Note: Descriptions are shown in the official language in which they were submitted.
CA 02351167 2001-05-10
WO OO/Z8033 PCT/US99/26'788 -
NOVEL DNAs AND POLYPEPTIDES
Reference to Related Application
This application claims the benefit of U.S. Provisional Application S.N.
60/107,821;
filed November 10, 1998, which is incorporated herein by reference.
BACKGROUND OF THE INVFNTION
Field of the Invention
The invention is directed to purified and isolated novel polypeptide molecules
and
fragments thereof, the nucleic acid molecules encoding such polypeptides,
processes for
production of recombinant forms of such polypeptide molecules, antibodies
generated against
such polypeptide molecules, fragmented peptides derived from these polypeptide
molecules,
and uses thereof. In particular, the invention is directed to the use of the
nucleic acid and
polypeptide molecules in the study of inflammatory bowel diseases (1BD)
Description of Related Art
Damage to the intestinal epithelial barrier is a hallmark of inflammatory
bowel
diseases (IBD). Examples of inflammatory bowel diseases include ileitis,
Crohn's disease (CD),
which can affect the whole digestive tract from mouth to anus, and ulcerative
colitis (UC),
which affects only the large intestine. Studying the factors that influence
the integrity of the
epithelial barrier in vivo is a difficult task for a number of reasons that
include the complexity of
the tissue itself (there are numerous cell types in the gut including
epithelial, stromal, endocrine,
neuronal and hematopoietic) and the technical problems associated with tissue
manipulation in
animals or in isolated organs. As a result of these issues, a number of in
vitro models of
epithelial barrier function have been developed over the years. The best
characterized of these
models is the T84 intestinal epithelial barrier system (Dharmsathaphorn et
al., Anr. J. Phvsiol.,
246:6204-6208, 1984 and Madara et al., J. Cell Biol.. 101:2124-2133, 1985).
T84 cells, while
derived from a human colonic adenocarcinoma. have retained many of the
properties associated
with normal colonic crypt cells. T84 cells form polarized monolayers that
exhibit high electrical
resistance and vectorial fluid and chloride secretion reminiscent of colonic
crypts irr vivo. These
properties are directly dependent on a complex of proteins referred to as
tight junctions and T84
cells express many of the known members of this complex (Youakim et al.,
Subnrirred for
CA 02351167 2001-05-10
WO 00/28033 PCTNS99l26788
publication, 1998). These cells also respond to proinflammatory cvtokines,
such as
interferon-gamma (INF-gamma), by decreasing barrier function (Youakim et al.,
Submiued for
publication, 1998; Madara et al., J. Clin. Irrvesr., 83:724-727, 1989; and
Adams et al., J.
Immunol., 150:2356-2363, 1993) and by up-regulating MHC Class II molecules and
antigen
presenting activity (Hershberg et al., J. Clin. Invest., 102:792-803, 1998).
This model system is
used to examine how the epithelial barrier is regulated by various agents such
as
interferon-gamma and cells of the immune system (e.g., neutrophils). The T84
model assists in
the elucidation of the mechanism of barner breakdown and recovery in response
to these agents
and in the identification of proteins (and genes) that may prevent barrier
breakdown or stimulate
1 o barrier recovery.
Given the important function of the epithelial gut barrier and despite the
growing body of
knowledge, there is a need in the art for the discovery, the identification,
and the elucidation of
the roles of new proteins involved in gut barrier function and IBD.
The identification of the primary structure, or sequence, of an unknown
protein is the
t 5 culmination of an arduous process of experimentation. In order to identify
an unknown protein,
the investigator can rely upon a comparison of the unknown protein to known
peptides using a
variety of techniques known to those skilled in the art. For instance,
proteins are routinely
analyzed using techniques such as electrophoresis, sedimentation,
chromatography, sequencing
and mass spectrometry.
2o In particular, comparison of an unknown protein to polypeptides of known
molecular
weight allows a determination of the apparent molecular weight of the unknown
protein (T.D.
Brock and M.T. Madigan, Biology of Microorganisms 76-77 (Prentice HaII, 6d ed.
1991 )).
Protein molecular weight standards are commercially available to assist in the
estimation of
molecular weights of unknown protein (New England Biolabs Inc. Catalog:130-
131, 1995; J. L.
25 Hartley, U.S. Patent No. 5,449,758). However, the molecular weight
standards may not
correspond closely enough in size to the unknown protein to allow an accurate
estimation of
apparent molecular weight. The difficulty in estimation of molecular weight is
compounded in
the case of proteins that are subjected to fragmentation by chemical or
enzymatic means,
modified by post-translational modification or processing, and/or associated
with other proteins
3o in non-covalent complexes.
In addition, the unique nature of the composition of a protein with regard to
its specific
amino acid constituents results in unique positioning of cleavage sites within
the protein.
Specific fragmentation of a protein by chemical or enzymatic cleavage results
in a unique
"peptide fingerprint" (D. W. Cleveland et al., J. Biol. Chem. 252:1102-1106,
1977; M. Brown et
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
al., J. Gen. Y7rol. 50:309-316, 1980). Consequently, cleavage at specific
sites results in
reproducible fragmentation of a given protein into peptides of precise
molecular weights.
Furthermore, these peptides possess unique charge characteristics that
determine the isoelectric
pH of the peptide. These unique characteristics can be exploited using a
variety of
electrophoretic and other techniques (T.D. Brock and M.T. Madigan, Biology of
.~licroorgarrisms 76-77 (Prentice Hall, 6d ed. 1991 )).
Fragmentation of proteins is further employed for amino acid composition
analysis and
protein sequencing (P. Matsudiara, J. Biol. Chem. 262:10035-10038, 1987; C.
Eckerskorn et
al., Electrophoresis 1988, 9:830-838, 1988), particularly the production of
fragments from
to proteins with a "blocked" N-terminus. Iwaddition, fragmented proteins can
be used for
immunization, for affinity selection (R. A. Brown, U.S. Patent No. 5,151,412),
for determination
of modification sites (e.g. phosphorylation), for generation of active
biological compounds (T.D.
Brock and M.T. Madigan, Biologv.~ of Microorganisms 300-30I (Prentice Hall, 6d
ed. 1991 )),
and for differentiation of homologous proteins (M. Brown et al., J. Gerr.
Virol. 50:309-316,
t 5 1980).
In addition, when a peptide fingerprint of an unknown protein is obtained, it
can be
compared to a database of known proteins to assist in the identification of
the unknown protein
using mass spectrometry (W.J. Henzel et al., Proc. Natl. Acad. Sci. USA
90:5011-5015, 1993; D.
Fenyo et al., Electrophoresis 19:998-1005, I998). A variety of computer
software programs to
2o facilitate these comparisons are accessible via the Internet, such as
Protein Prospector (Internet
site: prospector.uscf.edu), MultiIdent (Internet site:
www.expasy.ch/sprot/multiident.htmI),
PeptideSearch (Internet site: www.mann.embl-
heiedelberg.de...deSearch/FR_PeptideSearch
Form.html), and ProFound (Internet site: www.chait-sgi.rockefeller.edu/cgi-
bin/prot-id-
frag.html). These programs allow the user to specify the cleavage agent and
the molecular
2~ weights of the fragmented peptides within a designated tolerance. The
programs compare these
molecular weights to protein molecular weight information stored in databases
to assist in
determining the identity of the unknown protein. Accurate information
concerning the number
of fragmented peptides and the precise molecular weight of those peptides is
required for
accurate identification. Therefore, increasing the accuracy in determining the
number of
3o fragmented peptides and their molecular weight should result in enhanced
likelihood of success
in the identification of unknown proteins.
In addition, peptide digests of unknown proteins can be sequenced using tandem
mass
spectrometry (MS/MS), and the resulting sequence searched against databases
(J.K. Eng, et al.,
J. .~nr. Soc. A~ass Spec. 5:976-989 (1994); M. Mann and M. Wilm, Arral.
Cherry. 66:4390-4399
-3-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26~88
( I994); J.A. Taylor and R.S. Johnson, Rapid Comm. Mass Spec. 11:1067-1075 (
1997)}.
Searching programs that can be used in this process exist on the Internet,
such as Lutefisk 97
(Internet site: www.lsbc.com:70/Lutefisk97.htm1), and the Protein Prospector,
Peptide Search
and ProFound programs described above. Therefore, adding the sequence of a
gene and its
s predicted protein sequence and peptide fragments to a sequence database can
aid in the
identification of unknown proteins using tandem mass spectrometry.
Thus, there also exists a need in the art for polypeptides suitable for use in
peptide
fragmentation studies, preferably, polypeptides that have altered expression
in irritable bowel
diseases, for use in molecular weight measurements, and for use in protein
sequencing using
to tandem mass spectrometry.
SUMMARY OF THE INVENTION
Using the T84 model, it was determined that certain polypeptides have altered
(up-
regulated or down-regulated) expression patterns in response to INF-gamma.
Such molecules
15 may have a role in gut barner function and IBD and may be useful as
potential therapeutic
agents in the treatment of IBD and other gut pathologies. The invention aids
in fulfilling these
needs in the art by providing isolated nucleic acids and polypeptides encoded
by these nucleic
acids that have altered expression characteristics in the T84 gut barner
model. Particular
embodiments of the invention are directed to isolated nucleic acid molecules
comprising the
2o DNA sequences of SEQ ID NOs:I-26 and isolated nucleic acid molecules
encoding the amino
acid sequences of SEQ ID NOs:27-38, as well as nucleic acid molecules
complementary to these
sequences. Both single-stranded and double-stranded RNA and DNA nucleic acid
molecules are
encompassed by the invention, as well as nucleic acid molecules that hybridize
to a denatured,
double-stranded DNA comprising all or a portion of SEQ ID NOs:I-26 and/or the
DNA that
25 encodes the amino acid sequences of SEQ ID NOs:27-38. Also encompassed are
isolated
nucleic acid molecules that are derived by in vitro mutagenesis from nucleic
acid molecules
comprising sequences of SEQ ID NOs:I-26, that are degenerate from nucleic acid
molecules
comprising sequences of SEQ ID NOs:I-26, and that are allelic variants of DNA
of the
invention. The invention also encompasses recombinant vectors that direct the
expression of
3o these nucleic acid molecules and host cells transformed or transfected with
these vectors.
In another embodiment, the invention provides an isolated nucleic acid
molecule
comprising a polynucleotide having a nucleotide sequence at least 80%,
preferable 85%, more
preferably 90%, optimally 95%, identical to a sequence of a polynucleotide
selected from the
group consisting of:
-4-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
(a) a polynucleotide fragment of SEQ ID NO:1-26 or a polynucleotide which is
hybridizable to SEQ ID NO:1-26;
(b) a polynucleotide encoding a polypeptide fragment of a translation of SEQ
ID NO: I-
26 or a poiypeptide fragment encoded by the cDNA sequence which is
hybridizable to SEQ B7
NO:1-26;
(c) a polynucleotide encoding a polypeptide epitope of a translation of SEQ ID
NO: 1-
26 or a polypeptide epitope encoded by a cDNA sequence which is hybridizable
to SEQ ID
NO:1-26;
(e) a polynucleotide encoding a polypeptide of a translation of SEQ ID NO: I-
26,
0 having biological activity;
(f) a polynucleotide which is a variant of SEQ ID NO:1-26;
(g) a polynucleotide which is an allelic variant of SEQ ID NO:I-26;
(h) a polynucleotide which encodes a species homologue of a translation of SEQ
ID
NO: 1-26;
(i) a polynucleotide capable of hybridizing under stringent conditions to any
one of the polynucleotides specified in (a)-(h), wherein said polynucleotide
does not hybridize
under stringent conditions to a nucleic acid molecule having a nucleotide
sequence of only A
residues or of only T residues.
In another embodiment, the invention provides an isolated nucleic acid
molecule
2o comprising a polynucleotide having a nucleotide sequence at least 80%,
preferable 85%, more
preferably 90%, optimally 95%, identical to a sequence of a polynucleotide
selected from the
group consisting of:
(a) a polynucleotide fragment of SEQ ID NO:1-10 or a polynucleotide which is
hybridizable to SEQ ID NO:1-10;
(b) a polynucleotide encoding a polypeptide fragment of a translation of SEQ
ID NO: 1-
10 or a poiypeptide fragment encoded by the cDNA sequence which is
hybridizable to SEQ ID
NO:1-10;
(c) a polynucleotide encoding a polypeptide epitope of a translation of SEQ ID
NO: 1-
10 or a polypeptide epitope encoded by a cDNA sequence which is hybridizable
to SEQ ID
3o NO:1-10;
(e) a polynucleotide encoding a polypeptide of a translation of SEQ ID NO: 1-
10,
having biological activity;
(fj a polynucleotide which is a variant of SEQ ID NO:1-10;
(g) a polynucleotide which is an allelic variant of SEQ ID NO:1-10;
-5-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
(h) a polynucleotide which encodes a species homologue of a translation of SEQ
ID
NO: 1-10;
(i) a polynucleotide capable of hybridizing under stringent conditions to any
one of the polynucleotides specified in (a)-(h), wherein said polynucleotide
does not hybridize
a under stringent conditions to a nucleic acid molecule having a nucleotide
sequence of only A
residues or of only T residues.
In another embodiment, the invention provides an isolated nucleic acid
molecule
comprising a polynucleotide having a nucleotide sequence at least 80%,
preferable 85%, more
preferably 90%, optimally 95%, identical to a sequence of a polynucleotide
selected from the
1 o group consisting of
(a) a polynucleotide fragment of SEQ ID NO:11-26 or a polynucleotide which is
hybridizable to SEQ ID NO:11-26;
(b) a polynucleotide encoding a polypeptide fragment of a translation of SEQ
ID NO:
11-26 or a polypeptide fragment encoded by the cDNA sequence which is
hybridizable to SEQ
15 ID NO:11-26;
(c) a polynucleotide encoding a polypeptide epitope of a translation of SEQ ID
NO: 11-
26 or a polypeptide epitope encoded by a cDNA sequence which is hybridizable
to SEQ ID
NO:11-26;
(e) a poIynucleotide encoding a polypeptide of a translation of SEQ ID NO: 1 I-
26,
20 having biological activity;
(f) a polynucleotide which is a variant of SEQ ID NO:11-26;
(g) a polynucleotide which is an allelic variant of SEQ ID NO:11-26;
(h) a polynucleotide which encodes a species homologue of a translation of SEQ
ID
NO: 11-26;
25 (i) a poiynucleotide capable of hybridizing under stringent conditions to
any
one of the polynucleotides specified in (a)-(h), wherein said polynucleotide
does not hybridize
under stringent conditions to a nucleic acid molecule having a nucleotide
sequence of only A
residues or of only T residues.
In one embodiment, the isolated nucleic acid molecule comprises a nucleotide
sequence
3o encoding a secreted protein. In preferred embodiments, the isolated nucleic
acid molecule
comprises a nucleotide sequence encoding a polypeptide chosen from the group
consisting of:
(a) a polypeptide having the polypeptide sequence identified as a translation
of
SEQ ID NO: 1-26;
(b) a polypeptide having the polypepiide sequence of SEQ ID NO: 27-38; and
-6-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
(c) a polypeptide encoded by the cDNA which is hybridizable to SEQ ID NO:1-26.
Typically, the isolated nucleic acid molecule comprises the entire nucleotide
sequence of SEQ
ID NO:1-26 or a cDNA sequence which is hybridizable to SEQ ID NO:1-26.
Typically the
isolated nucleic acid molecule comprises sequential nucleotide deletions from
portions of the
nucleotide sequence encoding either the C-terminus or the N-terminus of the
polypeptide.
In other aspects, the invention provides a recombinant vector comprising the
isolated
nucleic acid molecule and a method of making a recombinant host cell
comprising the isolated
nucleic acid molecule and the recombinant host cell produced by such a method.
t o In other preferred embodiments, the invention provides an isolated
polypeptide having
an amino acid sequence at least 80%, preferably of leasst 85%, more preferably
at least 90%
identical to the sequence of a polypeptide selected from the group consisting
of
(a) a polypeptide fragment of a polypeptide encoded by a polynucleotide of SEQ
ID
NO: 1-26;
is (b) a polypeptide having the sequence of SEQ ID NO: 27-38;
(c) a polypeptide domain of a polypeptide encoded by a polynucleotide of SEQ
ID NO:
1-26;
(d) a polypeptide epitope of a polypeptide encoded by a polynucleotide of SEQ
ID NO:
1-26;
20 (e) a secreted form of a polypeptide encoded by a polynucleotide of SEQ ID
NO: 1-26;
(f) a full length protein of a polypeptide encoded by a polynucleotide of SEQ
ID NO: 1-
26;
(g) a variant of a polypeptide encoded by a polynucleotide of SEQ ID NO: 1-26;
(h) an allelic variant of a polypeptide encoded by a polynucleotide of SEQ ID
NO: 1-26;
25 and
(i) a species homologue of a polypeptide encoded by a polynucleotide of SEQ ID
NO:
1-26.
In some embodiments, the full length polypeptide comprises sequential amino
acid
3o deletions from the C-terminus. In other embodiments, the mature polypeptide
comprises
sequential amino acid deletions from the C-terminus. Alternatively, the full
length polvpeptide
can comprise sequential amino acid deletions from the N-terminus or the mature
polypeptide can
comprise sequential amino acid deletions from the N-terminus.
_7_
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
In other aspects. the invention provides an isolated antibody that binds
specifically to the
isolated polypeptide, a recombinant host cell that expresses the isolated
polypeptide, and a
method of making an isolated polypeptide comprising culturing the recombinant
host cell under
conditions such that said polypeptide is expressed; and recovering said
poiypeptide.
The invention in another embodiment is a method for preventing, treating, or
ameliorating irritable bowel discorders, comprising administering to a
mammalian subject a
therapeutically effective amount of the isolated polypeptide or the isolated
nucleic acid
molecule. In another embodiment, the invention provides a method of diagnosing
an irritable
to bowel disease or a susceptibility to irritable bowel disease in a subject
comprising: determining
the presence or absence of a mutation in the isolayed nucleic acid molecule,
and diagnosing an
irritable bowel disease or a susceptibility to irritable bowel disease based
on the presence or
absence of said mutation. Alternatively, irritable bowel disease or a
susceptibility to irritable
bowel disease in a subject can be diagnosed by a method comprising:
determining the presence
t 5 or amount of expression of the polypeptide in a biological sample; and
diagnosing irntable
bowel disease or a susceptibility to irritable bowel disease based on the
presence or amount of
expression of the polypeptide.
Typically, a binding partner of the polypeptide is identified by contacting
the
polypeptide with a binding partner; and determining whether the binding
partner affects a
20 physical property or an activity of the polypeptide. Typically activity in
a biological assay of a
secreted polypeptide is identified by expressing the polynucleotide of SEQ ID
NO:1-26 in a
cell; isolating the supernatant; detecting an activity in a biological assay;
and identifying the
polypeptide in the supernatant having the activity.
25 In addition, the invention encompasses methods of using the nucleic acids
noted above to
identify nucleic acids encoding proteins homologous to SEQ ID NOs:27-38; to
identify human
chromosomes that contain the nucleotide sequences of the invention; to map
genes near the
nucleotide sequences of the invention on human chromosomes; and to identify
genes associated
with certain diseases, syndromes, or other human conditions associated with
human
3o chromosomes containing sequences of the invention.
For example, four of the nucleotide sequences of the invention, IMX4 and
IMX56,
IMX21, and IMX44 are located on chromosomes 22, 22, 7, and 19, respectively
(IMX4 and
IMX56 are both located on chromosome 22). Thus, the above-named nucleotide
sequences
(IMX4, IMX56, IMX21, and IMX44) can be used to identify human chromosome
numbers 22,
_g_
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
7, and 19: to map genes on human chromosome numbers 22, 7, and i 9; and to
identify genes
associated with certain diseases, syndromes, or other human conditions
associated with human
chromosome numbers 22, 7, and 19.
The invention also encompasses the use of sense or antisense oligonucleotides
from the
nucleic acids of SEQ ID NOs: l-26 to inhibit the expression of the
polynucleotides encoded by
the nucleotide sequences of the invention.
The invention also encompasses isolated polypeptides and fragments thereof
encoded by
these nucleic acid molecules including soluble polypeptide portions of SEQ ID
NOs:27-38. The
invention further encompasses methods for the production of these
polypeptides, including
culturing a host cell under conditions promoting expression and recovering the
polypeptide from
the culture medium if it is secreted or from cultured cells if it is not
secreted. Especially, the
expression of these polypeptides in bacteria, yeast, plant, insect, and animal
cells is
encompassed by the invention.
In addition, the invention includes assays utilizing these polypeptides, to
screen for
is potential inhibitors of activity associated with polypeptide counter-
structure molecules, and
methods of using these polypeptides as therapeutic agents for the treatment of
diseases mediated
by polypeptide counter-structure molecules. Further, methods of using these
polypeptides in the
design of inhibitors thereof are also an aspect of the invention.
The invention further includes a method for using these polypeptides as
molecular
20 weight markers that allow the estimation of the molecular weight of a
protein or a fragmented
protein, as well as a method for the visualization of the molecular weight
markers of the
invention thereof using electrophoresis. The invention further encompasses
methods for using
the polypeptides of the invention as markers for determining the isoelectric
point of an unknown
protein, as well as controls for establishing the extent of fragmentation of a
protein.
25 Further encompassed by this invention are kits to aid in these
determinations.
Further encompassed by this invention is the use of the IMX nucleic acid
sequences,
predicted amino acid sequences of the polypeptide or fragments thereof, or a
combination of the
predicted amino acid sequences of the polypeptides and fragments thereof for
use in searching
an electronic database to aid in the identification of sample nucleic acids
and/or proteins.
3o The invention also encompasses IMX polypeptides and the use of these
polypeptides as
research reagents to further study gut epithelial barrier function and
regulation and therapeutic
reagents to treat inflammatory bowel disease and other gut pathologies.
-9-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Isolated polyclonal or monoclonal antibodies that bind to these polypeptides
are also
encompassed by the invention, in addition the use of these antibodies to aid
in purifying IMX
polypeptides.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure I presents the nucleotide sequence of IMX 4 (SEQ ID NO: 1 ).
Figure 2 presents the nucleotide sequence of IMX I O (SEQ ID NO: 14).
Figure 3 presents the nucleotide sequence of IMX 21 (SEQ ID NO: 15).
Figure 4 presents the nucleotide sequence of IMX 28 (SEQ ID NO: 16).
t0 Figure 5 presents the nucleotide sequence of IMX 32 (SEQ ID NO: I7).
Figure 6 presents the nucleotide sequence of IMX 39 (SEQ ID NO: 20).
Figure 7 presents the nucleotide sequence of IMX 40 (SEQ ID NO: 7).
Figure 8 presents the nucleotide sequence of IMX 42 (SEQ ID NO: 8).
Figure 9 presents the nucleotide sequence of IMX 44 (SEQ ID NO: 23).
Figure 10 presents the nucleotide sequence of IMX 56 (SEQ ID NO: 10).
Figure 11 presents the amino acid sequence of IMX 4 (SEQ ID NO: 27).
Figure 12 presents the amino acid sequence of IMX 10 (SEQ ID NO: 28}.
Figure 13 presents the amino acid sequence of IMX 21 (SEQ ID NO: 29).
Figure 14 presents the amino acid sequence of IMX 28 (SEQ ID NO: 30).
Figure 1 S presents the amino acid sequence of IMX 32 {SEQ ID NO: 32).
Figure 16 presents the amino acid sequence of IMX 39 (SEQ ID NO: 33}.
Figure 17 presents the amino acid sequence of IMX 40 (SEQ ID NO: 34).
Figure 18 presents the amino acid sequence of IMX 42 (SEQ ID NO: 35).
Figure 19 presents the amino acid sequence of IMX 44 (SEQ ID NO: 37).
Figure 20 presents the amino acid sequence of IMX 56 (SEQ ID NO: 38).
Figure 21 presents the nucleotide sequence of the 5' end of the clone (SEQ ID
NO:I3)
matched to part of the human ApoL gene (AF019225).
Figure 22 presents comparison of the 5' end of the clone suggests it
represents an
alternative splice product to reported ApoL, i.., bases 1-168 match to 2
e~cons on PAC carrying
the ApoL gene but are not included in the reported complete cDNA.
- 10-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
DETAILED DESCRIPTION OF THE INVENT10N
Definitions
The following definitions are provided to facilitate understanding of certain
terms used
throughout this specification.
In the present invention, "isolated" refers to material removed from its
original
environment (e.g., the natural environment if it is naturally occurring), and
thus is altered "by the
hand of man" from its natural state. For example, an isolated polynucleotide
could be part of a
vector or a composition of matter, or could be contained within a cell, and
still be "isolated"
1o because that vector, composition of matter, or particular cell is not the
original environment of
the polynucleotide.
In the present invention, a "secreted" protein refers to those proteins
capable of being
directed to the ER, secretory vesicles, or the extracellular space as a result
of a signal sequence,
as well as those proteins released into the extracellular space without
necessarily containing a
15 signal sequence. If the secreted protein is released into the extracellular
space, the secreted
protein can undergo extracellular processing to produce a "mature" protein.
Release into the
extracellular space can occur by many mechanisms, including exocytosis and
proteolytic
cleavage.
As used herein, a "polynucleotide" refers to a molecule having a nucleic acid
sequence
2o contained in SEQ ID NO:1-26. For example, the polynucleotide can contain
all or part of the
nucleotide sequence of the full length cDNA sequence, including the S' and 3'
untranslated
sequences, the coding region, with or without the signal sequence, the
secreted protein coding
region, as well as fragments, epitopes, domains, and variants of the nucleic
acid sequence.
Moreover, as used herein, a "polypeptide" refers to a molecule having the
translated amino acid
25 sequence generated from the polynucleotide as broadly defined.
