Note: Descriptions are shown in the official language in which they were submitted.
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/Z5497
MULTIDOMAIN POLYNUCLEOTIDE MOLECULAR SENSORS
CROSS-REFERENCES TO RELATED APPLICATIONS
This application claims priority benefit of U.S. Application Serial No.
60/106,829, filed November 3, 1998, and U.S. Application Serial No.
60/126,683, filed March 29, 1999.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
This invention was made with partial government support under grants
from the NIH (GM57500 and GM59343) and the Defense Advance Research
Projects Agency (DARPA). The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
1. Field of the Invention. This invention relates to a special class of
allosteric polynucleotides and processes for generating highly specific
polynucleo-
tide sensors with relative ease and efficiency.
2. Description of the Related Art. Mastery of the molecular forces that
dictate biopolymer folding and function would allow molecular engineers to
participate in the design of enzymes - a task that to date has been managed
largely
by the random processes of evolution. The reward for acquiring this capability
is
substantial considering that many applications in medicine, industry and
biotech-
nology demand high-speed enzymes with precisely tailored catalytic functions.
'Modular rational design' has proven to be an effective means for conferring
additional chemical and kinetic complexity upon existing protein (e.g. 1-4)
and
RNA enzymes (5-9). This engineering strategy takes advantage of the modular
CA 02348779 2001-04-24
WO 00/26226 PCTNS99/25497
2
nature of many protein (10) and RNA subdomains (11-13), which can be judi-
ciously integrated to form new multifunctional constructs. The recent
discoveries
of new catalytic RNA motifs (14, 15) and new ligand-binding motifs (16, 17)
have
considerably expanded the opportunities for ribozyme engineering.
Modular rational design has been used to create several artificial
ribozymes that are activated or deactivated by the binding of specific small
organic
molecules such as ATP (5,8) and flavin mononucleotide (FMN) (9). Each of these
allosteric ribozymes is composed of two independent structural domains: one an
RNA-cleaving ribozyme and the other a receptor (or "aptamer") for a specific
10 ligand. The conformational changes that occur within an aptamer domain upon
introduction of the ligand, termed "adaptive binding" (22-25), can trigger
kinetic
modulation of the adjoining catalytic domain by several different mechanisms
that
ultimately influence ribozyme folding (7, 8) .
Several groups of investigators have suggested that ribozymes or other
15 nucleic acids might be used in assays and the like. For example,
diagnostics using
ribozymes that catalyze the cleavage and release of a non-complementary,
labelled
nucleic acid co-target marker in the presence of a specific nucleic acid
target
molecule has been disclosed (43). Nucleic acid molecules which have no
catalytic
acitvity without a specific protein or nucleic acid co-factor and feature
catalytic
20 activity only in the presence of the same macromolecular co-factor have
been
disclosed as useful primarily in therapeutics (44). Bioreactive allosteric
polynu-
cleotides that modify a function or configuration of the polynucleotide with a
chemical effector and/or physical signal were disclosed for biosensors and/or
enzymes for diagnostic and catalytic purposes (45).
25 In nearly all examples reported to date, allosteric ribozymes have been
created by joining preexisting ligand-binding domains (or "aptamers") with
ribozyme domains to produce the ligand-responsive construct of choice (9, 65).
Since these methods require the use of preexisting ribozyme and ligand-binding
structures, the limited number of RNA domains that are currently available
CA 02348779 2001-04-24
WO 00/26226 PCTNS99125497
3
restricts the versatility of allosteric ribozyme engineering. Moreover, while
modular rational design alone or combined with in vitro selection techniques
has
been succeessful in producing allosteric catalysts from pre-existing aptamer
and
ribozyme motifs, the process can be slow and tedious. Many previously
described
5 procedures necessary to identify nucleic acids having specified binding or
catalytic
properties involve step-wise iterations of binding, partititioning and
amplification
(46-53). Furthermore, exclusive use of modular rational design precludes the
development of allosteric ribozymes controlled by effectors for which no
aptamer
motifs exist.
BRIEF SUMMARY OF THE INVENTION
It is an objective of the invention to use the combined application of
modular rational design, in vitro selection, and allosteric selection to
provide an
effective strategy for the rapid generation of precision polynucleotide
molecular
sensors.
15 It is another objective of the invention to provide specific ways of
employing polynucleotides as novel sensors and as in vivo genetic control
elements
for the regulation and/or report of gene expression.
It is a further objective of the invention to provide polynucleotide
sensing elements for use in a variety of clinical, industrial, agricultural,
and
environmental analyses.
These and other objectives are accomplished by the present invention,
which provides purified functional polynucleotides comprising an actuator
domain,
a receptor domain, and a bridging domain, wherein a signalling event such as
binding of a ligand to the receptor domain triggers a conformational change in
the
25 bridging domain which then modulates the catalytic and/or reporter activity
of the
actuator domain. The domains may be partially or completely overlapping or non-
overlapping such that one or more domain functions may be encoded in part by
the
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
4
same polynucleotide sequence. The polynucleotides can comprise RNA and/or
RNA analogues or DNA and/or DNA analogues; tripartite ribozymes are illustrat-
ed in the examples.
Also provided are processes for screening for multidomain polynucleo-
tide sensors using allosteric selection. In a typical process, a structural
component
of a multidomain allosteric polynucleotide is replaced with a random-sequence
domain to develop new receptor domains or even new actuator domains using in
vitro selection. Briefly, using an example process, randomization of the
ligand-
binding region of a polynucleotide generates new, structurally diverse
polynucleo-
tides that can then be screened to interact with other ligands.
Polynucleotide sensors of the invention are employed to qualitatively or
quantitatively measure a variety of ligands, including, but not limited to,
organic
and/or inorganic compounds, metal ions, pharmaceuticals, microbial or cellular
metabolites, blood or urine components, components of other bodily fluids, and
macromolecules. The sensors can also be employed to respond to electromagnetic
signals and/or physical signals such as temperature, light, sound, shock, pH,
and
ionic conditions. The sensors are attached to a solid support in some embodi-
ments. Also provided are biosensors having multidomain polynucleotides of the
invention as sensing elements.
Polynucleotide sensors of the invention may also be used in vivo as
genetic control elements that regulate or report gene expression in response
to a
ligand or signal, including non-invasive diagnostics and gene therapy
strategies.
In this aspect, methods of the invention encompass methods for regulating
expres-
sion of a gene in a cell by operably linking polynucleotides of the invention
to
genetic molecules of a cell such that the biological or phenotypic activity
encoded
by the gene is modulated in accordance with modulation of the activity of the
actuator domain. In embodiments involving expression of genes using RNA,
multidomain polynucleotide sensors may be incorporated in the coding region of
mRNA or in close proximity, but also in the 5'-leader or 3'-tail regions. In
DNA
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/Z5497
5
embodiments, polynucleotide sensors may be incorporated in regions that signal
gene destruction as well as gene expression.
Processes for generating ligand-responsive and other multidomain
sensors of the invention are also provided by the generation of novel
allosteric
5 molucules using modular rational design strategies. In typical embodiments,
a
necessary structural component of an allosteric ribozyme is replaced with a
random-sequence domain to produce polynucleotides having new effector-binding
sites or new effector-modulated catalytic domains that can be screened using
in
vitro selection. Briefly, in one embodiment, for example, randomization of the
10 ligand-binding region of an allosteric ribozyme generates new structural
diversity
and a family of structurally parallel polynucleotides that are screened for
their
efficiency in responding to, and/or reporting, ligand binding. By using this
allosteric selection strategy, new allosteric ribozymes with specificity for a
great
variety of effector molecules are generated.
15 Methods for using multidomain polynucleotide sensors of the invention
are correspondingly provided, as are processes for preparing polynucleotides
that
are responsive to the presence or absence of a signalling agent such as a
chemical
ligand that binds to the receptor domain. Also provided are analytical sensors
having multidomain polynucleotides of the invention as sensing elements.
20 BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the design of initial populations for allosteric selection of
aptamer domains and allosteric hammerhead ribozymes (SEQ ID NOs 1 and 2). A
random-sequence region that is x nucleotides (where x = any length) is
appended
to the catalytic nucleic acid motif directly (A) or through an existing
communica-
25 tion module such as the class I induction module (B) . N represents any
nucleotide
identity and the arrowhead indicates the site of cleavage within the
hammerhead
CA 02348779 2001-04-24
WO 00/26226 PC'T/US99i25497
6
ribozyme domain. In alternate embodiments (not shown) other ribozyme and
deoxyribozyme motifs are used.
Figure 2 illustrates combined modular rational design and in vitro
selection for FMN-sensitive allosteric ribozymes. (A) Tripartite construct
consist-
s ing of a hammerhead ribozyme joined to an FMN-binding aptamer (boxed, SEQ
ID NO: 3) via a random-sequence bridge composed of eight nucleotides (N). The
three stems that form the unmodified ribozyme are designated I, II and III and
the
site of RNA cleavage is indicated by the arrowhead. The randomized bridge
serves both as a partial replacement for stem II of the ribozyme and as a
flanking
stem for the aptamer. The G-C base pair immediately adjacent to the catalytic
core is needed for the hammerhead ribozyme to achieve maximal catalytic
activity
(9,42). Selection for FMN-inducible (B) and FMN-inhibited (C) allosteric
ribozymes gave rise to RNA populations that respond either positively or
negative-
ly to the presence of FMN, respectively. The initial RNA pool (GO) and succes-
sive RNA populations (G1 through G6) are identified.
Figure 3 shows bridge sequences and kinetic parameters for individual
allosteric ribozymes. (A) Sequences and corresponding ribozyme rate constants
for eight classes of induction elements isolated from G6. Plotted for each
class is
the logarithm of the observed rate constant for self cleavage in the absence
(open
circles) or presence (filled circles) of FMN. The base pairing schemes
depicted
for each bridge were generated by assuming that no base-pair shift relative to
the
G-C base pair remaining in stem II had occurred. Indicated are classes that
display greater than 20°k misfolding (*) and a class wherein an
extraneous
mutation exists in the stem-loop region of the aptamer domain (+). H1 is an
unmodified hammerhead ribozyme (4,7,$) that displays maximum catalytic
activity
and that remains unaffected by the presence of FMN. (B) Fold-activation of
catalytic activity (kob$+~kobs ) achieved in the presence of ligand for each
class of
FMN-inducible ribozyme. (C) Sequences and corresponding ribozyme rate
constants for five classes of inhibition elements isolated from G6. Nucleotide
deletions are represented as dashes. (D) Fold-inhibition of catalytic activity
CA 02348779 2001-04-24
WO OOIZ6226 PCTNS99/25497
7
(k~s /lc~S+) achieved in the presence of ligand for each class of FMN-
inhibited
ribozyme.
Figure 4 illustrates rapid ligand-dependent modulation of allosteric ribo-
zymes. Tripartite ribozyme constructs carrying either a class I induction
element
(A) or a class II inhibition element (B) are depicted. Sequences for the
aptamer
and ribozyme domains are as shown in Figure 2. The performance of these
ribozymes in the presence and absence of FMN are evident from plots (C) and
(D), which show the natural logarithm of the fraction ribozyme remaining un-
cleaved versus time relative to FMN addition. Inset plots provide an expanded
view of ribozyme responses to FMN addition.
Figure 5 shows the proposed 'slip-structure' mechanism for allosteric
regulation mediated by the class I induction element (A) and class II
inhibition
element (B) is illustrated. Shown are the proposed stem II secondary
structures of
the ligand-bound and unbound states of the FMN-modulated ribozymes. Not
depicted are the left- and right-flanking sequences which comprise the aptamer
and
ribozyme domains, respectively. Asterisks denote the G and C residues of the
hammerhead ribozyme that must pair to support catalysis, and the A and G
residues of the FMN aptamer that become paired upon ligand binding. Also
shown are bimolecular ribozyme constructs containing stem II elements designed
to simulate the active or inactive slip structures proposed for the class I
induction
module (C; I-1 through I-3, SEQ ID NOs 4 to 6) or the class II inhibition
module
(D; II-1 and II-2, SEQ ID NO: 7). Thick lines identify nucleotides that form
the
bridge elements. Mutations made within I-3 to reinforce the desired base-
pairing
conformation are encircled.
Figure 6 illustrates modular characteristics of the class I induction
element. (A) Sequence and secondary structures of allosteric ribozyme
constructs
containing either an FMN, theophylline, or ATP aptamer (constructs I(f), I(t),
and
I(a), respectively). The terminal A~G or G-C base pairs of each aptamer
(denoted
by asterisks) are interactions stabilized by ligand binding. (B) Qualitative
assess-
CA 02348779 2001-04-24
WO 00/26226
8
PCTNS99/25497
went of the specificity of ligand-induced ribozyme self-cleavage. Internally
s2p-labeled constructs were incubated at 23°C for 15 min in the absence
(-) or
presence of FMN (F; 200 ~.M), theophylline (T; 1 mM), or ATP (A; 1 mM). (C)
Kinetic parameters k°bs (open circles) and lc~s+ (filled circles)
determined for
each allosteric ribozyme construct in the absence or presence of its cognate
ligand,
respectively. (D) Allosteric activation of ribozyme function
(k°b$+/kd,s ) is depicted
for each construct.
Figure 7. (A) Initial population (GO) for the in vitro selection of theo-
phylline-sensitive allosteric hammerhead ribozymes. The theophylline aptamer
(SEQ ID NO: 8) is appended to stem II of the hammerhead ribozymes through a
random sequence region consisting of 10 nucleotides. N represents any
nucleotide
identity. The site of self-cleavage is indicated by the arrowhead. (B) In
vitro
selection and amplification of theophylline-activated allosteric hammerhead
ribozymes. The fraction of each population that cleaves in the absence (open
bars)
or presence (filled bars) of theophylline is shown on the left axis, while the
corresponding rate constant for self cleavage is indicated on the right axis.
