CHLAMYDIA ANTIGENS AND CORRESPONDING DNA FRAGMENTS AND USES THEREOF

ANTIGENES DE CHLAMYDIA ET FRAGMENTS D'ADN CORRESPONDANTS ET LEUR UTILISATION

English Abstract

The present invention provides purified and isolated polynucleotide molecules
that encode Chlamydia polypeptides which can be used in methods to prevent,
treat, and diagnose Chlamydia infection. In one form of the invention, the
polynucleotide molecules are selected from DNA that encode polypeptides
CPN100634 (SEQ ID Nos: 1, 2 and 11), CPN100635 (SEQ ID Nos: 3, 4, 12 and 13),
CPN100638 (SEQ ID Nos: 5, 6 and 14), CPN100639 (SEQ ID Nos: 7, 8 and 15),
CPN100708 (SEQ ID Nos: 9, 10 and 16).

French Abstract

La présente invention concerne des molécules polynucléotidiques purifiées et isolées qui codent pour les polypeptides de Chlamydia. Ces molécules peuvent s'utiliser dans des procédés pour prévenir, traiter et diagnostiquer les infections par Chlamydia. Dans une forme de l'invention, les molécules polynucléotidiques sont choisies à partir des ADN qui codent pour les polypeptides CPN100634 (SEQ ID Nos: 1, 2 et 11), CPN100635 (SEQ ID Nos: 3, 4, 12 et 13), CPN100638 (SEQ ID Nos: 5, 6 et 14), CPN100639 (SEQ ID Nos: 7, 8 et 15), CPN100708 (SEQ ID Nos: 9, 10 et 16).

Claims

50
CLAIMS:
1. A nucleic acid molecule comprising a nucleic acid
sequence which encodes a polypeptide selected from any one of:
(a) SEQ ID Nos: 12 to 16;
(b) an immunogenic fragment comprising at least 12
consecutive amino acids from a polypeptide of (a); and
(c) a polypeptide of (a) or (b) which has been
modified without loss of immunogenicity, wherein said modified
polypeptide is at least 75% identical in amino acid sequence to
the corresponding polypeptide of (a) or (b).
2. A nucleic acid molecule comprising a nucleic acid
sequence selected from any one of:
(a) SEQ ID Nos: 3 to 10;
(b) a sequence which encodes a polypeptide encoded by
any one of SEQ ID Nos: 3 to 10;
(c) a sequence comprising at least 38 consecutive
nucleotides from any one of the nucleic acid sequences of (a)
and (b); and
(d) a sequence which encodes a polypeptide which is
at least 75% identical in amino acid sequence to any one of the
polypeptides encoded by SEQ ID Nos: 3 to 10.
3. A nucleic acid molecule comprising a nucleic acid
sequence which is anti-sense to the nucleic acid molecule of
claim 1 or 2.
4. A nucleic acid molecule comprising a nucleic acid
sequence which encodes a fusion protein, said fusion protein

51
comprising a first polypeptide and a second polypeptide,
wherein the first polypeptide is selected from any one of:
(a) SEQ ID Nos: 11-16;
(b) an immunogenic fragment comprising at least 12
consecutive amino acids from a polypeptide of SEQ ID Nos: 11-
16; and
(c) a polypeptide of (a) or (b) which has been
modified without loss of immunogenicity, wherein said modified
polypeptide is at least 75% identical in amino acid sequence to
the corresponding polypeptide of (a) or (b).
5. The nucleic acid molecule of claim 4 wherein the
second polypeptide is a heterologous signal peptide.
6. The nucleic acid molecule of claim 4 wherein the
second polypeptide has adjuvant activity.
7. A nucleic acid molecule according to any one of
claims 1 to 6, operatively linked to one or more expression
control sequences.
8. A vaccine comprising a vaccine vector and at least
one first nucleic acid selected from any of:
(i) SEQ ID Nos: 1 to 10;
(ii) a nucleic acid sequence which encodes a
polypeptide encoded by any one of SEQ ID Nos: 1 to 10;
(iii) a nucleic acid sequence comprising at least 38
consecutive nucleotides from any one of the nucleic acid
sequences of (i) and (ii);
(iv) a nucleic acid sequence which encodes a
polypeptide which is at least 75% identical in amino acid

52
sequence to the polypeptide encoded by any one of SEQ ID Nos: 1
to 10;
(v) a nucleic acid sequence which encodes a
polypeptide whose sequence is set forth in any one of SEQ ID
Nos: 11 to 16;
(vi) a nucleic acid sequence which encodes an
immunogenic fragment comprising at least 12 consecutive amino
acids from any one of SEQ ID Nos: 11 to 16; and
(vii) a nucleic acid sequence, which encodes a
polypeptide as defined in (i) to (v) or an immunogenic fragment
as defined in (vi) which has been modified without loss of
immunogenicity, wherein said modified polypeptide or fragment
is at least 75% identical in amino acid sequence to the
corresponding polypeptide of (i) to (v) or the corresponding
fragment of (vi);
wherein each first nucleic acid is capable of being expressed
and wherein the vaccine optionally comprises a second nucleic
acid encoding and capable of expressing an additional
polypeptide which enhances the immune response to the
polypeptide expressed by the first nucleic acid.
9. A vaccine comprising a vaccine vector and at least
one first nucleic acid encoding a fusion protein, wherein the
fusion protein comprises:
(a) a first polypeptide selected from any of:
(i) a polypeptide encoded by any one of SEQ
ID Nos: 1 to 10;
(ii) a polypeptide encoded by a nucleic
acid sequence comprising at least 38 consecutive nucleotides
from any one of SEQ ID Nos: 1 to 10;

53
(iii) a polypeptide which is at least 75%
identical in amino acid sequence to the polypeptide encoded by
any one of SEQ ID Nos: 1 to 10;
(iv) a polypeptide whose sequence is set
forth in any one of SEQ ID Nos: 11 to 16;
(v) an immunogenic fragment comprising at
least 12 consecutive amino acids from any one of SEQ ID Nos: 11
to 16; and
(vi) a polypeptide as defined in (i) to
(iv) or an immunogenic fragment as defined in (v) which has
been modified without loss of immunogenicity, wherein said
modified polypeptide or fragment is at least 75% identical in
amino acid sequence to the corresponding polypeptide of (i) to
(iv) or the corresponding fragment of (v); and
(b) a second polypeptide;
wherein each first nucleic acid is capable of being expressed
and wherein the vaccine optionally comprises a second nucleic
acid encoding and capable of expressing an additional
polypeptide which enhances the immune response to the first
polypeptide.
10. The vaccine of claim 9 wherein the second polypeptide
is a heterologous signal peptide.
11. The vaccine of claim 9 wherein the second polypeptide
has adjuvant activity.
12. The vaccine of any one of claims 8 to 11 wherein
wherein each first nucleic acid is operatively linked to one or
more expression control sequences.
13. A vaccine comprising at least one first nucleic acid
according to any one of claims 1, 2, and 4 to 7 and a vaccine

54
vector wherein each first nucleic acid is expressed as a
polypeptide, the vaccine optionally comprising a second nucleic
acid encoding an additional polypeptide which enhances the
immune response to the polypeptide expressed by said first
nucleic acid.
14. The vaccine of any one of claims 8 to 13 wherein the
second nucleic acid encodes an additional Chlamydia
polypeptide.
15. A pharmaceutical composition comprising a nucleic
acid according to any one of claims 1 to 7 and a
pharmaceutically acceptable carrier.
16. A pharmaceutical composition comprising a vaccine
according to any one of claims 8 to 14 and a pharmaceutically
acceptable carrier.
17. A unicellular host transformed with the nucleic acid
molecule of claim 7.
18. An isolated nucleic acid probe of 5 to 100
nucleotides which hybridizes under stringent conditions to the
nucleic acid molecule of any one of SEQ ID Nos: 3 to 10, or to
a complementary or anti-sense sequence of said nucleic acid
molecule.
19. An isolated primer of 10 to 40 nucleotides which
hybridizes under stringent conditions to the nucleic acid
molecules of any one of SEQ ID Nos: 3 to 10, or to a
complementary or anti-sense sequence of said nucleic acid
molecule.
20. A polypeptide encoded by a nucleic acid sequence
according to any one of claims 1, 2 and 4 to 7.

55
21. A polypeptide comprising an amino acid sequence
selected from any of:
(a) SEQ ID Nos: 12 to 16;
(b) an immunogenic fragment comprising at least 12
consecutive amino acids from a polypeptide of (a); and
(c) a polypeptide of (a) or (b) which has been
modified without loss of immunogenicity, wherein said modified
polypeptide is at least 75% identical in amino acid sequence to
the corresponding polypeptide of (a) or (b).
22. A fusion polypeptide comprising a first polypeptide
and a second polypeptide, wherein the first polypeptide is
selected from any one of:
(a) a polypeptide encoded by any one of SEQ ID Nos: 1
to 10;
(b) a polypeptide encoded by a nucleic acid sequence
comprising at least 38 consecutive nucleotides from any one of
SEQ ID Nos: 1 to 10;
(c) a polypeptide which is at least 75% identical in
amino acid sequence to the polypeptide encoded by any one of
SEQ ID Nos: 1 to 10;
(d) a polypeptide whose sequence is set forth in any
one of SEQ ID Nos: 11 to 16;
(e) an immunogenic fragment comprising at least 12
consecutive amino acids from any one of SEQ ID Nos: 11 to 15;
and
(f) a polypeptide as defined in (a) to (d) or an
immunogenic fragment as defined in (e) which has been modified
without loss of immunogenicity, wherein said modified