A "polynucleotide" of the present invention also includes those
polynucleotides capable
of hybridizing, under stringent hybridization conditions, to sequences
contained in SEQ ID
NO:1-26, or the complement thereof, or the cDNA. "Stringent hybridization
conditions" refers
to an overnight incubation at 42° C in a solution comprising 50%
formamide, Sx SSC (750 mM
3o NaCI, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), Sx Denhardt's
solution, 10%
dextran sulfate, and 20 pg/ml denatured, sheared salmon sperm DNA, followed by
washing the
filters in 0.1 x SSC at about 65°C.
Also contemplated are nucleic acid molecules that hybridize to the
polynucleotides of the
present invention at lower stringency hybridization conditions. Changes in the
stringency of
-11-
CA 02351167 2001-05-10
WO 08/28033 PCT/US99/26788
hybridization and signal detection are primarily accomplished through the
manipulation of
formamide concentration (lower percentages of fonmamide result in lowered
stringency); salt
conditions, or temperature. For example, lower stringency conditions include
an overnight
incubation at 37°C in a solution comprising 6X SSPE (20X SSPE = 3M
NaCI; 0.2M NaHzPOa;
0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 ug/ml salmon sperm blocking
DNA;
followed by washes at 50°C with 1 XSSPE, 0.1 % SDS. In addition, to
achieve even lower
stringency, washes performed following stringent hybridization can be done at
higher salt
concentrarions (e.g. SX SSC).
Note that variations in the above conditions may be accomplished through the
inclusion
to and/or substitution of alternate blocking reagents used to suppress
background in hybridization
experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO,
heparin,
denatured salmon sperm DNA, and commercially available proprietary
formulations. The
inclusion of specific blocking reagents may require modification of the
hybridization conditions
described above, due to problems with compatibility.
15 Of course, a polynucleotide which hybridizes only to polyA+ sequences (such
as any 3'
terminal polyA+ tract of a cDNA shown in the sequence listing), or to a
complementary stretch
of T (or U) residues, would not be included in the definition of
"polynucleotide," since such a
polynucleotide would hybridize to any nucleic acid molecule containing a poly
(A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA clone).
20 The polynucleotide of the present invention can be composed of any
polyribonucleotide
or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA
or DNA.
For example, polynucleotides can be composed of single- and double-stranded
DNA, DNA that
is a mixture of single- and double-stranded regions, single- and double-
stranded RNA, and RNA
that is mixture of single- and double-stranded regions, hybrid molecules
comprising DNA and
25 RNA that may be single-stranded or, more typically, double-stranded or a
mixture of single- and
double-stranded regions. In addition, the polvnucleotide can be composed of
triple-stranded
regions comprising RNA or DNA or both RNA and DNA. A polynucleotide may also
contain
one or more modified bases or DNA or RNA backbones modified for stability or
for other
reasons. "Modified" bases include, for example, tritylated bases and unusual
bases such as
30 inosine. A variety of modifications can be made to DNA and RNA; thus,
"polynucleotide"
embraces chemically, enzymatically, or metabolically modified forms.
The polypeptide of the present invention can be composed of amino acids joined
to each
other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. and
may contain amino
acids other than the 20 gene-encoded amino acids. The polypeptides may be
modified by either
- I2-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
natural processes, such as posttranslational processing, or by chemical
modification techniques
which are well known in the art. Such modifications are well described in
basic texts and in
more detailed monographs, as well as in a voluminous research literature.
Modifications can
occur anywhere in a polypeptide, including the peptide backbone, the amino
acid side-chains
and the amino or carboxyl termini. It will be appreciated that the same type
of modification may
be present in the same or varying degrees at several sites in a given
polypeptide. Also, a given
polypeptide may contain many types of modifications. Polypeptides may be
branched, for
example, as a result of ubiquitination, and they may be cyclic, with or
without branching.
Cyclic, branched, and branched cyclic polypeptides may result from
posttranslation natural
to processes or may be made by synthetic methods. Modifications include
acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin, covalent
attachment of a heme
moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent
attachment of a
lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-
linking, cyclization,
disulfide bond formation, demethylation, formation of covalent cross-links,
formation of
cysteine, formation of pyroglutamate, formulation, gamma-carboxylation,
glycosylation, GPI
anchor formation, hydroxylation, iodination, methylation, myristoylation,
oxidation, pegylation,
proteolytic processing, phosphorylation, prenylation, racemization,
selenoylation, sulfation,
transfer-RNA mediated addition of amino acids to proteins such as
arginylation, and
ubiquitination. (See, for instance, PROTEINS - STRUCTURE AND MOLECULAR
2o PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (
1993);
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed.,
Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol
182:626-646 (1990);
Rattan et al., Ann NY Acad Sci 663:48-62 (1992).)
"A polypeptide having biological activity" refers to polypeptides exhibiting
activity
similar, but not necessarily identical to, an activity of a polypeptide of the
present invention,
including mature forms, as measured in a particular biological assay, with or
without dose
dependency. In the case where dose dependency does exist, it need not be
identical to that of the
polypeptide, but rather substantially similar to the dose-dependence in a
given activity as
compared to the polypeptide of the present invention (i.e., the candidate
polypeptide will exhibit
3o greater activity or not more than about 25-fold less and, preferably, not
more than about tenfold
less activity, and most preferably, not more than about three-fold less
activity relative to the
poiypeptide of the present invention.).
The translated amino acid sequence, beginning with the methionine, is
identified
although other reading frames can also be easily translated using known
molecular biology
13-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/Z6788
techniques. The polypeptides produced by the translation of these alternative
open reading
frames are specificaIiy contemplated by the present invention.
SEQ )D NO:1-26 and the translations ofSEQ ID NO: 1-26 as well as SEQ ID N0:27-
38
are sufficiently accurate and otherwise suitable for a variety of uses well
known in the art and
described further below. These probes will also hybridize to nucleic acid
molecules in biological
samples, thereby enabling a variety of forensic and diagnostic methods of the
invention.
Similarly, polypeptides identified from the translations of SEQ ID NO:1-26 may
be used to
generate antibodies which bind specifically to the secreted proteins encoded
by the cDNA clones
identified.
1o Nevertheless, DNA sequences generated by sequencing reactions can contain
sequencing
errors. The errors exist as misidentified nucleotides, or as insertions or
deletions of nucleotides
in the generated DNA sequence. The erroneously inserted or deleted nucleotides
cause frame
shifts in the reading frames of the predicted amino acid sequence. In these
cases, the predicted
amino acid sequence diverges from the actual amino acid sequence, even though
the generated
I5 DNA sequence may be greater than 99.9% identical to the actual DNA sequence
(for example,
one base insertion or deletion in an open reading frame of over 1000 bases).
The present invention also relates to the genes corresponding to SEQ ID NO:l-
26, and
translations of SEQ ID NO:1-26. The corresponding gene can be isolated in
accordance with
known methods using the sequence information disclosed herein. Such methods
include
2o preparing probes or primers from the disclosed sequence and identifying or
amplifying the
corresponding gene from appropriate sources of genomic material.
Also provided in the present invention are species homologues. Species
homoiogues
may be isolated and identified by making suitable probes or primers from the
sequences
provided herein and screening a suitable nucleic acid source for the desired
homologue.
25 The polypeptides of the invention can be prepared in any suitable manner.
Such
polypeptides include isolated naturally occurring polypeptides, recombinantly
produced
polypeptides, synthetically produced polypeptides, or polypeptides produced by
a combination
of these methods. Means for preparing such polypeptides are well understood in
the art.
The polypeptides may be in the form of the secreted protein, including the
mature form,
30 or may be a part of a larger protein, such as a fusion protein (see below).
It is often
advantageous to include an additional amino acid sequence which contains
secretory or leader
sequences, pro-sequences, sequences which aid in purification, such as
multiple histidine
residues, or an additional sequence for stability during recombinant
production.
The polypeptides of the present invention are preferably provided in an
isolated form,
- 14-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
and preferably are substantially purified. A recombinantly produced version of
a polvpeptide.
including the secreted polypeptide, can be substantially purified by the one-
step method
described in Smith and Johnson, Gene 67:3I-40 (1988). Polypeptides of the
invention also can
be purified from natural or recombinant sources using antibodies of the
invention raised against
the secreted protein in methods which are well known in the art.
Signal Seguences
Methods for predicting whether a protein has a signal sequence, as well as the
cleavage
point for that sequence, are available. For instance, the method of McGeoch,
Virus Res. 3:271-
286 ( 1985), uses the information from a short N-terminal charged region and a
subsequent
uncharged region of the complete (uncleaved) protein. The method of von
Heinje, Nucleic
Acids Res. 14:4683-4690 (1986) uses the information from the residues
surrounding the
cleavage site, typically residues -13 to +2, where +I indicates the amino
terminus of the secreted
protein. Therefore, from a deduced amino acid sequence, a signal sequence and
mature
1 ~ sequence can be identified.
Polvnucleotide and Polvneptide Variants
"Variant" refers to a polynucleotide or polypeptide differing from the
polynucleotide or
polypeptide of the present invention, but retaining essential properties
thereof. Generally,
variants are overall closely similar, and, in many regions, identical to the
polynucleotide or
polypeptide of the present invention.
Further embodiments of the present invention include polynucleotides having at
least
80% identity, more preferably at least 90% identity, and most preferably at
least 95%, 96%,
97%, 98% or 99% identity to a sequence contained in SEQ ID NO:1-26. Of course,
due to the
2s degeneracy of the genetic code, one of ordinary skill in the art will
immediately recognize that a
large number of the polynucleotides having at least 85%, 90%, 95%, 96%, 97%,
98%, or 99%
identity will encode a polypeptide identical to an amino acid sequence
contained in the
translations of SEQ ID NO:1-26.
Similarly, by a polypeptide having an amino acid sequence having at least, for
example,
.0 95% "identity" to a reference polypeptide, is intended that the amino acid
sequence of the
polypeptide is identical to the reference polypeptide except that the
polypeptide sequence may
include up to five amino acid alterations per each 100 amino acids of the
total length of the
reference polypeptide. In other words, to obtain a polypeptide having an amino
acid sequence at
least 95% identical to a reference amino acid sequence, up to S% of the amino
acid residues in
-15-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
the reference sequence may be deleted or substituted with another amino acid,
or a number of
amino acids up to 5% of the total amino acid residues in the reference
sequence may be inserted
into the reference sequence. These alterations of the reference sequence may
occur at the amino
or carboxy terminal positions of the reference amino acid sequence or anywhere
between those
terminal positions, interspersed either individually among residues in the
reference sequence or
in one or more contiguous groups within the reference sequence.
Further embodiments of the present invention include polypeptides having at
least 80%
identity, more preferably at least 85% identity, more preferably at least 90%
identity, and most
preferably at least 95%, 96%, 97%, 98% or 99% identity to an amino acid
sequence contained
l0 in translations of SEQ ID NO: 1-26. Preferably, the above polypeptides
should exhibit at least
one biological activity of the protein.
In a preferred embodiment, polypeptides of the present invention include
polypeptides
having at least 90% similarity, more preferably at Ieast 95% similarity, and
still more preferably
at least 96%, 97%, 98%, or 99% similarity to an amino acid sequence contained
in translations
of SEQ ID NO:1-26 as well as the amino acid sequences of SEQ ID N0:27-38.
The variants may contain alterations in the coding regions, non-coding
regions, or both.
Especially preferred are polynucleotide variants containing alterations which
produce silent
substitutions, additions, or deletions, but do not alter the properties or
activities of the encoded
polypeptide. Nucleotide variants produced by silent substitutions due to the
degeneracy of the
2o genetic code are preferred. Moreover, variants in which 5-10, 1-5, or 1-2
amino acids are
substituted, deleted, or added in any combination are also preferred.
Polynucleotide variants can
be produced for a variety of reasons, e.g., to optimize codon expression for a
particular host
(change codons in the human mRNA to those preferred by a bacterial host such
as E. coli).
Naturally occurring variants are called "allelic variants," and refer to one
of several
alternate forms of a gene occupying a given locus on a chromosome of an
organism. (Genes II,
Lewin, B., ed., John Wiley & Sons, New York ( 1985).) These allelic variants
can vary at either
the polynucleotide and/or polypeptide level. Alternatively, non-naturally
occurring variants may
be produced by mutagenesis techniques or by direct synthesis.
Using known methods of protein engineering and recombinant DNA technology,
~~ariants may be generated to improve or alter the characteristics of the
polypeptides of the
present invention. For instance, one or more amino acids can be deleted from
the N-terminus or
C-terminus of the secreted protein without substantial loss of biological
function. The authors of
Ron et al., J. Biol. Chem. 268: 2984-2988 (1993) reported variant KGF proteins
having heparin
binding activity even after deleting 3, 8, or 27 amino-terminal amino acid
residues. Similarly,
- 16-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Interferon gamma exhibited up to ten times higher activity after deleting 8-10
amino acid
residues from the carboxy terminus of this protein. (Dobeli et al., J.
Biotechnology 7:199-216
( 1988).)
Moreover, ample evidence demonstrates that variants often retain a biological
activity
similar to that of the naturally occurring protein. For example, Gayle and
coworkers (J. Biol.
Chem 268:22105-22111 (1993)) conducted extensive mutational analysis of human
cytokine IL-
1 a. They used random mutagenesis to generate over 3,500 individual IL- 1 a
mutants that
averaged 2.5 amino acid changes per variant over the entire length of the
molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that
to "[m]ost of the molecule could be altered with little effect on either
[binding or biological
activity]." (See Gayle et al., (1993), Abstract.) In fact, only 23 unique
amino acid sequences, out
of more than 3,500 nucleotide sequences examined, produced a protein that
significantly
differed in activity from wild-type.
Furthermore, even if deleting one or more amino acids from the N-terminus or C-
is terminus of a polypeptide results in modification or loss of one or more
biological functions,
other biological activities may still be retained. For example, the ability of
a deletion variant to
induce and/or to bind antibodies which recognize the secreted form will likely
be retained when
less than the majority of the residues of the secreted form are removed from
the N-terminus or
C-terminus. Whether a particular polypeptide lacking N- or C-terminal residues
of a protein
20 retains such immunogenic activities can readily be determined by routine
methods described
herein and otherwise known in the art.
Thus, the invention further includes polypeptide variants which show
substantial
biological activity. Such variants include deletions, insertions, inversions,
repeats, and
substitutions selected according to general rules known in the art so as have
little effect on
35 activity. For example, guidance concerning how to make phenotypically
silent amino acid
substitutions is provided in Bowie, J. U. et al., Science 247:1306-1310 (
1990), wherein the
authors indicate that there are two main strategies for studying the tolerance
of an amino acid
sequence to change. As the authors state, these two strategies, natural
selection and genetic
engineering, have revealed that proteins are surprisingly tolerant of amino
acid substitutions.
3o The authors further indicate which amino acid changes are likely to be
permissive at certain
amino acid positions in the protein. For example, most buried (within the
tertiary structure of
the protein) amino acid residues require nonpolar side chains, whereas few
features of surface
side chains are generally conserved. Moreover, tolerated conservative amino
acid substitutions
involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu
and Ile;
- 17-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
replacement of the hydroxyl residues Ser and Thr: replacement of the acidic
residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of the basic
residues Lys, Arg,
and His; replacement of the aromatic residues Phe, Tyr, and Trp, and
replacement of the small-
sized amino acids Ala, Ser, Thr, Met, and Gly.
Besides conservative amino acid substitution, variants of the present
invention include (i)
substitutions with one or more of the non-conserved amino acid residues, where
the substituted
amino acid residues may or may not be one encoded by the genetic code, or (ii)
substitution with
one or more of amino acid residues having a substituent group, or (iii) fusion
of the mature
polypeptide with another compound, such as a compound to increase the
stability and/or
to solubility of the polypeptide (for example; polyethylene glycol), or (iv)
fusion of the polypeptide
with additional amino acids, such as an IgG Fc fusion region peptide, or
leader or secretory
sequence, or a sequence facilitating purification. Such variant polypeptides
are deemed to be
within the scope of those skilled in the art from the teachings herein.
For example, polypeptide variants containing amino acid substitutions of
charged amino
is acids with other charged or neutral amino acids may produce proteins with
improved
characteristics, such as less aggregation. Aggregation of pharmaceutical
formulations both
reduces activity and increases clearance due to the aggregate's immunogenic
activity. (Pinckard
et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-
845 (1987);
Cleland et al., Crit. Rev. Therapeutic Drug Cattier Systems 10:307-377
(1993).)
Polvnucleotide and Polvpeptide Fragments
In the present invention, a "polynucieotide fragment" refers to a short
polynucleotide
having a nucleic acid sequence contained in that shown in SEQ ID NO:1-26. The
short
nucleotide fragments are preferably at least about 15 nt, and more preferably
at least about 20 nt,
still more preferably at least about 30 nt, and even more preferably, at least
about 40 nt in length.
A fragment "at least 20 nt in length," for example, is intended to include 20
or more contiguous
bases from the cDNA sequence contained in that shown in SEQ ID NO:1-26. These
nucleotide
fragments are useful as diagnostic probes and primers as discussed herein. Of
course, larger
fragments (e.g., 50, I50, and more nucleotides) are preferred.
3o Moreover, representative examples of polynucleotide fragments of the
invention,
include, for example, fragments having a sequence from about nucleotide number
I -50, S I-260,
101-150, I51-200, 201-250, 251-300, 301-350, 351-400, 401-450, and so forth,
to the end of
SEQ ID NO:1-26. In this context "about" includes the particularly recited
ranges, larger or
smaller by several (S, 4, 3, 2, or 1 ) nucleotides, at either terminus or at
both termini. Preferably,
-18-
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
these fragments encode a polypeptide which has biological activity.
In the present invention, a "polypeptide fragment" refers to a short amino
acid sequence
contained in the translations of SEQ ID NO:1-26 as well as SEQ ID N0:27-38.
Protein
fragments may be "free-standing," or comprised within a larger polypeptide of
which the
fragment forms a part or region, most preferably as a single continuous
region. Representative
examples of polypeptide fragments of the invention, include, for example,
fragments from about
amino acid number 1-20, 21-40, 41-60, and so forth, to the end of the coding
region. Moreover,
poiypeptide fragments can be about 20, 30, 40, 50 or 60, amino acids in
length. In this context
"about" includes the particularly recited ranges, larger or smaller by several
(5, 4, 3, 2, or 1 )
1 o amino acids, at either extreme or at both extremes.
Preferred polypeptide fragments include the secreted protein as well as the
mature form.
Further preferred polypeptide fragments include the secreted protein or the
mature form having a
continuous series of deleted residues from the amino or the carboxy terminus,
or both. For
example, any number~of amino acids, ranging from i-60, can be deleted from the
amino
t 5 terminus of either the secreted polypeptide or the mature form. Similarly,
any number of amino
acids, ranging from 1-30, can be deleted from the carboxy terminus of the
secreted protein or
mature form. Furthermore, any combination of the above amino and carboxy
terminus deletions
are preferred. Similarly, polynucleotide fragments encoding these polypeptide
fragments are
also preferred.
2o Also preferred are polypeptide and polynucleotide fragments characterized
by structural
or functional domains, such as fragments that comprise alpha-helix and alpha-
helix forming
regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming
regions, coii and coil-
forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta
amphipathic regions, flexible regions, surface-forming regions, substrate
binding region, and
2~ high antigenic index regions. Polypeptide fragments of the translations of
SEQ ID NO:1-26 as
well as SEQ ID N0:27-38 falling within conserved domains are specifically
contemplated by
the present invention. Moreover, polynucleotide fragments encoding these
domains are also
contemplated.
Other preferred fragments are biologically active fragments. Biologically
active
3o fragments are those exhibiting activity similar, but not necessarily
identical, to an activity of the
polypeptide of the present invention. The biological activity of the fragments
may include an
improved desired activity, or a decreased undesirable activity.
Epitopes & Antibodies
- 19-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
In the present invention, "epitopes" refer to polypeptide fragments having
antigenic or
immunogenic activity in an animal, especially in a human. A preferred
embodiment of the
present invention relates to a polypeptide fragment comprising an epitope, as
well as the
polynucleotide encoding this fragment. A region of a protein molecule to which
an antibody can
S bind is defined as an "antigenic epitope." In contrast, an "immunogenic
epitope" is defined as a
part of a protein that elicits an antibody response. (See, for instance,
Geysen et al., Proc. Natl.
Acad. Sci. USA 81:3998-4002 (1983).)
Fragments which function as epitopes may be produced by any conventional
means.
(See, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-S13S (1985)
further
to described in U.S. Patent No. 4,631,211.)
In the present invention, antigenic epitopes preferably contain a sequence of
at least
seven, more preferably at least nine, and most preferably between about 15 to
about 30 amino
acids. Antigenic epitopes are useful to raise antibodies, including monoclonal
antibodies, that
specifically bind the epitope. (See, for instance, Wilson et al., Cell 37:767-
778 (1984); Sutcliffe,
t 5 J. G. et al., Science 219:660-666 ( 1983).)
Similarly, immunogenic epitopes can be used to induce antibodies according to
methods
well known in the art. (See, for instance, SutcIiffe et al., supra; Wilson et
al., supra; Chow, M. et
al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J. et al., J. Gen.
Virol. 66:2347-
2354 (1985).) A preferred immunogenic epitope includes the secreted protein.
The
2o immunogenic epitopes may be presented together with a carrier protein, such
as an albumin, to
an animal system (such as rabbit or mouse) or, if it is long enough (at least
about 2S amino
acids), without a carrier. However, immunogenic epitopes comprising as few as
8 to 10 amino
acids have been shown to be sufficient to raise antibodies capable of binding
to, at the very least,
linear epitopes in a denatured polypeptide (e.g., in Western blotting.)
2S As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is
meant to
include intact molecules as well as antibody fragments (such as, for example,
Fab and F(ab')2
fragments) which are capable of specifically binding to protein. Fab and
F(ab')2 fragments lack
the Fc fragment of intact antibody, clear more rapidly from the circulation,
and may have less
non-specific tissue binding than an intact antibody. (Wahl et al., J. Nucl.
Med. 24:316-325
( 1983).) Thus, these fragments are preferred, as well as the products of a
FAB or other
immunogiobulin expression library. Moreover, antibodies of the present
invention include
chimeric, single chain, and humanized antibodies.
Fusion Proteins
-20-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Any polypeptide of the present invention can be used to generate fusion
proteins. For
example, the polypeptide of the present invention, when fused to a second
protein, can be used
as an antigenic tag. Antibodies raised against the polypeptide of the present
invention can be
used to indirectly detect the second protein by binding to the polypeptide.
Moreover, because
secreted proteins target cellular locations based on trafficking signals, the
polypeptides of the
present invention can be used as targeting molecules once fused to other
proteins.
Examples of domains that can be fused to polypeptides of the present invention
include
not only heterologous signal sequences, but also other heterologous functional
regions. The
fusion does not necessarily need to be direct, but may occur through linker
sequences.
1o Moreover, fusion proteins may also be engineered to improve characteristics
of the
polypeptide of the present invention. For instance, a region of additional
amino acids,
particularly charged amino acids, may be added to the N-terminus of the
polypeptide to improve
stability and persistence during purification from the host cell or subsequent
handling and
storage. Also, peptide moieties may be added to the polypeptide to facilitate
purification. Such
regions may be removed prior to final preparation of the polypeptide. The
addition of peptide
moieties to facilitate handling of polypeptides are familiar and routine
techniques in the art.
Moreover, polypeptides of the present invention, including fragments, and
specifically
epitopes, can be combined with parts of the constant domain of immunoglobulins
(IgG),
resulting in chimeric polypeptides. These fusion proteins facilitate
purification and show an
zo increased half life in vivo. One reported example describes chimeric
proteins consisting of the
first two domains of the human CD4-polypeptide and various domains of the
constant regions of
the heavy or light chains of mammalian immunoglobulins. (EP A 394,827;
Traunecker et al.,
Nature 331:84-86 (1988).) Fusion proteins having disulfide-linked dimeric
structures (due to the
IgG) can also be more efficient in binding and neutralizing other molecules,
than the monomeric
secreted protein or protein fragment alone. (Fountoulakis et al., J. Biochem.
270:3958-3964
( I 995).)
Similarly, EP-A-0 464 533 (Canadian counterpart 2045869) discloses fusion
proteins
comprising various portions of constant region of immunoglobulin molecules
together with
another human protein or part thereof. In many cases, the Fc part in a fusion
protein is
3o beneficial in therapy and diagnosis, and thus can result in, for example,
improved
phatmacokinetic properties. (EP-A 0 232 262.) Alternatively, deleting the Fc
part after the
fusion protein has been expressed, detected, and purified, would be desired.
For example, the Fc
portion may hinder therapy and diagnosis if the fusion protein is used as an
antigen for
immunizations. In drug discovery, for example, human proteins, such as hIL-5,
have been fused
-21
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
with Fc portions for the purpose of high-throughput screening assays to
identify antagonists of
hIL-5. (See. D. Bennett et al., J. Molecular Recognition 8:52-58 (1995); K.
Johanson et al., J.
Biol. Chem. 270:9459-9471 ( 1995).)
Moreover, the polypeptides of the present invention can be fused to marker
sequences,
such as a peptide which facilitates purification of the fused polypeptide. In
preferred
embodiments, the marker amino acid sequence is a hexa-histidine peptide, such
as the tag
provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA,
91311 ), among
others, many of which are commercially available. As described in Gentz et
al., Proc. Natl.
Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for
convenient
1o purification of the fusion protein. Another peptide tag useful for
purification, the "HA" tag,
corresponds to an epitope derived from the influenza hemagglutinin protein.
(Wilson et al., Cell
37:767 (1984).)
Thus, any of these above fusions can be engineered using the polynucleotides
or the polypeptides of the present invention.
Vectors, Host Cells, and Protein Production
The present invention also relates to vectors containing the polynucleotide of
the present
invention, host cells, and the production of polypeptides by recombinant
techniques. The vector
may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral
vectors may be
2o replication competent or replication defective. In the latter case, viral
propagation generally will
occur only in complementing host cells.
Nucleic Acid Molecules and Polypeptides of the Present Invention
The nucleic acid molecules encompassed in the invention comprise nucleotide
sequences
SEQ ID NO: 1-26.
The amino acid sequences of the polypeptides encoded by the nucleotide
sequences of
the invention are given in SEQ ID N0:27-38.