Figure 8 illustrates the tripartite design for allosteric ribozyme construc-
tion like that shown in Figure 1. (A) Sequence and secondary structure for an
FMN-sensitive allosteric ribozyme (66). In this construct, the cm+FMN1 commu-
nication module (boxed) separates the ribozyme and aptamer domains. This
communication module (cm) is the first sequence class (1) that was previously
identified to undergo allosteric activation (+) in the presence of flavin
mononucle-
otide (FMN). Base-paired elements that are required for hammerhead ribozyme
activity (I, II and III) are labeled according to Hertel, et al (72). An
arrowhead
identifies the site of hammerhead-mediated cleavage. (B) A tripartite
construct
carrying a randomized aptamer domain used as the pool to initiate in vitro
selec-
tion. N~ represents 25 nucleotides with random base identity.
Figure 9 shows the allosteric selection scheme and the isolation of RNA
sensors with new effector specificities. (A) Precursor RNAs are (I) subjected
to
CA 02348779 2001-04-24
WO 00/26226 9 PCTNS99/25497
negative selection in the absence of effector. Uncleaved RNAs are isolated by
PAGE and subjected to positive selection in the presence of a mixture of the
four
cNMPs. Cleaved RNAs are (II) amplified by RT-PCR to generate double stranded
DNA templates. The resulting DNAs are (III) transcribed using bacteriophage T7
5 RNA polymerase (T7 RNAP) to generate a new population of RNA molecules that
are (IV) subjected to the next round of negative and positive selections. (V)
Double-stranded DNAs from the desired rounds of selection are cloned and
sequenced for further analysis. The boxed T7 represents a double-stranded
promoter sequence for T7 RNAP. (B) Emergence of ligand-specific allosteric
10 ribozyrnes over the course of in vitro selection is reflected by plotting
the ratio of
cleavage yields (presence versus absence of effectors) for each round of
selection
(G1 through G28). Specificity of the ligand-sensitive populations that emerge
throughout the selection are designated by the bars. Asterisk denotes a change
in
the selection protocol to avoid acidifying the RNA sample prior to initiating
the
15 positive selection reaction. Daggers identify the rounds of selection where
the
cNMP that functions as an effector in the previous round is added to the
negative
selection reaction in subsequent rounds. Line indicates a cleavage ratio of 1,
which
represents the value expected if the cleavage activity of the population as a
whole
were to exhibit no preference for the effector mixture. (C) Selective
activation of
20 RNA cleavage by cNMPs. Trace amounts of internally 32P-labeled RNAs repre-
senting the populations G 18' , G20' and G23' were incubated for 15 min in the
reaction buffer used for in vitro selection (50 mM Tris-HCI, pH 7.5 at
23°C, and
20 mM MgCl2) in the absence of effector (-) or in the presence of 500 (M of
the
3',5'-cyclic mononucleotides A, G, C and U as indicated. Reaction products
were
25 separated by denaturing 10 °b PAGE and the bands were visualized and
quantified
using a PhosphorImager and ImageQuant software (Molecular Dynamics). Open
and filled arrowheads identify the precursor and 5' cleavage products, respec-
tively. The 3' cleavage products have greater electrophoretic mobility than
the
significantly larger precursor RNAs and 5'-cleavage fragments, and therefore
are
30 not present on the images.
CA 02348779 2001-04-24
WO 00/26226 PCTNS99/25497
10
Figure IO shows allosteric modulation of hammerhead ribozymes by
cNMPs. (A) Sequences of the original communication module domains (boxed)
and the original random-sequence domains (N~) for eight distinct clones
isolated
from the G18' RNA population (SEQ ID NOs 9 to 16). Dashes within the N~
5 domain represent nucleotide deletions that have occurred somewhere within
this
region. Numbers in parentheses report the number of identical clones with
identical sequences. All isolates are identified as having effector-responsive
allosteric function (+), show no response to the addition of effector (-), or
the
allosteric function was not determined (ND). Note that in nearly all cases,
the
10 communication module domains have acquired a minimum of one mutation. (B)
Ligand-dependent cleavage of individual allosteric ribozymes isolated from the
G18' RNA population. RNA precursors (open arrowheads) produce greater
amounts of 5'-cleavage product (filled arrowheads) in the presence of 500 ,uM
cGMP compared to its absence. The assays were conducted under in vitro
15 selection conditions, and as a result, the product yields in the presence
of effector
versus the absence of effector reflect the advantage that each ribozyme
maintains
during the selective-amplification process. Reaction products were separated
and
visualized as described above in the legend to Figure 9C. (C) The initial rate
constants for the clones depicted in B in the presence (k~+, filled circles)
or
20 absence (lc~s-, open circles) of 500 ~cM effector are depicted on a log
scale. These
rate constants reveal "on/off" ratios that range between 5- and 510-fold under
in
vitro selection conditions. (D-F) Allosteric modulation of G20' hammerhead
ribozymes by cCMP (SEQ ID NOs 17 to 23). (G-I) Allosteric modulation of G23'
hammerhead ribozymes by cAMP (SEQ ID NOs 24 to 31). Details for the
25 analysis of the cCMP- and cAMP-dependent ribozymes are as described in A-C.
Figure 11 depicts information related to molecular recognition of cAMP
by cAMP-3 RNA. (A) The caged cAMP analogue adenosine 3',5'-cyclic mono-
phosphate, P'-(2-nitrophenyl)ethyl ester is converted to 3',5'-cAMP by brief
irradiation with long wave UV light. (B) Allosteric activation of cAMP-3 RNA
by
30 uncaged cAMP. The plot depicts the natural logarithm of the fraction of
precursor
RNAs that remain uncleaved at different incubation times in the presence
(squares
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
11
and circles) or absence (triangles) of 2 mM caged CAMP. Shaded and filled
symbols represent data collected during or after UV irradiation, respectively.
Irradiated mixtures were exposed between t = 3.5 and 4.5 min (dashed lines).
The ribozyme is activated only when irradiated (filled symbols) in the
presence of
cAMP.
Figure 12 provides data related to molecular recognition of CAMP by
cAMP-1 RNA. (A) The effects of in situ depletion of cAMP from the reaction
buffer prior to the addition of the cAMP-1 allosteric ribozyme were determined
by
using 3',5'-cyclic nucleotide phosphodiesterase and calmodulin. Precursor RNAs
(open arrowhead) undergo activation when incubated in reaction mixtures
contain-
ing cAMP (+, lanes 3 and 4) or when incubated in reaction mixtures containing
cAMP and including either phosphodiesterase (pho) or calmodulin (cal) (lanes 5
and 6, respectively). When combined, the phosphodiesterase and its activator
calinodulin promote the hydrolysis of > 90% of the cAMP to yield 5'-AMP during
a 40 min preincubation (preinc) at 30°C. The cAMP-1 RNA, which does not
accommodate 5'-AMP as an effector (see Figure 13, below) is no longer
activated
under these conditions (lane 7). Reaction products were separated and
visualized as
described in the legend to Figure 9C. (B) Plot depicting the activation of
cAMP-1
by the addition of cAMP to 500 ~,M (indicated by the arrow) after exhaustive
depletion of an original sample of CAMP. This reaction is derivative of that
depicted in lane 7 of A, but where an 80 min preincubation with the
phosphodies-
terase/calmodulin mixture was used to more thoroughly deplete the initial
input of
cAMP. Filled and open circles identify data points collected before and after
addition of the second aliquot of cAMP, respectively.
25 Figure 13 shows patterns of selective molecular recognition by
cNMP-dependent allosteric ribozymes. Each of the three allosteric ribozymes
cGMP-1, cCMP-1 and cAMP-1 were incubated for 15 min under in vitro selection
conditions in the absence of effector (-), in the presence of 500 ~M of its
cognate
cNMP effector, or similarly with a panel of different effector analogues.
Internal-
ly 32P-labeled precrusor RNAs and the resulting 5'-cleavage fragments are
identi-
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
12
feed by open and filled arrowheads, respectively. 'G, C and A represent the
nucleosides guanosine, cytidine and adenosine, respectively. cIMP represents
inosine 3',5'-cyclic monophosphate. Reaction products were separated and
visualized as described in the legend to Figure 9C.
5 Figure 14 shows rapid effector-mediated activation of allosteric ribo-
zymes. Reactions containing internally 32P-labeled precursor RNAs as indicated
were incubated for a brief time in the absence of effector, then 5 mM of their
corresponding effector was added (dashed line) and the reaction was continued.
The x-axis reflects the time relative to the addition of effector. The
precursor
(open arrowheads) and resulting 5'-cleavage fragments (filled arrowheads) were
separated, visualized and quantitated as described in the legend to Figure 9C.
The
natural logarithm of the fraction of precursor remaining is plotted for each
data
point generated before {open circles) or after (filled circles) addition of
effector,
where the change in slope reflects the allosteric response of each ribozyme.
15 Figure 15 graphs effector binding affinities and the dynamic ranges for
various allosteric ribozymes. The logarithm of the rate constant for ribozyme
cleavage versus the logarithm of the effector concentration is plotted for
each of
the ten clones depicted in Figure 10. The minimum possible values for apparent
KD for each clone is represented by the location of the shaded arrowhead on
the
x-axis of each plot (assuming that kobs at 10 mM effector reflects k",~). The
difference in rate constants that is brought about by progressively increasing
the
concentration of the effector reflects the dynamic range for each clone. For
example, log k~,$ for cAMP-1 increases from -3 in the absence of effector
(Fig.
3I) to -0.5 upon saturation of effector. Variation in the rate constant
brought
25 about by different concentrations of effector corresponds to a dynamic
range for
cAMP-1 of -~ 300 fold. Dashed lines reflect the concentration of effector (500
~.M) used during in vitro selection.
Figure 16 illustrates reactive DNA biochips prepared with highly
selective multidomain polynucleotides of the invention in a grid assay. The
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
13
indicated sensors were applied to the chips as indicated by arraying different
ligand-sensitive sensors on a surface using standard nucleic acid
immobilization
techniques, and the chips are exposed to samples containing various potential
effector molecules. Compounds responsive to sensors denoted B19, C3, GS, G9,
S P1S, and S2 are found to be present in concentrations above the threshold
level.
DETAILED DESCRIPTION OF THE INVENTION
This invention is based upon the finding that combining a polynucleotide
actuator domain and a receptor domain, with a bridging domain that provides
communication between the two, results in precision polynucleotide sensors. By
use of modular rational design strategies that mix and match domains,
multidomain
polynucleotides are modified to generate large numbers of structurally
parallel
sensors that are then screened to identify sensors displaying optimal binding
and/or
reporting activity
In the practice of the invention, purified functional polynucleotides are
1 S generated or selected which comprise an actuator domain, a receptor
domain, and
a bridging domain such that a signalling agent such as binding of a ligand to
the
receptor domain triggers a conformational change in the bridging domain which
modulates the activity of the actuator domain. The overall structure functions
as a
molecular switch, with the signalling agent turning the reporter domain
partially or
totally "on" or "off" upon interaction with the receptor domain which then
communicates via the bridging domain. The molecular bridge in the engineered
sensor is not passive, but is instead a functional communication module that
activates, accelerates, decelerates, or triggers the action of the catalytic
or reporter
actuator. Indeed, as will be discussed in greater detail below, the invention
2S encompasses methods for providing or enhancing allosteric properties in a
polynu-
cleotide by inserting into the polynucleotide communication module sequences
that
bridge receptor domains and actuator domains in the polynucleotide such that
the
sequence modulates the activity of the actuator domain when the receptor
domain
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
14
is acted upon by a ligand or a physical signal. In some embodiments, different
communications modules are additionally used to modify the properties of the
catalytic or reporter actuator, such as changing the kinetics of a reaction
rate. In
other embodiments, the bridging domain can overlap the receptor or reporter
domain such that it is no longer present as a distinct structural entity.
Novel
allosteric polynucleotides of the invention are generated using modular
rational
design strategies by varying the actuator domain or the receptor domain and
screening the sensors so produced to identify sensors having optimal sensing
and/or reporting activities. The generation of some novel RNA sensors using
this
method is illustrated in Example 3 below.
Other additional domains may also be part of the construct such as, for
example, multiple receptor domains for the measurement or detection of muliple
components in a mixture tested by the sensor. Two or more domains may be
partially or completely overlapping or non-overlapping, or contain both
partially
overlapping and non-overlapping sequences. Thus, as used herein, a "domain" is
a functional designation, not a physical one, and sensors of the invention do
not
necessarily comprise different combinations of at least three distinct
sequences
directly or indirectly linked together, but instead can comprise sequences
wherein
some or all of the bases in the domains overlap with one another.
