Note: Descriptions are shown in the official language in which they were submitted.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26~
1
HUMAN SECRETORY PROTEIN-61
BACKGROUND OF THE INVENTION
Proliferation, maintenance, survival and
differentiation of cells of multicellular organisms are
controlled by hormones and polypeptide growth factors.
These diffusable molecules allow cells to communicate with
each other and act in concert to form cells and organs, and
to repair and regenerate damaged tissue. Examples of
hormones and growth factors include the steroid hormones
(e. g. estrogen, testosterone), parathyroid hormone,
follicle stimulating hormone, the interleukins, platelet
derived growth factor (PDGF), epidermal growth factor
(EGF), granulocyte-macrophage colony stimulating factor
(GM-CSF), erythropoietin (EPO) and calcitonin.
Hormones and growth factors influence cellular
metabolism by binding to proteins. Proteins may be
integral membrane proteins that are linked to signaling
pathways within the cell, such as second messenger systems.
Other classes of proteins are soluble molecules, such as
the transcription factors.
Of particular interest are cytokines, molecules
that promote the proliferation, maintenance, survival or
differentiation of cells. Examples of cytokines include
erythropoietin (EPO), which stimulates the development of
red blood cells; thrombopoietin (TPO), which stimulates
development of cells of the megakaryocyte lineage; and
granulocyte-colony stimulating factor (G-CSF), which
stimulates development of neutrophils. These cytokines are
useful in restoring normal blood cell levels in patients
suffering from anemia or receiving chemotherapy for cancer.
The demonstrated in vivo activities of these cytokines
CA 02350621 2001-05-11
WO 00/28030 PCT/US99126585.
2
illustrates the enormous clinical potential of, and need
for, other cytokines, cytokine agonists, and cytokine
antagonists.
DESCRIPTION OF THE INVENTION
The present invention addresses this need by
providing novel polypeptides and related compositions and
methods. Within one aspect, the present invention provides
an isolated polynucleotide encoding a mammalian secretory
protein termed mammalian secretory protein-61(hereinafter
referred to as Zsig61). The human Zsig61 polypeptide with
signal sequence is comprised of a sequence of amino acids
81 amino acids long with the initial Met as shown in SEQ ID
NO:1 and SEQ ID N0:2. The signal sequence is comprised of
amino acid residues 1-19, the mature sequence being
comprised of amino acid residue 20, a valine through and
including amino acid residue 81, a valine of SEQ ID N0:2.
The mature sequence is further defined by SEQ ID N0:4. In
an alternative signal peptidase cleavage site, the signal
sequences extends from amino acid residue 1-24, the mature
sequence then being comprised of amino acid residue 25, a
glycine, through and including amino acid residue 81, a
valine, of SEQ ID N0:2. This mature sequence is further
defined by SEQ ID NO: 5. In an alternative embodiment of
the present invention, a mature sequence is defined by
amino acid residue 48, a cysteine to and including amino
acid residue 78, a cysteine, of SEQ ID NO: 2, also defined
by SEQ ID N0:6.
Within an additional embodiment, the polypeptide
further comprises an affinity tag. Within a further
embodiment, the polynucleotide is DNA.
Within a second aspect of the invention there is
provided an expression vector comprising (a) a
transcription promoter; (b) a DNA segment encoding Zsig61
CA 02350621 2001-05-11
wo oonso3o Prrnrsg9n6sss
3
polypeptide, and (c) a transcription terminator, wherein
the promoter, DNA segment, and terminator are operably
linked.
Within a third aspect of the invention there is
provided a cultured eukaryotic cell into which has been
introduced an expression vector as disclosed above, wherein
said cell expresses a protein polypeptide encoded by the
DNA segment.
Within a further aspect of the invention there is
provided a chimeric polypeptide consisting essentially of a
first portion and a second portion joined by a peptide
bond. The first portion of the chimeric polypeptide
consists essentially of (a) a Zsig61 polypeptide as shown
in SEQ ID NOs: 2,4,5 and 6 (b) allelic variants of SEQ ID
NOs:2,4,5 and 6; and (c) protein polypeptides that are at
least 90% identical to (a) or (b). The second portion of
the chimeric polypeptide consists essentially of another
polypeptide such as an affinity tag. Within one embodiment
the affinity tag is an immunoglobulin Fc polypeptide. The
invention also provides expression vectors encoding the
chimeric polypeptides and host cells transfected to produce
the chimeric polypeptides.
Within an additional aspect of the invention
there is provided an antibody that specifically binds to a
Zsig61 polypeptide as disclosed above, and also an anti-
idiotypic antibody which neutralizes the antibody to a
Zsig61 polypeptide.
An additional embodiment of the present invention
relates to a peptide or polypeptide which has the amino
acid sequence of an epitope-bearing portion of a Zsig61
polypeptide having an amino acid sequence described above.
Peptides or polypeptides having the amino acid sequence of
an epitope-bearing portion of a Zsig61 polypeptide of the
CA 02350621 2001-05-11
WO 00128030 PC'f/US99/26585
4
present invention include portions of such polypeptides
with at least nine, preferably at least I5 and more
preferably at least 30 to 50 amino acids, although epitope-
bearing polypeptides of any length up to and including the
entire amino acid sequence of a polypeptide of the present
invention described above are also included in the present
invention. Examples of such polypeptides includes the
polypeptide extending from amino acid residue 25, a
glycine, to and including amino acid residue 62 an arginine
of SEQ ID N0:2, also defined by SEQ ID N0:8; the
polypeptide extending from amino acid residue 51, a
glutamine, to and including amino acid residue 75 a serine
of SEQ ID N0:2, also defined by SEQ ID N0:9; and the
polypeptide extending from amino acid residue 25, a
glycine, to and including amino acid residue 75 a serine of
SEQ ID N0:2, also defined by SEQ ID NO:10. Also claimed
are any of these polypeptides that are fused to another
polypeptide or carrier molecule.
Definitions
The term "affinity tag" is used herein to denote
a polypeptide segment that can be attached to a second
polypeptide to provide for purification or detection of the
second polypeptide or provide sites for attachment of the
second polypeptide to a substrate. In principal, any
peptide or protein for which an antibody or other specific
binding agent is available can be used as an affinity tag.
Affinity tags include a poly-histidine tract, protein A,
Nilsson et al., EMHO J. 4:1075 (1985); Nilsson et al.,
Methods Enzymol. 198:3 (1991), glutathione S transferase,
Smith and Johnson, Gene 67:31 (1988), Glu-Glu affinity tag,
Grussenmeyer et al., Proc. Natl. Acad. Sci. USA 82:7952-4
(1985), substance P, FlagTM peptide, Hopp et al.,
Biotechnology 6:1204-1210 (1988), streptavidin binding
peptide, or other antigenic epitope or binding domain.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
See, in general, Ford et al., Protein Expression and
Purification 2: 95-107 (1991). DNAs encoding affinity tags
are available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
5
The term "allelic variant" is used herein to
denote any of two or more alternative forms of a gene
occupying the same chromosomal locus. Allelic variation
arises naturally through mutation, and may result in
phenotypic polymorphism within populations. Gene mutations
can be silent (no change in the encoded polypeptide) or may
encode polypeptides having altered amino acid sequence.
The term allelic variant is also used herein to denote a
protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and~"carboxyl-
terminal" are used herein to denote positions within
polypeptides. where the context allows, these terms are
used with reference to a particular sequence or portion of
a polypeptide to denote proximity or relative position.
For example, a certain sequence positioned carboxyl-
terminal to a reference sequence within a polypeptide is
located proximal to the carboxyl terminus of the reference
sequence, but is not necessarily at the carboxyl terminus
of the complete polypeptide.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently
associated, stable pair under appropriate conditions. For
instance, biotin and avidin (or streptavidin) are
prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
CA 02350621 2001-05-11
wo oonao3o Pc~r~s99n6sss
6
complement/anti-complement pair preferably has a binding
affinity of <109 M-1.
The term "complements of a polynucleotide
molecule" is a polynucleotide molecule having a
complementary base sequence and reverse orientation as
compared to a reference sequence. For example, the
sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'
The term "contig" denotes a polynucleotide that
has a contiguous stretch of identical or complementary
sequence to another polynucleotide. Contiguous sequences
are said to "overlap" a given stretch of polynucleotide
sequence either in their entirety or along a partial
stretch of the polynucleotide. For example, representative
contigs to the polynucleotide sequence 5'-ATGGCTTAGCTT-3'
are 5'-TAGCTTgagtct-3' and 3'-gtcgacTACCGA-5'.
The term "degenerate nucleotide sequence" denotes
a sequence of nucleotides that includes one or more
degenerate codons (as compared to a reference
polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of
nucleotides, but encode the same amino acid residue (i.e.,
GAU and GAC triplets each encode Asp).
The term "expression vector" is used to denote a
DNA molecule, linear or circular, that comprises a segment
encoding a polypeptide of interest operably linked to
additional segments that provide for its transcription.
Such additional segments include promoter and terminator
sequences, and may also include one or more origins of
replication, one or more selectable markers, an enhancer, a
polyadenylation signal, etc. Expression vectors are
generally derived from plasmid or viral DNA, or may contain
elements of both.
CA 02350621 2001-05-11
WO 0OIZ8030 PCT/US99/26585
7
The term "isolated", when applied to a
polynucleotide, denotes that the polynucleotide has been
removed from its natural genetic milieu and is thus free of
other extraneous or unwanted coding sequences, and is in a
form suitable for use within genetically engineered protein
production systems. Such isolated molecules are those that
are separated from their natural environment and include
cDNA and genomic clones. Isolated DNA molecules of the
present invention are free of other genes with which they
are ordinarily associated, but may include naturally
occurring 5' and 3' untranslated regions such as promoters
and terminators. The identification of associated regions
will be evident to one of ordinary skill in the art (see
for example, Dynan and Tijan, Nature 316:774-78 (1985).
An "isolated" polypeptide or protein is a
polypeptide or protein that is found in a condition other
than its native environment, such as apart from blood and
animal tissue. In a preferred form, the isolated
polypeptide is substantially free of other polypeptides,
particularly other polypeptides of animal origin. It is
preferred to provide the polypeptides in a highly purified
form, i.e. greater than 95% pure, more preferably greater
than 99% pure. When used in this context, the term
"isolated" does not exclude the presence of the same
palypeptide in alternative physical forms, such as dimers
or alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA
segments, indicates that the segments are arranged so that
they function in concert for their intended purposes, e.g.,
transcription initiates in the promoter and proceeds
through the coding segment to the terminator.
CA 02350621 2001-05-11
WD 00/28030 PCT/US99/26585
8
The term "ortholog" denotes a polypeptide or
protein obtained from one species that is the functional
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
'~Paralogs'~ are distinct but structurally related
proteins made by an organism. Paralogs are believed to
arise through gene duplication. For example, a-globin, b-
globin, and myoglobin are paralogs of each other.
A "polynucleotide~' is a single- or double-
stranded polymer of deoxyribonucleotide or ribonucleotide
bases read from the 5' to the 3' end. Polynucleotides
include RNA and DNA, and may be isolated from natural
sources, synthesized in vitro, or prepared from a
combination of natural and synthetic molecules. Sizes of
polynucleotides are expressed as base pairs (abbreviated
"bp"), nucleotides ("nt"), or kilobases ("kb"?. Where the
context allows, the latter two terms may describe
polynucleotides that are single-stranded or double-
stranded. When the term is applied to double-stranded
molecules it is used to denote overall length and will be
understood to be equivalent to the term "base pairs". It
will be recognized by those skilled in the art that the two
strands of a double-stranded polynucleotide may differ
slightly in length and that the ends thereof may be
staggered as a result of enzymatic cleavage; thus all
nucleotides within a double-stranded polynucleotide
molecule may not be paired. Such unpaired ends will in
general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
naturally or synthetically. Polypeptides of less than
about 10 amino acid residues are commonly referred to as
"peptides".
CA 02350621 2001-05-11
WO OOI28030 PCT/US99/26585
9
The term "promoter" is used herein for its art-
recognized meaning to denote a portion of a gene containing
DNA sequences that provide for the binding of RNA
polymerase and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
A "protein" is a macromolecule comprising one or
more polypeptide chains. A protein may also comprise non-
peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be
added to a protein by the cell in which the protein is
produced, and will vary with the type of cell. Proteins
are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are
generally not specified, but may be present nonetheless.
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule (i.e., a ligand)
and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-
domain structure comprising an extracellular ligand-binding
domain and an intracellular effector domain that is
typically involved in signal transduction. Binding of
ligand to receptor results in a conformational change in
the receptor that causes an interaction between the
effector domain and other molecules) in the cell. This
interaction in turn leads to an alteration in the
3d metabolism of the cell. Metabolic events that are linked
to receptor-ligand interactions include gene transcription,
phosphorylation, dephosphorylation, increases in cyclic AMP
production, mobilization of cellular calcium, mobilization
of membrane lipids, cell adhesion, hydrolysis of inositol
lipids and hydrolysis of phospholipids. In general,
receptors can be membrane bound, cytosolic or nuclear;
monomeric (e. g., thyroid stimulating hormone receptor,
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
to
beta-adrenergic receptor) or multimeric (e. g., PDGF
receptor, growth hormone receptor, IL-3 receptor, GM-CSF
receptor, G-CSF receptor, erythropoietin receptor and IL-6
receptor).
The term "secretory signal sequence" denotes a
DNA sequence that encodes a polypeptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger
polypeptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a protein
encoded by a splice variant of an mRNA transcribed from a
gene.
Molecular weights and lengths of polymers
determined by imprecise analytical methods (e.g., gel
electrophoresis) will be understood to be approximate
values. when such a value is expressed as "about" X or
"approximately" X, the stated value of X will be understood
to be accurate to ~10%.
POLYNUCLEOTIDES:
The present invention also provides
polynucleotide molecules, including DNA and RNA molecules,
that encode the Zsig61 polypeptides disclosed herein.
CA 02350621 2001-05-11
WO 00128030 PCT/US99126585
11
Those skilled in the art will readily recognize that, in
view of the degeneracy of the genetic code, considerable
sequence variation is possible among these polynucleotide
molecules.
