Note: Descriptions are shown in the official language in which they were submitted.
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/Z6303
TITLE OF THE INVENTION
G PROTEIN-COUPLED RECEPTOR RESEMBLING THE LEUKOTRIENE B4
RECEPTOR
CROSS-REFERENCE TO RELATED APPLICATIONS
Not applicable.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
This invention relates to a novel human DNA encoding HG07, a G
protein-coupled receptor (GPCR) related to the leukotriene B4 receptor, the
protein
encoded by the DNA, and methods of identifying selective agonists and
antagonists of
the protein encoded by the DNA.
BACKGROUND OF THE INVENTION
G-protein coupled receptors (GPCRs) are a very large class of
membrane receptors that relay information from the exterior to the interior of
cells.
GPCRs function by interacting with a class of heterotrimeric proteins known as
G-
proteins. Most GPCRs function by a similar mechanism. Upon the binding of
agonist, a GPCR catalyzes the dissociation of guanosine diphosphate (GDP) from
the
a subunit of G proteins. This allows for the binding of guanosine triphosphate
(GTP)
to the a subunit, resulting in the disassociation of the a subunit from the (3
and y
subunits. The freed a subunit then interacts with other cellular components,
and in
the process passes on the extracellular signal represented by the presence of
the
agonist. Occasionally, it is the freed ~i and y subunits which transduce the
agonist
signal.
GPCRs possess common structural characteristics. They have seven
hydrophobic domains, each about 20-30 amino acids long, linked by sequences of
hydrophilic amino acids of varied length. These seven hydrophobic domains
intercalate into the plasma membrane, giving rise to a protein with seven
-1-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
transmembrane domains, an extracellular amino terminus, and an intracellular
carboxy terminus (Strader et al., 1994, Ann. Rev. Biochem. 63:101-132;
Schertler et
al., 1993, Nature 362:770-7721; Dohlman et al., 1991, Ann. Rev. Biochem.
60:653-
688).
GPCRs are expressed in a wide variety of tissue types and respond to a
wide range of ligands, e.g., protein hormones, biogenic amines, peptides,
lipid derived
messengers, etc. Given their wide range of expression and ligands, it is not
surprising
that GPCRs are involved in many pathological states. This has led to great
interest in
developing modulators of GPCR activity that can be used pharmacologically. For
example, Table 1 of Stadel et al., 1997, Trends Pharmacol. Sci. 18:430-437,
lists 37
different marketed drugs that act upon GPCRs. Accordingly, there is a great
need to
understand GPCR function and to develop agents that can be used to modulate
GPCR
activity.
Leukotriene B4 (5(S),12(R)-dihydroxy-6,14-cis, 8,10,-trans-
eicosatetraenoic acid) (LTB4) is involved in various immune responses, such as
defenses against infection, and is involved in the process of inflammation as
well.
LTB4 induces chemotactic migration (Goetzl & Pickett, 1980, J. Immunol.
125:1789-
1791) and chemokinetic activity (Palmer et al., 1980, Prostaglandins 20:411-
418) as
well as aggregation of polymorphonuclear leukocytes (Ford-Hutchinson et al.,
1980,
Nature 286:264-265).
High levels of LTB4 are implicated in certain disorders involving
inflammation, such as psoriasis (Degiulio et al., 1993, Ann. New York Acad.
Sci.
685:614-617). LTB4 has been detected in the spinal fluid of multiple sclerosis
patients (Neu et al., 1992, Acta Neurol. Scand. 86:586-587) and inhibition of
the
interaction of LTB4 with its receptor prevents the development of paralysis
and the
infiltration into the spinal chord by eosinophils in experimental allergic
encephalomyelitis, a murine model of multiple sclerosis (Gladue et al., 1996,
J. Exp.
Med. 183:1893-1898).
Yokomizo et al., 1997, Nature 387:620-624 isolated a human cDNA
encoding a receptor for LTB4 from HL-60 cells that had been stimulated to
differentiate by retinoic acid. Based upon its deduced amino acid sequence
(GenBank
accession numbers D89078 [cDNA]; D89079 [protein]), this cDNA encodes a seven-
transmembrane domain G-protein coupled receptor. Transfection of this cDNA
into
cells not nonmally expressing the encoded receptor, and not normally
responsive to
leukotriene B4, resulted in the conversion of the transfected cells into cells
that
-2-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
specifically bound LTB4 with a Kd similar to that of differentiated HL-60
cells.
Upon exposure to LTB4, the transfected cells also displayed several functional
responses characteristic of LTB4-responsive cells: an increase in
intracellular
calcium, D-myo-inositol 1,4,5-triphosphate (InsP3) accumulation, inhibition of
adenylyl cyclase, and chemotaxis.
SUMMARY OF THE INVENTION
The present invention is directed to a novel human DNA that encodes
a G-protein coupled receptor, HG07. The DNA encoding HG07 is substantially
free
from other nucleic acids and has the nucleotide sequence shown in
SEQ.ID.NO.:1.
Also provided is an HG07 protein encoded by the novel DNA sequence. The HG07
protein is substantially free from other proteins and has the amino acid
sequence
shown in SEQ.ID.N0.:2. Methods of expressing HG07 in recombinant systems and
of identifying agonists and antagonists of HG07 are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the complete cDNA sequence of HG07
(SEQ.ID.NO.:1 ).
Figure 2 shows the complete amino acid sequence of HG07
(SEQ.ID.N0.:2).
Figure 3A-B shows the location of the HG07 open reading frame. The
nucleotide sequence shown is a portion of (SEQ.ID.NO.:1 ). The amino acid
sequence
shown is (SEQ.ID.N0.:2).
Figure 4 shows the results of a Northern blot of HG07 mRNA in
various human tissues.
Figure 5 shows an alignment of the amino acid sequence of HG07 with
the amino acid sequence of a human leukotriene B4 receptor (SEQ.ID.N0.:3;
GenBank accession number D89079, see Yokomizo et al., 1997, Nature 387:620-
624).
DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention:
"Substantially free from other proteins" means at least 90%, preferably
95%, more preferably 99%, and even more preferably 99.9%, free of other
proteins.
-3-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
Thus, an HG07 protein preparation that is substantially free from other
proteins will
contain, as a percent of its total protein, no more than 10%, preferably no
more than
5%, more preferably no more than 1 %, and even more preferably no more than
0.1 %,
of non-HG07 proteins. Whether a given HG07 protein preparation is
substantially
free from other proteins can be determined by such conventional techniques of
assessing protein purity as, e.g., sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) combined with appropriate detection methods, e.g.,
silver staining or immunoblotting.