Multidomain polynucleotide molecular sensors of the invention may be
RNA, RNA analogues, DNA, DNA analogues, or mixtures thereof. Analogues
include chemically bodified bases and unusual natural bases such as, but not
limited to, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcyti-
dine, 5'-carboxymethylaminomethyl-2-thioridine, 5-carboxymethylaminomethyluri-
dine, dihydrouridine, 2'-O-methylpseudouridine, ~i-D-galactosylqueosine, 2'O-
methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methyl-
pseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-
methylguanosine, 2-methyladenosine, 3-methylcytidine, 5-methyicytidine, N6-
methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxy-
aminomethyl-2-thiouridine, ~i-D-mannosylqueosine, 5-methoxycarbonylmethyluri-
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
dine, 5-methyloxyuridin, 2-methylthio-NG-isopentenyladenosine, N((9-~3-D-ribo-
furanosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-~3-D-
ribofuranosyl-
purine-6-yl)N-methyl-carbamoyl)threonine, uridine-5-oxyacetic acid methyl
ester,
uridine-5-oxyacetic acid, wybutoxosine, pseudouridine, queosine, 2-
thiocytidine, 5-
5 methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-
~3-D-
ribofuranosylpurine-6-yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-
O-
methyluridine, wybutosine, and 3-(3-amino-3-carboxypropyl uridine. Further
encompassed by the invention are polynucleotidess modified during or after
preparation of the sensor using standard means.
10 As summarized above, polynucleotide sensors of the invention are
designed and constructed independently or together to comprise the actuator
domain and receptor domain in communication with the bridging domain such that
binding of a ligand to the receptor domain and/or a signal triggers a
conformation-
al change in the bridging domain which modulates the activity of the actuator
15 domain. Since they are responsive to ligands and/or signals, multidomain
polynu-
cleotides of the invention have a variety of uses, particularly as sensing
elements
in clinical, industrial, agricultural, and environmental analyses, and as
genetic
control or report elements for gene expression.
Sensors of the invention may be employed in solution or suspension or
attached to a solid support. Alone or as a component of an analytical kit or
probe,
the polynucleotides are used to detect the presence or absence of a ligand or
a
signal in a sample by contact of the sample with the polynucleotide. In a
typical
practice of these methods, a sample is incubated with the polynucleotide or
device
comprising the polynucleotide as a sensing element for a time under conditions
sufficient to observe the catalytic or reporter effect produced by the
actuator
domain. This is monitored using any method known to those skilled in the art,
such as measurement and/or observation of polynucleotide self cleavage or
ligation; binding of a radioactive, fluorescent, or chromophoric tag; binding
of a
monoclonal or fusion phage antibody; or change in component concentration,
spectrophotometric, or electrical properties. It is an advantage of the
invention
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
16
that current biosensor technology employing potentiometric electrodes, FETs,
various probes, redox mediators, and the like can be adapted for use in
conjunc-
tion with the new polynucleotide sensors of the invention for measurement of
changes in polynucleotide function or configuration initiated by the actuator
domain.
Sensors of the invention may be used to detect the presence or absence
of a compound or other ligand, as well as its concentration. Sensors can be
engineered to detect any type of Iigand such as, but not limited to, all types
of
organic and inorganic compounds, metal ions, minerals, macromolecules, poly-
mers, oils, microbial or cellular metabolites, blood or urine components,
other
bodily fluids obtained from biological samples, pesticides, herbicides,
toxins,
nonbiological materials, and combinations of any of these. Organic compounds
include various biochemicals in addition to those mentioned above such as
amino
acids, peptides, polypeptides, nucleic acids, nucleosides, nucleotides,
sugars,
carbohydrates, polymers, and lipids. One or more ligands may be sensed by the
same sensor in some embodiments.
Thus, sensors of the invention have wide application in clinical diagnosis
and medicine and veterinary medicine, including the determination of blood
components such as glucose, electrolytes, metabolites and gases; serum analyte
determinations; bacterial and viral analyses; pharmaceutical and drug
analyses;
drug design; cell recognition/histocompatibility; cell adhesion studies;
bacterial
and viral analysis; DNA probe design; gene identification; and hormone
receptor binding. Industrial applications include the detection of vitamins
and
other ingredients, toxins, and microorganisms in foods; military applications
such
as dispstick testing; industrial effluent control; pollution control and
monitoring;
remote sensing; process control; separation chemistry; and biocomputing.
Agricultural applications include farm and garden analyses and evaluations of
genetic control and effects of compounds, particularly small molecules, in
trans-
genic plants and animals (including in vivo measurements). Multiple sensors
may
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
17
be placed on a single sensory element or chip, such as that illustrated in
Figure
16, to detect multiple ligands and other signalling agents.
In alternate embodiments, or in combination with ligand detection,
multidomain polynucleotide sensors of the invention can be engineered to
respond
to any change in energy reception measurable by a change in molecular conforma-
tion, a physical signal, an electromagnetic signal, and combinations thereof
including, but not limited to radiation such as UV irradiation of caged
effectors
illustrated in Figure 11, temperature changes, pH, ionic concentration, shock,
sound, and combinations thereof.
Upon stimulation by a ligand or signal, the actuator domain modifies its
catalytic function or reporter function. Any observation of a change in
polynucle-
otide configuration or function may be employed to determine this. In many
embodiments, an observation of a chemical reaction is made such as measurement
and/or observation of polynucleotide self cleavage or ligation, substrate
cleavage,
or generation of a catalytic reaction product using standard assays. In
others,
simple binding of a radioactive, fluorescent, or chromophoric tag, binding of
a
monoclonal or fusion phage antibody, or binding of a tagged antibody is
observed.
Alternatively, changes in component concentration, temperature, pH,
appearance,
spectrophotometric or electrical properties and the like, may be observed.
As mentioned above, the invention correspondingly provides methods
for detecting one or more ligands and/or signals by contacting the sample with
a
polynucleotide sensor of the invention responsive to the ligand and/or signal.
Use
of sensors responsive to more than one ligand and/or signal, tandem use of an
array of multiple sensors each responsive to different ligands and/or signals,
and
tandem use of multiple sensors with sensors responsive to more than one Iigand
and/or signal, in many cases attached to a solid support, are encompassed by
the
invention.
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
18
Multidomain polynucleotide sensors of the invention may also be used
for the control and/or report of gene expression in vivo. For example,
ribozymes
exhibiting new allosteric binding specificity and refined kinetic
characteristics are
generated using allosteric selection are made to function inside cells with a
level of
catalytic performance that is of biological significance. In these
embodiments,
regulation or report of gene expression in a cell of an organism is achieved
by
operably linking a sensor to a genetic molecule in the cell such that the
biological
or phenotypic activity encoded by the gene is modulated in accordance with
modulation of the activity of the actuator domain. RNA sensors may be inserted
anywhere in the coding region of an mRNA encoding a gene-of interest, or in
close proximity thereto, or in the S'-leader or 3'-tail regions, so long as
the sensor
functions to stimulate, terminate, or modulate expression of gene translation
in the
presence of the sensor's corresponding ligand(s) and/or signal(s). Likewise,
DNA
sensors may be inserted anywhere in a gene-of interest or a gene regulating
it,
including in regions encoding gene self destruction, regions upstream of gene
expression, as well as in the coding regions of the gene, so long as the
sensor
functions to stimulate, terminate, or modulate gene transcription in the
presence of
the sensor's corresponding ligand(s) and/or signal(s).
Sensors are inserted in genetic molecules for control and/or report of
gene expression using standard methods of introducing foreign genes into
cells.
The methodology depends upon the gene of interest, and typically includes cell
transfection, transformation or transduction of cells using plasmids; Herpes,
adeno, adeno-associated, vaccinia, retroviral, and other insertion vector
viruses;
and liposomes. Although less common, insertion of naked RNA (or DNA) by
cleavage of cellular genetic material followed by ligation may also be
employed.
Gene expresion may be regulated or reported in any type of organisms,
including microorganisms, plants, and animals. Gene regulation is achieved by
administration to a cell having a sensor attached to a genetic molecule, the
appropriate ligand(s) and/or signals) using standard methods. Administration
of
CA 02348779 2001-04-24
WO 00/26226 19 PCTNS99/25497
ligands to microorganisms, for example, is typically achieved simply by adding
the
ligand to the medium or removing it, or by perfusing the bacteria, yeast, or
molds. Ligands may be administered to plants by spraying or injecting the
plant
itself, or applying it to the soil and/or with water. Ligands may be
administered
to animals orally, topically, intravenously, and intraperitoneally, typically
in
association with a pharmaceutically acceptable carrier. Report of gene
expression
is correspondingly determined by measurement of receptor binding to ligand,
and
can be used for non-invasive diagnostics of nearly any biological or
pharmaceutical
compound of interest administered to, or produced by, an organism. In this
context, multidomain polynucleotides of the invention are useful both in non-
invasive diagnostics as well as for control of therapeutic ribozymes.
The invention correspondingly provides processes for preparing polynu-
cleotides that are responsive to the presence or absence of a chemical
effector or
other ligand, a physical signal, an electromagnetic signal, or combinations
thereof,
comprising linking an actuator domain, a receptor domain, and a bridging
domain
together such that binding of a ligand to the receptor domain and/or signal
triggers
a conformational change in the bridging domain which modulates the activity of
the actuator domain. Other sensors can be developed by mixing and matching
domains from different sensors.
Some sensors of the invention are developed through allosteric selection.
Allosteric selection is an in vitro selection technique for the development of
allosteric nucleic acid enzymes that are controlled by ligands for which an
aptamer
has not previously been identified. In this capacity, allosteric selection
also
represents a novel approach to the generation of aptamers than bind target
ligands.
For this purpose, a random sequence library is typically appended to a
catalytic
nucleic acid motif such as the hammerhead ribozyme illustrated in Figures l
and
8. The random domain may be attached directly to the ribozyme (Figure 1 A) or
through an existing 'communication modules' (Figures 1B and 8). In the latter
case, the communication module is expected to inhibit self cleavage within the
ribozyme domain in the absence of a target ligand. In this manner, in vitro
CA 02348779 2001-04-24
WO 00/26226 20 PCT/US99/25497
selection for self cleavage in the presence of target ligands will yield new
aptamers
and allosteric ribozymes if ligand binding to unique sequences derived from
the
random region triggers a conformational change that is conducive to ribozyme
cleavage.
Using this selection strategy, four natural 3',5'-cyclic mononucleotides
incuding the second messengers cGMP and cAMP were targeted by hammerhead
ribozymes in Example 3. This collection of molecules provides a diverse set of
targets that are of biological importance and that challenge the structure
formation
and molecular recognition capabilities of RNA. Ribozymes that rapidly self
cleave
only when incubated with their corresponding effector compounds were
identified.
Representative RNAs exhibit 5,000-fold activation in the presence of cGMP or
cAMP, thus displaying precise molecular recognition chacteristics and
operating
with catalytic rates that match those exhibited by unaltered ribozymes. These
findings demonstrate that a vast number of ligand-responsive ribozymes with
dynamic structural chacteristics can be generated in a massively parallel
fashion.
Moreover, optimized allosteric ribozymes provide especially selective sensors
of
chemical agents or as genetic control elements for the programmed destruction
of
cellular RNAs.
Allosteric selection of aptamers to small ligands has two distinct
advantages over the conventional affinity chromatography methods for aptarner
selection. First, aptamers to numerous ligands may be generated in a single
selection rather than the laborious single ligand-single aptamer selection
strategy
afforded by affinity chromatography. Second, aptamers are selected to bind
ligands free in solution rather than ligand that has been covalently modified
and
immobilized on a solid support. This aspect affords potential aptamers
complete
access to the entire ligand. It is conceivable that any effector-ribozyme pair
could
be developed using this approach. This unique process of nucleic acid
development
may therefore be used to develop nucleic acids that interact with a variety of
ligands including small organic compounds, peptides or proteins, or other
nucleic
acids. In addition to ligand binding, allosteric selection also provides a
means of
CA 02348779 2001-04-24
WO 00/26226 21 PCTNS99/25497
developing nucleic acid motifs capable of detecting a variety of physical
phenome-
na including pH, temperature, ionic conditions, or Iight.
While not wishing to be bound to any theory, it appears that the commu-
nication module function provided by the bridging domain is accomplished in
sensors of the invention by one or a combination of mechanisms such as the
'slip-
structure' interconversion set out in Example 1 below. Control can also be
achieved using steric interactions such as binding of small compounds,
structure
stabilization such as unfolding or misfolding in the presence or absence of an
effector, antisense effects based on simple nucleic acid base pairing, and/or
quarternary structure. Any type of relay of a ligand-binding or physical or
electromagnetic effect sensed by the receptor domain may be employed to
transfer
information to the actuator (reporter or catalytic) domain by the bridging
domain.
It is an advantage of the invention that use of polynucleotides as sensors
offer advantages over protein-based enzymes in a number of commercial and
industrial processes. Problems such as protein stability, supply, substrate
specific-
ity and inflexible reaction conditions all limit the practical implementation
of
natural biocatalysts. DNA can be engineered to operate as a sensor under
defined
reactions conditions. Moreover, sensors made from DNA are expected to be
much more stable and can be easily made by automated oligonucleotide
synthesis.
In addition, both DNA and RNA sensors may be selected for their ability to
function on a solid support and are expected to retain their activity when
immobi-
lized.
As has been mentioned, the invention further encompasses the use of
multidomain polynucleotide molecular sensors attached to a solid support for
assays, diagnostics, catalytic processes, and the like. Immobilizing novel RNA
or
DNA enzymes provides a new form of coated surfaces for the efficient sensing
of
ligands or chemical transformations for testing of individual samples or in a
continuous-flow reactor under both physiological and non-physiological
conditions.
The engineering of new sensors can be each tailor-made to efficiently respond
to
CA 02348779 2001-04-24
WO 00/26226 22 PCT/US99/25497
certain ligands or signals under user-defined conditions. Due to the high
stability
of the DNA phosphodiester bond, such surfaces when coated with multidomain
DNA sensors are expected to remain active for much longer than similar
surfaces
that are be coated with protein enzymes or ribozymes.
