Note: Descriptions are shown in the official language in which they were submitted.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 1 -
A NOVEL METHOD OF DIAGNOSING,
MONITORING, STAGING, IMAGING AND TREATING LUNG CANCER
FIELD OF THE INVENTION
This invention relates, in part, to newly developed
assays for detecting, diagnosing, monitoring, staging,
prognosticating, imaging and treating cancers, particularly
lung cancer.
BACKGROUND OF THE INVENTION
Lung cancer is the second most prevalent type of cancer
for both men and women in the United States and is the most
common cause of cancer death in both sexes. Lung cancer can
result from a primary tumor originating in the lung or a
secondary tumor which has spread from another organ such as
the bowel or breast. Primary lung cancer is divided into
three main types; small cell lung cancer; non-small cell lung
cancer; and mesothelioma. Small cell lung cancer is also
called "Oat Cell" lung cancer because the cancer cells are a
distinctive oat shape. There are three types of non-small cell
lung cancer. These are grouped together because they behave
in a similar way and respond to treatment differently to small
cell lung cancer. The three types are squamous cell
carcinoma, adenocarcinoma, and large cell carcinoma. Squamous
cell cancer is the most common type of lung cancer. It
develops from the cells that line the airways. Adenocarcinoma
also develops from the cells that line the airways. However,
adenocarcinoma develops from a particular type of cell that
produces mucus (phlegm). Large cell lung cancer has been thus
named because the cells look large and rounded when they are
viewed under a microscope. Mesothelioma is a rare type of
cancer which affects the covering of the lung called the
pleura. Mesothelioma is often caused by exposure to asbestos.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 2 -
Secondary lung cancer is cancer that has started
somewhere else in the body (for example, the breast or bowel)
and spread to the lungs. Choice of treatment for secondary
lung cancer depends on where the cancer started. In other
words, cancer that has spread from the breast should respond
to breast cancer treatments and cancer that has spread from
the bowel should respond to bowel cancer treatments.
The stage of a cancer indicates how far a cancer has
spread. Staging is important because treatment is often
decided according to the stage of a cancer. The staging is
different for non-small cell and for small cell cancers of the
lung.
Non-small cell cancer can be divided into four stages.
Stage I is very localized cancer with no cancer in the lymph
nodes. Stage II cancer has spread to the lymph nodes at the
top of the affected lung. Stage III cancer has spread near
to where the cancer started. This can be to the chest wall,
the covering of the lung (pleura), the middle of the chest
(mediastinum) or other lymph nodes. Stage IV cancer has
spread to another part of the body.
Since small cell lung cancer can spreads quite early in
development of the disease, small cell lung cancers are
divided into only two groups. These are: limited disease,
that is cancer that can only be seen in one lung and in nearby
lymph nodes; and extensive disease, that is cancer that has
spread outside the lung to the chest or to other parts of the
body. Further, even if spreading is not apparent on the
scans, it is likely that some cancer cells will have broken
away and traveled through the bloodstream or lymph system.
To be safe, it is therefore preferred to treat small cell lung
cancers as if they have spread, whether or not secondary
cancer is visible. Because surgery is not typically used to
treat small cell cancer, except in very early cases, the
staging is not as critical as it is with some other types of
cancer. Chemotherapy with or without radiotherapy is often
CA 02347656 2001-02-02
WO 00/08206 FCT/US99/16247
- 3 -
employed. The scans and tests done at first will be used later
to see how well a patient is responding to treatment.
WO 98/56951 (published December 17, 1998) discloses a set
of contiguous and partially overlapping cDNA sequences and
polypeptides encoded thereby, designated as LS170. These
sequences are suggested to be useful in detecting, diagnosing,
staging, monitoring, prognosticating, in vivo imaging,
preventing or treating, and determining the predisposition of
an individual to disease and conditions of the lung, such as
lung cancer. The LS170-specific polynucleotide is taught to
have at least 50% identity with a polynucleotide selected from
the group consisting of SEQ ID NO:1-9 as disclosed in WO
98/56951. SEQ ID NO:l taught in WO 98/56951 overlaps with an
LSG, SEQ ID N0: 4, used in the instant invention.
In the present invention methods are provided for
detecting, diagnosing, monitoring, staging, prognosticating,
in vivo imaging and treating lung cancer via five (5) Lung
Specific Genes (LSG). The five LSGs refer, among other
things, to native proteins expressed by the genes comprising
the polynucleotide sequences of any of SEQ ID NO: l, 2, 3, 4,
or 5. In the alternative, what is meant by the five LSGs as
used herein, means the native mRNAs encoded by the genes
comprising any of the polynucleotide sequences of SEQ ID NO:
1, 2, 3, 4, or 5 or it can refer to the actual genes
comprising any of the polynucleotide sequences of SEQ ID NO:
1, 2, 3, 4, or 5.
Procedures used for detecting, diagnosing, monitoring,
staging, and prognosticating lung cancer are of critical
importance to the outcome of the patient. For example,
patients diagnosed with early lung cancer generally have a
much greater five-year survival rate as compared to the
survival rate for patients diagnosed with distant metastasized
lung cancer. New diagnostic methods which are more sensitive
and specific for detecting early lung cancer are clearly
needed.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 4 -
Lung cancer patients are closely monitored following
initial therapy and during adjuvant therapy to determine
response to therapy and to detect persistent or recurrent
disease of metastasis. There is clearly a need for a lung
cancer marker which is more sensitive and specific in
detecting lung cancer, its recurrence and progression.
Another important step in managing lung cancer is to
determine the stage of the patient's disease. Stage
determination has potential prognostic value and provides
criteria for designing optimal therapy. Generally,
pathological staging of lung cancer is preferable over
clinical staging because the former gives a more accurate
prognosis. However, clinical staging would be preferred were
it at least as accurate as pathological staging because it
does not depend on an invasive procedure to obtain tissue for
pathological evaluation. Staging of lung cancer would be
improved by detecting new markers in cells, tissues, or bodily
fluids which could differentiate between different stages of
invasion.