"Substantially free from other nucleic acids" means at least
90°/, preferably 95°/, more preferably 99°/, and even
more preferably
99.9%, free of other nucleic acids. Thus, an HG07 DNA preparation that
is substantially free from other nucleic acids will contain, as a percent of
its total nucleic acid, no more than 10%, preferably no more than 5%, more
preferably no more than 1%, and even more preferably no more than 0.1%,
of non-HG07 nucleic acids. Whether a given HG07 DNA preparation is
substantially free from other nucleic acids can be determined by such
conventional techniques of assessing nucleic acid purity as, e.g., agarose
gel electrophoresis combined with appropriate staining methods, e.g.,
ethidium bromide staining, or by sequencing.
"Functional equivalent" means a receptor which does not
have exactly the same amino acid sequence as naturally occurring HG07,
due to alternative splicing, substitutions, deletions, mutations, or
additions, but retains substantially the same biological activity as HG07.
Such functional equivalents will have significant amino acid sequence
identity with naturally occurring HG07. Genes and DNA encoding such
functional equivalents can be detected by reduced stringency
hybridization with a DNA sequence encoding naturally occurring HG07.
For the purposes of this invention, naturally occurring HG07 has the
amino acid sequence shown as SEQ.ID.N0.:2 and is encoded by
SEQ.ID.NO.:1. A nucleic acid encoding a functional equivalent has at
least about 50% identity at the nucleotide level to SEfI.ID.N0.:1.
A polypeptide has "substantially the same biological activity" as HG07
if that polypeptide has a Kd for a ligand that is no more than 5-fold greater
than the
ICd of HG07 having SEQ.ID.N0.:2 for the same ligand.
-4-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
A "conservative amino acid substitution" refers to the
replacement of one amino acid residue by another, chemically similar,
amino acid residue. Examples of such conservative substitutions are:
substitution of one hydrophobic residue (isoleucine, leucine, valine, or
methionine) for another; substitution of one polar residue for another
polar residue of the same charge (e.g., arginine for lysine; glutamic acid for
aspartic acid).
By "isolated HG07 protein" or "isolated HG07 DNA" is meant
HG07 protein or DNA encoding HG07 that has been isolated from a
natural source. Use of the term "isolated" indicates that HG07 protein or
DNA has been removed from its normal cellular environment. Thus, an
isolated HG07 protein may be in a cell-free solution or placed in a different
cellular environment from that in which it occurs naturally. The term
isolated does not imply that an isolated HG07 protein is the only protein
present, but instead means that an isolated HG07 protein is at least 95%
free of non-amino acid material (e.g., nucleic acids, lipids, carbohydrates)
naturally associated with the HG07 protein. Thus, an HG07 protein that
is expressed in bacteria or even in eukaryotic cells which do not naturally
(i.e., without human intervention) express it through recombinant means
is an "isolated HG07 protein." Similarly, DNA encoding HG07 that is
present in bacteria or even in eukaryotic cells which do not naturally (i.e.,
without human intervention) contain it through recombinant means is an
"isolated DNA encoding HG07."
One aspect of this invention is an isolated DNA comprising
nucleotides encoding a polypeptide having the amino acid sequence
SEQ.ID.N0.:2.
This isolated DNA is substantially free from other nucleic acids and can be
either
single stranded or double stranded, i.e., paired with its complementary
sequence.
Another aspect of this invention is the identification and cloning of a cDNA
which
encodes HG07, a G protein-coupled receptor. This cDNA is substantially free
from
other nucleic acids and can be either single stranded or double stranded. The
present
invention provides a cDNA molecule substantially free from other nucleic acids
having the nucleotide sequence shown in Figure 1 as SEQ.ID.NO.:1. SEQ.ID.NO.:1
contains an open reading frame (positions 158-1,324 of SEQ.ID.NO.:1) encoding
a
protein of 389 amino acids (see Figure 3A-B). Thus, the present invention also
-5-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99J26303
provides a DNA molecule substantially free from other nucleic acids comprising
the
nucleotide sequence of positions 158-1,324 of SEQ.ID.NO.:1. The present
invention
also provides recombinant DNA molecules comprising the nucleotide sequence of
positions 158-1,324 of SEQ.>D.NO.:1.
Based on its predicted amino acid sequence, the HG07 protein most
likely represents a novel G-protein coupled receptor (GPCR) since the HG07
protein
contains many of the characteristic features of G-protein coupled receptors
(GPCRs),
e.g..
(a) seven transmembrane domains;
(b) three intracellular loops;
(c) three extracellular loops; and
(d) the GPCR triplet signature sequence.
Northern blot analysis (Figure 4) showed that HG07 RNA is
widely expressed in humans as a transcript of about 2.4 kb, especially in
cells of the immune system (peripheral blood lymphocytes (PBLs) and
spleen}. This argues for a role for HG07 in such immune system functions
as inflammation, responses to infection, chemotaxis of lymphocytes, etc..
The novel DNA sequences of the present invention encoding
HG07, in whole or in part, can be linked with other DNA sequences, i.e.,
DNA sequences to which HG07 is not naturally linked, to form
"recombinant DNA molecules" containing HG07. The novel DNA
sequences of the present invention can be inserted into vectors in order to
direct recombinant expression of HG07. Such vectors may be comprised of
DNA or RNA; for most purposes DNA vectors are preferred. Typical
vectors include plasmids, modified viruses, bacteriophage, cosmids, yeast
artificial chromosomes, and other forms of episomal or integrated DNA
that can encode HG07. One skilled in the art can readily determine an
appropriate vector for a particular use.
Included in the present invention are DNA sequences that hybridize to
SEQ.ID.NO.:1 under stringent conditions. By way of example, and not
limitation, a
procedure using conditions of high stringency is as follows: Prehybridization
of filters
containing DNA is carried out for 2 hr. to overnight at 65°C in buffer
composed of
6X SSC, SX Denhardt's solution, and 100 pg/ml denatured salmon sperm DNA.
Filters are hybridized for 12 to 48 hrs at 65°C in prehybridization
mixture containing
100 pg/ml denatured salmon sperm DNA and S-20 X 106 cpm of 32P-labeled probe.
-6-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/Z6303
Washing of filters is done at 37°C for 1 hr in a solution containing 2X
SSC, 0.1%
SDS. This is followed by a wash in O.1X SSC, 0.1% SDS at 50°C for 45
min. before
autoradiography.
Other procedures using conditions of high stringency would include
either a hybridization step carried out in SXSSC, 5X Denhardt's solution, 50%
formamide at 42°C for 12 to 48 hours or a washing step carned out in
0.2X SSPE,
0.2% SDS at 65°C for 30 to 60 minutes.
