Note: Descriptions are shown in the official language in which they were submitted.
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
PHARMACEUTICAL COMPOSITION, CONTAINING FRAGMENTS OF AN ANTIGENIC
PROTEIN ENCODING DNA ENDOWED WITH ANTI-TUMOR EFFECT.
Field of the invention
The invention relates to a pool of DNA plasmid constructs
containing the sequences of human MUC-1 encoding fragments and
to a pool of DNA plasmids in which the fragments themselves are
preceded by the sequence encoding a protein consisting of human
ubiquitin fused to a bacterial LacI fragment. The invention
further relates to their use in the preparation of
pharmaceutical compositions for use as DNA anti-tumor vaccines.
Background art
The invention provides an anti-tumor therapy based on the
induction or activation of the immune response able to bring
about tumor rejection. The validity of such an idea is
demonstrated' from the first clinical results; for example,
patients treated with a viral vaccine containing the
Carcinoembryonic Antigen (CEA) encoding sequences demonstrated
immune system activation against this antigen (Tsang KY et al.
J. Natl. Cancer. Inst. 87: 982, 1995).
The activation of an immune anti-tumor response is
achievable through four different approaches:
a) Ex vivo engineering of patient tumor cells in order to
make them more immunogenic and suitable as a vaccine;
b) Ex vivo engineering of patient immune cells in order to
pre-activate an in vitro immune response.
c) Inoculation of naked or liposome capsulated or viral
particle integrated (retrovirus, vaccinia virus, adenovirus,
etc.) DNA encoding tumor associated antigens;
d) Treatment with recombinant or synthetic soluble tumor
antigens conjugated or mixed with adjuvants.
The first two approaches consist of the engineering of
every single patient cell and are limited in that they are
necessarily patient-specific, while the latter two are aimed to
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
2
obtain products comparable to a traditional drug.
The new vaccination methods reflect the development of new
technologies. The recent indications coming from the
experimentation on DNA naked vaccines that induce either a
persistent antibody or a cell immune response, make the
traditional protein subunit vaccines constituted of certain
specific peptides, inducing a lymphocyte population, obsolete.
Intramuscularly or intradermically injected proteins, encoded by
naked DNA, induce a cytotoxic-specific response as well as a
helper response. This powerful combination is extremely
effective but the underling mechanism is not completely
clarified yet. Muscle cells express class I MHC antigens at low
levels only, and do not apparently express class II antigens or
co-stimulatory molecules. Consequently, transfected muscle cells
I5 are unlikely to play an important role in the onset of the
immune response per se. Recent data show that Antigen Presenting
Cells (APC), such as macrophages or dendritic cells, play a
fundamental role in capturing the myocyte released antigen and
in the subsequent processing and presenting of the respective
peptides in the context of the class I and II molecules, thus
inducing a CD8+ cell activation with cytotoxic activity as well
as activation of the CD4+ cells co-operating with B lymphocytes
in eliciting the antibody response (Corr M et al J. Exp~. Med.
184:1555, 1996) (Tighe, H. et a1. Irr~nunology Today 19:89, 1998) .
2~ Furthermore, the use of cytokines is known to improve the
therapeutic effect deriving from immunization with DNA.
Cytokines can be administered in the form of exogenous proteins
as reported in Irvine et al., J. Immunol. 156: 238, 1996. An
alternative approach is represented by the contemporaneous
inoculation of both the tumor antigen or the desired cytokine
encoding plasmids, thus allowing the cytokine to be produced in
si to (Kim JJ et a1 . Immunol 158 : 816, 1997) .
The active immunization approach of the present invention
is based on the use of DNA vectors as vaccines against the MUC-1
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
3
human antigen or Polymorphic Epithelial Mucin (PEM),
overexpressed in tumor cells. MUC-1 is an epithelial luminal
surface glycoprotein (Patton S. et a1. BBA 1241:407, 1995). In
the cell transformation process this glycoprotein loses the
apical localization and its expression level rises dramatically.
The protein function consists of protecting the luminal
surfaces, for example in the mammal gland, ovary, endometrium,
colon, stomach, pancreas, bladder, kidney, etc. A glycosylation
defect is reported that makes tumor cell associated MUC-1
antigenically different from normal cell associated MUC-1. This
phenomenon causes tumor MUC-1 to expose the antigen epitopes
that are normally masked by the sugar moieties in the normal
cell expressed MUC-1. This characteristic makes tumor MUC-1
particularly interesting in an induction of a tumor specific
antibody response (Apostolopoulos V. et a1. Crit. Rev. Immunol.
14:293, 1994) .
As an objective, the vaccination is aimed at inducing
immune responses against tumor cells expressing MUC1 at high
levels, preserving at the same time the low expressing normal
epithelia. The DNA vaccination relies upon the entrance of a
gene or portions thereof inside the body cells followed by
transcription and translation of the inserted sequence and thus
the intracellular synthesis of the corresponding polypeptide. An
important advantage of this system is that the neo-synthesized
protein is naturally processed inside the cell and the produced
peptides are associated with the Major Histocompatibility
Complex class I molecules (MHC-I). The MHC/peptide complexes are
therefore naturally exported to the cell surface where they can
be recognized by the immune system CD8+ cytotoxic cells. Only
the polypeptides synthesized inside the cell are then processed
and presented in association with the MHC class I molecules,
thus making it the only mechanism to stimulate, a specific
cytotoxic response. Vaccination systems based on protein or
peptide administration are usually more effective in stimulating
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
4
the antibody immune response which, to date, has been shown to
be ineffective in rejecting tumor cells. Current gene therapy
techniques rely upon DNA packaging in recombinant viral vectors
(retrovirus and adenovirus). The naked DNA administration is
much more advantageous in terms of effectiveness and safety
compared to viral vector therapies (Kumar V and Sercarz E.
Nature Med. 2: 857, 1996; McDonnel WM et al., New England J. of
Med. 334: 42, 1996). In fact naked DNA is unable either to
duplicate or integrate in the host tissue DNA and does not
induce the immune response to viral proteins.
The use of the ubiquitin to enhance the neo-synthesized
protein processing and thus cytotoxic lymphocyte induction was
recently reported (Rodriguez F. et al., J. Virology 7I: 8497,
1997) . The use of ubiquitin in order to generate proteins with
an N-terminal amino acid, making them unstable and thus prone to
enhanced degradation, had been previously reported (Bechmair A.
et al., SCIENCE 234: 179, 1986). The higher instability of these
proteins was subsequently related to enhanced intracellular
processing and presentation of model proteins by N~iC-1 (Grant E
2 0 P et al . , J. Immunol . 155 : 3750, 1995) ( Wu Y and Kipps T. J. , J.