Other objects, features, advantages and aspects of the
present invention will become apparent to those of skill in
the art from the following description. It should be
understood, however, that the following description and the
specific examples, while indicating preferred embodiments of
the invention, are given by way of illustration only. Various
changes and modifications within the spirit and scope of the
disclosed invention will become readily apparent to those
skilled in the art from reading the following description and
from reading the other parts of the present disclosure.
SUMMARY OF THE INVENTION
Toward these ends, and others, it is an object of the
present invention to provide a method for diagnosing the
presence of lung cancer by analyzing for changes in levels of
LSG in cells, tissues or bodily fluids compared with levels
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 5 -
of LSG in preferably the same cells, tissues, or bodily fluid
type of a normal human control, wherein an increase in levels
of LSG in the patient versus normal human control is
associated with lung cancer.
Further provided is a method of diagnosing metastatic
lung cancer in a patient having such cancer which is not known
to have metastasized by identifying a human patient suspected
of having lung cancer that has metastasized; analyzing a
sample of cells, tissues, or bodily fluid from such patient
for LSG; comparing the LSG levels in such cells, tissues, or
bodily fluid with levels of LSG in preferably the same cells,
tissues, or bodily fluid type of a normal human control,
wherein an increase in LSG levels in the patient versus the
normal human control is associated with a cancer which has
metastasized.
Also provided by the invention is a method of staging
lung cancer in a human which has such cancer by identifying
a human patient having such cancer; analyzing a sample of
cells, tissues, or bodily fluid from such patient for LSG;
comparing LSG levels in such cells, tissues, or bodily fluid
with levels of LSG in preferably the same cells, tissues, or
bodily fluid type of a normal human control sample, wherein
an increase in LSG levels in the patient versus the normal
human control is associated with a cancer which is progressing
and a decrease in the levels of LSG is associated with a
cancer which is regressing or in remission.
Further provided is a method of monitoring lung cancer
in a human having such cancer for the onset of metastasis.
The method comprises identifying a human patient having such
cancer that is not known to have metastasized; periodically
analyzing a sample of cells, tissues, or bodily fluid from
such patient for LSG; comparing the LSG levels in such cells,
tissue, or bodily fluid with levels of LSG in preferably the
same cells, tissues, or bodily fluid type of a normal human
control sample, wherein an increase in LSG levels in the
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 6 -
patient versus the normal human control is associated with a
cancer which has metastasized.
Further provided is a method of monitoring the change in
stage of lung cancer in a human having such cancer by looking
at levels of LSG in a human having such cancer. The method
comprises identifying a human patient having such cancer;
periodically analyzing a sample of cells, tissues, or bodily
fluid from such patient for LSG; comparing the LSG levels in
such cells, tissue, or bodily fluid with levels of LSG in
preferably the same cells, tissues, or bodily fluid type of
a normal human control sample, wherein an increase in LSG
levels in the patient versus the normal human control is
associated with a cancer which is progressing and a decrease
in the levels of LSG is associated with a cancer which is
regressing or in remission.
Further provided are antibodies against the LSGs or
fragments of such antibodies which can be used to detect or
image localization of the LSGs in a patient for the purpose
of detecting or diagnosing a disease or condition. Such
antibodies can be polyclonal or monoclonal, or prepared by
molecular biology techniques. The term "antibody", as used
herein and throughout the instant specification is also meant
to include aptamers and single-stranded oligonucleotides such
as those derived from an in vitro evolution protocol referred
to as SELEX and well known to those skilled in the art.
Antibodies can be labeled with a variety of detectable labels
including, but not limited to, radioisotopes and paramagnetic
metals. These antibodies or fragments thereof can also be
used as therapeutic agents in the treatment of diseases
characterized by expression of a LSG. In therapeutic
applications, the antibody can be used without or with
derivatization to a cytotoxic agent such as a radioisotope,
enzyme, toxin, drug or a prodrug.
Other objects, features, advantages and aspects of the
present invention will become apparent to those of skill in
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
the art from the following description. It should be
understood, however, that the following description and the
specific examples, while indicating preferred embodiments of
the invention, are given by way of illustration only. Various
changes and modifications within the spirit and scope of the
disclosed invention will become readily apparent to those
skilled in the art from reading the following description and
from reading the other parts of the present disclosure.
DESCRIPTION OF THE INVENTION
The present invention relates to diagnostic assays and
methods, both quantitative and qualitative for detecting,
diagnosing, monitoring, staging, prognosticating, in vivo
imaging and treating cancers by comparing levels of LSG with
those of LSG in a normal human control. What is meant by
levels of LSG as used herein, means levels of the native
protein expressed by the gene comprising the polynucleotide
sequence of any of SEQ ID NO: 1, 2, 3, 4, or 5. In the
alternative, what is meant by levels of LSG as used herein,
means levels of the native mRNA encoded by the gene comprising
any of the polynucleotide sequences of SEQ ID NO: 1, 2, 3,
4, or 5 or levels of the gene comprising any of the
polynucleotide sequence of SEQ ID NO: l, 2, 3, 4, or 5. Such
levels are preferably measured in at least one of, cells,
tissues and/or bodily fluids, including determination of
normal and abnormal levels. Thus, for instance, a diagnostic
assay in accordance with the invention for diagnosing over-
expression of LSG protein compared to normal control bodily
fluids, cells, or tissue samples may be used to diagnose the
presence of cancers, including lung cancer. Any of the five
LSGs may be measured alone in the methods of the invention,
or all together or any combination of the five.
All the methods of the present invention may optionally
include measuring the levels of other cancer markers as well
as LSG. Other cancer markers, in addition to LSG, useful in
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
_ g _
the present invention will depend on the cancer being tested
and are known to those of skill in the art.
Diagnos tic Assays
The present invention provides methods for diagnosing the
presence of lung cancer by analyzing for changes in levels of
LSG in cells, tissues or bodily fluids compared with levels
of LSG in cells, tissues or bodily fluids of preferably the
same type from a normal human control, wherein an increase in
levels of LSG in the patient versus the normal human control
is associated with the presence of lung cancer.
without limiting the instant invention, typically, for
a quantitative diagnostic assay a positive result indicating
the patient being tested has cancer is one in which cells,
tissues, or bodily fluid levels of the cancer marker, such as
LSG, are at least two times higher, and most preferable are
at least five times higher, than in preferably the same cells,
tissues, or bodily fluid of a normal human control.
