Note: Descriptions are shown in the official language in which they were submitted.
CA 02346220 2001-05-24
CA Patent
File No. 45424.10
EI\fGINEERED BirA FOR L~V VITRO BIOTINYLATION
Inventors: Sau-Ching Wu, Sui-Lam Wong
.A major attraction to use Bacillus subtilis as an expression host for
heterologous protein
production is its capability to secrete e:Ytracellular proteins into the
culture medium. To take full
;advantage of this system, an efficient nnethod of recovering the target
protein is crucial. For
secretory proteins whi<;h cannot be purified by a simple scheme, in vitro
biotinylation using
biotin ligase (BirA) offers an effective alternative for their purification.
Availability of large
;mounts of quality Bir.A can be critical for in vitro biotinylation. We report
here the engineering
;rnd production of an E. coli BirA and its application in the purification of
staphylokinase, a
~Ebrin-specific plasminogen activator, from the culture supernatant of B.
subtilis via in vitro
biotinylation. BirA was tagged with both a chitin binding domain and a
hexahistidine tail to
facilitate both its purification and its removal from the biotinylated sample.
We show in this
paper how, in a unique way, we solved the problem of protein aggregation in
the E. coli BirA
production system to achieve a yield oj'soluble functional BirA hitherto
unreported in the
literature. Application of this novel BirA to protein purification via in
vitro biotinylation in
general will also be discussed. Biotinylated staphylokinase produced in the
study not only can act
as an intermediate for easy purification; it can also serve as an important
element in the creation
of a blood clot targeting and dissolving. agent.
"Designer affinity purification" of proteins ( 1 ), a strategy which involves
fusing the target protein
'Kith an affinity tag to facilitate its puri:6cation, is an attractive
approach for efficient purification
of target proteins from a crude preparation. Many affinity tags have been
developed for this
purpose, among which glutathione S-transferase (GST) (2), P-galactosidase (3),
maltose binding
protein (4), and biotin acceptor domains (5, 6) are more popular. Since some
of these proteins
tags are relatively large, it is not uncorrtmon for them to contribute to more
than 50% of the
molecular mass of the protein fusions and create some undesirable side
effects. For example,
CA 02346220 2001-05-24
large tags can occasionally cause solubility problem during protein production
and adversely
affect the conformation and biological activity of the target proteins (7, 8).
Moreover, use of
these tags usually requires post-purification tag removal by chemical or
enzymatic means which
can be a challenging, time-consuming and costly process and which may not be
compatible with
the target protein ( 1 ). For these reasons, small tags including His-tag (9),
strep-tag ( 10) and
biotinylation tag (11, l2) are preferred choices. Strep-tags I and II are
short peptides (9 amino
acids in length) that can bind selectively to streptavidin (Kd -10' M).
Biotinylation tags,
identified through screening of a peptide library (11, 12, 13), are peptide
tags (13-15 amino
acids) that can be biotinylated enzymatically using the E. coli biotin ligase
(BirA). Since the
affinity of both his- and strep-tags to their affinity matrices is not
particularly high, presence of
contaminants is a common problem. This shortcoming can be avoided by the use
of the
biotinylation tag since biotin binds to monomeric avidin ( 14, 15) or nitro-
avidin ( 16) with a
much higher affinity ('~d 10' to 10' M). A systematic comparison of the use of
these three tags to
purify a rat neurotensin receptor expressed in E. coli demonstrates that
biotinylation tag provides
the highest efficiency and purity ( 17;).
Recombinant proteins with biotinylation tags have commonly been biotinylated
in vivo
using endogenous BirE~ or co-overproduced BirA (6, 17, 18, 19). This approach
may not be
desirable for some applications as in vivo biotinylation has a number of
drawbacks. First,
incomplete biotinylation of the target proteins because of limited cellular
resources (BirA and
ATP) is a common occurrence (18). Limitation caused by BirA deficiency could
sometimes be
overcome by coexpressing birA (17); hawever, limitation from depletion of
intracellular ATP is
more difficult to addre~~s. In the biotinylation reaction, BirA uses ATP to
introduce the biotin
;moiety to the lysine residue on the biotinylation tag (20). Thus, all events
involved in producing
the biotinylated protein fusions in vivo (production of BirA, production of
the target protein,
enzymatic biotinylation) are highly energy-demanding processes. This may
explain why in some
eases, coexpression of BirA could only partially improve the biotinylation
efficiency with still a
ilarge amount of the target proteins remaining unbiotinylated ( 17, 18). A
second drawback with in
vivo biotinylation is thc~ presence of endogenous biotinylated proteins. For
example, E. coli has
one (biotin carboxyl carrier protein or BC:CP, a subunit of acetyl-CoA
carboxylase)(5) and B.
2
CA 02346220 2001-05-24
subtilis has two such biotinylated entities (BCCP and pyruvate
carboxylase)(21). Although these
biotinylated proteins are present as a tiny fraction of the total
intracellular proteins, the prospect
of having these contaminants in an otherwise highly pure sample is definitely
undesirable.
Finally, in vivo biotinyiation has a serious limitation: it cannot be used to
effectively biotinylate
secreted proteins since both BirA and ,ATP are intracellular. Thus, this
technique cannot be used
to exploit the full advantages of secretary production of heterologous
proteins such as ease of
protein recovery, reduced cell toxicity and absence of intracellular
biotinylated contaminants as
mentioned earlier. It may be desirable to avoid these limitations by carrying
out biotinylation in
vitro.
For in vitro biotinylation, availability of BirA can be a critical factor.
This is particularly
true if large scale protein purification via biotinylation is the goal. In
this paper, we describe the
production and characterization of an ewgineered BirA which contains a C-
terminal His-tag and
an N-terminal chitin binding domain (CBD). Both tags facilitate the
purification of this
engineered version of l3irA. In addition, the N-terminal CBD also allows the
rapid removal of
BirA from the biotinyl~ation mixture after the completion of the reaction.