Immunol. 159: 6037, 1997) .
The use of single constructs containing partial antigen
encoding DNA fragments (influenza virus nucleoprotein), having a
higher antigenic presentation efficiency compared to the
analogues with the whole antigenic sequence, in DNA vaccination
was reported (Anion L. C. et al . , J. Immunol . 158: 2535, 1997) .
Furthermore the processing of intracellular proteins and
presentation of the respective peptides by Ng-iC class I proteins
in physiologic conditions, underlie the mechanism of
immunological surveillance. For a given protein and a specific
!~iC context, there are peptide fragments termed dominants (i. e.
prevailing on subdominants or cryptics), which are unable to
generate any immune response because they are recognized as
"self". It has now been outlined, according to an aspect of the
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
present invention, that an approach aimed at supporting the non-
dominant epitope presentation by the administration of a mix of
antigen protein fragments is able to elicit a surprising
cytotoxic immune response.
5 Descrifltion of the invention
It has now been found that DNA molecules, encoding
fragments of a protein overexpressed in tumor cells, can be
conveniently used to induce an antigen-specific anti-tumor
immune response .
The invention relates particularly to a pharmaceutical
composition containing one or more DNA encoding Mucin (MUC-1)
protein fragments.
The DNA used in the present invention can be plasmid or
viral DNA, preferably plasmid DNA obtained employing the pMRS30
expression vector described in fig. 13.
The compositions according to the invention contain
preferably at least two DNA fragments of the Mucin (MUC-1) or of
another protein overexpressed in tumor cells.
The compositions according to the invention contain
preferably at least four fragments, each ranging from 200 to
about 700 nucleotides, each sequence being juxtaposed and
possibly partially overlapping, from about 50 to about 150
nucleotides, at the 3' and/or 5' end of the adjacent one.
The DNA fragments according to the invention can be
possibly preceded at the 5' end by a ubiquitin encoding DNA
sequence and possibly also by a LacI portion of Escherichia
coli.
The invention relates also to new DNA fragments and to the
use of Mucin-1 fragments defined above in the medicine and anti-
tumor vaccine preparation.
Description of the fic;ures
Fig. 1
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS166 expression
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
6
vector. This DNA includes the sequence corresponding to
nucleotides 136-339 of the EMBL sequence J05581, preceded by the
translation start codon, ATG and followed by the two translation
stop codons, TGA and TAA. The encoded polypeptide thus includes
a Metionin followed by the amino acids encoded by the 136-339
fragment of the EMBL sequence J05581.
Fig. 2
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pMRS169 expression vector. This DNA includes
the sequence corresponding to nucleotides 205-720 of the EMBL
sequence J05581, preceded by the translation start codon, ATG
and followed by two translation stop codons, TGA and TAA. The
encoded polypeptide thus includes a Metionin followed by the
amino acids encoded by the 205-720 fragment of the EMBL sequence
J05581.
Fig. 3
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the Xbal site of the pMRS30 expression
vector to give the pMRS168 expression vector. This DNA includes
the sequence corresponding to nucleotides 631-1275 of the EMBL
sequence J05581, preceded by the translation start codon, ATG
and followed by two translation stop codons, TGA and TAA. The
encoded polypeptide thus includes a Metionin followed by the
amino acids encoded by the 631-1275 fragment of the EMBL
sequence J05581.
Fig. 4
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pMRS167 expression vector. This DNA includes
the sequence corresponding to nucleotides 1222-1497 of the EMBL
sequence J05581, preceded by the translation start codon, ATG
and followed by two translation stop codons, TGA and TAA. The
encoded polypeptide thus includes a Metionin followed by the
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
7
amino acids encoded by the 1222-1497 fragment of the EMBL
sequence J05581.
Fig. 5
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pMRS175 expression vector. This DNA includes
the sequence corresponding to nucleotides 136-1497 of the EMBL
sequence J05581, preceded by the translation start codon, ATG
and followed by two translation stop codons, TGA and TAA. The
encoded polypeptide thus includes a Metionin followed by the
amino acids encoded by the 136-1497 fragment of the EMBL
sequence J05581.
Fig. 6
Nucleotide DNA sequence (with the respective amino acid
sequence) termed UBILacI. The encoded polypeptide includes the
Ubiquitin sequence fused to a partial sequence of the bacterial
protein beta-galactosidase, as described in Chau V. et a1.
Science 243: 1576, 1989.
Fig. 7
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the expression vector
pMRS30 to give the pMRS171 expression vector. This DNA includes
the sequence termed UBILacI (see fig. 6) fused to the sequence
corresponding to nucleotides 136-339 of the EMBL sequence J05581
followed by two translation stop codons, TGA and TAA. The coded
polypeptide thus includes the amino acid sequence reported in
Fig. 6, fused to the sequence including the amino acids encoded
by the fragment 136-339 of the EMBL sequence J05581.
Fig. 8
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pMRS174 expression vector. This DNA includes
the sequence termed, ITBILacI (see fig. 6) fused to the sequence
partially corresponding to nucleotides 205-720 of the EMBL
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
8
sequence J05581 followed by two translation stop codons, TGA and
TAA. The encoded polypeptide thus includes the amino acid
sequence reported in Fig. 6, fused to the sequence including the
amino acids encoded by the fragment 205-720 of the EMBL sequence
J05581.
Fig. 9
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pMRS173 expression vector. This DNA includes
the sequence termed UBILacI (see fig. 6) fused to the sequence
partially corresponding to nucleotides 631-1275 of the EMBL
sequence J05581 followed by two translation stop codons, TGA and
TAA. The encoded polypeptide thus includes the amino acid
sequence reported in Fig. 6, fused to the sequence including the
amino acids encoded by the fragment 631-1275 of the EMBL
sequence J05581.
Fig. 10
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pMRS30 expression
vector to give the pNIRS172 expression vector. This DNA includes
the sequence termed UBILacI (see fig. 6) fused to the sequence
partially corresponding to nucleotides 1222-1497 of the ENBL
sequence J05581 followed by two translation stop codons, TGA and
TAA. The encoded polypeptide thus includes the amino acid
sequence reported in Fig. 6, fused to the sequence including the
amino acids encoded by the fragment 1222-1497 of the EMBL
sequence J05581.
Fig. 11
Nucleotide DNA sequence (with the respective amino acid
sequence) inserted at the XbaI site of the pNIRS30 expression
vector to give the pMRS176 expression vector. This DNA includes
the sequence named UBILacI (see fig. 6) fused to the sequence
partially corresponding to nucleotides 136-1497 of the EI~L
sequence J05581 followed by two translation stop codons, TGA and
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
9
TAA. The encoded polypeptide thus includes the amino acid
sequence reported in Fig. 6, fused to the sequence including the
amino acids encoded by the fragment 136-1497 of the EMBL
sequence J05581.