The present invention also provides a method of
diagnosing metastatic lung cancer in a patient having lung
cancer which has not yet metastasized for the onset of
metastasis. In the method of the present invention, a human
cancer patient suspected of having lung cancer which may have
metastasized (but which was not previously known to have
metastasized) is identified. This is accomplished by a
variety of means known to those of skill in the art. For
example, in the case of lung cancer, patients are typically
diagnosed with lung cancer following traditional detection
methods.
In the present invention, determining the presence of LSG
level in cells, tissues, or bodily fluid, is particularly
useful for discriminating between lung cancer which has not
metastasized and lung cancer which has metastasized. Existing
techniques have difficulty discriminating between lung cancer
which has metastasized and lung cancer which has not
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
_ g _
metastasized and proper treatment selection is often dependent
upon such knowledge.
In the present invention, the cancer marker level
measured in such cells, tissues, or bodily fluid is LSG, and
is compared with levels of LSG in preferably the same cells,
tissue, or bodily fluid type of a normal human control. That
is, if the cancer marker being observed is just LSG in serum,
this level is preferably compared with the level of LSG in
serum of a normal human patient. An increase in the LSG in
the patient versus the normal human control is associated with
lung cancer which has metastasized.
V~lithout limiting the instant invention, typically, for
a quantitative diagnostic assay a positive result indicating
the cancer in the patient being tested or monitored has
metastasized is one in which cells, tissues, or bodily fluid
levels of the cancer marker, such as LSG, are at least two
times higher, and more preferably are at least five times
higher, than in preferably the same cells, tissues, or bodily
fluid of a normal patient.
Normal human control as used herein includes a human
patient without cancer and/or non cancerous samples from the
patient; in the methods for diagnosing metastasis or
monitoring for metastasis, normal human control preferably
includes samples from a human patient that is determined by
reliable methods to have lung cancer which has not
metastasized such as samples from the same patient prior to
metastasis.
Staging
The invention also provides a method of staging lung
cancer in a human patient.
The method comprises identifying a human patient having
such cancer and analyzing a sample of cells, tissues, or
bodily fluid from such patient for LSG. The measured LSG
levels are then compared to levels of LSG in preferably the
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 10 -
same cells, tissues, or bodily fluid type of a normal human
control sample, wherein an increase in LSG levels in the
patient versus the normal human control is associated with a
cancer which is progressing and a decrease in the levels of
LSG is associated with a cancer which is regressing or in
remission.
Monitoring
Further provided is a method of monitoring lung cancer
in a human having such cancer for the onset of metastasis.
The method comprises identifying a human patient having such
cancer that is not known to have metastasized; periodically
analyzing a sample of cells, tissues, or bodily fluid from
such patient for LSG; comparing the LSG levels in such cells,
tissue, or bodily fluid with levels of LSG in preferably the
same cells, tissues, or bodily fluid type of a normal human
control sample, wherein an increase in LSG levels in the
patient versus the normal human control is associated with a
cancer which has metastasized.
Further provided by this inventions is a method of
monitoring the change in stage of lung cancer in a human
having such cancer. The method comprises identifying a human
patient having such cancer; periodically analyzing a sample
of cells, tissues, or bodily fluid from such patient for LSG;
comparing the LSG levels in such cells, tissue, or bodily
fluid with levels of LSG in preferably the same cells,
tissues, or bodily fluid type of a normal human control
sample, wherein an increase in LSG levels in the patient
versus the normal human control is associated with a cancer
which is progressing in stage and a decrease in the levels of
LSG is associated with a cancer which is regressing in stage
or in remission.
Monitoring such patient for onset of metastasis is
periodic and preferably done on a quarterly basis. However,
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 11 -
this may be more or less frequent depending on the cancer, the
particular patient, and the stage of the cancer.
Assay Techniques
Assay techniques that can be used to determine levels of
gene expression, such as LSG of the present invention, in a
sample derived from a host are well-known to those of skill
in the art. Such assay methods include radioimmunoassays,
reverse transcriptase PCR (RT-PCR) assays,
immunohistochemistry assays, in situ hybridization assays,
competitive-binding assays, Western Blot analyses, ELISA
assays and proteomic approaches. Among these, ELISAs are
frequently preferred to diagnose a gene's expressed protein
in biological fluids.
An ELISA assay initially comprises preparing an antibody,
if not readily available from a commercial source, specific
to LSG, preferably a monoclonal antibody. In addition a
reporter antibody generally is prepared which binds
specifically to LSG. The reporter antibody is attached to a
detectable reagent such as radioactive, fluorescent or
enzymatic reagent, for example horseradish peroxidase enzyme
or alkaline phosphatase.
To carry out the ELISA, antibody specific to LSG is
incubated on a solid support, e.g., a polystyrene dish, that
binds the antibody. Any free protein binding sites on the
dish are then covered by incubating with a non-specific
protein such as bovine serum albumin. Next, the sample to be
analyzed is incubated in the dish, during which time LSG
binds to the specific antibody attached to the polystyrene
dish. Unbound sample is washed out with buffer. A reporter
antibody specifically directed to LSG and linked to
horseradish peroxidase is placed in the dish resulting in
binding of the reporter antibody to any monoclonal antibody
bound to LSG. Unattached reporter antibody is then washed
out. Reagents for peroxidase activity, including a
CA 02347656 2001-02-02
WO 00/08206 PCT/EJS99/16247
- 12 -
colorimetric substrate are then added to the dish.
Immobilized peroxidase, linked to LSG antibodies, produces a
colored reaction product. The amount of color developed in
a given time period is proportional to the amount of LSG
protein present in the sample. Quantitative results typically
are obtained by reference to a standard curve.
A competition assay may be employed wherein antibodies
specific to LSG attached to a solid support and labeled LSG
and a sample derived from the host are passed over the solid
support and the amount of label detected attached to the solid
support can be correlated to a quantity of LSG in the sample.