Polynucleotides, generally a cDNA sequence, of
the present invention encode the described polypeptides
herein. A cDNA sequence which encodes a polypeptide of the
present invention is comprised of a series of codons, each
amino acid residue of the polypeptide being encoded by a
codon and each codon being comprised of three nucleotides.
The amino acid residues are encoded by their respective
codons as follows.
Alanine (Ala) is encoded by GCA, GCC, GCG or GCT;
Cysteine (Cys) is encoded by TGC or TGT;
Aspartic acid (Asp) is encoded by GAC or GAT;
Glutamic acid (Glu) is encoded by GAA or GAG;
Phenylalanine (Phe) is encoded by TTC or TTT;
Glycine (Gly) is encoded by GGA, GGC, GGG or GGT;
Histidine (His) is encoded by CAC or CAT;
Isoleucine (Ile) is encoded by ATA, ATC or ATT;
Lysine (Lys) is encoded by AAA, or AAG;
Leucine (Leu) is encoded by TTA, TTG, CTA, CTC,
CTG or CTT;
Methionine (Met) is encoded by ATG;
Asparagine (Asn) is encoded by AAC or AAT;
Proline (Pro) is encoded by CCA, CCC, CCG or CCT;
Glutamine (Gln) is encoded by CAA or CAG;
Arginine (Arg) is encoded by AGA, AGG, CGA, CGC,
CGG or CGT;
Serine (Ser) is encoded by AGC, AGT, TCA, TCC,
TCG or TCT;
Threonine (Thr) is encoded by ACA, ACC, ACG or
ACT;
Valine (Val) is encoded by GTA, GTC, GTG or GTT;
Tryptophan (Trp) is encoded by TGG; and
CA 02350621 2001-05-11
WO OOI28030 PCT/US99/26585.
12
Tyrosine (Tyr) is encoded by TAC or TAT.
It is to be recognized that according to the
present invention, when a polynucleotide is claimed as
described herein, it is understood that what is claimed are
both the sense strand, the anti-sense strand, and the DNA
as double-stranded having both the sense and anti-sense
strand annealed together by their respective hydrogen
bonds. Also claimed is the messenger RNA (mRNA) which
encodes the polypeptides of the president invention, and
which mRNA is encoded by the cDNA described herein.
Messenger RNA (mRNA) will encode a polypeptide using the
same codons as those defined herein, with the exception
that each thymine nucleotide (T) is replaced by a uracil
nucleotide (U).
One of ordinary skill in the art will also
appreciate that different species can exhibit "preferential
codon usage." In general, see, Grantham, et al., Nuc.
Acids Res. 8:1893-1912 (1980); Haas, et a1. Curr. Biol.
6:315-324 (1996); Wain-Hobson, et al., Gene 13:355-364
(1981); Grosjean and Fiers, Gene 18:199-209 (1982); Holm,
Nuc. Acids Res. 14:3075-3087 (1986): Ikemura, J. Mol. Biol.
158:573-597 (1982). As used herein, the term "preferential
codon usage" or "preferential codons" is a term of art
referring to protein translation codons that are most
frequently used in cells of a certain species, thus
favoring one or a few representatives of the possible
codons encoding each amino acid. For example, the amino
acid Threonine (Thr) may be encoded by ACA, ACC, ACG, or
ACT, but in mammalian cells ACC is the most commonly used
codon; in other species, for example, insect cells, yeast,
viruses or bacteria, different Thr codons may be
preferential. Preferential codons for a particular species
can be introduced into the polynucleotides of the present
invention by a variety of methods known in the art.
CA 02350621 2001-05-11
WO 00128030 PCT/US99/26585
13
Introduction of preferential codon sequences into
recombinant DNA can, for example, enhance production of the
protein by making protein translation more efficient within
a particular cell type or species. Sequences containing
preferential codons can be tested and optimized for
expression in various species, and tested for functionality
as disclosed herein.
Within preferred embodiments of the invention the
isolated polynucleotides will hybridize to similar sized
regions of SEQ ID NO:1, or a sequence complementary
thereto, under stringent conditions. In general, stringent
conditions are selected to be about 5°C lower than the
thermal melting point (Tm) for the specific sequence at a
defined ionic strength and pH. The Tm is the temperature
(under defined ionic strength and pH) at.which 50% of the
target sequence hybridizes to a perfectly matched probe.
Typical stringent conditions are those in which the salt
concentration is up to about 0.03 M at pH 7 and the
temperature is at least about 60°C.
As previously noted, the isolated polynucleotides
of the present invention include DNA and RNA. Methods for
preparing DNA and RNA are well known in the art. In
general, RNA is isolated from a tissue or cell that
produces large amounts of Zsig61 RNA. Such tissues and
cells are identified by Northern blotting, Thomas, Proc.
Natl. Acad. Sci. USA 77:5201 (1980}, and include pancreas,
liver and kidney. Total RNA can be prepared using guanidine
HC1 extraction followed by isolation by centrifugation in a
CsCl gradient, Chirgwin et al., Biochemistry 18:52-94
(1979). Poly (A)+ RNA is prepared from total RNA using the
method of Aviv and Leder, Proc. Natl. Acad. Sci. USA
69:1408-1412 (1972). Complementary DNA (cDNA} is prepared
from poly(A1+ RNA using known methods. In the alternative,
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
14
genomic DNA can be isolated. Polynucleotides encoding
Zsig61 polypeptides are then identified and isolated by,
for example, hybridization or PCR.
A full-length clone encoding Zsig61 can be
obtained by conventional cloning procedures. Complementary
DNA (cDNA) clones are preferred, although for some
applications (e.g., expression in transgenic animals) it
may be preferable to use a genomic clone, or to modify a
cDNA clone to include at least one genomic intron. Methods
for preparing cDNA and genomic clones are well known and
within the level of ordinary skill in the art, and include
the use of the sequence disclosed herein, or parts thereof,
for probing or priming a library. Expression libraries can
be probed with antibodies to Zsig6l, receptor fragments, or
other specific binding partners.
The polynucleotides of the present invention can
also be synthesized using DNA synthesizers. Currently the
method of choice is the phosphoramidite method. If
chemically synthesized double stranded DNA is required for
an application such as the synthesis of a gene or a gene
fragment, then each complementary strand is made
separately. The production of short genes (60 to 80 bp) is
technically straightforward and can be accomplished by
synthesizing the complementary strands and then annealing
them. For the production of longer genes (>300 bp),
however, special strategies must be invoked, because the
coupling efficiency of each cycle during chemical DNA
synthesis is seldom 100%. To overcome this problem,
synthetic genes (double-stranded) are assembled in modular
form from single-stranded fragments that are from 20 to 100
nucleotides in length. See Glick and Pasternak, Molecular
Biotechnology, Principles & Applications of Recombinant
DNA, (ASM Press, Washington, D.C. 1994); Itakura et al.,
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
Annu. Rev. Biochem. 53: 323-356 (1984) and Climie et al.,
Proc. Natl. Acad. Sci. USA 87:633-637 (1990).
The present invention further provides
5 counterpart polypeptides and polynucleotides from other
species (orthologs). These species include, but are not
limited to mammalian, avian, amphibian, reptile, fish,
insect and other vertebrate and invertebrate species. Of
particular interest are Zsig61 polypeptides from other
10 mammalian species, including murine, porcine, ovine,
bovine, canine, feline, equine, and other primate
polypeptides. Orthologs of human Zsig61 can be cloned
using information and compositions provided by the present
invention in combination with conventional cloning
15 techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that. expresses Zsig61
as disclosed herein. Suitable sources of mRNA can be
identified by probing Northern blots with probes designed
from the sequences disclosed herein. A library is then
prepared from mRNA of a positive tissue or cell line. A
Zsig61-encoding cDNA can then be isolated by a variety of
methods, such as by probing with a complete or partial
human cDNA or with one or more sets of degenerate probes
based on the disclosed sequences. A cDNA can also be
cloned using the polymerase chain reaction, or PCR (Mullis,
U.S. Patent No. 4,683,202), using primers designed from the
representative human Zsig61 sequence disclosed herein.
Within an additional method, the cDNA library can be used
to transform or transfect host cells, and expression of the
cDNA of interest can be detected with an antibody to Zsig61
polypeptide. Similar techniques can also be applied to the
isolation of genomic clones.
Those skilled in the art will recognize that the
sequence disclosed in SEQ ID N0:1 represents a single
allele of human Zsig61 and that allelic variation and
alternative splicing are expected to occur. Allelic
CA 02350621 2001-05-11
WO 00128030 PCT/US99I26585
16
variants of this sequence can be cloned by probing cDNA or
genomic libraries from different individuals according to
standard procedures. Allelic variants of the DNA sequence
shown in SEQ ID NO:1, including those containing silent
mutations and those in which mutations result in amino acid
sequence changes, are within the scope of the present
invention, as are proteins which are allelic variants of
SEQ ID N0:2. cDNAs generated from alternatively spliced
mRNAs, which retain the properties of the Zsig61
polypeptide are included within the scope of the present
invention, as are polypeptides encoded by such cDNAs and
mRNAs. Allelic variants and splice variants of these
sequences can be cloned by probing cDNA or genomic
libraries from different individuals or tissues according
to standard procedures known in the art.
The present invention also provides isolated
Zsig61 polypeptides that are substantially homologous to
the polypeptides of SEQ ID N0:2 and their orthologs. The
term "substantially homologous" is used herein to denote
polypeptides having 50%, preferably 60%, more preferably at
least 80%, sequence identity to the sequences shown in SEQ
ID N0:2 or their orthologs. Such polypeptides will more
preferably be at least 90% identical, and most preferably
95% or more identical to SEQ ID NOs:2, 3,4 or 5 or their
orthologs.) Percent sequence identity is determined by
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48: 603-616 (1986) and Henikoff and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919 (1992).
Briefly, two amino acid sequences are aligned to optimize
the alignment scores using a gap opening penalty of 10, a
gap extension penalty of 1, and the "blosum 62" scoring
matrix of Henikoff and Henikoff (ibid.) as shown in Table 1
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
17
(amino acids are indicated by the standard one-letter
codes). The percent identity is then calculated as:
Total number of identical matches
x 100
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences)
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
18
ch
'-1 N M
r-I I
H ell N N O
I
Wit' ri M N N
I I I
LW~I r-i cr M N
I I I ~
W ~ V' N N rl M r-i
I I I I
lfl O N v-i rl v-i rl I-i
I I I ~ I
lJ1 rl M r~ O I-i M N N
I I I I I I I
dl N N O M N rl N ri rl
I ~ I I I I I
I" I dl N M rl O M N ri M ~-1 M
I I I I I I
n'Ii OD M M ~ N ri N '-1 N N N M
I I I I I I I I I I
U ' 10 N ~ dl N M M N O N N M M
I I I I I I I I I I I
W 111 N O M M rl N M ri O rl M N N
1 I I I I I I I I I
111 N N O M N .-~ O M r-i O r1 N c-1 N
I I I I I I I I I
U ~ O1 M V' M M rl r-I M r~ N M ri '-1 N N ri
I I I I I I I I I I I I I I I
A lD M O N r1 rl M dl ri M M r1 O ri ~ M M
I I I I 1 I I I I I I I I
10 ri M O O O rl M M O N M N e-I O ~ N M
I I I t I I I I I
(Y., IJ1 O N M rl O N O M N N rl M N r'-1 ri M N M
I I I I I I I I I I I ~ I
I4,' dl r~ N N O ~ ,-I O N rl '-I ri ,-I N ,-t r-1 O M N O
I I I I I I I I I I I I I I
x z A U a w ~ x H a x ~ r~, w r~ H 3 ~I
v
s~
N
m o ~ o
ri N
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
19
Sequence identity of polynucleotide molecules is
determined by similar methods using a ratio as disclosed
above.
Variant Zsig61 polypeptides or substantially
homologous Zsig61 polypeptides are characterized as having one
or more amino acid substitutions, deletions or additions.
These changes are preferably of a minor nature, that is
conservative amino acid substitutions (see Table 2) and other
substitutions that do not significantly affect the folding or
activity of the polypeptide; small deletions, typically of one
to about 30 amino acids; and small amino- or carboxyl-terminal
extensions, such as an amino-terminal methionine residue, a
small linker peptide of up to about 20-25 residues, or an
affinity tag. The present invention thus includes
polypeptides of from 20 to 30 amino acid residues that
comprise a sequence that is at least 90%, preferably at least
95%, and more preferably 99% or more identical to the
corresponding region of SEQ ID N0:4. Polypeptides comprising
affinity tags can further comprise a proteolytic cleavage site
between the Zsig51 polypeptide and the affinity tag.
Preferred such sites include thrombin cleavage sites and
factor Xa cleavage sites.
Table 2
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
Polar: glutamine
asparagine
CA 02350621 2001-05-11
WO 00/28030 PCT/US99I26585
Table 2 cont.
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
The present invention further provides a variety of
other polypeptide fusions [and related multimeric proteins
comprising one or more polypeptide fusions]. For example, a
Zsig61 polypeptide can be prepared as a fusion to a dimerizing
protein as disclosed in U.S. Patents Nos. 5,155,027 and
5,567,584. Preferred dimerizing proteins in this regard
include immunoglobulin constant region domains.
Immunoglobulin-Zsig61 polypeptide fusions can be expressed in
genetically engineered cells [to produce a variety of
multimeric Zsig61 analogs]. Auxiliary domains can be fused to
Zsig61 polypeptides to target them to specific cells, tissues,
or macromolecules (e. g., collagen). For example, a Zsig61
polypeptide or protein could be targeted to a predetermined
cell type by fusing a Zsig61 polypeptide to a ligand that
specifically binds to a receptor on the surface of the target
cell. In this way, polypeptides and proteins can be targeted
for therapeutic or diagnostic purposes. A Zsig61 polypeptide
can be fused to two or more moieties, such as an affinity tag
for purification and a targeting domain. Polypeptide fusions
can also comprise one or more cleavage sites, particularly
between domains. See, Tuan et al., Connective Tissue Research
34:1-9 (1996).