56
polypeptide or fragment is at least 75% identical in amino acid
sequence to the corresponding polypeptide of (a) to (d) or the
corresponding fragment of (e).
23. The fusion protein of claim 22 wherein the second
polypeptide is a heterologous signal peptide.
24. The fusion protein of claim 22 wherein the second
polypeptide has adjuvant activity.
25. A method for producing a polypeptide of claim 20 or
21, or a fusion protein of any one of claims 22 to 24,
comprising the step of culturing a unicellular host of claim
17.
26. An antibody against the polypeptide of claim 20 or
21, or against a fusion protein of any one of claims 22 to 24.
27. A vaccine comprising at least one first polypeptide
selected from any of:
(i) a polypeptide encoded by any one of SEQ ID Nos: 1
to 10;
(ii) a polypeptide encoded by a nucleic acid sequence
comprising at least 38 consecutive nucleotides from any one of
SEQ ID Nos: 1 to 10;
(iii) a polypeptide which is at least 75% identical
in amino acid sequence to the polypeptide encoded by any one of
SEQ ID Nos: 1 to 10;
(iv) a polypeptide whose sequence is set forth in any
one of SEQ ID Nos: 11 to 16;
(v) an immunogenic fragment comprising at least 12
consecutive amino acids from any one of SEQ ID Nos: 11 to 16;
and

57
(vi) a polypeptide as defined in (i) to (iv) or an
immunogenic fragment as defined in (v) which has been modified
without loss of immunogenicity, wherein said modified
polypeptide or fragment is at least 75% identical in amino acid
sequence to the corresponding polypeptide of (i) to (iv) or the
corresponding fragment of (v);
wherein the vaccine optionally comprises an additional
polypeptide which enhances the immune response to the first
polypeptide.
28. A vaccine comprising at least one fusion protein,
wherein the fusion protein comprises:
(a) a first polypeptide selected from any of:
(i) a polypeptide encoded by SEQ ID No: 1;
(ii) a polypeptide encoded by a nucleic
acid sequence comprising at least 38 consecutive nucleotides
from SEQ ID No: 1;
(iii) a polypeptide which is at least 75%
identical in amino acid sequence to the polypeptide encoded by
SEQ ID No: 1;
(iv) a polypeptide whose sequence is set
forth in SEQ ID No: 2;
(v) an immunogenic fragment comprising at
least 12 consecutive amino acids from SEQ ID No:2; and
(vi) a polypeptide as defined in (i) to
(iv) or an immunogenic fragment as defined in (v) which has
been modified without loss of immunogenicity, wherein said
modified polypeptide or fragment is at least 75% identical in
amino acid sequence to the corresponding polypeptide of (i) to
(iv) or the corresponding fragment of (v); and

58
(b) a second polypeptide;
wherein the vaccine optionally comprises an additional
polypeptide which enhances the immune response to the first
polypeptide.
29. The vaccine of claim 28 wherein the second
polypeptide is a heterologous signal peptide.
30. The vaccine of claim 28 wherein the second
polypeptide has adjuvant activity.
31. A vaccine comprising at least one first polypeptide
according to any one of claims 20 to 24, optionally comprising
an additional polypeptide which enhances the immune response to
the first polypeptide.
32. The vaccine of any one of claims 27 to 31 wherein the
additional polypeptide comprises a Chlamydia polypeptide.
33. A pharmaceutical composition comprising a polypeptide
according to any one of claims 20 to 24 and a pharmaceutically
acceptable carrier.
34. A pharmaceutical composition comprising a vaccine
according to any one of claims 27 to 32 and a pharmaceutically
acceptable carrier.
35. A pharmaceutical composition comprising an antibody
according to claim 26 and a pharmaceutically acceptable
carrier.
36. A method far preventing or treating Chlamydia
infection using:
(a) the nucleic acid of any one of claims 1 to 7;

59
(b) the vaccine of any one of claims 8 to 14 and 27
to 32;
(c) the pharmaceutical composition of any one of
claims 15, 16 and 33 to 35;
(d) the polypeptide of claim 20 or 21, or a fusion
protein of any one of claims 22 to 24; or
(e) the antibody of claim 26.
37. A method of detecting Chlamydia infection comprising
the step of assaying a body fluid of a mammal to be tested,
with a component selected from any one of:
(a) the nucleic acid of any one of claims 1 to 7;
(b) the polypeptide of claim 20 or 21, or a fusion
protein of any one of claims 22 to 24; and
(c) the antibody of claim 26.
38. A diagnostic kit comprising instructions for use and
a component selected from any one of:
(a) the nucleic acid of any one of claims 1 to 7;
(b) the polypeptide of claim 20 or 21, or a fusion
protein of any one of claims 22 to 24; and
(c) the antibody of claim 26.
39. A method for identifying a polypeptide of claim 20 or
21, or a fusion protein of any one of claims 22 to 24 which
induces an immune response effective to prevent or lessen the
severity of Chlamydia infection in a mammal previously
immunized with polypeptide, comprising the steps of:

60
(a) immunizing a mouse with the polypeptide or fusion
protein; and
(b) inoculating the immunized mouse with Chlamydia;
wherein the polypeptide or fusion protean which prevents or
lessens the severity of Chlamydia infection in the immunized
mouse compared to a non-immunized control mouse is identified.

Description

CA 02352759 2001-05-31
WD 00/32794 PCT/CA99101147
1
TITLE OF INVENTION
CHLAMYDIA ANTIGENS AND CORRESPONDING DNA FRAGMENTS AND
USES THEREOF
REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S.
Provisional Application No. 60/110,427, filed December 1, 1998,
U.S. Provisional Application No.60/110,438, filed December l,
1998,U.S. Provisional Application No. 60/110,339, filed December
1, 1998, U.S. Provisional Application No. 60/110,428, filed
December l, 1998, U.S. Provisional Application No. 60/110,340,
filed December I, 1998.
FIELD OF INVENTION
The present invention relates to Chlamydia antigens
and corresponding DNA molecules, which can be used to prevent
and treat ~Ch.Iamydia infection in mammals, such as humans.
BACKGROUND OF THE INVENTION
Chlamydiae are prokaryotes. They exhibit morphologic
arid structural similarities to gram-nE:gative bacteria including
a trilaminar outer membrane, which contains lipopolysaccharide
and several membrane proteins that are structurally and
functionally analogous to proteins found in E co3i. They are
obligate intra-cellular parasites with a unique biphasic life
cycle consisting of a metabolically i7zactive but infectious
extracellular stage and a replicating but non-infectious
intracellular stage. The replicative stage of the life-cycle
takes place within a membrane-bound inclusion which sequesters
the bacteria away from the cytoplasm of the infected'host cell.
C. pneumoniae is a common human pathogen, originally
described as the TWAR strain of Chlam,ydia psittaci but
subsequently recognised to be a new species. C. pneumoniae is
antigenically, genetically and morphologically distinct from

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
2
other chlamydia species (C. trachomatis, C. pecorum and
C. psittaci). It shows 10% or less DNF, sequence homology with
either of C. trachomatis or C. psittaci:.
pneumoniae is a common cause of community acquired
pneumonia, only less frequent than StrE~ptococcus pneumoniae and
Mycoplasma pneumoniae (Grayston et al. (1995) Journal of
Infectious Diseases 168:1231; Campos ei: al: (1995) Investigation
of Ophthalmology and Visual Science 36:1477). It can also cause
upper respiratory tract symptoms and d~_sease, including
bronchitis and sinusitis (Grayston et al. (1995) Journal of
Infectious Diseases 168:1231; Grayston et a1 (1990) Journal of
Infectious Diseases 161:618; Marrie (1993) Clinical Infectious
Diseases. 18:501; Wang et al (1986) Ch_Lamydial infections).
Cambridge University Press, Cambridge, p. 329The great majority
of the adult population (over 600) has antibodies to
C. pneumoniae (Wang et al (1986) Chlamydial infections.
Cambridge University Press, Cambridge, p. 329), indicating past
infection which was unrecognized or as;~rmptomatic.
C. pneumoniae infection usually presents as an acute
respiratory disease (i.e., cough, sore throat, hoarseness, and
fever; abnormal chest sounds on auscultation). For most
patients, the cough persists for 2 to 6 weeks, and recovery is
slow. In approximately l00 of these cases, upper respiratory
tract infection is followed by bronchitis or pneumonia.
Furthermore, during a C. pneumoniae epidemic, subsequent
co-infection with pneumococcus has been noted in about half of
these pneumonia patients, particularly in the infirm and the
elderly. As noted above, there is more and more evidence that
C. pneumoniae infection is also linked to diseases other than
respiratory infections.
The reservoir for the organism is presumably people.
In contrast to C. psittaci infections, there is no known bird or
animal reservoir. Transmission has not been clearly defined:
It may result from direct contact with secretions, from fomites,

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
3
or from airborne spread. There is a long incubation period,
which may last for many months. Based on analysis of epidemics,
C. pneumoniae appears to spread slowly through a population
(case-to-case interval averaging 30 days) because infected
persons are inefficient transmitters oj° the organism.
Susceptibility to C. pneumoniae is universal. Reinfections
occur during adulthood, following the primary infection as a
child. C. pneumoniae appears to be an endemic disease
throughout the world, noteworthy for superimposed intervals of
increased incidence (epidemics) that persist for 2 to 3 years.
C. trachomatis infection does not confer cross-immunity to
C. pneumoniae. Infections are easily 'treated with oral
antibiotics, tetracycline or erythromy~~in (2 g/d, for at least
10 to 19 d). A recently developed drug, azithromycin, is highly
effective as a single-dose therapy against chlamydial
infections.
In most instances, C. pneumoniae infection is often
mild and without complications, and up to 900 of infections are
subacute or unrecognized. Among children in industrialized
countries, infections have been thought to be rare up to the age
of 5 y, although a recent study (E Normann et aI, Chlamydia
pneumoniae in children with acute respiratory tract infections,
Acta Paediatrica, 1998, Vol 87, Iss 1, pp 23-27) has reported
that many children in this age group show PCR evidence of
infection despite being seronegative, and estimates a prevalence
of 17-19°s in 2-4 y olds. In developing countries, the
seroprevalence of C. pneumoniae antibodies among young children
is elevated, and there are suspicions that C. pneumoniae may be
an important cause of acute lower respiratory tract disease and
mortality for infants and children in tropical regions of the
world.
From seroprevalence studies and studies of local
epidemics, the initial C. pneumoniae infection usually happens
between the ages of 5 and 20 y. In the USA, for example, there