The discovery of the nucleic acids of the invention enables the construction
of expression
vectors comprising nucleic acid sequences encoding polypeptides; host cells
transfected or
3o transformed with the expression vectors; isolated and purified biologically
active polypeptides
and fragments thereof; the use of the nucleic acids or oligonucleotides
thereof as probes to
identify nucleic acids encoding proteins.having amino acid sequences
homologous to SEQ ID
NOs: 27-38; the use of the nucleic acids or oligonucleotides thereof to
identify human
chromosomes, for example, 22, 7, and 19; the use of the nucleic acids or
oligonucleotides
CA 02351167 2001-05-10
WO 00!28033 PCT/US99/26788
thereof to map genes on human chromosomes, for example, ?2, 7, and 19; the use
of the nucleic
acids or oligonucleotides thereof to identify genes associated with certain
diseases, syndromes or
other human conditions associated with human chromosomes such as 22, 7, and
19; the use of
single-stranded sense or antisense oIigonucleotides from the nucleic acids to
inhibit expression
of polynucleotides encoded by the IMX sequences; the use of such polypeptides
and soluble
fragments as molecular weight markers; the use of such polypeptides and
fragmented peptides as
controls for peptide fragmentation, and kits comprising these reagents; the
use of such
polypeptides and fragments thereof to generate antibodies, and the use of
antibodies to purify
IMX polypeptides.
to
NUCLEIC ACID MOLECULES
In a particular embodiment, the invention relates to certain isolated
nucleotide sequences
that are free from contaminating endogenous material. A "nucleotide sequence"
refers to a
polynucleotide molecule in the form of a separate fragment or as a component
of a larger nucleic
t5 acid construct. The nucleic acid molecule has been derived from DNA or RNA
isolated at least
once in substantially pure form and in a quantity or concentration enabling
identification,
manipulation, and recovery of its component nucleotide sequences by standard
biochemical
methods (such as those outlined in Sambrook et al., Molecular Cloning: A
Laboratory Manual,
2nd sed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY ( 1989)). Such
sequences are
2o preferably provided and/or constructed in the form of an open reading frame
uninterrupted by
internal non-translated sequences, or introns, that are typically present in
eukaryotic genes.
Sequences of non-translated DNA can be present 5' or 3' from an open reading
frame, where the
same do not interfere with manipulation or expression of the coding region.
Nucleic acid molecules of the invention include DNA in both single-stranded
and
25 double-stranded fonm, as well as the RNA complement thereof. DNA includes,
for example,
cDNA, genomic DNA, chemically synthesized DNA, DNA amplified by PCR, and
combinations thereof. Genomic DNA may be isolated by conventional techniques,
e.g., using
the cDNA of SEQ ID NOs: l-2G, or a suitable fragment thereof, as a probe.
The DNA molecules of the invention include full length genes as well as
polynucleotides
3o and fragments thereof. The full length gene may include the N-terminal
signal peptide. Other
embodiments include DNA encoding a soluble form, e.g., encoding the
extracellular domain of
the protein, either with or without the signal peptide.
The nucleic acids of the invention are preferentially derived from human
sources, but the
invention includes those derived from non-human species, as well.
-23-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Preferred SeQUences
The particularly preferred nucleotide sequences of the invention are SEQ ID
NOs: 1-26,
as set forth above. cDNA clones having the nucleotide sequence of SEQ ID NOs:
l-26 were
isolated as described in Example 1. The sequences of amino acids encoded by
the DNA of SEQ
ID NOs:I-26 are shown in SEQ ID NOs:27-38.
Additional Sequences
Due to the known degeneracy of the genetic code, wherein more than one codon
can
to encode the same amino acid, a DNA sequence can vary from that shown in SEQ
ID NOs:I-26,
and still encode a polypeptide having the amino acid sequence of SEQ ID NOs:27-
38. Such
variant DNA sequences can result from silent mutations (e.g., occurring during
PCR
amplification), or can be the product of deliberate mutagenesis of a native
sequence.
The invention thus provides additional isolated DNA sequences encoding
polypeptides
15 of the invention, selected from: (a) DNA comprising the nucleotide
sequences of SEQ 1D NOs:
1-26; (b) DNA encoding the polypeptides of SEQ ID NOs:27-38; (c) DNA capable
of
hybridization to a DNA of (a) or (b) under conditions of moderate stringency
and which encodes
polypeptides of the invention; (d) DNA capable of hybridization to a DNA of
(a) or (b) under
conditions of high stringency and which encodes polypeptides of the invention,
and (e) DNA
2o which is degenerate, as a result of the genetic code, to a DNA defined in
(a), (b), (c), or (d) and
which encode polypeptides of the invention. Of course, polypeptides encoded by
such DNA
sequences are encompassed by the invention.
As used herein, conditions of moderate stringency can be readily determined by
those
having ordinary skill in the art based on, for example, the length of the DNA.
The basic
25 conditions are set forth by Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2 ed.
Vol. 1, pp. 1.101-264, Cold Spring Harbor Laboratory Press, (1989), and
include use of a
prewashing solution for the nitrocellulose filters SX SSC, 0.5% SDS, 1.0 mM
EDTA (pH 8.0),
hybridization conditions of about 50% formamide, 6X SSC at about 42~C (or
other similar
hybridization solution, such as Stark's solution, in about 50% formamide at
about 42~C), and
3o washing conditions of about 60°C, O.SX SSC, 0.1 % SDS. Conditions of
high stringency can
also be readily determined by the skilled artisan based on, for example, the
length of the DNA.
Generally, such conditions are defined as hybridization conditions as above,
and with washing at
approximately 68~C, 0.2X SSC, 0.1% SDS. The skilled artisan will recognize
that the
-24-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
temperature and wash solution salt concentration can be adjusted as necessary
according to
factors such as the length of the probe.
Also included as an embodiment of the invention is DNA encoding polypeptide
fragments and polypeptides comprising inactivated N-glycosylation site(s),
inactivated protease
processing site(s), or conservative amino acid substitution(s), as described
below.
In another embodiment, the nucleic acid molecules of the invention also
comprise
nucleotide sequences that are at least 80% identical to a native sequence.
Also contemplated are
embodiments in which a nucleic acid molecule comprises a sequence that is at
least 90%
identical, at least 95% identical, at least 98% identical, at least 99%
identical, or at least 99.9%
to identical to a native sequence.
The percent identity may be determined by visual inspection and mathematical
calculation. Alternatively, the percent identity of two nucleic acid sequences
can be determined
by comparing sequence information using the GAP computer program, version 6.0
described by
Devereux et al. (Nucl. Acids Res. 12:387, 1984) and available from the
University of Wisconsin
15 Genetics Computer Group (UWGCG). The preferred default parameters for the
GAP program
include: ( 1 ) a unary comparison matrix (containing a value of I for
identities and 0 for non-
identities) for nucleotides, and the weighted comparison matrix of Gribskov
and Burgess, Nucl.
Acids Res. !4:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of
Protein
Sequence and Structure, National Biomedical Research Foundation, pp. 353-358,
1979; (2) a
2o penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol
in each gap; and (3)
no penalty for end gaps. Other programs used by one skilled in the art of
sequence comparison
may also be used.
The invention provides isolated nucleic acids useful in the production of
polypeptides.
Such polypeptides may be prepared by any of a number of conventional
techniques. A DNA
2s sequence encoding an IMX polypeptide or a desired fragment thereof may be
subcloned into an
expression vector for production of the polypeptide or fragment. The DNA
sequence
advantageously is fused to a sequence encoding a suitable leader or signal
peptide.
Alternatively, the desired fragment may be chemically synthesized using known
techniques.
DNA fragments also may be produced by restriction endonuclease digestion of a
full length
3o cloned DNA sequence, and isolated by electrophoresis on agarose gels. If
necessary,
oligonucleotides that reconstruct the 5' or 3' terminus to a desired point may
be ligated to a DNA
fragment generated by restriction enzyme digestion. Such oligonucleotides may
additionally
contain a restriction endonuclease cleavage site upstream of the desired
coding sequence, and
position an initiation codon (ATG) at the N-terminus of the coding sequence.
-25-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
The well-known polymerise chain reaction (PCR) procedure also may be employed
to
isolate and amplify a DNA sequence encoding a desired protein fragment.
Oligonucleotides that
define the desired termini of the DNA fragment are employed as 5' and 3'
primers. The
oligonucleotides may additionally contain recognition sites for restriction
endonucleases, to
facilitate insertion of the amplif ed DNA fragment into an expression vector.
PCR techniques
are described in Saiki et al., Science 239:487 ( 1988); Recombinant DNA
Methodolog3~, Wu et al.,
eds., Academic Press, Inc., San Diego ( 1989), pp. 189-196; and PCR Protocols:
A Guide to
Methods acrd Applications, Innis et al., eds., Academic Press, Inc. ( 1990).
t o POLYPEPTIDES AND FRAGMENTS THEREOF
The invention encompasses polypeptides and fragments thereof in various forms,
including those that are naturally occurring or produced through various
techniques such as
procedures involving recombinant DNA technology. Such forms include, but are
not limited to,
derivatives, variants, and oligomers, as well as fusion proteins or fragments
thereof.
t5
Polmentides and Fragments Thereof
The polypeptides of the invention include full length proteins encoded by the
nucleic
acid sequences set forth above. Particularly preferred polypeptides comprise
the amino acid
sequences of SEQ ID NOs:27-38.
2o The polypeptides of the invention may include an N-terminal hydrophobic
region that
functions as a signal peptide, and may contain an extracellular domain, and
may also contain a
transmembrane region and a C-terminal cytoplasmic domain as well as a spacer
region.
Computer analysis may be used to predict the location of the signal peptide.
For example, the isolated polypeptides of SEQ ID N0:14 (IMX 28) and SEQ ID
N0:19
25 (IMX 44) include an N-terminal hydrophobic region that functions as a
signal peptide.
Computer analysis predicts that the signal peptide corresponds to residues 1
to I 7 of SEQ ID
N0:14, and cleavage of the signal peptide of SEQ ID N0:14 results in a mature
protein
comprising amino acids 18 to 372. The signal peptide of IMX 44 corresponds to
residues 1 to
37 of SEQ ID N0:19. The next mast likely computer-predicted signal peptide
cleavage sites (in
3o descending order) would occur after amino acids 36, 26 and 27 of SEQ ID
N0:19. Cleavage of
the signal peptide at position 37 thus would yield a mature protein comprising
amino acids 38
through 261 of SEQ ID N0:19.
The skilled artisan will recognize that the above-described boundaries of such
regions of
the polypeptide are approximate. To illustrate, the boundaries of the mature
protein (which may
-26-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
be predicted by using computer programs available for that purpose) may differ
from those
described above.
The polypeptides of the invention may be membrane bound or they may be
secreted and,
thus, soluble. Soluble polypeptides are capable of being secreted from the
cells in which they
are expressed. In general, soluble polypeptides may be identified (and
distinguished from non-
soluble membrane-bound counterparts) by separating intact cells which express
the desired
polypeptide from the culture medium, e.g., by centrifugation, and assaying the
medium
(supernatant) for the presence of the desired polypeptide. The presence of
polypeptide in the
medium indicates that the polypeptide was secreted from the cells and thus is
a soluble form of
to the protein.
In one embodiment, the soluble polypeptides and fragments thereof comprise ail
or part
of the extracellular domain, but lack the transmembrane region that would
cause retention of the
polypeptide on a cell membrane. A soluble polypeptide may include the
cytoplasmic domain, or
a portion thereof, as long as the polypeptide is secreted from the cell in
which it is produced.
15 In general, the use of soluble forms is advantageous for certain
applications. Purification
of the polypeptides from recombinant host cells is facilitated, since the
soluble polypeptides are
secreted from the cells. Further, soluble polypeptides are generally more
suitable for
intravenous administration.
The invention also provides polypeptides and fragments of the extracellular
domain that
2o retain a desired biological activity. Particular embodiments are directed
to polypeptide
fragments that retain the ability to bind the native cognate, substrate, or
counter-structure
("binding partner"). Such a fragment may be a soluble polypeptide, as
described above. In
another embodiment, the polypeptides and fragments advantageously include
regions that are
conserved in the family as described above.
25 Also provided herein are polypeptide fragments comprising at least 20, or
at least 30,
contiguous amino acids of the sequence of SEQ ID NOs:27-38. Fragments derived
from the
cytoplasmic domain find use in studies of signal transduction, and in
regulating cellular
processes associated with transduction of biological signals. Polypeptide
fragments also may be
employed as immunogens, in generating antibodies.
Variants
Naturally occurring variants as well as derived variants of the polypeptides
and
fragments are provided herein.
-27-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Variants may exhibit amino acid sequences that are at least 80% identical.
Also
contemplated are embodiments in which a polypeptide or fragment comprises an
amino acid
sequence that is at least 90% identical, at least 95% identical, at least 98%
identical, at least 99%
identical, or at least 99.9% identical to the preferred polypeptide or
fragment thereof. Percent
identity may be determined by visual inspection and mathematical calculation.
Alternatively,
the percent identity of two protein sequences can be determined by comparing
sequence
information using the GAP computer program, based on the algorithm of
Needleman and
Wunsch (J. Mol. Bio. 48:443, 1970) and available from the University of
Wisconsin Genetics
Computer Group (UWGCG). The preferred default parameters for the GAP program
include:
to (1) a scoring matrix, blosum62, as described by Henikoff and Henikoff
(Proc. Natl. Acad. Sci.
USA 89:10915, 1992); (2) a gap weight of 12; (3) a gap length weight of 4; and
(4) no penalty
for end gaps. Other programs used by one skilled in the art of sequence
comparison may also be
used.
The variants of the invention include, for example, those that result from
alternate
IS mRNA splicing events or from proteolytic cleavage. Alternate splicing of
mRNA may, for
example, yield a truncated but biologically active protein, such as a
naturally occurring soluble
form of the protein. Variations attributable to proteolysis include, for
example, differences in
the N- or C-termini upon expression in different types of host cells, due to
proteolytic removal
of one or more terminal amino acids from the protein (generally from 1-5
terminal amino acids).
2o Proteins in which differences in amino acid sequence are attributable to
genetic polymorphism
(allelic variation among individuals producing the protein) are also
contemplated herein.
Additional variants within the scope of the invention include polypeptides
that may be
modified to create derivatives thereofby forming covalent or aggregative
conjugates with other
chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups
and the like.
25 Covalent derivatives may be prepared by linking the chemical moieties to
functional groups on
amino acid side chains or at the N-terminus or C-terminus of a polypeptide.
Conjugates
comprising diagnostic (detectable) or therapeutic agents attached thereto are
contemplated
herein, as discussed in more detail below.
Other derivatives include covalent or aggregative conjugates of the
polypeptides with
30 other proteins or polypeptides, such as by synthesis in recombinant culture
as N-terminal or C-
terminal fusions. Examples of fusion proteins are discussed below in
connection with
oligomers. Further, fusion proteins can comprise peptides added to facilitate
purification and
identification. Such peptides include, for example, poly-His or the antigenic
identification
peptides described in U.S. Patent No. 5,011,912 and in Hopp et al.,
BiolTechnolog3~ 6:1204,
-28-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
1988. One such peptide is the FLAG A peptide, Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys,
which is
highly antigenic and provides an epitope reversibly bound by a specifc
monoclonal antibody,
enabling rapid assay and facile purification of expressed recombinant protein.
A murine
hybridoma designated 4E 11 produces a monoclonal antibody that binds the FLAG~
peptide in
the presence of certain divalent metal cations, as described in U.S. Patent
5,01 I,9I2, hereby
incorporated by reference. The 4E 11 hybridoma cell line has been deposited
with the American
Type Culture Collection under accession no. HB 9259. Monoclonal antibodies
that bind the
FLAG'S peptide are available from Eastman Kodak Co., Scientific Imaging
Systems Division,
New Haven, Connecticut.
to Among the polypeptides provided herein are variants of native polypeptides
that retain
the native biological activity or the substantial equivalent thereof. One
example is a variant that
binds with essentially the same binding affinity as does the native form.
Binding affinity can be
measured by conventional procedures, e.g., as described in U.S. Patent No.
5,512,457 and as set
forth below.
15 Variants include polypeptides that are substantially homologous to the
native form, but
which have an amino acid sequence different from that of the native form
because of one or
more deletions, insertions or substitutions. Particular embodiments include,
but are not limited
to, polypeptides that comprise from one to ten deletions, insertions or
substitutions of amino
acid residues, when compared to a native sequence.
20 A given amino acid may be replaced, for example, by a residue having
similar
physiochemical characteristics. Examples of such conservative substitutions
include
substitution of one aliphatic residue for another, such as Ile, Val, Leu, or
Ala for one another;
substitutions of one polar residue for another, such as between Lys and Arg,
Glu and Asp, or
Gln and Asn; or substitutions of one aromatic residue for another, such as
Phe, Trp, or Tyr for
25 one another. Other conservative substitutions, e.g., involving
substitutions of entire regions
having similar hydrophobicity characteristics, are well known.
Similarly, the DNAs of the invention include variants that differ from a
native DNA
sequence because of one or more deletions, insertions or substitutions, but
that encode a
biologically active polypeptide.
3o The invention further includes polypeptides of the invention with or
without associated
native-pattern glycosylation. Polypeptides expressed in yeast or mammalian
expression systems
(e.g., COS-1 or COS-7 cells) can be similar to or significantly different from
a native
polypeptide in molecular weight and glycosylation pattern, depending upon the
choice of
expression system. Expression of polypeptides of the invention in bacterial
expression systems,
-29-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
such as E. coli, provides non-glycosylated molecules. Further, a given
preparation may include
multiple differentially glycosylated species of the protein. Glycosyl groups
can be removed
through conventional methods, in particular those utilizing glycopeptidase. In
general,
glycosylated polypeptides of the invention can be incubated with a molar
excess of
glycopeptidase (Boehringer Mannheim}.
Correspondingly, similar DNA constructs that encode various additions or
substitutions
of amino acid residues or sequences, or deletions of terminal or internal
residues or sequences
are encompassed by the invention. For example, N-glycosylation sites in the
polypeptide
extracellular domain can be modified to preclude glycosylation, allowing
expression of a
to reduced carbohydrate analog in mammalian and yeast expression systems. N-
glycosylation sites
in eukaryotic polypeptides are characterized by an amino acid triplet Asn-X-Y,
wherein X is any
amino acid except Pro and Y is Ser or Thr. Appropriate substitutions,
additions, or deletions to
the nucleotide sequence encoding these triplets will result in prevention of
attachment of
carbohydrate residues at the Asn side chain. Alteration of a single
nucleotide, chosen so that
15 Asn is replaced by a different amino acid, for example, is sufficient to
inactivate an N-
glycosylation site. Alternatively, the Ser or Thr can by replaced with another
amino acid, such
as Ala. Known procedures for inactivating N-glycosylation sites in proteins
include those
described in U.S. Patent 5,071,972 and EP 276,846, hereby incorporated by
reference.
In another example of variants, sequences encoding Cys residues that are not
essential
20 for biological activity can be altered to cause the Cys residues to be
deleted or replaced with
other amino acids, preventing formation of incorrect intramolecular disuIfde
bridges upon
folding or renaturation.
Other variants are prepared by modification of adjacent dibasic amino acid
residues, to
enhance expression in yeast systems in which KEX2 protease activity is
present. EP 212,914
15 discloses the use of site-specific mutagenesis to inactivate KEX2 protease
processing sites in a
protein. KEX2 protease processing sites are inactivated by deleting, adding or
substituting
residues to alter Arg-Arg, Arg-Lys, and Lys-Arg pairs to eliminate the
occurrence of these
adjacent basic residues. Lys-Lys pairings are considerably less susceptible to
KEX2 cleavage,
and conversion of Arg-Lys or Lys-Arg to Lys-Lys represents a conservative and
preferred
30 approach to inactivating KEX2 sites.
-30-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Oli~omers
Encompassed by the invention are oligomers or fusion proteins that contain IMX
polypeptides. Such oligomers may be in the form of covalently-linked or non-
covalently-linked
multimers, including dimers, trimers, or higher oligomers. As noted above,
preferred
polypeptides are soluble and thus these oligomers may comprise soluble
polypeptides. In one
aspect of the invention, the oligomers maintain the binding ability of the
polypeptide
components and provide therefor, bivalent, trivalent, etc., binding sites.
One embodiment of the invention is directed to oligomers comprising multiple
polypeptides joined via covalent or non-covalent interactions between peptide
moieties fused to
1o the polypeptides. Such peptides may be peptide linkers (spacers), or
peptides that have the
property of promoting oligomerization. Leucine zippers and certain
polypeptides derived from
antibodies are among the peptides that can promote oligomerization of the
polypeptides attached
thereto, as described in more detail below.
Immunoglobulin-based Oliaomers
15 As one alternative, an oligomer is prepared using polypeptides derived from
immunoglobulins. Preparation of fusion proteins comprising certain
heterologous polypeptides
fused to various portions of antibody-derived polypeptides (including the Fc
domain) has been
described, e.g., by Ashkenazi et al. (PNAS USA 88:10535, 1991 ); Byrn et al.
(Nature 344:677,
1990); and Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion
Proteins", in
2o Current Protocols in Immunology, Suppl. 4, pages 10.19.1 - 10.19.11, 1992).
One embodiment of the present invention is directed to a dimer comprising two
fusion
proteins created by fusing a polypeptide of the invention to an Fc polypeptide
derived from an
antibody. A gene fusion encoding the polypeptide/Fc fusion protein is inserted
into an
appropriate expression vector. Polypeptide/Fc fusion proteins are expressed in
host cells
25 transformed with the recombinant expression vector, and allowed to assemble
much like
antibody molecules, whereupon interchain disulfide bonds form between the Fc
moieties to yield
divalent molecules.
The term "Fc polypeptide" as used herein includes native and mutein forms of
polypeptides comprising from the Fc region of an antibody. Truncated forms of
such
3o polypeptides containing the hinge region that promotes dimerization are
also included.
Preferred polypeptides comprise an Fc polypeptide derived from a human IgGI
antibody
comprising any or all of the CH domains of the Fc region.
One suitable Fc polypeptide, described in PCT application WO 93/10151, hereby
incorporated by reference, is a single chain polvpeptide extending from the N-
terminal hinge
-31 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
region to the native C-terminus of the Fc region of a human IgGI antibody.
Another useful Fc
polypeptide is the Fc mutein described in U.S. Patent 5,457,035 and in Baum et
al., (EMBO J
13:3992-4001, 1994) incorporated herein by reference. The amino acid sequence
of this mutein
is identical to that of the native Fc sequence presented in WO 93/10151,
except that amino acid
19 has been changed from Leu to Ala, amino acid 20 has been changed from Leu
to Glu, and
amino acid 22 has been changed from Gly to Ala. The mutein exhibits reduced
affinity for Fc
receptors.
The above-described fusion proteins comprising Fc moieties (and oligomers
formed
therefrom) offer the advantage of facile purification by affinity
chromatography over Protein A
to or Protein G columns.
In other embodiments, the polypeptides of the invention may be substituted for
the
variable portion of an antibody heavy or light chain. If fusion proteins are
made with both
heavy and light chains of an antibody, it is possible to form an oligomer with
as many as four
soluble regions of the proteins of the invention.
t5
Peptide-linker Based OliQOmers
Alternatively, the oligomer is a fusion protein comprising multiple
polypeptides, with or
without peptide linkers (spacer peptides). Among the suitable peptide linkers
are those
described in U.S. Patents 4,751,180 and 4,935,233, which are hereby
incorporated by reference.
2o A DNA sequence encoding a desired peptide linker may be inserted between,
and in the same
reading frame as, the DNA sequences of the invention, using any suitable
conventional
technique. For example, a chemically synthesized oligonucleotide encoding the
linker may be
ligated between the sequences. In particular embodiments, a fusion protein
comprises from two
to four soluble IMX polypeptides, separated by peptide linkers.
Leucine-Zippers
Another method for preparing the oligomers of the invention involves use of a
leucine
zipper. Leucine zipper domains are peptides that promote oligomerization of
the proteins in
which they are found. Leucine zippers were originally identified in several
DNA-binding
3o proteins (Landschulz et al., Science 240:1759, 1988), and have since been
found in a variety of
different proteins. Among the known leucine zippers are naturally occurring
peptides and
derivatives thereof that dimerize or trimerize.
Examples of leucine zipper domains suitable for producing soluble oligomeric
proteins
are described in PCT application WO 94/10308, and the leucine zipper derived
from lung
-32-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
surfactant protein D (SPD) described in Hoppe et al. (FEBSLetters 344:191,
1994), hereby
incorporated by reference. The use of a modified leucine zipper that allows
for stable
trimerization of a heterologous protein fused thereto is described in Fanslow
et aI. (Semin.
Immunol. 6:267-278, 1994). Recombinant fusion proteins comprising a soluble
polypeptide
fused to a leucine zipper peptide are expressed in suitable host cells, and
the soluble oligomer
that forms is recovered from the culture supernatant.
In particular embodiments, leucine residues in a leucine zipper moiety are
replaced by
isoleucine residues. Such peptides comprising isoleucine may be referred to as
"isoleucine
zippers" but are encompassed by the term "leucine zippers" as employed herein.
PRODUCTION OF POLYPEPTIDES AND FRAGMENTS THEREOF
Expression, isolation and purification of the polypeptides and fragments of
the invention
may be accomplished by any suitable technique, including but not limited to
the following:
Expression Systems
The present invention also provides recombinant cloning and expression vectors
containing DNA, as well as host cell containing the recombinant vectors.
Expression vectors
comprising DNA may be used to prepare the polypeptides or fragments of the
invention encoded
by the DNA. A method for producing polypeptides comprises culturing host cells
transformed
with a recombinant expression vector encoding the polypeptide, under
conditions that promote
expression of the polypeptide, then recovering the expressed polypeptides from
the culture. The
skilled artisan will recognize that the procedure for purifying the expressed
polypeptides will
vary according to such factors as the type of host cells employed, and whether
the polypeptide is
membrane-bound or a soluble form that is secreted from the host cell.