Reagents mentioned in the foregoing procedures for carrying out high
stringency hybridization are well known in the art. Details of the composition
of
these reagents can be found in, e.g., Sambrook, Fritsch, and Maniatis, 1989,
Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor
Laboratory Press. In addition to the foregoing, other conditions of high
stringency
which may be used are well known in the art.
The degeneracy of the genetic code is such that, for all but two amino
acids, more than a single codon encodes a particular amino acid. This allows
for the
construction of synthetic DNA that encodes the HG07 protein where the
nucleotide
sequence of the synthetic DNA differs significantly from the nucleotide
sequence of
SEQ.ID.NO.:1, but still encodes the same HG07 protein as SEQ.ID.NO.:1. Such
synthetic DNAs are intended to be within the scope of the present invention.
If it is
desired to express such synthetic DNAs in a particular host cell or organism,
the
codon usage of such synthetic DNAs can be adjusted to reflect the codon usage
of that
particular host, thus leading to higher levels of expression of HG07 protein
in the
host.
Another aspect of the present invention includes host cells that have
been engineered to contain and/or express DNA sequences encoding HG07. Such
recombinant host cells can be cultured under suitable conditions to produce
HG07.
An expression vector containing DNA encoding HG07 can be used for expression
of
HG07 in a recombinant host cell. Recombinant host cells may be prokaryotic or
eukaryotic, including but not limited to, bacteria such as E. coli, fungal
cells such as
yeast, mammalian cells including, but not limited to, cell lines of human,
bovine,
porcine, monkey, and rodent origin, and insect cells including but not limited
to,
Drosophila and silkworm derived cell lines. Cell lines derived from mammalian
species which are suitable for recombinant expression of HG07 and which are
commercially available, include but are not limited to, L cells L-M(TK-) (ATCC
CCL
_7_
CA 02351874 2001-05-10
WO 00/Z9423 PCT/US99/26303
1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), Raji (ATCC CCL 86),
CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651),
CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658),
HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and
MRC-5 (ATCC CCL 171).
Human embryonic kidney (HEK 293) cells and Chinese hamster ovary
(CHO) cells are particularly suitable for expression of the HG07 protein
because these
cells express a large number of G-proteins. Thus, it is likely that at least
one of these
G-proteins will be able to functionally couple the signal generated by
interaction of
HG07 and its ligands, thus transmitting this signal to downstream effectors,
eventually resulting in a measurable change in some assayable component, e.g.,
cAMP level, expression of a reporter gene, hydrolysis of inositol lipids, or
intracellular Ca2+ levels.
Other cells that are particularly suitable for expression of the HG07
protein are immortalized melanophore pigment cells from Xenopus laevis. Such
melanophore pigment cells can be used for functional assays using recombinant
expression of HG07 in a manner similar to the use of such melanophore pigment
cells
for the functional assay of other recombinant GPCRs (Graminski et al., 1993,
J. Biol.
Chem. 268:5957-5964; Lerner, 1994, Trends Neurosci. 17:142-146; Potenza &
Lerner, 1992, Pigment Cell Res. 5:372-378).
A variety of mammalian expression vectors can he used to express
recombinant HG07 in mammalian and other cells. Commercially available
mammalian expression vectors which are suitable include, but are not limited
to,
pCR2.1 (Invitrogen), pMClneo (Stratagene), pSGS (Stratagene), pcDNAI and
pcDNAIamp, pcDNA3, pcDNA3.1, pCR3.1 (Invitrogen), EBO-pSV2-neo (ATCC
37593), pBPV-1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224),
pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), and pSV2-dhfr (ATCC 37146).
For expression in non-mammalian cells, various suitable expression vectors are
known in the art. The choice of vector will depend upon cell type used, level
of
expression desired, and the like. Following expression in recombinant cells,
HG07
can be purified to a level that is substantially free from other proteins by
conventional
techniques, e.g., salt fractionation, ion exchange chromatography, size
exclusion
chromatography, hydroxylapatite adsorption chromatography, hydrophobic
interaction chromatography, and preparative gel electrophoresis.
_g-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
The present invention includes HG07 protein substantially free from
other proteins. The amino acid sequence of the full-length HG07 protein is
shown in
Figure 2 as SEQ.ID.N0.:2. Thus, the present invention includes HG07 protein
substantially free from other proteins having the amino acid sequence of
SEQ.ID.N0.:2.
As with many receptor proteins, it is possible to modify many of the
amino acids of HG07, particularly those which are not found in the ligand
binding
domain, and still retain substantially the same biological activity as the
original
receptor. Thus this invention includes modified HG07 polypeptides which have
amino acid deletions, additions, or substitutions but that still retain
substantially the
same biological activity as HG07. It is generally accepted that single amino
acid
substitutions do not usually alter the biological activity of a protein (see,
e.g.,
Molecular Biology of the Gene, Watson et al., 1987, Fourth Ed., The
Benjamin/Cummings Publishing Co., Inc., page 226; and Cunningham & Wells,
1989, Science 244:1081-1085). Accordingly, the present invention includes
polypeptides where one amino acid substitution has been made in SEQ.ID.N0.:2
wherein the polypeptides still retain substantially the same biological
activity as
HG07. The present invention also includes polypeptides where two or more amino
acid substitutions have been made in SEQ.ID.N0.:2 wherein the polypeptides
still
retain substantially the same biological activity as HG07. In particular, the
present
invention includes embodiments where the above-described substitutions are
conservative substitutions. In particular, the present invention includes
embodiments
where the above-described substitutions do not occur in the ligand-binding
domain of
HG07.
When deciding which amino acid residues of HG07 may be substituted
to pmduce polypeptides that are functional equivalents of HG07, one skilled in
the art
would be guided by a comparison of the amino acid sequence of HG07 with the
amino acid sequences of related proteins, e.g., the human leukotriene B4
receptor
disclosed in Yokomizo et al., 1997, Nature 387:620-624. See also Figure 5 of
the
present application. Such a comparison would allow one skilled in the art to
minimize the number of amino acid substitutions made in regions that are
highly
conserved between HG07 and the related protein. Accordingly, the present
invention
includes embodiments where the substitutions are conservative and do not occur
in
positions where HG07 and the human Ieukotriene B4 receptor share the same
amino
acid (see Figure 5).