This engineered BirA
was applied to biotinylate a secretary recombinant protein (staphylokinase)
from Bacillus
subtilis. The recombin;~nt staphylokinase was tagged with a biotinylation
peptide. We show that,
by coupling in vitro biotinylation with subsequent affinity purification using
monomeric avidin,
~we have been able to rc;cover a large amount of active staphylokinase in high
purity.
Construction of pET-BirA-His
lPlasmid pET-BirA-His is an expression vector to produce BirA with a C-
terminal hexahistidine
~:ag in E. coli using the T7 promoter system. E coli BirA was amplified by PCR
with E. coli
~;enomic DNA as the template and synthetic oligonucleotides ECBIRAF (S'
GGGAATTCTAAGGATAACACC(i7'GCCACTG 3') and ECBIRAB (5' GGAAGCTT
'rTGTTTTTCTGCAC'TACGCAGGG 3') as the forward and backward primers,
respectively.
The amplified product carried an EcoRI site at the 5' end and a HindIII site
at the 3' end. The
~~70-by fragment was digested with EcoRIiHmdIII and inserted in frame to pET-
29b (Novagen,
l:lSA) to give pET-Birth-His.
CA 02346220 2001-05-24
Construction of pET-C',BD-BirA-His
This vector allows the production of CBD-BirA-His in E. coli. The gene
encoding a chitin
binding domain (22) was amplified from the pCYBI plasmid carrying the CBD of
chitinase Al
(New England BioLabs, Canada) using; the forward primer CBDF (5'
CCCATATGACGAC.AAATCCTGCsTGTATCC 3') and the backward primer CBDB (5'
CCAGATCTTGAAGCTGCCACAAGGCAGGAAC 3'). The 165-by amplified product was then
~3igested by Ndel and ~iglII and inserted into pET-BirA-His. The resulting
plasmid, designated
pET-CBD-BirA-His, vvas transformed to E. coli BL21(DE3) (Novagen, USA) for
expression
;studies.
Construction of pSAK:PFB
'This is a B. subtilis vector for secretoy production of staphylokinase (SAK)
containing a C-
terminal biotinylation peptide (PFB). This vector used a strong and
constitutively expressed
promoter (P43) to drive the transcription and a B. subtilis levansucrase
signal peptide to direct
~;he secretion. The biotinylation tag wars fused translationally to secretory
staphylokinase in the
iFollowing manner. The sequence encoding PFB was fused in frame to the 3'-end
of the sak gene
in pSAK-K1, a pWB980-based vector in B. subtilis (23), by PCR with pSAK-K1 as
the template,
5' CAAGCAACAGTATTAACC 3' as the forward primer and 5'
CCAAGCTTATCGATGAT'rCCAAA C',CATTTTTTCJTG CAT
CAAGAATATGATG.AAGGGATCCAGAGCCACTAGTAGATCC 3' as the backward primer.
'Che backward primer encodes a 15-amino acid peptide with the amino acid
sequence
LHHILDAQKMV WNHR ( 1 I ). The amplified 578-by fragment was digested with
HindIII and
used to replace an equivalent fragment from HindIII digested pSAK-KI. The
resulting plasmid,
designated pSAKPFB, was transformed to B. subtilis WB800, an eight-protease
deficient strain
(;24) and the transformamts screened for the right orientation of the insert.
(ell growth
4
CA 02346220 2001-05-24
E. coli BL21 [pET-CB:D-BirA-His] was grown at 30°C', in Luria broth ( 1
% tryptone, 0.5% yeast
extract, 0.2% NaCI) containing 30 ug/ml kanamycin to 150 klett units in a
shake flask. IPTG was
then added to a final concentration of 0.1 mM and growth continued for 5-10
hours. Cell density
was measured using a Klett-Summerson photoelectric colorimeter with a green
filter (Klett Mfg.
Co., USA). B. subtilis WB800[pSAKfFB] was cultivated in super-rich medium (25)
containing
10 pg/ml of kanamycin at 37°C in a shake flask. Cells were harvested at
5-6 fours after
inoculation.
Purification of BirA
Cells of E. coli BL21 [pET-CBD-BirE1-His] were harvested by centrifugation at
10,000 x g for 5
min at 4°C. Cell pellet was resuspended in lysing buffer, disrupted
with French press and the
crude lysate was separ;~ted into the sohable and insoluble fractions by
centrifugation (20,000 x g
for 20 min). CBD-Bir~~-His in the soluble fraction was purified by either of
two schemes: metal
~:.helation chromatography or chitin affinity chromatography. For metal
chelation
~~hromatography, the lysing buffer contained 15 mM imidazole, O.SM NaCI, 0.1%
Triton X, 1
~mM phenylmethylsulfimyl fluoride (PIvISF), and 20 mM Tris-HCI, pH 8Ø
His.Bind Quick 900
partridges (Novagen, LISA) charged with NiZ+ were used as the affinity matrix.
CBD-BirA-His
was eluted stepwise with increasing imidazole concentrations (60 mM, 250 mM, 1
M imidazole)
;according to the manui:acturer's suggestions. For chitin afflinity
chromatography, cells were
llysed in buffer containing 1 M NaCI, 1 mM EDTA, 0.1 % Triton X, 5 mM (3-
mercaptoethanol, 1
mM PMSF and 20 mNf sodium phosphate, pH 7Ø The soluble cellular fraction was
loaded to a
column packed with chitin beads (New England BioLabs, Canada) equilibrated in
lysing buffer.
,After washing with 5-10 column volumes of lysing buffer followed by 20 mM
sodium acetate,
pH 5.5, CBD-BirA-His was eluted with 20 mM acetic acid, pH 3Ø
In either scheme, fractions containing pure CBD-BirA-His (confirmed by SDS-
PAGE)
were pooled, concentrated and buffer-changed to a storage solution containing
50 mM imidazole,
:p0 mM NaCI, 5% glycerol and 5 mM ~S-mercaptoethanol, pH 6.8, using Ultrafree-
4
5
CA 02346220 2001-05-24
centrifugation tubes (Millipore Corporation, USA). Pure CBD-BirA-His was
quantified by its
absorbance at 280 run using a molar e:Ktinction coefficient of 68420 M -' cm
'' (26).