Any suitable expression system may be employed. The vectors include a DNA
encoding
a polypeptide or fragment of the invention, operably linked to suitable
transcriptional or
translational regulatory nucleotide sequences, such as those derived from a
mammalian,
microbial, viral, or insect gene. Examples of regulatory sequences include
transcriptional
promoters, operators, or enhancers, an mRNA ribosomal binding site, and
appropriate sequences
which control transcription and translation initiation and termination.
Nucleotide sequences are
operably linked when the regulatory sequence functionally relates to the DNA
sequence. Thus,
a promoter nucleotide sequence is operably linked to a DNA sequence if the
promoter nucleotide
sequence controls the transcription of the DNA sequence. An origin of
replication that confers
-33-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
the ability to replicate in the desired host cells, and a selection gene by
which transformants are
identified, are generally incorporated into the expression vector.
In addition, a sequence encoding an appropriate signal peptide (native or
heterologous}
can be incorporated into expression vectors. A DNA sequence for a signal
peptide (secretory
leader) may be fused in frame to the nucleic acid sequence of the invention so
that the DNA is
initially transcribed, and the mRNA translated, into a fusion protein
comprising the signal
peptide. A signal peptide that is functional in the intended host cells
promotes extracellular
secretion of the polypeptide. The signal peptide is cleaved from the
polypeptide upon secretion
of polypeptide from the cell.
t0 The skilled artisan will also recognize that the positions) at which the
signal peptide is
cleaved may differ from that predicted by computer program, and may vary
according to such
factors as the type of host cells employed in expressing a recombinant
polypeptide. A protein
preparation may include a mixture of protein molecules having different N-
terminal amino
acids, resulting from cleavage of the signal peptide at more than one site.
t5 Suitable host cells for expression of polypeptides include prokaryotes,
yeast or higher
eukaryotic cells. Mammalian or insect cells are generally preferred for use as
host cells.
Appropriate cloning and expression vectors for use with bacterial, fungal,
yeast, and mammalian
cellular hosts are described, for example, in Pouwels et al. Cloning vectors:
A Laboratory
Manual, Elsevier, New York, (1985). Cell-free translation systems could also
be employed to
20 produce polypeptides using RNAs derived from DNA constructs disclosed
herein.
Prokaryotic Systems
Prokaryotes include gram-negative or gram-positive organisms. Suitable
prokaryotic
host cells for transformation include, for example, E. coli, Bacillus
subtilis, Salmonella
25 typhimurium, and various other species within the genera Pseudomonas,
Streptomyces, and
Staphylococcus. In a prokaryotic host cell, such as E. toll, a polypeptide may
include an N-
terminal methionine residue to facilitate expression of the recombinant
polypeptide in the
prokaryotic host cell. The N-terminal Met may be cleaved from the expressed
recombinant
polypeptide.
30 Expression vectors for use in prokaryotic host cells generally comprise one
or more
phenotypic selectable marker genes. A phenotypic selectable marker gene is,
for example, a
gene encoding a protein that confers antibiotic resistance or that supplies an
autotrophic
requirement. Examples of useful expression vectors for prokaryotic host cells
include those
derived from commercially available plasmids such as the cloning vector pBR322
(ATCC
-34-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99I26788
37017). pBR322 contains genes for ampicillin and tetracycline resistance and
thus provides
simple means for identifying transformed cells. An appropriate promoter and a
DNA sequence
are inserted into the pBR322 vector. Other commercially available vectors
include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEMl (Promega
Biotec,
Madison, WI, USA).
Promoter sequences commonly used for recombinant prokaryotic host cell
expression
vectors include (3-lactamase (penicillinase), lactose promoter system (Chang
et al., Nature
275:615, 1978; and Goeddel et al., Nature 281:544, 1979), tryptophan (trp)
promoter system
(Goeddel et al., Nucl. Acids Res. 8:4057, 1980; and EP-A-36776) and tac
promoter (Maniatis,
to Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, p.
412, 1982). A
particularly useful prokaryotic host cell expression system employs a phage
~,PLpromoter and a
cI857ts thennolabile repressor sequence. Plasmid vectors available from the
American Type
Culture Collection which incorporate derivatives of the ~,P~ promoter include
plasmid pHUB2
(resident in E. coli strain JMB9, ATCC 37092) and pPLc28 (resident in E. coli
RR1, ATCC
15 53082).
Yeast Systems
Alternatively, the polypeptides may be expressed in yeast host cells,
preferably from the
Saccharomvces genus (e.g., S. cerevisiae). Other genera of yeast, such as
Pichia or
2o Kluyveromyces, may also be employed. Yeast vectors will often contain an
origin of replication
sequence from a 2p yeast plasmid, an autonomously replicating sequence (ARS),
a promoter
region, sequences for polyadenylation, sequences for transcription
termination, and a selectable
marker gene. Suitable promoter sequences for yeast vectors include, among
others, promoters
for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol.
Chem. 155:2073, 1980)
25 or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149, 1968;
and Holland et al.,
Biochem. 17:4900, 1978), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase,
hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate
isomerase, 3-
phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phospho-
glucose
isomerase, and glucokinase. Other suitable vectors and promoters for use in
yeast expression
3o are further described in Hitzeman, EPA-73,657. Another alternative is the
glucose-repressible
ADH2 promoter described by Russell et al. (J. Biol. Chem. 258:2674, 1982) and
Beier et aI.
(Nature 300:724, 1982). Shuttle vectors replicable in both yeast and E. coli
may be constructed
by inserting DNA sequences from pBR322 for selection and replication in E.
coli (Amp gene
and origin of replication) into the above-described yeast vectors.
-35-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
The yeast a-factor leader sequence may be employed to direct secretion of the
polypeptide. The a-factor leader sequence is often inserted between the
promoter sequence and
the structural gene sequence. See, e.g., Kurjan et al., Cell 30:933, 1982 and
Bitter et al., Proc.
Natl. Acad. Sci. USA 81:5330, 1984. Other leader sequences suitable for
facilitating secretion of
recombinant polypeptides from yeast hosts are known to those of skill in the
art. A leader
sequence may be modified near its 3' end to contain one or more restriction
sites. This will
facilitate fusion of the leader sequence to the structural gene.
Yeast transformation protocols are known to those of skill in the art. One
such protocol
is described by Hinnen et al., Proc. Natl. Acad Sci. USA 75:1929, 1978. The
Hinnen et al.
to protocol selects for Trp+ transformants in a selective medium, wherein the
selective medium
consists of 0.67% yeast nitrogen base, 0.5% casamino acids, 2% glucose, 10
mglml adenine and
20 mg/ml uracil.
Yeast host cells transformed by vectors containing an ADH2 promoter sequence
may be
grown for inducing expression in a "rich" medium. An example of a rich medium
is one
consisting of 1 % yeast extract, 2% peptone, and 1 % glucose supplemented with
80 mg/ml
adenine and 80 mg/ml uracil. Derepression of the ADH2 promoter occurs when
glucose is
exhausted from the medium.
Mammalian or Insect Svsterns
2o Mammalian or insect host cell culture systems also may be employed to
express
recombinant polypeptides. Bacculovirus systems for production of heterologous
proteins in
insect cells are reviewed by Luckow and Summers, BiolTechnology 6:47 (1988).
Established
cell lines of mammalian origin also may be employed. Examples of suitable
mammalian host
cell lines include the COS-7 line of monkey kidney cells (ATCC CRL 1651 )
(Gluzman et al.,
Cell 13:175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese
hamster ovary
(CHO) cells, HeLa cells, and BHK (ATCC CRL 10) cell lines, and the CV1/EBNA
cell line
derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) as
described by
McMahan et al. (EMBO J. 10: 2821, 1991 ).
Established methods for introducing DNA into mammalian cells have been
described
(Kaufman, R.J., Large Scale Mammalian Cell Culture, 1990, pp. 15-69).
Additional protocols
using commercially available reagents, such as Lipofectamine lipid reagent
(GibcoBRL) or
Lipofectamine-Plus lipid reagent, can be used to transfect cells (Felgner et
al., Proc. Natl. Acad.
Sci. USA 84:7413-7417, 1987). In addition, electroporation can be used to
transfect mammalian
cells using conventional procedures, such as those in Sambrook et al.
(Molecular Cloning: A
-36-
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
Laboraton~ Manual, 2 ed. Vol. 1-3, Cold Spring Harbor Laboratory Press, 1989).
Selection of
stable transformants can be performed using methods known in the art, such as,
for example,
resistance to cytotoxic drugs. Kaufman et al., Meth. in Enzvmologv 185:487-
511, 1990,
describes several selection schemes, such as dihydrofolate reductase (DHFR)
resistance. A
suitable host strain for DHFR selection can be CHO strain DX-B 11, which is
deficient in DHFR
(Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980). A plasmid
expressing
the DHFR cDNA can be introduced into strain DX-B11, and only cells that
contain the plasmid
can grow in the appropriate selective media. Other examples of selectable
markers that can be
incorporated into an expression vector include cDNAs confernng resistance to
antibiotics, such
1o as 6418 and hygromycin B. Cells harboring the vector can be selected on the
basis of resistance
to these compounds.
Transcriptional and translational control sequences for mammalian host cell
expression
vectors can be excised from viral genomes. Commonly used promoter sequences
and enhancer
sequences are derived from polyoma virus, adenovirus 2, simian virus 40
(SV40), and human
t5 cytomegalovirus. DNA sequences derived from the SV40 viral genome, for
example, SV40
origin, early and late promoter, enhancer, splice, and polyadenylation sites
can be used to
provide other genetic elements for expression of a structural gene sequence in
a mammalian host
cell. Viral early and late promoters are particularly useful because both are
easily obtained from
a viral genome as a fragment, which can also contain a viral origin of
replication (Hers et al.,
20 Nature 273:113, 1978; Kaufinan, Meth. in Enzvmology, 1990). Smaller or
larger SV40
fragments can also be used, provided the approximately 250 by sequence
extending from the
Hind III site toward the Bgl I site located in the SV40 viral origin of
replication site is included.
Additional control sequences shown to improve expression of heterologous genes
from
mammalian expression vectors include such elements as the expression
augmenting sequence
25 element (EASE) derived from CHO cells (Moms et al., Animal Cell Technology,
1997, pp. 529-
534 and PCT Application WO 97/25420) and the tripartite leader (TPL) and VA
gene RNAs
from Adenovirus 2 (Gingeras et al., J. Biol. Chem. 257:13475-13491, 1982). The
internal
ribosome entry site (IRES) sequences of viral origin allows dicistronic mRNAs
to be translated
eff ciently (Oh and Sarnow, Current Opinion in Genetics acrd Development 3:295-
300, 1993;
3o Ramesh et al., Nucleic Acids Research 24:2697-2700, 1996). Expression of a
heterologous
cDNA as part of a dicistronic mRNA followed by the gene for a selectable
marker (e.g. DHFR)
has been shown to improve transfectability of the host and expression of the
heterologous cDNA
(Kaufinan, Meth. i~r En~vmoloy, 1990). Exemplary expression vectors that
employ dicistronic
-37-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
mRNAs are pTR-DC/GFP described by Mosser et al., Biotechnigues 22:150-161,
1997, and
p2A5I described by Morris et al., Animal Cell Technology, 1997, pp. 529-534.
A useful high expression vector, pCAVNOT, has been described by Mosley et al.,
Cell
59:335-348, 1989. Other expression vectors for use in mammalian host cells can
be constructed
as disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280, 1983). A useful
system for stable
high level expression of mammalian cDNAs in C127 murine mammary epithelial
cells can be
constructed substantially as described by Cosman et al. (Mol. Irnmunol.
?3:935, 1986). A useful
high expression vector, PMLSV N1/N4, described by Cosman et al., Nature
312:768, 1984, has
been deposited as ATCC 39890. Additional useful mammalian expression vectors
are described
to in EP-A-0367566, and in WO 91/18982, incorporated by reference herein. In
yet another
alternative, the vectors can be derived from retroviruses.
Another useful expression vector, pFLAG~, can be used. FLAGg technology is
centered
on the fusion of a low molecular weight (1kD), hydrophilic, FLAG' marker
peptide to the N-
terminus of a recombinant protein expressed by pFLAG~' expression vectors.
Regarding signal peptides that may be employed, the native signal peptide may
be
replaced by a heterologous signal peptide or leader sequence, if desired. The
choice of signal
peptide or leader may depend on factors such as the type of host cells in
which the recombinant
polypeptide is to be produced. To illustrate, examples of heterologous signal
peptides that are
functional in mammalian host cells include the signal sequence for interleukin-
7 (IL-7)
2o described in United States Patent 4,965,195, the signal sequence for
interleukin-2 receptor
described in Cosman et al., Nature 312:768 (1984); the interleukin-4 receptor
signal peptide
described in EP 367,566; the type I interleukin-1 receptor signal peptide
described in U.S. Patent
4,968,607; and the type II interleukin-1 receptor signal peptide described in
EP 460,846.
Purification
The invention also includes methods of isolating and purifying the
polypeptides and
fragments thereof.
-38-
CA 02351167 2001-05-10
WO 00/Z8033 PCT/US99/26788
Isolation and Purification
The "isolated" polypeptides or fragments thereof encompassed by this invention
are
polypeptides or fragments that are not in an environment identical to an
environment in which it
or they can be found in nature. The "purified" polypeptides or fragments
thereof encompassed
by this invention are essentially free of association with other proteins or
polypeptides, for
example, as a purification product of recombinant expression systems such as
those described
above or as a purified product from a non-recombinant source such as
naturallv_ occurring cells
and/or tissues.
In one preferred embodiment, the purification of recombinant polypeptides or
fragments
1 o can be accomplished using fusions of polypeptides or fragments of the
invention to another
polypeptide to aid in the purification of polypeptides or fragments of the
invention. Such fusion
partners can include the poly-His or other antigenic identification peptides
described above as
well as the Fc moieties described previously.
With respect to any type of host cell, as is known to the skilled artisan,
procedures for
15 purifying a recombinant polypeptide or fragment will vary according to such
factors as the type
of host cells employed and whether or not the recombinant polypeptide or
fragment is secreted
into the culture medium.
In general, the recombinant polypeptide or fragment can be isolated from the
host cells if
not secreted, or from the medium or supernatant if soluble and secreted,
followed by one or
2o more concentration, salting-out, ion extrhange, hydrophobic interaction,
affinity purification or
size exclusion chromatography steps. As to specific ways to accomplish these
steps, the culture
medium first can be concentrated using a commercially available protein
concentration filter, for
example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the
concentration step,
the concentrate can be applied to a purification matrix such as a gel
filtration medium.
25 Alternatively, an anion exchange resin can be employed, for example, a
matrix or substrate
having pendant diethylaminoethyl (DEAF) groups. The matrices can be
acrylamide, agarose,
dextran, cellulose or other types commonly employed in protein purification.
Alternatively, a
canon exchange step can be employed. Suitable cation exchangers include
various insoluble
matrices comprising sulfopropyl or carboxymethyl groups. In addition, a
chromatofocusing step
3o can be employed. Alternatively, a hydrophobic interaction chromatography
step can be
employed. Suitable matrices can be phenyl or octyl moieties bound to resins.
In addition,
affinity chromatography with a matrix which selectively binds the recombinant
protein can be
employed. Examples of such resins employed are lectin columns, dye columns,
and metal-
cheIating columns. Finally, one or more reverse-phase high performance liquid
chromatography
-39-
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788 '
(RP-HPLC) steps employing hydrophobic RP-HPLC media, (e.g., silica gel or
polymer resin
having pendant methyl, octyl, octyldecyl or other aliphatic groups) can be
employed to further
purify the polypeptides. Some or all of the foregoing purification steps, in
various
combinations, are well known and can be employed to provide an isolated and
purified
recombinant protein.
It is also possible to utilize an affinity column comprising a polypeptide-
binding protein
of the invention, such as a monoclonal antibody generated against polypeptides
of the invention,
to affinity-purify expressed polypeptides. These polypeptides can be removed
from an affinity
column using conventional techniques, e.g., in a high salt elution buffer and
then dialyzed into a
to lower salt buffer for use or by changing pH or other components depending
on the affinity
matrix utilized, or be competitively removed using the naturally occurring
substrate of the
affinity moiety, such as a poIypeptide derived from the invention.
In this aspect of the invention, polypeptide-binding proteins, such as the
anti-polypeptide
antibodies of the invention or other proteins that may interact with the
polypeptide of the
15 invention, can be bound to a solid phase support such as a column
chromatography matrix or a
similar substrate suitable for identifying, separating, or purifying cells
that express polypeptides
of the invention on their surface. Adherence of polypeptide-binding proteins
of the invention to
a solid phase contacting surface can be accomplished by any means. For
example, magnetic
microspheres can be coated with these polypeptide-binding proteins and held in
the incubation
2o vessel through a magnetic field. Suspensions of cell mixtures are contacted
with the solid phase
that has such polypeptide-binding proteins thereon. Cells having polypeptides
of the invention
on their surface bind to the fixed polypeptide-binding protein and unbound
cells then are washed
away. This affinity-binding method is useful for purifying, screening, or
separating such
polypeptide-expressing cells from solution. Methods of releasing positively
selected cells from
25 the solid phase are known in the art and encompass, for example, the use of
enzymes. Such
enzymes are preferably non-toxic and non-injurious to the cells and are
preferably directed to
cleaving the cell-surface binding partner.
Alternatively, mixtures of cells suspected of containing polypeptide-
expressing cells of
the invention first can be incubated with a biotinylated polypeptide-binding
protein of the
3o invention. Incubation periods are typically at least one hour in duration
to ensure sufficient
binding to polypeptides of the invention. The resulting mixture then is passed
through a column
packed with avidin-coated beads, whereby the high affinity of biotin for
avidin provides the
binding of the polypeptide-binding cells to the beads. Use of avidin-coated
beads is known in
-40-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
the art. See Berenson, et al. J. Cell. Biochem., lOD:239 (1986). Wash of
unbound material and
the release of the bound cells is performed using conventional methods.
The desired degree of purity depends on the intended use of the protein. A
relatively
high degree of purity is desired when the poiypeptide is to be administered in
vivo, for example.
In such a case. the polypeptides are purif ed such that no protein bands
corresponding to other
proteins are detectable upon analysis by SDS-polyacrylamide gel
electrophoresis (SDS-PAGE).
It will be recognized by one skilled in the pertinent field that multiple
bands corresponding to
the polypeptide may be visualized by SDS-PAGE, due to differential
glycosylation, differential
post-translational processing, and the like. Most preferably, the polypeptide
of the invention is
Io purified to substantial homogeneity, as indicated by a single protein band
upon analysis by SDS-
PAGE. The protein band may be visualized by silver staining, Coomassie blue
staining, or (if
the protein is radiolabeled) by autoradiography.
Assays
The purif ed polypeptides of the invention (including proteins, polypeptides,
fragments,
variants, oligomers, and other forms) may be tested for the ability to bind a
cognate, ligand,
receptor, substrate, or counter-structure and the like ("binding partner") in
any suitable assay,
such as a conventional binding assay. To illustrate, the polypeptide may be
labeled with a
detectable reagent (e.g., a radionuclide, chromophore, enzyme that catalyzes a
colorimetric or
2o fluorometric reaction, and the like). The labeled polypeptide is contacted
with cells expressing
the binding partner. The cells then are washed to remove unbound labeled
polypeptide, and the
presence of cell-bound label is determined by a suitable technique, chosen
according to the
nature of the label.
One example of a binding assay procedure is as follows. A recombinant
expression
i5 vector containing the binding partner cDNA is constructed using methods
known in the art.
CV1-EBNA-1 cells in 10 cm2 dishes are transfected with the recombinant
expression vector.
CV-I/EBNA-1 cells (ATCC CRL 10478) constitutively express EBV nuclear antigen-
1 driven
from the CMV immediate-early enhancer/promoter. CV 1-EBNA-1 was derived from
the
African Green Monkey kidney cell line CV-1 (ATCC CCL 70), as described by
McMahan et al.
3o (EMBO J. 10:2821, 1991 ).
The transfected cells are cultured for 24 hours, and the cells in each dish
then are split
into a 24-well plate. After culturing an additional 48 hours, the transfected
cells (about 4 x 10'~
ceIls/weil) are washed with BM-NFDM, which is binding medium (RPMI I640
containing 25
mg/ml bovine serum albumin, 2 mg/ml sodium azide, 20 mM Hepes pH 7.2) to which
50 mg/ml
-41 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
nonfat dry milk has been added. The cells then are incubated for 1 hour at
37°C with various
concentrations of, for example, a soluble polypeptide/Fc fusion protein made
as set forth above.
Cells then are washed and incubated with a constant saturating concentration
of a ~ZSI-mouse
anti-human IgG in binding medium, with gentle agitation for i hour at
37°C. After extensive
washing, cells are released via trypsinization.
The mouse anti-human IgG employed above is directed against the Fc region of
human
IgG and can be obtained from Jackson Immunoresearch Laboratories, Inc., West
Grove, PA.
The antibody is radioiodinated using the standard chloramine-T method. The
antibody will bind
to the Fc portion of any polypeptide/Fc protein that has bound to the cells.
In all assays, non-
t0 specific binding of ~ZSI-antibody is assayed in the absence of the Fc
fusion protein/Fc, as well as
in the presence of the Fc fusion protein and a 200-fold molar excess of
unlabeled mouse anti-
human IgG antibody.
Cell-bound ~ZSI-antibody is quantified on a Packard Autogamma counter.
Affinity
calculations (Scatchard, Ann. N. Y. Acad Sci. S 1:660, 1949) are generated on
RS/1 (BBN
t5 Software, Boston, MA) run on a Microvax computer.
Another type of suitable binding assay is a competitive binding assay. To
illustrate,
biological activity of a variant may be determined by assaying for the
variant's ability to
compete with the native protein for binding to the binding partner.
Competitive binding assays can be performed by conventional methodology.
Reagents
2o that may be employed in competitive binding assays include radiolabeled IMX
polypeptides and
intact cells expressing the IMX polypeptide (endogenous or recombinant) on the
cell surface.
For example, a radiolabeled soluble IMX polypeptide fragment can be used to
compete with a
soluble IMX polypeptide variant for binding to the cell surface binding
partner. Instead of intact
cells, one could substitute a soluble binding partner/Fc fusion protein bound
to a solid phase
25 through the interaction of Protein A or Protein G (on the solid phase) with
the Fc moiety.
Chromatography columns that contain Protein A and Protein G include those
available from
Pharmacia Biotech, Inc., Piscataway, NJ.
Another type of competitive binding assay utilizes the radiolabeled soluble
binding
partner, such as a soluble binding partner/Fc fusion protein, and intact cells
expressing the IMX
3o polypeptide. Qualitative results can be obtained by competitive
autoradiographic plate binding
assays, while Scatchard plots (Scatchard, Ann. N. Y. Acad Sci. 51:660, 1949)
may be utilized to
generate quantitative results.
- 42 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
USE OF 1MX NUCLEIC ACIDS OR OLIGONUCLEOTIDES
In addition to being used to express polypeptides as described above, the
nucleic acids of
the invention, including DNA, and oligonucleotides thereof can be used:
as probes to identify nucleic acid encoding proteins homologous to IMX
polypeptides;
to identify human chromosomes;
_ to map genes on human chromosome numbers 7, 19, and 22;
to identify genes associated with certain diseases, syndromes, or other
conditions associated with human chromosome numbers 7, 19, and 22;
to _ as single-stranded sense or antisense oligonucleotides, to inhibit
expression of
polypeptide encoded by the IMX sequences;
_ to help detect defective genes in an individual; and
for gene therapy.
15 Probes
Among the uses of nucleic acids of the invention is the use of fragments as
probes or
primers. Such fragments generally comprise at least about 17 contiguous
nucleotides of a DNA
sequence. In other embodiments, a DNA fragment comprises at least 30, or at
least 60,
contiguous nucleotides of a DNA sequence.
2o Because homologs of SEQ ID NOs:I-26, from other mammalian species, are
contemplated herein, probes based on the human DNA sequence of SEQ ID NOs:I-26
may be
used to screen cDNA libraries derived from other mammalian species, using
conventional cross-
species hybridization techniques.
Using knowledge of the genetic code in combination with the amino acid
sequences set
25 forth above, sets of degenerate oligonucleotides can be prepared. Such
oligonucleotides are
useful as primers, e.g., in polymerase chain reactions (PCR), whereby DNA
fragments are
isolated and amplified.
- 43 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Identifyin~ Chromosome Number
All or a portion of the nucleic acids of SEQ )D NOs:I-26, including
oligonucleotides,
can be used by those skilled in the art using well-known techniques to
identify the human
chromosomes, and the specific locus thereof, that contain the DNA of IMX
family members.
Useful techniques include, but are not limited to, using the sequence or
portions, including
oligonucleotides, as a probe in various well-known techniques such as in situ
hybridization to
chromosome spreads, Southern blot hybridization to hybrid cell lines,
fluorescent tagging, and
radiation hybrid mapping.
1o For example, chromosomes can be mapped by radiation hybridization.
PCR is performed using the Whitehead Institute/MIT Center for Genome Research
Genebridge4
panel of 93 radiation hybrids (http://www-genome.wi.mit.edu/ftp/distribution/
human_STS_releases/july97/rhmap/genebridge4.html). Primers are used which lie
within a
putative exon of the gene of interest and which amplify a product from human
genomic DNA,
t 5 but do not amplify hamster genomic DNA. The results of the PCRs are
converted into a data
vector that is submitted to the Whitehead/MIT Radiation Mapping site on the
Internet
(http://www-seq.wi.mit.edu). The data is scored and the chromosomal assignment
and
placement relative to known Sequence Tag Site (STS) markers on the radiation
hybrid map is
provided. The following web site provides additional information about
radiation hybrid
2o mapping: http://www-genome.wi.mit.edu/ftp/distribution/human_STS
releases/july97/
07-97.INTRO.html).