CA 02350621 2001-05-11
WO OOI28030 PCT/US99/26585
21
The proteins of the present invention can also
comprise non-naturally occurring amino acid residues. Non-
naturally occurring amino acids include, without limitation,
traps-3-methylproline, 2,4-methanoproline, cis-4-
hydroxyproline, traps-4-hydroxyproline, N-methylglycine, allo-
threonine, methylthreonine, hydroxyethylcysteine,
hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, thiazolidine carboxylic acid, dehydroproline,
3- and 4-methylproline, 3,3-dimethylproline, tert-leucine,
norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenylalanine. Several methods
are known in the art for incorporating non-naturally occurring
amino acid residues into proteins. For example, an in vitro
system can be employed wherein nonsense mutations are
suppressed using chemically aminoacylated suppressor tRNAs.
Methods for synthesizing amino acids and
aminoacylating tRNA are known in the art. Transcription and
translation of plasmids containing nonsense mutations is
carried out in a cell-free system comprising an E. coli S30
extract and commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for example,
Robertson et al., J. Am. Chem. Soc. 113:2722 (1991); Ellman et
al., Methods Enzymol. 202:301 (1991; Chung et al., Science
259:806-809 (1993); and Chung et al., Proc. Natl. Acad. Sci.
USA 90:10145-1019 (1993). In a second method, translation is
carried out in Xenopus oocytes by microinjection of mutated
mRNA and chemically aminoacylated suppressor tRNAs, Turcatti
et al., J. 8iol. Chem. 271:19991-19998 (1996). Within a third
method, E. coli cells are cultured in the absence of a natural
amino acid that is to be replaced (e.g., phenylalanine) and in
the presence of the desired non-naturally occurring amino
acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/Z6585
22
azaphenylalanine, or 4-fluorophenylalanine). The non-
naturally occurring amino acid is incorporated into the
protein in place of its natural counterpart. See, Koide et
al., Biochem. 33:7470-7476 (1994). Naturally occurring amino
acid residues can be converted to non-naturally occurring
species by in vitro chemical modification. Chemical
modification can be combined with site-directed mutagenesis to
further expand the range of substitutions, Wynn and Richards,
Protein Sci. 2:395-403 (1993).
A limited number of non-conservative amino acids,
amino acids that are not encoded by the genetic code, non-
naturally occurring amino acids, and unnatural amino acids may
be substituted for Zsig61 amino acid residues.
Essential amino acids in the polypeptides of the
present invention can be identified according to procedures
known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis, Cunningham and Wells, Science
244: 1081-1085 (1989); Bass et al., Proc. Natl. Acad. Sci. USA
88:4498-502 (1991). In the latter technigue, single alanine
mutations are introduced at every residue in the molecule, and
the resultant mutant molecules are tested for biological
activity as disclosed below to identify amino acid residues
that are critical to the activity of the molecule. See also,
Hilton et al., J. Biol. Chem. 271:4699-708, 1996. Sites of
ligand-receptor interaction can also be determined by physical
analysis of structure, as determined by such techniques as
nuclear magnetic resonance, crystallography, electron
diffraction or photoaffinity labeling, in conjunction with
mutation of putative contact site amino acids. See, for
example, de Vos et al., Science 255:306-312 (1992); Smith et
al., J. Mol. Biol. 224:899-904 (1992); Wlodaver et al., FEES
Lett. 309:59-64 (1992).
CA 02350621 2001-05-11
WO 00128030 PCTIUS99/26585
23
Multiple amino acid substitutions can be made and
tested using known methods of mutagenesis and screening, such
as those disclosed by Reidhaar-Olson and Sauer, Science
241:53-57 (1988) or Bowie and Sauer, Proc. Natl. Acad. Sci.
USA 86:2152-2156 (1989). Briefly, these authors disclose
methods for simultaneously randomizing two or more positions
in a polypeptide, selecting for functional polypeptide, and
then sequencing the mutagenized polypeptides to determine the
spectrum of allowable substitutions at each position. Other
methods that can be used include phage display, e.g., Lowman
et al., Biochem. 30:10832-10837 (1991); Ladner et al., U.S.
Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and
region-directed mutagenesis, Derbyshire et al., Gene 46:145
(1986); Ner et al., DNA 7:127 (1988).
Variants of the disclosed Zsig61 DNA and polypeptide
sequences can be.generated through DNA shuffling as disclosed
by Stemmer, Nature 370:389-391, (1994), Stemmer, Proc. Natl.
Acad. Sci. USA 91:10747-10751 (1994) and WIPO Publication WO
97/20078. Briefly, variant DNAs are generated by in vitro
homologous recombination by random fragmentation of a parent
DNA followed by reassembly using PCR, resulting in randomly
introduced point mutations. This technique can be modified by
using a family of parent DNAs, such as allelic variants or
DNAs from different species, to introduce additional
variability into the process. Selection or screening for the
desired activity, followed by additional iterations of
mutagenesis and assay provides for rapid "evolution" of
sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be
combined with high-throughput, automated screening methods to
detect activity of cloned, mutagenized polypeptides in host
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
24
cells. Mutagenized DNA molecules that encode active
polypeptides can be recovered from the host cells and rapidly
sequenced using modern equipment. These methods allow the
rapid determination of the importance of individual amino acid
residues in a polypeptide of interest, and can.be applied to
polypeptides of unknown structure.
Using the methods discussed herein, one of ordinary
skill in the art can identify and/or prepare a variety of
polypeptide fragments or variants of SEQ ID NOs:2,4,5 or 6 or
that retain the properties of the wild-type Zsig61 protein.
For any Zsig61 polypeptide, including variants and
fusion proteins, one of ordinary skill in the art can readily
generate a fully degenerate polynucleotide sequence encoding
that variant using the information set forth in Tables 1 and 2
above.
PROTEIN PRODUCTION
The Zsig61 polypeptides of the present invention,
including full-length polypeptides, biologically active
fragments, and fusion polypeptides, can be produced in
genetically engineered host cells according to conventional
techniques. Suitable host cells are those cell types that can
be transformed or transfected with exogenous DNA and grown in
culture, and include bacteria, fungal cells, and cultured
higher eukaryotic cells. Eukaryotic cells, particularly
cultured cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are
disclosed by Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, 1989), and Ausubel et al., eds., Current
Protocols in Molecular Biology (John Wiley and Sons, Inc., NY,
1987) .
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
In general, a DNA sequence encoding a Zsig61
polypeptide is operably linked to other genetic elements
required for its expression, generally including a
transcription promoter and terminator, within an expression
vector. The vector will also commonly contain one or more
selectable markers and one or more origins of replication,
although those skilled in the art will recognize that within
certain systems selectable markers may be provided on separate
vectors, and replication of the exogenous DNA may be provided
by integration into the host cell genome. Selection of
promoters, terminators, selectable markers, vectors and other
elements is a matter of routine design within the level of
ordinary skill in the art. Many such elements are described
in the literature and are available through commercial
suppliers.
To direct a Zsig61 polypeptide into the secretory
pathway of a host cell, a secretory signal sequence (also
known as a leader sequence, prepro sequence or pre sequence)
is provided in the expression vector. The secretory signal
sequence may be that of Zsig6l, or may be derived from another
secreted protein (e.g., t-PA) or synthesized de novo. The
secretory signal sequence is operably linked to the Zsig61 DNA
sequence, i.e., the two sequences are joined in the correct
reading frame and positioned to direct the newly synthesized
polypeptide into the secretory pathway of the host cell.
Secretory signal sequences are commonly positioned 5' to the
DNA sequence encoding the polypeptide of interest, although
certain secretory signal sequences may be positioned elsewhere
in the DNA sequence of interest (see, e.g., Welch et al., U.S.
Patent No. 5,037,743; Holland et al., U.S. Patent No.
5,143,830).
Alternatively, the secretory signal sequence
contained in the polypeptides of the present invention is used
CA 02350621 2001-05-11
WO 00128030 PCT/US99/26585
26
to direct other polypeptides into the secretory pathway. The
present invention provides for such fusion polypeptides. The
secretory signal sequence contained in the fusion polypeptides
of the present invention is preferably fused amino-terminally
to an additional peptide to direct the additional peptide into
the secretory pathway. Such constructs have numerous
applications known in the art. For example, these novel
secretory signal sequence fusion constructs can direct the
secretion of an active component of a normally non-secreted
protein, such as a receptor. Such fusions may be used in vivo
or in vitro to direct peptides through the secretory pathway.
Cultured mammalian cells are suitable hosts within
the present invention. Methods for introducing exogenous DNA
into mammalian host cells include calcium phosphate-mediated
transfection, Wigler et al., Cell 14:725 (1978); Corsaro and
Pearson, Somatic Cell Genetics 7:603 (1981); Graham and Van
der Eb, Virology 52:456 (1973), electroporation, Neumann et
al., EGO J. 1:841-845 (1982), DEAF-dextran mediated
transfection (Ausubel et al., ibid., and liposome-mediated
transfection, Hawley-Nelson et al., Focus 15:73 (1993);
Ciccarone et al., Focus 15:80 (1993), and viral vectors,
Miller and Rosman, BioTechniques 7:980(1989); Wang and Finer,
Nature Med. 2:714 (1996). The production of recombinant
polypeptides in cultured mammalian cells is disclosed, for
example, by Levinson et al., U.S. Patent No. 4,713,339; Hagen
et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC No.
CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No. CRL 1632),
BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL 1573; Graham
et al., J. Gen. Virol. 36:59 (1977) and Chinese hamster ovary
(e. g. CHO-K1; ATCC No. CCL 61) cell lines. Additional
suitable cell lines are known in the art and available from
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
27
public depositories such as the American Type Culture
Collection, Rockville, Maryland. In general, strong
transcription promoters are preferred, such as promoters from
SV-40 or cytomegalovirus. See, e.g., U.S. Patent No.
4,956,288. Other suitable promoters include those from
metallothionein genes (U.S. Patent Nos. 4,579,821 and
4,601,978) and the adenovirus major late promoter.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the gene
of interest to their progeny are referred to as "stable
transfectants." A preferred selectable marker is a gene
encoding resistance to the antibiotic neomycin. Selection is
carried out in the presence of a neomycin-type drug, such as
G-418 or the like. Selection systems can also be used to
increase the expression level of the gene of interest, a
process referred to as "amplification." Amplification is
carried out by culturing transfectants in the presence of a
low level of the selective agent and then increasing the
amount of selective agent to select for cells that produce
high levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate. Other
drug resistance genes (e. g. hygromycin resistance, multi-drug
resistance, puromycin acetyltransferase) can also be used.
Alternative markers that introduce an altered phenotype, such
as green fluorescent protein, or cell surface proteins such as
CD4, CD8, Class I MHC, placental alkaline phosphatase may be
used to sort transfected cells from untransfected cells by
such means as FACS sorting or magnetic bead separation
technology.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99r16585
28
Other higher eukaryotic cells can also be used as
hosts, including plant cells, insect cells and avian cells.
The use of Agrobacterium rhizogenes as a vector for expressing
genes in plant cells has been reviewed by Sinkar et al., J.
Biosci. (Bangalore) 11:47 (1987). Transformation of insect
cells and production of foreign polypeptides therein is
disclosed by Guarino et al., U.S. Patent No. 5,162,222 and
WIPO publication WO 94/06463. Insect cells can be infected
with recombinant baculovirus, commonly derived from Autographa
californica nuclear polyhedrosis virus (AcNPV). DNA encoding
the Zsig61 polypeptide is inserted into the baculoviral genome
in place of the AcNPV polyhedrin gene coding sequence by one
of two methods. The first is the traditional method of
homologous DNA recombination between wild-type AcNPV and a
transfer vector containing the Zsig61 flanked by AcNPV
sequences. Suitable insect cells, e.g. SF9 cells, are
infected with wild-type AcNPV and transfected with a transfer
vector comprising a Zsig61 polynucleotide operably linked to
an AcNPV polyhedrin gene promoter, terminator, and flanking
sequences. See, King, L.A, and Possee, R.D., The Baculovirus
Expression System: A Laboratory Guide, (Chapman & Hall,
London); 0'Reilly, D.R. et al., Baculovirus Expression
Vectors: A Laboratory Manual (Oxford University Press, New
York, New York, 1994); and, Richardson, C. D., Ed.,
Baculovirus Expression Protocols. Methods in Molecular
Biology, (Humana Press, Totowa, NJ 1995). Natural
recombination within an insect cell will result in a
recombinant baculovirus which contains Zsig61 driven by the
polyhedrin promoter. Recombinant viral stocks are made by
methods commonly used in the art.
The second method of making recombinant baculovirus
utilizes a transposon-based system described by Luckow, V.A,
et al., J Viro1 67:4566 (1993). This system is sold in the
CA 02350621 2001-05-11
WO 00/28030 PGT/US99/26585
29
Bac-to-Bac kit (Life Technologies, Rockville, MD). This
system utilizes a transfer vector, pFastBaclT"" (Life
Technologies) containing a Tn7 transposon to move the DNA
encoding the Zsig61 polypeptide into a baculovirus genome
maintained in E. coli as a large plasmid called a "bacmid."
