from the host cell where sequence information is
available.
"Gene" refers to a nucleic acid fragment that expresses a specific protein,
including
regulatory sequences preceding (5' non-coding sequences) and following (3' non-
coding
sequences) the coding sequence. "Native gene" refers to a gene as found in
nature with its
own regulatory sequences. "Chimeric gene" refers any gene that is not a native
gene,
comprising regulatory and coding sequences that are not found together in
nature.
Accordingly, a chimeric gene may comprise regulatory sequences and coding
sequences that
are derived from different sources, or regulatory sequences and coding
sequences derived
from the same source, but arranged in a manner different than that found in
nature.
"Endogenous gene" refers to a native gene in its natural location in the
genome of an
organism. A "foreign" gene refers to a gene not normally found in the host
organism, but
that is introduced into the host organism by gene transfer. Foreign genes can
comprise
native genes inserted into a non-native organism, or chimeric genes. A
"transgene" is a gene
that has been introduced into the genome by a transformation procedure.
"Coding sequence" refers to a nucleotide sequence that codes for a specific
amino acid
sequence. "Regulatory sequences" refer to nucleotide sequences located
upstream (5' non-
coding sequences), within, or downstream (3' non-coding sequences) of a coding
sequence,
and which influence the transcription, RNA processing or stability, or
translation of the
associated coding sequence. Regulatory sequences may include promoters,
translation
leader sequences, introns, and polyadenylation recognition sequences.
"Promoter" refers to a nucleotide sequence capable of controlling the
expression of a
coding sequence or functional RNA. In general, a coding sequence is located 3'
to a
promoter sequence. The promoter sequence consists of proximal and more distal
upstream
elements, the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a
nucleotide sequence which can stimulate promoter activity and may be an innate
element of
the promoter or a heterologous element inserted to enhance the level or tissue-
specificity of a
promoter. Promoters may be derived in their entirety from a native gene, or be
composed of
different elements derived from different promoters found in nature, or even
comprise
synthetic nucleotide segments. It is understood by those skilled in the art
that different
promoters may direct the expression of a gene in different tissues or cell
types, or at different
stages of development, or in response to different environmental conditions.
Promoters
which cause a nucleic acid fragment to be expressed in most cell types at most
times are
commonly referred to as "constitutive promoters". New promoters of various
types useful in
a variety of cells are constantly being discovered; numerous examples may be
found in the
compilation by Okamuro and Goldberg ( 1989) Biochemistry of Plants I S:1-82.
It is further
recognized that since in most cases the exact boundaries of regulatory
sequences have not
9
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
been completely defined, DNA fragments of different lengths may have identical
promoter
activity.
The "translation leader sequence" refers to a nucleotide sequence located
between the
promoter sequence of a gene and the coding sequence. The translation leader
sequence is
present in the fully processed mRNA upstream of the translation start
sequence. The
translation leader sequence may affect processing of the primary transcript to
mRNA,
mRNA stability or translation efficiency. Examples of translation leader
sequences have
been described (Turner and Foster (1995) Mol. Biotechnol. 3:225-236).
The "3' non-coding sequences" refer to nucleotide sequences located downstream
of a
coding sequence and include polyadenylation recognition sequences and other
sequences
encoding regulatory signals capable of affecting mRNA processing or gene
expression. 'The
polyadenylation signal is usually characterized by affecting the addition of
polyadenylic acid
tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding
sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
"RNA transcript" refers to the product resulting from RNA polymerase-catalyzed
transcription of a DNA sequence. When the RNA transcript is a perfect
complementary
copy of the DNA sequence, it is referred to as the primary transcript or it
may be a RNA
sequence derived from posttranscriptional processing of the primary transcript
and is
referred to as the mature RNA. "Messenger RNA (mRNA)" refers to the RNA that
is
without introns and that can be translated into protein by the cell. "cDNA"
refers to a
double-stranded DNA that is complementary to and derived from mRNA. "Sense"
RNA
refers to RNA transcript that includes the mRNA and so can be translated into
protein by the
cell. "Functional RNA" refers to sense RNA, ribozyme RNA, or other RNA that
may not be
translated but yet has an effect on cellular processes.
The term "operably linked" refers to the association of two or more nucleic
acid
fragments on a single nucleic acid fragment so that the function of one is
affected by the
other. For example, a promoter is operably linked with a coding sequence when
it is capable
of affecting the expression of that coding sequence (i.e., that the coding
sequence is under
the transcriptional control of the promoter). Coding sequences can be operably
linked to
regulatory sequences in sense orientation.
The term "expression", as used herein, refers to the transcription and stable
accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid
fragment of
the invention. Expression may also refer to translation of mRNA into a
polypeptide.
"Overexpression" refers to the production of a gene product in transgenic
organisms that
exceeds levels of production in normal or non-transformed organisms.
"Altered levels" refers to the production of gene products) in transgenic
organisms in
amounts or proportions that differ from that of normal or non-transformed
organisms.
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
A "signal sequence" is an amino acid sequence that is covalently linked to an
amino
acid sequence representing a mature protein. The signal sequence directs the
protein to the
secretory system (Chrispeels (1991) Ann. Rev. Plant Phys. Plant Mol. Biol.
42:21-53).
"Mature" protein refers to a post-translationally processed polypeptide; i.e.,
one from which
S any pre- or propeptides, including signal sequences, present in the primary
translation
product have been removed. "Precursor" protein refers to the primary product
of translation
of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides
may be but are
not limited to intracellular localization signals.
"Transformation" refers to the transfer of a nucleic acid fragment into the
genome of a
host organism, resulting in genetically stable inheritance. Host organisms
containing the
transformed nucleic acid fragments are referred to as "transgenic" organisms.
Examples of
methods of plant transformation include Agrobacterium-mediated transformation
(De Blaere
et al. (1987) Meth. Enrymol. 143:277) and particle-accelerated or "gene gun"
transformation
technology {Klein et al. (1987) Nature (London) 327:70-73; U.S. Patent No.
4,945,050,
incorporated herein by reference).
It is understood that "an insect cell" refers to one or more insect cells
maintained in
vitro as well as one or more cells found in an intact, living insect.
Standard recombinant DNA and molecular cloning techniques used herein are well
known in the art and are described more fully in Sambrook et al. Molecular
Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor,
1989
(hereinafter "Maniatis").
Nucleic acid fragments encoding at least a portion of several scorpion sodium
channel
agonists have been isolated and identified by comparison of cDNA sequences to
public
databases containing nucleotide and protein sequences using the BLAST
algorithms well
known to those skilled in the art. The nucleic acid fragments of the instant
invention may be
used to isolate cDNAs and genes encoding homologous proteins from the same or
other
arthropod species. Isolation of homologous genes using sequence-dependent
protocols is
well known in the art. Examples of sequence-dependent protocols include, but
are not
limited to, methods of nucleic acid hybridization, and methods of DNA and RNA
amplification as exemplified by various uses of nucleic acid amplification
technologies (e.g.,
polymerase chain reaction, ligase chain reaction).