Purification of SAK-PFB
Culture supernatant of B. subtilis WB800[pSAKPFB) was separated from the cells
by
centrifugation at 10,000 x g for 10 min at 4°C. SAK-PFB was
precipitated with ammonium
sulfate to 65% saturation at 4°C, desalted by dialysis, concentrated to
appropriate volume and
buffer-changed to 10 rnM Tris-HC 1, pH 8.0, using Ultrafree-4 centrifugation
tubes (Millipore
Corporation, USA). The sample was then biotinylated at 30°C for 4 hours
to overnight, using
CBD-BirA-His. The reaction mixture contained 50 mM bicine (pH 8.3), 10 mM ATP,
10 mM
magnesium acetate, SG uM biotin, and for every ml of final mix, 500 ug of SAK-
PFB and 5 ug
of purified E. coli CBD-BirA-His. following the reaction, the sample was mixed
with a small
amount of chitin bead:. to remove CBD-BirA-His. After a simple centrifugation
to remove the
chitin beads, the sample was passed over a column containing Sephadex G-25
(Amersham
Pharmacia Biotech, Canada) to remove the excess biotin. Biotinylated SAK-PFB
was separated
the unbiotinylated prol:eins by passing the sample over a monomeric avidin
agarose column
{Pierce, USA). Bound biotinylated SAK-PFB was eluted by competition with 2 mM
d-biotin.
Pure biotinylated SAK-PFB, was quantified by its absorbance at 280 nm using a
molar extinction
.coefficient of 22,900 nM'crri' (26) for calculation.
Determination of the activity of purified CBD-BirA-His
'The activity of purified CBD-BirA-1-its was compared with that of a wild type
E. coli BirA
available from a commercial source (Avidity, USA) using an ELISA method (13).
In this assay,
maltose binding protein-AviTag fusion (MBP-AviTag, Avidity, USA) was used as
the substrate.
.AviTag is a peptide tal; for efficient biotinylation ( 11 ). MBP-AviTag was
adsorbed to the wells
of a Reacti-bind malefic: anhydride activated polystyrene strip plate (Pierce,
USA). Biotinylation
was carried out at 30°(' with different amounts of enzymes and
different reaction times. The
reaction mixture contaiined 50 mM bicine (pH 8.3), 10 mM ATP, 10 mM magnesium
acetate, 50
5
CA 02346220 2001-05-24
uM biotin and BirA from different sources. Biotin ligated to the AviTag was
detected by its
interaction with streptavidin-horseradish peroxidase (Pierce, USA) using 1
step slow TMB
ELISA (3,3',5,5'-tetrarnethylbenzidine., Pierce) as the color development
reagent. A standard
curve of biotinylation reaction was established using known quantities of
fully biotinylated
MBP-AviTag (Avidity, USA). Readings were taken at end point at 450 nm using a
Bio-Tek
CERES 900 plate reader (Bio-Tek Instruments, Inc., LISA).
Matrix-assisted laser desorption ionization time-of flight (MALDI-TOF) mass
spectrometric
analyses
Protein samples in 25 mM ammonium acetate and the matrix solution of sinapinic
acid were
mixed on the MALDI plate and analyzed on a Perseptive Biosystems-(Framingham
Mass.)
Voyager-DE STR Mass spectrometer equipped with a pulsed nitrogen laser
operated at 337 nm
in a linear mode. The mass spectrometer was previously calibrated with
apomyoglobin (horse
skeletal) m/z 16952.56 and its dimer rr~/z 33905.12. These analyses were done
in Plant
Biotechnology Institute, National Research Council of Canada, Saskatoon,
Canada.
Other methods
Vent DNA polymerase: (New England BioLabs, Canada) was used for all DNA
amplification
reactions. The sequence of all PCR products was confirmed to be free of PCR
errors by
nucleotide sequencing based on the dideoxy method using a T7 sequencing kit
from Amersham
lPharmacia Biotech, Canada. SDS-polyacrylamide gel electrophoresis followed
standard
procedure based on the Laenimli system. Western blot was done on a
nitrocellulose membrane
using 4-chloro- 1 -naphthol (Bio-Rad, Canada) as the color development
reagent. SAK activity
was determined by radial caseinolysis assay on plasminogen-skim milk agarose
plate (27).
Results
Production of E. coli CBD-BirA-His using the pET expression system.
CA 02346220 2001-05-24
In this study, an IPT(r-induced expression of BirA in a pE'T-29b based vector
was used
for intracellular producaion of E. coli (:BD-BirA-His in BL21(DE3). CBD-BirA-
His (with both
CBD- and His-tags) produced migrated as a 40-kDa protein on the SDS gel (Fig.
1). The
presence of the His-to~; was found to complicate the production because, at a
growth temperature
of 30°C, 90% of CBD-BirA-His accunnulated as inclusion bodies (Fig. 1A,
lanes 1 and 2). In
contrast, over 80% of CBD-BirA (no His tag) produced under the same
cultivation condition was
in the soluble form (data not shown). 'l'o address the solubility problem,
different measures were
taken. These include lowering the growth temperature from 30°C
downwards, lowering the salt
.concentration in the culture medium, varying the IPTC~ levels, and modifying
the cellular
.osmotic environment with the use of sorbitol and betaine during cell growth
(28). These
measures at best yielded marginal improvement with still more than 70% of CBD-
BirA-His
present as insoluble aggregates. However, supplementing the culture medium
with 10-20 uM
biotin not only enhanced the growth rate of the culture (data not shown) but
also conspicuously
vpromoted solubility of CBD-BirA-His with about 40% of the protein in the
soluble fraction (Fig.