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
4
are estimated to be 30,000 cases of childhood pneumonia each
year caused by C. pneumoniae. Infections may cluster among
groups of children or young adults (e.g., school pupils or
military conscripts).
C. pneumoniae causes 10 to 25°s of community-acquired
lower respiratory tract infections (aa; reported from Sweden,
Italy, Finland, and the USA). During an epidemic, C. pneumonia
infection may account for 50 to 600 of: the cases of pneumonia.
During these periods, also, more episodes of mixed infections
with S. pneumoniae have been reported.
Reinfection during adulthood is common; the clinical
presentation tends to be milder. Based on population
seroprevalence studies, there tends to be increased exposure
with age, which is particularly evident among men. Some
investigators have speculated that a persistent, asymptomatic C.
pneumoniae infection state is common.
In adults of middle age or older, C. pneumoniae
infection may progress to chronic bronchitis and sinusitis. A
study in the USA revealed that the incidence of pneumonia caused
by C. pneumoniae in persons younger than 60 years is 1 case per
1,000 persons per year; but in the elderly, the disease
incidence rose three--fold. C. pneumoniae infection rarely leads
to hospitalization, except in patients with an underlying
illness. '
Of considerable importance :is the association of
atherosclerosis and C. pneumoniae infection. There are several
epidemiological studies showing a correlation of previous
infections with C. pneumoniae and heart attacks, coronary artery
and carotid artery disease (Saikku et a1.(1988) Lancet; ii:983;
Thom et a1. (1992) JAMA 268:68; Linna:nmaki ef a1: (1993),
Circulation 87:1030; Saikku et a1. {1992) Annals Internal
Medicine 116:273: Melnick et al {1993) American Journal of
Medicine 95:499). Moreover, the organisms has been detected in
atheromas and fatty streaks of the coronary, carotid, peripheral

CA 02352759 2001-05-31
WO 00!32794 PC'1'1CA99101147
arteries and aorta (Shor et a1. (1992) South African. Medical
Journal 82:158; Kuo et a.I. (1993) Journal of Infectious Diseases
167:841; Kuo et a1. (1993) Arteriosclerosis and Thrombosis
13:1500; Campbell et aI (1995) Journal of Infectious Diseases
5 172:585; Chiu et a1. Circulation, 1997 (In Press)). Viable
C. pneumoniae has been recovered from the coronary and carotid
artery (Ramirez et a1 (1995) Annals of Tnternal Medicine.
125:979; Jackson et aI. Abst. K121, p2?2, 36th ICAAC, 15-18 Sept.
1996, New Orleans). Furthermore, it has been shown that
C. pneumoniae can induce changes of at:herosclerosis in a rabbit
model (Fong et a1 (1997) Journal of Clinical Microbiolology
35:48). Taken together, these result~~ indicate that it is
highly probable that C. pneumoniae can cause atherosclerosis in
humans, though the epidemiological imp>ortance of chlamydial
atherosclerosis remains to be demonstrated.
A number of recent studies nave also indicated an
association between C. pneumoniae infection and asthma.
Infection has been linked to wheezing, asthmatic bronchitis,
adult-onset asthma and acute exacerbat:ions of asthma in adults,
arid small-scale studies have shown that prolonged antibiotic
treatment was effective at greatly reducing the severity of the
disease in some individuals (Hahn DL, et al. Evidence for
Chlamydia pneumoniae infection in steooid-dependent asthma.
Ann Allergy Asthma Immunol. 1998 Jan; 80(1): 45-49.; Hahn DL, et
a1. Association of Chlamydia pneumoniae IgA antibodies with
recently symptomatic asthma. Epidemiol Infect. 1996 Dec;
117(3): 513-517; Bjornsson E, et a1. Serology of chlamydia in
relation to asthma and bronchial hype:rresponsiveness. Scand J
Infect Dis. 1996; 28(1): 63-69.; Hahn DL. Treatment of Ch3amyd3a
pneumoniae infection in adult asthma: a before-after trial. J
Fam Pract. 1995 Oct; 41(4): 345-351.; Allegro L, et al. Acute
exacerbations of asthma in adults: role of Chlamydia pneurnoniae
infection. Eur Respir J. 1994 Dec; 7(12): 2165-2168.; Hahn DL,
et a1. Association of Chlamydia pneumoniae (strain TWAR)

CA 02352759 2001-05-31
WO 00!32794 PCTICA99101147
6
infection with wheezing, asthmatic bronchitis, and adult-onset
asthma. JAMA. 1991 Jul 10; 266(2): 225-230).
In light of these results a protective vaccine against
C. pneumaniae infection would be of considerable importance.
There is not yet an effective vaccine for any human chlamydial
infection. It is conceivable that an effective vaccine can be
developed using physically or chemically inactivated Chlamydiae.
However, such a vaccine does not have a high margin of safety.
In general, safer vaccines are made by genetically manipulating
I0 the organism by attenuation or by recombinant means.
Accordingly, a major obstacle in creating an effective and safe
vaccine against human chlamydial infection has been the paucity
of genetic information regarding Chlam~ydia, specifically
C. pneumoniae.
Studies with C. trachomatzs and C. ps.ittaci indicate
that safe and effective vaccine against Chlamydia is an
attainable goal. For example, mice which have recovered from a
lung infection with C. trachomatis are; protected from
infertility induced by a subsequent vaginal challenge {Pal et
a1.{1996) Infection and Immunity.64:5341). Similarly, sheep
immunized with inactivated C. ps.ittac~: were protected from
subsequent chlamydial-induced abortions and stillbirths (Jones
et a1. (1995) Vaccine 13:715). Protection from chlamydial
infections has been associated with Thl immune responses,
particularly the induction of INFg - producing CD4+T-cells
(Igietsemes et a1. (1993) Immunology Ei:317). The adoptive
transfer of CD4+ cell lines or clones to nude or SCID mice
conferred protection from challenge or cleared chronic disease
(Igietseme et al (1993) Regional Immunology 5:317; Magee et a1
(1993) Regional Immunology 5: 305), and in vivo depletion of
CD4+ T cells exacerbated disease post--challenge (Landers et a1
(1991) infection & Immunity 59:3774; Magee et a1 (1995)
Infection & Immunity 63:516) . However, the presence of
sufficiently high titres of neutralising antibody at mucosal

CA 02352759 2001-05-31
WO 00/32794 PC'f/CA99101147
7
surfaces can also exert a protective effect (Cotter et a1.
(1995) Infection and Immunity 63:4704).
Antigenic variation within the species C. pneumoniae
is not well documented due to insufficient genetic information,
though variation is expected to exist based on C. trachomatis.
Serovars of C. trachomatis are defined on the basis of antigenic
variation in the major outer membrane protein (MOMP), but
published C. pneumoniae MOMP gene sequences show no variation
between several diverse isolates of the organism (Campbell et a1
{1990) Infection and Immunity 58:93; NicCafferty et a1 (1995)
Infection and Immunity 63:2387-9; Knudsen et aI (1996) Third
Meeting of the European Society for Chlamydia Research, Vienna).
Regions of the protein known to be conserved in other chlamydial
MOMPs are conserved in C. pneumoniae l;Campbell et a1 {1990)
Infection and Immunity 58:93; McCafferty et a1 (1995) Infection
and Immunity 63:2387-9). One study has described a strain of C.
pneumoniae with a MOMP of greater that: usual molecular weight,
but the gene for this has not been sequenced (Grayston et al.
(1995) Journal of Infectious Diseases 268:1231): Partial
sequences of outer membrane protein 2 from nine diverse isolates
were also found to be invariant (Rami~:ez et a.~ {1996) Annals of
Internal Medicine 125:979). The gene; for HSP60 and HSP70 show
little variation from other chlamydial species, as would be
expected. The gene encoding a 76kDa antigen has been cloned
from a single strain of C. pneumoniae. It has no significant
similarity with other known chlamydia_L genes (Marrie (1993)
Clinical Infectious Diseases. 18:501)..
Many antigens recognised by immune sera to
C. pneumoniae are conserved across al:L chlamydiae, but 98kDa,
76 kDa and 54 kDa proteins appear to be C. pneumoniae-specific
(Campos et a.t. (1995) Investigation o:E Ophthalmology and Visual
Science 36:1477; Marrie (1993) Clinical Infectious Diseases.
18:501; Wiedmann-A1-Ahmad M, et a1. Reactions of polyclonal and
neutralizing anti-p54 monoclonal antibodies with an isolated,

Dec-19-DD 03:31pm From-STiBIFiCo, 619-E3~:-8440 T-166 P D5uIT F-953
' 19-12-2000 CA 02352759 2001-05-31 CA 009901147
7713-2 '
8
. speCies_spec.ifiG 5~-ki'!odaiton protein of Chlamydia pneumoniae.
Olin DiaQri bob Xmmunol. ~.g97 Nov: ~ (6) : 700-'704) . A
publication relevant to 98 ~CDa pxoteins is Perez Melgosa et al.
FE~NlS Microbiology Letters. 112(2): 199-204. 1993. Anothsr
relevant publicat~.on is Rnudsen, Database EriIBI,, accession
number 086164, d1--i1~1998.
Immunoblotting of isolates with sera from patients
does s'r~ow variation of blotting patterns between isolates,
indicating that serotypes C. pneumon.iae may exist (Grayston et
al. (lgg5) Journal of InfBCti~ous Disease: 168:1231: Ramire~ et
al 11996) Annals of Internal Medicine 12x:979?~ However, the
results are poten~eially confouned by the infection status of
the ps.tients, since immunoblot profiles ~~f a patient's sexa
chance wyth time post-infection. ~n assessment of the number
and relative frequency of any serotypes, and the defining
antigens, is not yet possible.
Accordingly, a need exists for identifying and
isolat~.nr palynucleotide s~squences of C. pnez~mora.zae for use in
preverting and treating Chlamydia infection.
SrRY t7~' ~.'8E aNfVEN~ION
The present invention provides purified and isolated
polynucleotide mt~lecules that encnde Ch.Zarnyd.ia polypeptides
which can be used ~.n methods to prevent, treat, azd diagnose
Chlamydia infection. In one form of the ineentiori, the
~ paiynucleotide molecules are selected fr3m DNA that encode
pblypepticbes CPN100634 (SEQ ID. Nos: 1 a»d 2) , CFrI~.0463~ (sE~
TL Ncs: 3 and 4), C'Pi~100638 (SEQ rD Nos: 5 and 6), CP1~~.00639
( SEQ ID Nos : 7 and 8 ) , and CP~110.~7 G 8 ( SEQ ZD Nos : 9 and 10 ) .
-\ A~MENDEL? ~1-1EET