For example, genes encoding other alpha toxin XIV, either as cDNAs or genomic
DNAs, could be isolated directly by using all or a portion of the instant
nucleic acid
fragments as DNA hybridization probes to screen libraries from any desired
arthropod
employing methodology well known to those skilled in the art. Specific
oligonucleotide
probes based upon the instant nucleic acid sequences can be designed and
synthesized by
methods known in the art (Maniatis). Moreover, the entire sequences can be
used directly to
synthesize DNA probes by methods known to the skilled artisan such as random
primer
11
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
DNA labeling, nick translation, or end-labeling techniques, or RNA probes
using available
in vitro transcription systems. In addition, specific primers can be designed
and used to
amplify a part or all of the instant sequences. The resulting amplification
products can be
labeled directly during amplification reactions or labeled after amplification
reactions, and
used as probes to isolate full length cDNA or genomic fragments under
conditions of
appropriate stringency.
In addition, two short segments of the instant nucleic acid fragments may be
used in
polymerise chain reaction protocols to amplify longer nucleic acid fragments
encoding
homologous genes from DNA or RNA. The polymerise chain reaction may also be
performed on a library of cloned nucleic acid fragments wherein the sequence
of one primer
is derived from the instant nucleic acid fragments, and the sequence of the
other primer takes
advantage of the presence of the polyadenylic acid tracts to the 3' end of the
mRNA
precursor encoding arthropod genes. Alternatively, the second primer sequence
may be
based upon sequences derived from the cloning vector. For example, the skilled
artisan can
follow the RACE protocol (Frohman et al. ( 1988) Proc. Natl. Acid. Sci. USA
85:8998-9002)
to generate cDNAs by using PCR to amplify copies of the region between a
single point in
the transcript and the 3' or 5' end. Primers oriented in the 3' and 5'
directions can be
designed from the instant sequences. Using commercially available 3' RACE or
5' RACE
systems (BRL), specific 3' or 5' cDNA fragments can be isolated (Ohara et al.
(1989) Proc.
Natl. Acid. Sci. USA 86:5673-5677; Loh et al. (1989) Science 243:217-220).
Products
generated by the 3' and 5' RACE procedures can be combined to generate full-
length cDNAs
(Frohman and Martin (1989) Techniques 1:165).
Availability of the instant nucleotide and deduced amino acid sequences
facilitates
immunological screening of cDNA expression libraries. Synthetic peptides
representing
portions of the instant amino acid sequences may be synthesized. These
peptides can be
used to immunize animals to produce polyclonal or monoclonal antibodies with
specificity
for peptides or proteins comprising the amino acid sequences. These antibodies
can be then
be used to screen cDNA expression libraries to isolate full-length cDNA clones
of interest
(Lerner (1984) Adv. Immunol. 36:1-34; Maniatis).
The nucleic acid fragments of the instant invention may be used to create
transgenic
plants in which the disclosed scorpion sodium channel agonists are expressed.
This would
be useful as a means for controlling insect pests by producing plants that are
more insect-
tolerant than the naturally occurring variety.
Expression in plants of the proteins of the instant invention may be
accomplished by
first constructing a chimeric gene in which the coding region is operably
linked to a
promoter capable of directing expression of a gene in the desired tissues at
the desired stage
of development. For reasons of convenience, the chimeric gene may comprise
promoter
sequences and translation leader sequences derived from the same genes. 3' Non-
coding
12
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
sequences encoding transcription termination signals may also be provided. The
instant
chimeric gene may also comprise one or more introns in order to facilitate
gene expression.
Plasmid vectors comprising the instant chimeric gene can then constructed. The
choice of plasmid vector is dependent upon the method that will be used to
transform host
plants. The skilled artisan is well aware of the genetic elements that must be
present on the
plasmid vector in order to successfully transform, select and propagate host
cells containing
the chimeric gene. The skilled artisan will also recognize that different
independent
transformation events will result in different levels and patterns of
expression (Jones et al.
( 1985) EMBO J. 4:2411-2418; De Almeida et al. ( 1989) Mol. Gen. Genetics
218:78-86), and
thus that multiple events must be screened in order to obtain lines displaying
the desired
expression level and pattern. Such screening may be accomplished by Southern
analysis of
DNA, Northern analysis of mRNA expression, Western analysis of protein
expression, LC-
MS, or phenotypic analysis.
The instant polypeptides (or portions thereof) may be produced in heterologous
host
cells, particularly in the cells of microbial hosts, and can be used to
prepare antibodies to the
these proteins by methods well known to those skilled in the art. The
antibodies are useful
for detecting the polypeptides of the instant invention zn situ in cells or in
vitro in cell
extracts. Preferred heterologous host cells for production of the instant
polypeptides are
microbial hosts. Microbial expression systems and expression vectors
containing regulatory
sequences that direct high level expression of foreign proteins are well known
to those
skilled in the art. Any of these could be used to construct a chimeric gene
for production of
the instant polypeptides. This chimeric gene could then be introduced into
appropriate
microorganisms via transformation to provide high level expression of the
encoded scorpion
sodium channel agonist. An example of a vector for high level expression of
the instant
polypeptides in a bacterial host is provided (Example 8).
Insecticidal baculoviruses have great potential to provide an environmentally
benign
method for agricultural insect pest control. However, improvements to efficacy
are required
in order to make these agents competitive with current chemical pest control
agents. One
approach for making such improvements is through genetic alteration of the
virus. For
instance, it may be possible to modify the viral genome in order to improve
the host range of
the virus, to increase the environmental stability and persistence of the
virus, or to improve
the infectivity and transmission of the virus. In addition, improving the rate
at which the
virus acts to compromise the infected insect would significantly enhance the
attractiveness of
insecticidal baculoviruses as adjuncts or replacements for chemical pest
control agents. One
method for increasing the speed with which the virus affects its insect host
is to introduce
into the baculovirus foreign genes that encode proteins that are toxic to the
insect wherein
death or incapacitation of the insect is no longer dependent solely on the
course of the viral
13
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
infection, but instead is aided by the accumulation of toxic levels of the
foreign protein. The
results are insecticidal recombinant baculoviruses.
Recombinant baculoviruses expressing the instant scorpion sodium channel
agonists
(or portions thereof) may be prepared by protocols now known to the art (e.g.,
Tomalski
et al., U.S. Patent No. 5,266,317, exemplifying neurotoxins from the insect-
parasitic mites;
McCutchen et al. (1991) BiolTechnology 9:848-852; Maeda et al. (1991) Virology
184:777-780, illustrating construction of a recombinant baculovirus expressing
AaIT; also
see O'Reilly et al. (1992) Baculovirus Expression Vectors: A Laboratory
Manual, W. H.
Freeman and Company, New York; King and Possee (1992) The Baculovirus
Expression
System, Chapman and Hall, London; U.S. Patent No. 4,745,051). These methods of
gene
expression provide economical preparation of foreign proteins in a eukaryotic
expression
vector system, in many instances yielding proteins that have achieved their
proper tertiary
conformation and formed the proper disulfide bridges necessary for activity.