A variety of different chromatographic resins and coupling methods can
be employed to immobilize sensors of the invention on a support. For example,
a
simple non-covalent method that takes advantage of the strong binding affinity
of
streptavidin for biotin as previously described (45) may be employed. In other
embodiments, sensors can be coupled to the column supports via covalent links
to
the matrix, thereby creating a longer-lived biosensor. Various parameters of
the
system including temperature, sample preparation, sensor size and sensitivity,
and
the like, can be adjusted to give optimal sensing properties. In fact, these
parame-
ters can be preset based on the kinetic or other characteristic displayed by
the
immobilized sensor.
In conclusion, the simultaneous use of rational and combinatorial
approaches to enzyme engineering (41) provides a powerful approach to the
design
of new ribozymes and other sensors. As illustrated below, in some embodiments,
tripartite ribozyme constructs generated using this strategy of polynucleotide
engineering function as highly-specific sensors for various small organic com-
pounds. A critical component of these constructs are the ligand-responsive
bridge
elements. These dynamic structural domains act as simple 'communication
modules' that can be used to rapidly engineer new RNA molecular sensors simply
by swapping domains within the context of the tripartite construct. In
addition,
the introduction of mutations into the receptor domain of the construct should
make possible the in vitro selection of new ligand-binding domains based on
the
modulation of a catalytic or other reporter activity. In a similar manner, new
RNA molecular sensors can be made that serve as new precision biosensors, or
that function in vivo as genetic control or reporter elements that regulate
gene
expression in response to the presence of many different kinds of effector
mole-
cules.
CA 02348779 2001-04-24
WO 00/26226 23 PCT/US99/25497
Examples
The following examples are presented to further illustrate and explain
the present invention and should not be taken as limiting in any regard.
Example 1. Engineering Precision RNA Molecular Sensors
Ligand-specific molecular sensors composed of RNA were created by
coupling pre-existing catalytic and receptor domains via novel structural
bridges
(65). Binding of ligand to the receptor triggers a conformational change
within the
bridge, and this structural reorganization dictates the activity of the
adjoining
ribozyme. The modular nature of these tripartite constructs makes possible the
rapid construction of precision RNA molecular sensors that trigger only in the
presence of their corresponding ligand.
MATERIALS AND METHODS
Ol~onucleotides. Synthetic DNA and the 14-nucleotide substrate RNA
were prepared by standard solid phase methods and purified by denaturing (8 M
urea) polyacrylamide gel electrophoresis (PAGE) as described previously (4)
RNA substrate was 5' 3zP-labeled with T4 polynucleotide kinase and (~y-32P)-
ATP,
and repurified by PAGE. Double-stranded DNA templates for in vitro transcrip-
tion using T7 RNA polymerase were generated by extension of primer A (5'-TA-
ATACGACTCACTATAGGGCGACCCTGATGAG, SEQ ID NO: 32)) on a DNA
template complementary to the desired RNA. Extension reaction were conducted
with reverse transcriptase (RT) as described previously (7).
In Vitro Selection. Selection for allosteric activation was performed by
first preselecting each successive population (1 ~.M internally 32P-labeled
RNA;
ref. 5) for self cleavage without FMN in 10 wL reaction buffer {50 mM Tris-HCl
(pH 7.5 at 23°C) and 20 mM MgCl2) for 20 hr at 23°C.
Preselections for G4-G6
were punctuated at 5 hr intervals by heating to 65 ° C for 1 min to
denature and
refold any misfolded molecules. Uncleaved RNA was purified by denaturing (8 M
CA 02348779 2001-04-24
WO 00/Z6226 24 PCT/US99/25497
urea) 10% (PAGE), eluted from excised gel, and precipitated with ethanol. The
resulting RNA was selected by incubation in the reaction buffer in the
presence of
200 ~,M FMN for the times indicated. Reaction times for positive selections
during subsequent iterations of the selective-amplification process were
decreased
to favor allosteric ribozymes with the fastest rates of self cleavage.
Products
separated by 10 % PAGE were imaged and quantitated using a PhosphorImager
and ImageQuaNT software (Molecular Dynamics). The 5'-cleavage fragments
produced in the presence of FMN were isolated as described above, amplified by
RT-PCR (primer A and primer B: 5'-GGGCAACCTACGGCTTTCACCGTTTCG
(5,9, SEQ ID NO: 33), and the resulting double-stranded DNA was transcribed in
vitro (5) to generate the next RNA population. Selection for FMN inhibition
was
conducted in an identical fashion, except that FMN was included in both the
transcription and the preselection, but was excluded in the selection
reaction.
Individual molecules from G6 populations of both selections were isolated by
cloning (TA Cloning Kit, Invitrogen) and analyzed by sequencing (ThermalSe-
quenase Kit, Amersham).
Allosteric Ribozyme Assays. Reactions containing internally 32P-labeled
self cleaving ribozyme ( 100 to 500 nM ) and either 200 ~,M FMN, 1 mM theoph-
ylline, or 1 mM ATP were initiated by the addition of reaction buffer and
incubat-
ed through several half lives with periodic sampling. Products were separated
by
denaturing PAGE and yields were quantitated as described above. Rate constants
were derived by plotting the natural logarithm of the fraction of uncleaved
RNA
versus time and establishing the negative slope of the resulting line. The
values for
each rate constant given are the average of a minimum of three replicate
assays,
each that differed by less than two fold. Ribozymes carrying the class I
induction
element and the class II inhibition element were arbitrarily chosen for
detailed
analysis.
Bimolecular assays were conducted under single-turnover conditions
with ribozyme (500 nM) in excess over trace amounts ( -,- 5 nM) of 5' 32P-
labeled
substrate. Reactions were initiated by combining ribozyme and substrate that
were
preincubated separately for 10 min at 23°C in reaction buffer. Kinetic
parameters
were generated as described above. Product yields were corrected for the
amount
CA 02348779 2001-04-24
WO 00/26226 25 PCT/US99/25497
of substrate that remained uncleaved after exhaustive incubation with the
unmodi-
fied hammerhead ribozyme (5). The values for each rate constant given are the
average of a minimum of two replicate assays that differed by less than two
fold.
RESULTS AND DISCUSSION
In Vitro Selection of Allosteric Ribozymes. A population of > 65,000
variant RNAs composed of separate FMN-binding aptamer (26) and hammerhead
ribozyme (27, 28) domains that are joined by a random-sequence bridge were
generated (Figure 2A). The bridge replaces a majority of the natural 'stem II'
portion of the hammerhead motif - a structural element that is a critical
determi-
nant of ribozyme activity (29, 30). The randomized domain within the resulting
tripartite construct will provide a sampling of alternative stem II elements
that
might respond to FMN binding in the adjacent aptamer domain, and confer either
positive or negative allosteric control upon the adjoining ribozyme domain.
Two
identical RNA pools (---6 x 10'2 molecules each) were subjected to in vitro
selection ( 14, 15) either for FMN-dependent allosteric induction (Figure 2B)
or
allosteric inhibition (Figure 2C). To isolate bridges that direct the
allosteric
induction of ribozymes, a 'negative selection' for self cleavage in the
absence of
FMN was applied to the first pool. RNAs that remained uncleaved during this
reaction were isolated and subsequently subjected to a 'positive selection'
for
self cleavage in the presence of FMN. This method is expected to favor the
isolation of ribozymes that activate only when FMN is detected. In contrast,
the
second pool was both transcribed and pre-selected in the presence of FMN. The
surviving RNA precursors were then subjected to positive selection in the
absence
of ligand, which favors the isolation of bridges that direct ribozymes to
undergo
allosteric inhibition.
Both RNA populations isolated after six rounds of selection (G6) display
high sensitivity to FMN, demonstrating that the combined engineering approach
is
an effective means to generate ribozymes that function as highly-specific
molecular
switches. The in vitro selection process could have produced novel RNA struc-
tures that cleave by some other means under the permissive reaction
conditions.
For example, isoalloxazine rings like that found in FMN have been shown to
CA 02348779 2001-04-24
WO 00/26226
PCT/US99/25497
26
promote photocleavage of RNA molecules (31) and could conceivably serve as a
cofactor for a novel FMN-dependent ribozyme. However, the RNAs isolated by
selection appear to cleave in a reaction that is solely mediated by the
original
hammerhead ribozyme domain that was integrated into each construct as deter-
s mined by gel mobility of RNA cleavage fragments.
Seauence and Functional Characteristics of Isolated Bridce Elements.
The G6 populations from both selections were cloned, sequenced, and assayed
for
allosteric function (Figure 3). Eight distinct classes of bridges, designated
as
'induction elements' I through VIII, were identified in the FMN-inducible RNA
population. Ribozymes with these different classes of induction elements show
unique rate constants for self cleavage in the absence (lcob$ ) or presence
(kobs+) of
ligand (Figure 2A). Most classes exhibit greater than 100-fold allosteric
activation
(lc~s+/k~-), with classes I, III, and VII exhibiting FMN-dependent rate
enhance-
ments of --270 fold (Figure 2B). This allosteric induction is similar in
magnitude
to the kinetic modulation seen with some natural allosteric protein enzymes
(32).
Furthermore, the lcobs + values attained by nearly all classes approach the
maxi-
mum kobs (1.1 min-1) measured for an unmodified hammerhead ribozyme (Figure
3A).
Likewise, five distinct classes of bridges were identified and were
designated as 'inhibition elements' I through V (Figure 3C). Unlike the FMN-in-
ducible populations which showed an immediate response to in vitro selection,
ligand-dependent inhibition of ribozyme function was not detected until G3 of
this
parallel selection. Interestingly, each of the five classes carries a 1- or 2-
nucleo-
tide deletion within the randomized bridge domain, suggesting that none of the
sequence variants comprising the original RNA pool formed an adequate li-
gand-responsive element that could confer allosteric inhibition. The relative
delay
in deriving an FMN-inhibited RNA population may have been due to the necessary
emergence of specific nucleotide deletions within the bridge domain - an occur-
rence that is dependent on the frequency of deletion events during the selec-
tive-amplification process. Consistent with this hypothesis is the fact that
sequenc-
es of the inhibition elements are highly homologous, indicating that the
emergence
and diversification of a single responsive bridge domain may have given rise
to all
CA 02348779 2001-04-24
WO 00/26226 27 PCT/US99/25497
classes examined. All five classes demonstrate substantial allosteric
inhibition
(200 to 600 fold) in the presence of FMN (Figure 3D).
Many of the bridge elements isolated by selection display maximum rate
enhancements that are at least 10-fold lower than that measured for the
unmodified
5 hammerhead ribozyme H1 (Figure 3). Among the allosteric ribozymes that
display the largest rate constants for RNA cleavage carry the class III
induction
element (k~$+ = 0.25 min') or the class III inhibition element (kobs- = 0.45
min '). The maximum rate constants for these two ribozymes are, respectively,
only four and two-fold slower than H 1. Using similar in vitro selection
methods,
10 a population of theophylline-dependent ribozymes that use a tripartite
configuration
like that described for the FMN-sensitive RNAs was isolated. Individual
theophyl-
line-sensitive ribozymes from this population display rate constants that
exceed 1
miri', thereby confirming that allosteric hammerhead ribozymes indeed can be
made to operate as efficiently as the unmodified ribozyme.
15 Ranid Interconversion Between Active and Inactive Ribozyme Struc-
tures. The inactive state for ribozymes that carry the class I induction
element
(Figure 4A) is maintained for long periods of time in the absence of FMN,
yielding only ~ 1 % self cleavage per hour (Figure 4C). However, self cleavage
is
triggered almost instantaneously upon the addition of ligand (Figure 4C;
inset), in
20 this case bringing about a 270-fold increase in catalytic rate. Presumably,
the
'off' state maintained by induction elements in the absence of FMN lacks the
ability to form the stable stem II structure that is necessary for ribozyme
activity.
Alternatively, each element forms a distinct structure that prevents formation
of
this essential stem. FMN binding establishes the 'on' state by inducing a
confor-
25 mational change in the aptamer that rapidly converts the induction element
into a
structure that is compatible with ribozyme function. In contrast, ribozymes
that
carry the class II inhibition element (Figure 4B) rapidly self cleave in the
absence
of FMN, but quickly convert to an inactive state upon addition of Iigand
(Figure
4D; inset). Here, inhibition elements maintain the 'off' state by binding FMN
and
30 stabilizing specific bridge structures that preclude ribozyme function.
Release of
the ligand results in structural reorganization of the bridge and establishes
the 'on'
state of the adjoining ribozyme. However, it remains unclear what structural
state
CA 02348779 2001-04-24
WO 00/26226 28 PCT/US99/25497
is responsible for the slow rate of cleavage seen with the class II inhibition
element when FMN is present. Further experimentation is needed to determine
whether the FMN-ribozyme complex remains weakly active, or whether the small
number of FMN-free RNAs present under equilibrium binding conditions solely
contribute to the RNA cleavage rate that is observed.
Mechanism for Allosteric Function. The rapid Iigand-dependent
activation or inhibition of ribozyme function indicates that the
conformational
changes required to modulate activity must be highly responsive to ligand
binding.
It appears that for some elements this allosteric transition is achieved
through
localized base-pairing changes within each bridge domain, and that binding
energy
derived from Iigand-aptamer complex formation is used to create this shift in
structural configuration.