The pFastBacl'"' transfer vector utilizes the AcNPV polyhedrin
promoter to drive the expression of the gene of interest, in
this case Zsig6l. However, pFastBaclT"" can be modified to a
considerable degree. The polyhedrin promoter can be removed
and substituted with the baculovirus basic protein promoter
(also known as Pcor, p6.9 or MP promoter) which is expressed
earlier in the baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins. See, Hill-
Perkins, M.S. and Possee, R.D., J Gen Viro1 71:971 (1990);
Bonning, B.C. et al., J Gen Viro1 75:1551 (1994); and,
Chazenbalk, G.D., and Rapoport, B., J Bio1 Chem 270:1543
(1995). In such transfer vector constructs, a short or long
version of the basic protein promoter can be used. Moreover,
transfer vectors can be constructed which replace the native
Zsig61 secretory signal sequences with secretory signal
sequences derived from insect proteins. For example, a
secretory signal sequence from Ecdysteroid Glucosyltransferase
(EGT), honey bee Melittin (Invitrogen, Car7.sbad, CA), or
baculovirus gp67 (PharMingen, San Diego, CA) can be used in
constructs to replace the native Zsig61 secretory signal
sequence. In addition, transfer vectors can include an in-
frame fusion with DNA encoding an epitope tag at the C- or N-
terminus of the expressed Zsig61 polypeptide, for example, a
Glu-Glu epitope tag, Grussenmeyer, T. et aZ., Proc Natl Acad
Sci. 82:7952 (1985). Using a technique known in the art, a
transfer vector containing Zsig61 is transformed into E. coli,
and screened for bacmids which contain an interrupted lacZ
gene indicative of recombinant baculovirus. The bacmid DNA
containing the recombinant baculovirus genome is isolated,
CA 02350621 2001-05-11
WO OO/Z8030 PCT/US99126585
using common techniques, and used to transfect Spodoptera
frugiperda cells, e.g. Sf9 cells. Recombinant virus that
expresses Zsig61 is subsequently produced. Recombinant viral
stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells,
typically a cell line derived from the fall army worm,
Spodoptera frugiperda. See, in general, Glick and Pasternak,
Molecular biotechnology: Principles and Applications of
Recombinant DNA (ASM Press, Washington, D.C., 1994). Another
suitable cell line is the High FiveOT'" cell line (Invitrogen)
derived from Trichoplusia ni (U. S. Patent #5,300,435).
Commercially available serum-free media are used to grow and
maintain the cells. Suitable media are Sf900 IIT"" (Life
Technologies) or ESF 921T"" (Expression Systems) for the Sf9
cells; and Ex-ce110405T'" (JRH Biosciences, Lenexa, KS) or
Express FiveOT'" (Life Technologies) for the T. ni cells. The
cells are grown up from an inoculation density of
approximately 2-5 x 105 cells to a density of 1-2 x 106 cells
at which time a recombinant viral stock is added at a
multiplicity of infection (MOI) of 0.1 to 10, more typically
near 3. The recombinant virus-infected cells typically
produce the recombinant Zsig61 polypeptide at 12-72 hours
post-infection and secrete it with varying efficiency into the
medium. The culture is usually harvested 48 hours post-
infection. Centrifugation is used to separate the cells from
the medium (supernatant). The supernatant containing the
Zsig61 polypeptide is filtered through micropore filters,
usually 0.45 ~.m pore size. Procedures used are generally
described in available laboratory manuals (King, L. A. and
Possee, R.D., ibid.; O~Reilly, D.R. et al., ibid.; Richardson,
C. D., ibid.). Subsequent purification of the Zsig61
polypeptide from the supernatant can be achieved using methods
described herein.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
31
Fungal cells, including yeast cells, can also be
used within the present invention. Yeast species of
particular interest in this regard include Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica. Methods
for transforming S. cerevisiae cells with exogenous DNA and
producing recombinant polypeptides therefrom are disclosed by,
for example, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et
al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No.
4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray
et al., U.S. Patent No. 4,845,075. Transformed cells are
selected by phenotype determined by the selectable marker,
commonly drug resistance or the ability to grow in the absence
of a particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POT1 vector
system disclosed by Kawasaki et al. (U.S. Patent No.
4,931,373), which allows transformed cells to be selected by
growth in glucose-containing media. Suitable promoters and
terminators for use in yeast include those from glycolytic
enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311;
Kingsman et al., U.S. Patent No. 4,615,974; and Bitter, U.S.
Patent No. 4,977,092) and alcohol dehydrogenase genes. See
also U.S. Patents Nos. 4,990,446; 5,063,154; 5,139,936 and
4,661,454. Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces
lactis, Kluyveromyces fragilis, Ustilago maydis, Pichia
pastoris, Pichia methanolica, Pichia guillermondii and Candida
maltosa are known in the art. See, for example, Gleeson et
al., J. Gen. Microbiol. 132:3459 (1986) and Cregg, U.S. Patent
No. 4,882,279. Aspergillus cells may be utilized according to
the methods of McKnight et al., U.S. Patent No. 4,935,349.
Methods for transforming Acremonium chrysogenum are disclosed
CA 02350621 2001-05-11
WO 00/28030 PCT/US99l26585.
32
by Sumino et al., U.S. Patent No. 5,162,228. Methods for
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
The use of Pichia methanolica as host for the
production of recombinant proteins is disclosed in WIPO
Publications WO 97/17450, WO 97/17451, WO 98/02536, and WO
98/02565. DNA molecules for use in transforming P.
methanolica will commonly be prepared as double-stranded,
circular plasmids, which are preferably linearized prior to
transformation. For polypeptide production in P. methanolica,
it is preferred that the promoter and terminator in the
plasmid be that of a P. methanolica gene, such as a P.
methanolica alcohol utilization gene (AUGI or AUG2). Other
useful promoters include those of the dihydroxyacetone
synthase (DHAS), formate dehydrogenase (FMD), and catalase
(CAT) genes. To facilitate integration of the DNA into the
host chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in Pichia
methanolica is a P. methanolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC
4.1.1.21), which allows ade2 host cells to grow in the absence
of adenine. For large-scale, industrial processes where it is
desirable to minimize the use of methanol, it is preferred to
use host cells in which both methanol utilization genes (AUG1
and AUG2) are deleted. For production of secreted proteins,
host cells deficient in vacuolar protease genes (PEP4 and
PR91) are preferred. Electroporation is used to facilitate
the introduction of a plasmid containing DNA encoding a
polypeptide of interest into P. methanolica cells. It is
preferred to transform P. methanolica cells by
electroporation using an exponentially decaying, pulsed
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
33
electric field having a field strength of from 2.5 to 4.5
kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of
from 1 to 40 milliseconds, most preferably about 20
milliseconds.
Prokaryotic host cells, including strains of the
bacteria Escherichia coli, Bacillus and other genera are also
useful host cells within the present invention. Techniques
for transforming these hosts and expressing foreign DNA
sequences cloned therein are well known in the art, see, e.g.,
Sambrook et al., ibid.). When expressing a Zsig61 polypeptide
in bacteria such as E. coli, the polypeptide may be retained
in the cytoplasm, typically as insoluble granules, or may be
directed to the periplasmic space by a bacterial secretion
sequence. In the former case, the cells are lysed, and the
granules are recovered and denatured using, for example,
guanidine isothiocyanate or urea. The denatured polypeptide
can then be refolded and dimerized by diluting the denaturant,
such as by dialysis against a solution of urea and a
combination of reduced and oxidized glutathione, followed by
dialysis against a buffered saline solution. In the latter
case, the polypeptide can be recovered from the periplasmic
space in a soluble and functional form by disrupting the cells
(by, for example, sonication or osmotic shock) to release the
contents of the periplasmic space and recovering the protein,
thereby obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured
according to conventional procedures in a culture medium
containing nutrients and other components required for the
growth of the chosen host cells. A variety of suitable media,
including defined media and complex media, are known in the
art and generally include a carbon source, a nitrogen source,
essential amino acids, vitamins and minerals. Media may also
contain such components as growth factors or serum, as
required. The growth medium will generally select for cells
CA 02350621 2001-05-11
WO 00/28030 PCTlUS99/26585
34
containing the exogenously added DNA by, for example, drug
selection or deficiency in an essential nutrient which is
complemented by the selectable marker carried on the
expression vector or co-transfected into the host cell. P.
methanolica cells are cultured in a medium comprising adequate
sources of carbon, nitrogen and trace nutrients at a
temperature~of about 25°C to 35°C. Liquid cultures are
provided with sufficient aeration by conventional means, such
as shaking of small flasks or sparging of fermentors. A
preferred culture medium for P. methanolica is YEPD (2°- D-
glucose, 2% BactoTM Peptone (Difco Laboratories, Detroit, MI),
1% BactoTM yeast extract (Difco Laboratories), 0.004% adenine
and 0.006% L-leucine).
Protein Isolation
It is preferred to purify the polypeptides of the
present invention to >_80% purity, more preferably to >_90%
purity, even more preferably >_95% purity, and particularly
preferred is a pharmaceutically pure state, that is greater
than 99.9% pure with respect to contaminating macromolecules,
particularly other proteins and nucleic acids, and free of
infectious and pyrogenic agents. Preferably, a purified
polypeptide is substantially free of other polypeptides,
particularly other polypeptides of animal origin.
Expressed recombinant Zsig61 polypeptides (or
chimeric Zsig61 polypeptides) can be purified using
fractionation and/or conventional purification methods and
media. Ammonium sulfate precipitation and acid or chaotrope
extraction may be used for fractionation of samples.
Exemplary purification steps may include hydroxyapatite, size
exclusion, FPLC and reverse-phase high performance liquid
chromatography. Suitable chromatographic media include
derivatized dextrans, agarose, cellulose, polyacrylamide,
CA 02350621 2001-05-11
WO 00128030 PCT/US99126585
specialty silicas, and the like. PEI, DEAF, QAE and Q
derivatives are preferred. Exemplary chromatographic media
include those media derivatized with phenyl, butyl, or octyl
groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl
butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose
(Pharmacia) and the like; or polyacrylic resins, such as
Amberchrom CG 71 (Toso Haas) and the like. Suitable solid
supports include glass beads, silica-based resins, cellulosic
resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross-linked polyacrylamide resins and the like that
are insoluble under the conditions in which they are to be
used. These supports may be modified with reactive groups
that allow attachment of proteins by amino groups, carboxyl
groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate
moieties. Examples of coupling chemistries include cyanogen
bromide activation, N-hydroxysuccinimide activation, epoxide
activation, sulfhydryl activation, hydrazide activation, and
carboxyl and amino derivatives for carbodiimide coupling
chemistries. These and other solid media are well known and
widely used in the art, and are available from commercial
suppliers. Methods for binding receptor polypeptides to
support media are well known in the art. Selection of a
particular method is a matter of routine design and is
determined in part by the properties of the chosen support.
See, for example, Affinity Chromatography: Principles &
Methods (Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988).
The polypeptides of the present invention can be
isolated by exploitation of their properties. For example,
immobilized metal ion adsorption (IMAC) chromatography can be
used to purify histidine-rich proteins, including those
comprising polyhistidine tags. Briefly, a gel is first
charged with divalent metal ions to form a chelate, Sulkowski,
Trends in Biochem. 3:1 (1985). Histidine-rich proteins will
be adsorbed to this matrix with differing affinities,
depending upon the metal ion used, and will be eluted by
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
36
competitive elution, lowering the pH, or use of strong
chelating agents. Other methods of purification include
purification of glycosylated proteins by lectin affinity
chromatography and ion exchange chromatography. Methods in
Enzymol., Vol. X82, "Guide to Protein Purification", M.
Deutscher, (ed.),page 529-539 (Acad. Press, San Diego, 1990).
Within additional embodiments of the invention, a fusion of
the polypeptide of interest and an affinity tag (e. g.,
maltose-binding protein, an immunoglobulin domain) may be
constructed to facilitate purification.
Moreover, using methods described in the art,
polypeptide fusions, or hybrid Zsig61 proteins, are
constructed using regions or domains of the inventive Zsig6l,
Sambrook et al., ibid., Altschul et al., ibid., Picard, Cur.
Opin. Biology, 5:511 (1994). These methods allow the
determination of the biological importance of larger domains
or regions in a polypeptide of interest. Such hybrids may
alter reaction kinetics, binding, constrict or expand the
substrate specificity, or alter tissue and cellular
localization of a polypeptide, and can be applied to
polypeptides of unknown structure.
Fusion proteins can be prepared by methods known to
those skilled in the art by preparing each component of the
fusion protein and chemically conjugating them.
Alternatively, a polynucleotide encoding both components of
the fusion protein in the proper reading frame can be
generated using known techniques and expressed by the methods
described herein. For example, part or all of a domains)
conferring a biological function may be swapped between Zsig61
of the present invention with the functionally equivalent
domains) from another family member. Such domains include,
but are not limited to, the secretory signal sequence,
conserved, and significant domains or regions in this family.
CA 02350621 2001-05-11
WO OOI28030 PCTNS99/26585
37
Such fusion proteins would be expected to have a biological
functional profile that is the same or similar to polypeptides
of the present invention or other known family proteins,
depending on the fusion constructed. Moreover, such fusion
proteins may exhibit other properties as disclosed herein.
Zsig61 polypeptides or fragments thereof may also be
prepared through chemical synthesis. Zsig61 polypeptides may
be monomers or multimers; glycosylated or non-glycosylated;
pegylated or non-pegylated; and may or may not include an
initial methionine amino acid residue.
Chemical Synthesis of Polypeptides
Polypeptides, especially polypeptides of the present
invention can also be synthesized by exclusive solid phase
synthesis, partial solid phase methods, fragment condensation
or classical solution synthesis. The polypeptides are
preferably prepared by solid phase peptide synthesis, for
example as described by Merrifield, J. Am. Chem. Soc. 85:2149
(1963) .
ASSAYS
The activity of molecules of the present invention
can be measured using a variety of assays.
Zsig61 can be measured in vitro using cultured cells
or in vivo by administering molecules of the claimed invention
to the appropriate animal model. For instance, Zsig61
transfected (or co-transfected) expression host cells may be
embedded in an alginate environment and injected (implanted)
into recipient animals. Alginate-poly-L-lysine
microencapsulation, permselective membrane encapsulation and
diffusion chambers have been described as a means to entrap
transfected mammalian cells or primary mammalian cells. These
types of non-immunogenic "encapsulations" or microenvironments
CA 02350621 2001-05-11
WO 00/28030 PCT/US99l26585
38
permit the transfer of nutrients into the microenvironment,
and also permit the diffusion of proteins and other
macromolecules secreted or released by the captured cells
across the environmental barrier to the recipient animal.
Most importantly, the capsules or microenvironments mask and
shield the foreign, embedded cells from the recipient animal s
immune response. Such microenvironments can extend the life
of the injected cells from a few hours or days (naked cells)
to several weeks (embedded cells).