Commonly, the introduction of heterologous genes into the baculovirus genome
occurs
by homologous recombination between viral genomic DNA and a suitable "transfer
vector"
containing the heterologous gene of interest. These transfer vectors are
generally plasmid
DNAs that are capable of autonomous replication in bacterial hosts, affording
facile genetic
manipulation. Baculovirus transfer vectors also contain a genetic cassette
comprising a
region of the viral genome that has been modified to include the following
features (listed in
the 5' to 3' direction): 1 ) viral DNA comprising the 5' region of a non-
essential genomic
region; 2) a viral promoter; 3) one or more DNA sequences encoding restriction
enzyme sites
facilitating insertion of heterologous DNA sequences; 4) a transcriptional
termination
sequence; and 5) viral DNA comprising the 3' region of a non-essential genomic
region. A
heterologous gene of interest is inserted into the transfer vector at the
restriction site
downstream of the viral promoter. The resulting cassette comprises a chimeric
gene wherein
the heterologous gene is under the transcriptional control of the viral
promoter and
transcription termination sequences present on the transfer vector. Moreaver,
this chimeric
gene is flanked by viral DNA sequences that facilitate homologous
recombination at a non-
essential region of the viral genome. Recombinant viruses are created by co-
transfecting
insect cells that are capable of supporting viral replication with viral
genamic DNA and the
recombinant transfer vector. Homologous recombination between the flanking
viral DNA
sequences present on the transfer vector and the homologous sequences on the
viral genomic
DNA takes place and results in insertion of the chimeric gene into a region of
the viral
genome that does not disrupt an essential viral function. The infectious
recombinant virion
consists of the recombined genomic DNA, referred to as the baculovirus
expression vector,
surrounded by a protein coat.
In a preferred embodiment, the non-essential region of the viral genome that
is present
on the transfer vector comprises the region of the viral DNA responsible for
polyhedrin
14
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
production. Most preferred is a transfer vector that contains the entire
polyhedrin gene
between the flanking sequences that are involved in homologous recombination.
Recombination with genomic DNA from viruses that are defective in polyhedrin
production
(due to a defect in the genomic copy of the polyhedrin gene) will result in
restoration of the
polyhedrin-positive phenotype. This strategy facilitates identification and
selection of
recombinant viruses.
In another embodiment, baculoviral genomic DNA can be directly modified by
introduction of a unique restriction enzyme recognition sequence into a non-
essential region
of the viral genome. A chimeric gene comprising the heterologous gene to be
expressed by
the recombinant virus and operably linked to regulatory sequences capable of
directing gene
expression in baculovirus-infected insect cells, can be constructed and
inserted directly into
the viral genome at the unique restriction site. This strategy eliminates both
the need for
construction of transfer vectors and reliance on homologous recombination for
generation of
recombinant viruses. This technology is described by Ernst et al. (Ernst et
al. (1994) Nuc.
Acid Res. 22: 2855-2856), and in W094/28114.
Recombinant baculovirus expression vectors suitable for delivering genetically
encoded insect-specific neurotoxins require optimal toxin gene expression for
maximum
e~cacy. A number of strategies can be used by the skilled artisan to design
and prepare
recombinant baculoviruses wherein toxin gene expression results in sufficient
quantities of
toxin produced at appropriate times during infection in a functional form and
available for
binding to target cells within the insect host.
The isolated toxin gene fragment may be digested with appropriate enzymes and
may
be inserted into the pTZ-18R plasmid (Pharmacia, Piscataway, N~ at the
multiple cloning
site using standard molecular cloning techniques. Following transformation of
E. coli
DHSaMCR, isolated colonies may be chosen and plasmid DNA prepared. Positive
clones
will be identified and sequenced with the commercially available forward and
reverse
primers.
Spodoptera frugiperda cells (Sf 9) may be propagated in ExCell~ 401 media
(JRH Biosciences, Lenexa, KS) supplemented with 3.0% fetal bovine serum.
Lipofectin~
(SO ~,L at 0.1 mg/mL, GibcoBRL) may be added to a SO ~.L aliquot of the
transfer vector
containing the toxin gene of interest (500 ng) and linearized polyhedrin-
negative AcNPV
(2.5 ~,g, Baculogold~ viral DNA, Pharmigen, San Diego, CA). Sf 9 cells
(approximate 50%
monolayer) may be co-transfected with the viral DNA/transfer vector solution.
The
supernatant fluid from the co-transfection experiment may be collected at 5
days
post-transfection and recombinant viruses may be isolated employing standard
plaque
purification protocols, wherein only polyhedrin-positive plaques will be
selected (Granados,
R. R., Lawler, K. A., Virology (1981),108, 297-308).
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
To propagate the recombinant virus of interest, isolated plaques may be picked
and
suspended in 500 pL of ExCell~ media supplemented with 2.5% fetal bovine
serum. Sf 9
cells in 35 mM petri dishes (50% monolayer) may be inoculated with 100 pL of
the viral
suspension, and supernatant fluids collected at 5 days post infection. These
supernatant
fluids will be used to inoculate cultures for large scale propagation of
recombinant viruses.
Expression of the encoded toxin gene by the recombinant baculovirus will be
confirmed using a bioassay, LCMS, or antibodies. The presence of toxin
activity in the
recombinant viruses will be monitored in vivo. These assays involve comparison
of
biological activity of recombinant viruses to wild-type. Third instar larvae
of H. virescens
are infected orally by consumption of diet that contains test and control
viruses and the
larvae monitored for behavioral changes and mortality.
Isolated plugs of a standard insect diet are inoculated with approximately
5000 PIBs of
each virus. Individual larvae that have not fed for 12 h prior to beginning of
the bioassay are
allowed to consume the diet for 24 h. The larvae are transferred to individual
wells in a diet
tray and monitored for symptoms and mortality on a daily basis (Zlotkin et al.
( 1991 )
Biochimie (Paris) 53:1073-1078).
EXAMPLES
The present invention is further defined in the following Examples, in which
all parts
and percentages are by weight and degrees are Celsius, unless otherwise
stated. It should be
understood that these Examples, while indicating preferred embodiments of the
invention,
are given by way of illustration only. From the above discussion and these
Examples, one
skilled in the art can ascertain the essential characteristics of this
invention, and without
departing from the spirit and scope thereof, can make various changes and
modifications of
the invention to adapt it to various usages and conditions.
EXAMPLE 1
Composition of cDNA Libraries' Isolation and Sequencing of cDNA Clones
cDNA libraries representing mRNAs from various Leiurus scorpion telson tissues
were prepared. cDNA libraries may be prepared by any one of many methods
available.
For example, the cDNAs may be introduced into plasmid vectors by first
preparing the
cDNA libraries in Uni-ZAPTM XR vectors according to the manufacturer's
protocol
(Stratagene Cloning Systems, La Jolla, CA). The Uni-ZAPTM XR libraries are
converted
into plasmid libraries according to the protocol provided by Stratagene. Upon
conversion,
cDNA inserts will be contained in the plasmid vector pBluescript. In addition,
the cDNAs
may be introduced directly into precut Bluescript II SK(+) vectors
(Stratagene) using T4
DNA ligase (New England Biolabs), followed by transfection into DH10B cells
according to
the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in
plasmid
vectors, plasmid DNAs are prepared from randomly picked bacterial colonies
containing
recombinant pBluescript plasmids, or the insert cDNA sequences are amplified
via
16
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
polymerase chain reaction using primers specific for vector sequences flanking
the inserted
cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-
primer
sequencing reactions to generate partial cDNA sequences (expressed sequence
tags or
"ESTs"; see Adams et al., (1991) Science 252:1651-1656). The resulting ESTs
are analyzed
using a Perkin Elmer Model 377 fluorescent sequencer.