1 A, lanes 3 and 4; Fig. 1 B, lanes 1 and 2). Moreover, whereas temperature
lowering by itself
~iid not effectively solve the problem of inclusion body formation, a measure
combining biotin
supplementation and temperature lowering (25°C, post-induction)
enhanced BirA solubility
significantly. Typically, 70-90% of BirA produced under this condition was in
the soluble form
( Fig 1B, lanes 3 and 4), amounting to about 100 mg of soluble CBD-BirA-His
per liter of
culture.
l~,ngineered E. coli Bir,A could be purified with simple manipulations
CBD-BirA-His was equipped with two tags: a 6-amino-acid histidine tag preceded
by an 8-
amino-acid linker and ;~ 53-amino-acid chitin binding domain followed by an 18-
amino-acid
linker. These tags allow rapid purification of the protein by either scheme:
metal chelation or
chitin affinity chromatography. Fig. '2A shows the purification of CBD-BirA-
His using a Niz+
chelation column. CBI)-BirA-His bound to the column effectively with
essentially no loss in the
slow-through fractions (lane 2). Reasonably pure fractions (over 80% purity)
were recovered by
8
CA 02346220 2001-05-24
elution with imidazole (lanes 3-5). C..'BD-BirA-His in these fractions could
be further purified to
over 95% purity by repeatedly reloading the purified CBD-BirA-His to the Ni2+
chelation
column. The chitin affinity scheme was more efficient. CBD-BirA-His bound to
the chitin
column with high affinity and great specificity with no CBD-BirA-His
detectable in the flow-
through and washes (Fig. 2B, lanes 2 and 3). A single-column operation was
usually adequate to
recover CBD-BirA-His with over 95%~ purity (Fig. 2B, lane 4). Chitin affinity
chromatography,
however, has a major drawback. About 40-50% of the CBD-BirA-His tended to be
retained on
the column and could not be recovered) even with extensive washes and elutions
at low pH.
Despite this drawback. we have been able to recover 1.5-2 mg of highly pure
CBD-BirA-His
from 100 ml of shake flask culture using the chitin column, representing an
overall recovery
yield of 15-20%. The recovery rate with the metal chelation scheme (involving
three cycles of
Ni' chelation column) ro purify CBD-BirA-His with over 95% purity is similar.
Purified engineered BirA demonstrated high biological activity
Activity of CBD-BirA-His was determined by its ability to biotinylate maltose
binding protein
'tagged with a short biotinylation peptide designated AviTag (I 1) in an ELISA
study. With
vunbiotinylated MBP-A.viTag as the substrate using parameters (amount of
enzyme used and
reaction time) that ensured a linear rate of enzymatic reaction, the activity
of CBD-BirA-His
purified from either scheme was found to be 50% more active than that of the
natural E. coli
BirA from a commercial source (Table I ).
'Table I . Activity of BirA from different sources
Source of BirA Specific ActivityRelative Activity
~
Metal chelation'40.2 1.48
Chitin affinity242.7 I .58
Commercial3 27.1 1
Activity of BirA was determined by ELISA method (13) using unbiotinylated MBP-
AviTag
(Avidity, USA) as the substrate. Specific activity of BirA is defined as ng
biotinylated MBP-
9
CA 02346220 2001-05-24
AviTag formed per min per tzg of enzyme at 30°C. 'CBD-BirA-His purified
by metal chelation
chromatography. ''CBD-BirA-His purified by chitin affinity scheme. 3Wild type
E. coli BirA
obtained from a commercial supplier (Avidity, I1SA). Data represent the
average of two
independent trials.
This shows that the BirA engineered, produced and purified using our
purification scheme is of
high quality. The presence of His-tag has little effect on the biological
activity of the purified
enzyme as CBD-BirA and CBD-BirA-flis exhibited similar specific activities on
biotinylation of
MBP-AviTag (data not shown). 'The readiness of CBD-BirA-His to biotinylate
proteins with a
biotinylation tag was also demonstrated in a Western blot analysis (Fig. 3).
Two test proteins
were used as examples: MBP-AviTag and staphylokinase tagged with another
biotinylation tag
designated PFB. Probing with streptavidin-horseradish peroxidase showed
biotinylation of both
proteins with BirA (Fi;~. 3B, lanes 1 arid 2).
Engineered BirA is active in a fairly broad pH range
'The pH activity profile of CBD-BirA-1-Iis was established with an ELISA study
similar to the
one used for the determination of its biotinylation activity. Different
reagents were used to
provide buffering capacity for a broad pH range (see legend to Fig. 4). MBP-
AviTag was used as
'the substrate. Fig. 4 shows that CBD-I?~irA-His had a pH optimum around 6.5.
It retained a fairly
thigh activity at pH 5.5-8.3, but the activity dropped substantially at either
ends. This information
would be useful for one to tailor an optimal condition for in vitro
biotinylation with this enzyme.
'To our knowledge, the pH activity proitile of natural E. call BirA has not
been systematically
studied before.
Secretory production of staphylokinase-PFB from B. subtilis
'to explore the possibility of purifying a secretory fusion protein carrying a
biotinylation tag
i~rom a B. subtilis culture supernatant via in vitro biotinylation using the
engineered BirA,
staphylokinase (SAK), a very promising blood clot dissolving agent (29), was
used as a model
CA 02346220 2001-05-24
system. A 15-amino-acid biotinylation tag (PFB) was added to the C-terminal
end of SAK
containing an 18-amino-acid C-terminal linker sequence [(GSTSG)3SGS]. Addition
of the linker
and the biotinylation tag did not affect the secretory production yield of SAK-
PFB since SAK
with or without PFB was produced at ;~ comparable level (Fig. 5A, lanes 1 and
2). When
analyzed by SDS-PACiE, SAK-PFB showed an apparent molecular mass of 21 kDa.
The
calculated molecular mass of SAK-PFB is 18,862 Da. To confirm that the intact
form of SAK-
PFB was produced from B. subtilis, the molecular mass of SAK-PFB was
determined by
MALDI-TOF mass spectrometry. The observed molecular mass matched closely with
the
expected value and was determined to be 18,861.22 Da (data not shown).