Fig. 12
Electrophoretic.analysis on 1~ agarose gel in 1X TBE. mRNA
extracted from CHO, CD34+ dendritic cells and dendritic cells
from PBMC, respectively, transfected with pMRS169, and subjected
to RT-PCR reaction either with (lanes 4, 8, 12) or without
(lanes 5, 9, 13) Reverse Transcriptase. Molecular weight DNA
marker (lane 1); internal negative controls (lanes 2, 6);
internal positive controls (lanes 3, 7, 10, 11); positive
control from Promega kit (lane 14).
Fig. I3
Z5 Nucleotide sequence of the pMRS30 expression vector. The 1-
2862 region corresponds to the AccI (location 504) - BamHI
(location 3369) region of the pSV2CAT vector (EMBL M77788); the
2863-3721 region includes the human cytomegalovirus promoter
(human cytomegalovirus major immediate-early gene enhancer); the
3722-4905 region includes several cloning sites, including XbaI
(location 3727), and the processing signal of the rabbit beta-
globin gene.
Detailed description of the invention
A DNA plasmid pool encoding, in eukaryotic cells, fragments
of the MUC-1 human protein antigen was prepared. Constructs are
based on the mammalian expression vector termed pMRS30,
described in figure 13 and previously claimed in the Patent
Application W095/11982, and contain partial sequences of the
MUC-1 cDNAs reported in the EMBL database with accession number
J05581. MUC-1 encoding DNA was fragmented so that each fragment
represents a discrete portion, partially overlapping to the
adjacent ones. Administration of a mix of such plasmids can
cause different plasmids to transfect different APC cells at the
administration site. Therefore such cells produce and process
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
discrete portions of the MUC-1 protein giving the related
peptides. In those conditions, the occurring subdominant and
cryptic peptides can also be presented in association with class
I MHC molecules thus generating a cytotoxic immune response.
5 The present invention thus relates to the use of a group of
four constructs (Figures 1 to 4) containing MUC-1 cDNA partial
fragments in admixture containing at least two of them and a
group of four constructs (Figures 7 to 10) containing MUC-1 cDNA
partial fragment preceded by the DNA encoding a protein sequence
10 containing Ubiquitin and an Escherichia coli Lac I portion
(Figure 6) used separately or in admixture containing at least
two of them.
The present invention relates also to the use of the
construct (Figure 5) containing the almost complete sequence of
the MUC-1 cDNA and the construct (Figure 11) containing the
almost complete sequence of the MUC-1 cDNA preceded by the DNA
encoding a protein sequence containing Ubiquitin and an
Escherichia coli Lac I portion.
The mixture of the four constructs containing the partial
fragments of the MUC-1 cDNA and the mixture of the four
constructs containing the partial fragments of the MUC-1 cDNA
preceded by the DNA encoding a protein sequence, containing
Ubiquitin and an Escherichia coli Lac I portion, represents a
preferred embodiment of the present invention.
Constructs according to the present invention can be used
in the anti-tumor therapy of patient affected with tumors
characterized by high MUC-1 expression.
Constructs described in the present invention were obtained
as follows.
In the case of the first series of constructs, the
fragments of the MUC-1 DNA were obtained by RT-PCR from BT20
cell line or by DNA partial chemical synthesis. Such fragments
were then cloned into the pNIR.S30 expression vector and verified
by sequencing.
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
11
In the case of the second series of constructs, the
fragments were obtained from the first series of constructs by a
PCR re-amplification. These fragments were then fused to the DNA
encoding the Ubiquitin (obtained by RT-PCR from MCF7 cell line
mRNA) and a partial lacI sequence (obtained by PCR from the
commercial vector pGEX). DNA sequences thus obtained were then
cloned in the pMRS30 expression vector and verified by
sequencing. For the intended therapeutic or prophylactic uses,
fragments or constructs according to the invention are suitably
formulated, using carriers and methods previously employed in
naked DNA vaccines, as described for example in The
Immunologist, 1994, 2:1; WO 90/11092, Proc. Natl. Acad. Sci.
U.S.A., 1986, 83, 9551; US 5580859; Immunology today 19 (1998),
89-97); Proc. Natl. Acad. Sci. U.S.A. 90 (1993), 11478-11482;
Nat. Med. 3 (1997), 526-532; Vaccine I2 (1994), 1495-1498; DNA
Cell. Biol. 12 (1993), 777-783. The dosages will be determined
on the basis of clinical and pharmacological-toxicological
trials. Generally speaking, they will be comprised between 0.005
~g/kg and 5 ~g/kg of the fragment mix. The composition of the
invention can also contain a cytokine or a cytokine encoding
plasmid.
The invention will be further illustrated by means of the
following examples.
Example 1. Plasmid pN~tS166 construction.
BT20 tumor cells (ATCC HTB-19) were cultured in Eagles MEM
supplemented with 10% fetal calf serum. Ten million cells were
trypsinized, washed with PBS, and mRNA extracted.
An aliquot of this RNA was subjected to RT-PCR (reverse
transcriptase-polymerase chain reaction) reaction in ~ the
presence of the following synthetic oligonucleotides:
V11 (5 GATCTCTAGAATGACAGGTTCTGGTCATGCAAGC 3)
V4 (5 GATCTCTAGAAAGCTTATCAACCTGAAGCTGGTTCCGTGGC 3)
T_he produced DNA fragment, purified and digested with the
restriction enzyme XbaI, was cloned into the pMRS30 expression
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
12
vector, containing the human cytomegalovirus promoter and the
beta-globin polyadenylation signal as claimed in the Patent
W09511982. The resulting pMRS166 vector contains a DNA fragment
including the ATG codon, the sequence corresponding to the
nucleotides 136-339 of the EMBL sequence J05581, and two stop
codons, TGA and TAA.
This fragment is reported in fig. 1.
Example 2. Plasmid pl~tS169 construction.
An aliquot of the RNA obtained as reported in example 1 was
amplified by RT-PCR in the presence of the following synthetic
oligonuclotides:
V12 (5 GATCTCTAGAATGGTGCCCAGCTCTACTGAGAAGAATGC 3)
V15 (5 GGCGGTGGAGCCCGGGGCTGGCTTGT 3)
The produced DNA fragment, purified and digested with the
restriction enzymes SmaI and XbaI, was fused, by the SmaI
restriction site, to a DNA fragment entirely synthetically
constructed, and including a sequence partially corresponding to
the nucleotides 457-720 of the EMBL sequence J05581 and two stop
codons, TGA and TAA. The whole fragment was thus cloned in the
XbaI site of the pMRS30 expression vector. The resulting pMRS169
vector contains a DNA fragment including the ATG codon, the
sequence partially corresponding to the nucleotides 205-720 of
the ENIBL sequence J05581, and two stop codons, TGA and TAA.