Nucleic acid methods may be used to detect LSG mRNA as
a marker for lung cancer. Polymerase chain reaction (PCR) and
other nucleic acid methods, such as lipase chain reaction
(LCR) and nucleic acid sequence based amplification (NASABA),
can be used to detect malignant cells for diagnosis and
monitoring of various malignancies. For example, reverse-
transcriptase PCR (RT-PCR) is a powerful technique which can
be used to detect the presence of a specific mRNA population
in a complex mixture of thousands of other mRNA species. In
RT-PCR, an mRNA species is first reverse transcribed to
complementary DNA (cDNA) with use of the enzyme reverse
transcriptase; the cDNA is then amplified as in a standard PCR
reaction. RT-PCR can thus reveal by amplification the
presence of a single species of mRNA. Accordingly, if the
mRNA is highly specific for the cell that produces it, RT-PCR
can be used to identify the presence of a specific type of
cell.
Hybridization to clones or oligonucleotides arrayed on
a solid support (i.e., gridding) can be used to both detect
the expression of and quantitate the level of expression of
that gene. In this approach, a cDNA encoding the LSG gene
is fixed to a substrate. The substrate may be of any suitable
type including but not limited to glass, nitrocellulose, nylon
or plastic. At least a portion of the DNA encoding the LSG
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 13 -
gene is attached to the substrate and then incubated with the
analyte, which may be RNA or a complementary DNA (cDNA) copy
of the RNA, isolated from the tissue of interest.
Hybridization between the substrate bound DNA and the analyte
can be detected and quantitated by several means including but
not limited to radioactive labeling or fluorescence labeling
of the analyte or a secondary molecule designed to detect the
hybrid. Quantitation of the level of gene expression can be
done by comparison of the intensity of the signal from the
analyte compared with that determined from known standards.
The standards can be obtained by in vitro transcription of the
target gene, quantitating the yield, and then using that
material to generate a standard curve.
Of the proteomic approaches, 2D electrophoresis is a
technique well known to those in the art. Isolation of
individual proteins from a sample such as serum is
accomplished using sequential separation of proteins by
different characteristics usually on polyacrylamide gels.
First, proteins are separated by size using an electric
current. The current acts uniformly on all proteins, so
smaller proteins move farther on the gel than larger proteins.
The second dimension applies a current perpendicular to the
first and separates proteins not on the basis of size but on
the specific electric charge carried by each protein. Since
no two proteins with different sequences are identical on the
basis of both size and charge, the result of a 2D separation
is a square gel in which each protein occupies a unique spot.
Analysis of the spots with chemical or antibody probes, or
subsequent protein microsequencing can reveal the relative
abundance of a given protein and the identity of the proteins
in the sample.
The above tests can be carried out on samples derived
from a variety of patients' cells, bodily fluids and/or tissue
extracts (homogenates or solubilized tissue) such as from
tissue biopsy and autopsy material. Bodily fluids useful in
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 14 -
the present invention include blood, urine, saliva, or any
other bodily secretion or derivative thereof. Blood can
include whole blood, plasma, serum, or any derivative of
blood.
In Vivo Antibody Use
Antibodies against LSG can also be used in vivo in
patients with disease of the lung. Specifically, antibodies
against an LSG can be injected into a patient suspected of
having a disease of the lung for diagnostic and/or therapeutic
purposes. The use of antibodies for in vivo diagnosis is well
known in the art. For example, antibody-chelators labeled
with Indium-111 have been described for use in the
radioimmunoscintographic imaging of carcinoembryonic antigen
expressing tumors (Sumerdon et al. Nucl. Med. Biol. 1990
17:247-254). In particular, these antibody-chelators have
been used in detecting tumors in patients suspected of having
recurrent colorectal cancer (Griffin et al. J. Clin. Onc. 1991
9:631-640). Antibodies with paramagnetic ions as labels for
use in magnetic resonance imaging have also been described
(Lauffer, R.B. Magnetic Resonance in Medicine 1991 22:339-
342). Antibodies directed against LSGs can be used in a
similar manner. Labeled antibodies against an LSG can be
injected into patients suspected of having a disease of the
lung such as lung cancer for the purpose of diagnosing or
staging of the disease status of the patient. The label used
will be selected in accordance with the imaging modality to
be used. For example, radioactive labels such as Indium-111,
Technetium-99m or Iodine-131 can be used for planar scans or
single photon emission computed tomography (SPELT). Positron
emitting labels such as Fluorine-19 can be used in positron
emission tomography. Paramagnetic ions such as Gadlinium
(III) or Manganese (II) can used in magnetic resonance imaging
(MRI). Localization of the label within the lung or external
to the lung permits determination of the spread of the
disease. The amount of label within the lung also allows
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 15 -
determination of the presence or absence of cancer in the
lung.
For patients diagnosed with lung cancer, injection of an
antibody against an LSG can also have a therapeutic benefit.
The antibody may exert its therapeutic effect alone.
Alternatively, the antibody is conjugated to a cytotoxic agent
such as a drug, toxin or radionuclide to enhance its
therapeutic effect. Drug monoclonal antibodies have been
described in the art for example by Garnett and Baldwin,
Cancer Research 1986 46:2407-2412. The use of toxins
conjugated to monoclonal antibodies for the therapy of various
cancers has also been described by Pastan et al. Cell 1986
47:641-648). Yttrium-90 labeled monoclonal antibodies have
been described for maximization of dose delivered to the tumor
while limiting toxicity to normal tissues (Goodwin and Meares
Cancer Supplement 1997 80:2675-2680). Other cytotoxic
radionuclides including, but not limited to Copper-67, Iodine-
131 and Rhenium-186 can also be used for labeling of
antibodies against LSGs.
Antibodies which can be used in these in vivo methods
include both polyclonal and monoclonal antibodies and
antibodies prepared via molecular biology techniques.
Antibody fragments can also be used.
EXAMPLES
The present invention is further described by the
following examples. The examples are provided solely to
illustrate the invention by reference to specific embodiments.
These exemplifications, while illustrating certain specific
aspects of the invention, do not portray the limitations or
circumscribe the scope of the disclosed invention.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 16 -
Example 1
Searches were carried out and LSGs identified using the
following Search Tools as part of the LIFESEQ database
available from Incyte Pharmaceuticals, Palo Alto, CA:
Library Comparison (compares one library to one other
library) allows the identification of clones expressed in
tumor and absent or expressed at a lower level in normal
tissue.