~~osc-i~-no o3;3~pm FroarS58/F&Co, 6t3-Z3T-6440 T-166 P.O6/12 F-853
19-12-2000 CA 02352759 2001-05-31 CA 009901147
'1 ~ 813-2
8a
Another form of the invention plvovides po? ype?~t~.aes
corresponding to tre i5o~.ated DNA molecuir=s. The amino acid
Sequences of the aarresponding encoded po:Lypeptides are shown
for CPN140634 as SEA Iii No: 11. CPN14~635 as 5E~ ID t~os: 12 and
13, CPN1~J0638 as SE;~ ID No: 1~, CPN10~639 as SEQ TD No: 1~~ and
CFh~ 10708 as SEQ ~'D No: 16.
Those sk~.lled in the art will readily understand that
the inver.~ior., raving provided trye polynu.cleot~.de sequences
encoding Ch.iamydia polypeptides, also provides polynucleotides
encoding
_ . - _ _~A~ENDED~SHEET

CA 02352759 2001-05-31
WO 00132794 PCT/CA99101147
9
fragments derived from such peptides. Moreover, the invention
is understood to provide mutants and dESrivatives of such
polypeptides and fragments derived therefrom, which result from
the addition, deletion, or substitution of non-essential amino
acids as described herein. Those skil:Led in the art would also
readily understand that the invention, having provided the
polynucleotide sequences encoding Chlamydia polypeptides,
further provides monospecific antibodies that specifically bind
to such polypeptides.
The present invention has wide application and includes
expression cassettes, vectors, and cells transformed or
transfected with the polynucleotides of the invention.
Accordingly, the present invention further provides (i) a method
for producing a polypeptide of the invention in a recombinant
host system and related expression cassettes, vectors, and
transformed or transfected cells: (ii) a vaccine, or a live
vaccine vector such as a pox virus, Salmonella typhimurium, or
Vibrio cholerae vector, containing a polynucleotide of the
invention, such vaccines and vaccine vectors being useful for,
e.g., preventing and treating Chlamydia infection, in
combination with a diluent or carrier, and related
pharmaceutical compositions and associated therapeutic and/or
prophylactic methods: (iii) a therapeutic and/or prophylactic
use of an RNA or DNA molecule of the invention, either in a
naked form or formulated with a delivery vehicle, a polypeptide
or combination of polypeptides, or a monospecific antibody of
the invention, and related pharmaceutical compositions; (iv) a
method for diagnosing the presence of Chlamydia in a biological
sample, which can involve the use of a DNA or RNA molecule, a
monospecific antibody, or a polypeptid.e of the invention; and
(v) a method for purifying a polypeptide of the invention by
antibody-based affinity chromatography.

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
I. 0
BRIEF DESCRIPTION OF THE DRAWINGS
The present invention will be further understood from the
following description with reference to the drawings, in which:
Figure 1 shows the nucleotide ~;equence of the CPN100634
(SEQ ID No: 1 - entire sequence and SEQ TD No: 2 - coding
sequence) and the deduced amino acid sequence of the CPN100634
protein from Chlamydia pneumoniae (SEQ ID No: 11).
Figure 2 shows the restriction enzyme analysis of the
gene encoding the C. pneumoni.ae CPN100634 gene.
20 Figure 3 shows the nucleotide sequence of the CPN100635
(SEQ ID No: 3 - entire sequence and SEQ ID No: 4 - coding
sequence) and the deduced amino acid sequence of the CPN100635
protein from Chlamyd.ia pneumon.iae (SEQ ID No: 12 - entire amino
acid sequence corresponding to the open reading frame, and 13 -
the post--translationally processed polypeptide).
Figure 4 shows the restriction enzyme analysis of the
gene encoding the C. pneumoniae CPN100~635 gene.
Figure 5 shows the nucleotide ;sequence of the CPN100638
(SEQ ID No: 5 - entire sequence and SE~Q ID No: 6 - coding
sequence) and the deduced amino acid ~~equence of the CPN100638
protein from Chlamydia pneumoniae (SEQ ID No: 14). The sequence
is encoded on the negative strand.
Figure 6 shows the restriction enzyme analysis of the
gene encoding the C. pneumoniae CPN10C)638 gene.
Figure 7 shows the nucleotide sequence of the CPN100639
(SEQ ID No: 7 - entire sequence and SF;Q ID No: 8 - coding
sequence} and the deduced amino acid :sequence of the CPN100639
protein from Chlamydia pneumoniae (SE(~ ID No: 15} .
Figure 8 shows the restriction enzyme analysis of the
gene encoding the C. pneumoniae CPN100&39 gene.
Figure 9 shows the nucleotide sequence of the CPN100708
(SEQ ID No: 9 - entire sequence and SEQ ID No: 10 - coding
sequence coded for on the negative strand) and the deduced amino

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/0114Z
I1
acid sequence of the CPN100708 protein from Chla'mydia pneumoniae
(SEQ ID No: 16).
Figure 10 shows the restriction enzyme analysis of the
gene encoding the C. pneumoniae CPN100'~08 gene.
Figures 21 through 15 show an identification of T and B
cell epitopes from the amino acid sequE~nces shown in the
foregoing figures,
DETAILED DESCRIPTION OF INVENTION
Open reading frames (ORFs) encoding chlamydial
polypeptides have been identified from the C. pneumoniae genome.
These polypeptides include polypeptide;s found permanently in the
bacterial membrane structure, polypept:ides present in the
external vicinity of the bacterial membrane, polypeptides found
25 permanently in the inclusion membrane .structure, polypeptides
present in the external vicinity of the inclusion membrane, and
polypeptides released into the cytoplasm of the infected cell.
These polypeptides can be used to prevent and treat Chlamydia
infection.
According to a first aspect of the invention, isolated
polynucleotides are provided which encode the precursor and
mature forms of Chlamydia polypeptides, whose amino acid
sequences are selected from the group consisting of: SEQ ID
Nos: I1 to I6.
The term "isolated polynucleotide" is defined as a
polynucleotide removed from the environment in which it
naturally occurs. For example, a naturally-occurring DNA
molecule present in the genome of a living bacteria or as part
of a gene bank is not isolated, but the same molecule separated
from the remaining part of the bacterial genome, as a result of,
e.g., a cloning event (amplification), is isolated. Typically,
an isolated DNA molecule is free from DNA regions (e. g., coding
regions) with which it is immediately contiguous at the 5' or 3'
end, in the naturally occurring genome~. Such isolated

CA 02352759 2001-05-31
WO OOI32794 PCT/CA99101147
12
polynucleotides may be part of a vector or a composition and
still be defined as isolated in that such a vector or
composition is not part of the natural environment of such
polynucleotide.
~ The polynucleotide of the invention is either RNA or DNA
(cDNA, genomic DNA, or synthetic DNA), or modifications,
variants, homologs or fragments thereof'. The DNA is either
double-stranded or single-stranded, and, if single-stranded, is
either the coding strand or the non-coding (anti-sense) strand.
Any one of the sequences that encode tree polypeptides of the
invention as shown in SEQ ID Nos: 1 to 10 is (a) a coding
sequence,(b) a ribonucleotide sequence derived from
transcription of (a), or (c) a coding :>equence which uses the
redundancy or degeneracy of the genetic: code to encode the same
polypeptides. By "polypeptide" or "protein" is meant any chain
of amino acids, regardless of length or post-translational
modification (e. g., glycosylation or phosphorylation). Both
terms are used interchangeably in the present application.
Consistent with the first aspect of the invention, amino
acid sequences are provided which are homologous to any one of
SEQ ID Nos: 11 to 15. As used herein, "homologous amino acid
sequence" is any polypeptide which is encoded, in whole or in
part, by a nucleic acid sequence which hybridizes at 25-35°C
below critical melting temperature (Tm), to any portion of the
nucleic acid sequences of SEQ ID Nos: :1 to 10. A homologous
amino acid sequence is one that differs from an amino acid
sequence shown in any one of SEQ ID No~s: 11 to 16 by one or more
conservative amino acid substitutions. Such a sequence also
encompass serotypic variants (defined '.below) as well as
sequences containing deletions or insertions which retain
inherent characteristics of the polype:ptide such as
immunogenicity. Preferably, such a sequence is at least 750,
more preferably 80%, and most preferably 90o identical to any
one of SEQ ID Nos: Il to 16.

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
13
Homologous amino acid sequences include sequences that
are identical or substantially identical to SEQ ID Nosa ll to
16. By "amino acid sequence substantially identical" is meant a
sequence that is at least 904, preferably 950, more preferably
970, and most preferably 99a identical to an amino acid sequence
of reference and that preferably differs from the sequence of
reference by a majority of conservative amino acid
substitutions.
Conservative amino acid substitutions are substitutions
among amino acids of the same class. 'These classes include, for
example, amino acids having uncharged ;polar side chains, such as
asparagine, glutamine, serine, threonine, and tyrosine; amino
acids having basic side chains, such as lysine, arginine, and
histidine; amino acids having acidic side chain , such as
aspartic acid and glutamic acid: and amino acids having nonpolar
side chains, such as glycine, alanine, valine, leucine,
isoleucine, proline, phenylalanine, methianine, tryptophan, and
cysteine.
Homology is measured using sequence analysis software
such as Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center,
1710 University Avenue, Madison, WI 53705. Amino acid sequences
are aligned to maximize identity. Gaps may be artificially
introduced into the sequence to attain. proper alignment. Once
the optimal alignment has been set up, the degree of homology is
established by recording all of the positions in which the amino
acids of both sequences are identical, relative to the total
number of positions.
Homologous polynucleotide sequences are defined in a
similar way. Preferably, a homologou~~ sequence is one that is
at least 45%, more preferably 600, and most preferably 85%
identical to any one of coding sequences SEQ ID Nos: 1 to 10.
Consistent with the first aspect of the invention,
polypeptides having a sequence homologous to any one of SEQ ID