This fragment is reported in fig. 2.
Example 3. Plasmid pI~2S168 construction.
An aliquot of the RNA obtained as reported in example 1 was
amplified by RT-PCR in the presence of the following synthetic
oligonuclotides:
V13 (5 GATCTCTAGAATGGGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
V8 (5 GATCTCTAGAAAGCTTATCACAAGGCAATGAGATAGACAATGGCC 3)
The produced DNA fragment, purified and digested with the
restriction enzyme XbaI was cloned in the pMRS30 expression
vector. The resulting pNIR.S168 vector contains a DNA fragment
including the ATG codon, the sequence corresponding to the
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
13
nucleotides 631-1275 of the EMBL sequence J05581, and two stop
codons, TGA and TAA.
This fragment is reported in fig. 3.
Example 4. Plasmid pl~tSl67 construction.
An aliquot of the RNA obtained as reported in example 1 was
subjected to RT-PCR reaction in the presence of the following
synthetic oligonucleotides:
VI4 (5 GATCTCTAGAATGCTGGTGCTGGTCTGTGTTCTGGTTGCGC 3)
V10 (5 GATCTCTAGAAAGCTTATCACAAGTTGGCAGAAGTGGCTGC 3)
The produced DNA fragment, purified and digested with the
restriction enzyme XbaI was cloned in the pMRS30 expression
vector. The resulting pMRS167 vector contains a DNA fragment
including the ATG codon, the sequence corresponding to the
nucleotides 1222-1497 of the ENIBL sequence J05581, and two stop
codons, TGA and TAA.
This fragment is reported in fig. 4.
Example 5. Plasmid pNatS175 construction.
pMRS166, 169, 168, 167 plasmids were subjected to PCR
reaction in the presence of the following nucleotide pairs:
V11 (see example 1)
V18 (5 AACCTGAAGCTGGTTCCGTGGC 3) for pMRS166
V19 (5 GTGCCCAGCTCTACTGAGAAGAATGC 3)
V20 (5 GCTGGGAATTGAGAATGGAGTGCTCTTGC 3) for pMRS169
V21 (5 GGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
V22 (5 CAAGGCAATGAGATAGACAATGGCC 3) for pMRS168
V23 (5 CTGGTGCTGGTCTGTGTTCTGGTTGCG 3)
V10 (see example 4) for pMRS167
The four DNA fragments obtained in the respective PCR
reactions were mixed in equimolar amounts and PCR reacted in the
presence of the V11 and V10 oligonuclotides.
The produced DNA f ragment , purified and digested with the
XbaI restriction enzyme, was cloned in the pMRS30 expression
vector. The resulting pMRSI75 vector contains a DNA fragment
including the ATG codon, the sequence partially corresponding to
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
14
the nucleotides 136-1497 of the EMBL sequence J05581 and two
stop codons TGA and TAA.
This fragment is reported in fig. 5.
Example 6. Plasmid pNatS171 construction.
MCF7 tumor cells (ATCC HTB-22) were cultured in Eagles MEM
supplemented with 10% fetal calf serum. Ten million cells were
trypsinized, washed with PBS, and mRNA extracted.
An aliquot of this RNA was subjected to RT-PCR in the
presence of the following synthetic oligonucleotides:
UBIup (5GATCTCTAGAATGCAGATCTTCGTGAAGACCCTGACTGGT 3)
UBIdown
(STCACCAGCGAGACGGGCAACAGCCATGCACCACTACCGTGCCTCCCACCTCTGAGACGGAGC
ACCAGG 3)
The reaction produces a DNA fragment termed fragment 1.
DNA from pGEXIIT (Pharmacia) was subjected to PCR reaction
in the presence of the following synthetic oligonucleotides:
LacIup (5CCTCCGTCTCAGAGGTGGGAGGCACGGTAGTGGTGCATGGCTGTTGCCC
GTCTCGCTGGTGAAAAG 3)
LacIdown (5GATCGGATCCTCGGGAAACCTGTCGTGCCAGCTGC 3)
This reaction gives a DNA fragment termed fragment 2.
The 1 and 2 DNA fragments, obtained in the respective PCR
reactions, were mixed in equimolar amounts and subjected to PCR
reaction in presence of the UBIup and Lacldown oligonucleotides.
The produced DNA fragment, purified and digested with the
restriction enzymes XbaI and BamHI, was cloned into the pUCl8
commercial plasmid. The resulting pMRS156 vector contains a DNA
fragment including the sequence encoding the ubiquitin fused to
the sequence encoding a bacterial beta-galactosidase portion.
This fragment, termed UBILacI, is reported in fig. 6.
Plasmid pMRS166 DNA was subjected to a PCR reaction in
presence of the following synthetic oligonucleotides:
V3 (SGATCGGATCCACAGGTTCTGGTCATGCAAGC 3)
V4 (see Example 1)
The produced DNA fragment, purified and digested with the
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
restriction enzymes XbaI and BamHI, was fused, by ligation into
the two BamHI sites, to the UBILacI fragment deriving from the
pNI~2S156 plasmid. The resulting fragment was cloned into the
pMRS30 expression vector. The resulting pMRS171 vector contains
5 a DNA fragment including the UBILacI sequence, the sequence
corresponding to the 136-339 nucleotides of the EMBL sequence
J05581 and two stop codons, TGA and TAA. This fragment is
reported in fig. 7.
Example 7. Plasmid pNatS174 construction.
10 Plasmid pMRS169 DNA was subjected to PCR reaction in the
presence of the following synthetic oligonucleotides:
V5 (5GATCGGATCCGTGCCCAGCTCTACTGAGAAGAATGC 3)
V6(5GATCTCTAGAAAGCTTATCAGCTGGGAATTGAGAATGGAGTGCTCTTGC 3)
The produced DNA fragment, purified and digested with the
15 restriction enzymes Xbal and BamHI, was fused, by ligation into
the two BamHI sites, to the UBILacI fragment deriving from the
pMRS156 plasmid. The resulting fragment was cloned into the
pMRS30 expression vector. The resulting pMRS174 vector contains
a DNA fragment including the UBILacI sequence, the sequence
corresponding to the 205-720 nucleotides of the ENiBL sequence
J05581, and two stop codons, TGA and TAA. This fragment is
reported in fig. 8.
Example 8. Plasmid pl~tS173 construction.