-9-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
One skilled in the art would also recognize that polypeptides that are
functional equivalents of HG07 and have changes from the HG07 amino acid
sequence that are small deletions or insertions of amino acids could also be
produced
by following the same guidelines, i.e., minimizing the differences in amino
acid
sequence between HG07 and related proteins. Small deletions or insertions are
generally in the range of about 1 to 5 amino acids. The effect of such small
deletions
or insertions on the biological activity of the modified HG07 polypeptide can
easily
be assayed by producing the polypeptide synthetically or by making the
required
changes in DNA encoding HG07 and then expressing the DNA recombinantly and
assaying the protein produced by such recombinant expression. Assays that
could be
used include simple binding assays to determine if the modified HG07
polypeptide is
capable of binding the same ligands, with approximately the same affinity, as
the
naturally occurring HG07 protein. Alternatively, one can use functional assays
such
as assays for increases in intracellular calcium, D-myo-inositol 1,4,5-
triphosphate
(InsP3) accumulation, inhibition of adenylyl cyclase, or chemotaxis. Such
assays can
be based upon similar assays for the leukotriene B4 receptor disclosed in
Yokomizo et
al., 1997, Nature 387:620-624.
The present invention also includes C-terminal truncated forms of
HG07, particularly those which encompass the extracellular portion of the
receptor,
but lack the intracellular signaling portion of the receptor. Such truncated
receptors
are useful in various binding assays described herein, for crystallization
studies, and
for structure-activity-relationship studies.
The present invention also includes chimeric HG07 proteins. Chimeric
HG07 proteins consist of a contiguous polypeptide sequence of HG07 fused in
frame
to a polypeptide sequence of a non-HG07 protein. For example, the N-terminal
domain and seven transmembrane spanning domains of HG07 fused at the C-
terminus
in frame to a G protein would be a chimeric HG07 protein.
The present invention also includes HG07 proteins that are in the form
of multimeric structures, e.g., dimers. Such multimers of other G-protein
coupled
receptors are known (Hebert et al., 1996, J. Biol. Chem. 271, 16384-16392; Ng
et al.,
1996, Biochem. Biophys. Res. Comm. 227, 200-204; Romano et al., 1996, J. Biol.
Chem. 271, 28612-28616).
The present invention also includes isolated forms of HG07 proteins.
The present invention includes methods of identifying compounds that
specifically bind to HG07 protein, as well as compounds identified by such
methods.
- 10-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
The specificity of binding of compounds having affinity for HG07 is shown by
measuring the affinity of the compounds for recombinant cells expressing the
cloned
receptor or for membranes from such cells. Expression of the cloned receptor
and
screening for compounds that bind to HG07 or that inhibit the binding of a
known
ligand of HG07 to such cells, or membranes prepared from such cells, provides
an
effective method for the rapid selection of compounds with high affinity for
HG07.
Such ligands or compounds can be radiolabeled, but can also be nonisotopic
compounds that can be used to displace bound radioIabeled ligands or that can
be
used as activators in functional assays. Compounds identified by the above
method
are likely to be agonists or antagonists of HG07 and may be peptides,
proteins, or
non-proteinaceous organic molecules.
Therefore, the present invention includes assays by which
HG07 agonists and antagonists may be identified. Methods for identifying
agonists and antagonists of other receptors are well known in the art and
can be adapted to identify agonists and antagonists of HG07. Accordingly,
the present invention includes a method for determining whether a
substance is a potential agonist or antagonist of HG07 that comprises:
(a) transfecting cells with an expression vector encoding
HG07;
(b) allowing the transfected cells to grow for a time
sufficient to allow HG07 to be expressed;
(c) exposing the cells to a labeled ligand of HG07 in the
presence and in the absence of the substance;
(d) measuring the binding of the labeled ligand to HG07;
where if the amount of binding of the labeled ligand is less in the presence
of the substance than in the absence of the substance, then the substance
is a potential agonist or antagonist of HG07.
The conditions under which step (c) of the method is
practiced are conditions that are typically used in the art for the study of
protein-ligand interactions: e.g., physiological pH; salt conditions such as
those represented by such commonly used buffers as PBS or in tissue
culture media; a temperature of about 4°C to about 55°C.
The present invention also includes a method for determining
whether a substance is capable of binding to HG07, i.e., whether the
-11-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
substance is a potential agonist or an antagonist of HG07, where the
method comprises:
(a) providing test cells by transfecting cells with an
expression vector that directs the expression of HG07 in the cells;
(b) exposing the test cells to the substance;
(c) measuring the amount of binding of the substance to
HG07;
(d) comparing the amount of binding of the substance to
HGO? in the test cells with the amount of binding of the substance to
control cells that have not been transfected with HG07;
wherein if the amount of binding of the substance is greater
in the test cells as compared to the control cells, the substance is capable
of binding to HG07. Determining whether the substance is an agonist or
antagonist can then be accomplished by the use of functional assays such
as, e.g., the assay involving the use of promiscuous G-proteins described
below.
The conditions under which step (b) of the method is
practiced are conditions that are typically used in the art for the study of
protein-ligand interactions: e.g., physiological pH; salt conditions such as
those represented by such commonly used buffers as PBS or in tissue
culture media; a temperature of about 4°C to about 55°C.
In a particular embodiment of the above-described methods,
the cells are eukaryotic cells. In another embodiment, the cells are
mammalian cells. In other embodiments, the cells are L cells L-M(TK-)
{ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), Raji
(ATCC CCL 86), CV-1 (ATCC CCL 70), COS-I (ATCC CRL 1650), COS-7
(ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92),
NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL
1616), BS-C-1 (ATCC CCL 26) or MRC-5 (ATCC CCL 171).
The assays described above can be carried out with cells that
have been transiently or stably transfected with HG07. Transfection is
meant to include any method known in the art for introducing HG07 into
the test cells. For example, transfection includes calcium phosphate or
-12-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
calcium chloride mediated transfection, lipofection, infection with a
retroviral construct containing HG07, and electroporation.
Where binding of the substance or agonist to HG07 is
measured, such binding can be measured by employing a labeled
substance or agonist. The substance or agonist can be labeled in any
convenient manner known to the art, e.g., radioactively, fluorescently,
enzymatically.
In particular embodiments of the above-described methods, HG07 has
an amino acid sequence of SEQ.ID.N0.:2.
The above-described methods can be modified in that, rather
than exposing the test cells to the substance, membranes can be prepared
from the test cells and those membranes can be exposed to the substance.
Such a modification utilizing membranes rather than cells is well known
in the art and is described in, e.g., Hess et al., 1992, Biochem. Biophys.
R,es. Comm. 184:260-268.
Accordingly, the present invention provides a method for
determining Whether a substance is capable of binding to HG07
comprising:
(a) providing test cells by transfecting cells with an
expression vector that directs the expression of HG07 in the cells;
(b) preparing membranes containing HG07 from the test
cells and exposing the membranes to a ligand of HG07 under conditions
such that the ligand binds to the HG07 in the membranes;
(c) subsequently or concurrently to step (b), exposing the
membranes from the test cells to a substance;
(d) measuring the amount of binding of the ligand to the
HG07 in the membranes in the presence and the absence of the substance;
(e) comparing the amount of binding of the ligand to HG07 in the
membranes in the presence and the absence of the substance where a decrease in
the
amount of binding of the ligand to HG07 in the membranes in the presence of
the
substance indicates that the substance is capable of binding to HG07;
where HG07 has an amino acid sequence of SEQ.ID.N0.:2.