A critical component of the proposed mechanism for both allosteric
induction and inhibition is a single sheared A~G base pair, located within the
aptamer domain immediately adjacent to the bridge, which forms only when FMN
is bound (33, 34). With class I induction elements, the presence of FMN
stabiliz-
es the A~G base pair which in turn establishes a specific register for base
pairing
within the bridge (Figure SA). In the absence of this FMN-dependent structural
constraint, base pairing throughout the bridge may 'slip' one base pair
relative to
the A~G interaction, thereby displacing the G-C base pair needed for ribozyme
function. This inactive conformation would be maintained if no single
nucleotide
is bulged from the top strand of the bridge. Symmetric internal bulges are
known
to be more stable than asymmetric or single-nucleotide bulges (35). Therefore,
the register that is set by the sheared A~G base pair may be faithfully
propagated
along the bridge element if the presence of symmetric internal bulges favor a
continuously-stacked stem II domain. Interestingly, all inhibition modules
acquired
deletions that appear to be essential for their function. This corresponds
well with
a slip-structure mechanism, as a continuously-stacked bridge in this case
would
disrupt the critical G-C base pair of the ribozyme when FMN was bound, while
the absence of FMN would allow proper ribozyme folding (Figure SB).
To further investigate this 'slip structure' mechanism for allosteric
regulation, several ribozyme constructs were created using stable stem-loop
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
29
structures in place of the FMN-binding domain (Figure SC). In its occupied
state,
the FMN aptamer forms a compact, approximately A-form RNA structure (34).
Therefore, the stem-loop structures integrated into the test constructs should
simulate the FMN-bound aptamer and enforce the putative slip structures
necessary
to either induce or inhibit ribozyme function. For example, construct I-1 is
designed to simulate the structure of a class I induction element bound to FMN
by
enforcing the formation of the sheared A~G pair. Indeed, the k~,,s for I-1 in
the
absence of FMN is identical to the rate constant for the FMN-induced form of
the
parent allosteric ribozyme (Table 1). Two additional constructs (I-2 and I-3)
were
used to determine the rate constants when the opposing 'slipped' version is
enforced with progressively stronger base pairing. Construct I-2 is not
significant-
ly inhibited when the aptamer is replaced by structures that should favor the
inactive conformation. Perhaps in this context, a single bulged nucleotide
along the
top strand of the bridge may occur which would restore proper ribozyme
folding.
15 However, the activity of the adjoining ribozyme is substantially diminished
when
potential bulge formation is precluded by the introduction of additional base
pairs
in the bridge that forms construct I-3, consistent with the proposed mechanism
for
allosteric function.
Further evidence for a slip-structure mechanism was provided by
20 examining the class II inhibition element. Here, FMN binding enforces a
base
pairing pattern that precludes formation of the active ribozyme conformation
(Figure SD). In the absence of FMN, the loss of the A~G base pair may permit
the remaining base pairs to slip by one nucleotide, thereby forming the active
ribozyme conformation. Constructs II-1 and II-2, designed with stem-loop
25 structures that enforce the two different base-pairing conformers, display
rate
constants that correspond closely with the values for the active and inactive
states
of the parent allosteric ribozyme, respectively (Table 1). In all examples,
the
bridge elements contain unpaired bases that presumably destabilize the stem
structures and allow rapid interconversion between different structural
states. A
30 similar RNA switch mechanism may serve an important role in the structure
and
function of 16S ribosomal RNA (35, 36), a finding that indicates this
mechanism
for allosteric function may not be unprecedented. Although alternative
mechanisms
CA 02348779 2001-04-24
WO 00/26226 PCTNS99/25497
for allosteric function may be in operation, these striking correlations all
are
consistent with the proposed slip-structure mechanism. Similar studies with
the
remaining classes of bridge elements might reveal whether this mechanism is
also
more general in occurrence.
5 Ensineering Allosteric Ribozymes with New Lisand Specificities. If
binding energy derived from the ligand-aptamer complex is used to shift the
thermodynamic balance between two slip-structure conformations, then each
bridge
may act as a generic reporter of the occupation state of the adjoining aptamer
domain in a manner that is independent of the sequence and ligand specificity
of
10 the aptamer. To examine this possibility, the FMN aptamer was removed from
the class I induction element of an FMN-sensitive ribozyme and replaced with
either an aptamer that binds theophylline (37) or an aptamer that binds ATP
(38)
(Figure 6A). In each case, ligand binding is known to stabilize base pairing
of the
terminal nucleotides of the appended aptamer (33, 38, 39). Therefore, adaptive
15 binding of ligand by the aptamer may trigger the allosteric transition
necessary for
class I function. Indeed, each ribozyme construct undergoes self cleavage only
in
the presence of its cognate ligand (Figure 6B). Kinetic analyses (Figures 6C
and
6D) show that the activity of the FMN-inducible ribozyme increases 270-fold in
the presence of FMN, while the theophylline- and ATP-inducible ribozymes are
20 activated 110- and 40-fold, respectively, only by their corresponding
ligands.
These findings indicate that the task of regulating ribozyme activity rests
mainly
on the bridge element, which relays information concerning the binding state
of
the aptamer to the adjoining ribozyme domain.
Although the class I induction element can be engineered to respond to
25 several unrelated effector molecules, this characteristic is not
universally applica-
ble. For example, appending an aptamer for arginine (40) to the class I
induction
element failed to produce a significant allosteric effect. Two of three other
classes
of induction elements tested (classes VI and VII) also display modularity when
engineered to carry the theophylline aptamer. However, class III induction
30 element and class III inhibition elements showed no response to the
addition of
effector when similarly appended to the same aptamer. These findings indicate
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
31
that the successful design of an allosteric ribozyme using this modular
approach
requires the fusion of compatible 'matched pairs' of aptamer and bridge
domains.
Table 1. Catalytic rate constants for the 'on' and 'off' states of class I
(induction)
and class II (inhibition) ribozymes compared to constructs designed to
simulate
these states.
lcob$ (x 10-' miri') Simulant lcobs (x 10-' miri')
Allosteric Ribozyme 'on' 'off' Construct 'on' 'off'
Class I (induction) p.46 0.0017 I-1 0.46
I-2 - 0.21
I-3 - 0.04
Class II (inhibition) 2.0 0.0080 II-1 0.47
II-2 - 0.0020
Example 2.
In Vitro Selection of Theonhvlline-Sensitive Allosteric Hammerhead Ribozymes
To investigate whether the process of developing communication
modules may be applicable toward any number of aptamer-ribozyme combinations,
5 in vitro selection for allosteric hammerhead ribozymes activated by
theophylline
binding has been performed. This selection has sought not only to validate the
combined modular rational design and in vitro selection process, but develop
new
communication modules that try the limits of nucleic acid allostery. The
initial
population for the development of allosteric theophylline-sensitive ribozymes
is
10 conceptually identical to that previously demonstrated to yield FMN-
sensitive
catalysts. However, the theophylline aptamer was appended to stem II of the
hammerhead ribozyme through a random-sequence region consisting of S+5 or 10
total nucleotide positions (Figure 7A) . An RNA population resulting from
eight
rounds of in vitro selection and amplification of theophylline-activated
ribozymes
15 exhibits a marked capability to catalyze the self cleavage reaction in the
presence
versus the absence of theophylline (G8; Figure 7B). The population as a whole
demonstrates an observed rate constant in the presence of ligand (kobs+) that
is
CA 02348779 2001-04-24
WO 00/26226 32 PCT/US99/25497
essentially identical to the observed rate constant for an unmodified
hammerhead
ribozyme ( ~ 1 min'). A number of individuals from the final population were
isolated and further characterized to establish the sequences of the
communication
modules and the kinetic parameters for ligand-activated catalysis (Table 2).
Many
Table 2. Communication module sequences and kinetic parameters of theophylline-
sensitive allosteric hammerhead ribozymes isolated by in vitro selection.
clone sequence kobs (mini) kobs+ (min's)fold activation
b , '
AUUGA
'4
I I 4.3 x 10 1. I 2600
, GGACC
UCGCU
7 '3 s
I 1 I 1.8 x 10 5.9 x 10 330
GGCGC
UUUGA _
I I 4 ' s
I I I I .4 x 10 9.0 x I 0 6400
GAACC
UCAUA
I 3 ( I I 1. I x l0'3 6.3 x I 0~ 570
t
GGUCU
UCUUA
'4 's
IS I 4.1 x 10 5.3 x 10 1300
GGCUC
UCAUA
'4 's
16 I I 2.6 x 10 9.3 x 10 3600
GGUCC
UUAGA
4
18 I I 6.4 x 10 1.4 2200
GGUCC
Sequence of each clone derived froth nucleotides comprising. the random region
of tl~e
initial population.
6 Observed rate constant for self-cleavage in the absence of theophylline.
Initial observed rate constant for self-cleavage in the presence of 200 p.M
theopiylline.
d kobs+ ~ ~obs.~
CA 02348779 2001-04-24
WO 00/26226 33 PCT/US99/25497
isolates were demonstrated to achieve theophylline-dependent rate constants
that
approach or exceed 1 min', where allosteric activation ranged from several
hundred- to several thousand-fold. In this manner, selection for theophylline-
sen-
sitive allosteric hammerhead ribozymes has provided functionally superior
catalysts
without compromising the catalytic efficiency of the ribozyme motif. The use
of
combined modular rational design and in vitro selection techniques for the
devel-
opment of ligand-sensitive allosteric ribozymes is thus be widely applicable
toward
the development of novel allosteric catalysts.
Example 3.
Allosteric Selection of Ribozvmes Responsive to cGMP and cAMP Messengers
Example 1 illustrated the generation of a series of allosteric ribozymes
using a three-domain construct (Figures 1 and 8). For several of the bridging
domains identified, it was observed during the course of experiments that
replacing
the original aptamer domain with different aptamer domains having various
ligand
specificities produced new allosteric ribozymes with the corresponding
effector
dependencies. In other words, certain bridging domains or communication
modules
including the class I communication module (cm + FMN 1 ) depicted in Figure 8
appear to serve as generic reporters of the occupation state of different
appended
aptamers regardless of the particular ligand specificity. This example reports
further studies conducted to investigate whether undiscovered aptamers could
trigger ribozyme function if they were judiciously integrated into the
effector-binding site of the tripartite RNA construct. A new construct was
generated in which the entire effector-binding site is replaced with a 25-
nucleotide
domain comprised of random sequence (Figure 8). The organization of this RNA
construct facilitated the isolation of allosteric ribozymes with novel
effector
specificities using a selective-amplification process herein termed
"allosteric
selection" (Figure 9A) . This process favors the enrichment of the RNA
population
for those ribozymes that remain inactive in the absence of effector, but that
are
activated upon effector addition (73).
CA 02348779 2001-04-24
WO 00/26226 34 PCT/US99/25497
MATERIALS AND METHODS
RNA Pool Preparation. DNA templates for the RNA pool depicted in
Fig. 1B and the oligonucleotides used for RT-PCR were prepared by automated
DNA synthesis (Keck Biotechnology Resource Laboratory, Yale University). All
DNAs were purified by denaturing {8 M urea) polyacrylamide gel electrophoresis
{PAGE) before use. The DNA template 5'-GGGCAACCTACGGCTTTCACCGT-
TTCGACGT{N~)AAGGCTCATCAGGGTCGCC (4.15 nmoles, SEQ ID NO: 32
+ ACGT and SEQ ID NO: 34) was made double-stranded by extension in the
presence of 'primer 2' (5'-TAATACGACTCACTATAGGGCGACCCTGATGAG,
8.3 nmoles, SEQ ID NO: 32), which introduces the promoter for T7 RNA
polymerase (T7 RNAP). The DNA extension reaction (300 ~ul) was carried out
using Superscript II reverse transcriptase (RT, GibcoBRL) according to the
manufacturer's directions.
The resulting double-stranded DNAs were recovered by precipitation
with ethanol and resuspended in a 2 ml transcription mixture containing 50 mM
Tris-HCl (pH 7.5 at 23°C), 15 mM MgCl2, 5 mM dithiothreitol, 2 mM
spermi-
dine, 2 rnM each of the four dNTPs, 200 wCi ( 32P)UTP, and 60,000 U T7
RNAP. The transcription mixture was incubated at 37°C for 1 hr and the
resulting
uncleaved precursor RNAs (internally 32P-labeled) were isolated by denaturing
10 % PAGE. Note that PAGE purification eliminates ribozymes that have under-
gone self-cleavage during the in vitro transcription reaction. This inherently
introduces an additional negative selection step that disfavors the isolation
of
ribozymes that function without activation by an effector. Moreover, this step
disfavors the isolation of allosteric ribozymes that cannot distinguish
between the
intended cNMP target effectors and the NTPs that are required for in vitro
transcription.
Allosteric Selection. In vitro selection for allosteric ribozymes that
respond to the cNMPs (Sigma) was carried out using repeated rounds of negative
and positive selection. For the first round of negative selection, an initial
pool of
RNA precursors (9.3 nmol, 5.6 x 10'5 molecules) was incubated at 23°C
for 5 hr
in a reaction mixture (930 ~cl) containing 50 mM Tris-HCl (pH 7.5) and 20 mM
MgClz in the absence of the four cNMPs. Precursor RNAs that resist cleavage
CA 02348779 2001-04-24
WO 00/26226 35 PCT/US99/25497
during this incubation were isolated by denaturing 10 % PAGE. Purified
precursor
RNAs were then subjected to the first round of positive selection at 23
°C for 30
min in the same reaction iiuffer (930 ~.1) containing 500 ~,M each of the four
cNMPs. At this stage, cleaved products were purified by denaturing 10% PAGE
and the 5' cleavage fragments were recovered from the gel by crush-soak
elution
and amplified by reverse transcription followed by PCR (RT-PCR). Reverse
transcription was conducted in a reaction buffer (400 ~cl total) using
Superscript II
RT according to the manufacturer's directions cDNA and using primer 1
(5'-GGGCAACCTACGGCTTTCACCGTTTCG, SEQ ID NO: 33). Subsequent
PCR amplification of the resulting cDNA using primers 1 and 2 (500 pmoles
each)
was conducted in a reaction mixture (2 ml total) containing IO mM Tris-HCl (pH
8.3 at 23°C), 50 mM KCI, 1.5 mM MgCl2, 0.01 % gelatin, 0.2 mM each dNTP
and 50 U Taq polymerase (Promega). The reaction was thermocycled for the
desired number of iterations at 94°C for 30 sec, 55°C for 30
sec, and 72°C for 60
sec.