Functional SAK-PFB could be purified via in vitro biotinylation using the
engineered BirA
After concentrated from the culture supernatant, SAK-PFB was biotinylated in
vitro using
purified CBD-BirA-His. The rate of biotinylation depends, among other
variables, on the amount
of enzyme used for the reaction. As SAK-PFB is fairly stable, biotinylation
could be carried out
using varying amounts of enzyme from several hours to overnight with no
apparent adverse
effect. Biotinylated SA.K-PFB, with an apparent molecular mass of 21.5 kDa on
the SDS gel,
emigrated more slowly than its unbiotinylated counterpart (Fig. 5A, lane 3 vs.
lane 2, Fig. 6, lane
2 vs. lane 1). This allows us to easily monitor the extent of biotinylation.
In all biotinylation runs
;attempted so far, over !~5% biotinylation of SAK-PFB could be achieved as
demonstrated by the
s~bsence of any significant amount of SAK-PFB in the flow-through or washes of
the monomeric
;~vidin agarose column (Fig. 6, lanes 3 and 4). The completion of
biotinylation was also
remonstrated by the M:ALDI-TOF mass spectrometric analysis. The peak with the
expected
molecular mass corresponding to the unbiotinylated form of SAK-PFB disappeared
completely
i.n the biotinylated sample while a new peak with the expected molecular mass
corresponding to
l:he biotinylated form appeared (data not shown). Biotinylated SAK-PFB could
be effectively
purified using a monorneric avidin agarose column with remarkable specificity
(Fig. 6, lanes
:>-7). We have been able to recover about 450 ~g of highly pure SAKPFB from a
crude sample
containing 600 ug of SAK-PFB on a single column, representing an overall yield
of 75%. SAK-
1?FB purified by this method showed full biological activity as compared with
both the
11
CA 02346220 2001-05-24
unbiotinylated form and the natural, untagged SAK on a plasminogen assay ml of
B. subtilis
culture.
Discussion
'To capture the full advantages of in vitro biotinylation, a ready source of
easily purified, high
quality BirA is needed. In this study, we addressed this concern by
engineering an E. coli BirA
with a different tag at each end (CBD-l~irA-His). These tags enable easy
recovery of the protein
by simple column manipulations. Use of the His-tag allows a one-step recovery
of large amounts
of reasonably pure Bir.A, while use of t:he CBD enables, again, a single-
column recovery of a
llesser quantity of ultrapure BirA. These two grades of BirA can be found
useful in different
applications. For example, reasonably pure BirA can be used to biotinylate a
crude extract (such
as the secreted fraction) as other contaminants can be removed later via the
monomeric avidin
step. On the other hand, ultrapure BirA. is critical in the biotinylation of
pure proteins (such as
affinity-purified single chain antibodies). Besides the tag advantage, the
production yield and
quality of our engineered BirA compare favourably with the literature data. By
supplementing
t:he medium with biotin and lowering the post-induction temperature to
25°C, the soluble
CBD-BirA-His reached a level of 100 nng per liter of culture. This level is
double the amount of
GST-BirA reported previously (30). Moreover, the specific activity of CBD-
BirAHis was found
to be more than that of the natural BirA from a commercial source. In one
study involving
GST-BirA (30), thrombin was applied to cleave off GST from the fusion and the
resulting BirA
showed a comparable activity similar to that of the wild type BirA. In another
case (19),
esST-BirA, used uncleaved, was shown to retain biotin ligase activity but the
specific activities
of the fused and non-fused versions were not studied.
Several interesting and important observations were made during the
development of the
engineered BirA. First, supplementation of biotin in the culture medium could
help reduce the
formation of inclusion bodies. Biotin was commonly included in the culture
medium in in vivo
biotinylation studies involving the E. c~li system since E. coli has been
shown to uptake biotin
via an active transport mechanism (31 ). In those studies, biotin served
mainly as one of the
12
CA 02346220 2001-05-24
substrates for BirA in the biotinylation reaction. Our observation in this
work suggests that being
a substrate, biotin can also possibly enhance the proper folding of BirA in
favour of soluble
protein formation. Second, presence of small tags at both ends of BirA does
not materially affect
the biological activity of BirA as a biotin ligase. We designed two small
affinity tags for the
BirA: a 53-amino acid chitin binding domain and a 6-amino acid His-tag. The
engineered BirA,
used as such, demonstrated a higher specific activity than that of the natural
BirA (from a
commercial source). This shows that the engineered BirA retained good
biological activity
through the purification procedure and, unlike some large tags, can be used
uncleaved. Third,
although CBD-BirA could be produced as a soluble enzyme in large quantities,
addition of a
short C-terminal His-tag severely reversed the situation with the problematic
formation of
inclusion aggregates. This shows that t:he use of small tags does not
guarantee that the system
will work as expected. Even if the tags do not affect biological activity of
the target protein,
.complications like prooein insolubility during production can arise and have
to be addressed
.accordingly.
'Two interesting observations were also made during the purification of the
biotinylated proteins.
Occasionally, we detected a biotin-Bir.A complex in Western blot probed with
;~treptavidin-horseradish peroxidase even though the sample had been boiled in
the presence of
SDS before loading to the SDS-polyacrylamide gel. This complex is likely to be
the tight entity
i;Kd = 7 x 10-") formed between BirA .and biotinoyl-5'-AMP, an intermediate in
the biotinylation
reaction carried out by BirA (32). The presence of this complex means that
postbiotinylation
removal of BirA is necessary not only when pure target protein is involved but
also when crude
sample is used for biotinylation. The installation of the N-terminal CBD in
CBDBirA-His allows
rapid removal of BirA by the use of chitin beads. In the purification of
SAKPFB, CBD-BirA-His
was removed by chitin bead treatment in a simple centrifugation step to avoid
the potential
problem of contamination. Thus, the tags on CBD-BirA-His facilitate not only
purification of
CBD-BirA-His but also removal of C'.I?~D-BirA-His from the postbiotinylation
reaction mixture.