Identifyin~ Associated Diseases
As described previously, IMX molecules numbered 4, 21, 44, and 56 have been
mapped
25 to particular chromosome locations. Thus, the nucleic acid of a particular
IMX molecule or a
fragment thereof can be used by one skilled in the art using well-known
techniques to analyze
abnormalities associated with gene mapping to such chromosomes. This enables
one to
distinguish conditions in which this marker is rearranged or deleted. In
addition, nucleotides of
such IMX molecules or fragments thereof can be used as a positional marker to
map other genes
30 of previously unknown location.
The DNA may be used in developing treatments for any disorder mediated
(directly or
indirectly) by defective, or insufficient amounts of, the genes corresponding
to the nucleic acids
of the invention. Disclosure herein of native nucleotide sequences permits the
detection of
defective genes, and the replacement thereof with normal genes. Defective
genes may be
-44-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
detected in in vitro diagnostic assays, and by comparison of a native
nucleotide sequence
disclosed herein with that of a gene derived from a person suspected of
harboring a defect in this
gene.
Sense-Antisense
Other useful fragments of the nucleic acids include antisense or sense
oligonucleotides
comprising a single-stranded nucleic acid sequence (either RNA or DNA) capable
of binding to
target mRNA (sense) or DNA {antisense) sequences. Antisense or sense
oligonucleotides
according to the present invention comprise a fragment of DNA (SEQ ID NOs:I-
26). Such a
1o fragment generally comprises at least about 14 nucleotides, preferably from
about 14 to about 30
nucleotides. The ability to derive an antisense or a sense oligonucleotide,
based upon a cDNA
sequence encoding a given protein is described in, for example, Stein and
Cohen (Cancer Res.
48:2659, 1988) and van der Krol et al. (BioTechniques 6:958, 1988).
Binding of antisense or sense oligonucleotides to target nucleic acid
sequences results in
15 the formation of duplexes that block or inhibit protein expression by one
of several means,
including enhanced degradation of the mRNA by RNAseH, inhibition of splicing,
premature
termination of transcription or translation, or by other means. The antisense
oligonucleotides
thus may be used to block expression of proteins. Antisense or sense
oligonucleotides further
comprise oligonucleotides having modified sugar-phosphodiester backbones (or
other sugar
20 linkages, such as those described in W091/06629) and wherein such sugar
linkages are resistant
to endogenous nucleases. Such oligonucleotides with resistant sugar linkages
are stable in vivo
(i.e., capable of resisting enzymatic degradation) but retain sequence
specificity to be able to
bind to target nucleotide sequences.
Other examples of sense or antisense oligonucleotides include those
oligonucleotides
25 which are covalently linked to organic moieties, such as those described in
WO 90/10448, and
other moieties that increases affinity of the oligonucleotide for a target
nucleic acid sequence,
such as poly-(L-lysine). Further still, intercalating agents, such as
eliipticine, and alkyiating
agents or metal complexes may be attached to sense or antisense
oligonucleotides to modify
binding specificities of the antisense or sense oligonucleotide for the target
nucleotide sequence.
3o Antisense or sense oligonucleotides may be introduced into a cell
containing the target
nucleic acid sequence by any gene transfer method, including, for example,
lipofection, CaPOa-
mediated DNA transfection, electroporation, or by using gene transfer vectors
such as Epstein-
Barr virus.
- 45 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Sense or antisense oligonucleotides also may be introduced into a cell
containing the
target nucleotide sequence by formation of a conjugate with a ligand binding
molecule, as
described in WO 91/04753. Suitable ligand binding molecules include, but are
not limited to,
cell surface receptors, growth factors, other cytokines, or other ligands that
bind to cell surface
receptors. Preferably, conjugation of the ligand binding molecule does not
substantially
interfere with the ability of the ligand binding molecule to bind to its
corresponding molecule or
receptor, or block entry of the sense or antisense oligonucleotide or its
conjugated version into
the cell.
Alternatively, a sense or an antisense oligonucleotide may be introduced into
a cell
to containing the target nucleic acid sequence by formation of an
oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex
is preferably
dissociated within the cell by an endogenous lipase.
USE OF IMX POLYPEPTIDES AND FRAGMENTED POLYPEPTIDES
~ 5 Uses include, but are not limited to, the following:
- Purifying proteins and measuring activity thereof
- Delivery Agents
- Therapeutic and Research Reagents
- Molecular weight and Isoelectric focusing markers
20 - Controls for peptide fragmentation
- Identification of unknown proteins
- Preparation of Antibodies
Purification Reagents
Z5 Each of the polypeptides of the invention finds use as a protein
purification reagent. The
polypeptides may be attached to a solid support material and used to purify
(binding partner)
proteins by affinity chromatography. In particular embodiments, a polypeptide
(in any form
described herein that is capable of binding (binding partner)) is attached to
a solid support by
conventional procedures. As one example, chromatography columns comaining
functional
30 groups that will react with functional groups on amino acid side chains of
proteins are available
(Pharmacia Biotech, Inc., Piscataway, NJ). In an alternative, a polypeptide/Fc
protein (as
discussed above) is attached to Protein A- or Protein G-containing
chromatography columns
through interaction with the Fc moiety.
-46-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
The polypeptide also finds use in purifying or identifying cells that express
(binding
partner) on the cell surface. Polypeptides are bound to a solid phase such as
a column
chromatography matrix or a similar suitable substrate. For example, magnetic
microspheres can
be coated with the polypeptides and held in an incubation vessel through a
magnetic field.
Suspensions of cell mixtures containing (binding partner) expressing cells are
contacted with the
solid phase having the polypeptides thereon. Cells expressing (binding
partner) on the cell
surface bind to the fixed polypeptides, and unbound cells then are washed
away.
Alternatively, the polypeptides can be conjugated to a detectable moiety, then
incubated
with cells to be tested for (binding partner) expression. After incubation,
unbound labeled
1o matter is removed and the presence or absence of the detectable moiety on
the cells is
determined.
In a further alternative, mixtures of cells suspected of containing (binding
partner) cells
are incubated with biotinylated poiypeptides. Incubation periods are typically
at least one hour
in duration to ensure sufficient binding. The resulting mixture then is passed
through a column
packed with avidin-coated beads, whereby the high affinity of biotin for
avidin provides binding
of the desired cells to the beads. Procedures for using avidin-coated beads
are known (see
Berenson, et al. J. Cell. Biochem., l OD:239, 1986). Washing to remove unbound
material, and
the release of the bound cells, are performed using conventional methods.
Measuring Activity
Polypeptides also fnd use in measuring the biological activity of (binding
partner)
protein in terms of their binding affinity. The polypeptides thus may be
employed by those
conducting "quality assurance" studies, e.g., to monitor shelf life and
stability of protein under
different conditions. For example, the polypeptides may be employed in a
binding affinity study
to measure the biological activity of a (binding partner) protein that has
been stored at different
temperatures, or produced in different cell types. The proteins also may be
used to determine
whether biological activity is retained after modification of a (binding
partner) protein (e.g.,
chemical modification, truncation, mutation, etc.). The binding affinity of
the modified (binding
partner) protein is compared to that of an unmodified (binding partner)
protein to detect any
3o adverse impact of the modifications on biological activity of (binding
partner). The biological
activity of a (binding partner) protein thus can be ascertained before it is
used in a research
study, far example.
-47-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Delivery Aeents
The polypeptides also find use as carriers for delivering agents attached
thereto to cells
bearing binding partner. Cells expressing (binding partner) include those
identified in (add
citation if reference known). The polypeptides thus can be used to deliver
diagnostic or
therapeutic agents to such cells (or to other cell types found to express
(binding partner) on the
cell surface) in in vitro or in vivo procedures.
Detectable (diagnostic) and therapeutic agents that may be attached to a
polypeptide
include, but are not limited to, toxins, other cytotoxic agents, drugs,
radionuclides,
chromophores, enzymes that catalyze a colorimetric or fluorometric reaction,
and the like, with
the particular agent being chosen according to the intended application. Among
the toxins are
ricin, abrin, diphtheria toxin, Pseudomonas aeruginosa exotoxin A, ribosomal
inactivating
proteins, mycotoxins such as trichothecenes, and derivatives and fragments
(e.g., single chains)
thereof. Radionuclides suitable for diagnostic use include, but are not
limited to, ~23h 131h 99mTc,
15 ~~~In, and 76Br. Examples ofradionuclides suitable for therapeutic use are
13~I, zuAt,'7Br, ~86Re,
~saRe~ z~zPb~ znBi~ ~o9Pd, 6aCu, and 6'Cu.
Such agents may be attached to the polypeptide by any suitable conventional
procedure.
The polypeptide comprises functional groups on amino acid side chains that can
be reacted with
functional groups on a desired agent to form covalent bonds, for example.
Alternatively, the
20 protein or agent may be derivatized to generate or attach a desired
reactive functional group.
The derivatization may involve attachment of one of the bifunctional coupling
reagents available
for attaching various molecules to proteins (Pierce Chemical Company,
Rockford, Illinois). A
number of techniques for radiolabeling proteins are known. Radionuclide metals
may be
attached to polypeptides by using a suitable bifunctional chelating agent, for
example.
25 Conjugates comprising polypeptides and a suitable diagnostic or therapeutic
agent
(preferably covalently linked) are thus prepared. The conjugates are
administered or otherwise
employed in an amount appropriate for the particular application.
Therapeutic Agents
3o Polypeptides of the invention may be used in developing treatments for any
disorder
mediated (directly or indirectly) by defective, or insufficient amounts of the
polypeptides. These
polypeptides may be administered to a mammal afflicted with such a disorder.
The polypeptides may also be employed in inhibiting a biological activity of
(binding
partner), in in vitro or irr vivo procedures. For example, a purified
polypeptide may be used to
- 48 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
inhibit binding of (binding partner) to endogenous cell surface (binding
partner). Biological
effects that result from the binding of (binding partner) to endogenous
receptors thus are
inhibited.
IMX polypeptides may be administered to a mammal to treat a (binding partner-
mediated disorder. Such (binding partner)-mediated disorders include
conditions caused
(directly or indirectly) or exacerbated by (binding partner).
Compositions of the present invention may contain a polypeptide in any form
described
herein, such as native proteins, variants, derivatives, oiigomers, and
biologically active
fragments. In particular embodiments, the composition comprises a soluble
polypeptide or an
to oligomer comprising soluble polypeptides.
Compositions comprising an effective amount of a polypeptide of the present
invention,
in combination with other components such as a physiologically acceptable
diluent, carrier, or
excipient, are provided herein. The polypeptides can be formulated according
to known
methods used to prepare pharmaceutically useful compositions. They can be
combined in
is admixture, either as the sole active material or with other known active
materials suitable for a
given indication, with pharmaceutically acceptable diluents (e.g., saline,
Tris-HCI, acetate, and
phosphate buffered solutions), preservatives (e.g., thimerosal, benzyl
alcohol, parabens),
emulsifiers, solubilizers, adjuvants and/or carriers. Suitable formulations
for pharmaceutical
compositions include those described in Remington's Pharmaceutical Sciences,
I6th ed. 1980,
2o Mack Publishing Company, Eastan, PA.
In addition, such compositions can be complexed with polyethylene glycol
(PEG), metal
ions, or incorporated into polymeric compounds such as polyacetic acid,
polyglycolic acid,
hydrogels, dextran, etc., or incorporated into liposomes, microemulsions,
micelles, unilamellar
or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Such
compositions will influence
25 the physical state, solubility, stability, rate of in vivo release, and
rate of in vivo clearance, and
are thus chosen according to the intended application.
The compositions of the invention can be administered in any suitable manner,
e.g.,
topically, parenterally, or by inhalation. The term "parenteral" includes
injection, e.g., by
subcutaneous, intravenous, or intramuscular routes, also including localized
administration, e.g.,
3o at a site of disease or injury. Sustained release from implants is also
contemplated. One skilled
in the pertinent art will recognize that suitable dosages will vary, depending
upon such factors as
the nature of the disorder to be treated, the patient's body weight, age, and
general condition, and
the route of administration. Preliminary doses can be determined according to
animal tests, and
-49-
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
the scaling of dosages for human administration is performed according to art-
accepted
practices.
Compositions comprising nucleic acids in physiologically acceptable
formulations are
also contemplated. DNA may be formulated for injection, for example.
Research Agents
Another use of the polypeptide of the present invention is as a research tool
for studying
the biological effects that result from inhibiting interactions between
polypeptides of the
invention and their "binding partner". Polypeptides also may be employed in in
vitro assays for
o detecting binding partner or cells expressing the binding partner or the
interactions thereof.
Molecular Weight. Isoelectric Point Markers
The polypeptides of the present invention can be subjected to fragmentation
into smaller
peptides by chemical and enzymatic means, and the peptide fragments so
produced can be used
in the analysis of other proteins or polypeptides. For example, such peptide
fragments can be
15 used as peptide molecular weight markers, peptide isoelectric point
markers, or in the analysis of
the degree of peptide fragmentation. Thus, the invention also includes these
polypeptides and
peptide fragments, as well as kits to aid in the determination of the apparent
molecular weight
and isoelectric point of an unknown protein and kits to assess the degree of
fragmentation of an
unknown protein.
2o Although all methods of fragmentation are encompassed by the invention,
chemical
fragmentation is a preferred embodiment, and includes the use of cyanogen
bromide to cleave
under neutral or acidic conditions such that specific cleavage occurs at
methionine residues (E.
Gross, Methods in Enz. 11:238-255, 1967). This can further include additional
steps, such as a
carboxymethyiation step to convert cysteine residues to an unreactive species.
25 Enzymatic fragmentation is another preferred embodiment, and includes the
use of a
protease such as Asparaginylendo-peptidase, Arginylendo-peptidase,
Achromobacter protease I,
Trypsin, Staphlococcus aureus V8 protease, Endoproteinase Asp-N, or
Endoproteinase Lys-C
under conventional conditions to result in cleavage at specific amino acid
residues.
Asparaginylendo-peptidase can cleave specifically on the carboxyl side of the
asparagine
3o residues present within the polypeptides of the invention. Arginylendo-
peptidase can cleave
specifically on the carboxyl side of the arginine residues present within
these polypeptides.
Achromobacter protease I can cleave specifically on the carboxyl side of the
lysine residues
present within the polypeptides (Sakiyama and Nakat, U.S. Patent No.
5,248,599; T. Masaki et
al., Biochim. Biophvs. Acta 660:44-50, 1981; T. Masaki et al., Biochim.
Biophrs. Acta 660:51-
-SO-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
55, 1981 ). Trypsin can cleave specifically on the carboxyl side of the
arginine and lysine
residues present within polypeptides of the invention. Enzymatic fragmentation
may also occur
with a protease that cleaves at multiple amino acid residues. For example,
Staphlococcus aureus
V8 protease can cleave specifically on the carboxyl side of the aspartic and
giutamic acid
residues present within polypeptides (D. W. Cleveland, J. Biol. Chem. 3:1102-
1106, 1977).
Endoproteinase Asp-N can cleave specifically on the amino side of the
asparagine residues
present within polypeptides. Endoproteinase Lys-C can cleave specifically on
the carboxyl side
of the lysine residues present within polypeptides of the invention. Other
enzymatic and
chemical treatments can likewise be used to specifically fragment these
polypeptides into a
1o unique set of specific peptides.
Of course, the peptides and fragments of the polypeptides of the invention can
also be
produced by conventional recombinant processes and synthetic processes well
known in the art.
With regard to recombinant processes, the polypeptides and peptide fragments
encompassed by
invention can have variable molecular weights, depending upon the host cell in
which they are
expressed. Glycosylation of polypeptides and peptide fragments of the
invention in various cell
types can result in variations of the molecular weight of these pieces,
depending upon the extent
of modification. The size of these pieces can be most heterogeneous with
fragments of
polypeptide derived from the extracellular portion of the polypeptide.
Consistent polypeptides
and peptide fragments can be obtained by using polypeptides derived entirely
from the
2o transmembrane and cytoplasmic regions, pretreating with N-glycanase to
remove glycosylation,
or expressing the polypeptides in bacterial hosts.
The molecular weight of these polypeptides can also be varied by fusing
additional
peptide sequences to both the amino and carboxyl tenminal ends of polypeptides
of the
invention. Fusions of additional peptide sequences at the amino and carboxyl
terminal ends of
polypeptides of the invention can be used to enhance expression of these
polypeptides or aid in
the purification of the protein. In addition, fusions of additional peptide
sequences at the amino
and carboxyl terminal ends of polypeptides of the invention will alter some,
but usually not all,
of the fragmented peptides of the polypeptides generated by enzymatic or
chemical treatment.
Of course, mutations can be introduced into polypeptides of the invention
using routine and
3o known techniques of molecular biology. For example, a mutation can be
designed so as to
eliminate a site of proteolytic cleavage by a specific enzyme or a site of
cleavage by a specific
chemically induced fragmentation procedure. The elimination of the site will
alter the peptide
fingerprint of polypeptides of the invention upon fragmentation with the
specific enzyme or
chemical procedure.
-51 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
The polypeptides and the resultant fragmented peptides can be analyzed by
methods
including sedimentation, electrophoresis, chromatography, and mass
spectrometry to determine
their molecular weights. Because the unique amino acid sequence of each piece
specifies a
molecular weight, these pieces can thereafter serve as molecular weight
markers using such
analysis techniques to assist in the determination of the molecular weight of
an unknown
protein, polypeptides or fragments thereof. The molecular weight markers of
the invention serve
particularly well as molecular weight markers for the estimation of the
apparent molecular
weight of proteins that have similar apparent molecular weights and,
consequently, allow
increased accuracy in the determination of apparent molecular weight of
proteins.
to When the invention relates to the use of fragmented peptide molecular
weight markers,
those markers are preferably at least 10 amino acids in size. More preferably,
these fragmented
peptide molecular weight markers are between 10 and 100 amino acids in size.
Even more
preferable are fragmented peptide molecular weight markers between 10 and 50
amino acids in
size and especially between 10 and 35 amino acids in size. Most preferable are
fragmented
~ 5 peptide molecular weight markers between 10 and 20 amino acids in size.
Among the methods for determining molecular weight are sedimentation, gel
electrophoresis, chromatography, and mass spectrometry. A particularly
preferred embodiment
is denaturing polyacrylamide gel electrophoresis (U. K. Laemmli, Nature
227:680-685, 1970).
Conventionally, the method uses two separate lanes of a gel containing sodium
dodecyl sulfate
2o and a concentration of acrylamide between 6-20%. The ability to
simultaneously resolve the
marker and the sample under identical conditions allows for increased
accuracy. It is
understood, of course, that many different techniques can be used for the
determination of the
molecular weight of an unknown protein using polypeptides of the invention,
and that this
embodiment in no way limits the scope of the invention.
25 Each unglycosylated polypeptide or fragment thereof has a pI that is
intrinsically
determined by its unique amino acid sequence (which pI can be estimated by the
skilled artisan
using any of the computer programs designed to predict pI values currently
available, calculated
using any well-known amino acid pKa table, or measured empirically). Therefore
these
polypeptides and fragments thereof can serve as specific markers to assist in
the determination
30 of the isoelectric point of an unknown protein, polypeptide, or fragmented
peptide using
techniques such as isoelectric focusing. These polypeptide or fragmented
peptide markers serve
particularly well for the estimation of apparent isoelectric points of unknown
proteins that have
apparent isoelectric points close to that of the polypeptide or fragmented
peptide markers of the
invention.
-52-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
The technique of isoelectric focusing can be further combined with other
techniques such
as gel electrophoresis to simultaneously separate a protein on the basis of
molecular weight and
charge. The ability to simultaneously resolve these polypeptide or fragmented
peptide markers
and the unknown protein under identical conditions allows for increased
accuracy in the
determination of the apparent isoelectric point of the unknown protein. This
is of particular
interest in techniques, such as two dimensional electrophoresis (T.D. Brock
and M.T. Madigan,
Biology of Microorganisms 76-77 (Prentice I-call, 6d ed. 1991 )), where the
nature of the
procedure dictates that any markers should be resolved simultaneously with the
unknown
protein. In addition, with such methods, these polypeptides and fragmented
peptides thereof can
1o assist in the determination of both the isoelectric point and molecular
weight of an unknown
protein or fragmented peptide.
Polypeptides and fragmented peptides can be visualized using two different
methods that
allow a discrimination between the unknown protein and the molecular weight
markers. In one
embodiment, the polypeptide and fragmented peptide molecular weight markers of
the invention
~ 5 can be visualized using antibodies generated against these markers and
conventional
immunoblotting techniques. This detection is performed under conventional
conditions that do
not result in the detection of the unknown protein. It is understood that it
may not be possible to
generate antibodies against all polypeptide fragments of the invention, since
small peptides may
not contain immunogenic epitopes. It is further understood that not all
antibodies will work in
2o this assay; however, those antibodies which are able to bind polypeptides
and fragments of the
invention can be readily determined using conventional techniques.
The unknown protein is also visualized by using a conventional staining
procedure. The
molar excess of unknown protein to polypeptide or fragmented peptide molecular
weight
markers of the invention is such that the conventional staining procedure
predominantly detects
25 the unknown protein. The level of these polypeptide or fragmented peptide
molecular weight
markers is such as to allow little or no detection of these markers by the
conventional staining
method. The preferred molar excess of unknown protein to polypeptide molecular
weight
markers of the invention is between 2 and 100,000 fold. More preferably, the
preferred molar
excess of unknown protein to these polypeptide molecular weight markers is
between 10 and
30 10,000 fold and especially between 100 and 1,000 fold.
It is understood of course that many techniques can be used for the
determination and
detection of molecular weight and isoelectric point of an unknown protein,
polypeptides, and
fragmented peptides thereof using these polypeptide molecular weight markers
and peptide
fragments thereof and that these embodiments in no way limit the scope of the
invention.
-53-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
In another embodiment, the analysis of the progressive fragmentation of the
polypeptides
of the invention into specific peptides (D. W. Cleveland et al., J. Biol.
Chem. 252: I I02-I 106,
1977), such as by altering the time or temperature of the fragmentation
reaction, can be used as a
control for the extent of cleavage of an unknown protein. For example,
cleavage of the same
amount of polypeptide and unknown protein under identical conditions can allow
for a direct
comparison of the extent of fragmentation. Conditions that result in the
complete fragmentation
of the polypeptide can also result in complete fragmentation of the unknown
protein.
As to the specific use of the polypeptides and fragmented peptides of the
invention as
molecular weight markers, the fragmentation of the polypeptides of SEQ )D
NOs:27-38 with
to cyanogen bromide generates a unique set of fragmented peptide molecular
weight markers. An
additional fragment results if the initiating methionine is present. The
distribution of methionine
residues determines the number of amino acids in each peptide and the unique
amino acid
composition of each peptide determines its molecular weight.
In addition, the preferred purified polypeptides of the invention (SEQ ID
NOs:27-38)
have calculated molecular weights of approximately 3683, 1783, 11248, 75503,
43040, 8051,
33306, 3515, 10736, 25162, and 2450 Daltons.
Where an intact protein is used, the use of these polypeptide molecular weight
markers
allows increased accuracy in the determination of apparent molecular weight of
proteins that
have apparent molecular weights close to 3683, 1783, 11248, 75503, 43040,
8051, 33306, 3515,
10736, 25162, or 2450 Daltons. Where fragments are used, there is increased
accuracy in
determining molecular weight over the range of the molecular weights of the
fragment.
Finally, as to the kits that are encompassed by the invention, the
constituents of such kits
can be varied, hut typically contain the polypeptide and fragmented peptide
molecular weight
markers. Also, such kits can contain the poiypeptides wherein a site necessary
for fragmentation
has been removed. Furthermore, the kits can contain reagents for the specific
cleavage of the
polypeptide and the unknown protein by chemical or enzymatic cleavage. Kits
can further
contain antibodies directed against polypeptides or fragments thereof of the
invention.
Identification of Unknown Proteins
As set forth above, a polypeptide or peptide fingerprint can be entered into
or compared
to a database of known proteins to assist in the identification of the unknown
protein using mass
spectrometry (W.J. Henzel et al., Proc. Natl. Acad Sci. USA 90:5011-5015,
1993; D. Fenyo et
al., Electrophoresis 19:998-1005, 1998). A variety of computer software
programs to facilitate
these comparisons are accessible via the Internet, such as Protein Prospector
(Internet site:
-54-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
prospector.uscf.edu), MuItiIdent (Internet site:
www.expasy.clv'sprotimultiident.html},
PeptideSearch (Internet site: www.mane.embl-heiedelberg.de...deSearch/FR
PeptideSearch
Form.html), and ProFound (Internet site: www.chait-sgi.rockefeller.edu/cgi-
bin/prot-id-
frag.html). These programs allow the user to specify the cleavage agent and
the molecular
weights of the fragmented peptides within a designated tolerance. The programs
compare these
molecular weights to protein databases to assist in determining the identity
of the unknown
protean.
In addition, a polypeptide or peptide digest can be sequenced using tandem
mass
spectrometry (MS/MS) and the resulting sequence searched against databases
(J.K. Eng, et al., J.
l0 Am. Soc. Mass Spec. 5:976-989 (1994); M. Mann and M. Wilm, Anal. Chem.
66:4390-4399
(1994); J.A. Taylor and R.S. Johnson, Rapid Comm. Mass Spec. 11:1067-1075
(1997)).
Searching programs that can be used in this process exist on the Internet,
such as Lutefisk 97
(Internet site: www.Isbc.com:70/Lutefisk97.htm1), and the Protein Prospector,
Peptide Search
and ProFound programs described above. Therefore, adding the sequence of a
gene and its
15 predicted protein sequence and peptide fragments to a sequence database can
aid in the
identification of unknown proteins using tandem mass spectrometry.
Antibodies
Antibodies that are immunoreactive with the polypeptides of the invention are
provided
2o herein. Such antibodies specifically bind to the polypeptides via the
antigen-binding sites of the
antibody (as opposed to non-specific binding). Thus, the polypeptides,
fragments, variants,
fusion proteins, etc., as set forth above may be employed as immunogens in
producing
antibodies immunoreactive therewith.
Polyclonal and monoclonal antibodies may be prepared by conventional
techniques.