Subsetting is similar to library comparison but allows
the identification of clones expressed in a pool of libraries
and absent or expressed at a lower level in a second pool of
libraries.
Transcript Imaging lists all of the clones in a single
library or a pool of libraries based on abundance. Individual
clones can then be examined using Electronic Northerns to
determine the tissue sources of their component ESTs.
Protein Function: Incyte has identified subsets of ESTs
with a potential protein function based on homologies to known
proteins. Some examples in this database include
Transcription Factors and Proteases. Some leads were
identified by searching in this database for clones whose
component ESTs showed disease specificity.
Electronic subtractions, transcript imaging and protein
function searches were used to identify clones, whose
component ESTs were exclusively or more frequently found in
libraries from specific tumors. Individual candidate clones
were examined in detail by checking where each EST originated.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/I6247
- 17 -
Table l: LSGs
SEQ ID # Clone ID Gene ID Method
1 2589190 6361 Transcript Imaging
2 1237018 6997 Transcript Imaging
3 1510111 5658 Transcript Imaging
4 1355520 236760 Transcript Imaging
5 3117390 7387 Transcript Imaging
The following example was carried out using standard
techniques, which are well known and routine to those of skill
in the art, except where otherwise described in detail.
Routine molecular biology techniques of the following example
can be carried out as described in standard laboratory
manuals, such as Sambrook et al., MOLECULAR CLONING: A
LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. (1989).
Example 2: Relative Quantitation of Gene Expression.
Real-Time quantitative PCR with fluorescent Taqman probes
is a quantitation detection system utilizing the 5'- 3'
nuclease activity of Taq DNA polymerase. The method uses an
internal fluorescent oligonucleotide probe (Taqman) labeled
with a 5' reporter dye and a downstream, 3' quencher dye.
During PCR, the 5'-3' nuclease activity of Taq DNA polymerase
releases the reporter, whose fluorescence can then be detected
by the laser detector of the Model 7700 Sequence Detection
System (PE Applied Biosystems, Foster City, CA, USA).
Amplification of an endogenous control is used to
standardize the amount of sample RNA added to the reaction and
normalize for Reverse Transcriptase (RT) efficiency. Either
cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
or 18S ribosomal RNA (rRNA) was used as this endogenous
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 18 -
control. To calculate relative quantitation between all the
samples studied, the target RNA levels for one sample were
used as the basis for comparative results (calibrator).
Quantitation relative to the "calibrator" can be obtained
using the standard curve method or the comparative method
(User Bulletin #2: ABI PRISM 7700 Sequence Detection System).
The tissue distribution and the level of the target gene
were evaluated for every example in normal and cancer tissue.
Total RNA was extracted from these tissues and corresponding
matched adjacent tissues. Subsequently, first strand cDNA was
prepared with reverse transcriptase and the polymerase chain
reaction was done using primers and Taqman probe specific to
each target gene . The results were analyzed using the ABI
PRISM 7700 Sequence Detector. The absolute numbers are
relative levels of expression of the target gene in a
particular tissue compared to the calibrator tissue.
Comparative Examples
Similar mRNA expression analysis for genes coding for the
diagnostic markers PSA (Prostate Specific Antigen) and PLA2
(Phospholipase A2) was performed for comparison. PSA is the
only cancer screening marker available in clinical
laboratories. V,lhen the panel of normal pooled tissues was
analyzed, PSA was expressed at very high levels in prostate,
with a very low expression in breast and testis. After
analysis of more than 55 matching samples from 14 different
tissues, the data corroborated the tissue specificity seen
with normal tissue samples. PSA expression was compared in
cancer and normal adjacent tissue for 12 matching samples of
prostate tissue. The relative levels of PSA were higher in
10 cancer samples (83%). Clinical data recently obtained
support the utilization of PLA2 as a staging marker for late
stages of prostate cancer. mRNA expression data showed
overexpression of the mRNA in 8 out of the 12 prostate
matching samples analyzed (66%). The tissue specificity for
PLA2 was not as good as the one described for PSA. In
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 19 -
addition to prostate, small intestine, liver, and pancreas
also showed high levels of mRNA expression for PLA2.
Measurement of SEQ ID NO: S; Clone ID3117390; Gene ID7387
(Lng109)
The absolute numbers shown in Table 2 are relative levels
of expression of Lngl09 (SEQ ID N0:5) in 12 normal different
tissues. All the values are compared to normal small
intestine (calibrator). These RNA samples are commercially
available pools, originated by pooling samples of a particular
tissue from different individuals.
Table 2: Relative levels of Lng109 Expression in Pooled
Samples
Tissue NORMAL
Brain 26.6
Heart 0.004
Kidney 0.016
Liver 0
Lung 46.6
Mammary Gland0.2
Muscle 0.1
Prostate 0.4
Small 1
Testis 12.1
Thymus 0.2
Uterus j 0.2
The relative levels of expression in Table 2 show that Lng109
(SEQ ID N0:5) mRNA expression is higher (46.6) in lung
compared with all the other normal tissues analyzed. Testis,
with a relative expression level of 12.1, and brain (26.6) are
the only other tissues expressing considerable mRNA for
Lng109. These results establish that Lng109 mRNA expression
is highly specific for lung.
The absolute numbers in Table 2 were obtained analyzing
pools of samples of a particular tissue from different
individuals. They can not be compared to the absolute numbers
originated from RNA obtained from tissue samples of a single
individual in Table 3.
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 20 -
The absolute numbers depicted in Table 3 are relative
levels of expression of Lng109 (SEQ ID N0:5) in 57 pairs of
matching samples. All the values are compared to normal small
intestine (calibrator). A matching pair is formed by mRNA
from the cancer sample for a particular tissue and mRNA from
the normal adjacent sample for that same tissue from the same
individual.