An alternative in vivo approach for assaying
proteins of the present invention involves viral delivery
systems. Exemplary viruses for this purpose include
adenovirus, herpesvirus, vaccinia virus and adeno-associated
virus (AAV). Adenovirus, a double-stranded DNA virus, is
currently the best studied gene transfer vector for delivery
of heterologous nucleic acid (for a review, see T.C. Becker et
al., Meth. Cell Biol. 43:161 (1994); and J.T. Douglas and D.T.
Curiel, Science & Medicine 4:44 (1997). The adenovirus system
offers several advantages: adenovirus can (i) accommodate
relatively large DNA inserts; (ii) be grown to high-titer;
(iii) infect a broad range of mammalian cell types; and (iv)
be used with a large number of available vectors containing
different promoters. Also, because adenoviruses are stable in
the bloodstream, they can be administered by intravenous
injection.
By deleting portions of the adenovirus genome,
larger inserts (up to 7 kb) of heterologous DNA can be
accommodated. These inserts can be incorporated into the
viral DNA by direct ligation or by homologous recombination
with a co-transfected plasmid. In an exemplary system, the
essential E1 gene has been deleted from the viral vector, and
the virus will not replicate unless the E1 gene is provided by
the host cell (the human 293 cell line is exemplary). When
intravenously administered to intact animals, adenovirus
CA 02350621 2001-05-11
WO 00/28030 PCTNS99/26585
39
primarily targets the liver. If the adenoviral delivery
system has an E1 gene deletion, the virus cannot replicate in
the host cells. However, the host's tissue (e. g., liver) will
express and process (and, if a secretory signal sequence is
present, secrete) the heterologous protein. Secreted proteins
will enter the circulation in the highly vascularized liver,
and effects on the infected animal can be determined.
The adenovirus system can also be used for protein
production in vitro. By culturing adenovirus-infected non-293
cells under conditions where the cells are not rapidly
dividing, the cells can produce proteins for extended periods
of time. For instance, BHK cells are grown to confluence in
cell factories, then exposed to the adenoviral vector encoding
the secreted protein of interest. The cells are then grown
under serum-free conditions, which allows infected cells to
survive for several weeks without significant cell division.
Alternatively, adenovirus vector infected 2935 cells can be
grown in suspension culture at relatively high cell density to
produce significant amounts of protein (see Garnier et al.,
Cytotechnol. 15:145 (1994). With either nrotoco7. an
expressed, secreted heterologous protein can be repeatedly
isolated from the cell culture supernatant. Within the
infected 2935 cell production protocol, non-secreted proteins
may also be effectively obtained.
Agonists and Antagonists
In view of the tissue distribution observed for
Zsig6l, agonists (including the natural ligand/ substrate/
cofactor/ etc.) and antagonists have enormous potential in
both in vitro and in vivo applications. For example, Zsig61
and agonist compounds are useful as components of defined cell
culture media, and may be used alone or in combination with
other cytokines and hormones to replace serum that is commonly
used in cell culture.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
Antagonists
Antagonists are also useful as research reagents for
characterizing sites of ligand-receptor interaction. Also as a
treatment for prostate cancer. Inhibitors of Zsig61 activity
(Zsig61 antagonists) include anti-Zsig61 antibodies and
soluble Zsig61 receptors, as well as other peptidic and non-
peptidic agents (including ribozymes).
Zsig61 can also be used to identify inhibitors
(antagonists) of its activity. Test compounds are added to
the assays disclosed herein to identify compounds that inhibit
the activity of Zsig6l. In addition to those assays disclosed
herein, samples can be tested for inhibition of Zsig61
activity within a variety of assays designed to measure
receptor binding or the stimulation/inhibition of Zsig61-
dependent cellular responses. For example, Zsig61-responsive
cell lines can be transfected with a reporter gene construct
that is responsive to a Zsig61-stimulated cellular pathway.
Reporter gene constructs of this type are known in the art,
and will generally comprise a Zsig61-DNA response element
operably linked to a gene encoding a protein which can be
assayed, such as luciferase. DNA response elements can
include, but are not limited to, cyclic AMP response elements
(CRE), hormone response elements (HRE) insulin response
element (IRE), Nasrin et al., Proc. Natl. Acad. Sci. USA
87:5273 (1990) and serum response elements (SRE) (Shaw et a1.
Cell 56: 563 (1989). Cyclic AMP response elements are
reviewed in Roestler et al. , J. Bio1 . Cherry. 263 (19) : 9063
(1988) and Habener, Molec. Endocrinol. 4 (8):1087 (1990).
Hormone response elements are reviewed in Beato, Cell 56:335
(1989). Candidate compounds, solutions, mixtures or extracts
are tested for the ability to inhibit the activity of Zsig61
on the target cells as evidenced by a decrease in Zsig61
stimulation of reporter gene expression. Assays of this type
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
41
will detect compounds that directly block Zsig61 binding to
cell-surface receptors, as well as compounds that block
processes in the cellular pathway subsequent to receptor-
ligand binding. In the alternative, compounds or other
samples can be tested for direct blocking of Zsig61 binding to
receptor using Zsig61 tagged with a detectable label (e. q.,
l2sl, biotin, horseradish peroxidase, FITC, and the like).
Within assays of this type, the ability of a test sample to
inhibit the binding of labeled Zsig61 to the receptor is
indicative of inhibitory activity, which can be confirmed
through secondary assays. Receptors used within binding
assays may be cellular receptors or isolated, immobilized
receptors.
A Zsig61 polypeptide can be expressed as a fusion
with an immunoglobulin heavy chain constant region, typically
an Fc fragment, which contains two constant region domains and
lacks the variable region. Methods for preparing such fusions
are disclosed in.U.S. Patents Nos. 5,155,027 and 5,567,584.
Such fusions are typically secreted as multimeric molecules
wherein the Fc portions are disulfide bonded to each other and
two non-Ig polypeptides are arrayed in closed proximity to
each other. Fusions of this type can be used to affinity
purify the ligand. For use in assays, the chimeras are bound
to a support via the Fc region and used in an ELISA format.
A Zsig61 ligand-binding polypeptide can also be used
for purification of ligand. The polypeptide is immobilized on
a solid support, such as beads of agarose, cross-linked
agarose, glass, cellulosic resins, silica-based resins,
polystyrene, cross-linked polyacrylamide, or like materials
that are stable under the conditions of use. Methods for
linking polypeptides to solid supports are known in the art,
and include amine chemistry, cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation, sulfhydryl
activation, and hydrazide activation. The resulting medium
CA 02350621 2001-05-11
WO 00/28030 PCT/IlS99/26585
42
will generally be configured in the form of a column, and
fluids containing ligand are passed through the column one or
more times to allow ligand to bind to the receptor
polypeptide. The ligand is then eluted using changes in salt
concentration, chaotropic agents (guanidine HC1), or pH to
disrupt ligand-receptor binding.
An assay system that uses a ligand-binding receptor
(or an antibody, one member of a complement/ anti-complement
pair) or a binding fragment thereof, and a commercially
available biosensor instrument (BIAcore, Pharmacia Biosensor,
Piscataway, NJ) may be advantageously employed. Such
receptor, antibody, member of a complement/anti-complement
pair or fragment is immobilized onto the surface of a receptor
chip. Use of this instrument is disclosed by Karlsson, J.
~mmunol. Methods 145:229 (1991) and Cunningham and Wells, J.
Mol. Biol. 234:554 (1993). A receptor, antibody, member or
fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold film
within the flow cell. A test sample is passed through the
cell. If a ligand, epitope, or opposite member of the
complement/anti-complement pair is present in the sample, it
will bind to the immobilized receptor, antibody or member,
respectively, causing a change in the refractive index of the
medium, which is detected as a change in surface plasmon
resonance of the gold film. This system allows the
determination of on- and off-rates, from which binding
affinity can be calculated, and assessment of stoichiometry of
binding.
Ligand-binding receptor polypeptides can also be
used within other assay systems known in the art. Such
systems include Scatchard analysis for determination of
binding affinity, Scatchard, Ann. NY Acad. Sci. 51: 660 (1949)
CA 02350621 2001-05-11
WO 00128030 PC'f/US99126585
43
and calorimetric assays, Cunningham et al., Science 253:545
(1991); Cunningham et al., Science 295:821 (1991).
Zsig61 polypeptides can also be used to prepare
antibodies that specifically bind to Zsig61 epitopes, peptides
or polypeptides. The Zsig61 polypeptide or a fragment thereof
serves as an antigen (immunogen) to inoculate an animal and
elicit an immune response. Suitable antigens would be the
Zsig61 polypeptides encoded by SEQ ID NOs:2-24. Antibodies
generated from this immune response can be isolated and
purified as described herein. Methods for preparing and
isolating polyclonal and monoclonal antibodies are well known
in the art. See, for example, Current Protocols in
Immunology, Cooligan, et a1. (eds.), National Institutes of
Health, (John Wiley and Sons, Inc., 1995); Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Second Edition (Cold
Spring Harbor, NY, 1989); and Hurrell, J. G. R., Ed.,
Monoclonal Hybridoma Antibodies: Techniques and Applications
(CRC Press, Inc., Boca Raton, FL, 1982).
As would be evident to one of ordinary skill in the
art, polyclonal antibodies can be generated from inoculating a
variety of warm-blooded animals such as horses, cows, goats,
sheep, dogs, chickens, rabbits, mice, and rats with a Zsig61
polypeptide or a fragment thereof. The immunogenicity of a
Zsig61 polypeptide may be increased through the use of an
adjuvant, such as alum (aluminum hydroxide) or Freund's
complete or incomplete adjuvant. Polypeptides useful for
immunization also include fusion polypeptides, such as fusions
of Zsig61 or a portion thereof with an immunoglobulin
polypeptide or with maltose binding protein. The polypeptide
immunogen may be a full-length molecule or a portion thereof.
If the polypeptide portion is "hapten-like", such portion may
be advantageously joined or linked to a macromolecular carrier
CA 02350621 2001-05-11
wo oonso3o rc~r~sgvnbsss
44
(such as keyhole limpet hemocyanin (KLH), bovine serum albumin
(BSA) or tetanus toxoid) for immunization.
As used herein, the term "antibodies" includes
polyclonal antibodies, affinity-purified polyclonal
antibodies, monoclonal antibodies, and antigen-binding
fragments, such as F(ab')2 and Fab proteolytic fragments.
Genetically engineered intact antibodies or fragments, such as
chimeric antibodies, Fv fragments, single chain antibodies and
the like, as well as synthetic antigen-binding peptides and
polypeptides, are also included. Non-human antibodies may be
humanized by grafting non-human CDRs onto human framework and
constant regions, or by incorporating the entire non-human
variable domains (optionally "cloaking" them with a human-like
surface by replacement of exposed residues, wherein the result
is a "veneered" antibody). In some instances, humanized
antibodies may retain non-human residues within the human
variable region framework domains to enhance proper binding
characteristics. . Through humanizing antibodies, biological
half-life may be increased, and the potential for adverse
immune reactions ugon administration to humans is reduced.
Alternative techniques for generating or selecting
antibodies useful herein include in vitro exposure of
lymphocytes to Zsig61 protein or peptide, and selection of
antibody display libraries in phage or similar vectors (for
instance, through use of immobilized or labeled Zsig61 protein
or peptide). Genes encoding polypeptides having potential
Zsig61 polypeptide binding domains can be obtained by
screening random peptide libraries displayed on phage (phage
display) or on bacteria, such as E. coli. Nucleotide
sequences encoding the polypeptides can be obtained in a
number of ways, such as through random mutagenesis and random
polynucleotide synthesis. These random peptide display
libraries can be used to screen for peptides which interact
with a known target which can be a protein or polypeptide,
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
such as a ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al., US
Patent NO. 5,223,409; Ladner et al., US Patent NO. 4,946,778;
Ladner et al., US Patent NO. 5,403,484 and Ladner et al., US
Patent NO. 5,571,698) and random peptide display libraries and
kits for screening such libraries are available commercially,
for instance from Clontech (Palo Alto, CA), Invitrogen Inc.
(San Diego, CA), New England Biolabs, Inc. (Beverly, MA) and
Pharmacia LKB Biotechnology Inc. (Piscataway, NJ). Random
peptide display libraries can be screened using the Zsig61
sequences disclosed herein to identify proteins which bind to
Zsig6l. These "binding proteins" which interact with Zsig61
polypeptides can be used for tagging cells; for isolating
homolog polypeptides by affinity purification; they can be
directly or indirectly conjugated to drugs, toxins,
radionuclides and the like. These binding proteins can also
be used in analytical methods such as for screening expression
libraries and neutralizing activity. The binding proteins
can also be used for diagnostic assays for determining
circulating levels of polypeptides; for detecting or
quantitating soluble polypeptides as marker of underlying
pathology or disease. These binding proteins can also act as
Zsig61 "antagonists" to block Zsig61 binding and signal
transduction in vitro and in vivo. These anti-Zsig61 binding
proteins would be useful for inhibiting the activity of
Zsig6l.
Antibodies are determined to be specifically binding
if: 1) they exhibit a threshold level of binding activity,
and/or 2) they do not significantly cross-react with related
polypeptide molecules. First, antibodies herein specifically
bind if they bind to a Zsig61 polypeptide, peptide or epitope
with a binding affinity (Ka) of 106 M 1 or greater, preferably
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
46
107 M 1 or greater, more preferably 108 M 1 or greater, and
most preferably 109 M 1 or greater. The binding affinity of
an antibody can be readily determined by one of ordinary skill
in the art, for example, by Scatchard analysis.