25 See, for example, Monoclonal A~rtibodies, Hybridomas: A New Dimension in
Biological
Analyses, Kennet et al. (eds.), Plenum Press, New York (1980); and Antibodies:
A Labora~on~
Manual , Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold
Spring Harbor,
NY, ( 1988).
Antigen-binding fragments of such antibodies, which may be produced by
conventional
3o techniques, are also encompassed by the present invention. Examples of such
fragments
include, but are not limited to, Fab and F(ab')a fragments. Antibody fragments
and derivatives
produced by genetic engineering techniques are also provided.
The monoclonal antibodies of the present invention include chimeric
antibodies, e.g.,
humanized versions of murine monoclonal antibodies. Such humanized antibodies
may be
-55-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
prepared by known techniques, and offer the advantage of reduced
immunogenicitv when the
antibodies are administered to humans. In one embodiment, a humanized
monoclonal antibody
comprises the variable region of a murine antibody (or just the antigen
binding site thereof) and
a constant region derived from a human antibody. Alternatively, a humanized
antibody
fragment may comprise the antigen binding site of a murine monoclonal antibody
and a variable
region fragment (lacking the antigen-binding site) derived from a human
antibody. Procedures
for the production of chimeric and further engineered monoclonal antibodies
include those
described in Riechmann et al. (Nature 332:323, 1988), Liu et al. (PNAS
84:3439, 1987), Larrick
et al. (BiolTechrrology 7:934, 1989), and Winter and Hams (TIPS 14:139, May,
1993).
1 o Procedures to generate antibodies transgenically can be found in GB
2,272,440, US Patent Nos.
~,~69,825 and 5,545,806 and related patents claiming priority therefrom, all
of which are
incorporated by reference herein.
In one embodiment, the antibodies are specific for the polvpeptides of the
present
invention, and do not cross-react with other proteins. Screening procedures by
which such
15 antibodies may be identified are well known, and may involve immunoaffinity
chromatography,
for example.
Hybridoma cell lines that produce monoclonal antibodies specific for the
polypeptides of
the invention are also contemplated herein. Such hybridomas may be produced
and identified
by conventional techniques. One method for producing such a hybridoma cell
line comprises
2o immunizing an animal with a polypeptide; harvesting spleen cells from the
immunized animal;
fusing said spleen cells to a myeloma cell line, thereby generating hybridoma
cells; and
identifying a hybridoma cell line that produces a monoclonal antibody that
binds the
polypeptide. The monoclonal antibodies may be recovered by conventional
techniques.
25 Uses Thereof
The antibodies of the invention can be used in assays to detect the presence
of the
polypeptides or fragments of the invention, either in vitro or in vivo. The
antibodies also may be
employed in purifying polypeptides or fragments of the invention by
immunoaffinity
chromatography.
3o Those antibodies that additionally can block binding of the polypeptides of
the invention
to the binding partner may be used to inhibit a biological activity that
results from such binding.
Such blocking antibodies may be identified using any suitable assay procedure,
such as by
testing antibodies for the ability to inhibit binding of the binding partner
to certain cells
expressing the binding partner. Alternatively, blocking antibodies may be
identified in assays
-56-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
for the ability to inhibit a biological effect that results from binding
of~the binding partner to
target cells.
Such an antibody may be employed in an irr vitro procedure, or administered in
vivo to
inhibit a biological activity mediated by the entity that generated the
antibody. Disorders caused
or exacerbated (directly or indirectly) by the interaction of (binding
partner) with cell surface
(binding partner) receptor thus may be treated. A therapeutic method involves
irr vivo
administration of a blocking antibody to a mammal in an amount effective in
inhibiting a
(binding partner)-mediated biological activity. Monoclonal antibodies are
generally preferred for
use in such therapeutic methods. In one embodiment, an antigen-binding
antibody fragment is
employed.
Antibodies may be screened for agonistic (i.e., ligand-mimicking) properties.
Such
antibodies, upon binding to cell surface antigen, induce biological effects
(e.g., transduction of
biological signals) similar to the biological effects induced when (binding
partner) binds to cell
sut'face antigen.
15 Compositions comprising an antibody that is directed against a polypeptide
of the
invention, and a physiologically acceptable diluent, excipient, or carrier,
are provided herein.
Also provided herein are conjugates comprising a detectable (e.g., diagnostic)
or
therapeutic agent, attached to the antibody. Examples of such agents are
presented above. The
conjugates find use in in vitro or in vivo procedures.
2o The following examples are provided to further illustrate particular
embodiments of the
invention, and are not to be construed as limiting the scope of the present
invention.
EXAMPLE 1: Isolation of the IMX Nucleic Acids
The T84 Epithelial Barrier Model
25 As discussed above, damage to the intestinal epithelial barrier is a
hallmark of (IBD),
and a number of irr vitro models of epithelial barrier function have been
developed over the
years. The best characterized of these models is the T84 intestinal epithelial
barrier system,
Dharmsathaphorn et al., Am. J. Phvsiol., 246:6204-6208, 1984 and Madara et
al., J. Cell Biol.,
1 O 1:2124-2133,1985).
3o T84 cells were plated on 75 mm polycarbonate transwell filter inserts
(Costar) and grown
in DMEIF 12 ( 1:1 ) containing I 0% heat-inactivated bovine calf serum. The
cells were
maintained at confluence for 2-3 days, and integrity of the epithelial barrier
was determined by
measuring transepithelial electrical resistance (TER) using an EVOM epithelial
voltoltmmeter
(World Precision Instruments). When the TER values were greater than 1000
ohms/cm2 and
-57-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
were stable, cells were treated with interferon-g (30 nglml. Genzyme) added to
the basolateral
side of the membrane. At various times after treatment (4, 24 and 44h), TERs
were measured to
monitor the interferon-induced disruption of the barrier, and RNA was
harvested from the cells
at those time points using TRIzoI reagent (Life Technologies). RNA was
extracted using
conventional methods and subsequently used for TOGAT"t analysis as described
in Example 2.
TOGAT"~ analysis
This example describes a method for determining mRNA expression
characteristics. The
isolated RNA was analyzed using a method of simultaneous sequence-specific
identification of
mRNAs known as TOGAT"t (Total Gene expression Analysis) described in U.S.
Patent No.
5,459,037 and U.S. Patent No. 5,807,680; hereby incorporated herein by
reference. Preferably,
prior to the application of the TOGAT"t technique, the isolated RNA was
enriched to form a
starting polyA-containing mRNA population by methods known in the art. In a
preferred
embodiment, the TOGAT"~ method further comprised an additional PCR step
performed using
four separate reactions, one for each of the four 5' PCR primers, and cDNA
templates prepared
from a population of antisense cRNAs. A final PCR step used 256 5' PCR primers
in 64
subpools for each of the four reactions of the previous step produced PCR
products that were
cDNA fragments that corresponded to the 3'-region of the starting mRNA
population.
The produced PCR products were then identified by a) the sequence of at least
the 5'
seven base pairs, preferably the sequence of the entire fragment, and b) the
length of the
zo fragment. These two parameters, sequence and fragment length, were used to
compare the
obtained PCR products to a database of known polynucleotide sequences. A
database search for
homologous sequences in Genbank resulted in no matches, indicating the novelty
of the IMX
sequences of the invention. The intensities of the PCR products were compared
across the 4
input RNA samples (t=0, 4hr, 24hr, 44hr) and species that were regulated were
identified and
z5 further characterized (Table 1 ).
The DSTs of SEQ ID NO: t -26 and fragments thereof are useful as probes to
study and
diagnose the changes in gene expression demonstrated by the data of Table 1.
Alternatively,
polypeptides and fragments thereof that are the translations of SEQ ID NO:I-26
and fragments
3o thereof are useful as probes to study and diagnose the changes in gene
expression demonstrated
by the data of Table 1.
_58_
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Relative
PCR Fragment
Amount
Name DST SEQ Digital 0 4hr 24hr ~ 44hr
ID NO: Address
(fig I)
IMX 1 TAAG 187 41 I 94 350 299
4
IMX 2 TTCT 159 250 716 250 207
IMX 3 CTTC 364 35 60 330 749
21
IMX 4 CCAT 4l4 I38 435 647 464
28
IMX 5 CCGA 374 237 539 25 32
32
1MX 6 TGGA 450 24 87 110 78
39
IMX 7 TCTA 163 38 294 67 153
40
IMX 8 GAGC 426 145 I 733 876 1076
42
IMX 9 CTGC 221 248 344 1499 1624
44
IMX 10 GATA 111 955 1223 2357 3450
56
Table i. IMX Nucleic Acid Molecules. Relative expression levels determined by
TOGAT"~.
s EXAMPLE 2: Fnrther Characterization of 1MX4
Nnclelc Acid Molecules and Polvoentidea
An additional 600bp sequence (SEQ ID NO:11 ) that included DST IMX4 (SEQ m
NO:1 ) was obtained by anchor PCR from a T84 library. A clone approximately
2.Okb in length
was then isolated from a commercial library (Origene 1. The sequence of the 3'
end of the clone
to (SEQ ID N0:12) included the sequence of the IMX4 DST. The sequence of the
5' end of the
clone (SEQ ID N0:13) matched part of the human ApoL gene (AF019225. Figure 21
).
Complete sequence of the clone was not obtained. However, comparison of 5' end
of the clone
suggests it represents an alternative splice product to the reported ApoL
sequence, i.e., bases 1-
168 match to 2 exons on PAC carrying the ApoL gene but are not included in the
reported
1 t complete cDNA. See Figure ??. A polypeptide translated from IMX4 is
provided in SEQ )D
NO: 27.
EXAMPLE 3: Further Characterization of llfIXlO and 111tX21
Nucleic Acid Molecules and Poivoeotides
Further experiments failed to show regulation of these DSTs in replications
using PCR
,2o with extended primers and Northern blots. A polvpeptide translated from
f~IXIO (SEQ m
-59-
CA 02351167 2001-05-10
WO 00/28033 PCT/tJS99/26788
N0:14) is provided in SEQ 1D NO: 28. A polypeptide translated from IMX21 (SEQ
ID NO:1S)
is provided in SEQ ID NO: 29.
EXAMPLE 4: Further Characterization of IMY28
Nucleic Acid Molecules and Polvpeptides
One polypeptide translated from IMX28 is provided in SEQ ID NO: 30.
A GST fusion protein of IMX28 was used in studies designed to identify
potential
ligands for this enzyme.The GST fusion of IMX28 was prepared as follows: IMX28-
8, a clone
with the full length coding sequence, was excised from pGEM by SaII-NotI
digestion and
subcloned into SaII-NotI digested pGEX-SX-3 (Pharmacia). The pGEX-SX-3 plasmid
contains
the Schistosoma iaponicum glutathione-S-transferase (GST) gene S' to the SaII-
NotI cloning
site. Insertion of the IMX28-8 DNA fragment into this cloning site results in
a fusion gene
containing GST-IMX28 in the proper reading frame. The complete sequence of the
fusion
protein consists of GST followed by a Factor Xa tripeptide cleavage site, the
peptide consisting
of Gly-Ile-Pro-Arg-Asn-Ser-Arg-Val-Asp-Ala-Thr that is derived partially from
the pGEX
vector and partially from the SaII-NotI fragment of IMX28 and IMX28. The
vector containing
the fusion gene was electroporated into competent bacterial cells and a single
colony containing
the DNA, confirmed by diagnostic restriction digestion, was expanded to a
2SOml culture for
2o purification of the fusion protein.
Briefly, cells horn these cultures were peileted and resupended in STE buffer
containing
a protease inhibitor cocktail and 20ug/ml hen egg lysozyme. The cells were
lysed by addition of
10% sarcosyl in STE (final sarcosyl concentration was 1.S%), sonicated and
centrifuged to
remove cell debris. The supernatant was passed over a Glutathione-Sepharose 4B
column,
washed sequentially with 1.5% sarcosyl in STE and then STE. The bound
material, containing
the GST-IMX28 fusion protein was eluted by adding 20mM Glutathione in STE. The
eluted
material was analyzed by SDS-PAGE to confirm the presence of the GST-IMX28
fusion
protein.
A recombinant adenovirus construct expressing IMX28 was used to infect T84
cells to
3o determine effects on epithelial barrier formation. To construct adenoviral
vectors with untagged
full length Imx28 and NH2-terminally FLAG tagged Imx28, the pADEASY1 system
described
by He et al. ( 1998 ) Proc. Natl. Acad. Sci. USA 95: 2509-2S 14, was used. For
the untagged
construct a Notl fragment carrying the full coding region of Imx28 was
inserted into the
polylinker of the pAdtrackCMV shuttle vector. After confirmation of the
correct orientation the
-60-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
vector was cut with the restriction enzyme Pac l and co-transformed into E.
coli. Strain BJ5183
along with the pADEasyl vector. Recombinants containing the Imx28 product were
screened for
as described and by gene specific PCR. To generate non-replicative, infectious
viral particles the
helper strain 293EBNA-EBNA or 293MSR was transfected with PmeI linearized
recombinant
vector. After 3 days virus was harvested by freeze-thaw lysis of the
transfected cells. Several
rounds of infection of these cells with viral supetnatents were performed to
boost titers. The
tagged version was prepared by addition of the FLAG sequence and a Gly-Gly-Gly-
Gly spacer
region onto the full length coding sequence of Imx28 via PCR with a 5' oligo
with the
incorporated nucleotides for the tag and spacer. The PCR product was cloned
into a TA- vector
1o and excised with NotI and cloned as above. Screening and viral particle
production was as
above. No deleterious or positive effects were observed on T84 barrier
function in the presence
or absence of IFN-gamma.
EXAMPLE 5: Further Characterization of IMX32
Nucleic Acid Molecules and Polypeptides
The original clone produced by extending the 1MX32 DST was 1588 by in length
(SEQ
ID NO: 17). The first round of anchor PCR yielded a 670bp product that was
used to produce a
contig that extended the sequence 585 bases to 2173 (SEQ ID NO: 17). Another
round of anchor
PCR yielded the 1676 by product, immunex32-a24.seq. (SEQ ID NO: 18) which
further
2o extended the contig for Imx32 to 2834 bp. In addition, the immunex32-
a24.seq product revealed
an alternative splice tacking bases 211-639 of 1MX32-1 clone.
There is an ORF for 155 amino acids at the 5' end of the sequence (SEQ ID
N0:31
translated from SEQ ID NO: 16; SEQ ID N0:32 translated from SEQ ID NO: 18).
BLAST
analysis suggests that the ORF may contain a KRAB-like domain because it has
partial matches
to Zn-finger proteins which contain KRAB domains at their N-terminus such as
ZNF140.
EXAMPLE 6: Further Characterization of IMX39
Nucleic Acid Molecules and Polvpepti_des
One polypeptide translated from IMX39 is provided in SEQ ID NO: 33.
IMX39 FLAG-tagged and untagged adenoviral vector versions were prepared as
outlined
above for Imx28 in Example 4, above. Controls for the expression were
infection with other
FLAG- tagged adenoviral delivered proteins such as IMXS. Based upon the
predicted structure
from its cDNA sequence, it was expected that the 1MX39 polypeptide would be a
cytoplasmic
protein. However, since some secreted cytokines, such as those of the IL-1
family, lack a
-61
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
predicted signal sequence but are secreted from the cell, this expectation was
tested
experimentally in both T84 cells via adenoviral mediated transduction and via
transfection into
CV1EBNA cells with another expression vector, pDC412. Despite evidence for
succesful
expression in the transfected cells, no product was found in the media as
determined by FLAG
western (T84 system) or 35-S radiolabeled product (CV 1 EBNA system). The
positive control in
the CV1 system was an Imx44-Fc fusion protein known to be secrete. In both
systems empty
vectors were used as a negative control. The attempted expression of 1MX39
polypeptides had
no apparent effect on barrier function in the absence or presence of IFN-
gamma.
to
EXAMPLE 7: Further Characterization of IMX40
Nucleic Acid Molecules and Polvpeptides
Anchor PCR using an Origene human small intestine library revealed a product
of 1669
by (SEQ ID NO: 20). Bases 1-265 of the DST IMX40 (SEQ ID N0:7) align with
bases 1565-
ts 1669 of this sequence. The anchor PCR product has a potential 155 as ORF
from bases 185-650.
A translation of this ORF is given in SEQ ID N0:34. This ORF has no
recognizable features,
motifs, or database homologies.
2o EXAMPLE 8: Further Characterization of IMX42
Nucleic Acid Molecules and Polvpeptides
Several attempts to screen libraries using DST IMX42 (SEQ ID N0:8) as well as
anchor
PCR and RACE have not produced a clone with a longer sequence. BLAST
comparison against
against imxhutdb extended sequence approx 200 bases to 592 bases (SEQ ID NO:
21 ).
25 However, the sequence extension did not doesn't increase any database
matches found by
comparison to the DST IMX42 sequence. The contig has a potential ORF of 134
amino acids
(SEQ ID NO: 36) which, while a COOH terminal extension of SEQ ID N0:35, may be
a partial
sequence.
- 62 -
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
EXAMPLE 9: Further Characterization of IMX44
Nucleic Acid Molecules and Polvpeptides
Longer polynucleotides corresponding to DST IMX44 have been identified (SEQ ID
N0:22, 23, 24). A translated polypeptide is found in SEQ ID N0:37. A soluble
Fc form of
IMX44 polypeptide was synthesized and used in various assays. 1MX44-Fc had no
effect on
T84 barrier function in the absence or presence of IFN-gamma. IMX44-Fc had no
effect on
natural killer (NK) cell activation. IMX44-Fc had no positive hits on cognate
screen assays.
A soluble FLAG polyHis form was also produced. No activity in cellular
activation
assays was found nor any alteration of cytokine production using this
polypeptide in assays.
The expression of 1MX44 in various murine models of gut inflammation was
determined
by Northern and array analysis. Little to no regulation of transcript was
found was found in
anti-CD3-induced ileitis in C57BL/6 mice, DSS-induced colitis in BALB/c mice
or C57BL/6
mice, mdrl knock out mice with colitis, and 1FN-gamma stimulated LN T cells.
EXAMPLE 10: Further Characterization of IMX56
Nucleic Acid Molecules and Polvpeptides
A translated IMX56 polypeptide is found in SEQ ID N0:38. Comparison of the DST
2o sequence 1MX56 to IMAGE consortium clones extended the sequence (SEQ ID
N0:25) which
was 3' on sequenced PAC to the described end of human ApoL. Anchor PCR using a
T84
library produced results that indicated that the 1MX56 DST is derived from an
alternate 3' UTR
of ApoL.
EXAMPLE 11: Monoclonal Antibodies That Bind IMX Polvpeptides
Monoclonal antibodies that bind the polypeptides of the invention can be
prepared by
methods well known in the art. Suitable immunogens that may be employed in
generating such
antibodies include, but are not limited to, purified 1MX polypeptides or an
immunogenic
fragment thereof such as the extracellular domain, or fusion proteins
containing IMX
3o polypeptides (e.g., a soluble IMX 21 polypeptide/Fc fusion protein).
Purified 1MX polypeptides of the invention can be used to generate monoclonal
antibodies immunoreactive therewith, using conventional techniques such as
those described in
U.S. Patent 4,411,993. Briefly, mice are immunized with an 1MX polypeptide
immunogen
emulsified in complete Freund's adjuvant, and injected in amounts ranging from
10-100 :g
-63-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
subcutaneously or intraperitoneally. Ten to twelve days later, the immunized
animals are
boosted with additional IMX polypeptide immunogen emulsified in incomplete
Freund's
adjuvant. Mice are periodically boosted thereafter on a weekly to bi-weekly
immunization
schedule. Serum samples are periodically taken by retro-orbital bleeding or
tail-tip excision to
test for anti-IMX polypeptide antibodies by dot blot assay, ELISA (Enzyme-
Linked
Immunosorbent Assay) or inhibition of IMX polypeptide/binding partner
interactions.
Following detection of an appropriate antibody titer, positive animals are
provided one
last intravenous injection of 1MX polypeptide immunogen in saline. Three to
four days later, the
animals are sacrificed, spleen cells harvested, and spleen cells are fused to
a murine myeloma
to cell line, e.g., NS 1 or preferably P3x63Ag8.653 (ATCC CRL 1580). Fusions
generate
hybridoma cells, which are plated in multiple microtiter plates in a HAT
(hypoxanthine,
aminopterin and thymidine) selective medium to inhibit proliferation of non-
fused cells,
myeloma hybrids, and spleen cell hybrids.
The hybridoma cells are screened by ELISA for reactivity against the purified
IMX
polypeptide of interest by adaptations of the techniques disclosed in Engvall
et al.,
Immunochem. 8:871, 1971 and in U.S. Patent 4,703,004. A preferred screening
technique is the
antibody capture technique described in Beckmann et al., (J. Immunol.
144:4212, 1990)
Positive hybridoma cells can be injected intraperitoneally into syngeneic
BALB/c mice to
produce ascites containing high concentrations of anti-IMX polypeptide
monoclonal antibodies.
2o Alternatively, hybridoma cells can be grown in vitro in flasks or roller
bottles by various
techniques. Monoclonal antibodies produced in mouse ascites can be purified by
ammonium
sulfate precipitation, followed by gel exclusion chromatography.
Alternatively, affinity
chromatography based upon binding of antibody to Protein A or Protein G can
also be used, as
can affnity chromatography based upon binding to the IMX polypeptide of
interest.
Alternatively, IMX nucleic acid molecules or fragments thereof can be
expressed to
produce IMX polypeptides or fragments thereof, that can be used to make
antibodies that are
useful for identifying corresponding polypeptides in techniques such as
western blotting,
immunocytochemistry ,and ELISA assays using standard techniques such as those
described in
U.S. Patent No. 4,900,81 l, incorporated by reference herein.
3o The references cited herein are incorporated by reference herein in their
entirety.
-64-
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
SEQUENCE LISTING
<110> Baum, Peter
DuBose, Robert
Sims, Johri E
Youakim, Adel
Hasel, Karl W
Hilbush, Brian S
<120> Novel DNAs and Polypeptides
<130> 98,664-A
<140>
<141> 1999-11-10
<150> 60/107821
<151> 1998-11-10
<160> 38
<170> PatentIn Ver. 2.1
<210> 1
<2I1> 137
<212> DNA
<213> Homo Sapiens
<400> 1
ccggtaagta aacagtcaga aaattagcat gaaagcagtt tagcattggg aggaagcaca 60
gatctctaga gctgtcctgt cgctgcccag gattgacctg tgtgtaagtc ccaataaact 120
cacctactca ccaaaaa
137
<210> 2
<211> 10
<212> DNA
<213> Homo Sapiens
<400> 2 .