Another interesting observation is that the biotinylated protein exhibited a
small mobility shift on
the SDS gel. This has a practical application for the biotinylation of small
target proteins as one
13
CA 02346220 2001-05-24
may be able to monitor the extent of biotinylation, easily by SDS-PAGE. This
method worked
well for SAK-PFB wil:h a molecular mass of 19 kDa.
In vitro biotinylation offers a general tool to affinity purify secretory
proteins not only
from E. coli but also from other organiisms such as B. subtilis. This approach
is most valuable for
the purification of proi:eins (e.g. staphylokinase) which cannot be recovered
by other affinity
purification methods and which require multiple chromatographic steps for
their purification. As
demonstrated in this study, addition of the biotinylation tag to
staphylokinase affected neither the
production yield nor the biological activity of staphylokinase and intact SAK-
PFB could be
produced as confirmed by mass spectrometric analysis. This system works best
when the target
protein has a high-level expression, thc~ fusion is stable, and protease
activity is absent. The high
efficiency biotinylation achieved with our SAK-PFB study may be attributed to
the remarkable
secretory yield of SAK; in B. subtilis (over 100 mg/I in a shake flask) (3 3),
the stability of SAK-
PFB, and the use of an eight-protease deficient strain which has been shown to
dramatically
enhance the yield (24) and stability (unpublished data) of some secretory
proteins in B. subtilis.
The high efficiency biotinylation, coupled with the high capacity of monomeric
avidin with its
exceptional affinity and specificity to biotin, contributes to a remarkable
recovery of quantitative
.amounts of distinctly pure staphylokinase. This approach can be applied to
other secretory
proteins from B. subtilis.
Besides protein purification, the homogeneous biotinylated products made
possible by the
1'aighly selective, site-specific action of ('.BD-BirA-His on the
biotinylation tag offers many other
;applications. They serve as agents in immunoassays, drug delivery, imaging
and targeting (34, 3
:>, 36, 37). Biotinylated proteins can also be immobilized in an orientation-
specific manner (38)
to generate protein or antibody biochips for surface plasmon resonance based
biosensor
measurements (39, 40), active electronic microchips for biomolecule detection
and quantification
I 41 ), and high density protein microarrays for high throughput proteomics
studies (42).
14
CA 02346220 2001-05-24
References:
The following references are incorporated herein as if reproduced in their
entirety.
1. Sharma, S. K. (1997) Designer affinity purifications of recombinant
proteins in "Affinity
Separations: a practical approach" (Matejtschuk, P., Ed.), pp. 197-218, IRL
Press,
Oxford.
2. Smith, D. B., and Johnson, K. .S. (1988) Single-step purification of
polypeptides
expressed in Escherichia coli as fusions with glutathione S-transferase. Gene
67, 31-40.
3. Hirel, P. H., Le:veque, F., Mellot, P., Dardel, F., Panvert, M., Mechulain,
Y., and Fayat,
G. (1988) Genf;tic engineering of methionyl-tRNA synthetase: in vitro
regeneration of an
active synthetase by proteolytic; cleavage of a methionyl-tRNA synthetase-beta-
galactosidase chimeric protein. Biochimie 70, 773-782.
4. Sachdev, D., and Chirgwin, J. A (2000) Fusions to maltose-binding protein:
control of
folding and solubility in protein purification. Methods EnzymoL 326:312-321.
5. Cronan, J. E., Jr. (1990) Biotination of proteins in vivo: a post-
translational modification
to label, purify and study proteins. J.BioI~ Chem. 265, 10327-10333.
6. Cronan, J. E., Jr., and Reed, K. E. (2000) Biotinylation of proteins in
vivo: a useful
posttranslational modification for protein analysis. Methods EnzymoL 326, 440-
458.
7. Yu, L., Deng, ><:., and Yu, C. A. (1995) Cloning, gene sequencing, and
expression of the
small molecular mass ubiquinone-binding protein of mitochondrial ubiquinol-
cytochrome
c reductase. JBi.oLChem. 270,25634-25638.
CA 02346220 2001-05-24
8. Corchero, J. L.., Viaplana, E., H'~enito, A., and Villaverde, A. (1996) The
position of the
heterologous domain can influence the solubility and proteolysis of beta-
galactosidase
fusion proteins in E. coli. J Biotechnol 48, 191-200.
9. Bornhorst, I A., and Falke, J. J. (2000) Purification of proteins using
polyhistidine
affinity tags. Methods Enzymol 326, 245-254.
10. Skerra, A., and Schmidt, T. U. (2000) Use of the Strep-Tag and
streptavidin for detection
and purification of recombinant proteins. Methods Enzymol 326, 271-304.
11. Schatz, P. I (1~~93) Use of peptide libraries to map the substrate
specificity of a peptide-
modifying enzyme: a 13 residue consensus peptide specifies biotinylation in
Escherichia
coli. Biotechnology (N. Y.) 1 l, 1 13 8-1143.
12. Beckett, D., Kovaleva, E., and Schatz, P. 1 (1999) A minimal peptide
substrate in biotin
holoenzyme sy:nthetase-catalyzed biotinylation. Protein Sci. 8, 921-929.
13. Cull, M. G., and Schatz, P. J. (2000) Biotinylation of proteins in vivo
and in vitro using
small peptide tags. Methods Enzymol. 326, 430-440.
14. Henrikson, K. P., Allen, S. H., and Maloy, W. L. (1979) An avidin monomer
affinity
column for the purification ok~b~iotin-containing enzymes. Anal.Biochem. 94,
366-370.
15. Kohanski, R. ~~., and Lane, M. D. (1990) Monovalent avidin affinity
columns. Methods
Enzymol. 184,194-200.
16. Morag, E., Bayer, E. A., and V~lilchek, M. (1996) Immobilized nitro-avidin
andnitro-
streptavidin as :reusable affinity matrices for application in avidin-biotin
technology.