Additional rounds of selective amplification were repeated in a similar
fashion using 15 min positive selection reactions until effector-sensitive
ribozyme
function was detected. Subsequent rounds of selection included both negative
and
positive selection steps that were conducted as described above using smaller
RNA
pools and with the reaction sizes scaled down accordingly. For the first 5
rounds
of selection, a 10 x stock mixture of cNMPs was added to the RNA pool prior to
the addition of the remaining components of the reaction buffer. In subsequent
rounds, the cNMP mixture was added after the reaction buffer to preclude the
isolation of acid-sensitive ribozymes. In addition, negative selections were
altered
to more aggressively select against ribozymes that cleave slowly or that
distribute
between active and inactive conformations upon refolding. To disfavor slow-
cleav-
ing ribozymes, the negative selection time was increased from 5 hr to as much
as
48 hr and multiple negative selection steps were occasionally employed prior
to
conducting positive selection. To disfavor misfolding ribozymes, periodic
thermo-
cycling was employed as described previously (65), or chemical denaturation
with
urea or mild alkali were used in an iterative fashion between periods of
negative
selection to induce multiple cycles of denaturation, renaturation and self
cleavage.
CA 02348779 2001-04-24
WO 00/26226 36 PCTNS99/25497
Interestingly, ribozymes that use a misfolding strategy for survival also
resisted the
negative selection strategies that rely on thermal and urea-mediated
denaturation
(unpublished observations). Therefore, the use of alkaline denaturation proved
most effective for negative selection.
Allosteric Ribozyme Characterization. RNA populations displaying
cNMP-dependent self cleavage were cloned (TOPO TA Cloning Kit, Invitrogen),
sequenced (Thermo Sequenase Cycle Sequencing Kit, USB) and further analyzed
by establishing the effector-mediated modulation of ribozyme kinetics.
Double-stranded DNA templates for individual allosteric ribozyme clones were
prepared either by PCR amplification of the plasmid DNA using primers 1 and 2,
or by preparation of the appropriate synthetic DNA template. Internally 32P-la-
beled RNAs were prepared by in vitro transcription as described above.
Initial rate constants for RNA self cleavage were established by incubat-
ing trace amounts ( ---100 nM) of internally 32P-labeled RNA precursors in
selec-
tion buffer containing different concentrations of cNMP effectors as indicated
for
each experiment. Reactions were terminated by the addition of 2 x PAGE loading
buffer containing additional EDTA to sequester the Mg2+ cofactor (65). For
each
clone, a plot of the fraction of precursor cleaved ( < 20 ~ processed) versus
time
gave a straight line where the slope reflects the initial rate constant for
the
ribozyme under the particular reaction conditions used. In all cases,
duplicate
experiments gave rate constants that varied by less that 50 ~ .
The caged cAMP analogue, adenosine 3',5'-cyclic monophosphate,
P1-(2-nitrophenyl)ethyl ester (Calbiochem), was resuspended in
dimethylsulfoxide
(DMSO) to yield a 100 x stock solution (200 mM). Dissolved analogue was
delivered to the ribozyme reaction to yield final concentrations of 2 mM, and
the
resulting reaction mixture was supplemented with DMSO to give a final
concentra-
tion of 5 % to prevent its precipitation. This concentration of DMSO had no
affect
on the function of the clone cAMP-3. UV irradiation of the samples contained
in
a polycarbonate microtiter plate (USA Scientific) was conducted using a UV
transilluminator (Spectroline model TVC-312A) that produces light centered at
312
nm. Under these conditions, greater than 80 ~ of the analogue is converted to
cAMP.
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
37
The cAMP depletion reactions were prepared by delivering cAMP (500
p,M), 3',5'-cyclic nucleotide phosphodiesterase (activator deficient from
bovine
brain, Sigma) and calmodulin (3',5'-cyclic nucleotide phosphodiesterase
activator,
Sigma) as indicated for each reaction. Lyophilized phosphodiesterase and cal-
modulin samples were separately resuspended in a buffer containing 50 mM MES
(pH 6.5 at 23 °C), 100 mM NaCI and 60 % glycerol. Phosphodiesterase was
delivered as indicated to a final concentration of 5 x 10~ U ,ul-' and
calmodulin
was delivered as indicated to a final concentration of 1.5 U ~cl-1. Reactions
for
the cAMP depletion studies contained 50 mM Tris-HCl (pH 7.5 at 23°C),
20 mM
MgClz, 30 ~M CaCl2, and 2.7 % glycerol. Trace amount of internally 32P-labeled
cAMP-1 RNA was added immediately (no preincubation) or was added after a 40
or 80 min preincubation that was carried out at 30°C.
RESULTS AND DISCUSSION
Beginning with a pool of 10'5 RNA molecules representing nearly all
possible sequence variants within the random-sequence domain of the construct,
successive negative and positive selection reactions were conducted using a
mixture of the four natural 3',5'-cyclic mononucleotides (cNMPs; 500 p,M each)
as potential effector molecules. Each RNA population was prepared by in vitro
transcription in the absence of the cNMP mixture and the full-length precursor
RNAs were purified by denaturing 10% polyacrylamide gel electrophoresis
(PAGE). The isolated RNA precursors were incubated in the absence of the
effector mixture under otherwise permissive reaction conditions (reaction
buffer:
50 mM Tris-HCI, pH 7. S at 23 °C, and 20 mM Mg2+) for an extended
period of
time. Uncleaved precursors from this negative selection reaction were again
isolated by PAGE and subjected to positive selection by brief incubation under
the
permissive reaction conditions containing the cNMP mixture. The resulting
5'-cleavage products were purified by PAGE and amplified by reverse transcrip-
tion followed by the polymerase chain reaction (RT-PCR). This selective-am-
plification process was repeated to favor the enrichment of allosteric
ribozymes
that respond to any of the four cNMPs.
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/Z5497
38
Acid-Sensitive and Effector-Independent Ribozymes. After only six
rounds of selective amplification (G6), the RNA pool exhibited a significant
positive response to the addition of the cNMP mixture (Figure 9b). However,
upon further examination, it was found that the G6 RNA population does not
specifically recognize any of the cNMPs, but is dominated by ribozymes that
are
triggered to function by a brief acidic treatment. Over the first six rounds
of selec-
tion, the pH of the RNA mixture had been unintentionally lowered by adding an
acidic mixture of cNMPs immediately prior to the addition of the reaction
buffer.
To prevent acidification, the RNA pool used for the positive selection was buf
fered with 50 mM Tris-HCl (pH 7.5 at 23°C) prior to the addition of the
cNMP
mixture and the 20 mM Mg2+ used to initiate the reaction.
Two additional classes of selfish RNA molecules also became evident in
the early stages of selection. One class of selfish ribozymes promote the RNA
cleavage reaction with substantially reduced catalytic rates in both the
negative and
positive selection steps. The other class distributes into properly folded and
misfolded states. In both cases, the ribozymes are not completely self
processed
during the negative selection reaction, and therefore are enriched by the
selec-
tive-amplification process without responding to the effectors. These two
types of
selfish RNAs contributed to the high background level of RNA catalysis that
was
observed in the positive selection reaction, and this rendered the efficiency
of the
allosteric selection process less than optimal.
Fortunately, ribozymes that specifically activate by recognizing an
effector molecule attain a significant selective advantage over ribozymes that
employ the effector-independent strategies described above. Extension of the
incubation time for the negative selection reaction was used to further
disfavor
ribozymes that cleave more slowly. However, ribozymes that persist using a
misfolding strategy were more difficult to eliminate. Presumably, a certain
portions of these molecules partition into active and inactive conformational
states
after each denaturation event. Therefore, only part of the population cleaves
during the negative selection. Upon purification of the uncleaved precursors
by
denaturing PAGE, the RNAs have another chance to refold and distribute between
the two conformational states. This allows a significant portion of the
population
CA 02348779 2001-04-24
WO 00/26226
PCT/US99/25497
39
to cleave during the subsequent positive selection reaction. To disfavor
ribozymes
that employ this strategy, multiple rounds of negative selection and
purification
were conducted. Alternatively, negative selection reactions were interspersed
with
thermal or chemical denaturation steps to cleave and refold the RNAs
repetitively
(see Materials and Methods above).
Isolation of cNMP-Deuendent Hammerhead Ribozymes. A measurable
response to the cNMP mixture was once again exhibited by the selected RNA
populations after a total of 14 rounds (Figure 9B). The G16 RNA pool was
observed to be dominated by allosteric ribozymes that are activated
specifically
upon the addition of cGMP. Therefore, an additional two rounds of selection
using only cGMP as the effector. The resulting population, termed G18' RNA, is
highly responsive to the addition of cGMP (Figure 9C).
To recover ribozymes that respond to the remaining cNMPs, cGMP was
added to the negative selection reaction at G17 and supplied the remaining
three
effectors in the positive selection reaction. By G19, the RNA pool no longer
responds to cGMP, but shows specificity for cCMP. Therefore, an additional
round of selection using only cCMP as the effector was conducted to produce
G20' RNA. This RNA population preferentially cleaves in the presence of cCMP
(Figure 9C).
In a repetition of this strategy, both cGMP and cCMP were included in
the negative selection beginning with G20, while supplying CAMP and cUMP in
the positive selection. This process yielded a population of RNAs at G22 that
now
responds positively to cAMP. An additional round of selection using only cAMP
gave rise to G23' RNA, a population that exhibits allosteric activation
exclusively
by this effector (Figure 9C). However, after conducting an additional six
rounds of
selection using only cUMP in the positive selection reaction, specific
enhancement
in RNA cleavage by this effector was not observed. This finding indicates that
cUMP-specific ribozymes were not present in the initial population and that
ribozymes with this effector specificity did not by chance emerge as a result
of
mutations acquired during the selective-amplification process.
Kinetic Modulation of Ribozymes with cGMP cCMP and cAMP.
Clones from the G18', G20' and G23' populations were sequenced in order to
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
further characterize the function of the selected RNAs. Of the 12 clones
examined
from the G18 population, eight display considerable diversity within the
original
random-sequence domain (Figure l0A). Interestingly, all individuals sustained
at
least one mutation within the regions that define the communication module,
and
5 all but one clone carry deletions within the random-sequence domain. This
finding
indicates that the original pool may not have offered a significant
representation of
allosteric ribozymes for the cNMP targets despite our efforts to bias the
design of
the RNA construct in favor of allosteric function.
Clones cGMP-1 through cGMP-4 were tested for catalytic activity and
10 each responds positively to the addition of cGMP with distinctive
characteristics
(Figure lOB). A comparison of the initial rates of hammerhead cleavage
measured
in the absence and the presence of effector (without regard for non-linear
kinetics)
reveal that cGMP-1 is activated ~ 510 fold under the conditions used for
allosteric
selection (Figure lOC). The remaining three clones are activated to a lesser
15 magnitude, however each exhibits selective activation with cGMP and shows
no
cross reactivity with the remaining non-cognate effector molecules.
Similarly, individual clones from the G20' and G23' populations demon-
strate specific activation with cCMP and cAMP effectors, respectively. As
observed with the cGMP-specific RNAs, the sequences of the isolated G20' RNAs
20 reveal the acquisition of significant mutations or deletions over the
course of the
selection process, indicating that these changes may have been necessary to
give
rise to allosteric function (Figure lOD). Although the catalytic performance
of all
seven clones sequenced from G20' were examined, only cCMP-1 and cCMP-2
were observed to be activated by its corresponding effector (Figures l0E and
25 lOF). The remaining clones manifest weak catalytic activity without regard
to the
presence of any effector, indicating that these RNAs have persisted to this
stage in
the selection process without utilizing an allosteric activation strategy.
Eight distinct individuals were also identified among the 13 clones se-
quenced from the G23' population (Figure lOG). Again, the clones have experi-
30 enced significant acquisition of mutations within the original
communication
module or deletions within the random-sequence domains. Each of the five
clones
examined from the G23' population respond positively to the presence of cAMP
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
41
(Figure lOH). Moreover, the clones cAMP-1 through cAMP-4 display allosteric
reaction kinetics that are similar to those observed with the previous
allosteric
constructs (Figure l0I). Although no cUMP-dependent ribozymes were isolated
from this RNA population, the diversity of sequences and kinetic
characteristics of
the allosteric ribozymes that were recovered indicate that significant
potential
exists for the generation of novel effector-modulated RNAs.
Molecular Reco nition by Effector Binding Sites. Of primary concern is
whether the representative cGMP-, cCMP- and cAMP-dependent ribozymes
directly recognize the atomic structures of their corresponding effectors, or
whether they respond to some other physicochemical signaling agent that might
be
unintentionally introduced into the reaction mixture. Precedence for
alternative
effectors for allosteric activation is provided by the observation that the
first
ribozymes that dominated the RNA population do not respond specifically to any
of the four cNMPs, but are sensitive to acidification of the reaction mixture.