The present invention provides a method for determining
whether a substance is capable of binding to HG07 comprising:
-13-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99l26303
(a) providing test cells by transfecting cells with an
expression vector that directs the expression of HG07 in the cells;
(b) preparing membranes containing HG07 from the test
cells and exposing the membranes from the test cells to the substance;
(c) measuring the amount of binding of the substance to
the HG07 in the membranes from the test cells;
(d) comparing the amount of binding of the substance to HG07 in
the membranes from the test cells with the amount of binding of the substance
to
membranes from control cells that have not been transfected with HG07;
where HG07 has an amino acid sequence of SEQ.ID.N0.:2;
where if the amount of binding of the substance to HG07 in the
membranes from the test cells is greater than the amount of binding of the
substance
to the membranes from the control cells, then the substance is capable of
binding to
HG07.
As a further modification of the above-described methods,
RNA encoding HG07 can be prepared, e.g., by in vitro transcription using
a plasmid containing HG07 under the control of a bacteriophage T7
promoter, and the RNA can be microinjected into Xenopus oocytes in order
to cause the expression of HG07 in the oocytes. Substances are then
tested for binding to the HG07 expressed in the oocytes. Alternatively,
rather than detecting binding, the effect of the substances on the
electrophysiological properties of the oocytes can be determined.
The present invention includes assays by which HG07
agonists and antagonists may be identified by their ability to stimulate or
antagonize a functional response mediated by HG07. One skilled in the
art would be familiar with a variety of methods of measuring the
functional responses of G-protein coupled receptors (see, e.g., Lerner,
1994, Trends Neurosci. 17:142-146 [changes in pigment distribution in
melanophore cells]; Yokomizo et al., 1997, Nature 387:620-624 [changes
in cAMP or calcium concentration; chemotaxis]; Howard et al., 1996,
Science 273:974-97? [changes in membrane currents in Xenopus oocytes];
McKee et al., 1997, Mol. Endocrinol. 11:415-423 [changes in calcium
concentration measured using the aequorin assay]; Offermanns & Simon,
- I4-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
1995, J. Biol. Chem. 270:15175, 15180 [changes in inositol phosphate
levels]).
Accordingly, the present invention provides a method of
identifying agonists and antagonists of HG07 comprising:
S (a) providing test cells by transfecting cells with an
expression vector that directs the expression of HG07 in the cells;
(b) exposing the test cells to a substance that is suspected
of being an agonist or an antagonist of HG07;
(c) measuring the amount of a functional response of the
test cells that have been exposed to the substance;
(d) comparing the amount of the functional response
exhibited by the test cells with the amount of the functional response
exhibited by control cells;
wherein if the amount of the functional response exhibited by the test
cells differs from the amount of the functional response exhibited by the
control cells,
the substance is an agonist or antagonist of HG07;
where the control cells are cells that have not been transfected with
HG07 but have been exposed to the substance or are test cells that have not
been
exposed to the substance;
where HG07 has the amino acid sequence SEQ.ID.N0.:2.
In particular embodiments, the functional response is selected from the
group consisting of changes in pigment distribution in melanophore cells;
changes in
CAMP or calcium concentration; chemotaxis; changes in membrane currents in
Xenopus oocytes; and changes in inositol phosphate levels.
HG07 belongs to the class of proteins known as G-protein
coupled receptors (GPCRs). GPCRs transmit signals across cell
membranes upon the binding of ligand. The ligand-bound GPCR interacts
with a heterotrimeric G-protein, causing the Ga subunit of the G-protein
to disassociate from the G(3 and Gy subunits. The Ga subunit can then go
on to activate a variety of second messenger systems.
Generally, a particular GPCR is only coupled to a particular
type of G-protein. Thus, to observe a functional response from the GPCR,
it is necessary to ensure that the proper G-protein is present in the system
containing the GPCR. It has been found, however, that there axe certain
-15-
CA 02351874 2001-05-10
WO 00/29423 PCTNS99/26303
G-proteins that are "promiscuous." These promiscuous G-proteins will
couple to, and thus transduce a functional signal from, virtually any
GPCR. See Offermanns & Simon, 1995, J. Biol. Chem. 270:151?5, 15180
(Offermanns). Offermanns described a system in which cells are
transfected with expression vectors that result in the expression of one of
a large number of GPCRs as well as the expression of one of the
promiscuous G-proteins Gal5 or Gal6. Upon the addition of an agonist of
the GPCR to the transfected cells, the GPCR was activated and was able,
via Gal5 or Gal6, to activate the ~3 isoform of phospholipase C, leading to
an increase in inositol phosphate levels in the cells.
Therefore, by making use of these promiscuous G-proteins as
in Offermanns, it is possible to set up functional assays for HG07, even in
the absence of knowledge of the G-protein with which HG07 is coupled iii
vivo. One possibility is to create a fusion or chimeric protein composed of ,
the extracellular and membrane spanning portion of HG07 fused to a
promiscuous G-protein. Such a fusion protein would be expected to
transduce a signal following binding of ligand to the HG07 portion of the
fusion protein. Accordingly, the present invention provides a method of
identifying antagonists of HGO? comprising:
(a) providing cells that expresses a chimeric HG07 protein
fused at its C-terminus to a promiscuous G-protein;
(b) exposing the cells to an agonist of HG07;
(c) subsequently or concurrently to step (b), exposing the
cells to a substance that is a suspected antagonist of HG07;
(d) measuring the level of inositol phosphates in the cells;
where a decrease in the level of inositol phosphates in the cells in the
presence of the substance as compared to the level of inositol phosphates in
the cells
in the absence of the substance indicates that the substance is an antagonist
of HG07.
Another possibility for utilizing promiscuous G-proteins in
connection with HG07 includes a method of identifying agonists of HG07
comprising:
(a) providing cells that expresses both HG07 and a
promiscuous G-protein;
-16-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
(b) exposing the cells to a substance that is a suspected
agonist of HG07;
(c) measuring the level of inositol phosphates in the cells;
where an increase in the level of inositol phosphates in the
cells as compared to the level of inositol phosphates in the cells in the
absence of the suspected agonist indicates that the substance is an agonist
of HG07.
Levels of inositol phosphates can be measured by monitoring
calcium mobilization. Intracellular calcium mobilization is typically
assayed in whole cells under a microscope using fluorescent dyes or in cell
suspensions via luminescence using the aequorin assay.