EXAMPLE 2
Identification of cDNA Clones
ESTs encoding scorpion sodium channel agonists were identified by conducting
BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see also www.ncbi.nlm.nih.gov/BLAST~ searches for similarity to
sequences
contained in the BLAST "nr" database (comprising all non-redundant GenBank CDS
translations, sequences derived from the 3-dimensional structure Brookhaven
Protein Data
Bank, the last major release of the SWISS-PROT protein sequence database,
EMBL, and
DDBJ databases). The cDNA sequences obtained in Example 1 were analyzed for
similarity
to all publicly available DNA sequences contained in the "nr" database using
the BLASTN
algorithm provided by the National Center for Biotechnology Information
(NCBI). The
DNA sequences were translated in all reading frames and compared for
similarity to all
publicly available protein sequences contained in the "nr" database using the
BLASTX
algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI.
For
convenience, the P-value (probability) of observing a match of a cDNA sequence
to a
sequence contained in the searched databases merely by chance as calculated by
BLAST are
reported herein as "pLog" values, which represent the negative of the
logarithm of the
reported P-value. Accordingly, the greater the pLog value, the greater the
likelihood that the
cDNA sequence and the BLAST "hit" represent homologous proteins.
EXAMPLE 3
Characterization of cDNA Clones Encodine Alpha Toxin XIV
The BLASTX search using the EST sequences from clones listed in Table 3
revealed
similarity of the polypeptides encoded by the cDNAs to alpha toxin XIV from
Buthus
occitanus (NCBI General Identifier No. 1041278). Shown in Table 3 are the
BLASTP
results for individual ESTs:
TABLE 3
BLAST Results for Sequences Encoding Polypeptides Homologous to Alpha Toxin
XIV
BLAST pLog Score
Clone ~ nat ~~Q
lst.pk0004. a 12 24.15
lst.pk0016.c5.f 28.00
lst.pk001 S.hl I.f 29.70
17
CA 02341062 2001-02-28
WO 00/24772
PC7YUS99/24922
The nucleotide sequences from the clones presented above encode entire toxins
and all
or part of the corresponding signal sequence. The amino acid sequence set
forth in SEQ ID
N0:2 contains a signal sequence (amino acids 1-11 ) and a mature toxin (amino
acids 12-75).
The amino acid sequence set forth in SEQ ID N0:4 contains a signal sequence
(amino acids
1-12) and a mature toxin (amino acids 13-79). The amino acid sequence set
forth in SEQ ID
N0:6 contains a signal sequence (amino 1-19) and a mature toxin (amino acids
20-87).
Figure I presents an alignment of the amino acid sequences set forth in SEQ ID
NOs:2, 4 and 6 and the Buthus occitanus sequence (NCBI General Identifier No.
1041278).
The data in Table 4 represents a calculation of the percent identity of the
amino acid
sequences set forth in SEQ ID NOs:2, 4 and 6 and the Buthus occitanus sequence
(SEQ ID
N0:7).
TABLE 4
Percent Identity of Amino Acid Sequences Deduced From the Nucleotide Sequences
of cDNA Clones Encodin Pol a tides Homolo ous to A1 ha Toxin XIV
Percent Identity to
SEQ ID NO. 1041278
2 60.0
4 68.4
6 64.7
Sequence alignments and percent identity calculations were performed using the
Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc.,
Madison, WI). Multiple alignment of the sequences was performed using the
Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the
default
parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for
pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3,
WINDOW=5 and DIAGONALS SAVED=5. Sequence alignments and BLAST scores and
probabilities indicate that the instant nucleic acid fragments encode three
distinct, entire,
scorpion alpha toxin XIV, two of which have partial signal sequences and one
has the entire
signal sequence.
EXAMPLE 4
Characterization of cDNA Clones Encodin Neruotoxin I
The BLASTX search using the EST sequence from clone lst.pk0013.f1 revealed
similarity of the protein encoded by the cDNAs to neurotoxin I from Buthus
occitanus
tunetanus (NCBI General Identifier No. 134335), with a pLog value of 36.70.
The amino
acid sequence set forth in SEQ ID N0:9 contains a signal sequence (amino acids
1-19) and a
mature protein (amino acids 20-84). Figure 2 presents an alignment of the
amino acid
sequences set forth in SEQ ID N0:9 and the Buthus occitanus sequence (SEQ ID
NO:10).
18
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
The amino acid sequence presented in SEQ ID N0:9 is 80.0% identical to the
Buthus
occitanus sequence.
Sequence alignments and percent identity calculations were performed using the
Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc.,
Madison, WI). Multiple alignment of the sequences was performed using the
Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the
default
parameters (KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5).
Sequence alignments and BLAST scores and probabilities indicate that the
instant nucleic
acid fragment encodes an entire scorpion neurotoxin I with its signal
sequence.
EXAMPLE S
Characterization of cDNA Clones Encoding Depressant Toxin LqhIT2
The BLASTX search using the EST sequences from clones listed in Table 5
revealed
similarity of the polypeptides encoded by the cDNAs to depressant toxin LqhIT2
from
Leiurus quinquestriatus (NCBI General Identifier No. I02796). Shown in Table 5
are the
BLAST results for individual ESTs:
TABLE 5
BLAST Results for Sequences Encoding Polypeptides Homologous
to Depressant Toxin LQHIT2
BLAST pLog Score
Clone 102796
Ist.pk0004.c8 39.75
lst.pk0013.c9 32.40
lst.pkpk0004.e8 18.85
The nucleotide sequences from the clones presented above encode entire toxins
and all
or part of the corresponding signal sequence. The amino acid sequence set
forth in SEQ ID
N0:12 contains a signal sequence (amino acids 1-2I) and a mature protein
(amino acids
22-85). The amino acid sequence set forth in SEQ ID NO:14 contains a signal
sequence
(amino acids 1-21) and a mature protein (amino acids 22-85). The amino acid
sequence set
forth in SEQ ID N0:6 contains a signal sequence (amino acids 1-19) and a
mature protein
(amino acids 20-85}.
Figure 3 presents an alignment of the amino acid sequences set forth in SEQ ID
NOs:l2, 14 and 16 and the Leiurus quinquestriatus sequence (NCBI General
Identifier
No. 102796). The data in Table 6 represents a calculation of the percent
identity of the
amino acid sequences set forth in SEQ ID NOs:12, I4 and 16 and the Leiurus
quinquestriatus sequence (SEQ ID N0:17).