Second, antibodies are determined to specifically
bind if they do not significantly cross-react with related
polypeptides. Antibodies do not significantly cross-react with
related polypeptide molecules, for example, if they detect
Zsig61 but not known related polypeptides using a standard
Western blot analysis (Ausubel et al., ibid.). Examples of
known related polypeptides are orthologs, proteins from the
same species that are members of a protein family (e.g. IL-
16), Zsig61 polypeptides, and non-human Zsig6l. Moreover,
antibodies may be "screened against" known related
polypeptides to isolate a population that specifically binds
to the inventive polypeptides. For example, antibodies raised
to Zsig61 are adsorbed to related polypeptides adhered to
insoluble matrix; antibodies specific to Zsig61 will flow
through the matrix under the proper buffer conditions. Such
screening allows isolation of polyclonal and monoclonal
antibodies non-crossreactive to closely related polypeptides,
Antibodies: A Laboratory Manual, Harlow and Lane (eds.) (Cold
Spring Harbor Laboratory Press, 1988); Current Protocols in
Immunology, Cooligan, et al. (eds.), National Institutes of
Health (John Wiley and Sons, Inc., 1995). Screening and
isolation of specific antibodies is well known in the art.
See, Fundamental Immunology, Paul (eds.) (Raven Press, 1993);
Getzoff et al., Adv. in Immunol. 43: 1-98 (1988); Monoclonal
Antibodies: Principles and Practice, Coding, J.W. (eds.),
(Academic Press Ltd., 1996); Benjamin et al., Ann. Rev.
Immunol. 2: 67-101 (1984).
CA 02350621 2001-05-11
WO 00/28030 PGT/US99/26585.
47
A variety of assays known to those skilled in the
art can be utilized to detect antibodies which specifically
bind to Zsig61 proteins or peptides. Exemplary assays are
described in detail in Antibodies: A Laboratory Manual, Harlow
and Lane (Eds.) (Cold Spring Harbor Laboratory Press, 1988).
Representative examples of such assays include: concurrent
immunoelectrophoresis, radioimmunoassay, radioimmuno-
precipitation, enzyme-linked immunosorbent assay (ELISA), dot
blot or Western blot assay, inhibition or competition assay,
and sandwich assay. In addition, antibodies can be screened
for binding to wild-type versus mutant Zsig61 protein or,
polypeptide.
Antibodies to Zsig61 may be used for tagging cells
that express Zsig6l; fox isolating Zsig61 by affinity
purification; for diagnostic assays for determining
circulating levels of Zsig61 polypeptides; for detecting or
quantitating soluble Zsig61 as marker of underlying pathology
or disease; in analytical methods employing FRCS; for
screening expression libraries; for generating anti-idiotypic
antibodies; and as neutralizing antibodies or as antagonists
to block Zsig61 in vitro and in vivo. Suitable direct tags or
labels include radionuclides, enzymes, substrates, cofactors,
inhibitors, fluorescent markers, chemiluminescent markers,
magnetic particles and the like; indirect tags or labels may
feature use of biotin-avidin or other complement/anti-
complement pairs as intermediates. Antibodies herein may also
be directly or indirectly conjugated to drugs, toxins,
radionuclides and the like, and these conjugates used for in
vivo diagnostic or therapeutic applications. Moreover,
antibodies to Zsig61 or fragments thereof may be used in vitro
to detect denatured Zsig61 or fragments thereof in assays, for
example, Western Blots or other assays known in the art.
CA 02350621 2001-05-11
WO 00/28030 PCTIUS99/26585
48
BIOACTIVE CONJUGATES:
Antibodies or polypeptides herein can also be
directly or indirectly conjugated to drugs, toxins,
radionuclides and the like, and these conjugates used for in
vivo diagnostic or therapeutic applications. For instance,
polypeptides or antibodies of the present invention can be
used to identify or treat tissues or organs that express a
corresponding anti-complementary molecule (receptor or
antigen, respectively, for instance). More specifically,
Zsig61 polypeptides or anti-Zsig61 antibodies, or bioactive
fragments or portions thereof, can be coupled to detectable or
cytotoxic molecules and delivered to a mammal having cells,
tissues or organs that express the anti-complementary
molecule.
Suitable detectable molecules may be directly or
indirectly attached to the polypeptide or antibody, and
include radionuclides, enzymes, substrates, cofactors,
inhibitors, fluorescent markers, chemiluminescent markers,
magnetic particles and the like. Suitable cytotoxic molecules
may be directly or indirectly attached to the polypeptide or
antibody, and include bacterial or plant toxins (for instance,
diphtheria toxin, Pseudomonas exotoxin, ricin, abrin and the
like), as well as therapeutic radionuclides, such as iodine-
131, rhenium-188 or yttrium-90 (either directly attached to
the polypeptide or antibody, or indirectly attached through
means of a chelating moiety, for instance). Polypeptides or
antibodies may also be conjugated to cytotoxic drugs, such as
adriamycin. For indirect attachment of a detectable or
cytotoxic molecule, the detectable or cytotoxic molecule can
be conjugated with a member of a complementary/
anticomplementary pair, where the other member is bound to the
polypeptide or antibody portion. For these purposes,
biotin/streptavidin is an exemplary complementary/
anticomplementary pair.
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
49
In another embodiment, polypeptide-toxin fusion
proteins or antibody-toxin fusion proteins can be used for
targeted cell or tissue inhibition or ablation (for instance,
to treat cancer cells or tissues). Alternatively, if the
polypeptide has multiple functional domains (i.e., an
activation domain or a ligand binding domain, plus a targeting
domain), a fusion protein including only the targeting domain
may be suitable for directing a detectable molecule, a
cytotoxic molecule or a complementary molecule to a cell or
tissue type of interest. In instances where the domain only
fusion protein includes a complementary molecule, the anti-
complementary molecule can be conjugated to a detectable or
cytotoxic molecule. Such domain-complementary molecule fusion
proteins thus represent a generic targeting vehicle for
cell/tissue-specific delivery of generic anti-complementary-
detectable/ cytotoxic molecule conjugates.
In another embodiment, Zsig61-cytokine fusion
proteins or antibody-cytokine fusion proteins can be used for
enhancing in vivo killing of target tissues (for example,
blood and bone marrow cancers), if the Zsig61 polypeptide or
anti-Zsig61 antibody targets the hyperproliferative blood or
bone marrow cell. See, generally, Hornick et al., Blood
89:4437 (1997). They described fusion proteins enable
targeting of a cytokine to a desired site of action, thereby
providing an elevated local concentration of cytokine.
Suitable Zsig61 polypeptides or anti-Zsig61 antibodies target
an undesirable cell or tissue (i.e., a tumor or a leukemia),
and the fused cytokine mediated improved target cell lysis by
effector cells. Suitable cytokines for this purpose include
interleukin 2 and granulocyte-macrophage colony-stimulating
factor (GM-CSF), for instance.
The bioactive polypeptide or antibody conjugates
described herein can be delivered intravenously,
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
intraarterially or intraductally, or may be introduced locally
at the intended site of action.
USES OF POLYNUCLEOTIDE/POLYPEPTIDE:
Proteins and peptides of the present invention can
be immobilized on a column and membrane preparations run over
the column, Immobilized Affinity Ligand Techniques, Hermanson
et al., eds., pp.195-202 (Academic Press, San Diego, CA,
1992,). Proteins and peptides can also be radiolabeled,
Methods in Enzymol., vol. 182, "Guide to Protein
Purification", M. Deutscher, ed., pp 721-737 (Acad. Press, San
Diego, 1990) or photoaffinity labeled, Brunner et al., Ann.
Rev. Biochem. 62:483-514 (1993) and Fedan et al., Biochem.
Pharmacol. 33:1167 (1984) and specific cell-surface proteins
can be identified.
GENE THERAPY:
Polynucleotides encoding Zsig61 polypeptides are
useful within gene therapy applications where it is desired to
increase or inhibit Zsig61 activity. If a mammal has a
mutated or absent Zsig61 gene, the Zsig61 gene can be
introduced into the cells of the mammal. In one embodiment, a
gene encoding a Zsig61 polypeptide is introduced in vivo in a
viral vector. Such vectors include an attenuated or defective
DNA virus, such as, but not limited to, herpes simplex virus
(HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), and the like. Defective
viruses, which entirely or almost entirely lack viral genes,
are preferred. A defective virus is not infective after
introduction into a cell. Use of defective viral vectors
allows for administration to cells in a specific, localized
area, without~concern that the vector can infect other cells.
Examples of particular vectors include, but are not limited
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/Z6585
51
to, a defective herpes simplex virus 1 (HSV1) vector, Kaplitt
et al., Molec. Cell. Neurosci. 2:320 (1991); an attenuated
adenovirus vector, such as the vector described by Stratford-
Perricaudet et al., J. Clin. Invest. 90:626 (1992); and a
defective adeno-associated virus vector, Samulski et al., J.
Virol. 61:3096 (1987); Samulski et al., J. Virol. 63:3822
(1989) .
In another embodiment, a Zsig61 gene can be
introduced in a retroviral vector, e.g., as described in
Anderson et al., U.S. Patent No. 5,399,346; Mann et a1. Cell
33:153, 1983; Temin et al., U.S. Patent No. 4,650,764; Temin
et al., U.S. Patent No. 4,980,289; Markowitz et al., J. Virol.
62:1120 (1988); Temin et al., U.S. Patent No. 5,124,263;
International Patent Publication No. WO 95/07358, published
March 16, 1995 by Dougherty et al.; and Kuo et al., Blood
82:845 (1993). Alternatively, the vector can be introduced by
lipofection in vivv using liposomes. Synthetic cationic
lipids can be used to prepare liposomes for in vivo
transfection of a gene encoding a marker, Felgner et al.,
Proc. Natl. Acad. Sci. USA 84:7413 (1987); Mackey et al.,
Proc. Natl. Acad. Sci. USA 85:8027 (1988). The use of
lipofection to introduce exogenous genes into specific organs
in vivo has certain practical advantages. Molecular targeting
of liposomes to specific cells represents one area of benefit.
More particularly, directing transfection to particular cells
represents one area of benefit. For instance, directing
transfection to particular cell types would be particularly
advantageous in a tissue with cellular heterogeneity, such as
the pancreas, liver, kidney, and brain. Lipids may be
chemically coupled to other molecules for the purpose of
targeting. Targeted peptides (e.g., hormones or
CA 02350621 2001-05-11
WO 00/28030 PCTlUS99/26585
52
neurotransmitters), proteins such as antibodies, or non-
peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the
body; to introduce the vector as a naked DNA plasmid; and then
to re-implant the transformed cells into the body. Naked DNA
vectors for gene therapy can be introduced into the desired
host cells by methods known in the art, e.g., transfection,
electroporation, microinjection, transduction, cell fusion,
DEAE dextran, calcium phosphate precipitation, use of a gene
gun or use of a DNA vector transporter. See, e.g., Wu et al.,
J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem.
26.3:14621-4, 1988.
Antisense methodology can be used to inhibit Zsig61
gene transcription, such as to inhibit cell proliferation in
vivo. Polynucleotides that are complementary to a segment of
a Zsig61-encoding polynucleotide (e.g., a polynucleotide as
set froth in SEQ ID NO:1) are designed to bind to Zsig61-
encoding mRNA and to inhibit translation of such mRNA. Such
antisense polynucleotides are used to inhibit expression of
Zsig61 polypeptide-encoding genes in cell culture or in a
subject.
The present invention also provides reagents which
will find use in diagnostic applications. For example, the
Zsig61 gene, a probe comprising Zsig61 DNA or RNA or a
subsequence thereof can be used to determine if the Zsig61
gene is present on chromosome 17p13.3 or if a mutation has
occurred. Detectable chromosomal aberrations at the Zsig61
gene locus include, but are not limited to, aneuploidy, gene
copy number changes, insertions, deletions, restriction site
changes and rearrangements. Such aberrations can be detected
using polynucleotides of the present invention by employing
molecular genetic techniques, such as restriction fragment
length polymorphism (RFLP) analysis, short tandem repeat (STR)
CA 02350621 2001-05-11
WO 00128030 PCT/US99l16585.
53
analysis employing PCR techniques, and other genetic linkage
analysis techniques known in the art (Sambrook et al., ibid.;
Ausubel et. al., ibid.; Marian, Chest 108:255 (1995).
Transgenic mice, engineered to express the Zsig61
gene, and mice that exhibit a complete absence of Zsig51 gene
function, referred to as "knockout mice", Snouwaert et al.,
Science 257:1083 (1992), may also be generated, Lowell et al.,
Nature 366:740-42 (1993). These mice may be employed to study
the Zsig61 gene and the protein encoded thereby in an in vivo
system.
CHROMOSOMAL LOCALIZATION:
Radiation hybrid mapping is a somatic cell genetic
technique developed for constructing high-resolution,
contiguous maps of mammalian chromosomes (Cox et al., Science
250:245 (1990). Partial or full knowledge of a gene's
sequence allows one to design PCR primers suitable for use
with chromosomal radiation hybrid mapping panels. Radiation
hybrid. mapping panels are commercially available which cover
the entire human genome, such as the Stanford G3 RH Panel and
the GeneBridge 4 RH Panel (Research Genetics, Inc.,
Huntsville, AL). These panels enable rapid, PCR-based
chromosomal localizations and ordering of genes, sequence-
tagged sites (STSs), and other nonpolymorphic and polymorphic
markers within a region of interest. This includes
establishing directly proportional physical distances between
newly discovered genes of interest and previously mapped
markers. The precise knowledge of a gene's position can be
useful for a number of purposes, including: 1) determining if
a sequence is part of an existing contig and obtaining
additional surrounding genetic sequences in various forms,
such as YACs, BACs or cDNA clones; 2) providing a possible
candidate gene for an inheritable disease which shows linkage
to the same chromosomal region; and 3) cross-referencing model
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/Z6585.
54
organisms, such as mouse, which may aid in determining what
function a particular gene might have. Zsig61 has been mapped
to 17p13.3.
Sequence tagged sites (STSs) can also be used
independently for chromosomal localization. An STS is a DNA
sequence that is unique in the human genome and can be used as
a reference point for a particular chromosome or region of a
chromosome. An STS is defined by a pair of oligonucleotide
primers that are used in a polymerase chain reaction to
specifically detect this site in the presence of all other
genomic sequences. Since STSs are based solely on DNA
sequence they can be completely described within an electronic
database, for example, Database of Sequence Tagged Sites
(dbSTS), GenBank, (National Center for Biological Information,
National Institutes of Health, Bethesda, MD
http://www.ncbi.nlm.nih.gov), and can be searched with a gene
sequence of interest for the mapping data contained within
these short genomic landmark STS sequences.