Table 3: Relative levels of Lng109 Expression in Individual
Samples
Sample Cancer type Tissue Cancer Matching
ID Normal
LNG AC82 Adenocarcinoma Lung 1 16.6 0.9
LNG 60XL Adenocarcinoma Lung 2 20.4 45.3
LNG AC66 Adenocarcinoma Lung 3 12.4 7.5
LNG AC69 Adenocarcinoma Lung 4 177.9 4.2
LNG AC88 Adenocarcinoma Lung 5 89 33.7
LNG AC11 Adenocarcinoma Lung 6 20.3 88.3
LNG AC39 Adenocarcinoma Lung 7 103.3 1.8
LNG AC90 Adenocarcinoma Lung 8 342.5 0.9
LNG AC32 Adenocarcinoma Lung 9 152.7 0
LNG SQ9X Squamous cell Lung 10 14.2 0.7
carcinoma
LNG SQ45 Squamous cell Lung 11 179.8 15.9
carcinoma
LNG SQ56 Squamous cell Lung 12 55.5 59.3
carcinoma
LNG SQ32 Squamous cell Lung 13 21.3 6.4
carcinoma
LNG SQ80 Squamous cell Lung 14 83 36
carcinoma
LNG SQ16 Squamous cell Lung 15 27.2 4.8
carcinoma
LNG SQ79 Squamous cell Lung 16 11.2 18
carcinoma
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 21 -
LNG C20X Squamous cell Lung 17 0.2 0.63
carcinoma
LNG 47XQ Squamous cell Lung 18 188.1 0
carcinoma
LNG SQ44 Squamous cell Lung 19 6.3 0.2
carcinoma
LNG BR94 Squamous cell Lung 20 12 0
carcinoma
LNG 90X Squamous cell Lung 21 7.6 3.6
carcinoma
LNG LC71 Large cell Lung 22 69.1 168.3
carcinoma
LNG Large cell Lung 23 11.8 250.7
LC109 carcinoma
LNG 75XC Metastatic Lung 24 1.5 1.8
f rom bone
cancer
LNG MT67 Metastatic Lung 25 3.1 2.7
from renal
cancer
LNG MT71 Metastatic Lung 26 9.9 21.9
from melanoma
BLD 32XK Bladder 1 0.1 0
BLD 46XK Bladder 2 0.3 0
CLN AS67 Colon 1 0.2 0.1
CLN C9XR Colon 2 0.02 0
CVX KS52 Cervix 1 0.1 0
CVX NK23 Cervix 2 0.1 0
END 28XA Endometrium 2.2 0.1
1
ENDO Endometrium 0 0
2
12XA
ENDO 68X Endometrium 1.33 2.6
3
ENDO 8XA Endometrium 0 0
4
KID Kidney 1 0.1 0.1
106XD
KID Kidney 2 0.1 0.2
109XD
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 22 -
LIV 94XA Liver 1 0 0.04
LIV 15XA Liver 2 48.6 0.03
MAM A06X Mammary 1 0 0
MAM 59X Mammary 2 0.9 0
OVR 103X Ovary 1 0.5 2.6
PAN 71XL Pancreas 1 0.1 0.1
PAN 77X Pancreas 2 0.1 0
PRO 20XB Prostate 1 0.3 0.1
PRO 12B Prostate 2 0.3 0
PRO 69XB Prostate 3 0.6 0.5
SMI 21XA Sm. Int. 1 0.3 0
SMI H89 Sm. Int. 2 0.1 0.2
STO AC44 Stomach 1 0.2 0.2
STO AC99 Stomach 2 0.1 0.2
STO MT54 Stomach 3 0.3 0
STO TA73 Stomach 4 0.4 0.7
TST 39X Testis 4.8 0.8
UTR Uterus 1 0.6 0.5
135X0
UTR Uterus 2 0 0.1
141X0
0=negative
In the analysis of matching samples, the higher levels
of expression were in lung, showing a high degree of tissue
specificity for lung tissue. Of all the samples different
than lung analyzed, only one sample (the cancer sample Liver
2 with 48.6) showed an expression comparable to the mRNA
expression in lung. These results confirmed the tissue
specificity results obtained with the panel of normal pooled
samples (Table 2).
Furthermore, the level of mRNA expression in cancer
samples and the isogenic normal adjacent tissue from the
same individual was compared. This comparison provides an
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 23 -
indication of specificity for the cancer stage (e. g.
higher levels of mRNA expression in the cancer sample
compared to the normal adjacent). Table 3 shows
overexpression of Lng109 in 16 primary lung cancer tissues
compared with their respective normal adjacent (lung
samples #l, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 18, 19,
20, and 21). There was overexpression in the cancer
tissue for 700 of the lung matching samples tested (total
of 23 lung matching samples).
Altogether, the high level of tissue specificity,
plus the mRNA overexpression in 70% of the primary lung
matching samples tested are demonstrative of Lng109 being
a diagnostic marker for lung cancer.
Measurement of SEQ ID N0:4; Clone ID1355520 (1981752);
Gene ID236760 (Lng110)
The absolute numbers depicted in Table 4 are relative
levels of expression of Lng110 in 12 normal different
tissues. All the values are compared to normal testis
(calibrator). These RNA samples are commercially
available pools, originated by pooling samples of a
particular tissue from different individuals.
Table 4: Relative levels of Lng109 Expression in Pooled
Samples
Tissue NORMAL
Brain 0
Heart 0.003
Kidney 0.02
Liver 0
Lung 392.1
Mammary 0
Muscle 0
Prostate 0.1
Sm. Int. 0
Testis 1
Thymus 0.6
Uterus 0
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/1624'1
- 24 -
The relative levels of expression in Table 4 show
that Lng110 mRNA expression is more than 300 fold higher
in the pool of normal lung (392.1) compared to all the
other tissues analyzed. These results demonstrate that
Lng110 mRNA expression is highly specific for lung.
The absolute numbers in Table 4 were obtained
analyzing pools of samples of a particular tissue from
different individuals. They can not be compared to the
absolute numbers originated from RNA obtained from tissue
samples of a single individual in Table 5.
The absolute numbers depicted in Table 5 are relative
levels of expression of Lng110 in 60 pairs of matching
samples. All the values are compared to normal testis
(calibrator). A matching pair is formed by mRNA from the
cancer sample for a particular tissue and mRNA from the
normal adjacent sample for that same tissue from the same
individual.