Plasmid pMRS168 DNA was subjected to PCR reaction in the
presence of the following synthetic oligonucleotides:
V7 (5GATCGGATCCGGCTCAGCTTCTACTCTGGTGCACAACGGC 3)
V8 (see example 3)
The produced DNA fragment, purified and digested with the
restriction enzymes Xbal and BamHI, was fused, by ligation into
the two BamHI sites, to the UBILacI fragment deriving from the
pMRS156 plasmid. The resulting fragment was cloned into the
pMRS30 expression vector. The resulting pMRS173 vector contains
a DNA fragment including the UBILacI sequence, the sequence
corresponding to the 631-1275 nucleotides of the EMBL sequence
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
16
J05581, and two stop codons, TGA and TAA. This fragment is
reported in fig. 9.
Example 9. Plasmid pI~tS172 construction.
Plasmid pMRS167 DNA was subjected to PCR reaction in the
presence of the following synthetic oligonucleotides:
V9 (5 GATCGGATCCCTGGTGCTGGTCTGTGTTCTGGTTGCGC 3)
V10 (see example 4)
The produced DNA fragment, purified and digested with the
restriction enzymes XbaI and BamHI, was fused, by ligation into
the two BamHI sites, to the UBILacI fragment deriving from
pMRS156 plasmid. The resulting fragment was cloned into the
pMRS30 expression vector. The resulting pMRS172 vector contains
a DNA fragment including the UBILacI sequence, the sequence
corresponding to the 1222-1497 nucleotides of the EMBL sequence
J05581, and two stop codons, TGA and TAA. This fragment is
reported in fig. 10.
Example 10. Plasmid pI41tS176 construction.
Plasmid pMRS167 DNA was subjected PCR reaction in the
presence of the following synthetic oligonucleotides:
V3 (see example 6)
V10 (see example 4)
The produced DNA fragment, purified and digested with the
restriction enzymes XbaI and BamHI, was fused, by ligation into
the two BamHI sites, to the UBILacI fragment deriving from
pMRS156 plasmid. The resulting fragment was cloned into the
pMRS30 expression vector. The resulting pMRS176 vector contains
a DNA fragment including the UBILacI sequence, the sequence
corresponding to the 136-1497 nucleotides of the EMBL sequence
J05581, and two stop codons, TGA and TAA. This fragment is
reported in fig. 11.
Example 11. Eukaryotic cell transfection and testing for
transcription.
CHO (Chinese Hamster Ovary) cells were cultured in alpha
MEM supplemented with ribonucleotides and deoxyribonucleotides
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
17
at transfection time.
Dendritic cells were obtained from CD34+ hemopoietic
precursors cultured in IMDM without serum, supplemented with GM
CSF, IL4, SCF, Flt3 and TNFalpha. After 7 days the obtained cell
population was transfected.
Dendritic cells were obtained from monocytes isolated from
PBMC (peripheral blood mononuclear cells), cultured in RPMI
supplemented with FCS, GM-CSF, and IL-4. After 7 days the
obtained cell population was transfected.
In each case, about one million cells were transfected with
one of the plasmids reported in examples 1 to 10. Transfection
was carried out using 3 ~g of plasmid DNA and 4 ~.1 of DMRIE
(Gibco) by lipofection.
After 24 hours cells were harvested, washed with PBS and
lysed in order to extract the mRNA.
A mRNA aliquot was subjected to RT-PCR reaction in the
presence of the oligonucleotide pair specific for the
transfected DNA plasmid.
This experiment was carried out for each plasmid reported
in the examples 1 to 10, using the following oligonucleotide
pairs: V11/V4 for pMRS166, V12/V6 for pMRS169, V13/VS for
pMRS168, V4/V10 for pMRS167, V4/V10 for pMRS175, UBIup/V4 for
pMRS171, UBIup/V6 for pMRS174, UBIup/V8 for pMRS173, UBIup/V10
for pMRS172, V14/V10 for pMRS176.
As a representative example, figure 12 reports the
electrophoretic analysis of the DNA fragments obtained by RT-PCR
from the mRNA of the three cell populations, transfected with
the pMRS169 plasmid. In this case the oligonucleotide pair
V12/V6 was used.
Example 12. In vivo study results.
In the in vivo studies, the mixtures of the four fragments
and the pMRS30 plasmid (vector without insert and thus used as a
negative control) were used. In order to test the occurred
immunization, an ELISA test was used to show the human mucin
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
18
specific antigens.
The in vivo studies were conducted using human MUC1
transgenic C57BL mice. As a consequence in these animals the
MUC1 protein represents a self-protein. The employed vaccination
schedule consists of 3 intradermic (dorsal portion, 50
micrograms DNA for each side) administrations (at days 0, 14,
28) of 100 micrograms plasmid DNA. At day 14 after the last
administration, the animals were sacrificed and sera were tested
for anti-human mucin antibodies.
The assayed fragment mixes, object of the present
invention, stimulated a good immune response in the treated
animals.
On the other hand, vaccination experiments with a 60
aminoacid peptide corresponding to the 20 aminoacids reported in
fig. 2, from location 86 to location 105, repeated three times
(this peptide is termed 3XTR}, were also carried out.
The two vaccinations differ in the type of the elicited
antibody response. The antibody titer results much more higher
in the vaccination with 3XTR. Furthermore the noticed IgG
subtypes are in favor of an essentially humoral (antibody)
response in the case of vaccination with 3XTR, and of a cellular
response (cytotoxic) in the case of vaccination with DNA. For
anti-tumor therapy, a principally cytotoxic immune response is
preferable. Because the experiments were carried out on
transgenic mice, in whom the human mucin is "self", we can
foresee a similar response in humans. This response could
justify the use, as DNA vaccines, of the compounds of the
present invention in the treatment of MUC1 overxpressing human
tumors.
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
SEQUENCE LISTING
<110> MENARINI RICERCHE S.p.A.