To
determine if the mechanism of ribozyme activation is mediated through direct
molecular recognition of cNMPs, adenosine 3',5'-cyclic monophosphate, P1-(2-ni-
trophenyl)ethyl ester, a "caged" form of cAMP was used (Figure 11A). The
caged cAMP is a triester analogue of cAMP similar to those reported by Ner-
bonne, et al. (67) and is uncaged by cleavage of the added phosphoester
linkage by
irradiation with ultraviolet light. This caged effector provides a means to
test
whether an individual cAMP-dependent clone can be activated upon releasing the
effector by irradiation.
The cAMP-dependent clones cAMP-1, cAMP-2 and cAMP-4 (Figure
l0I) each cleave when presented with the caged effector (data not shown),
suggest-
ing that the allosteric binding sites of these RNAs accommodate the chemical
alteration present in this analogue of cAMP. In contrast, the cAMP-3 clone
exhibits the same rate constant whether it is incubated with 500 ~,M caged
cAMP
or whether it is incubated in the absence of effector (Figure 11B).
Presumably,
the allosteric binding site of cAMP-3 excludes the caged CAMP compound from
binding and activating the adjoining ribozyme. However, brief irradiation of a
mixture containing CAMP-3 RNA and the caged cAMP with long wave UV light
centered on ~ 312 nm results in a significant activation of ribozyme function.
The
CA 02348779 2001-04-24
WO 00/26226
PCT/US99/25497
42
finding that UV-induced production of cAMP in situ triggers ribozyme
activation
is consistent with a mechanism whereby cAMP is directly recognized as an
effector by this particular allosteric ribozyme.
To further investigate whether molecular recognition of cNMP effectors by RNA
mediates allosteric ribozyme function, an assay wherein cAMP is depleted from
the reaction mixture in situ was established (Figure 12). The in situ
depletion of
cAMP was achieved using cyclic nucleotide phosphodiesterase (68) and its
activator calmodulin. These proteins do not deplete the effector when
incubated
independently, but when combined they efficiently hydrolyze 3',5'-cyclic AMP
to
yield 5'-AMP. Under the assay conditions less than 10% of the cAMP is de-
stroyed during a 40 min preincubation in the presence of the phosphodiesterase
alone, however more than 90 % is destroyed in a similar reaction containing
cahnodulin, an activator of cyclic nucleotide phosphodiesterase activity.
The allosteric ribozyme cAMP-1 does not accommodate 5'-AMP as an
effector (see Figure 13). As a result, this ribozyme should not be activated
if
cAMP is first depleted by the catalytic action of phosphodiesterase/calmodulin
complexes. As expected, we find that neither phosphodiesterase nor calmodulin
alone inhibit allosteric activation of cAMP-1 RNA (Figure 12A, lanes 5 and 6).
In contrast, the allosteric ribozyme is not significantly activated when added
to a
reaction mixture containing cAMP that has been preincubated with both phospho-
diesterase and calmodulin (Figure 12A, lane 7). Moreover, it was observed that
cAMP-1 ribozymes in a reaction mixture equivalent to that used for lane 7
could
be activated upon addition of a second aliquot of cAMP (Figure 12B). This
indicates that the loss of ribozyme activation upon preincubation with both
protein
factors is caused by the depletion of cAMP effector and is not due to any
inhibito-
ry effects that are inherent to the protein complex. Both studies described
above,
which involve either in situ production or depletion of cAMP, provide evidence
that at least some of the many ribozymes isolated by allosteric selection
directly
recognize their corresponding cNMP effector molecules.
Molecular Discrimination by Allosteric Bindine Sites. A preliminary
survey of the molecular recognition determinants was conducted using
representa-
tive clones cGMP-1, cCMP-1 and cAMP-1. In each case, the RNAs exhibit
CA 02348779 2001-04-24
WO 00/Z6226 PCTNS99/25497
43
significant discrimination against closely related analogues of their
corresponding
effector (Figure 13). For example, cGMP-1 RNA shows significant discrimination
against 3'-GMP and 5'-GMP, the hydrolyzed analogues of cGMP. Likewise, the
cCMP-1 and cAMP-1 clones also exhibit this same ability to distinguish whether
the cyclic phosphodiester structure of their corresponding cNMP effectors has
been
opened by hydrolysis of the 5'O-P or the 3'O-P bonds.
Although additional experimentation is necessary to more clearly define
the determinants of molecular recognition for these allosteric ribozymes, it
appears
that in each case the discrimination against opened-ring analogues could be
due to
steric interactions. The observation that all three clones remain at least
partially
active when supplied with the corresponding nucleoside and deoxynucleoside
analogues of cNMP indicates that the phosphate moiety is not absolutely
required
for allosteric activation. In contrast, alteration of many of the functional
groups on
the nucleotide base of each effector adversely affects allosteric ribozyme
function
(Figure 13). Therefore, the base moieties of the cNMP effectors appear to be
essential for molecular recognition by the different effector-binding domains.
Rapid Activation of cNMP-Dependent Ribozymes. A common charac-
teristic of the small-molecule-dependent allosteric ribozymes created to date
is the
rapid activation or deactivation of ribozyme function upon addition of the
effector
(5, 7, b5). The rapid allosteric response is a kinetic feature that is highly
desir-
able for RNA molecular switches that are to find practical application.
Therefore,
the activation kinetics for the three representative clones cGMP-1, cCMP-1 and
cAMP-1 were examined. In each case, the ribozymes appear to be activated
within seconds after introduction of their corresponding effector molecules
(Figure
14). Rapid activation of ribozyme function is indicative of a dynamic RNA
structure that quickly forms active effector-binding and ribozyme
conformations
only upon introduction of the appropriate signaling agent.
Each of the clones described above maintain linear cleavage kinetics
through at least one half life (Figure 14), indicating that greater than 50%
of an
individual clone's RNAs are activated upon addition of the appropriate
effector.
However, self-cleavage for some individuals reaches a plateau after only a
short
reaction time, which might be indicative of significant misfolding problems.
Upon
CA 02348779 2001-04-24
WO 00/Z6226
PCT/US99/25497
44
allosteric activation, most clones examined undergo between 20 % to 90 %
process-
ing before cessation of catalysis.
Binding Affinities and DXnamic ranses. The effector-binding site of
each allosteric ribozyme is expected to bind its ligand with a distinct
affinity that
can be described by a dissociation constant (KD) for the RNA-ligand
interaction.
If occupation of the effector-binding site indeed correlates with the level of
activation for a particular allosteric ribozyme, then an apparent KD for
effector
binding can be established for this interaction by examining the dependency of
catalytic rate on the concentration of effector.
To provide a comprehensive analysis of the binding affinities displayed
by the allosteric ribozymes that were isolated in this study, the effector
concentra-
tion-dependent activities of all ten allosteric ribozymes described in Figures
11 to
13 were determined. Apparent KD values were determined by establishing the
effector concentration that produces a rate constant that is half maximal (1/2
k"~.
In all cases, the apparent KD falls near the concentration of each effector
used
during in vitro selection (Figure 15). These constants range from 200 ~,M
(cGMP-3) to ~4 mM (cCMP-1). By comparison, most ligand-binding RNAs
isolated by SELEX methods (16, 46-53) bind with higher affinities, indicating
that
improvements in the sensitivity of these allosteric ribozymes to lower
concentra-
tions of effector could be achieved.
The plots used to define the apparent KD for each allosteric ribozyme
(Figure 11) also reveal the range of rate constants that are exhibited for
different
concentrations of effector. This "dynamic range" for allosteric responses is
highly
variable between the different clones, suggesting that the diversity of
functional
characteristics that can be manifested by allosteric ribozymes is substantial.
As
expected from the preliminary analysis (Figure lOB), the cGMP-3 ribozyme has a
poor rate enhancement or "allosteric response" to cGMP. As a result, this
individual exhibits an overall dynamic range of less than one order of
magnitude.
In contrast, the clone that displays the best dynamic range is cGMP-1, which
maintains a linear increase in the logarithm of its rate constant from 1 ~,M
through
1 mM. Although the increase in the rate constant for cGMP-1 under in vitro
selection conditions is ~ 500 fold, the overall rate increase upon saturation
of the
CA 02348779 2001-04-24
WO 00/Z6226 PCT/US99/25497
effector-binding site with cGMP is approximately 5,000 fold. This corresponds
to
a dynamic range for cGMP-1 of greater than three orders of magnitude.
Eneineerins Novel RNA Molecular Sensors. The allosteric selection
strategy (Figure 9A) employed in this study provides an alternative approach
for
5 the isolation of novel multidomain RNAs that function as molecular switches,
and
for the isolation of new ligand-binding RNA structures. The simultaneous
isolation of numerous allosteric ribozymes that respond to particular cNMP
targets
are reported herein. Similarly, allosteric selection could be used for the
isolation
of molecular sensors on a massively parallel scale by using mixtures of metal
ions
10 and metal complexes or by using complex mixtures containing hundreds of
organic
compounds, proteins or nucleic acids as candidate effector molecules in the
positive selection reaction. Indeed, any physicochemical impulse that can
influence
RNA structure folding could be a signalling agent for allosteric ribozyme
function.
Structural and Functional Versatility of RNAs. In contrast to the limited
15 functions of natural ribozymes, protein enzymes catalyze a tremendous array
of
chemical transformations with extraordinary precision and enormous rate
enhance-
ments. Included among the diverse biochemical functions of protein enzymes are
conformational changes that in some instances provide effector-dependent
allosteric
modulation (21). Unlike their protein counterparts, natural ribozymes are not
20 known to undergo allosteric modulation of catalytic activity. However, the
results
of this study and several earlier studies (5, 6, 8, 9, 61-63, 65, 66) provide
evidence that nucleic acids are quite capable of modulating catalytic activity
in
response to various effector compounds. These findings are consistent with
earlier
suggestions (57-60) that RNA may have significant untapped potential for
complex
25 catalytic function. Presumably, the true catalytic potential of nucleic
acids can be
harnessed for the construction of synthetic ribozymes that make unique
biochemi-
cal applications possible.
It is important to note that the allosteric ribozymes described in this
study have not been subjected to any efforts to optimize their allosteric
responses
30 and catalytic function. Illustrated are representative clones that were
generated by
this initial in vitro selection process, regardless of their kinetic
characteristics, in
order to give a sense of the properties of allosteric ribozymes that first
proved
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/Z5497
46
successful. The ribozymes described in this example should be considered
prototypic because in most cases their effector binding affinities and
catalytic rates
are most likely inadequate to serve in most applications. Presumably,
individual
classes of allosteric ribozymes isolated by allosteric selection will be
amenable to
5 further optimization using similar in vitro selection strategies like those
used in
this study. This would ultimately allow their development as efficient
molecular
sensors for various applications.
Implications for the Control of Gene Expression. Precise control over
gene expression is of profound importance to the normal function of all cells.
Likewise, the purposeful manipulation of gene expression that is directed with
precise temporal or spatial command is of great interest to those who desire
to
control biological systems at the molecular level. Conceivably, the regulation
of
gene expression can occur at any stage of the process of information transfer
from
DNA to RNA and from RNA to the final protein product. In fact, natural systems
15 have evolved an abundance of strategies that are used to adjust the levels
of gene
accessibility and to modulate the molecular processes that occur after
transcription
(69). Many of these mechanisms have become targets for the development of
small-molecule regulators that can be used to control gene expression (70) .
A number of genetic control mechanisms of cells are exerted at the level
20 of RNA. Natural antisense interactions and the modulation of RNA stability,
for
example, are two mechanisms that are known to impact gene expression. Anti-
sense oligonucleotides and ribozymes are widely used by investigators to
purpose-
fully influence the expression of specific genes by exploiting these two mecha-
nisms. These approaches modulate RNA function either by sterically blocking
25 access to the RNA target or by targeting the RNA for destruction. Recently,
it
was shown that mRNA translation could be blocked by exploiting specific
interac-
tions between aptamers and certain dye compounds (71). Specifically, RNA
aptamers that selectively bind Hoechst dyes H3325$ and H33342 were integrated
into mRNAs such that gene expression was selectively blocked when these
ligands
30 were introduced to the cell. Similarly, allosteric ribozymes could be fused
to
mRNAs so that when the corresponding effector molecule is introduced into the
cell, the ribozyme domain adjusts its catalytic activity. Therefore,
allosteric
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/2549?
47
effector molecules could be used to modulate the stability of mRNAs and thus
influence the expression of a target gene.
The allosteric selection protocol described herein makes possible the
simultaneous selection of new allosteric ribozymes that respond to any of
hundreds
or even thousands of compounds. This provides a means to test whether self
clea-
ving ribozymes such as the hammerhead can be made to respond to a wide range
of effector stimuli and whether the resulting allosteric constructs can be
integrated
with mRNAs as new genetic control elements. If this proves feasible, then
nearly
any natural or bioavailable compound is a candidate for the purposeful control
of
gene expression in genetically transformed organisms.
The above description is for the purpose of teaching the person of
ordinary skill in the art how to practice the present invention, and it is not
intended to detail all those obvious modifications and variations of it which
will
become apparent to the skilled worker upon reading the description. It is
intend-
15 ed, however, that all such obvious modifications and variations be included
within
the scope of the present invention, which is defined by the following claims.
The
claims are intended to cover the claimed components and steps in any sequence
which is effective to meet the objectives there intended, unless the context
speci-
fically indicates the contrary.