19
CA 02341062 2001-02-28
WO 00/24772
TABLE 6
PCT/US99/24922
Percent Identity of Amino Acid Sequences Deduced From the Nucleotide Sequences
of cDNA Clones Encoding Polypeptides Homologous to Depressant Toxin LghIT2
Percent Identity to
SEQ ID NO. 102796
12 86.9
14 72.1
16 45.9
Sequence alignments and percent identity calculations were performed using the
Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc.,
Madison, WI). Multiple alignment of the sequences was performed using the
Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the
default
parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for
pairwise alignments using the Clustal method were KTUPLE l, GAP PENALTY=3,
WINDOW=S and DIAGONALS SAVED=S. Sequence alignments and BLAST scores and
probabilities indicate that the instant nucleic acid fragments encode three
distinct entire
scorpion depressant toxin LqhIT2 proteins with their signal sequences.
EXAMPLE 6
Expression of Chimeric Genes in Monocot Cells
A chimeric gene comprising a cDNA encoding the instant polypeptides in sense
orientation with respect to the maize 27 kD zein promoter that is located 5'
to the cDNA
fragment, and the 10 kD zein 3' end that is located 3' to the cDNA fragment,
can be
constructed. The cDNA fragment of this gene may be generated by polymerase
chain
reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers.
Cloning sites
(Nco I or Sma I) can be incorporated into the oligonucleotides to provide
proper orientation
of the DNA fragment when inserted into the digested vector pML 103 as
described below.
Amplification is then performed in a standard PCR. The amplified DNA is then
digested
with restriction enzymes Nco I and Sma I and fractionated on an agarose gel.
The
appropriate band can be isolated from the gel and combined with a 4.9 kb Nco I-
Sma I
fragment of the plasmid pML 103. Plasmid pML 103 has been deposited under the
terms of
the Budapest Treaty at ATCC (American Type Culture Collection, 10801
University Blvd.,
Manassas, VA 20110-2209), and bears accession number ATCC 97366. The DNA
segment
from pML103 contains a 1.05 kb Sal I-Nco I promoter fragment of the maize 27
kD zero
gene and a 0.96 kb Sma I-Sal I fragment from the 3' end of the maize 10 kD
zein gene in the
vector pGem9Zf(+) (promega). Vector and insert DNA can be ligated at
15°C overnight,
essentially as described (Maniatis). The ligated DNA may then be used to
transform E coli
XL1-Blue (Epicurian Coli XL-1 BlueT""; Stratagene). Bacterial transfonmants
can be
screened by restriction enzyme digestion of plasmid DNA and limited nucleotide
sequence
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
analysis using the dideoxy chain termination method (SequenaseT"" DNA
Sequencing Kit;
U.S. Biochemical). The resulting plasmid construct would comprise a chimeric
gene
encoding, in the 5' to 3' direction, the maize 27 kD zero promoter, a cDNA
fragment
encoding the instant polypeptides, and the 10 kD zero 3' region.
The chimeric gene described above can then be introduced into corn cells by
the
following procedure. Immature corn embryos can be dissected from developing
caryopses
derived from crosses of the inbred corn lines H99 and LH132. The embryos are
isolated 10
to 11 days after pollination when they are 1.0 to 1.5 mm long. The embryos are
then placed
with the axis-side facing down and in contact with agarose-solidified N6
medium (Chu
et al., (1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark
at 27°C.
Friable embryogenic callus consisting of'undifferentiated masses of cells with
somatic
proembryoids and embryoids borne on suspensor structures proliferates from the
scutellum
of these immature embryos. The embryogenic callus isolated from the primary
explant can
be cultured on N6 medium and sub-cultured on this medium every 2 to 3 weeks.
The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst Ag, Frankfurt,
Germany) may be used in transformation experiments in order to provide for a
selectable
marker. This plasmid contains the Pat gene (see European Patent Publication 0
242 236)
which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers
resistance to herbicidal glutamine synthetase inhibitors such as
phosphinothricin. The pat
gene in p35S/Ac is under the control of the 35S promoter from cauliflower
mosaic virus
(Odell et al. (1985) Nature 313:810-812) and the 3' region of the nopaline
synthase gene
from the T-DNA of the Ti plasmid of Agrobacterium fume, faciens.
The particle bombardment method (Klein et al. (1987) Nature 327:70-73) may be
used
to transfer genes to the callus culture cells. According to this method, gold
particles (I pm
in diameter) are coated with DNA using the following technique. Ten p.g of
plasmid DNAs
are added to SO p,L of a suspension of gold particles (60 mg per mL). Calcium
chloride
(50 pL of a 2.5 M solution) and spermidine free base (201tL of a 1.0 M
solution) are added
to the particles. The suspension is vortexed during the addition of these
solutions. After
10 minutes, the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the
supernatant
removed. The particles are resuspended in 200 p.L of absolute ethanol,
centrifuged again
and the supernatant removed. The ethanol rinse is performed again and the
particles
resuspended in a final volume of 30 ~L of ethanol. An aliquot (5 pL) of the
DNA-coated
gold particles can be placed in the center of a KaptonT"' flying disc (Bio-Rad
Labs). The
particles are then accelerated into the corn tissue with a BiolisticT"" PDS-
1000/He (Bio-Rad
Instruments, Hercules CA), using a helium pressure of 1000 psi, a gap distance
of 0.5 cm
and a flying distance of 1.0 cm.
For bombardment, the embryogenic tissue is placed on filter paper over agarose
solidified N6 medium. The tissue is arranged as a thin lawn and covered a
circular area of
21
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
about 5 cm in diameter. The petri dish containing the tissue can be placed in
the chamber of
the PDS-1000/He approximately 8 cm from the stopping screen. The air in the
chamber is
then evacuated to a vacuum of 28 inches of Hg. The macrocarrier is accelerated
with a
helium shock wave using a rupture membrane that bursts when the He pressure in
the shock
tube reaches 1000 psi.
Seven days after bombardment the tissue can be transferred to N6 medium that
contains gluphosinate (2 mg per liter) and lacks casein or proline. The tissue
continues to
grow slowly on this medium. After an additional 2 weeks the tissue can be
transferred to
fresh N6 medium containing gluphosinate. After 6 weeks, areas of about 1 cm in
diameter
of actively growing callus can be identified on some of the plates containing
the glufosinate-
supplemented medium. These calli may continue to grow when sub-cultured on the
selective medium.
Plants can be regenerated from the transgenic callus by first transfernng
clusters of
tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two
weeks the
1 S tissue can be transferred to regeneration medium (Fromm et al., ( 1990)
BiolTechnology
8:833-839).
EXAMPLE 7
Expression of Chimeric Genes in Dicot Cells
A seed-specific expression cassette composed of the promoter and transcription
terminator from the gene encoding the ~3 subunit of the seed storage protein
phaseolin from
the bean Phaseolus vulgaris (Doyle et al. (1986) J. Biol. Chem. 261:9228-9238)
can be used
for expression of the instant polypeptides in transformed soybean. The
phaseolin cassette
includes about 500 nucleotides upstream (5') from the translation initiation
codon and about
1650 nucleotides downstream (3') from the translation stop codon of phaseolin.