RESEARCH TOOL UTILITY
The polynucleotides provided by the present
invention can be used by the research community for various
purposes. The polynucleotides can be used to express
recombinant protein for analysis, characterization or
therapeutic; as markers for tissues in which the corresponding
protein is preferentially expressed (either constitutively or
at a particular stage of tissue differentiation or development
or disease states); as molecular weight markers on Southern
gels; as chromosome markers (when labeled) to map related gene
positions; to compare with endogenous DNA sequences in
patients to identify potential genetic disorders; as probes to
hybridize and thus discover novel, related DNA sequences; as a
source of information to derive PCR primers for genetic
fingerprinting; as a probe to "subtract-out" known sequences
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
in the process of discovering other novel polynucleotides; to
raise anti-protein antibodies using DNA immunization
techniques; and as an antigen to raise anti-DNA antibodies or
elicit another immune response. Where the polynucleotide
encodes a protein which binds or potentially binds to another
protein (such as, for example, in a receptor-ligand
interaction), the polynucleotide can also be used in
interaction trap assays [such as, for example, that described
in Gyuris et a1. Cell 75:791-803 (1993)] to identify
polynucleotides encoding the other protein with which binding
occurs or to identify inhibitors of the binding interaction.
The proteins provided by the present invention can
similarly be used to raise antibodies or to elicit another
immune response: as a reagent (including the labeled reagent)
in assays designed to quantitatively determine levels of the
protein (or its receptor).in biological fluids; as markers for
tissues using labeled antibodies; and to isolate correlative
receptors or ligands. Where the protein binds or potentially
binds to another protein (such as, for example, in a receptor-
ligand interaction), the protein can be used to identify the
other protein with which binding occurs or to identify
inhibitors of the binding interaction. Proteins involved in
these binding interactions can also be used to screen for
peptide or small molecule inhibitors or agonists of the
binding interaction.
Any or all of these "research tool" utilities are
capable of being developed into reagent grade or kit format
for commercialization as "research products".
Cytokine and Cell Proliferation/Differentiation Activity
A protein of the present invention may exhibit
cytokine-cell proliferation (either inducing or inhibiting) or
cell differentiation (either inducing or inhibiting)activity
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
56
or may induce production of other cytokines in certain cell
populations. Many protein factors discovered to date,
including all know cytokines, have exhibited activity in one
or more factor dependent cell proliferation assays, and hence
the assays serve has a convenient confirmation of cytokine
activity. The activity of a protein of the present invention
is evidenced by any one of a number of routine factor
dependent cell proliferation assays for cell lines including
without limitation, 32D, DA2, DA1G, T10, B9, B9/11, BaF3,
MC9/G, M+(preB M+), 2E8, RBS, DA1,123, T1165, HT2, CTLL2, TF-
1, Mole and CMK.
The activity of a protein of the invention may,
among other means, be measured by assays for T-cell or
thymocyte proliferation, assays for cytokine production or
proliferation of spleen cells, lymph node cells or thymocytes,
assays for proliferation and differentiation of hematopoietic
and lymphopoietic cells, and assays for T-cell clone responses
to antigens which will identify, among others, proteins that
affect antigen-presenting cells (APC)/T-cell interactions as
well as direct T-cell effects by measuring proliferation and
cytokine production. Other immunological assays include assays
for T-cell dependent immunoglobulin responses and isotype
switching (which will identify, among others, proteins that
modulate T-cell dependent antibody responses and that affect
Thl/Th2 profiles); mixed lymphocyte reaction (MLR) assays
(which will identify proteins that generate predominantly Thl
and CTL responses); dendritic cell-dependent assays (which
will identify, among others, proteins expressed a by dendritic
cells that activate naive T-cells); assays for lymphocyte
survival/apvptvsis (which will identify proteins that prevent
apoptosis after superantigen induction and proteins that
regulate lymphocyte homeostasis); assays for B cell function
and assays for protein that influence early steps of T-cell
commitment and development. The above-described assays are
described in one or more of the following references: Current
CA 02350621 2001-05-11
WO 00/28030 PC'f/US99/26585.
57
Protocols in Immunology, (John Wiley and Sons, Toronto, 1997);
Takai et al., J. Immunol. 137:3494-3500 (1986); Bertagnolli et
al. J. Immunol. 145:1706-1712 (1990); Bertagnolli et al.,
Cell. Immunol. 133:327-341 (1991); Bertagnolli et al., J.
Immunol. 149:3778-3783 (1992); Bowman et al., J. Immunol.
152:1756-1761 (1994); de Vries et al., J. Exp. Med. 173:1205-
1211 (1991); Moreau et al., Nature 336:690-692 (1988);
Greenberger et al., Proc. Natl. Acad. Sci. U.S.A. 80:2931-2938
(1983); Weinberger et al., Proc. Natl. Acad. Sci. USA,
77:6091-6095 (1980); Weinberger et al., Eur. J. Immunol.
11:405-411 (1981); Takai et al., J. Immunol. 140:508-512
(1988); Maliszewski, J. Immunol. 144: 3028-3033 (1990);
Herrmann et al., Proc. Natl Acad. Sci USA 78:24882492 (1981);
Herrmann et al., J. Immunol. 128:1968-1974 (1982); Handa et
a1. J. Immunol. 135:1564-1572 (1985); Bowmanet et al., J.
Virology 61:1992-1998; Brown et al., J. Immunol. 153:3079-3092
(1994); Maliszewski, J. Immunol. 144:3028-3033 (1990); Guery
et al. J. Immunol. 134:536-544 (1995); Inaba et al., J. Exp.
Med. 173:549-559 (1991); Macatonia et al., J. Immunol.
154:5071-5079 (1995); Porgador et al., J. Exp. Med. 182:255-
260 (1995); Nair et a1. J. Virol. 67:4062-4069 (1993); Huang
et al., Science 264:961-965 (1994); Macatonia et al., J. Exp.
Med. 169:1255-1264 (1989); Bhardwaj et al., J. Clin. Invest.
94:797-807 (1994); Inaba et al., J. Exp. Med. 172:631-64D
(1990); Darzynkiewicz et al., Cytometry 13:795-808 (1992):
Gorczyca et al., Leukemia 7:659-670 (1993); Gorczyca et al.,
Can. Res. 53:1945-1951 (1993); Itoh et al., Cell 66:233-243
(1991);Zacharchuk, J. Immunol. 145:4037-4045 (1990); Zamai et
aI. Cytometry 14:891-897 (1993); Gorczyca et al., Inter. J.
Oncol. 1:639-648 (1992); Antica et al., Blood 84:111-117
CA 02350621 2001-05-11
WO 00/28030 PCTJUS99/26585..
58
(1994); Fine et al., Cell. Immunol. 155:111-122 (1994); Galy
et al., Blood 85:2770-2778 (1995); and Toki et al., Proc.
Natl. Acad Sci. USA 88:7548-7551 (1991).
Immune Stimulating/Suppressing Activity
A protein of the present invention may also exhibit
immune stimulating or immune suppressing activity including,
without limitation, the activities for which assays are
described herein. A protein may be useful in the treatment of
various immune deficiencies and disorders [including severe
combined immunodeficiency (SCID)], e.g., in regulating (up or
down) growth and proliferation of T or B lymphocytes., as well
as effecting the cytolytic activity of natural killer (NK)
cells and other cell populations. These immune deficiencies
may be genetic or by caused by viral as well as bacterial or
fungal infections or may result from autoimmune disorders. The
protein of the present invention by may possibly be used to
treat such diseases or to boost the immune system.
Hematopoiesis
The protein of the present invention may be useful
in promoting hematopoiesis, including causing proliferation of
red blood cells, megakaryocytes, and myeloid cells such as
monocytes/macrophages. Assays for relating to stem cell growth
or differentiation include: Freshney, M.G., in Culture of
Hematopoietic Cells, Frshney, R.I. et al., Eds. (Wiley-Liss,
Inc., New York, N.Y., 1994); Johansson et a1. Cell. Bio.
15:141-151 (1995); Keller et al., Mol. & Cell. Bio. 13:473-486
(1993); McClanahan et al., Blood 81:2903-2915 (1993); Hirayama
et al., Proc. Natl. Acad. Sci. USA 89:5907-5911 (1992); and
Neben et al., Exp. Hematol. 22:353-359 (1994).
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585
59
Tissue Regeneration or Repair
The protein of the present invention may be used to
repair or regenerate any number of different tissues including
bone, ligaments, tendons, neurons and skin. Assays for tissue
regeneration include those described in International Patent
Publication No. W095/16035 (bone, cartilage, tendon);
W095/05846 (neuron); and W091/07491 (skin, endothelium).
Activin/Inhibin Activity
A protein of the present invention may also exhibit
activin or inhibin related activities. Inhibin is a
glycoprotein that circulates in plasma and inhibits
gonadotropin-releasing hormone (GnRH)-stimulated follicle
stimulating hormone (FSH) secretion by the pituitary gland.
Activin has the opposite action and stimulates FSH secretion.
Thus, the protein of the present invention may be useful as a
contraceptive or as a based upon the ability of inhibins to
decrease fertility in female mammals and decrease
spermatogenesis in male mammals. Assays for activin/inhibin
activity are described in the following: Vale et al.,
Endocrinology 92:562-572 (1972); Ling et al., Nature 321: 779-
782 (1986); Vale et al., Nature 321:776-779 (1986); Mason et
al., Nature 318:659-663 (1985); Forage et al., Proc. Natl.
Acad. Sci. USA 83:3091-3095 (1986).
For pharmaceutical use, the proteins of the present
invention are formulated for parenteral, particularly
intravenous or subcutaneous, delivery according to
conventional methods. Intravenous administration will be by
bolus injection or infusion over a typical period of one to
several hours. In general, pharmaceutical formulations will
include a Zsig61 protein in combination with a
CA 02350621 2001-05-11
WO 00/28030 PCT/US99126585.
pharmaceutically acceptable vehicle, such as saline, buffered
saline, 5% dextrose in water or the like. Formulations may
further include one or more excipients, preservatives,
solubilizers, buffering agents, albumin to prevent protein
loss on vial surfaces, etc. Methods of formulation are well
known in the art and are disclosed, for example, in Remington:
The Science and Practice of Pharmacy, Gennaro, ed.,(Mack
Publishing Co., Easton, PA, 19th ed., 1995). Therapeutic
doses will generally be in the range of 0.1 to 100 ~g/kg of
patient weight per day, preferably 0.5-20 mg/kg per day, with
the exact dose determined by the clinician according to
accepted standards, taking into account the nature and
severity of the condition to be treated, patient traits, etc.
Determination of dose is within the level of ordinary skill in
the art. The proteins may be administered for acute
treatment, over one week or less, often over a period of one
to three days or may be used in chronic treatment, over
several months or years.
Northern blots confirm the predicted message size
and demonstrate abundant levels ofZsig61 mRNA in human liver,
kidney and pancreas. Since the original clone was derived
from a library representing the endocrine pancreas (islets of
Langerhans), the signal in whole pancreas is likely due at
least in part to expression in the islet cells. On RNA "dot
blots" the presence of zsig6l mRNA in liver, kidney and
pancreas is confirmed. Numerous other tissues, including
pituitary, thyroid, adrenal, prostate, stomach, small
intestine and colon show a relatively weaker degree of
hybridization with the zsig6l-specific probe. In addition,
zsig6l mRNA was found in fetal liver and fetal kidney RNA
samples.
Zsig61 mRNA is found in a large number of glandular
organs, most of which share a common function of regulating
energy homeostasis (i.e. the absorption, utilization, and
CA 02350621 2001-05-11
WO OOI28030 PCT/US99/26585.
61
excretion of nutrients from the body?. zsig6l is likely to be
secreted from these tissues in response to events or
conditions which alter metabolic parameters such as blood
glucose levels or the concentrations of other carbohydrates or
lipids. Conditions such as pH, temperature or. oxygen tension
may also affect secretion of zsig6l from these tissues.
Zsig61 may then act through a receptor mediated mechanism or
by modulating the activity of some other blood component to
alleviate the condition. The presence of zsig6l mRNA in fetal
liver and kidney samples suggests a possible role for this
protein in growth and/or differentiation of tissues.
Modulation of zsig6l levels in proximity to the
target tissue should be useful in the treatment of conditions
associated with abnormal metabolic activity, including
abnormal proliferation or degenerative conditions. This may
be achieved by administration of polypeptide, fragments . ,
antibodies ., binding proteins, DNA based therapy, etc.
The invention is further illustrated by the
following non-limiting examples.
Example 1
Cloning of Zsig61
The expressed sequence tag (EST) of SEQ ID NO: 3 was
discovered through the random sequencing of a pancreatic islet
cDNA library, described in Example 2 below, and the full-
length clone isolated and sequenced resulting in the sequences
of SEQ ID NOs: 1 and 2, and SEQ ID NOs: 4-6.
CA 02350621 2001-05-11
WO 00/28030 PCTIUS99/26585
62
Example 2
Production a Pancreatic Islet Cell cDNA Library
RNA extracted from pancreatic islet cells was
reversed transcribed in the following manner. The first strand
cDNA reaction contained 10 ml of human pancreatic islet cell
poly d(T)-selected poly (A)+ mRNA (Clontech, Palo Alto, CA)
at a concentration of 1.0 mg/ml, and 2 ml of 20 pmole/ml first
strand primer SEQ ID N0:7 (GTC TGG GTT CGC TAC TCG AGG CGG CCG
CTA TTT TTT TTT TTT TTT TTT)SE containing an Xho I restriction
site. The mixture was heated at 70°C for 2.5 minutes and
cooled by chilling on ice. First strand cDNA synthesis was
initiated by the addition of 8 ml of first strand buffer (5x
SUPERSCRIPTS buffer; Life Technologies, Gaithersburg, MD), 4
ml of 100 mM dithiothreitol, and 3 ml of a deoxynucleotide
triphosphate (dNTP) solution containing 10 mM each of dTTP,
dATP, dGTP and 5-methyl-dCTP (Pharmacia LKB Biotechnology,
Piscataway, NJ) to the RNA-primer mixture. The reaction
mixture was incubated at 40° C for 2 minutes, followed by the
addition of 10 ml of 200 U/ml RNase H- reverse transcriptase
(SUPERSCRIPT IIa; Life Technologies). The efficiency of the
first strand synthesis was analyzed in a parallel reaction by
the addition of 10 mCi of 32P-adCTP to a 5 ml aliquot from one
of the reaction mixtures to label the reaction for analysis.