cggttcttga gcccagtaga tgccatttga agaaaaaaat cacttgaaaa tgagacagaa 60
agaatggaaa ctaaatccta gctctaaagg caccaggctg attaaaaa 108
<210> 3
<2I1> 306
<212> DNA
<223> Homo Sapiens
<400> 3
cggcttcagc agtatcgtgc caaagcagaa ctagctcgat ctaccagacc ccaggcctgg 60
gttccaaggg aaaaattgcc cagaccactc accagcagtg cttcagctat tcgtaaactt 120
atgcggaaag cagaactcat ggggatcagt acagatatct ttccagtgga caattcagat 180
actagttcta gtgtggatgg aaggagaaaa cataagcaac cagctctcac tgcagatttt 240
gtaaattatt attttgagag aaatatgcgc atgattcaaa ttcaggaaaa tatggctgaa 300
caaaaa
3 06
<210> 4
<211> 366
<212> DNA
<213> Homo Sapiens
1
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
<400> 4
cggccatgtg gytgctcggt cctkggttgc tcgcttgctg tgcaagacat tagcccttta 60
gttatgagcc tgtgggaact tcaggggttc ccagtgggga gagcagtggc agtgggaggc 120
atctgggggc caaaggtcag tggcaggggg tatttcagta ttatacaact gctgtggcca 180
gacttgtata ctggctgaat atcagtgctg tttgtaattt ttcactttga gaaccaacat 240
taattccata cgaatcaagt gttttgtaac tgctattcat ttattcagca aatatttatt 300
gatcatctct tctccataag atagtgtgat aaacacagtc atgaataaag ttatttccac 360
caaaaa
366
<210> 5
<211> 324
<212> DNA
<213> Homo Sapiens
IS <400> 5
cggccgacac tgggcttttt atgagagtga cagattacta ggacctcatt atgtggtaga 60
agtaatgtag gggaaatggc gattatcttt ttttaaaagc aatagctgtt gtatatcaat 120
gataaatgaa aaattagtta ttcttgtaaa ttgaagaaag aatggttatc atagagggta 180
gttcaagtaa aagaaccagg gctgggtgtg gtggctcacg ttctgtagtc cctgtacttt 240
gggaggccaa ggcagatgga tctcttgagg ccaggagttc gagaccagcc tgaccaacat 300
ggcgagaccg tgtctcccca aaaa 324
<210> 6
<211> 398
<212> DNA
<213> Homo Sapiens
<400> 6
cggtggatga cagcccacgg gcggcacagt cacttctgcc tgttgctctg acaccaaccc 60
aggcagctct gctgtggctt ctcctgggct ctggcattag ttggtctgtg tcacattgtc 120
agaacaggtg gcctgtgtgg tgccatcgag tccctgctgg ttccccttgt cctgggaggg i80
tcacccattg cccaaggaag tgcatccacc tggcaggtga cctggaggag tagcttcccc 240
gaggaccccc aggcttggcc tgtgattgcg caaacccaca tttcctaagc acactggaca 300
cccttcgagt gtgggtttta acatccctgt gagattgaat acttgtgcca cacatgtcac 360
aaaagagtat ggaaataaaa gaaaatttat ccgaaaaa 398
<210> 7
<211> 113
<212> DNA
<213> Homo sapiens
<400> 7
ccggtctatg gcattaaccc tcacttaact tttcagcctg ccagcctgcc ctatggattt 60
cggacttgcc agccacacaa ttccttaaaa taaatctctc cgtctcataa aaa 113
<210> 8
<211> 379
<212> DNA
<213> Homo Sapiens
<400> 8
ccgggagctg tgaagggaac gtgagggggc ggcgtagtgg agacccacgg caggcctgaa 60
gaagagcggc ggccgagccc gccttccctg caccatgctc atagaggatg tggatgccct 120
caagtcctgg ctggccaagt tactggagcc gatatgtgat gctgatcctt cagccttagc 180
caactatgtt gtagcactgg tcaagaagga caaacctgag aaagaattaa aagccttttg 240
tgctgatcaa cttgatgtct ttttacaaaa agaaacttca ggttttgtgg acaaactatt 300
tgaaagtctc tatactaaga actaccttcc acttttggaa ccagtaaagc ctgagccaaa 360
accactagcc caagaaaaa 37
2
CA 02351167 2001-05-10
WO 00/28033 PCTlUS99/Z6788
<210> 9
<211> 180
<212> DNA
<213> Homo Sapiens
<400> 9
cggctgcctg cctttttttc tgatccagac cctcggcacc tgctacttac caactggaaa 60
attttacgca tcccatgaag cccagataca caaaattcca ccccatgatc aagaatcctg 120
ctccactaag aatggtgcta aagtaaaact agtttaataa gccctaaaaa 180
<210> 10
<211> 60
<212> DNA
<213> Homo Sapiens
<400> 10
ccgggatatc gccactgcac tccagcctgg gtgacggagc gagactccgt ctcagaaaaa 60
<210> 11
<211>
<212> DNA
<213> Homo Sapiens
<400> 11
1 tcaatcctgg gcggcgacaa gacagctcta gagatctgag cttcctccca
51 atgctaaact gctttcatgc taattttctg actgtttact taccgggtaa
101 gagcgatggg actgttttca ttggttggtt ctcacatact ctctgggaag
151 tttgggttct cagggacacc tgctcctcag ctggggacca tggccatggc
201 ccaccacctg cccttcagtg ttcaagcagg ggacatgcac cctttagtaa
251 cctggagggg acccatcaca tgacaaccac cccaacgacc atcatcagga
301 agccgctgcc tgactgagat atgcccccag gaggacaagg gagagtggat
351 gctggaaaga cagggcaggg gaccatcacc agggaaagac ttcattcttc
401 ggaggacatt gaacctgggg ctgggtctgt agtggagccg ctgtttcttc
451 tcctgtatcc aactgttcta actcttgggc tttctccatt ttcagctctt
501 tcttttcctg gccttctcat tgctggntcc ttcaagcctc cnctctatnc
551 ttccgncaat atattcttt
<210> 12
<211>
<212> DNA
<213> Homo Sapiens
<400> 12
1 cggcgacaag acagctctag agatctgagc ttcctcccaa tgctaaactg
51 ctttcatgct aattttctga ctgtttactt accgggtaag agcgatggga
101 ctgttttcat tggttggttc tcacatactc tctgggaagt ttgggttctc
151 agggacacct gctcctcagc tggggaccat ggccatggcc caccacctgc
201 ccttcagtgt tcaagcaggg gacatgcacc ctttagtaac ctggagggga
251 cccatcacat gacaaccacc ccaacgacca tcatcaggaa gccgctgcct
301 gactgagata tgcccccagg aggacaaggg agagtggatg ctggaaagac
351 agggcagggg accatcacca gggaaagact tcattcttcg gaggacattg
401 aacctggggc tgggtctgta gtggagccgc tgtttcttct cctgtatcca
451 actgttctaa ctcttgggct ttctccattt tcagctcttt cttttcctgg
501 ccttctcatt gctggttcct tcaagcctcc tctctattct tccgtcaata
551 tattcttttt tttttttttt ttttgaaatg gagtctcgct ctgtcaccca
601 agctggagtg ca
3
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
<210> 13
<211>
<212> DNA
<213> Homo sapiens
<400> 13
1 cacgagctgt ctggttatta tacagacgca taactggagg tgggatccac
IO 51 acagctcaga acagctggat cttgctcagt ctctgccagg ggaagattcc
101 ttggaggagg ccctgcagcg acatggaggg agctgctttg ctgagagtct
151 ctgtcctctg catctggatg agtgcacttt tccttggtgt gggagtgagg
201 gcagaggaag ctggagcgag ggtgcaacaa aacgttccaa gtgggacaga
251 tactggagat cctcaaagta agcccctcgg tgactgggct gctggcacca
IS 301 tggacccaga gagcagtatc tttattgagg atgccattaa gtatttcaag
351 gaaaaagtga gcacacagaa tctgctactc ctgctgactg ataatgaggc
401 ctggaacgga ttcgtggctg ctgctgaact gcccaggaat gaggcagatg
451 agctccgtaa agctctggac aaccttgcaa gacaaatgat catgaaagac
501 aaaaactggc acgataaagg ccagcagtac agaaactggt ttctgaaaag
20 551 agtttcctcg ggtgaaaaag taagcttgag gataacataa gaaagcttcc
602 gtgcccttgc aanatggg
<210> 14
25 <211> 1044
<212> DNA
<213> Homo sapiens
<400>
14
30 gaatttaatacgactcactatagggaatttggccctcgaggccaagaattcggcacgagg60
caacaacaacaacaaaaaaaaactgaacatctccatattactgacacccaattcaagaaa120
caaaatattacagccccttccaggatattcctggggtctcttccatctctactaacccct180
gactacaaacagcctccacctatttcacctgacattgtactttatgaaagcagcagttct240
cagatggggctattttgccccctggggacattagggagtatctggagacactgagggttg300
35 tgtctacttggggggagttgtgttactgcatccagtgagtccagggatccagggatgccg360
ctcaacatcctgaaatgcacagggaacccccacacatagaacagagaaattgctgagcca420
aaatgtcagcagtgtcacagctgacaccctgatatacacactatcacacagtatctgctc480
tttcgggctcaggatctttttcattctaatcatctcataggaaacagaaatgtcatttag540
aggtaggtacagtccacaacaaagaagaacctgagttttttttttttttttaatcagcct600
40 ggtgcctttagagctaggatttagtttctattctttctgtctcattttcaagtgattttt660
ttcttcaaatggcatctactgggctcaagaactggagatccccacaaagctgagattcac720
atgggaattttgtacacacccacacaggtatacacttccatttacatgcagacatccacc780
cacagatacacacatccggagaccaagacagaacgcaaactgccccataaaagcacggtt840
ccccaaacaggagaaacgcaccattcactccagggaggtatctatttgtttaattcagcc900
45 tctgatagtcaggctgttgccaagcccagctctgaaactcttcccctctaggaaagaaag960
atggattttttctttactcaagaatatagatctaaaaaaaaaaaaaaaaaaagttggcgg1020
ccgcaagcttattccctttagtga
1044
50 <210> 25
<211> 2577
<212> DNA
<213> Homo sapiens
55 <400> 15
ggtaccgggc cccccctcga ggtcgacggt atcgataagc ttgatatcga attcgcggcc 60
gctgagaaat taactccccg gggccgccgg gttgactgcg ctgcctgggc cggaggtctt 120
ctccggccag ggagcgctgt gggaaggggc tcgagcggcc agggccaggc gaggccgggg 180
gggcgggggg ttaggggacc gcggggctac tcttgggagc gcccctgtcc ggctggctgc 240
60 gcgccggttt taaatagcat ctttcggact tgtcttcgcg gccccagtcc ccgacctcgg 300
cgctgcctgg gctcctgcag cctctcccta agtcttctcc aaacgaccac ctcacggatt 360
4
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
ccttatggat cgcagctcca agaggaggca ggtgaagcct ttggcagctt ctctgctgga 420
agctcttgat tatgatagtt cagatgacag tgattttaaa gttggagatg cctcaggact 480
cgctgattct tgagaagagt caaaactgga gctctcaaaa aatggaccat attctgattt 540
gctgtgtttg tctgggagat aatagtgagg acgctgatga aataattcag tgtgacaatt 600
gtggcattac agtccatgaa ggttgttatg gagttgatgg agagagtgac tctattatga 660
gttcagcttc tgaaaactcc actgaacctt ggttttgtga tgcctgtaaa tgtggtgttt 720
ctcctagctg tgaactgtgt cctaatcagg atggaatttt caaggagaca gatgctggaa 780
gatgggttca tattgtttgt gccctgtatg ttcctggagt agcctttgga gatattgaca 840
aattacgacc agtaacacta acggaaatga actattccaa atatggtgcc aaggagtgta 900
gcttttgtga agaccctcgc tttgctagaa ctggggtttg cattagctgt gatgcaggga 960
tgtgcagagc ctatttccat gtgacctgtg ctcaaaagga aggtctgctt tcagaggcag 1020
cggcggaaga ggatatagca gatccattct ttgcttattg taagcaacat gcagataggt 1080
tagacagaaa gtggaagaga aaaaactact tggctctaca gtcctattgt aaaatgtctt 1140
tgcaagagag agagaagcaa ctatcaccag aagcacaggc aaggatcaat gcccggcttc 1200
agcagtatcg tgccaaagca gaactagctc gatctaccag accccaggcc tgggttccaa 1260
gggaaaaatt gcccagacca ctcaccagca gtgcttcagc tattcgtaaa cttatgcgga 1320
aagcagaact catggggatc agtacagata tctttccagt ggacaattca gatactagtt 1380
ctagtgtgga tggaaggaga aaacataagc aaccagctct cactgcagat tttgtgaatt 1440
attattttga gagaaatatg cgcatgattc aaattcagga aaatatggct gaacaaaaga 1500
atataaaaga taaattagag aatgaacaag aaaagcttca tgtagaatat aataagctat 1560
gtgaatcttt agaagaacta caaaacctga atggaaaact tcgaagtgaa ggacaaggaa 1620
tatgggcttt actaggcaga atcacagggc agaagttgaa tataccggca attttgcgag 1680
cacccaagga gagaaaacca agtaaaaaag aaggaggcac acaaaagaca tctactcttc 1740
ctgcagtact ttatagttgt gggatttgta agaagaacca tgatcagcat cttcttttat 1800
tgtgtgatac ctgtaaacta cattaccatc ttggatgtct ggatcctcct cttacaagga 1860
tgccaagaaa gaccaaaaac agttattggc agtgctcgga atgtgaccag gcagggagca 1920
gtgacatgga agcagatatg gccatggaaa ccctaccaga tggaaccaaa cgatcaagga 1980
ggcagattaa ggaaccagtg aaatttgttc cacaggatgt gccaccagaa cccaagaaga 2040
ttccgataag aaacacgaga accagaggac gaaaacgaag cttcgttcct gaggaagaaa 2100
aacatgagga aagagttcct agagagagaa gacaaagaca gtctgtgttg caaaagaagc 2160
ccaaggctga agatttaaga actgaatgtg caacttgcaa gggaactgga gacaatgaaa 2220
atcttgtcag gtgtgatgaa tgcagactct gctaccattt tggctgtttg gatcctcctt 2280
tgaaaaagtc tcctaaacag acaggctacg gatggatatg tcaggaatgt gattcttcat 2340
cttccaagga agatgaaaat gaagctgaaa gaaaaaatat atctcaggag ctcaacatgg 2400
aacagaaaaa tccaaagaaa taaaagattt tctgtagtgt ttttgaaaag tttgcagctt 2460
atgtaatagc agataaaatt tctaattgta aaatgttaaa ttgagcggcc gcgaattcct 2520
gcagcccggg ggatccacta gttctagagc ggccgccacc gcggtggagc tccagct 2577
<210> 16
<211> 2065
<212> DNA
<213> Homo sapiens
<400> 16
attaaccctc actaaaggga acaaaagctg gagctccacc gcggtggcgg ccgctctaga 60
actagtggat cccccgggct gcaggaattc ggcacgaggt gcgcggctgc aacggca cc 120
9
gcgggaagct cgggccggca gggtttcccc gcacgctggc gcccagctcc cggcgcggag 180
gccgctgtaa gtttcgcttt ccattcagtg gaaaacgaaa gctgggcggg gtgccacgag 240
cgcggggcca gaccaaggcg ggcccggagc ggaacttcgg tcccagctcg gtccccggct 300
cagtcccgac gtggaactca gcagcggagg ctggacgctt gcatggcgct tgagagattc 360
catcgtgcct ggctcacata agcgcttcct ggaagtgaag tcgtgctgtc ctgaacgcgg 420
gccaggcagc tgcggcctgg gggttttgga gtgatcacga atgagcaagg cgtttgggct 480
cctgaggcaa atctgtcagt ccatcctggc tgagtcctcg cagtccccgg cagatcttga 540
agaaaagaag gaagaagaca gcaacatgaa gagagagcag cccagagagc gtcccagggc 600
ctgggactac cctcatggcc tggttggttt acacaacatt ggacagacct gctgccttaa 660
ctccttgatt caggtgttcg taatgaatgt ggacttcacc aggatattga agaggatcac 720
ggtgcccagg ggagctgacg agcagaggag aagcgtccct ttccagatgc ttctgctgct 780
ggagaagatg caggacagcc ggcagaaagc agtgcggccc ctggagctgg cctactgcct 840
gcagaagtgc aacgtgccct tgtttgtcca acatgatgct gcccaactgt acctcaaact 900
ctggaacctg attaaggacc agatcactga tgtgcacttg gtggagagac tgcaggccct 960
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
gtatatgatc cgggtgaagg actccttgat ttgcgttgac tgtgccatgg agagtagcag 1020
aaacagcagc atgctcaccc tcccactttc tctttttgat gtggactcaa agcccctgaa 1080
gacactggag gacgccctgc actgcttctt ccagcccagg gagttatcaa gcaaaagcaa 1140
gtgcttctgt gagaactgtg ggaagaagac ccgtgggaaa caggtcttga agctgaccca 1200
S tttgccccag accctgacaa tccacctcat gcgattctcc atcaggaatt cacagacgag 1260
aaagatctgc cactccctgt acttccccca gagcttggat ttcagccaga tccttccaat 1320
gaagcgagag tcttgtgatg ctgaggagca gtctggaggg cagtatgagc tttttgctgt 1380
gattgcgcac gtgggaatgg cagactccgg tcattactgt gtctacatcc ggaatgctgt 1440
ggatggaaaa tggttctgct tcaatgactc caatatttgc ttggtgtcct gggaagacat 1500
ccagtgtacc tacggaaatc ctaactacca ctggcaggaa actgcatatc ttctggttta 1560
catgaagatg gagtgctaat ggaaatgccc aaaaccttca gagattgaca cgctgtcatt 1620
ttccatttcc gttcctggat ctacggagte ttctaagaga ttttgcaatg aggagaagca 1680
ttgttttcaa actatataac tgagccttat ttataattag ggatattatc aaaatatgta 1740
accatgaggc ccctcaggtc ctgatcagtc agaatggatg ctttcaccag cagacccggc 1800
catgtggctg ctcggtcctg ggtgctcgct gctgtgcaag acattagccc tttagttatg 1860
agcctgtggg aacttcaggg gttcccagtg gggagagcag tggcagtggg aggcatctgg 1920
gggccaaagg tcagtggcag ggggtatttc agtattatac aactgctgtg accagacttg 1980
tatactggct gaatatcagt gctgtttgta atttttcact ttgagaacca acattaattc 2040
catatgaaaa aaaaaaaaaa aaaaa 2065
<210> 17
<211> 1588
<212> DNA
<213> Homo Sapiens
<400> 17
gcggccgctctagaactagtggatcccccgggctgcaggaattcgcggccgctaaatgaa60
ctcccataagagtctacacaccatagaactcataccaggaatcacaaagtctctaaattt120
ccaaagttaactggaaatattacaaactgcagaataattccaggccaaaatatgttaaat180
tcataacatgatgtatatcaaaggaaaaaaggacatgtggaaatgacacattatcttcag240
tgtataaaatattcatttatgtgaagtttcttggaaaggctacactactattactggttt300
ccgtctgatgtttgagatctgttgattttatgcttttcttacaggcctttcattatgatc360
tttgggaaggaatcaataaaatgatagggcctacttcattaggtgtggttcattcctatt420
catgctccctggaagaacaagaatgctgaattttgaaatttaatattgtatgaattagca480
tcagggagaggtggagaaaaatacaaaactaaaagtcatgcttattgtgttcagtgtgcc540
cttctccagagggccactggcttataggaaaggattgctgctctaccagttgaccaggag600
atggcacgccaggacattaagacactggagttttgtttcgtttttttttttttttttgag660
atggagtctcgctctcttgacaggcaggagtacagtggtgcgatctcggctcactgcaaa720
ctccgcctcccgggttcaagtgattctcctgcctcggcctcccgagtagctgggactaca780
ggcgtgtgccaccacccccagctaacttttgtatttttagtagagacagggtttcaccat840
gttggccaggatggtctcaatctcttgacctcatgatccgcccgcctccgccttccaaag900
tgctgggattacaggcgtgagccagtgtgcccggccgacactgggctttttatgagagtg960
acagattactaggacctcattatgtggtagaagtaatgtaggggaaatggcgattatctt1020
tttttaaaagcaatagctgttgtatatcaatgataaatgaaaaattagttattcttgtaa1080
attgaagaaagaatggttatcatagagggtagttcaagtaaaagaaccagggctgggtgt1140
ggtggctcacgttctgtaatccctgtactttgggaggccaaggcagatggatctcttgag1200
gccaggagttcgagaccagcctgaccaacatggcaaaaccgtgtctctacaaaaaataca1260
aaaattagccggacatcgtggtagatgcctgtagtctcagatattcaggagaccgagggg1320
aaaatcacttgaacccgggggacggaggttgcagtgagctgagatcgcaccactgctcgc1380
cagcctgggcaacagagtgagactctgcctcaaaaaaaaaccaaaccaaaccaaagaacc1440
agaatagcatgtgcacatatacacagacgtttcacaactggcattatgttttgctactgt1500
tttatttacaatgtatcacaagttttatgctttaataaaatttaatcataacttcaaaaa1560
aaaaaaaaaaaaaaagcggccgcgaatt 1588
<210> 18
<211>
<212> DNA
<213> Homo
Sapiens
6
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
<400> 18
1 gcggccgctc ttttacccag tggtcaaaac tggcacaaca
caggatttat
51 actggagagc aacctcacaa atgtaatgaa agtggtaagg
ctttttatca
I01 aatgtccttg tctttggggt catgagaaaa ttcatacaga
atctattaaa
151 aatgtactaa acatggaaag acctttaagc aacagtgatg
tgatgaaggt
201 ggtagttttt taaatgaact cccataagag tctacacacc
atagaactca
251 taccaggaat cacaaagtct ctaaatttcc aaagttaact
ggaaatatta
301 caaactgcag aataattcca ggccaaaata tgttaaattc
ataacatgat
351 gtatatcaaa ggaaaaaagg acatgtggaa atgacacatt
atcttcagtg
401 tataaaatat tcatttatgt gaagtttctt ggaaaggcta
cactactatt
451 actggtttcc gtctgatgtt tgagatctgt tgattttatg
cttttcttac
501 aggcctttca ttatgatctt tgggaaggaa tcaataaaat
gatagggcct
551 acttcattag gtgtggttca ttcctattca tgctcgcggc
cgctctagaa
601 ctagtggatc ccccgggctg caggaattcg cggccgctaa
atgaactccc
651 ataagagtct acacaccata gaactcatac caggaatcac
aaagtctcta
701 aatttccaaa gttaactgga aatattacaa actgcagaat
aattccaggc
751 caaaatatgt taaattcata acatgatgta tatcaaagga
aaaaaggaca
801 tgtggaaatg acacattatc ttcagtgtat aaaatattca
tttatgtgaa
851 gtttcttgga aaggctacac tactattact ggtttccgtc
tgatgtttga
901 gatctgttga ttttatgctt ttcttacagg cctttcatta
tgatctttgg
951 gaaggaatca ataaaatgat agggcctact tcattaggtg
tggttcattc
1001 ctattcatgc tccctggaag aacaagaatg ctgaattttg
aaatttaata
1051 ttgtatgaat tagcatcagg gagaggtgga gaaaaataca
aaactaaaag
1101 tcatgcttat tgtgttcagt gtgcccttct ccagagggcc
actggcttat
1151 aggaaaggat tgctgctcta ccagttgacc aggagatggc
acgccaggac
1201 attaagacac tggagttttg tttcgttttt tttttttttt
ttgagatgga
1251 gtctcgctct cttgacaggc aggagtacag tggtgcgatc
tcggctcact
1301 gcaaactccg cctcccgggt tcaagtgatt ctcctgcctc
ggcctcccga
1351 gtagctggga ctacaggcgt gtgccaccac ccccagctaa
cttttgtatt
1401 tttagtagag acagggtttc accatgttgg ccaggatggt
ctcaatctct
1451 tgacctcatg atccgcccgc ctccgccttc caaagtgctg
ggattacagg
1501 cgtgagccag tgtgcccggc cgacactggg ctttttatga
gagtgacaga
1551 ttactaggac ctcattatgt ggtagaagta atgtagggga
aatggcgatt
1601 atcttttttt aaaagcaata gctgttgtat atcaatgata
aatgaaaaat
1651 tagttattct tgtaaattga agaaagaatg gttatcatag
agggtagttc
1701 aagtaaaaga accagggctg ggtgtggtgg ctcacgttct
gtaatccctg
1751 tactttggga ggccaaggca gatggatctc ttgaggccag
gagttcgaga
1801 ccagcctgac caacatggca aaaccgtgtc tctacaaaaa
atacaaaaat
1851 tagccggaca tcgtggtaga tgcctgtagt ctcagatatt
caggagaccg
1901 aggggaaaat cacttgaacc cgggggacgg aggttgcagt
gagctgagat
1951 cgcaccactg ctcgccagcc tgggcaacag agtgagactc
tgcctcaaaa
2001 aaaaaccaaa ccaaaccaaa gaaccagaat agcatgtgca
catatacaca
2051 gacgtttcac aactggcatt atgttttgct actgttttat
ttacaatgta
2101 tcacaagttt tatgctttaa taaaatttaa tcataacttc
aaaaaaaaaa
aaaaaaaaaa gcggccgcga att
<2I0> I9
<211>
<212> DNA
<213> Homo Sapiens IMX 32
<400> 19
<210> 20
<211> 2410
<212> DNA
<213> Homo Sapiens
<400> 20
7
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
gaattcggca cgaggaaaac atttgcccct tgcagaagat cacccttagt tcttcctcgg 60
aagagtatca gaaggtctgg aacctcttta accgcacgct gcctttctac tttgttcaga 120
agattgagcg agtacagaac ctggccctct gggaagtcta ccagtggtgc gttggggctc 180
gctcttggtg ggctggtgac tctgtccctt cacaccactg gctggttgcc acatgtggcc 240
cgggtttcca ggaaaagcag agcggcagtt agggctgcca tgtgctggga gctgtgtgtc 300
tgctctcctt cgtccgctcc cccagggcag tgtggtagca catcccattg tagagatgag 360
ggcaccgagg cttcctggag cataccacct ggtcccgttc atgagtggtg gcaaagctag 420
cactctcact tgtccattct gccttcctgg agaccagtgg gatgggtcag tacagcccac 480
cacaccatta gccccaggaa cataaggctg tggctagaca gcaggggtct caggttcata 540
catgaggact ggcttgtcct tgagcaccca ctcacctgtc tatgtgggga ggaatcctac 600
aataggtcac catggcaggc tgggtcttgc tgacctgtcc.ccagatgggg ttggggtagt 660
gtaatgtgta ctctgtgcac agtgatgaag tctgggaatg ggagagggga gaaggatggg 720