Between the
5' and 3' regions are the unique restriction endonuclease sites Nco I (which
includes the ATG
translation initiation codon), Sma I, Kpn I and Xba I. The entire cassette is
flanked by
Hind III sites.
The cDNA fragment of this gene may be generated by polymerase chain reaction
(PCR) of the cDNA clone using appropriate oligonucleotide primers. Cloning
sites can be
incorporated into the oligonucleotides to provide proper orientation of the
DNA fragment
when inserted into the expression vector. Amplification is then performed as
described
above, and the isolated fragment is inserted into a pUCl8 vector carrying the
seed expression
cassette.
Soybean embryos may then be transformed with the expression vector comprising
sequences encoding the instant polypeptides. To induce somatic embryos,
cotyledons,
3-5 mm in Length dissected from surface sterilized, immature seeds of the
soybean cultivar
A2872, can be cultured in the light or dark at 26°C on an appropriate
agar medium for
6-10 weeks. Somatic embryos which produce secondary embryos are then excised
and
22
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
placed into a suitable liquid medium. After repeated selection for clusters of
somatic
embryos which multiplied as early, globular staged embryos, the suspensions
are maintained
as described below.
Soybean embryogenic suspension cultures can maintained in 35 mL liquid media
on a
rotary shaker, 150 rpm, at 26°C with florescent lights on a 16:8 hour
day/night schedule.
Cultures are subcultured every two weeks by inoculating approximately 35 mg of
tissue into
35 mL of liquid medium.
Soybean embryogenic suspension cultures may then be transformed by the method
of
particle gun bombardment (Klein et al. (1987) Nature (London) 327:70, U.S.
Patent
No. 4,945,050). A DuPont BiolisticT"" PDS1000/HE instrument (helium retrofit)
can be used
for these transformations.
A selectable marker gene which can be used to facilitate soybean
transformation is a
chimeric gene composed of the 35S promoter from cauliflower mosaic virus
(Odell et al.
(1985) Nature 313:810-812), the hygromycin phosphotransferase gene from
plasmid pJR225
(from E. toll; Gritz et al.(1983) Gene 25:179-188) and the 3' region of the
nopaline synthase
gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The seed
expression
cassette comprising the phaseolin 5' region, the fragment encoding the instant
polypeptides
and the phaseolin 3' region can be isolated as a restriction fragment. This
fragment can then
be inserted into a unique restriction site of the vector carrying the marker
gene.
To 50 p,L of a 60 mg/mL 1 p.m gold particle suspension is added (in order): 5
p.L
DNA ( 1 p,g/p,L), 20 p,l spermidine (0.1 M), and 50 p,L CaCl2 (2.5 M}. The
particle
preparation is then agitated for three minutes, spun in a microfuge for 10
seconds and the
supernatant removed. The DNA-coated particles are then washed once in 400 ~L
70%
ethanol and resuspended in 40 wL of anhydrous ethanol. The DNA/particle
suspension can
be sonicated three times for one second each. Five pL of the DNA-coated gold
particles are
then loaded on each macro carrier disk.
Approximately 300-400 mg of a two-week-old suspension culture is placed in an
empty 60x15 mm petri dish and the residual liquid removed from the tissue with
a pipette.
For each transformation experiment, approximately 5-10 plates of tissue are
normally
bombarded. Membrane rupture pressure is set at 1100 psi and the chamber is
evacuated to a
vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches
away from the
retaining screen and bombarded three times. Following bombardment, the tissue
can be
divided in half and placed back into liquid and cultured as described above.
Five to seven days post bombardment, the liquid media may be exchanged with
fresh
media, and eleven to twelve days post bombardment with fresh media containing
50 mg/mL
hygromycin. This selective media can be refreshed weekly. Seven to eight weeks
post
bombardment, green, transformed tissue may be observed growing from
untransformed,
necrotic embryogenic clusters. Isolated green tissue is removed and inoculated
into
23
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
individual flasks to generate new, clonally propagated, transformed
embryogenic suspension
cultures. Each new line may be treated as an independent transformation event.
These
suspensions can then be subcultured and maintained as clusters of immature
embryos or
regenerated into whole plants by maturation and germination of individual
somatic embryos.
EXAMPLE 8
Expression of Chimeric Genes in Microbial Cells
The cDNAs encoding the instant polypeptides can be inserted into the T7 E.
coli
expression vector pBT430. This vector is a derivative of pET-3a (Rosenberg et
al. (1987)
Gene 56:125-135) which employs the bacteriophage T7 RNA polymerase/T7 promoter
system. Plasmid pBT430 was constructed by first destroying the EcoR I and Hind
III sites in
pET-3a at their original positions. An oligonucleotide adaptor containing EcoR
I and
Hind III sites was inserted at the BamH I site of pET-3a. This created pET-3aM
with
additional unique cloning sites for insertion of genes into the expression
vector. Then, the
Nde I site at the position of translation initiation was converted to an Nco I
site using
oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM in this
region,
5'-CATATGG, was converted to 5'-CCCATGG in pBT430.
Plasmid DNA containing a cDNA may be appropriately digested to release a
nucleic
acid fragment encoding the protein. This fragment may then be purified on a 1
% NuSieve
GTGr"" low melting agarose geI (FMC). Buffer and agarose contain 10 p,g/ml
ethidium
bromide for visualization of the DNA fragment. The fragment can then be
purified from the
agarose gel by digestion with GELaseT"" (Epicentre Technologies) according to
the
manufacturer's instructions, ethanol precipitated, dried and resuspended in 20
p,L of water.
Appropriate oligonucleotide adapters may be ligated to the fragment using T4
DNA ligase
(New England Biolabs, Beverly, MA). The fragment containing the ligated
adapters can be
purified from the excess adapters using low melting agarose as described
above. The vector
pBT430 is digested, dephosphorylated with alkaline phosphatase (NEB) and
deproteinized
with phenol/chloroform as described above. The prepared vector pBT430 and
fragment can
then be ligated at 16°C for 15 hours followed by transformation into
DHS electrocompetent
cells (GIBCO BRL). Transformants can be selected on agar plates containing LB
media and
100 pg/mL ampicillin. Transformants containing the gene encoding the instant
polypeptides
are then screened for the correct orientation with respect to the T7 promoter
by restriction
enzyme analysis.
For high level expression, a plasmid clone with the cDNA insert in the correct
orientation relative to the T7 promoter can be transformed into E. coli strain
BL21(DE3)
(Studier et al. (1986) J. Mol. Biol. 189:113-130). Cultures are grown in LB
medium
containing ampicillin (100 mg/L) at 25°C. At an optical density at 600
nm of approximately
1, IPTG (isopropylthio-~i-galactoside, the inducer) can be added to a final
concentration of
0.4 mM and incubation can be continued for 3 h at 25°. Cells are then
harvested by
24
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
centrifugation and re-suspended in SO pL of 50 mM T'ris-HCl at pH 8.0
containing 0.1 mM
DT'T and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of 1 mm glass
beads can
be added and the mixture sonicated 3 times for about 5 seconds each time with
a microprobe
sonicator. The mixture is centrifuged and the protein concentration of the
supernatant
determined. One pg of protein from the soluble fraction of the culture can be
separated by
SDS-polyacrylamide gel electrophoresis. Gels can be observed for protein bands
migrating
at the expected molecular weight.