In a particular embodiment of the above-described method,
the cells are eukaryotic cells. In another embodiment, the cells are
mammalian cells. In other embodiments, the cells are L cells L-M(TK-)
(ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), Raji
(ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7
(ATCC CRL 1651), CHO-Kl (ATCC CCL 61), 3T3 (ATCC CCL 92),
NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL
1616), BS-C-1 (ATCC CCL 26) or MRC-5 (ATCC CCL 171).
In a particular embodiment of the above-described method,
the cells are transfected with expression vectors'that direct the expression
of HG07 and the promiscuous G-protein in the cells.
The conditions under which step (b) of the method is
practiced are conditions that are typically used in the art for the study of
protein-ligand interactions: e.g., physiological pH; salt conditions such as
those represented by such commonly used buffers as PBS or in tissue
culture media; a temperature of about 4°C to about 55°C.
In a particular embodiment of the above-described method,
the promiscuous G-protein is selected from the group consisting of Gal5 or
Gal6. Expression vectors containing Gal5 or Gal6 are known in the art.
See, e.g., Offermanns; Buhl et al., 1993, FEBS Lett. 323:132-134;
Amatruda et al., 1993, J. Biol. Chem. 268:10139-10144.
-17-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
The above-described assay can be easily modified to form a
method to identify antagonists of HG07. Such a method is also part of the
present invention and comprises:
(a) providing cells that expresses both HG07 and a
promiscuous G-protein;
(b) exposing the cells to a substance that is an agonist of
HG07;
(c) subsequently or concurrently to step (b), exposing the
cells to a substance that is a suspected antagonist of HG07;
(d) measuring the level of inositol phosphates in the cells;
where a decrease in the level of inositol phosphates in the
cells in the presence of the suspected antagonist as compared to the level
of inositol phosphates in the cells in the absence of the suspected
antagonist indicates that the substance is an antagonist of HG07.
In a particular embodiment of the above-described method,
the cells are eukaryotic cells. In another embodiment, the cells are
mammalian cells. In other embodiments, the cells are L cells L-M(TK-)
(ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), Raji
(ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7
(ATCC CRL I651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92),
NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL
1616), BS-C-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171).
The conditions under which steps (b) and (c) of the method
are practiced are conditions that are typically used in the art for the study
of protein-ligand interactions: e.g., physiological pH; salt conditions such
as those represented by such commonly used buffers as PBS or in tissue
culture media; a temperature of about 4°C to about 55°C.
In a particular embodiment of the above-described method,
the cells are transfected with expression vectors that direct the expression
of HG07 and the promiscuous G-protein in the cells.
In a particular embodiment of the above-described method,
the promiscuous G-protein is selected from the group consisting of Gals or
Gal6.
-18-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
In particular embodiments of the above-described methods, HG07 has
an amino acid sequence of SEQ.ID.N0.:2.
Another functional asssay that can be used to identify agonists and
antagonists of HG07 relies on the ability of leukotriene B4 to induce the
chemotaxis
or chemokinesis of certain cell types through action at the leukotriene
receptor (see,
e.g., Yokomizo et al., 1997, Nature 387:620-624; Ng et al., 1991, J. Immunol.
147:3096-3103). Given the high degreee of similarity in amino acid sequence
between HG07 and the leukotriene B4 receptor (about 46%, see Figure 5), is is
expected that agonists of HG07 will be able to induce the chemotaxis or
chemokinesis
of cells.
Accordingly, the present invention provides a method of identifying
agonists of HG07 comprising:
(a) providing test cells by transfecting cells with an
expression vector that directs the expression of HG07 in the cells;
1 S (b) exposing the test cells to a substance;
(c) measuring the amount of chemotaxis or chemokinesis
exhibited by the test cells that have been exposed to the substance;
(d) comparing the amount of chemotaxis or chemokinesis
exhibited by the test cells with the amount of chemotaxis or chemokinesis
exhibited by control cells;
wherein if the amount of chemotaxis or chemokinesis exhibited by the
test cells is greater than the amount of chemotaxis or chemokinesis exhibited
by
control cells, the substance is an agonist of binding to HG07;
where the control cells are cells that have not been transfected with
HG07 but have been exposed to the substance or are test cells that have not
been
exposed to the substance;
where HG07 has the amino acid sequence SEQ.)D.N0.:2.
In particular embodiments the cells are CHO cells.
While the above-described methods are explicitly directed to testing
whether "a" substance is an agonist or antagonist of HG07, it will be clear to
one
skilled in the art that such methods can be adapted to test collections of
substances,
e.g., combinatorial libraries, to determine whether any members of such
collections
are activators or inhibitors of HG07. Accordingly, the use of collections of
substances, or individual members of such collections, as the substance in the
above-
described methods is within the scope of the present invention.
-19-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
Agonists and antagonists of HG07 that are identified by the
above-described methods are expected to have utility in the treatment of
diseases that involve the inappropriate expression of HG07. In particular,
given the expression pattern of HG07 (see Figure 4), such agonists and
antagonists are expected to have utility in the treatment of various
immune system disorders or disorders involving inflammation, e.g.,
multiple sclerosis, arthritis, asthma, lupus. Such agonists and
antagonists are also expected to be useful in treating various infectious
diseases.
Given the resemblance between HG07 and the leukotriene
B4 (LTB4) receptor, it is expected that agonists and antagonists of HG07
will have pharmacological activity and be useful in a manner similar to
that in which agonists and antagonists of the LTB4 receptor are useful.
Agonists and antagonists of the LTB4 receptor are useful in the treatment
of rheumatoid arthritis, gout, psoriasis, inflammatory bowel disease (U.S.
Patent No. 5,684,162), chronic lung diseases, endotoxic shock, septic
shock, and adult respiratory distress syndrome (U.S. Patent No.
5,552,441).
While HG07 appears to be most similar to the LTB4 receptor,
and thus is expected to be pharmacologically useful in a manner similar to
that of the LTB4 receptor, it is also expected that HG07 may have affinity
for other related leukotrienes, e.g., leukotrienes A4, C4, D4, and E4.
Antagonists of the leukotriene D4 receptor, such as zafirlukast,
montelukast, and pranlukast, have been shown to have utility in the
treatment of asthma (Tan & Spector, July/August 1997, Science and
Medicine 26-33). Thus, it is expected that antagonists of HG07 may also
have utility in the treatment of asthma.
The present invention includes pharmaceutical compositions
comprising agonists and antagonists of HG07. The agonists and
antagonists are generally combined with pharmaceutically acceptable
carriers to form pharmaceutical compositions. Examples of such carriers
and methods of formulation of pharmaceutical compositions containing
agonists and antagonists and carriers can be found in Remington's
Pharmaceutical Sciences. To form a pharmaceutically acceptable
-20-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
composition suitable for effective administration, such compositions will
contain a therapeutically effective amount of the agonists and antagonists.