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/OI 147
14
Nos: l1 to 16 include naturally-occurring allelic variants, as
well as mutants or any other non-naturally occurring variants
that retain the inherent characteristics of the polypeptide of
SEQ ID Nos: 11 to 16.
As is known in the art, an allelic variant is an
alternate form of a polypeptide that is characterized as having
a substitution, deletion, or addition of one or more amino acids
that does not alter the biological function of the polypeptide.
By "biological function" is meant the function of the
polypeptide in the cells in which it naturally occurs, even if
the function is not necessary for the growth or survival of the
cells. For example, the biological function of a porin is to
allow the entry into cells of compound~> present in the
extracellular medium. Biological function is distinct from
antigenic property. A polypeptide can have more than one
biological function.
Allelic variants are very common in nature. For example,
a bacterial species such as C. pneumon~~ae, is usually
represented by a variety of strains that differ from each other
by minor allelic variations. Indeed, ~~ polypeptide that
fulfills the same biological function in different strains can
have an amino acid sequence (and polynucleotide sequence) that
is not identical in each of the strains. Despite this
variation, an immune response directed generally against many
allelic variants has been demonstrated.. In studies of the
Ch3amydial MOMP antigen, cross-strain <~ntibody binding plus
neutralization of infectivity occurs desspite amino acid sequence
variation of MOMP from strain to strain, indicating that the
MOMP, when used as an immunogen, is to:Lerant of amino acid
variations.
Polynucleotides encoding homologous polypeptides or
allelic variants are retrieved by polymerase chain reaction
(PCR) amplification of genomic bacterial DNA extracted by
conventional methods. This involves t'he use of synthetic

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/Ol 147
oligonucleotide .primers matching upstream and downstream of the
5' and 3' ends of the encoding domain. Suitable primers are
designed according to the nucleotide sequence information
provided in SEQ ID Nos: 1 to 10. The procedure is as follows: a
5 primer is selected which consists of 10 to 40, preferably 15 to
nucleotides. It is advantageous to select primers containing
C and G nucleotides in a proportion su:Eficient to ensure
efficient hybridization i.e., an amount of C and G. nucleotides
of at least 40%, preferably 500 of the total nucleotide
10 content.A standard PCR reaction contains typically 0.5 to 5
Units of Taq DNA polymerase per 100 JCL,, 20 to 200 ~M
deoxynucleotide each, preferably at eqoaivalent concentrations,
0.5 to 2.5 MM magnesium over the total deoxynucieotide
concentration, 105 to 106 target molecules, and about 20 pmol of
15 each primer. About 25 to 50 PCR cycles are performed, with an
annealing temperature 15°C to 5°C below the true Tm of the
primers. A more stringent annealing temperature improves
discrimination against incorrectly annealed primers and reduces
incorportion of incorrect nucleotides ,at the 3' end of primers.
20 A denaturation temperature of 95°C to ~~7°C is typical,
although
higher temperatures may be appropriate for dematuration of G+C-
rich targets. The number of cycles performed depends on the
starting concentration of target molecules, though typically
more than 40 cycles is not recommended as non-specific
25 background products tend to accumulate.
An alternative method for retrieving polynucleotides
encoding homologous polypeptides or allelic variants is by
hybridization screening of a DNA or RNA library. Hybridization
procedures are well-known in the art and are described in
Ausubel et al., (Ausubel et al., Current Protocols in Molecular
Biology, John Wiley & Sons Inc., 1994), Silhavy et a~l. (Silhavy
et a1. Experiments with Gene Fusions, Cold Spring Harbor
Laboratory Press, 19$4), and Davis et a1. (Davis et al. A Manual

CA 02352759 2001-05-31
WO 00132794 PCTlCA99/Ol l47
16
for Genetic Engineering: Advanced Bacterial Genetics, Cold
Spring Harbor Laboratory Press, 1980))" Important: parameters
for optimizing hybridization conditions are reflected in a
formula used to obtain the critical melting temperature above
which two complementary DNA strands separate from each other
(Casey & Davidson, Nucl. Acid Res. (19'77) 4:1539). For
polynucleotides of about 600 nucleotides or larger, this foxmula
is as follows: Tm = 81.5 + 0.5 x (% G+C} + 1.6 log (positive ion
concentration) - D.6 x (% formamide). Under appropriate
stringency conditions, hybridization temperature (Th) is
approximately 20 to 40°C, 20 to 25°C, or, preferably 30 to
40°C
below the calculated Tm. Those skilled in the art will
understand that optimal temperature and salt conditions can be
readily determined.
For the polynucleotides of the invention, stringent
conditions are achieved for both pre-hybridizing and hybridizing
incubations (i) within 4-16 hours at 42°C, in 6 x SSC containing
50% formamide, or (ii) within 4-16 hours at 65°C in an aqueous
6 x SSC solution (1 M NaCl, 0.1 M sodium citrate (pH 7"0)).
Useful homologs and fragments thereof that do not occur
naturally are designed using known methods for identifying
regions of an antigen that are likely to tolerate amino acid
sequence changes and/or deletions. As an example, homologous
polypeptides from different: species are compared; conserved
sequences are identified. The more divergent sequences are the
most likely to tolerate sequence changes. Homology among
sequences may be analyzed using the BLAST homology searching
algorithm of Altschul et al., Nucleic Acids Res.25:3389-3402
(1997). Alternatively, sequences are modified such that they
become more reactive to T- and/or B-cells. (See Figures 11 to
15 below for identification of T- and B- epitopes). Yet another
alternative is to mutate a particular amino acid residue or
sequence within the polypeptide in vitro, then screen the mutant

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
17
polypeptides for their ability to prevE:nt or treat Chlamydia
infection according to the method outlined below.
A person skilled in the art will readily understand that
by following the screening process of this invention, it will be
determined without undue experimentation whether a particular
homolog of any of SEQ ID Nos: 11 to 16 may be useful in the
prevention or treatment of Chlamydia infection. The screening
procedure comprises the steps:
(i) immunizing an animal, preferably mouse, with the
test homolog or fragment;
(ii) inoculating the immunized animal with Chlamydia;
and,
(iii) selecting those homologs or fragments which confer
protection against Chlam.ydia.
By "conferring protection" is meant that there is a
reduction is severity of any of the ef:Eects of Chlamydia
infection, in comparison with a control animal which was not
immunized with the test homolog or fragment.
It has been previously demonstrated (Yang, Z. P., Chi, E.
Y., Kuo, C. C. and Grayston, J. T. 1993. A mouse model of C.
pneumoniae strain TWAR pneumonitis. 61(5):2037-2040) that mice
are susceptible to intranasal infection with different isolates
of C. pneumoniae. Strain AR-39 (Chi, E. Y., Kuo, C. C. and
Grayston, J. T. , 1987. Unique ultrastructure in the elementary
body of Chlamydia sp. strain TWAR. J. Bacteriol. 169(8):3757-63)
was used in Balb/c mice as a challenge infection model to
examine the capacity of chlamydia gene products delivered as
naked DNA to elicit a protective response against a sublethal
C. pneumoniae lung infection. Protective immunity is defined as
an accelerated clearance of pulmonary infection.
Groups of 7 to 9 week old male Balb/c mice (6 to 10 per
group) were immunized intramuscularly (i.m.) plus intranasally
(i.n.) with plasmid DNA containing the coding sequence of a
C. pneumoniae polypeptide. Saline or the plasmid vector lacking

CA 02352759 2001-05-31
WO 00/32794 PC'FICA99101147
18
an inserted chlamydial gene was given to groups of control
animals.
For i.m. immunization alternatE: left and right quadriceps
were injected with 100~,g of DNA in 50.1 of PBS on three
occasions at 0, 3 and 6 weeks. For i.n. immunization,
anaesthetized mice aspirated 501 of PBS containing 50 ~.g DNA on
three occasions at 0, 3 and 6 weeks. At week 8, immunized mice
were inoculated i.n. with 5 x 105 IFU of C. pneumoniae, strain
AR39 in 100,1 of SPG buffer to test their ability to limit the
growth of a sublethal C. pneumoniae challenge.
Zungs were taken from mice at day 9 post--challenge and
immediately homogenised in SPG buffer (7.5o sucrose, 5mM
glutamate, 12.5mM phosphate pH7.5). T'he homogenate was stored
frozen at -70°C until assay. Dilutions of the homogenate were
assayed for the presence of infectious. chlamydia by inoculation
onto monolayers of susceptible cells. The inoculum was
centrifuged onto the cells at 3000rpm for 2 hour, then the cells
were incubated for three days at 35°C in the presence of l~.g/mi
cycloheximide. After incubation the monolayers were fixed with
formalin and methanol then immunopero~:idase stained for the
presence of chlamydial inclusions using convalescent sera from
rabbits infected with C. pneumoniae and metal-enhanced DAB as a
peroxidase substrate.
Consistent with the first aspect of the invention,
palypeptide derivatives are provided i:hat are partial sequences
of SEQ ID Nos: 11 to 16, partial sequences of polypeptide
sequences homologous to SEQ ID Nos: 1:L to IC, polypeptides
derived from full-length polypeptides by internal deletion, and
fusion proteins.
It is an accepted practice in the field of immunology to
use fragments and variants of protein immunogens as vaccines, as
all that is required to induce an immune response to a protein
is a small (e.g., 8 to 10 amino acid) immunogenic region of the