EXAMPLE 9
Expression of Chimeric Genes in Insect Cells
IO T'he cDNAs encoding the instant polypeptides may be introduced into the
baculovirus
genome itself. For this purpose the cDNAs may be placed under the control of
the
polyhedron promoter, the IE1 promoter, or any other one of the baculovirus
promoters. The
cDNA, together with appropriate leader sequences is then inserted into a
baculovirus transfer
vector using standard molecular cloning techniques. Following transformation
of E coli
DHSa, isolated colonies are chosen and plasmid DNA is prepared and is analyzed
by
restriction enzyme analysis. Colonies containing the appropriate fragment are
isolated,
propagated, and plasmid DNA is prepared for cotransfection.
Spodoptera frugiperda cells (Sf 9) are propagated in ExCell~ 401 media
(JRH Biosciences, Lenexa, KS) supplemented with 3.0% fetal bovine serum.
Lipofectin~
(50 pL at 0.1 mg/mL, Gibco/BRL) is added to a 50 p,L aliquot of the transfer
vector
containing the toxin gene (500 ng) and linearized polyhedrin-negative AcNPV
(2.5 pg,
Baculogold~ viral DNA, Pharmigen, San Diego, CA). Sf 9 cells (approximate 50%
monolayer) are co-transfected with the viral DNA/transfer vector solution. The
supernatant
fluid from the co-transfection experiment is collected at 5 days post-
transfection and
recombinant viruses are isolated employing standard plaque purification
protocols, wherein
only polyhedrin-positive plaques are selected (O'Reilly et al. (1992),
Baculovirus Expression
Vectors: A Laboratory Manual, W. H. Freeman and Company, New York.). Sf 9
cells in
mM petri dishes (50% monolayer) are inoculated with 100 pL of a serial
dilution of the
viral suspension, and supernatant fluids are collected at 5 days post
infection. In order to
30 prepare larger quantities of virus for characterization, these supernatant
fluids are used to
inoculate larger tissue cultures for large scale propagation of recombinant
viruses.
Expression of the instant polypeptides encoded by the recombinant baculovirus
is confirmed
by bioassay.
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
SEQUENCE LISTING
<110> E. I. du Pont de Nemours and Company
<120> SCORPION TOXINS
<130> BB1208
<190>
<141>
<150> 60/105,404
<151> 1998-10-23
<160> 17
<170> Microsoft Office 97
<210> 1
<211> 228
<212> DNA
<213> Leiurus quinquestriatus
<400> 1
gtttggcact tctcttcatg acaggtgtgg agagtgtacg tgatggttat attgcccagc 60
ccgaaaactg tgtctaccat tgcattccag attgcgacac gttatgtaag gataacggtg 120
gtacgggtgg ccattgcgga tttaaacttg gacacggaat tgcctgctgg tgcaatgcct 180
tgcccgataa tgtagggatt atagttgatg gagtaaaatg tcataaag 228
<210> 2
<211> 75
<212> PRT '
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(11)
<400> 2
Leu Ala Leu Leu Phe Met Thr Gly Val Glu Ser Val Arg Asp Gly Tyr
1 5 10 15
Ile Ala Gln Pro Glu Asn Cys Val Tyr His Cys Ile Pro Asp Cys Asp
20 25 30
Thr Leu Cys Lys Asp Asn Gly Gly Thr Gly Gly His Cys Gly Phe Lys
35 40 95
Leu Gly His Gly Ile Ala Cys Trp Cys Asn Ala Leu Pro Asp Asn Val
50 55 60
Gly Ile Ile Val Asp Gly Val Lys Cys His Lys
65 70 75
<210> 3
<211> 238
<212> DNA
<213> Leiurus quinquestriatus
<400> 3
tagtttggca cttctcttca tgacaggngt ggagagtgta cgtgacggtt atattgccaa 60
gcccgaaaac tgtgcacacc attgctttcc agggtcctcc ggttgcgaca cattatgtaa 120
ggaaaacggt ggtacgggtg gccattgcgg atttaaagtt ggacatggaa ctgcctgctg 180
gtgcaatgcc ttgcccgata aagtagggat tatagtagat ggagtaaaat gccatcgc 23g
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
<210> 9
<211> 79
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(12)
<400> 4
Ser Leu Ala Leu Leu Phe GlyValGluSer ValArgAsp Gly
Met Thr
1 5 10 15
Tyr Ile Ala Lys Pro Glu AlaHisHisCys PheProGly Ser
Asn Cys
20 25 30
Ser Gly Cys Asp Thr Leu GluAsnGlyGl.yThrGlyGly His
Cys Lys
35 40 45
Cys Gly Phe Lys Val Gly ThrAlaCysTrp CysAsnAla Leu
His Gly
50 55 60
Pro Asp Lys Val Gly Ile AspGlyValLys CysHisArg
Ile Val
65 70 75
<210> 5 '
<211> 258
<212> DNA
<213> Leiurus quinquestriatus
<400> 5
atgaatcatt tggtaatgat tagtttggca tgacaggtgt 60
cttcttttca ggagagtggt
gtacgtgatg ggtatattgc ccagcccgaa accattgctt 120
aactgtgtct tccagggtcc
cccggttgcg acacattatg taaagagaac gtggccattg 180
ggtgcttcga cggatttaaa
gaaggacacg gacttgcctg ctggtgcaat ataaagtagg 240
gatctgcccg gataatagta
gaaggagaaa aatgccat 258
<210> 6
<211> 87
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(19)
<400> 6
Met Asn His Leu Val Met LeuAlaLeuLeu PheMetThr Gly
Ile Ser
1 5 10 15
Val Glu Ser Gly Val Arg TyrIleAlaGln ProGluAsn Cys
Asp Gly
20 25 30
Val Tyr His Cys Phe Pro ProGlyCysAsp ThrLeuCys Lys
Gly Ser
35 40 95
Glu Asn Gly Ala Ser Ser CysGlyPheLys GluGlyHis Gly
Gly His
50 55 60
Leu Ala Cys Trp Cys Asn ProAspLysVal GlyIleIle Val
Asp Leu
65 70 75 80
Glu Gly Glu Lys Cys His
Lys
85
2