Therapeutic or prophylactic compositions are administered to
an individual in amounts sufficient to treat or prevent conditions where
HG07 activity is abnormal. The effective amount can vary according to a
variety of factors such as the individual's condition, weight, gender, and
age. Other factors include the mode of administration. The appropriate
amount can be determined by a skilled physician.
Compositions can be used alone at appropriate dosages.
Alternatively, co-administration or sequential administration of other
agents can be desirable.
The compositions can be administered in a wide variety of
therapeutic dosage forms in conventional vehicles for administration. For
example, the compositions can be administered in such oral dosage forms
as tablets, capsules (each including timed release and sustained release
formulations), pills, powders, granules, elixirs, tinctures, solutions,
suspensions, syrups and emulsions, or by injection. Likewise, they can
also be administered in intravenous (both bolus and infusion),
intraperitoneal, subcutaneous, topical with or without occlusion, or
intramuscular form, all using forms well known to those of ordinary skill
in the pharmaceutical arts.
Advantageously, compositions can be administered in a
single daily dose, or the total daily dosage can be administered in divided
doses of two, three or four times daily. Furthermore, compositions can be
administered in intranasal form via topical use of suitable intranasal
vehicles, or via transdermal routes, using those forms of transdermal skin
patches well known to those of ordinary skill in that art. To be
administered in the form of a transdermal delivery system, the dosage
administration will, of course, be continuous rather than intermittent
throughout the dosage regimen.
The dosage regimen utilizing the compositions is selected in
accordance with a variety of factors including type, species, age, weight,
sex and medical condition of the patient; the severity of the condition to be
treated; the route of administration; the renal, hepatic and cardiovascular
-21 -
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
function of the patient; and the particular composition thereof employed.
A physician of ordinary skill can readily determine and prescribe the
effective amount of the composition required to prevent, counter or arrest
the progress of the condition. Optimal precision in achieving
concentrations of composition within the range that yields efficacy
without toxicity requires a regimen based on the kinetics of the
composition's availability to target sites. This involves a consideration of
the distribution, equilibrium, and elimination of a composition.
The present invention also includes methods of expressing
IO HG07 in recombinant systems and then utilizing the recombinantly
expressed HG07 for counter-screening. When screening compounds in
order to identify potential pharmaceuticals that specifically interact with
a target receptor, it is necessary to ensure that the compounds identified
are as specific as possible for the target receptor. To do this, it is
I S necessary to screen the compounds against as wide an array as possible of
receptors that are similar to the target receptor. Thus, in order to find
compounds that are potential pharmaceuticals that interact with receptor
A, it is necessary not only to ensure that the compounds interact with
receptor A (the "plus target") and produce the desired pharmacological
20 effect through receptor A, it is also necessary to determine that the
compounds do not interact with receptors B, C, D, etc. (the "minus
targets"). In general, as part of a screening program, it is important to
have as many minus targets as possible (see Hodgson, 1992,
Bio/Technology 10:973-980, at 980). Therefore, HGO? proteins and DNA
25 encoding HG07 proteins have utility in counter-screens. That is, they can
be used as "minus targets" in counter-screens in connection with screening
projects designed to identify compounds that specifically interact with
other G-protein coupled receptors.
The DNA of the present invention, or hybridization probes
30 based upon the DNA, can be used in chromosomal mapping studies in
order to identify the chromosomal location of the HG07 gene or of genes
encoding proteins related to HG07. Such mapping studies can be carried
out using well-known genetic and/or chromosomal mapping techniques
such as, e.g., linkage analysis with respect to known chromosomal
-22-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
markers or in situ hybridization. See, e.g., Verma et aL, I988, Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New
York, NY. After identifying the chromosomal location of the HG07 gene or
genes encoding proteins related to HG07, this information can be
compared with the locations of known disease-causing genes contained in
genetic map data (such as the data found in the genome issue of Science
(1994, 265:1981-2144). In this way, one can correlate the chromosomal
location of the HG07 gene or of genes encoding proteins related to HG07
with the locations of known disease-causing genes and thus help to limit
the region of DNA containing such disease-causing genes. This will
simplify the process of cloning such disease-causing genes. Also, once
linkage between the chromosomal location of the HG07 gene or of genes
encoding proteins related to HG07 and the locations of a known disease-
causing gene is established, that linkage can be used diagnostically to
identify restriction fragment length polymorphisms (RFLPs) in the
vicinity of the HG07 gene or of genes encoding proteins related to HG07.
Such RFLPs will be associated with the disease-causing gene and thus
can be used to identify individuals carrying the disease-causing gene.
For such chromosomal mapping studies as described herein,
it may be advantageous to use, in addtion to the DNA of the present
invention, the reverse complement of the DNA of the present invention or
RNA corresponding to the DNA of the present invention.
Nucleotide sequences that are complementary to the HG07
sequences disclosed herein can be synthesized for use in antisense
therapy. Such antisense molecules can be DNA, stable derivatives of DNA
such as phosphorothioates or methyl phosphonates, RNA, stable
derivatives of RNA such as 2'-O-alkyl RNA, or other forms of HG07
antisense molecules. HG07 antisense molecules can be introduced into
cells by a variety of methods, e.g., microinjection, liposome encapsulation,
or by expression from vectors harboring the antisense sequence. HG07
antisense therapy is expected to be particularly useful in the treatment of
conditions where it is beneficial to reduce HG07 activity.
The present invention also includes antibodies to the HG07
protein. Such antibodies may be polyclonal antibodies or monoclonal
- 23 -
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/Z6303
antibodies and are useful in treating disorders of the immune system that
involve the inappropriate expression or activity of the HG07 protein. The
antibodies of the present invention are raised against the entire HG07
protein or against suitable antigenic fragments of the protein that are
S coupled to suitable carriers, e.g., serum albumin or keyhole limpet
hemocyanin, by methods well known in the art. Methods of identifying
suitable antigenic fragments of a protein are known in the art. See, e.g.,
Hopp & Woods, 1981, Proc. Natl. Acad. Sci. USA 78:3824-3828; and
Jameson & Wolf, 1988, CABIOS (Computer Applications in the
Biosciences) 4:181-186.
For the production of polyclonal antibodies, HG07 protein or an
antigenic fragment, coupled to a suitable carrier, is injected on a periodic
basis into an
appropriate non-human host animal such as, e.g., rabbits, sheep, goats, rats,
mice.