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
19
protein. Various short synthetic peptides corresponding to
surface-exposed antigens of pathogens other than Chlamydia have
been shown to be effective vaccine antigens against their
respective pathogens, e.g. an 11 residue peptide of murine
mammary tumor virus (Casey & Davidson, Nucl. Acid Res. (1977)
4:1539), a 16-residue peptide of Semli:ki Forest virus (Snijders
et a.I., 1991. J. Gen. Virol. 72:557-56.5), and two overlapping
peptides of 15 residues each from canine parvovirus (Langeveld
et al., Vaccine 12(15):1473-1480, 1994).
Accordingly, it will be readily apparent to one skilled
in the art, having read the present description, that partial
sequences of SEQ ID Nos: 11 to 16 or their homologous amino acid
sequences are inherent to the full-length sequences and are
taught by the present invention. Such polypeptide fragments
preferably are at least 12 amino acids in length.
Advantageously, they are at least 20 amino acids, preferably at
least 50 amino acids, more preferably at least 75 amino acids,
and most preferably at least 100 amino acids in length.
Polynucleotides of 30 to 600 nucleotides encoding partial
sequences of sequences homologous to SEQ ID Nos: ll to 16 are
retrieved by PCR amplification using the parameters outlined
above arid using primers matching the sequences upstream and
downstream of the 5' and 3° ends of the fragment to be
amplified. The template polynucleotide for such amplification
is either the full length polynucleotide homologous to one of
SEQ ID Nos: 1 to 10, or a polynucleotide contained in a mixture
of polynucleotides such as a DNA or RNA library. As an
alternative method for retrieving the partial sequences,
screening hybridization is carried out. under conditions
described above arid using the formula for calculating Tm. Where
fragments of 30 to 600 nucleotides are. to be retrieved, the
calculated Tm is corrected by subtracting (600/polynucleotide
size in base pairs) and the stringency conditions are defined by
a hybridization temperature that is 5 to 10°C below Tm. Where

CA 02352759 2001-05-31
WO OOI32794 PCT/CA99/01147
oligonucleotides shorter than 20-30 bases are to be obtained,
the formula for calculating the Tm is as follows: Tm = 4 x (G+C)
+ 2 (A+T}. For example, an 18 nucleotide fragment of 50% G+C
would have an approximate Tm of 54°C. Short peptides that are
5 fragments of SEQ. ID Nos. 11 to 16 or their homologous
sequences, are obtained directly by chemical synthesis (E. Gross
and H. J. Meinhofer, 4 The Peptides: Analysis, Synthesis,
Biology; Modern Techniques of Peptide Synthesis, John Wiley &
Sons (1981), and M. Bodanzki, Principles of Peptide Synthesis,
10 Springer -Verlag (1984)).
Useful polypeptide derivatives, e.g., polypeptide
fragments, are designed using compute~_-assisted analysis of
amino acid sequences. This identifies probable surface-exposed,
antigenic regions (Hughes et al., 199:?. Infect. Immun.
15 60(9):3497). An analysis of the 6 am:Lno acid sequences
contained in SEQ ID Nos: 1I to 16, based on the product of
flexibility and hydrophobicity propensities using the program
SEQSEE (Wishart DS, et al. ~~SEQSEE: a comprehensive program
suite for protein sequence analysis." Comput Appl Biosc.i. 1994
20 Apr;lO(2):12I-32), reveal a number of potential B- and T-cell
epitopes which may be used as a basis for selecting useful
immunogenic fragments and variants. '.The results are shown in
Figures 11 to 15. This analysis uses a reasonable combination
of external surface features that is :Likely to be recognized by
antibodies. Probable T-cell epitvpes for HLA-A0201 MHC subclass
were revealed by an algorithm written at Connaught Laboratories
that emulates an approach developed at the NIH (Parker KC, et
a1. "Peptide binding to MHC class T molecules: implications for
antigenic peptide prediction." Immuno.l. Res 1995;14(1}:34-57).
Epitopes which induce a protective T cell-dependent
immune response are present throughout the length of the
poiypeptide. However, some epitopes .may be masked by secondary
and tertiary structures of the polype:ptide. To reveal such
masked epitopes large internal deletions are created which

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
21
remove much of the original protein structure and exposes the
masked epitopes. Such internal deletions sometimes effects the
additional advantage of removing immunodominant regions of high
variability among strains. Polynucleotides encoding polypeptide
fragments and polypeptides having large internal deletions are
constructed using standard methods (Ausubel et al., Current
Protocols in Molecular Biology, John Wiley & Sons Inc., 1994).
Such methods include standard PCR, inverse PCR, restriction
enzyme treatment of cloned DNA molecules, or the method of
Kunkel et al. (Kunkel et a1. Proc. Natl. Acad. Sci. USA (1985)
82:448). Components for these methods arid instructions for
their use are readily available from various commercial sources
such as Stratagene. Once the deletion mutants have been
constructed, they are tested for their ability to prevent or
treat Chlamydia infection as described above.
As used herein, a fusion polypf:ptide is one that contains
a polypeptide or a polypeptide derivative of the invention fused
at the N- or C-terminal end to any other polypeptide
(hereinafter referred to as a peptide tail). A simple way to
obtain such a fusion polypeptide is by translation of an in-
frame fusion of the polynucleotide sequences, i.e., a hybrid
gene. The hybrid gene encoding the fusion polypeptide is
inserted into an expression vector which is used to transform or
transfect a host cell. Alternatively, the polynucleotide
sequence encoding the polypeptide or polypeptide derivative is
inserted into an expression vector in which the polynucleotide
encoding the peptide tail is already present. Such vectors and
instructions for their use are commercially available, e.g. the
pMal-c2 or pMal-p2 system from New England Biolabs, in which the
peptide tail is a maltose binding protein, the glutathione-S-
transferase system of Pharmacia, or th.e His-Tag system available
from Novagen. These and other expression systems provide
convenient means for further purification of polypeptides and
derivatives of the invention.

CA 02352759 2001-05-31
WO 00132794 PCT/CA99/01147
22
An advantageous example of a fusion polypeptide is one
where the polypeptide or homolog or fragment of the invention is
fused to a polypeptide having adjuvani: activity, such as subunit
B of either cholera toxin or E, coli heat-labile toxin. Another
advantageous fusion is one where the polypeptide, homolog or
fragment is fused to a strong T-cell e:pitope or B-cell epitope.
Such an epitope may be one known in the art (e. g. the Hepatitis
B virus core antigen, D.R. Millich et al., "Antibody production
to the nucleocapsid and envelope of the Hepatitis B virus primed
by a single synthetic T cell site", Nature. 1987. 329:547-549),
or one which has been identified in another polypeptide of the
invention {Figures 11-15). Consistent: with this aspect of the
invention is a fusion polypeptide comprising T- or B-cell
epitopes from one of SEQ ID Nos: 11 to 16 or its homolog or
fragment, wherein the epitopes are derived from multiple
variants of said polypeptide or homolog or fragment, each
variant differing from another in the location and sequence of
its epitope within the polypeptide. :>uch a fusion is effective
in the prevention and treatment of Ch_Lamydia infection since it
optimizes the T-- and B-cell response i.o the averall polypeptide,
homolog or fragment.
To effect fusion, the polypeptide of the invention is
fused to the N-, or preferably, to the. C-terminal end of the
polypeptide having adjuvant activity or T- or B-cell epitope.
Alternatively, a polypeptide fragment of the invention is
inserted internally within the amino acid sequence of the
polypeptide having adjuvant activity. The T- or B-cell epitope
may also be inserted internally within the amino acid sequence
of the polypeptide of the invention.
Consistent with the first aspect, the polynucleotides of
the invention also encode hybrid precursor polypeptides
containing heterologous signal peptidcas, which mature into
polypeptides of the invention. By "heterologous signal peptide"

CA 02352759 2001-05-31
WO 00132794 PCTICA99101147
23
is meant a signal peptide that is not found in naturally-
occurring precursors of polypeptides of the invention.
A polynucleotide molecule according to the invention,
including RNA, DNA, or modifications or combinations thereof,
have various applications. A DNA molecule is used, for example,
(i) in a process for producing the encoded polypeptide in a
recombinant host system, (ii) in the construction of vaccine
vectors such as poxviruses, which are further used in methods
and compositions for preventing and/o:r treating Chlamydia
infection, (iii) as a vaccine agent (as well as an RNA
molecule), in a naked form or formulai~ed with a delivery vehicle
and, (iv) in the construction of attenuated Chlamydia strains
that can over-express a polynucleotide of the invention or
express it in a non-toxic, mutated foam.
Accordingly, a second aspect c~f the invention encompasses
(i) an expression cassette containing a DNA molecule of the
invention placed under the control of the elements required for
expression, in particular under the control of an appropriate
promoter; (ii) an expression vector containing an expression
cassette of the invention; (iii) a procaryotic or eucaryotic
cell transformed ar transfected with .an expression cassette
and/or vector of the invention, as we:l1 as (iv) a process for
producing a polypeptide or polypeptide derivative encoded by a
polynucleotide of the invention, whiclh involves culturing a
procaryotic or eucaryotic cell transformed or transfected with
an expression cassette and/or vector of the inventions under
conditions that allow expression of t:he DNA molecule of the
invention and, recovering the encoded polypeptide or polypeptide
derivative from the cell culture.
3D A recombinant expression system is selected from
procaryatic and eucaryotic hosts. Eucaryotic hosts include
yeast cells (e. g. , Saccharomyces cerevis.zae or Pichia pastori.s) ,
mammalian cells (e. g., COS1, NIH3T3, or JEG3 cells), arthropods
cells (e. g., Spodoptera frugiperda (SF9) cells), and plant

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
24
cells. A preferred expression system is a procaryotic host such
as E. coli. Bacterial and eucaryotic cells are available from a
number of different sources including commercial sources to
those skilled in the art, e.g., the American Type Culture
Collection (ATCC; Rockville, Maryland). Commercial sources of
cells used for recombinant protein expression also provide
instructions for usage of the cells.
The choice of the expression system depends on the
features desired for the expressed polypeptide. For example, it
may be useful to produce a polypeptide of the invention in a
particular lipidated form or any other form.
One skilled in the art would readily understand that not
all vectors and expression control sequences and hosts would be
expected to express equally well the polynucleatides of this
invention. With the guidelines described below, however, a
selection of vectors, expression control sequences and hosts may
be made without undue experimentation and without departing from
the scope of this invention.
In selecting a vector, the hosi~ must be chosen that is
compatible with the vector which is to exist and possibly
replicate in it. Considerations are made with respect to the
vector copy number, the ability to control the copy number,
expression of other proteins such as antibiotic resistance. In
selecting an expression control sequence, a number of variables
are considered. Among the important variable are the relative
strength of the sequence (e. g. the ability to drive expression
under various conditions), the ability' to control the sequence's
function, compatibility between the poiynucleotide to be
expressed and the control sequence (e. g. secondary structures
are considered to avoid hairpin structures which prevent
efficient transcription). In selecting the host, unicellular
hosts are selected which are compatible with the selected
vector, tolerant of any possible toxic effects of the expressed
product, able to secrete the expressed. product efficiently if