The reactions were incubated at 40°C for 5 minutes, 45°C
for
50 minutes, then incubated at 50°C for 10 minutes.
Unincorporated 32P-adCTP in the labeled reaction was removed
by chromatography on a 400 pore size gel filtration column
(Clontech Laboratories, Palo Alto, CA). The unincorporated
nucleotides and primers in the unlabeled first strand
reactions were removed by chromatography on 400 pore size gel
filtration column (Clontech Laboratories, Palo Alto, CA). The
length of labeled first strand cDNA was determined by agarose
gel electrophoresis. The second strand reaction contained 102
ml of the unlabeled first strand cDNA, 30 ml of 5x polymerase
CA 02350621 2001-05-11
wo oonsoso rcrNS~n6sss
63
I buffer (125 mM Tris: HC1, pH 7.5, 500 mM KC1, 25 mM MgCl2,
50mM (NH4) 2S04) ) , 2.0 ml of 100 mM dithiothreitol, 3.0 ml of
a solution containing 10 mM of each deoxynucleotide
triphosphate, 7 ml of 5 mM b-NAD, 2.0 ml of 20 U/ml E. coli
DNA ligase (New England Biolabs; Beverly, MA), 5 ml of 10 U/ml
E. coli DNA polymerase I (New England Biolabs, Beverly, MA),
and 1.5 ml of 2 U/ml RNase H (Life Technologies, Gaithersburg,
MD). A 10 ml aliquot from one of the second strand synthesis
reactions was labeled by the addition of 10 mCi 32P-adCTP to
monitor the efficiency of second strand synthesis. The
reactions were incubated at 16° C for two hours, followed by
the addition of 1 ml of a 10 mM dNTP solution and 6.0 ml T4
DNA polymerase (10 U/ml, Boehringer Mannheim, Indianapolis,
IN) and incubated for an additional 10 minutes at 16°C.
Unincorporated 32P-adCTP in the labeled reaction was removed
by chromatography through a 400 pore size gel filtration
column (Clontech Laboratories, Palo Alto, CA) before analysis
by agarose gel electrophoresis. The reaction was terminated
by the addition ,of 10.0 ml 0.5 M EDTA and extraction with
phenol/chloroform and chloroform followed by ethanol
precipitation in the presence of 3.0 M Na acetate and 2 ml of
Pellet Paint carrier (Novagen, Madison, WI). The yield of
cDNA was estimated to be approximately 2 mg from starting mRNA
template of 10 mg.
Eco RI adapters were ligated onto the 5~ ends of the
cDNA described above to enable cloning into an expression
vector. A 12.5 ml aliquot of cDNA ("'2.0 mg) and 3 ml of 69
pmole/ml of Eco RI adapter (Pharmacia LKB Biotechnology Inc.,
Piscataway, NJ) were mixed with 2.5 ml lOx ligase buffer (660
mM Tris-HC1 pH 7.5, 100 mM MgCl2), 2.5 ml of 10 mM ATP, 3.5 ml
0.1 M DTT and 1 ml of 15 U/ml T4 DNA ligase (Promega Corp.,
Madison, WI). The reaction was incubated 1 hour at 5°C, 2
hours at 7.5°C, 2 hours at 10°C, 2 hours at 12.5°C and 16
hours at 10° C. The reaction was terminated by the addition
CA 02350621 2001-05-11
WO 00/Z8030 PCT/US99/26585
64
of 65 ml H20 and 10 ml lOX H buffer (Boehringer Mannheim,
Indianapolis, IN) and incubation at 70°C for 20 minutes.
To facilitate the directional cloning of the cDNA
into an expression vector, the cDNA was digested with Xho I,
resulting in a cDNA having a 5' Eco RI cohesive end and a 3'
Xho I cohesive end. The Xho I restriction site at the 3' end
of the cDNA had been previously introduced. Restriction
enzyme digestion was carried out in a reaction mixture by the
addition of 1.0 ml of 40 U/ml Xho I (Boehringer Mannheim,
Indianapolis, IN). Digestion was carried out at 37°C for 45
minutes. The reaction was terminated by incubation at 70°C
for 20 minutes and chromatography through a 400 pore size gel
filtration column (Clontech Laboratories, Palo Alto, CA).
The cDNA was ethanol precipitated, washed with 70\%
ethanol, air dried and resuspended in 10.0 ml water, 2 ml of
lOX kinase buffer (660 mM Tris-HCl, pH 7.5, 100 mM MgCl2), 0.5
ml 0.1 M DTT, 2~m1 10 mM ATP, 2 ml T4 polynucleotide kinase
(10 U/ml, Life Technologies, Gaithersburg, MD). Following
incubation at 37° C for 30 minutes, the cDNA was ethanol
precipitated in the presence of 2.5 M Ammonium Acetate, and
electrophoresed on a 0.8\% low melt agarose gel. The
contaminating adapters and cDNA below 0.6 Kb in length were
excised from the gel. The electrodes were reversed, and the
cDNA was electrophoresed until concentrated near the lane
origin. The area of the gel containing the concentrated cDNA
was excised and placed in a microfuge tube, and the
approximate volume of the gel slice was determined. An
aliquot of water approximately three times the volume of the
gel slice (300 ml) and 35 ml 10x b-agarose I buffer (New
England Biolabs) was added to the tube, and the agarose was
melted by heating to 65°C for 15 minutes. Following
equilibration of the sample to 45°C, 3 ml of 1 U/ml b-agarose
I (New England Biolabs, Beverly, MA) was added, and the
CA 02350621 2001-05-11
WO 00/Z8030 PCT/US99/26585
mixture was incubated for 60 minutes at 45°C to digest the
agarose. After incubation, 40 ml of 3 M Na acetate was added
to the sample, and the mixture was incubated on ice for 15
minutes. The sample was centrifuged at 14,000 x g for 15
minutes at room temperature to remove undigested agarose. The
cDNA was ethanol precipitated, washed in 70\% ethanol, air-
dried and resuspended in 40 ml water.
Following recovery from low-melt agarose gel, the
cDNA was cloned into the Eco RI and Xho I sites of pBLUESCRIPT
SK+ vector (Gibco/BRL, Gaithersburg, MD) and electroporated
into DH10B cells. Bacterial colonies containing ESTs of known
genes were identified and eliminated from sequence analysis by
reiterative cycles of probe hybridization to hi-density colony
filter arrays (Genome Systems, St. Louis, MI). cDNAs of known
genes were pooled in groups of 50 - 100 inserts and were
labeled with 32P-adCTP using a MEGAPRIME labeling kit
(Amersham, Arlington Heights, IL). Colonies which did not
hybridize to the probe mixture were selected for sequencing.
Sequencing was done using an ABI 377 sequencer using either
the T3 or the reverse primer. The resulting data were analyzed
which resulted in the identification of the novel gene Zsig6l.
CA 02350621 2001-05-11
WO 00/28030 PCTNS99/26585.
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> Mammalian Secretory Protein-61
<130> Zsig61
<150> 09/191.074
<151> 1998-11-12
<160> 10
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 882
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (84)...(326)
<400> 1
gatggccagt agccacctgg ctcccccttg aaacggcctg tctgccggtg cagctaaaca 60
gagctgagag atgaaggcac agc atg agc cct gat gtg cgc ttt ctg ctc ctg 113
Met Ser Pro Asp Val Arg Phe Leu Leu Leu
1 5 10
ctc ctg ctc ctg ccc ctt cgg agg cct gtg cca gtg gca get ggg ccc 161
Leu Leu Leu Leu Pro Leu Arg Arg Pro Val Pro Val Ala Ala Gly Pro
15 20 25
gga gac acc agg ccg gca ctg ctc tcc ttc gag gca ccc gtg ttt gtg 209
Gly Asp Thr Arg Pro Ala Leu Leu Ser Phe Glu Ala Pro Val Phe Val
30 35 40
ccg acg ctg act ccc ggt tgt ctg cag cag cca cgt ggc cga aat gga 257
Pro Thr Leu Thr Pro Gly Cys Leu Gln Gln Pro Arg Gly Arg Asn Gly
45 50 55
gcc tct cca cgg ggg ctc ctt ccc cag ccc ctg gat ggc aca gca gcc 305
Ala Ser Pro Arg Gly Leu Leu Pro Gln Pro Leu Asp Gly Thr Ala Ala
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585_
2
60 65 70
tct cct gtc tgt cac cac gtg tgacctgctc ccttactctt cagccgctca 356
Ser Pro Val Cys His His Val
75 80
tccacgtctgcaggggcatctaactctgtcccagggtatcccagaccctggctcacgccc416
caggctctccattcaggctccatcgtccacctcagaccatctcaggtttgctggtcttct476
ggactagcgcagccagaaagaacccaggaaggaagcctcacgtctgacacaagaaccttc536
ggtgctaatccgagggcggtatgtgcatcctcagcacctgcccatccggcaccatcctct596
gatccagggactgtgagcaacagggccccgtggccaggacatctctcaccctccagttaa656
aatctcgccagttgagtctgcccatgaaagtaggcgctgaactgcccaataaatccacaa716
gtaagagttgcaagaaggagccaaaaagggctgagctgaatgactcatatatgaaataat776
ttgataattaatataaataggaaatttaaagtctccagctgagtgacagaaaacacctta836
aaaagctcaagagagaggaaaggaagaaaataaacctataattgca 882
<210> 2
<211> 81
<212> PRT
<213> Homo sapiens
<400> 2
Met Ser Pro Asp Val Arg Phe Leu Leu Leu Leu Leu Leu Leu Pro Leu
1 5 10 15
Arg Arg Pro Val Pro Val Ala Ala Gly Pro Gly Asp Thr Arg Pro Ala
20 25 30
Leu Leu Ser Phe Glu Ala Pro Val Phe Val Pro Thr Leu Thr Pro Gly
35 40 45
Cys Leu Gln Gln Pro Arg Gly Arg Asn Gly Ala Ser Pro Arg Gly Leu
50 55 60
Leu Pro Gln Pro Leu Asp Gly Thr Ala Ala Ser Pro Val Cys His His
65 70 75 80
Val
<210> 3
<211> 234
<212> ONA
<213> Homo Sapiens
<400> 3
atggccagta gncacctggc tcccccttga aacggcctgt ctgccggtgc agctaaacag 60
agctgagaga tgaaggcaca gcatgagccc tgatgtgcgc tttctgctcc tgctcctgct 120
cctgcccctt cggaggcctg tgccagnggg agctgggccc ggagacacca ggccggcact 180
gctctccttc gaggcacccg tgtttgtgcc gacgctgact cccggttgtc tgca 234
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/Z6585
3
<210> 4
<211> 62
<212> PRT
<213> Homo sapiens
<400> 4
Val Pro Ual Ala Ala Gly Pro Gly Asp Thr Arg Pro Ala Leu Leu Ser
1 5 10 15
Phe Glu Ala Pro Ual Phe Ual Pro Thr Leu Thr Pro Gly Cys Leu Gln
20 25 30
Gln Pro Arg Gly Arg Asn Gly Ala Ser Pro Arg Gly Leu Leu Pro Gln
35 40 45
Pro Leu Asp Gly Thr Ala Ala Ser Pro Ual Cys Nis His Ual
50 55 60
<210> 5
<211> 57
<212> PRT
<213> Homo Sapiens
<400> 5
Gly Pro Gly Asp Thr Arg Pro Ala Leu Leu Ser Phe Glu Ala Pro Val
1 5 10 15
Phe Val Pro Thr Leu Thr Pro Gly Cys Leu Gln Gln Pro Arg Gly Arg
20 25 30
Asn Gly Ala Ser Pro Arg Gly Leu Leu Pro Gln Pro Leu Asp Gly Thr
35 40 45
Ala Ala Ser Pro Val Cys His His Ual
50 55
<210> 6
<211> 30
<212> PRT
<213> Homo sapiens
<400> 6
Cys Leu Gln Gln Pro Arg Gly Arg Asn Gly Ala Ser Pro Arg Gly Leu
1 5 10 15
Leu Pro Gln Pro Leu Asp Gly Thr Ala Ala Ser Pro Val Cys
20 25 30
<210> 7
<211> 48
<212> DNA
<213> Homo sapiens
CA 02350621 2001-05-11
WO 00/28030 PCT/US99/26585.
4
<400> 7
gtctgggttc gctactcgag gcggccgcta tttttttttt tttttttt 48
<210> 8
<211> 38
<212> PRT
<213> Homo sapiens
<400> 8
Gly Pro Gly Asp Thr Arg Pro Ala Leu Leu Ser Phe Glu Ala Pro Val
1 5 10 15
Phe Val Pro Thr Leu Thr Pro Gly Cys Leu Gln Gln Pro Arg Gly Arg
20 25 30
Asn Gly Ala Ser Pro Arg
<210> 9
<211> 25
<212> PRT
<213> Homo sapiens
<400> 9
Gln Gln Pro Arg Gly Arg Asn Gly Ala Ser Pro Arg Gly Leu Leu Pro
1 5 10 15
Gln Pro Leu Asp Gly Thr Ala Ala Ser
20 25
<210> 10
<211> 51
<212> PRT
<213> Homo sapiens
<400> 10
Gly Pro Gly Asp Thr Arg Pro Ala Leu Leu Ser Phe Glu Ala Pro Val
1 5 10 15
Phe Val Pro Thr Leu Thr Pro Gly Cys Leu Gln Gln Pro Arg Gly Arg
20 25 30
Asn Gly Ala Ser Pro Arg Gly Leu Leu Pro Gln Pro Leu Asp Gly Thr
35 40 45
Ala Ala Ser