Anal.Biochem. 243, 257-263.
16
CA 02346220 2001-05-24
17. Tucker, J., and Grisshammer, R. ( 1996) Purification of a rat neurotensin
receptor
expressed in Escherichia coli. Biochem.J 317, 891-899.
18. Chapman-Smith, A., Turner, L). L., Cronan, J. E., Jr., Morris, T. W., and
Wallace, J. C.
( 1994) Expression, biotinylation and purification of a biotin-domain peptide
from the
biotin carboxyl carrier protein of Escherichia coli acetyl-CoA carboxylase.
Biochem.J
302, 881-887.
19. Saviranta, P., Haavisto, T., Ra~ppu, P., Karp, M., and I,ovgren, T. (1998)
In vitro
enzymatic biotinylation of recombinant Fab fragments through a peptide
acceptor tail.
Bioconjug. Chem. 9,725-735.
20. Chapman-Smith, A., and Cronan, J. E., Jr. ( 1999) The enzymatic
biotinylation of
proteins: a post-translational modification of exceptional specificity. Trends
Biochem.Sci.
24, 359363.
21. Marini, P., Li, S. J., Gardiol, D., Cronan, J. E., Jr., and De Mendoza, D.
(1995) The
genes encoding the biotin carboxyl carrier protein and biotin carboxylase
subunits of
Bacillus subtilis acetyl coenzynne a carboxylase, the first enzyme of fatty
acid synthesis.
J.Bacteriol. 177, 7003-7006.
22. Watanabe, T., Ito, Y., Yamada, I'., Hashimoto, M., Sekine, S., and Tanaka,
H. (1994)
The roles of the; C-terminal domain and type III domains of chitinase A1 from
Bacillus
circulans WL- l2 in chitin degradation. J.Bacteriol. 176, 4465-4472.
23. Wu, S.-C., and Wong, SA. ( 1999) Development of improved pUB 110-based
vectors for
expression and secretion studies in Bacillus subtilis. J.Biotechnol. 72, 185-
195.
17
CA 02346220 2001-05-24
24. Wit, S.-C., Yeung, J. C., Szarka, S. J., and Wong, S.-L. (2000) Functional
production
and characterization of a fibrin specific single-chain antibody fragment from
Bacillus
subtilis. 11th International conference of antibody engineering, San Diego,
California.
25. Halting, S. M... Sanchez-Anzaldo, F. J., Fukuda, R., Doi, R. H., and
Meares, C. F. ( 1977)
Zinc is associated with the beta subunit of DNA dependent RNA polymerase of
Bacillus
subtilis. Biochemistry 16, 2880-2884.
26. Gill, S. C., and Von Hippel, P. H. (1989) Calculation of protein
extinction coefficients
from amino acid sequence data. Anal.Biochem. 182, 319-326.
27. Wu, X-C., Ye, R., Duan, Y., and Wong, S.-L. (1998) Engineering of plasmin-
resistant
forms of streptokinase and thei.° production in Bacillus subtilis:
streptokinase with longer
functional half life. Appl.Environ.Microbiol. 64, 824-829.
28. Blackwell, J. P:., and Horgan, R. ( 199 1 ) A novel strategy for
production of a highly
expressed recombinant protein in an active form. FEBS Lett. 295, 10-12.
29. Collen, D. (19!8) Staphylokinase: a potent, uniquely fibrin-selective
thrombolytic agent.
Nat.Med. 4,279-284.
30. O'dallaghan, C. A., Byford, M. F., Wyer, J. R., Willcox, B. E., Jakobsen,
B. K.,
Mcmichael, A. J., and Bell, J. 1. (1999) BirA enzyme: production and
application in the
study of membrane receptor-ligand interactions by site-specific biotinylation.
Anal.Biochem. 266, 9-15.
31. Piffeteau, A., and Gaudry, M. (1985) Biotin uptake: influx, efflux and
countertransport
in Escherichia c;oli K 12. Biochem.Biophy.Acta 816, 77-82.
18
CA 02346220 2001-05-24
32. Xu, Y., and Beckett, D. (1994;1 Kinetics of biotinyl-5'-adenylate
synthesis catalyzed by
the Escherichia coli repressor of biotin biosynthesis and the stability of the
enzyme-product complex. Biochemistry 33, 7354-7360.
33. Ye, R., Kim, J. H., Kim, B. G., Szarka, S., Sihota, S., and Wong, S.-L.
(1999) High-level
secretory production of intact, lbiologically active staphylokinase from
Bacillus subtilis.
Biotechnol.Bioeng. 62, 87-96.
34. Wilchek, M., and Bayer, E. A. ( 1988) The avidin-biotin complex in
bioanalytical
applications. Anal.Biochem. 171, 1-32.
35. Yao, Z., Zhang, M., Kobayashi, H., Sakahara, H., Nakada, H., Yamashina, L,
and
Konishi, J. (19!5) Improved targeting of radiolabeled streptavidin in tumors
pretargeted
with biotinylatc~d monoclonal antibodies through an avidin chase Improved
targeting of
radiolabeled streptavidin in tumors pretargeted with biotinylated monoclonal
antibodies
through an avidin chase. J.Nucl..Med. 36, 837-84 1.
36. Ohno, K., Levin, B., and Meruelo, D. (1996) Cell-specific, multidrug
delivery system
using streptavidin-protein A fusion protein. Biochem.Md.Med. 58, 227-23 3.
37. Smith, I S., Ke:ller, J. R., Lohrey, N. C., McCauslin, C. S., Ortiz, M.,
Cowan, K., and
Spence, S. E. (:1999) Redirected infection of directly biotinylated
recombinant adenovirus
vectors through cell surface receptors and antigens. Proc.Natl.Acad.Sci.U.S.A.
96, 8855-
8860.
38. Turkova, J. (1999) Oriented immobilization of biologically active proteins
as a tool for
revealing proteiin interactions and function. J Chromatogr.B Biomed.Sci.AppL
722, 11-3
1.