Table 5: Relative levels of Lng109 Expression in
Individual Samples
Sample Cancer type Tissue Cancer Matching
ID Normal
LNG AC82 Adenocarcinoma Lung 1 30.8 17
LNG 60XL Adenocarcinoma Lung 2 18.2 40.1
LNG AC66 Adenocarcinoma Lung 3 0 31.1
LNG AC69 Adenocarcinoma Lung 4 44.8 5.3
LNG AC88 Adenocarcinoma Lung 5 239.7 78.5
LNG AC11 Adenocarcinoma Lung 6 10.7 1.3
LNG AC39 Adenocarcinoma Lung 7 134.4 0.7
LNG AC90 Adenocarcinoma Lung 8 373.5 4.6
LNG AC32 Adenocarcinoma Lung 9 65.8 1.2
LNG SQ9X Squamous cell Lung 10 76.6 0.2
carcinoma
LNG SQ45 Squamous cell Lung 11 21.4 105.8
carcinoma
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 25 -
LNG SQ56 Squamous cell Lung 12 48.2 1049.1
carcinoma
LNG SQ14 Squamous cell Lung 13 2.3 0.7
carcinoma
LNG SQ32 Squamous cell Lung 14 3.2 0.5
carcinoma
LNG SQ80 Squamous cell Lung 15 191.3 0.3
carcinoma
LNG SQ16 Squamous cell Lung 16 21.3 0.7
carcinoma
LNG SQ79 Squamous cell Lung 17 1992 7.8
carcinoma
LNG C20X Squamous cell Lung 18 0.7 0.4
carcinoma
LNG 47XQ Squamous cell Lung 19 4.3 0
carcinoma
LNG SQ44 Squamous cell Lung 20 0 0
carcinoma
LNG BR94 Squamous cell Lung 21 100.8 0
carcinoma
LNG 90X Squamous cell Lung 22 5.2 45.4
carcinoma
LNG LC71 Large cell Lung 23 4.6 2.5
carcinoma
LNG Large cell Lung 24 876.1 111.4
LC109 carcinoma
LNG 75XC Metastatic Lung 25 19 27.2
from bone
cancer
LNG MT67 Metastatic Lung 26 0 0
from renal
cancer
LNG MT71 Metastatic Lung 27 0 5.2
from melanoma
BLD 32XK Bladder 1 0 0
BLD 46XK Bladder 2 0 0
CLN AS67 Colon 1 0 0
CLN C9XR Colon 2 0 0
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 26 -
CLN CM67 Colon 3 0 0
CVX KS52 Cervix 1 1.4 0
CVX NK23 Cervix 2 0 0
CVX Cervix 3 0 0
NKS18
END 28XA Endometrium 1 0.8 0
ENDO Endometrium 2 0 0
12XA
KID Kidney 1 0 0
106XD
KID Kidney 2 0 0
107XD
KID lOXD Kidney 3 0 0
KID 11XD Kidney 4 0 0
LIV 94XA Liver 1 0 0
LIV 15XA Liver 2 0 0
MAM A06X Mammary 1 0 0
MAM Mammary 2 0 0
B011X
MAM 12X Mammary 3 0 0
MAM 59X Mammary 4 0 0
OVR 103X Ovary 1 0.1 0
PAN 71XL Pancreas 1 0 0
PAN 77X Pancreas 2 0 0
PRO 20XB Prostate 1 0 0
PRO 12B Prostate 2 0 0
SMI 21XA Small 0 0
Intestine 1
SMI H89 Small 0 0
Intestine 2
STO AC44 Stomach 1 0 0
STO AC99 Stomach 2 0 0
TST 39X Testis 4.4 0
CA 02347656 2001-02-02
WO 00/08206 PCT/US99/16247
- 27 -
UTR Uterus 1 0 0
135X0
UTR Uterus 2 0 0
141X0
0=negative
In the analysis of matching samples, the higher
levels of expression were in lung showing a high degree of
tissue specificity for lung tissue. These results confirm
the tissue specificity results obtained with normal pooled
samples (Table 4).
Furthermore, the level of mRNA expression in cancer
samples and the isogenic normal adjacent tissue from the
same individual was compared. This comparison provides an
indication of specificity for the cancer stage (e. g.
higher levels of mRNA expression in the cancer sample
compared to the normal adjacent). Table 5 shows
overexpression of Lng110 in 18 primary lung cancer samples
compared with their respective normal adjacent (lung
samples #1, 4, 5, 6, 7, 8, 9, 10, 13, 14, 15, 16, 17, 18,
19, 21, 23 and 24). There is overexpression in the cancer
tissue for 75% of the lung matching samples tested (total
of 24 primary lung matching samples).
Altogether, the high level of tissue specificity,
plus the mRNA overexpression in 750 of the lung matching
samples tested are demonstrative of Lng110 being a
diagnostic marker for lung cancer. The amino acid
sequence encoded by the open reading frame of Lng110 is
depicted in SEQ ID N0:6.
CA 02347656 2001-03-09
-28-
SEQUENCE LISTING
<110> DIADEXUS, INC.