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
such is desired, to be able to express: the product in the
desired conformation, to be easily scaled up, and to which ease
of purification of the final product.
The choice of the expression cassette depends an the host
5 system selected as well as the features desired for the
expressed polypeptide: Typically, an expression cassette
includes a promoter that is functional in the selected host
system and can be constitutive or indu.cible; a ribosome binding
site; a start codon {ATG) if necessary; a region encoding a
10 signal peptide, e.g., a lipidation signal peptide; a DNA
molecule of the invention; a stop codon; and optionally a 3'
terminal region (translation and/or transcription terminator).
The signal peptide encoding region is adjacent to the
polynucleotide of the invention and placed in proper reading
15 frame. The signal peptide-encoding region is homologous or
heterologous to the DNA molecule encoding the mature polypeptide
and is compatible with the secretion apparatus of the host used
for expression. The open reading frame constituted by the DNA
molecule of the invention, solely or together with the signal
20 peptide, is placed under the control of the promoter so that
transcription and translation occur in the host system.
Promoters and signal peptide encoding regions are widely known
and available to those skilled in the art and include, for
example, the promoter of Salmonella t~:phimu.rium (and
25 derivatives) that is inducible by arab~inose (promoter araB} and
is functional in Gram-negative bacteria such as E. coli (as
described in U.S. Patent No. 5,028,530 and in Cagnon et al.,
{Cagnon et a.~., Protein Engineering (1991} 4(7):843)); the
promoter of the gene of bacteriophage T7 encoding RNA
polymerase, that is functional in a number of E, coli strains
expressing T7 polymerase (described in. U:S. Patent
No. 4,952,496); OspA lipidation signal peptide ; and RlpB
iipidation signal peptide (Takase et a:l. , J. Bact . ( 1987 )
169:5692).

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
26
The expression cassette is typ_Lcally part of an
expression vector, which is selected for its ability to
replicate in the chosen expression system. Expression vectors
(e. g., plasmids or viral vectors) can be chosen, for example,
from those described in Pouwels et a1. (Cloning Vectors: A
Laboratory Manual 1985, Supp. 1987). Suitable expression
vectors can be purchased from various commercial sources.
Methods for transforming/transi=ecting host cells with
expression vectors are well-known in the art and depend on the
host system selected as described in Ausubel et al., (Ausubel et
al., Current Protocols in Molecular Biology, John Wiley & Sons
Inc., 1994).
t3pon expression, a recombinant polypeptide of the
invention (or a polypeptide derivative) is produced and remains
in the intracellular compartment, is secreted/excreted in the
extracellular medium or in the periplasmic space, or is embedded
in the cellular membrane. The polypeptide is recovered in a
substantially purified form from the cell extract or from the
supernatant after centrifugation of the recombinant cell
culture. Typically, the recombinant polypeptide is purified by
antibody-based affinity purification or by other well-known
methods that can be readily adapted by a person skilled in the
art, such as fusion of the polynucleotide encoding the
polypeptide or its derivative to a small affinity binding
domain. Antibodies useful for purifying by immunoaffinity the
polypeptides of the invention are obtained as described below.
A polynucleotide of the invent_Lon can also be useful.as a
vaccine. There are two major routes, either using a viral or
bacteria, host as gene delivery vehicle (live vaccine vector) or
administering the gene in a free form, e.g., inserted into a
plasmid. Therapeutic or prophylactic efficacy of a
poiynucleotide of the invention is evaluated as described below.
Accordingly, a third aspect of the invention provides (i)
a vaccine vector such as a poxvirus, containing a DNA molecule

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
z~
of the invention, placed under the control of elements required
for expression; (ii) a composition of matter comprising a
vaccine vector of the invention, together with a diluent or
carrier; specifically (iii) a pharmaceutical composition
containing a therapeutically or prophylactically effective
amount of a vaccine vector of the inv~:ntion; (iv) a method for
inducing an immune response against Chlamydia in a mammal (e. g.,
a human; alternatively, the method can be used in veterinary
applications for treating or preventing Chlamydia infection of
animals, e.g., cats or birds), which involves administering to
the mammal an immunagenically effective amount of a vaccine
vector of the invention to elicit a protective or therapeutic
immune response to Chlamydia ; and particularly, (v) a method
for preventing and/or treating a Chlamydia (e. g.,
C. trachomatis, C. psittaCi, C, pneumc>nia, C. pecorum)
infection, which involves administering a prophylactic or
therapeutic amount of a vaccine vector of the invention to an
infected individual: Additionally, the third aspect of the
invention encompasses the use of a vaccine vector of the
invention in the preparation of a medicament for preventing
and/or treating Chlamydia infection.
As used herein, a vaccine vector expresses one ar several
polypeptides or derivatives of the invention. The vaccine
vector may express additionally a cytakine, such as interleukin-
2 (Ih-2) or interleukin-12 (IL-12), that enhances the immune
response (adjuvant effect). It is understood that each of the
components to be expressed is placed under the control of
elements required for expression in a mammalian cell.
Consistent with the third aspect of the invention is a
composition comprising several vaccine: vectors, each of them
capable of expressing a polypeptide oz- derivative of the
invention. A composition may also carnprise a vaccine vector
capable of expressing an additional Chlamydia antigen, or a

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/O1147
28
subunit, fragment, homolog, mutant, or derivative thereof,
optionally together with a cytokine such as IL-2 or IL-12.
Vaccination methods for treating or preventing infection
in a mammal comprises use of a vaccine: vector of the invention
to be administered by any conventional. route, particularly to a
mucosal (e. g., ocular, intranasal, oral, gastric, pulmonary,
intestinal, rectal, vaginal, or urinary tract) surface or via
the parenteral (e. g., subcutaneous, intradermal, intramuscular,
intravenous, or intraperitoneal) route. Preferred routes depend
upon the choice of the vaccine vector: Treatment may be
effected in a single dose or repeated at intervals. The
appropriate dosage depends on various parameters understood by
skilled artisans such as the vaccine vector itself, the route of
administration ar the condition of the' mammal to be vaccinated
I5 (weight, age and the like).
Live vaccine vectors available in the art include viral
vectors such as adenoviruses and poxviruses as well as bacterial
vectors, e.g., Shige3.la, Salmonella, Vibrio cholerae,
.Lactobacillus, Bacille bilie de Calmetae-Guerin (BCG), and
Streptococcus.
An example of an adenovirus vector, as well as a method
for constructing an adenovirus vector capable of expressing a
DNA molecule of the invention, are described in U.S. Patent No.
4,920,209. Poxvirus vectors include vaccinia and canary pox
virus, described in U.S. Patent No. 4,722,848 and U.S. Patent
No. 5, 364, 773, respectively. (Also se:e, . e. g. , Tartaglia et aZ. ,
Virology (1992) 188:217) for a description of a vaccinia virus
vector and Taylor et a1, Vaccine (199.'i) 13:539 for a reference
of a canary pox.) Poxvirus vectors capable of expressing a
polynucleotide of the invention are obtained by homologous
recombination as described in Kieny ei: al., Nature (1984)
312:163 so that the polynucleotide of the invention is inserted
in the viral genome under appropriate conditions for expression
in mammalian cells. Generally, the dose of vaccine viral

i;
CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01If7
29
vector, for therapeutic or prophylactic use, can be of from
about 1x104 to about 1x1011, advantageously from about 1x10' to
about 1x101°, preferably of from about 1x10' to about 1x109
plaque-forming units per kilogram. Pz:eferably, viral vectors
are administered parenterally; for example, in 3 doses, 4 weeks
apart. It is preferable to avoid adding a chemical adjuvant to
a composition containing a viral vector of the invention and
thereby minimizing the immune response: to the viral vector
itself .
Non-toxicogenic Vi.brio cholerae mutant strains that are
useful as a live oral vaccine are known. Mekalanos et al.,
Nature (1983) 306:551 and U.S. Patent No. 4,882,278 describe
strains which have a substantial amount of the coding sequence
of each of the two ctxA alleles deleted so that no functional
cholerae toxin is produced. WO 92/11354 describes a strain in
which the irgA loCUS is inactivated by mutations this mutation
can be combined in a single strain with ctxA mutations. WO
94/01533 describes a deletion mutant 7:acking functional ctxA and
attRSl DNA sequences. These mutant st:rains are genetically
engineered to express heterologous antigens, as described in
W0 94/19482. An effective vaccine do:~e of a Vibrio cholerae
strain capable of expressing a polypeptide or polypeptide
derivative encoded by a DNA molecule of the invention contains
about 1x105 to about 1x109, preferably about 1x106 to about 1x108,
viable bacteria in a volume appropriate for the selected route
of administration. Preferred routes of administration include
ali mucosal routes; most preferably, these vectors are
administered intranasally or orally.
Attenuated Salmonella typhimurium strains, genetically
engineered for recombinant expression of heterologous antigens
or not, and their use as oral vaccines are described in
Nakayama et a1. (Bio/Technology (1988) 6:693) and WO 92/11361.
Preferred routes of administration in<:lude all mucosal routes;

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
most preferably, these vectors are administered intranasally or
orally.
Other bacterial strains used as vaccine vectors in the
context of the present invention are described for Shigella
5 flexneri in High et al., EMBO (1992) 1.1:1991 and Sizemore et
al., Science (1995) 270:299; for Strex>tococcus gordonii in
Medaglini et al., Proc. Natl. Acad. Sc;i. USA (1995) 92:6868; and
for Bacille Calmette Guerin in Fl.ynn J~.I,., Cell. Mol. Biol.
(1994) 40 (suppl. I):31, WO 88/06626, WO 90/00594; WO 91/13157,
10 WO 92/01796, and WO 92/21376.
In bacterial vectors, the polynucleotide of the invention
is inserted into the bacterial genome or remains in a free state
as part-of a plasmid.
1°he composition comprising a vaccine bacterial vector of
Z5 the present invention may further contain an adjuvant . A
number of adjuvants are known to those. skilled in the art.
Preferred adjuvants as provided below.
Accordingly, a fourth aspect o:f the invention provides
(i) a composition of matter comprising a polynucleotide of the
20 invention, together with a diluent or carriers (ii) a
pharmaceutical composition comprising a therapeutically or
prophylactically effective amount of a~ polynucleotide of the
inventions (iii) a method for inducing an immune response
against Chlamyd.ia in a mammal by admir.Gistration of an
25 immunogenically effective amount of a polynucleotide of the
invention to elicit a protective immune response to Chlamydia:
and particularly, (iv) a method for preventing and/or treating a
Chlamydia (e. g. , C. trachomatis, C. p~>ittac.i, C. pneumoniae, or
C. pecorum) infection, by administering a prophylactic or
30 therapeutic amount of a polynucleotide~ of the invention to an
infected individual. Additionally, tree fourth aspect of the
invention encompasses the use of a pol.ynucleotide of the
invention in the preparation of a medicament for preventing
and/or treating Chlamydia infection. A preferred use includes