<120> PHARMACEUTICAL COMPOSITION, CONTAINING FRAGMENTS OF AN
ANTIGENIC PROTEIN ENCODING DNA ENDOWED WITH ANTI-TUMOR
EFFECT
<130> 5653MEUR
<140>
<141>
<150> MI98A002330
<151> 1998-10-30
<160> 35
<170> PatentIn Ver. 2.1
<210> 1
<211> 213
<212> DNA
<213> human
<400> 1
atgacaggtt ctggtcatgc aagctctacc ccaggtggag aaaaggagac ttcggctacc 60
cagagaagtt cagtgcccag ctctactgag aagaatgctg tgagtatgac cagcagcgta 120
ctctccagcc acagccccgg ttcaggctcc tccaccactc agggacagga tgtcactctg 180
gccccggcca cggaaccagc ttcaggttga taa 213
<210> 2
<211> 525
<2i2> DNA
<213> human
<400> 2
atggtgccca gctctactga gaagaatgct gtgagtatga ccagcagcgt actctccagc 60
cacagccccg gttcaggctc ctccaccact cagggacagg atgtcactct ggccccggcc 120
acggaaccag cttcaggttc agctgccacc tggggacagg atgtcacctc ggtcccagtc 180
accaggccag ccctgggctc caccaccccg ccagcccacg atgtcacctc agccccggac 240
aacaagccag ccccgggaag tactgctcca ccagcacacg gtgttacctc ggctccggat 300
accaggccgg ccccaggtag taccgcccct cctgcccatg gtgtcacatc tgccccggac 360
aacaggcctg cattgggtag tacagcaccg ccagtacaca acgttactag tgcctcaggc 420
tc~gctagcg gctcagcttc tactctggtg cacaacggca cctctgcgcg cgcgaccaca 480
accccagcga gcaagagcac tccattctca attcccagct gataa 525
1
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<210> 3
<211> 654
<212> DNA
<213> human
<400> 3
atgggctcag cttctactct ggtgcacaac ggcacctctg ccagggctac cacaacccca 60
gccagcaaga gcactccatt ctcaattccc agccaccact ctgatactcc taccaccctt 120
gccagccata gcaccaagac tgatgccagt agcactcacc atagcacggt acctcctctc 180
acctcctcca atcacagcac ttctccccag ttgtctactg gggtctcttt ctttttcctg 240
tcttttcaca tttcaaacct ccagtttaat tcctctctgg aagatcccag caccgactac 300
taccaagagc tgcagagaga catttctgaa atgtttttgc agatttataa acaagggggt 360
tttctgggcc tctccaatat taagttcagg ccaggatctg tggtggtaca attgactctg 420
gccttccgag aaggtaccat caatgtccac gacgtggaga cacagttcaa tcagtataaa 480
acggaagcag cctctcgata taacctgacg atctcagacg tcagcgtgag tgatgtgcca 540
tttcctttct ctgcccagtc tggggctggg gtgccaggct ggggcatcgc gctgctggtg 600
ctggtctgtg ttctggttgc gctggccatt gtctatctca ttgccttgtg ataa 654
<210> 4
<21I> 285
<212> DNA
<213> human
<400> 4
atgctggtgc tggtctgtgt tctggttgcg ctggccattg tctatctcat tgccttggct 60
gtctgtcagt gccgccgaaa gaactacggg cagctggaca tctttccagc ccgggatacc 120
taccatccta tgagcgagta ccccacctac cacacccatg ggcgctatgt gccccctagc 180
agtaccgatc gtagccccta tgagaaggtt tctgcaggta atggtggcag cagcctctct 240
tacacaaacc cagcagtggc agccacttct gccaacttgt gataa 285
<210> 5
<211> 1371
<212> DNA
<213> human
<400> 5
atgacaggtt ctggtcatgc aagctctacc ccaggtggag aaaaggagac ttcggctacc 60
cagagaagtt cagtgcccag ctctactgag aagaatgctg tgagtatgac cagcagcgta 120
ctctccagcc acagccccgg ttcaggctcc tccaccactc agggacagga tgtcactctg 180
gccccggcca cggaaccagc ttcaggttca gctgccacct ggggacagga tgtcacctcg 240
gtcccagtca ccaggccagc cctgggctcc accaccccgc cagcccacga tgtcacctca 300
gccccggaca acaagccagc cccgggaagt accgctccac cagcacacgg tgttacctcg 360
gctccggata ccaggccggc cccaggtagt accgcccctc ctgcccatgg tgtcacatct 420
gccccggaca acaggcctgc attgggtagt acagcaccgc cagtacacaa cgttactagt 480
gcctcaggct ctgctagcgg ctcagcttct actctggtgc acaacggcac ctctgcgcgc 540
2
CA 02348745 2001-04-27
WO 00/Z5827 PCT/EP99/07874
gcgaccacaa ccccagcgag caagagcact ccattctcaa ttcccagcca ccactctgat 600
actcctacca cccttgccag ccatagcacc aagactgatg ccagtagcac tcaccatagc 660
acggtacctc ctctcacctc ctccaatcac agcacttctc cccagttgtc tactggggtc 720
tctttctttt tcctgtcttt tcacatttca aacctccagt ttaattcctc tctggaagat 780
cccagcaccg actactacca agagctgcag agagacattt ctgaaatgtt tttgcagatt 840
tataaacaag ggggttttct gggcctctcc aatattaagt tcaggccagg atctgtggtg 900
gtacaattga ctctggcctt ccgagaaggt accatcaatg tccacgacgt ggagacacag 960
ttcaatcagt ataaaacgga agcagcctct cgatataacc tgacgatctc agacgtcagc 1020
gtgagtgatg tgccatttcc tttctctgcc cagtctgggg ctggggtgcc aggctggggc 1080
atcgcgctgc tggtgctggt ctgtgttctg gttgcgctgg ccattgtcta tctcattgcc 1140
ttggctgtct gtcagtgccg ccgaaagaac tacgggcagc tggacatctt tccagcccgg 1200
gatacctacc atcctatgag cgagtacccc acctaccaca cccatgggcg ctatgtgccc 1260
cctagcagta ccgatcgtag cccctatgag aaggtttctg caggtaatgg tggcagcagc 1320
ctctcttaca caaacccagc agtggcagcc acttctgcca acttgtgata a 1371
<210> 6
<211> 369
<212> DNA
<213> human
<400> 6
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 304
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatcc 369
<210> 7
<211> 579
<212> DNA
<213> human
<400> 7
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 300
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatcca caggttctgg tcatgcaagc tctaccccag gtggagaaaa ggagacttcg 420
gctacccaga gaagttcagt gcccagctct actgagaaga atgctgtgag tatgaccagc 480
agcgtactct ccagccacag ccccggttca ggctcctcca ccactcaggg acaggatgtc 540
actctggccc cggccacgga accagcttca ggttgataa 579
3
CA 02348745 2001-04-27
WO 00/25827 PC'T/EP99/07874
<210> 8
<211> 891
<212> DNA
<213> human
<400> 8
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 300
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatccg tgcccagctc tactgagaag aatgctgtga gtatgaccag cagcgtactc 420
tccagccaca gccccggttc aggctcctcc accactcagg gacaggatgt cactctggcc 480
ccggccacgg aaccagcttc aggttcagct gccacctggg gacaggatgt cacctcggtc 540
ccagtcacca ggccagccct gggctccacc accccgccag cccacgatgt cacctcagcc 600
ccggacaaca agccagcccc gggaagtact gctccaccag cacacggtgt tacctcggct 660
ccggatacca ggccggcccc aggtagtacc gcccctcctg cccatggtgt cacatctgcc 720
ccggacaaca ggcctgcatt gggtagtaca gcaccgccag tacacaacgt tactagtgcc 780
tcaggctctg ctagcggctc agcttctact ctggtgcaca acggcacctc tgcgcgcgcg 840
accacaaccc cagcgagcaa gagcactcca ttctcaattc ccagctgata a 891
<210> 9
<211> 1020
<212> DNA
<213> human
<400> 9
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 300
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatccg gctcagcttc tactctggtg cacaacggca cctctgccag ggctaccaca 420
accccagcca gcaagagcac tccattctca attcccagcc accactctga tactcctacc 480
acccttgcca gccatagcac caagactgat gccagtagca ctcaccatag cacggtacct 540