<120> A NOVEL METHOD OF DIAGNOSING, MONITORING, STAGING,
IMAGING AND TREATING LUNG CANCER
<130> PAT 48694W-1
<140> PCT/US99/16247
<141> 19-JUL-1999
<150> US 06/095,233
<151> 04-AUG-1998
<160> 6
<170> PatentIn Ver. 2.0
<210> 1
<211> 174
<212> DNA
<213> Homo Sapiens
<400> 1
cataattggg catactgtaa tattctcaga gatctatatg taaaatttgt atagtcatag 60
ttttatggtg ggttataatt gtctctagta gattctgtga gtctaaaaca ataggaagac 120
tgtgctccat tagcttgtca tgcaattttt aactttgaca atagactttt tttg 174
<210> 2
<211> 276
<212> DNA
<213> Homo Sapiens
<400> 2
aagaggagtctggaggtagggtccaagggccacgagccagtttgggctgctggagggggg60
cctggcaaggagggctctcggggaagcacctgtgggggtctgcttcctgaccccagggag120
ctagaggcctccctccctccaggccccccaagccaggctgagccagccgctaggggcacg180
gagcagtgcccaccttgcgcccagtgtggccagagcttcggccggaaggagctcagtgcg240
ccgcaccagcgcgtgcatcgtggcccccggcctttc 276
CA 02347656 2001-03-09
-29-
<210> 3
<211> 347
<212> DNA
<213> Homo sapiens
<220>
<221> unsure
<222> (279)..(280)
<220>
<221> unsure
<222> (272)
<220>
<221> unsure
<222> (311)
<400> 3
gttagcttcacaccttcggcagcaggagggcggcagcttctcgcaggcggcagggcgggc 60
ggccaggatcatgtccaccaccacatgccaagtggtggcgttcctcctgtccatcctggg 120
gctggccggctgcatcgcggccaccgggatggacatgtggagcacccaggacctgtacga 180
caaccccgtcacctccgtgttccagtacgaagggctctggaggagctgcgtgaggcagag 240
ttcaggcttcaccgaatgcaggccctatttcaccatccnngnacttccagccatgctgca 300
ggcagtgcganccctgatgatcgtaggcatcgtcctgggtgccattg 347
<210> 4
<211> 1016
<212> DNA
<213> Homo sapiens
<400> 4
acggggagagagaggagaccaggacagctgctgagacctctaagaagtccagatactaag 60
agcaaagatgtttcaaactgggggcctcattgtcttctacgggctgttagcccagaccat 120
ggcccagtttggaggcctgcccgtgcccctggaccagaccctgcccttgaatgtgaatcc 180
agccctgcccttgagtcccacaggtcttgcaggaagcttgacaaatgccctcagcaatgg 240
cctgctgtctgggggcctgttgggcattctggaaaaccttccgctcctggacatcctgaa 300
gcctggaggaggtacttctggtggcctccttgggggactgcttggaaaagtgacgtcagt 360
gattcctggcctgaacaacatcattgacataaaggtcactgacccccagctgctggaact 420
tggccttgtgcagagccctgatggccaccgtctctatgtcaccatccctctcggcataaa 480
CA 02347656 2001-03-09
-3 0-
gctccaagtgaatacgcccctggtcggtgcaagtctgttgaggctggctgtgaagctgga540
catcactgcagaaatcttagctgtgagagataagcaggagaggatccacctggtccttgg600
tgactgcacccattcccctggaagcctgcaaatttctctgcttgatggacttggccccct660
ccccattcaaggtcttctggacagcctcacagggatcttgaataaagtcctgcctgagtt720
ggttcagggcaacgtgtgccctctggtcaatgaggttctcagaggcttggacatcaccct780
ggtgcatgacattgttaacatgctgatccacggactacagtttgtcatcaaggtctaagc840
cttccaggaaggggctggcctctgctgagctgcttcccagtgctcacagatggctggccc900
atgtgctggaagatgacacagttgccttctctccgaggaacctgccccctctcctttccc960
accaggcgtgtgtaacatcccatgtgcctcacctaataaaatggctcttcttctgc 1016
<210> 5
<211> 597
<212> DNA
<213> Homo sapiens
<400> 5
tggctcgtga gtcccttggg catcccgctc ctgggcaggt caccaatagg tccccgcagt 60
tcccaatgga actgttccag tcctccccga ggcctccact tcaacctgtc tgtgtctgcc 120
caggcctggagttgtgtgaccctccccaccgcctggccttctccatgggggctggccttt 180
tctcggtggtgggcaccctgctgctgcccggcctggctgcgcttgtgcaggactggcgtc 240
ttctgcaggggctgggtgccctgatgagtggactcttgctgctcttttgggggaggaggt 300
ggagggagccgtgggcatcctcaccaacgctgcaggttcccggccctgttccccgagtct 360
ccctgctggctgctggccacaggtcaggtagctcgagccaggaagatcctgtggcgcttt 420
gcagaagccagtggcgtgggccccggggacagttccttggaggagaactccctggctaca 480
gagctgaccatgctgtctgcacggagcccccagccccggtaccactccccactggggctt 540
ctgcgtacccgagtcacctggagaaacgggcttatcttgggcttcagctcgctggtt 597
<210> 6
<211> 256
<212> PRT
<213> Homo sapiens
<400> 6
CA 02347656 2001-03-09
-31-
Met Phe Gln Thr Gly Gly Leu Ile Val Phe Tyr Gly Leu Leu Ala Gln
1 5 10 15
Thr Met Ala Gln Phe Gly Gly Leu Pro Val Pro Leu Asp Gln Thr Leu
20 25 30
Pro Leu Asn Val Asn Pro Ala Leu Pro Leu Ser Pro Thr Gly Leu Ala
35 40 45
Gly Ser Leu Thr Asn Ala Leu Ser Asn Gly Leu Leu Ser Gly Gly Leu
50 55 60
Leu Gly Ile Leu Glu Asn Leu Pro Leu Leu Asp Ile Leu Lys Pro Gly
65 70 75 80
Gly Gly Thr Ser Gly Gly Leu Leu Gly Gly Leu Leu Gly Lys Val Thr
85 90 95
Ser Val Ile Pro Gly Leu Asn Asn Ile Ile Asp Ile Lys Val Thr Asp
100 105 110
Pro Gln Leu Leu Glu Leu Gly Leu Val Gln Ser Pro Asp Gly His Arg
115 120 125
Leu Tyr Val Thr Ile Pro Leu Gly Ile Lys Leu Gln Val Asn Thr Pro
130 135 140
Leu Val Gly Ala Ser Leu Leu Arg Leu Ala Val Lys Leu Asp Ile Thr
145_ 150 155 160
Ala Glu Ile Leu Ala Val Arg Asp Lys Gln Glu Arg Ile His Leu Val
165 170 175
Leu Gly Asp Cys Thr His Ser Pro Gly Ser Leu Gln Ile Ser Leu Leu
180 185 190
Asp Gly Leu Gly Pro Leu Pro Ile Gln Gly Leu Leu Asp Ser Leu Thr
195 200 205
Gly Ile Leu Asn Lys Val Leu Pro Glu Leu Val Gln Gly Asn Val Cys
210 215 220
Pro Leu Val Asn Glu Val Leu Arg Gly Leu Asp Ile Thr Leu Val His
225 230 235 240
Asp Ile Val Asn Met Leu Ile His Gly Leu Gln Phe Val Ile Lys Val
245 250 255