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
<210> 7
<211> 85
<212> PRT
<213> Buthus occitanus
<400> 7
MetSerSer LeuMetIle SerThrAlaMet LysGlyLys AlaProTyr
1 5 10 15
ArgGInVal ArgAspGly TyrIleAlaGln ProHisAsn CysAlaTyr
20 25 30
HisCysLeu LysIleSer SerGlyCysAsp ThrLeuCys LysGl A
u sn
35 40
45
GlyAlaThr SerGlyHis CysGlyHisLys SerGlyHis Gl S Al
y er a
50 55
60
CysTrpCys LysAspLeu ProAspLysVal GlyIleIle ValHi
s Gly
65 70
75 80
Glu Lys
Cys His
Arg
85
<210> 8
<211> 252
<212> DNA
<213> Leiurus
quinquestriatus
<400> 8
atgaattatttggtantgat tagtttggca cttctcctcatgacaggtgta
t
gg 60
cgtgatgcttatattgccca gaactataac tgtgtatatcattgtgctttgag
gga
a
t
aa 120
tgcaacgatttatgtaccaa gaacggtgct aagagtggctattgccaat ccatat
tt
g g 180
agtggaaacgcctgctggtg catagatttg cccgataacgtaccgattaacggttca
t
ag 290
aaatgccatcgc accagga
252
<210> 9
<211> 84
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(19)
<400> 9
Met Asn Leu Val Xaa Ile Ser Leu Leu Leu
Tyr Ala Leu M
t
e Thr Gly
1 5
10 15
Val Glu Gly Arg Asp Ala Tyr Ile Asn T
Ser Ala Gln r A
y Cys Val
20 25 sn
30
Tyr His Ala Leu Asn Pro Tyr Cys Leu Cys L
Cys Asn Asp Thr
ys Asn
35 40
45
Gly Ala Ser Gly Tyr Cys Gln Trp Ser Ser A
Lys Phe Gly Gl Al
y sn
50 55 a
60
Cys Trp Ile Asp Leu Pro Asp Asn Ile Lys P
Cys Val Pro Val
ro Gly
65 70
75 80
Lys Cys His Arg
<210> 10
<211> 65
3
CA 02341062 2001-02-28
WO 00/24772
PCT/US99/24922
<212> PRT
<213> Buthus occitanus tunetanus
<400> 10
Gly Arg Asp Ala Tyr Ile Ala Gln Pro Glu Asn Cys Val Tyr Glu Cys
1 5 10 15
Ala Gln Asn Ser Tyr Cys Asn Asp Leu Cys Thr Lys Asn Gly Ala Thr
20 25 30
Ser Gly Tyr Cys Gln Trp Leu Gly Lys Tyr Gly Asn Ala Cys Trp Cys
35 40 45
Lys Asp Leu Pro Asp Asn Val Pro Ile Arg Ile Pro Gly Lys Cys His
50 55 60
Phe
65
<210> 11
<211> 256
<212> DNA
<213> Leiurus quinquestriatus
<900> 11
atgaaactct tacttttact cattgtctct gcttcaatgc tgattgaaag cttagttaat 60
gctgacggat atataagaag aaaagacgga tgcaaggttg catgcctgtt cggaaatgac 120
ggctgcaata aagaatgcaa agcttatggt gcctattatg gatattgttg gacctgggga 180
cttgcctgct ggtgcgaagg tcttccggat gacaagacat ggaagagtga aacaaacaca 240
tgcggtggca aaaagt
256
<210> 12
<211> 85
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(21)
<400> 12
Met Lys Ile Ile Ile Phe Leu Ile Val Ser Ser Leu Met Leu Ile Gly
1 5 10 15
Val Lys Thr Asp Asn Gly Tyr Leu Leu Asn Lys Ala Thr Gly Cys Lys
20 25 30
Val Trp Cys Val Ile Asn Asn Ala Ser Cys Asn Ser Glu Cys Lys Leu
35 90 45
Arg Arg Gly Asn Tyr Gly Tyr Cys Tyr Phe Trp I,ys Leu Ala Cys Tyr
50 55 60
Cys Glu Gly Ala Pro Lys Ser Glu Leu Trp Ala Tyr Ala Thr Asn Lys
65 70 75 80
Cys Asn Gly Lys Leu
<210> 13
<211> 255
<212> DNA
<213> Leiurus quinquestriatus
4
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
<400> 13
atgaaactgt tacttctgct aactatctca gcttcaatgc tgattgaagg cttagttaat 60
gctgacggat atataagagg aggcgacgga tgcaaggttt catgcgtgat aaatcatgtg 120
ttttgtgata atgaatgcaa agctgctggt ggctcttatg gatattgttg ggcctgggga 180
cttgcctgct ggtgcgaagg tcttccagct gacagggaat ggaagtatga aaccaataca 240
tgcggtggca aaaag
255
<210> 14
<211> 85
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(21)
<400> 14
Met Lys Leu Leu Leu Leu Leu Thr Ile Ser Ala Ser Met Leu Ile Glu
1 5 10 15
Gly Leu Val Asn Ala Asp Gly Tyr Ile Arg Gly Gly Asp Gly Cys Lys
20 25 30
Val Ser Cys Val Ile Asn His Val Phe Cys Asp Asn Glu Cys Lys Ala
35 40 45
Ala Gly Gly Ser Tyr Gly Tyr Cys Trp Ala Trp Gly Leu Ala Cys Trp
50 55 60
Cys Glu Gly Leu Pro Ala Asp Arg Glu Trp Lys Tyr Glu Thr Asn Thr
65 70 75 80
Cys Gly Gly Lys Lys
85
<210> 15
<211> 255
<212> DNA
<213> Leiurus quinquestriatus
<400> 15
atgaaaataa taatttttct aattgtgtca tcattaatgc tgataggagt gaagaccgat 60
aatggttact tgcttaacaa agccaccggt tgcaaggtct ggtgtgttat taataatgca 120
tcttgtaata gtgagtgtaa actaagacgt ggaaattatg gctactgcta tttctggaaa 180
ttggcctgtt attgcgaagg agctccaaaa tcagaacttt gggcttacgc aaccaataaa 240
tgcaatggga aatta
255
<210> 16
<211> 85
<212> PRT
<213> Leiurus quinquestriatus
<220>
<221> SIGNAL
<222> (1)..(19)
<400> 16
Met Lys Leu Leu Leu Leu Leu Ile Val Ser Ala Ser Met Leu Ile Glu
1 5 10 15
Ser Leu Val Asn Ala Asp Gly Tyr Ile Arg Arg Lys Asp Gly Cys Lys
20 25 30
Val Ala Cys Leu Phe Gly Asn Asp Gly Cys Asn 3.ys Glu Cys Lys Ala
35 40 45
5
CA 02341062 2001-02-28
WO 00/24772 PCT/US99/24922
Tyr Gly Ala Tyr Tyr Gly Tyr Cys Trp Thr Trp Gly Leu Ala Cys Trp
50 55 60
Cys Glu Gly Leu Pro Asp Asp Lys Thr Trp Lys Ser Glu Thr Asn Thr
65 70 75 80
Cys Gly Gly Lys Lys
85
<210> 17
<211> 61
<212> PRT
<213> Leiurus quinquestriatus
<400> 17
Asp Gly Tyr Ile Lys Arg Arg Asp Gly Cys Lys Val Ala Cys Leu Ile
1 5 10 15
Gly Asn Glu Gly Cys Asp Lys Glu Cys Lys Ala Tyr Gly Gly Ser Tyr
20 25 30
Gly Tyr Cys Trp Thr Trp Gly Leu Ala Cys Trp Cys Glu Gly Leu Pro
35 40 45
Asp Asp Lys Thr Trp Lys Ser Glu Thr Asn Thr Cys Glu
50 55 60
6