cctctca.cct cctccaatca cagcacttct ccccagttgt ctactggggt ctctttcttt 600
ttcctgtctt ttcacatttc aaacctccag tttaattcct ctctggaaga tcccagcacc 660
gactactacc aagagctgca gagagacatt tctgaaatgt ttttgcagat ttataaacaa 720
gggggttttc tgggcctctc caatattaag ttcaggccag gatctgtggt ggtacaattg 780
actctggcct tccgagaagg taccatcaat gtccacgacg tggagacaca gttcaatcag 840
tataaaacgg aagcagcctc tcgatataac ctgacgatct cagacgtcag cgtgagtgat 900
gtgccatttc ctttctctgc ccagtctggg gctggggtgc caggctgggg catcgcgctg 960
ctggtgctgg tctgtgttct ggttgcgctg gccattgtct atctcattgc cttgtgataa 1020
4
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<210> 10
<211> 651
<212> DNA
<213> human
<400> 10
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 300
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatccc tggtgctggt ctgtgttctg gttgcgctgg ccattgtcta tctcattgcc 420
ttggctgtct gtcagtgccg ccgaaagaac tacgggcagc tggacatctt tccagcccgg 480
gatacctacc atcctatgag cgagtacccc acctaccaca cccatgggcg ctatgtgccc 540
cctagcagta ccgatcgtag cccctatgag aaggtttctg caggtaatgg tggcagcagc 600
ctctcttaca caaacccagc agtggcagcc acttctgcca acttgtgata a 651
<210> 11
<211> 1737
<212> DNA
<213> human
<400> 11
atgcagatct tcgtgaagac cctgactggt aagaccatca ctctcgaagt ggagccgagt 60
gacaccattg agaatgtcaa ggcaaagatc caagacaagg aaggcatccc tcctgaccag 120
cagaggctca tctttgcagg caagcagctg gaagatggcc gcactctttc tgactacaac 180
atccagaaag agtccaccct gcacctggtg ctccgtctca gaggtgggag gcacggtagt 240
ggtgcatggc tgttgcccgt ctcgctggtg aaaagaaaaa ccaccctggc gcccaatacg 300
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc 360
cgaggatcca caggttctgg tcatgcaagc tctaccccag gtggagaaaa ggagacttcg 420
gctacccaga gaagttcagt gcccagctct actgagaaga atgctgtgag tatgaccagc 480
agcgtactct ccagccacag ccccggttca ggctcctcca ccactcaggg acaggatgtc 540
actctggccc cggccacgga accagcttca ggttcagctg ccacctgggg acaggatgtc 600
acctcggtcc cagtcaccag gccagccctg ggctccacca ccccgccagc ccacgatgtc 660
acctcagccc cggacaacaa gccagccccg ggaagtaccg ctccaccagc acacggtgtt 720
acctcggctc cggataccag gccggcccca ggtagtaccg cccctcctgc ccatggtgtc 780
acatctgccc cggacaacag gcctgcattg ggtagtacag caccgccagt acacaacgtt 840
actagtgcct caggctctgc tagcggctca gcttctactc tggtgcacaa cggcacctct 900
gcacgcgcga ccacaacccc agcgagcaag agcactccat tctcaattcc cagccaccac 960
tctgatactc ctaccaccct tgccagccat agcaccaaga ctgatgccag tagcactcac 1020
catagcacgg tacctcctct cacctcctcc aatcacagca cttctcccca gttgtctact 1080
ggggtctctt tctttttcct gtcttttcac atttcaaacc tccagtttaa ttcctctctg 1140
gaagatccca gcaccgacta ctaccaagag ctgcagagag acatttctga aatgtttttg 1200
cagatttata aacaaggggg ttttctgggc ctctccaata ttaagttcag gccaggatct 1260
gtggtggtac aattgactct ggccttccga gaaggtacca tcaatgtcca cgacgtggag 1320
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
acacagttca atcagtataa aacggaagca gcctctcgat ataacctgac gatctcagac 1380
gtcagcgtga gtgatgtgcc atttcctttc tctgcccagt ctggggctgg ggtgccaggc 1440
tggggcatcg cgctgctggt gctggtctgt gttctggttg cgctggccat tgtctatctc 1500
attgccttgg ctgtctgtca gtgccgccga aagaactacg ggcagctgga catctttcca 1560
gcccgggata cctaccatcc tatgagcgag taccccacct accacaccca tgggcgctat 1620
gtgcccccta gcagtaccga tcgtagcccc tatgagaagg tttctgcagg taatggtggc 1680
agcagcctct cttacacaaa cccagcagtg gcagccactt ctgccaactt gtgataa 1737
<210> 12
<211> 4905
<212> DNA
<213> human
<400> 12
ccaggaagct cctctgtgtc ctcataaacc ctaacctcct ctacttgaga ggacattcca 60
atcataggct gcccatccac cctctgtgtc ctcctgttaa ttaggtcact taacaaaaag 120
gaaattgggt aggggttttt cacagaccgc tttctaaggg taattttaaa atatctggga 180
agtcccttcc actgctgtgt tccagaagtg ttggtaaaca gcccacaaat gtcaacagca 240
gaaacataca agctgtcagc tttgcacaag ggcccaacac cctgctcatc aagaagcact 300
gtggttgctg tgttagtaat gtgcaaaaca ggaggcacat tttccccacc tgtgtaggtt 360
ccaaaatatc tagtgttttc atttttactt ggatcaggaa cccagcactc cactggataa 420
gcattatcct tatccaaaac agccttgtgg tcagtgttca tctgctgact gtcaactgta 480
gcattttttg gggttacagt ttgagcagga tatttggtcc tgtagtttgc taacacaccc 540
tgcagctcca aaggttcccc accaacagca aaaaaatgaa aatttgaccc ttgaatgggt 600
tttccagcac cattttcatg agttttttgt gtccctgaat gcaagtttaa catagcagtt 660
accccaataa cctcagtttt aacagtaaca gcttcccaca tcaaaatatt tccacaggtt 720
aagtcctcat ttaaattagg caaaggaatt cttgaagacg aaagggcctc gtgatacgcc 780
tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc 840
ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 900
cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga 960
gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt 1020
ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag 1080
tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag 1140
aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg 1200
ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg 1260
agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 1320
gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag 1380
gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc 1440
gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg 1500
cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc 1560
ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg 1620
cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg 1680
gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga 1740
cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac 1800
tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa 1860
aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 1920
aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 1980
6
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 2040
cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 2100
ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc 2160
accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 2220
tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 2280
cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 2340
gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 2400
ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 2460
cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 2520
tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 2580
ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct 2640
ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata 2700
ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 2760
gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atatggtgca 2820
ctctcagtac aatctgctct gatgccgcat agttaagcca gtatacaatc aatattggcc 2880
attagccata ttattcattg gttatatagc ataaatcaat attggctatt ggccattgca 2940
tacgttgtat ccatatcata atatgtacat ttatattggc tcatgtccaa cattaccgcc 3000
atgttgacat tgattattga ctagttatta atagtaatca attacggggt cattagttca 3060
tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc 3120
gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat 3180
agggactttc cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt 3240
acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc 3300
cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta 3360
cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg 3420
atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt 3480
gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac 3540
gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcagagctc gtttagtgaa 3600
ccgtcagatc gcctggagac gccatccacg ctgttttgac ctccatagaa gacaccggga 3660
ccgatccagc ctccgcggcc gggaacggtg cattggaacg cggattcccc gtgccaagaa 3720
agcttgtcta gaacccggga gagctcctga gaacttcagg gtgagtttgg ggacccttga 3780
ttgttctttc tttttcgcta ttgtaaaatt catgttatat ggagggggca aagttttcag 3840
ggtgttgttt agaatgggaa gatgtccctt gtatcaccat ggaccctcat gataattttg 3900
tttctttcac tttctactct gttgacaacc attgtctcct cttattttct tttcattttc 3960
tgtaactttt tcgttaaact ttagcttgca tttgtaacga atttttaaat tcacttttgt 4020
ttatttgtca gattgtaagt actttctcta atcacttttt tttcaaggca atcagggtat 4080
attatattgt acttcagcac agttttagag aacaattgtt ataattaaat gataaggtag 4140
aatatttctg catataaatt ctggctggcg tggaaatatt cttattggta gaaacaacta 4200
catcctggtc atcatcctgc ctttctcttt atggttacaa tgatatacac tgtttgagat 4260
gaggataaaa tactctgagt ccaaaccggg cccctctgct aaccatgttc atgccttctt 4320
ctttttccta cagctcctgg gcaacgtgct ggttgttgtg ctgtctcatc attttggcaa 4380
agaattcact cctcaggtgc aggctgccta tcagaaggtg gtggctggtg tggccaatgc 4440
cctggctcac aaataccact gagatctttt tccctctgcc aaaaattatg gggacatcat 4500
gaagcccctt gagcatctga cttctggcta ataaaggaaa tttattttca ttgcaatagt 4560
gtgttggaat tttttgtgtc tctcactcgg aaggacatat gggagggcaa atcatttaaa 4620
acatcagaat gagtatttgg tttagagttt ggcaacatat gccatatgct ggctgccatg 4680
aacaaaggtg gctataaaga ggtcatcagt atatgaaaca gccccctgct gtccattcct 4740
tattccatag aaaagccttg acttgaggtt agattttttt tatattttgt tttgtgttat 4800
ttttttcttt aacatcccta aaattttcct tacatgtttt actagccaga tttttcctcc 4860
7
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
tctcctgact actcccagtc atagctgtcc ctcttctctg gatcc 4905
<210> 13
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 13
gatcggatcc acaggttctg gtcatgcaag c 31
<210> 14
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 14
gatctctaga aagcttatca acctgaagct ggttccgtgg c 41
<210> 15
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 15
gatcggatcc gtgcccagct ctactgagaa gaatgc 36
<210> 16
<211> 49
< 212 > DtdA
<213> Artificial Sequence
<220>
8
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 16
gatctctaga aagcttatca gctgggaatt gagaatggag tgctcttgc 49
<210> 17
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<4ao> 1~
gatcggatcc ggctcagctt ctactctggt gcacaacggc 40
<210> 18
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 18
gatctctaga aagcttatca caaggcaatg agatagacaa tggcc 45
<210> 19
<211> 38
<212> DNA
<223> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<4~~0> 19
ga~cggatcc ctggtgctgg tctgtgttct ggttgcgc 38
<2~0> 20
<2_1> 41
9
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 20
gatctctaga aagcttatca caagttggca gaagtggctg c 41
<210> 21
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 21
gatctctaga atgacaggtt ctggtcatgc aagc 34
<210> 22
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 22
gatctctaga atggtgccca gctctactga gaagaatgc 39
<210> 23
<211> 43
<2i2> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 23
gatctctaga atgggctcag cttctactct ggtgcacaac ggc 43
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<210> 24
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 24
gatctctaga atgctggtgc tggtctgtgt tctggttgcg c 41
<210> 25
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 25
ggcggtggag cccggggctg gcttgt 26
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 26
aacctgaagc tggttccgtg gc 22
<210> 27
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
11
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
oligonucleotide
<400> 27
gtgcccagct ctactgagaa gaatgc 26
<210> 28
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 28
gctgggaatt gagaatggag tgctcttgc 29
<210> 29
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 29
ggctcagctt ctactctggt gcacaacggc 30
<210> 30
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 30
caaggcaatg agatagacaa tggcc 25
<210> 31
<211> 27
<212> DNA
12
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99/07874
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 31
ctggtgctgg tctgtgttct ggttgcg 2~
<210> 32
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 32
gatctctaga atgcagatct tcgtgaagac cctgactggt 40
<210> 33
<211> 68
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 33
tcaccagcga gacgggcaac agccatgcac cactaccgtg cctcccacct ctgagacgga 60
gcaccagg 68
<210> 34
<211> 66
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 34
cctccgtctc agaggtggga ggcacggtag tggtgcatgg ctgttgcccg tctcgctggt 60
13
CA 02348745 2001-04-27
WO 00/25827 PCT/EP99I07874
gaaaag 66
<210> 35
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
oligonucleotide
<400> 35
gatcggatcc tcgggaaacc tgtcgtgcca gctgc 35
14