19
CA 02346220 2001-05-24
39. Myszka, D. G. (1997) Kinetic analysis of macrornolecular interactions
using surface
plasmon reson~~nce biosensors. ('urr. Opin.Biotechnol. 8, 50-57.
40. Schultz, J., Lin, Y., Sanderson, J., Zuo, Y., Stone, D., Mallett, R.,
Wilbert, S., and
Axworthy, D. (2000) A tetravalent single-chain antibody-streptavidin fusion
protein for
pretargeted lymphoma therapy.. Cancer Res. 60, 6663-6669.
41. Ewalt, K. L., Haigis, R. W., Rooney, R., Ackley, D., and Krihak, M. (2001)
Detection of
Biological Toxins on an Active Electronic Microchip. Anal.Biochem. 289, 162-
172.
42. Cahill, D. J. (2;001 ) Protein and antibody arrays and their medical
applications.
J.Immunol.Methods 250, 81-9 1.
CA 02346220 2001-05-24
Figure legends Fig. I
Effects of (A) biotin and (B) growth temperature on the distribution of CBD-
BirA-His in the
intracellular fractions of E coli. (A) Cultures were grown at 30°C
throughout. Lanes 1 and 2: no
biotin added to culture medium. Lanes 3 and 4: biotin added at 12 uM to
culture medium. (B)
Growth medium contained 12 uM biotin for all samples. Lanes I and 2: cultures
grown at 30°C
throughout. Lanes 3-6: cultures grown at 30°C and shifted to
25°C post IPTG induction. Lanes
1-4: E. coli BL21(DE3;)[pET-CBD-Bir.A-His]; Lanes 5 and 6: negative control,
E. coli
BL21 (DE3)[pET29b]. Samples were analyzed on a 10% SDS-polyacrylamide gel and
stained by
Coomassie blue. M: molecular weight marker; S: soluble fraction; I: insoluble
fraction. Arrow
indicates CBD-BirA-His.
Fig. 2
:Purification of E. coli CBD-BirA-His using (A) Ni2+ column and (B) chitin
affinity column. (A)
'.Lane 1: crude lysate. Lane 2: column flow-through. Lanes 3: eluates (60 mM
imidazole). Lane 4:
eluate (250 mM imida;~ole). Lane 5: elvate (yM imidazole). (B) Lane 1: crude
lysate. Lane 2:
~~olumn flow-through. :Lane 3: pooled washes (2-column volumes). Lane 4:
eluate. Samples were
analyzed on a 10% SDS-polyacrylamide gel. M: molecular weight marker. Arrow
indicates
CBD-BirA-His.
l~ ig. 3
1?rotein biotinylation using CBD-BirA-flis purified on chitin affinity column,
(A) Coomassie
blue-stained gel. (B) Vfestern blot probed with streptavidin-horseradish
peroxidase using
~l-chloro- 1 -naphthol (Bio-Rad, Canada) as the color development reagent.
Samples were
analyzed on a 12% SDS gel. M: molecular weight marker. Lane I : MBP-AviTag
(Avidity) as the
substrate; Lane 2: SAK: with 15-mer biotinylation peptide tag as the
substrate. Biotinylation
reaction was carried ou.t at 30°C for ? l~crurs using 1 ~g of the
substrate, 50 ng of CBD-BirA-His
and other components :in the reaction mixture as described in Materials and
Methods.
21
CA 02346220 2001-05-24
Fig. 4
pH profile of engineered E coli CBD-BirA-His. 100 ng of unbiotinylated MBP-
AviTag
(Avidity, USA) was coated on the wellls of Reacti-bind malefic: anhydride
activated polystyrene
strip plate (Pierce, US~~) to act as the substrate. Reaction mixture contained
10 mM ATP, 10 mM
magnesium acetate, 50~ uM biotin and 10 ng CBD-BirA-His purified by chitin
affinity
chromatography. Biotinylation reaction was carried out at 30°C for 20
min. Bound biotin was
detected by streptavidin-horseradish pf~roxidase (Pierce) with 1-step slow TMB-
ELISA (Pierce)
as the color development reagent. The following buffers were used at 50 MM to
provide
buffering capacity for ;~ pH range 2.5 - I 1: glycine (2.5), NaAc (4.5), MES
(5.5), BIS-TRIS (6.5),
TRIS-HCl (7.5), bicinE; (8.3, 9), CAPS ( 10, 11 ). Data represent the average
of three independent
trials.
Fig. 5
~Staphylokinase activity as determined by the radial caseinolysis assay. (A)
Coomassie blue-
;~tained SDS gel showing SAK produced by B. subtilis. Amounts of samples
loaded on the lanes
'were normalized to cell density. M: molecular weight marker. Lane 1: natural,
untagged SAK
iproduced by WB800[pSAKP] (33). Lane 2: unbiotinylated SAK-PFB produced by
WB800[pSAKPFB]. Lane 3: purified biotinylated SAK-PFB produced by
WB800[pSAKPFB].
Lane 4: negative control WB800[pWB980]. (B) SAK activity was estimated using
the top
;rgarose plasminogen-skim milk plate method. The amounts of SAK in the
individual wells were
identical to those in the corresponding lanes shown in (A). Picture was taken
at 10 hours after
incubation at 37°C. Nu.inbers 1-4 correspond to the numbering in (A).
l~ fig. 6
1?urification of SAK-PFB from the culture supernatant of B. subtilis
WB800[pSAKPFB] by in
vitro biotinylation and monomeric avidin agarose chromatography. Samples were
analyzed on a
22
CA 02346220 2001-05-24
12% SDS polyacrylameide gel and stained by Coomassie blue. M: molecular weight
marker. Lane
1: ammonium sulfate precipitate before biotinylation. Lane 2: ammonium sulfate
precipitate after
biotinylation. Lane 3: column flow-through. Lane 4: 1-column volume wash.
Lanes 5 and 6:
eluate. Lane 7: concentrated pure SAK-PFB.
23