cacccactga ccagcagcct gaaaattcct acagcatccc agggctcagc tccatgcagg 780
agcaaggtgg gggtggggtt gggggaaatg ttacccattt tccaagggct gctctgcttt 840
iS tggagtccag ggaaccgctg ctgtctggag ctgtggaggg agggttttca cccagctccc 900
acgatccccc ttcttttcca caccctggct tgtggctgga gccttacagg cctagtcagg 960
gtagcctgtg acctgcgtct cttggtccca ggacactttt ggaattttgg aaaaatgtgt 1020
tgttttgcat caggccggct gtatttggtg gccggcacac tctgccccca gcacacattc 1080
ttctgtgatt ctaggcaaaa aggacagatg cagaagcaga acggagggaa ggccgtggac 1140
gagcggcagc tgttccacgg caccagcgcc atttttgtgg acgccatctg ccagcagaac 1200
tttgactggc gggtctgtgg tgttcatggc acttcctacg gcaaggggag ctactttgcc 1260
cgagatgctg catattccca ccactacagc aaatccgaca cgcagaccca cacgatgttc 1320
ctggcccggg tgctggtggg cgagttcgtc aggggcaatg cctcctttgt ccgtccgccg 1380
gccaaggagg gctggagcaa cgccttctat gatagctgcg tgaacagtgt gtccgacccc 1440
tccatctttg tgatctttga gaaacaccag gtctacccag agtatgtcat ccagtacacc 1500
acctcctcca agccctcggt cacaccctcc atcctgctgg ccttgggctc cctgttcagc 1560
agccgacagt gagcgcacag gagtgttcca ggcctttcac ctgctctgcc ttgaaatggc 1620
tatttgggcc tttccttttc tttttaaaca gaaactttta atgaactgtt ctcttaacat 1680
tgacctctca atgaagttat gttcttaatc tcttgctaat aatgattttt acttttaagt 1740
cacttttggg ttcactagtg gattaaccag aagtgattgt agttgagtcc agttttgctt 1800
tttaataatg tgttgaagtt ttagttttta ctctttgttg actttgctgc ttattggcac 1860
cagggacaga gtttctagat acaattttat ggattggttt taatttttat gagtttgtct 1920
ctgcagtgat tcggtttctc agagtctcat ggcatcatag tttttccaga atgacacagt 1980
agccaccggt ggatgacagc ccacgggcgg cacagtcact tctgcctgtt gctctgacac 2040
caacccaggc agctctgctg tggcttctcc tgggctctgg cattagttgg tctgtgtcac 2100
attgtcagaa caggtggctg ctgtgtggtg ccatcgagtc cctgctggtt ccccttgtcc 2160
tgggagggtc acccattgcc caaggaagtg catccacctg gcaggtgacc tggaggagta 2220
gcttccccga ggacccccag gcttggcctg tgattgcgca aacccacatt tcctaagcac 2280
actggacacc cttcgagtgt gggttttaac atccctgtga gattgaatac ttgtgccaca 2340
catgtcacaa aagagtatgg aaataaaaga aaatttatcc gaaaaaaaaa aaaaaaaaat 2400
gagcggccgc
2410
<210> 21
<211>
<212> DNA
<213> Homo sapiens IMX 40
<400> 21
1 ttgcagagct cgtttagtga accgtcagaa ttttgtaata cgactcacta
51 tagggcggcc gcgaattcgg caccaggttt cccccggctc tggcagagaa
101 acctgggttt cgacttgtga agcttgaggt tggatgtggg aattggcttg
151 gagtcatagg cgatgagagg gacattagga tattatgaag cccgtgaact
201 caactcctga gaaggacaca gcagagcgag agaaaagatg gaataaaaag
SS 251 gcctacctca ttgggctcgt gtgggtgagg agaactgaag agtctgagag
301 cgcggcacga gccagaggct acggaaaaca ctgccctcct acactccacc
351 ttggagagac ccagaaaaga acaagcttca tttgtaaaaa aggaaaacaa
401 ctcaggcaat gggggtggct taaaggcact ctacagtgtg cagatgcctt
451 ccacttcttc catctgccct gtctctccaa gaacccctat ggccccggtc
501 tcagaacaga gctgagtgca gaaatgaaaa tctatggctc tgtgttccaa
551 aacgatgaag aatttcaaga tggtggcagt ggtaaaatcc ttctccagga
8
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
601 aaaatctgtc cttggcccaa tgtgtaaaca cttgctgagg aacttggaat
651 aacttgcagt gtcttgcagt attgtgaaac cagcaacttg ttcacaattc
701 ttctgaattt cttgggaaat ttgaagtgga gtacctgtac caacatgaaa
751 tgacacgaat ttaagtgacg ctcaacaacg aaaagcaaaa agaaccaaag
801 aggaagcaac tgaaacaaca tctggatgta tttaaaaa a tacaatgcct
851 ccaaaatcag gtgtcattaa tgaaaattct gaagaaatgc caccggacat
901 agccaacgca cctacgctgt tgttattcat ttcctgcttt tcacagaaaa
951 caattttgtt gcatggaaga tcgtgaactt caaagggcag aggggaaact
1001 gtcccttggc ctctacccct ccaaggcccc actttttcat caacactcct
1051 tggacgcagc agaagtatga acataatatg gtcctgaatg aggctgagtc
1101 tttgggcgca gaagacccgg gttaataaaa ataggaaggt aagaaaagaa
1151 aagaaaaatc aagacacatc ataggactaa attcctatta tttatccact
1201 caggattgac cacccctttg ggccagatag ttgtaccccc atgtaccagg
1251 tgggcacatg aagacacaag aagtgctgtg atggttcatt ttgcacgtca
1301 ccttgcgtgg agtatgccaa ctcattgttt ggtcaaacac tagtctggac
1351 atggtggtaa aggtattttt tagatgagat taacgcttaa atcagtaaag
1401 caggttaccc accatactac gggtgggccc tgtccaatca gttgaaggca
1451 ttaagaacaa agattgaggt ttcctaaaga agatggaatt ctccttgaga
1501 ctacaacata gaaaccctat ctgagtttcc agcctgttgc cctgtggaat
1551 tcaaactcag gactccggtc tatggcatta accctcactt aacttttcag
1601 cctgccagcc tgccctatgg atttcggact tgccagccac acaattcctt
1651 aaaataaatc tctccgtct
<210> 22
<211>
<212> DNA
<213> Homo sapiens, IMX42
<400> 22
<210> 23
<211> 1025
<212> DNA
<213> Homo Sapiens
<400> 23
atggatagtc gccacacctt tgcccctgct gcgatgaccc tgtcgccact tctgctgttc 60
ctgccaccgc tgctgctgct gctggacgtc cccacggcgg cggtgcaggc gtcccctctg 120
caagcgttag acttctttgg gaatgggcca ccagttaact acaagacagg caatctatac 180
ctgcgggggc ccctgaagaa gtccaatgca ccgcttgtca atgtgaccct ctactatgaa 240
gcactgtgcg gtggctgccg agccttcctg atccgggagc tcttcccaac atggctgttg 300
gtcatggaga tcctcaatgt cacgctggtg ccctacggaa acgcacagga acaaaatgtc 360
agtggcaggt gggagttcaa gtgccagcat ggagaagagg agtgcaaatt caacaaggtg 420
gaggcctgcg tgttggatga acttgacatg gagctagcct tcctgaccat tgtctgcatg 480
gaagagtttg aggacatgga gagaagtctg ccactatgcc tgcagctcta cgccccaggg 540
ctgtcgccag acactatcat ggagtgtgca atgggggacc ccggcatgca gctcatgcac 600
gccaacgccc agcggacaga tgctctccag ccaccacacg agtatgtgcc ctgggtcacc 660
gtcaatggga aacccttgga agatcagacc cagctcctta cccttgtctg ccagttgtac 720
cagggcaaga agccggatgt ctgcccttcc tcaaccagct ccctcaggag tgtttgcttc 780
aagtgatggc cggtgagctg cggagagctc atggaaggcg agtgggaacc cggctgcctg 840
cctttttttt ctgatccaga ccctcggcac ctgctactta ccaactggaa aattttatgc 900
atcccatgaa gcccagatac acaaaattcc accccatgat caagaatcct gctccactaa 960
gaatggtgct aaagtaaaac tagtttaata agcaaaaaaa aaaaaaaaaa aattcctgcg 1020
gccgc 1025
<210> 24
<211> 1039
<212> DNA
9
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
<213> Homo Sapiens
<400> 24
gaattcggca cgagggctgc agtcgccaca cctttgcccc tgctgcgatg accctgtcgc 60
cacttctgct gttcctgcca ccgctgctgc tgctgctgga cgtccccacg gcggcggtgc 120
aggcgtcccc tctgcaagcg ttagacttct ttgggaatgg gccaccagtt aactacaaga 180
caggcaatct atacctgcgg gggcccctga agaagtccaa tgcaccgctt gtcaatgtga 240
ccctctacta tgaagcactg tgcggtggct gccgagcctt cctgatccgg gagctcttcc 300
caacatggct gttggtcatg gagatcctca atgtcacgct ggtgccctac ggaaacgcac 360
aggaacaaaa tgtcagtggc aggtgggagt tcaagtgcca gcatggagaa gaggagtgca 420
aattcaacaa ggtggaggcc tgcgtgttgg atgaacttga catggagcta gccttcctga 480
ccattgtctg catggaagag tttgaggaca tggagagaag tctgccacta tgcctgcagc 540
tctacgcccc agggctgtcg ccagacacta tcatggagtg tgcaatgggg gaccccggca 600
tgcagctcat gcacgccaac gcccagcgga cagatgctct ccagccacca cacgagtatg 660
IS tgccctgggt caccgtcaat gggaaaccct tggaagatca gacccagctc cttacccttg 720
tctgccagtt gtaccagggc aagaagccgg atgtctgccc ttcctcaacc agctccctca 780
ggagtgtttg cttcaagtga tggccggtga gctgcggaga gctcatggaa ggcgagtggg 840
aacccggctg cctgcctttt ttttctgatc cagaccctcg gcacctgcta cttaccaact 900
ggaaaatttt atgcatccca tgaagcccag atacacaaaa ttccacccca tgatcaagaa 960
tcctgctcca ctaagaatgg tgctaaagta aaactagttt aataagcaaa aaaaaaaaaa 1020
aaaaaattcc tgcggccgc 1039
<210> 25
<211> 466
<212> DNA
<213> Homo Sapiens
<400> 25
atggatagtc gccacacctt tgcccctgct gcgatgaccc tgtcgccact tctgctgttc 60
ctgccaccgc tgctgctgct gctggacgtc cccacggcgg cggtgcaggc gtcccctctg 120
caagcgttag acttctttgg gaatgggcca ccagttaact acaagacagg caatctatac 180
ctgcgggggc ccctgaagaa gtccaatgca ccgcttgtca atgtgaccct ctactatgaa 240
gcactgtgcg gtggctgccg agccttcctg atccgggagc tcttcccaac atggctgttg 300
gtcatggaga tcctcaatgt cacgctggtg ccctacggaa acgcacagga acaaaatgtc 360
agtggcaggt gggagttcaa gtgccagcat ggagaagagg agtgcaaatt caacaaggtg 420
gaggcctgcg tgttggatga acttgacatg gagctagcct tcctga 466
<210> 26
<211>
<212> DNA
<213> Homo Sapiens
<400> 26
<210> 27
<211> 32
<212> PRT
<213> Homo Sapiens
<400> 27
Met His Trp Glu Glu Ala Gln Ile Ser Arg Ala Val Leu Ser Leu Pro
1 5 10 15
Arg Ile Asp Leu Cys Val Ser Pro Asn Lys Leu Thr Tyr Ser Pro Lys
20 25 30
<210> 28
<211> 98
1~
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
<212> PRT
<213> Homo sapiens
<400> 28
Met Glu Phe Asn Thr Thr His Tyr Arg Glu Phe Gly Pro Arg Gly Gln
1 5 10 15
Glu Phe Gly Thr Arg Gln Gln Gln Gln Gln Lys Lys Thr Glu His Leu
20 25 30
His Ile Thr Asp Thr Gln Phe Lys Lys Gln Asn Ile Thr Ala Pro Ser
35 40 45
Arg Ile Phe Leu Gly Ser Leu Pro Ser Leu Leu Thr Pro Asp Tyr Lys
IS 50 55 60
Gln Pro Pro Pro Ile Ser Pro Asp Il.e Val Leu Tyr Glu Ser Ser Ser
65 70 75 80
Ser Gln Met Gly Leu Phe Cys Pro Leu Gly Thr Leu Gly Ser Ile Trp
85 g0 g5
Arg His
<210> 29
<211> 663
<212> PRT
<213> Homo sapiens
<400> 29
Met Ile Val Gln Met Thr Val Ile Leu Lys Leu Glu Met Pro Gln Asp
1 5 10 15
Ser Leu Ile Leu Glu Lys Ser Gln Asn Trp Ser Ser Gln Lys Met Asp
20 25 30
His Ile Leu Ile Cys Cys Val Cys Leu Gly Asp Asn Ser Glu Asp Ala
35 40 45
Asp Glu Ile Ile Gln Cys Asp Asn Cys Gly Iie Thr Val His Glu Gly
55 60
45 Cys Tyr Gly Val Asp Gly Glu Ser Asp Ser Ile Met Ser Ser Ala Ser
65 70 75 BO
Glu Asn Ser Thr Glu Pro Trp Phe Cys Asp Ala Cys Lys Cys Gly Val
85 90 95
Ser Pro Ser Cys Glu Leu Cys Pro Asn Gln Asp Gly Ile Phe Lys Glu
100 105 110
Thr Asp Ala Gly Arg Trp Val His Ile Val Cys Ala Leu Tyr Val Pro
115 120 125
Gly Val Ala Phe Gly Asp Ile Asp Lys Leu Arg Pro Val Thr Leu Thr
130 135 140
Glu Met Asn Tyr Ser Lys Tyr Gly Ala Lys Glu Cys Ser Phe Cys Glu
145 150 155
160
11
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Asp Pro Arg Phe Ala Arg Thr Gly Val Cys Ile Ser Cys Asp Ala Gly
165 170 175
Met Cys Arg Ala Tyr Phe His Val Thr Cys Ala Gln Lys Glu Gly Leu
180 185 190
Leu Ser Glu Ala Ala Ala Glu Glu Asp Ile Ala Asp Pro Phe Phe Ala
195 200 205
Tyr Cys Lys Gln His Ala Asp Arg Leu Asp Arg Lys Trp Lys Arg Lys
210 215 220
Asn Tyr Leu Ala Leu Gln Ser Tyr Cys Lys Met Ser Leu Gln GIu Arg
225 230 235 240
Glu Lys Gln Leu Ser Pro Glu Ala Gln Ala Arg Ile Asn Ala Arg Leu
245 250 255
Gln Gln Tyr Arg Ala Lys Ala GIu Leu Ala Arg Ser Thr Arg Pro Gln
260 265 270
Ala Trp Val Pro Arg Glu Lys Leu Pro Arg Pro Leu Thr Ser Ser Ala
275 280 285
Ser Ala Ile Arg Lys Leu Met Arg Lys Ala Glu Leu Met Gly Ile Ser
290 295 300
Thr Asp Ile Phe Pro Val Asp Asn Ser Asp Thr Ser Ser Ser Val Asp
305 310 315 320
Gly Arg Arg Lys His Lys Gln Pro Ala Leu Thr Ala Asp Phe Val Asn
325 330 335
Tyr Tyr Phe Glu Arg Asn Met Arg Met Ile Gln Ile Gln Glu Asn Met
340 345 350
Ala Glu Gln Lys Asn Ile Lys Asp Lys Leu Glu Asn Glu Gln Glu Lys
355 360 365
Leu His Val Glu Tyr Asn Lys Leu Cys Glu Ser Leu Glu Glu Leu Gln
370 375 380
Asn Leu Asn Gly Lys Leu Arg Ser Glu Gly Gln Gly Ile Trp Ala Leu
385 390 395 400
Leu Gly Arg Ile Thr Gly Gln Lys Leu Asn Ile Pro Ala Ile Leu Arg
405 410 415
Ala Pro Lys Glu Arg Lys Pro Ser Lys Lys Glu Gly Gly Thr Gln Lys
420 425 430
Thr Ser Thr Leu Pro Ala Val Leu Tyr Ser Cys Gly Ile Cys Lys Lys
435 440 445
Asn His Asp Gln His Leu Leu Leu Leu Cys Asp Thr Cys Lys Leu His
450 455 - 460
Tyr His Leu Gly Cys Leu Asp Pro Pro Leu Thr Arg Met Pro Arg Lys
465 470 475 480
12
CA 02351167 2001-05-10
WO 00/28033 PCTNS99/26788
Thr Lys Asn Ser Tyr Trp Gln Cys Ser Glu Cys Asp Gln Ala Gly Ser
485 490 495
Ser Asp Met Glu Ala Asp Met Ala Met Glu Thr Leu Pro Asp Gly Thr
500 505
510
Lys Arg Ser Arg Arg Gln Ile Lys Glu Pro Val Lys Phe Val Pro Gln
515 520 525
IO Asp Val Pro Pro Glu Pro Lys Lys Ile Pro Ile Arg Asn Thr Arg Thr
530 535 540
Arg Gly Arg Lys Arg Ser Phe Val Pro Glu Glu Glu Lys His Glu Glu
S45 550 555
15 560
Arg Val Pro Arg Glu Arg Arg Gln Arg Gln Ser Val Leu Gln Lys Lys
565 570 575
Pro Lys Ala GIu Asp Leu Arg Thr Glu Cys Ala Thr Cys Lys Gly Thr
20 580 585
590
Gly Asp Asn Glu Asn Leu Val Arg Cys Asp Glu Cys Arg Leu Cys Tyr
595 600 605
25 His Phe Gly Cys Leu Asp Pro Pro Leu Lys Lys Ser Pro Lys Gln Thr
610 615 620
Gly Tyr Gly Trp Ile Cys Gln Glu Cys Asp Ser Ser Ser Ser Lys Glu
625 630 635
30 640
Asp Glu Asn Glu Ala Glu Arg Lys Asn Ile Ser Gln Glu Leu Asn Met
645 650 655
Glu Gln Lys Asn Pro Lys Lys
35 660
<210> 30
<211> 372
40 <2I2> PRT
<213> Homo sapiens
<400> 30
Met Ser Lys Ala Phe Gly Leu Leu Arg Gln Ile Cys Gln Ser Ile Leu
45 1 5 to
Ala Glu Ser Ser Gln Ser Pro Ala Asp Leu Glu Glu Lys Lys Glu Glu
25 30
50 Asp Ser Asn Met Lys Arg Glu Gln Pro Arg Glu Arg Pro Arg Ala Trp
35 40 45
Asp Tyr Pro His Gly Leu Val Gly Leu His Asn Ile Gly Gln Thr Cys
50 S5 60
Cys Leu Asn Ser Leu Ile Gln Val Phe Val Met Asn Val Asp Phe Thr
70 - 75 80
Arg Ile Leu Lys Arg Ile Thr Val Pro Arg Gly Ala Asp Glu Gln Arg
60 85 90 95
13
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Arg Ser Val Pro Phe Gln Met Leu Leu Leu Leu Glu Lys Met Gln Asp
100 105 110
Ser Arg Gln Lys Ala Val Arg Pro Leu Glu Leu Ala Tyr Cys Leu Gln
115 120 125
Lys Cys Asn Val Pro Leu Phe Val Gln His Asp Ala Ala Gln Leu Tyr
130 135 140
Leu Lys Leu Trp'Asn Leu Ile Lys Asp Gln Ile Thr Asp Val His Leu
145 1S0 155
160
Val Glu Arg Leu Gln Ala Leu Tyr Met Ile Arg Val Lys Asp Ser Leu
165 170 I75
Ile Cys Val Asp Cys Ala Met GIu Ser Ser Arg Asn Ser Ser Met Leu
180 185 190
Thr Leu Pro Leu Ser Leu Phe Asp Val Asp Ser Lys Pro Leu Lys Thr
195 200 205
Leu Glu Asp Ala Leu His Cys Phe Phe Gln Pro Arg Glu Leu Ser Ser
210 215 220
Lys Ser Lys Cys Phe Cys Glu Asn Cys Gly Lys Lys Thr Arg Gly Lys
225 230 235
240
Gln Val Leu Lys Leu Thr His Leu Pro Gln Thr Leu Thr Ile His Leu
245 250 255
Met Arg Phe Ser Ile Arg Asn Ser Gln Thr Arg Lys Ile Cys His Ser
260 265 270
Leu Tyr Phe Pro Gln 5er Leu Asp Phe Ser Gln Ile Leu Pro Met Lys
275 280 285
Arg Glu Ser Cys Asp Ala Glu Glu Gln Ser Gly Gly Gln Tyr Glu Leu
290 295 300
Phe Ala Val Ile Ala His Val Gly Met Ala Asp Ser Gly His Tyr Cys
305 310 315
320
Val Tyr Ile Arg Asn Ala Val Aap Gly Lys Trp Phe Cys Phe Asn Asp
325 330 335
Ser Asn Ile Cys Leu Val Ser Trp Glu Asp Ile Gln Cys Thr Tyr Gly
340 345 350
Asn Pro Asn Tyr His Trp Gln Glu Thr Ala Tyr Leu Leu Val Tyr Met
355 360
365
Lys Met Glu Cys
370
<210> 31
<211> 71
<212> PRT
<213> Homo Sapiens
<400> 31
14
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
Met Ala Ala Ala Leu Leu Pro Ser Gly Gln Asn Trp His Asn Thr Gly
1 5 10 15
Phe Ile Leu Glu Ser Asn Leu Thr Asn Val Met Lys Val Val Arg Leu
20 25 30
Phe Ile Lys Cys Pro Cys Leu Trp Gly His Glu Lys Ile His Thr Glu
35 40 45
Ser Ile Lys Asn Val Leu Asn Met Glu Arg Pro Leu Ser Asn Ser Asp
50 55 60
Val Met Lys Val Val Val Phe
65 70
<210> 32
<211>
<212> PRT
<213> Homo Sapiens
<400> 32
30
40
50
<210> 33
<211> 302
<212> PRT
<213> Homo Sapiens
<400> 33 .
Met Cys Thr Leu Cys Thr Val Met Lys Ser Gly Asn Gly Arg Gly Glu
1 5 10 15
Lys Asp Gly His Pro Leu Thr Ser Ser Leu Lys Ile Pro Thr Ala Ser
IS
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
20 25 30
Gln Gly Ser Ala Pro Cys Arg Ser Lys Val Gly Val Gly Leu Gly Glu
35 40 45
Met Leu Pro Ile Phe Gln Gly Leu Leu Cys Phe Trp Ser Pro Gly Asn
50 55 60
Arg Cys Cys Leu Glu Leu Trp Arg Glu Gly Phe His Pro Ala Pro Thr
65 70 75 80
Ile Pro Leu Leu Phe His Thr Leu Ala Cys Gly Trp Ser Leu Thr Gly
85 90 95
Leu Val Arg Val Ala Cys Asp Leu Arg Leu Leu Val Pro Gly His Phe
100 105 110
Trp Asn Phe Gly Lys Met Cys Cys Phe Ala Ser Gly Arg Leu Tyr Leu
115 120 125
Val Ala Gly Thr Leu Cys Pro Gln His Thr Phe Phe Cys Asp Ser Arg
130 135 140
Gln Lys Gly Gln Met Gln Lys Gln Asn Gly Gly Lys Ala Val Asp Glu
145 I50 155 160
Arg Gln Leu Phe His Gly Thr Ser Ala Ile Phe Val Asp Ala Ile Cys
165 170 175
Gln Gln Asn Phe Asp Trp Arg Val Cys Gly Val His Gly Thr Ser Tyr
180 185 190
Gly Lys Gly Ser Tyr Phe Ala Arg Asp Ala Ala Tyr Ser His His Tyr
195 200 205
Ser Lys Ser Asp Thr Gln Thr His Thr Met Phe Leu Ala Arg Val Leu
210 215 220
Val Gly Glu Phe Val Arg Gly Asn Ala Ser Phe Val Arg Pro Pro Ala
225 230 235 240
Lys Glu Gly Trp Ser Asn Ala Phe Tyr Asp Ser Cys Val Asn Ser Val
245 250 255
Ser Asp Pro Ser Ile Phe Val Ile Phe Glu Lys His Gln Val Tyr Pro
260 265 270
Glu Tyr Val Ile Gln Tyr Thr Thr Ser Ser Lys Pro Ser Val Thr Pro
275 280 285
SO
Ser Ile Leu Leu Ala Leu Gly Ser Leu Phe Ser Ser Arg Gln
290 295 300
<210> 34
<211> 31
<212> PRT _
<213> Homo sapiens
<400> 34
Met Pro Val Tyr Gly Ile Asn Pro His Leu Thr Phe Gln Pro Ala Ser
16
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26788
1 5 10 I5
Leu Pro Tyr Gly Phe Arg Thr Cys Gln Pro His Asn Ser Leu Lys
20 25 30
S
<210> 35
<211> 95
<212> PRT
<213> Homo Sapiens
<400> 35
Met Leu Ile Glu Asp Val Asp Ala Leu Lys Ser Trp Leu Ala Lys Leu
1 5 10 15
IS
Leu Glu Pro Ile Cys Asp Ala Asp Pro Ser Ala Leu Ala Asn Tyr Val
25 30
Val Ala Leu Val Lys Lys Asp Lys Pro Glu Lys Glu Leu Lys Ala Phe
20 35 40 45
Cys Ala Asp Gln Leu Asp Val Phe Leu Gln Lys Glu Thr Ser Gly Phe
50 55 60
Val Asp Lys Leu Phe Glu Ser Leu Tyr Thr Lys Asn Tyr Leu Pro Leu
65 70 75 80
Leu Glu Pro Val Lys Pro Glu Pro Lys Pro Leu Ala Gln Glu Lys
85 90 95
<210> 36
<211>
<212> PRT
<213> Homo Sapiens
<400> 36
45
55
17
CA 02351167 2001-05-10
WO 00/Z8033 PCT/US99/26788
<210> 37
<211> 261
<212> PRT
<213> Homo Sapiens
<400> 37
Met Asp Ser Arg His Thr Phe Ala Pro Ala Ala Met Thr Leu Ser Pro
1 5 10
Leu Leu Leu Phe Leu Pro Pro Leu Leu Leu Leu Leu Asp Val Pro Thr
25 30
IS Ala Ala Val Gln Ala Ser Pro Leu Gln Ala Leu Asp Phe Phe Gly Asn
35 40 45
Gly Pro Pro Val Asn Tyr Lys Thr Gly Asn Leu Tyr Leu Arg Gly Pro
50 55 60
Leu Lys Lys Ser Asn Ala Pro Leu Val Asn Val Thr Leu Tyr Tyr Glu
65 70 75 80
Ala Leu Cys Gly Gly Cys Arg Ala Phe Leu Ile Arg Glu Leu Phe Pro
85 90 95
Thr Trp Leu Leu Val Met Glu Ile Leu Asn Val Thr Leu Val Pro Tyr
100 105 110
Gly Asn Ala Gln Glu Gln Asn Val Ser Gly Arg Trp Glu Phe Lys Cys
115 120 125
Gln His Gly Glu Glu Glu Cys Lys Phe Asn Lys Val Glu Ala Cys Val
130 135 140
Leu Asp Glu Leu Asp Met Glu Leu Ala Phe Leu Thr Ile Val Cys Met
145 150 155
160
Glu Glu Phe Glu Asp Met Glu Arg Ser Leu Pro Leu Cys Leu Gln Leu
165 170
175
Tyr Ala Pro Gly Leu Ser Pro Asp Thr Ile Met Glu Cys Ala Met Gly
180 185 190
Asp Pro Gly Met Gln Leu Met His Ala Asn Ala Gln Arg Thr Asp Ala
195 200 205
Leu Gln Pro Pro His Glu Tyr Val Pro Trp VaI Thr Val Asn Gly Lys
210 215 220
Pro Leu Glu Asp Gln Thr Gln Leu Leu Thr Leu Val Cys Gln Leu Tyr
225 230 235
240
Gln Gly Lys Lys Pro Asp Val Cys Pro Ser Ser Thr Ser Ser Leu Arg
245 250
255
Ser Val Cys Phe Lys
260
<210> 38
Ig
CA 02351167 2001-05-10
WO 00/28033 PCT/US99/26?88
<211> 21
<212> PRT
<213> Homo sapiens
<400> 38
Met Pro Gly Tyr Arg His Cys Thr Pro Ala Trp Val Thr Glu Arg Asp
1 5 10 15
Ser Val Ser Glu Lys
20
19