The animals are bled periodically and sera obtained are tested for the
presence of
1S antibodies to the injected antigen. The injections can be intramuscular,
intraperitoneal, subcutaneous, and the like, and can be accompanied with
adjuvant.
For the production of monoclonal antibodies, HG07 protein or an
antigenic fragment, coupled to a suitable carrier, is injected into an
appropriate nori-
human host animal as above for the production of polyclonal antibodies. In the
case
of monoclonal antibodies, the animal is generally a mouse. The animal's spleen
cells
are then immortalized, often by fusion with a myeloma cell, as described in
Kohler &
Milstein, 1975, Nature 256:495-497. For a fuller description of the production
of
monoclonal antibodies, see Antibodies: A Laboratory Manual, Harlow & Lane,
eds.,
Cold Spring Harbor Laboratory Press, 1988.
2S Gene therapy may be used to introduce HG07 polypeptides into the
cells of target organs. Nucleotides encoding HG07 polypeptides can be ligated
into
viral vectors which mediate transfer of the nucleotides by infection of
recipient cells.
Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus,
herpes
virus, vaccinia virus, and polio virus based vectors. Alternatively,
nucleotides
encoding HG07 polypeptides can be transferred into cells for gene therapy by
non-
viral techniques including receptor-mediated targeted transfer using ligand-
nucleotide
conjugates, lipofection, membrane fusion, or direct microinjection. These
procedures
and variations thereof are suitable for ex vivo as well as in vivo gene
therapy. Gene
-24-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
therapy with HG07 polypeptides will be particularly useful for the
treatment'of
diseases where it is beneficial to elevate HG07 activity.
A cDNA fragment encoding full-length HG20 can be isolated from an
appropriate human cDNA library by using the polymerase chain reaction (PCR)
employing suitable primer pairs. Such primer pairs can be selected based upon
the
cDNA sequence for HG20 shown in Figure 1 as SEQ.ID.NO.:1. Suitable primer
pairs
would be, e.g.:
CGCGGATCCGCCATCATGGCACCTTCTCATCGG
(SEQ.ID.N0.:4 and
GCGGGATCCTCAAAGGTCCCATTCCGG (SEQ.ID.N0.:5).
The above primers contain BamHI sites in their 5' ends to facilitate
cloning of the amplified cDNA into suitable vectors, e.g., pcDNA3.1. The above
primers are meant to be illustrative. One skilled in the art would recognize
that a
variety of other suitable primers can be designed.
PCR reactions can be carried out with a variety of thermostable
enzymes including but not limited to AmpliTaq, AmpliTaq Gold, or Vent
polymerase.
For AmpliTaq, reactions can be carried out in 10 mM Tris-Cl, pH 8.3, 2.0 mM
MgCl2, 200 ~M for each dNTP, 50 mM KCI, 0.2 pM for each primer, 10 ng of DNA
template, 0.05 units/wl of AmpliTaq. The reactions are heated at 95°C
for 3 minutes
and then cycled 35 times using the cycling parameters of 95°C, 20
seconds, 62°C, 20
seconds, 72°C, 3 minutes. In addition to these conditions, a variety of
suitable PCR
protocols can be found in PCR Primer, A Laboratory Manual, edited by C.W.
Dieffenbach and G.S. Dveksler, 1995, Cold Spring Harbor Laboratory Press; or
PCR
Protocols' A Guide to Methods and Applications, Michael et al., eds., 1990,
Academic Press .
A suitable cDNA library from which a clone encoding HG07
can be isolated would be a human cDNA library made from RNA from
prostate, ovary, pancreas, peripheral blood lymphocytes, or spleen. Such
libraries can be prepared by methods well-known in the art.
Alternatively, several commercially available libraries would be suitable,
e.g., cDNA libraries from Stratagene, Inc., La Jolla, CA, USA, such as
human ovary, catalog #937217, human pancreas, catalog #937208, or
human fetal spleen, catalog #937205). The primary clones of such
libraries can be subdivided into pools with each pool containing
approximately 20,000 clones and each pool can be amplified separately.
-25-
CA 02351874 2001-05-10
WO 00/29423 PCT/US99/26303
By this method, a cDNA fragment encoding an open reading frame of
389 amino acids (SEQ.ID.N0.:2) can be obtained. This cDNA fragment can be
cloned into a suitable cloning vector or expression vector. For example, the
fragment
can be cloned into the mammalian expression vector pcDNA3.1 (Invitrogen, San
Diego, Ca). HG07 protein can then be produced by transferring an expression
vector
encoding HG07 into a suitable host cell and growing the host cell under
appropriate
conditions. HG07 protein can then be isolated by methods well known in the
art.
As an alternative to the above-described PCR method, a cDNA clone
encoding HG07 can be isolated from a cDNA library using as a probe
oligonucleotides specific for HG07 and methods well known in the art for
screening
cDNA libraries with oligonucleotide probes. Such methods are described in,
e.g.,
Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual; Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York; Glover, D.M. (ed.), 1985, DNA
Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K., VoI. I, II.
Oligonucleotides that are specific for HG07 and that can be used to screen
cDNA
libraries can be readily designed based upon the cDNA sequence of HG07 shown
in
Figure 1 as SEQ.ID.NO.:1 and can be synthesized by methods well-known in the
art.
Genomic clones containing the HG07 gene can be obtained
from commercially available human PAC or BAC libraries, e.g., from
Research Genetics, Huntsville, AL. Alternatively, one may prepare
genomic libraries, especially in P1 artificial chromosome vectors, from
which genomic clones containing the HG07 can be isolated, using probes
based upon the HG07 nucleotide sequences disclosed herein. Methods of
preparing such libraries are known in the art (Ioannou et al.,1994, Nature
Genet.6:84-89).
The following non-limiting examples are presented to better illustrate
the invention.
EXAMPLE 1
Tissue distribution of HG07 RNA transcripts
The data shown in Figure 4 were obtained by the use of human multi-
tissue Northern blots purchased from Clontech (Palo Alto, CA). The blots were
-26-
CA 02351874 2001-05-10
WO 00!29423 PCT/US99/26303
hybridized with 32P-labelled pmbes prepared from a 805 by BamHI-ApaI fragment
of HG07. Hybridizations were carried out using the ExpressHyb buffer supplied
by
Clontech under conditions suggested by Clontech. The blots were then washed in
O.1X SSC/0.1% SDS at 60°C and exposed by autoradiography.
The present invention is not to be limited in scope by the specific
embodiments described herein. Indeed, various modifications of the invention
in
addition to those described herein will become apparent to those skilled in
the art
from the foregoing description. Such modifications are intended to fall within
the
scope of the appended claims.
Various publications are cited herein, the disclosures of which are
incorporated by reference in their entireties.
-27-