References
1. McDaniel, R. , et al. ( 1995) Nature 375, 549-554.
2. Marsden, A. F. A., et al. (1998) Science 279, 199-202.
3. Hellinga, H. W. & Marvin, J. S. (1998) Trends Biotechnol. 16, 183-189.
4. Crane, D. E., et al. (1998) Science 282, 63-68.
5. Tang, J. & Breaker, R. R. (1997) Chem. Biol. 4, 453-459.
6. Tang, J. & Breaker, R. R. (1997) RNA 3, 914-925.
7. Araki, M., et al. (1998) Nucleic Acids Res. 26, 3379-3384.
CA 02348779 2001-04-24
WO 00/26226 4$ PCT/US99/25497
8. Tang, J. & Breaker, R. R. (1998) Nucleic Acids Res. 26, 4214-4221.
9. Soukup, G. A. & Breaker, R. R. (in press, 1999) Allosteric ribozymes. In
Ribozymes: Biology and Biotechnology. (eds. Gaur, R.K. & Krupp, Eaton
Publishing: )
10. Gerstein, M., et al. (1994) Biochemistry 33, 6739-6749.
11. Pyle, A. M. & Green, J. B. {1995) Curr. Biol. 5, 303-310.
12. Draper, D. E. (1996) Trends Biochem. Sci. 21, 145-149
13. Westhof, E., et al. (1996) Fold. Des. 1, 78-88.
14. Willians, K. P. & Bartel, D. P. (1996) Nucleic Acids Mol. Biol. 10, 367-
381.
15. Breaker, R. R. (1997) Chem. Rev. 97, 371-390.
16. Gold, L. , et al. ( 1995) Annu. Rev. Biochem. 64, 763-797.
17. Osborne, S. E. & Ellington, A. D. (1997) Chem. Rev. 97, 349-370.
18. Monod, J. & Jacob, F. (1961) Cold Spring Harbor Symp. Quart. Biol. 26,
389-401.
19. Monod, J., Changeux, J.-P. & Jacob, F. (1963) J. Mol. Biol. 6, 306-329.
20. Kurganov, B. I. ( 1978) Allosteric Enzymes. John Wiley & Sons Ltd. , New
York, NY.
21. Perutz, M. (1994) Mechanisms of Cooperativity and Allosteric Regulation in
Proteins. (Cambridge University Press, New York, NY.)
22. Ye, X., et al. (1996) Nature Struct. Biol. 3, 1026-1033.
23. Hsiung, C. & Patel, D. J. (1996) Nature Struct. Biol. 3, 1046-1050.
24. Lin, C. H. & Patel, D. J. (1997) Chem. Biol. 4, 817-832.
25. Patel, D. J., et al. (1997) J. Mol. Biol. 272, 645-664.
26. Burgstaller, P. & Famulok, M. (1994) Angew. Chem. Int. Ed. Engl. 33,
1084-1087.
27. Forster, A. C. & Symons, R. H. (1987) Cell 49, 211-220.
28. Fedor, M. J. & Uhlenbeck, O. C. (1992) Biochemistry 31, 12042-12054.
CA 02348779 2001-04-24
WO 00/26226 49 PC'r/US99/25497
29. Tuschl, T. & Eckstein, F. ( 1993) Proc. Natl. Acad. Sci. USA 90, 6991-
6994.
30. Long, D. M. & Uhlenbeck, O. C. (1994) Proc. Natl. Acad. Sci. USA 91,
6977-6981.
31. Burgstaller, P., et al. (1997) Nucleic Acids Res. 25, 4018-4027.
32. Carey, J. (1988) Proc. Natl. Acad. Sci. USA 85, 975-979.
33. Burgstaller, P. & Famulok, M. (1996) Bioorg. Med. Chem. Lett. 6,
1157-1162.
34. Fan, P. , et al. ( 1996) J. Mol. Biol. 258, 480-500.
35. Serra, M. J. & Turner, D. H. Meth. Enzymol. 259, 242-261.
36. Lodmell J. S. & Dahlberg, A. E. (1997) Science 277, 1262-1267.
37. von Ahsen, U. (1998) Chem. Biol. 5, R3-R6.
38. Jenison, R. D., et al. (1994) Science 263, 1425-1429.
39. Sassanfar, M. & Szostak, J. W. (1993) Nature 364, 550-553.
40. Famulok, M. (1994) J. Am. Chem. Soc. 116, 1698-1706.
41. Breaker, R. R. & Joyce, G. F. (1994) Trends Biotechnol. 12, 268-275.
42. Ruffner, D. E., et al. (1990) Biochemistry 29, 10695-10702.
43. U.S. Pat. No. 5,589,333 to A. Shih, et al. (1996).
44. WO 98/08974 by N. Asher, et al. (Intelligene, 1998).
45. WO 98/27104 by R. Breaker (Yale University, 1998).
46. U.S. Pat. No. 5,567,588 to L. Gold & S. Ringquist (1996).
47. U.S. Pat. No. 5,637,459 to D. Burke, et al. (1997).
48. U.S. Pat. No. 5,712,375 to K.B. Jensen, et al. (1998).
49. U.S. Pat. No. 5,723,289 to B.E. Eaton & L. Gold (1998).
50. U.S. Pat. No. 5,723,592 to B.E. Eaton & L. Gold (1998).
51. U.S. Pat. No. 5,763,177 to L. Gold, et al. (1998).
CA 02348779 2001-04-24
WO 00/26226 PCTNS99/25497
50
52. U.S. Pat. No. 5,763,566 to K.B. Jensen, et al: (1998).
53. U.S. Pat. No. 5,773,598 to D. Burke, et al. (1998).
54. Pan, T. ( 1997) Curr. Opin. Chem. Biol. 1, 17-25.
55. Frauendorf, C. & Jaschke, A. (1998) Angew. Chem. Int. Ed. 37, 1378-1381.
56. Kurz, M. & Breaker, R.R. (1999) Current Topics in Microbiology and
Immunology, Vol. 243: Combinatorial Chemistry in Biology, (eds. Winnacker,
E.-L., et al., Springer-Verlag, Berlin, Germany) 137-15b.
57. White, H.B. III (1976) J. Mol. Evol. 7, 101-104.
58. Benner, S.A., et al. (1987) Cold Spring Harbor Symp. Quant. Biol. 52,
53-63.
59. Benner, S.A., et al. (1989) Proc. Natl. Acad. Sci. USA 86, 7054-7058.
60. Hirao, I. & Ellington, A.D. (1995) Curr. Biol. 5, 1017-1022.
61. Ports, H., & Lizardi, P.M. (1995) Bio/Technol. 13, 161-164.
62. Kuwabara, T., et al. (1998) Molecular Cell 2, 617-627.
63. Robertson, M.P., & Ellington, A.D. (1999) Nature Biotechnol. 17, 62-66.
64. Batey, R.T. & Doudna, J.A. (1998) 5, 337-340.
65. Soukup, G.A. & Breaker, R.R. (1999) Proc. Natl. Acad. Sci. USA 96,
3584-3589.
66. Soukup, G.A. & Breaker, R.R. (1999) Structure Fold. Des. 7, 783-791.
67. Nerbonne, J. M. , et al. ( 1984) Nature 310, 74-76.
68. Ho, H.C., et al. (1976) Biochim. Biophys. Acts 429, 461-473.
69. Lin, E.C.C. & Lynch, A.S. (1996) Regulation of gene expression in Esche-
richia coli. (R.G. Landes Co, Austin, Texas).
70. benison, C. & Kodadek, T. (1998) Chem. Biol. 5, 8129-8145.
71. Werstuck, G. & Green, M.R. (1998) Science 282, 296-298.
72. Hertel, K.J. , et al. ( 1992) Nucleic Acids Res. 20, 3252.
CA 02348779 2001-04-24
WO 00/26226 PCT/US99/25497
51
73. Koizumi, M., et al., (1999) Nat. Struc. Bio. 11, 1-10
The papers and patents cited herein are expressly incorporated in their
entireties by reference.
CA 02348779 2001-04-24
WO 00/26226 1 ~ 6 PCT/US99/25497
SEQUENCE LISTING
<110> Breaker, Ronald R.
Soukup, Garrett A.
<120> Multidomain Polynucleotide Sensors
<130> OCR-794B.PCT
<141> 1999-10-29
<150> US 60/106,829
US 60/126,683
<151> 1998-11-03
1999-03-29
<160> 34
<170> MS-DOS
<210> 1
<211> 27
<212> RNA
<220>
<221> hammerhead ribozyme
<222> III
<223> upper strand in figure
<300>
<301> Hertel, K.J., et al.
<302> Numbering system for the hammerhead
<303> Nucleic Acids Res
<304> 20
<306> 3252
<307> 1992
<400> 1
cgaaacggug aaagccguag guugccc 27
<210> 2
<211> 17
<212> RNA
<220>
<221> hammerhead ribozyme
<222> I
<223> lower strand in figure
<300>
<301> Hertel, K.J., et al.
<302> Numbering system for the hammerhead
<303> Nucleic Acids Res
<304> 20
<306> 3252
<307> 1992
<400> 2
gggcgacccu gaugaga 17
<210> 3
<211> 24
<212> RNA
CA 02348779 2001-04-24
WO 00/26226 2 ~ 6 PCTNS99/25497
<213> artificial sequence
<220>
<221> FMN aptamer
<223> boxed in figure
<400> 3
aggauaugcu ucuucggcag aagg 24
<210> 4
<211> 22
<212> RNA
<213> artificial sequence
<220>
<221> I-1 class I induction module
<400> 4
gccuuagccu ucgggcgacg uc 22
<210> 5
<211> 21
<212> RNA
<213> artificial sequence
<220>
<221> I-2 class I induction module
<400> 5
gccuugccuu cgggcgacgu c 21
<210> 6
<211> 21
<212> RNA
<213> artificial sequence
<220>
<221> I-3 class I induction module
<400> 6
gcguugccuu cgggcgacgc c 21
<210> 7
<211> 18
<212> RNA
<213> artificial sequence
<220>
<221> class II induction module
<400> 7
gauggccuuc gggcucuc 18
<210> 8
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> theophilline aptamer
<223> boxed in figure
<400> 8
auaccagccg aaaggcccuug gcag 24
<210> 9
<211> 24
<212> RNA
<213> artificial sequence
CA 02348779 2001-04-24
WO 00/26226
3 ~ 6 PCT/US99/25497
<221> clone cGMP-1
<400> 9
cagcagucgu ggaaaaacgu agcg 24
<210> 10
<211> 25
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-2
<400> 10
gagaagcugg aaaaacgcaa acacg 25
<210> 11
<211> 23
<212 > RNA
<213> artificial sequence
<220>
<221> clone cGMP-3
<400> 11
cgcaccaacg uucgucggcu gca 23
<210> 12
<211> 23
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-4
<400> 12
accccagagg ucagcugcau aac 23
<210> 13
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-5
<400> 13
gcaccgacgg uagcgaggcg auua 24
<210> 14
<211> 22
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-6
<400> 14
uugcgcgacu acaacgcaau ua 22
<210> 15
<211> 21
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-7
<400> 15
caaugucacu cagcacgauu a 21
CA 02348779 2001-04-24
WO 00/26226 4 ~ 6 PCT/US99/25497
<210> 16
<211> 22
<212> RNA
<213> artificial sequence
<220>
<221> clone cGMP-8
<400> 16
cggggcucau agcuugccac gc 22
<210> 17
<211> 25
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-1
<400> 17
cacagaaagu ggugugaacc gggau 25
<210> 18
<211> 25
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-2
<400> 18
ggauaaggug ucugcacuag uggau 25
<210> 19
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-3
<400> 19
caaaaacggc gacuacccgc auua 24
<210> 20
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-4
<400> 20
gaguugcgcg cagaaccgcc auua 24
<210> 21
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-5
<400> 21
uagccaacgu cagugugcgc auua 24
<210> 22
<211> 25
<212> RNA
<213> artificial sequence
CA 02348779 2001-04-24
WO 00/26226 5 ~ 6 PCT/US99/25497
<221> clone cCMP-6
<400> 22
aaaguugcgg acuacaacgc aauua 25
<210> 23
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cCMP-7
<400> 23
ugcggacuug caaugcgccga uua 24
<210> 24
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-1
<400> 24
ucaguacacg gugcagacaa aggu 24
<210> 25
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-2
<400> 25
ucgaggaggc aggugcaugu gggc 24
<210> 26
<211> 23
<212> RNA
<213> artificial sequence
<220>
<221> clone CAMP-3
<400> 26
ccccggcgca uuggacgacg agu 23
<210> 27
<211> 23
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-4
<400> 27
cgaagcugac caugcucagc ggg 23
<210> 28
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-5
CA 02348779 2001-04-24
WO 00/26226 6 ~ 6 PCT/US99/25497
ucgagucuuc agaugcaugu ggga 24
<210> 29
<211> 24
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-6
<400> 29
gugaguauuc aacgugaugu ggaa 24
<210> 30
<211> 23
<212> RNA
<213> artificial sequence
<220>
<221> clone cAMP-7
<400> 30
ucgagaauca ggugcaugug gua 23
<210> 31
<211> 22
<212> RNA
<213> artificial sequence
<220>
<221> clone CAMP-8
<400> 31
cgacuccgac caacggggga cg 22
<210> 32
<211> 32
<212> DNA
<213> artificial sequence
<220>
<221> primer
<223> used in constructs
<400> 32
taatacgactc actatagggc gaccctgatg ag 32
<210> 33
<211> 26
<212> DNA
<213> artificial sequence
<220>
<221> primer
<223> used in constructs
<400> 33
gggcaacctac ggctttcacc gtttcg 26
<210> 34
<211> 18
<212> DNA
<213> artificial sequence
<220>
<221> primer
<223> used in constructs
<400> 34
aaggctcatca gggtcgcc 18