CA 02352759 2001-05-31
WO 00132794 PCT/CA99/OI 147
31
the use of a DNA molecule placed under conditions for expression
in a mammalian cell, especially in a plasmid that is unable to
replicate in mammalian cells and to substantially integrate in a
mammalian genome.
Use of the polynucleotides of 'the invention include their
administration to a mammal as a vaccine, for therapeutic or
prophylactic purposes. Such polynucleotides are used in the
form of DNA as part of a plasmid that is unable to replicate in
a mammalian cell and unable to integrate into the mammalian
genome. Typically, such a DNA molecule is placed under the
control of a promoter suitable for expression in a mammalian
cell. The promoter functions either ubiquitously or tissue-
specifically. Examples of non-tissue specific promoters include
the early Cytomegalovirus (CMV) promoter (described in U.S.
Patent No. 4,168,062) and the Rous Sarcoma Virus promoter
(described in Norton & Coffin, Molec. Cell Bial. (1985) 5:281).
An example of a tissue-specific promoter is the desmin promoter
which drives expression in muscle cells (Li et al:, Gene (1989)
78:243, Li & Paulin, J. Biol. Chem. (1991) 266:6562 and Li &
Paulin, ~3. Biol. Chem. (3.993) 268:10403) . Use of promoters is
well-known to those skilled in the art. Useful vectors are
described in numerous publications, specifically WO 94/21797 and
Hartikka et al., Human Gene Therapy (1996) 7:1205.
Polynucleotides of the invention which are used as a
vaccine encode either a precursor or a. mature form of the
corresponding polypeptide. In the precursor form, the signal
peptide is either homologous or heterologous. In the latter
case, a eucaryotic leader sequence such as the leader sequence
of the tissue-type plasminogen factor (tPA) is preferred.
As used herein, a composition of the invention contains
one or several polynucleotides with optionally at least one
additional polynucleotide encoding another Ch~amyd.ia antigen
such as urease subunit A, B, or both, or a fragment, derivative,
mutant, or analog thereof. The compo~~ition may also contain an

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
32
additional polynucleotide encoding a cytokine, such as
interleukin-2 (IL-2) or interleukin-12 (IL-12) so that the
immune response is enhanced. These adlditional polynucleotides
are placed under appropriate control for expression.
Advantageously, DNA molecules of the invention and/or additional
DNA molecules to be included in the same composition, are
present in the same plasmid.
Standard techniques of molecular biology for preparing
and purifying polynucleotides.are used. in the preparation of
polynucleotide therapeutics of the invention. For use as a
vaccine, a poiynucleotide of the invention is formulated
according to various methods outlined below.
One method utilizes the polynu<~leotide in a naked form,
free of any delivery vehicles. Such a polynucleotide is simply
I5 diluted in a physiologically acceptable solution such as sterile
saline or sterile buffered saline, with or without a carrier.
When present, the carrier preferably is isotonic, hypotonic, or
weakly hypertonic, and has a relatively low ionic strength, such
as provided by a sucrose solution, e.g~., a solution containing
20% sucrose.
An alternative method utilizes the polynucleotide in
association with agents that assist in. cellular uptake.
Examples of such agents are (i) chemic:als that modify cellular
permeability, such as bupivacaine (ses, e.g., WO 94/16737), (ii)
liposomes for encapsulation of the polynucleotide, ar
(iii) cationic lipids or silica, gold, or tungsten
microparticles which associate themselves with the
polynucleotides.
Anionic and neutral liposomes ~~re well-known in the art
(see, e:g., Liposomes: A Practical Approach, RPC New Ed, IRL
press (1990), for a detailed description of methods for making
liposomes) and are useful for deiiveri.ng a large range of
products, including polynucleotides. Cationic lipids are also
known in the art and are commonly used for gene delivery. Such

CA 02352759 2001-05-31
WO 00132794 PCT/CA99/01147
33
lipids include Lipofectin~M also known as DOTMA (N-[1-(2;3-
dioleyloxy}propyl]-N,N,N-trimethylammonium chloride), DOTAP
(1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB
(dimethyldioctadecylammonium bromide), DOGS
(dioctadecylamidologlycyl spermine) and cholesterol derivatives
such as DC-Chol (3 beta-(N-(N',N'-dimeahyl aminomethane)-
carbamoyl) cholesterol). A description of these cationic lipids
can be found in EP 187,702, WO 90/11092, U.S. Patent
No. 5,283,185, WO 91/15501, WO 95/26356, and U.S. Patent
l0 No. 5,527,928. Cationic lipids for gene delivery are preferably
used in association with a neutral lipid such as DOPE (dioleyl
phosphatidylethanolamine}, as described in WO 90/11092 as an
example.
Formulation containing cationic liposomes may optionally
contain other transfection-facilitating compounds. A number of
them are described in WO 93/18759, WO 93/19768, WO 94/25608, and
W0 95102397. They include spermine derivatives useful for
facilitating the transport of DNA through the nuclear membrane
(see, for example, WO 93/18759} and membrane-permeabilizing
compounds such as GALA, Gramicidine S, and cationic bile salts
(see, for example, WO 93/19768).
Gold or tungsten microparticle;s are used for gene
delivery, as described in WO 91/00359, WO 93/17706, and Tang et
a~. Nature (1992) 356:152. The microparticle-coated
polynucleotide is injected via intrade:rmal or intraepidermal
routes using a needleless injection device ("gene gun"), such as
those described in U.S. Patent No. 4,945,050, U.S. Patent
No. 5,015,580, and WO 94/24263.
The amount of DNA to be used i:n a vaccine recipient
depends, e.g., on the strength of the promoter used in the DNA
construct, the immunogenicity of the expressed gene product, the
condition of the mammal intended for administration (e.g., the
weight, age, and general health of the; mammal), the mode of
administration, and the type of formu~.ation. In general, a

CA 02352759 2001-05-31
WO 00!32794 PCT/CA99/Ol 147
34
therapeutically or prophylactically effective dose from about 1
ug to about 1 mg, preferably, from about 10 ~zg to about 800 ~zg
and, more preferably, from about 25 uc~ to about 250 ug, can be
administered to human adults. The administration can be
achieved in a single dose or repeated at intervals.
The route of administration is any conventional route
used in the vaccine field. As general. guidance, a
polynucleotide of the invention is adrrEinistered via a mucosal
surface, e.g., an ocular; intranasal, pulmonary, oral,
intestinal, rectal, vaginal, and urinary tract surface; or via a
parenteral route, e.g., by an intravenous, subcutaneous,
intraperitoneal, intradermal, intraepi.dermal, or intramuscular
route. The choice of administration route depends on the
formulation that is selected. A polynucleotide formulated in
association with bupivacaine is advantageously administered into
muscles. When a neutral or anionic li.posome or a cationic
lipid, such as DOTMA or DC-Chol, is u~;ed, the formulation can be
advantageously injected via intravenous, intranasal
(aerosolization), intramuscular, intra.dermal, and subcutaneous
routes. A polynucleotide in a naked form can advantageously be
administered via the intramuscular, intradermal, or sub-
cutaneous routes.
Although not absolutely required, such a composition can
also contain an adjuvant. If so, a systemic adjuvant that does
not require concomitant administration in order to exhibit an
adjuvant effect is preferable such as, e.g., QS2l, which is
described in U.S. Patent No. 5,057,54E~.
The sequence information provided in the present
application enables the design of specific nucleotide probes and
primers that are used for diagnostic ~>urposes. Accordingly, a
fifth aspect of the invention provides a nucleotide probe or
primer having a sequence found in or derived by degeneracy of
the genetic code from a sequence shown in any one of SEQ ID Nos:
1 to 20.

CA 02352759 2001-05-31
WD 00/32794 PCT/CA99/01147
The term "probe" as used in th,e present application
refers to DNA (preferably single stranded) or RNA molecules (or
modifications or combinations thereof) that hybridize under the
stringent conditions, as defined above, to nucleic acid
5 molecules having SEQ ID Nos: l to 10 or to sequences homologous
to SEQ ID Nos: 1 to 10, or to their complementary or anti-sense
sequences. Generally, probes are significantly shorter than
full-length sequences . Such probes contain from about 5 to
about 100, preferably from about 10 to about 80, nucleotides.
10 In particular, probes have sequences i~hat are at least 75%,
preferably at least 85%, more preferably 95% homologous to a
portion of any of SEQ ID Nos: 1 to 10 or that are complementary
to such sequences. Probes may contain modified bases such as
inosine, methyl-5-deoXycytidine; deoxyuridine, dimethylamino-5-
15 deoxyuridine, or diamino-2, 6-purine. Sugar or phosphate
residues may also be modified or subsi~ituted. For example, a
deoxyribose residue may be replaced by a polyamide (Nielsen et
a.I., Science (1991) 254:1497) and phosphate residues may be
replaced by ester groups such as diphosphate; alkyl,
20 arylphosphonate and phosphorothioate esters. In addition, the
2'-hydroxyl group on ribonucleotides may be modified by
including such groups as alkyl groups.
Probes of the invention are used in diagnostic tests, as
capture or detection probes. Such capture probes are
25 conventionally immobilized on a solid support, directly or
indirectly; by covalent means or by p;~.ssive adsorption. A
detection probe is labelled by a dete~~tion marker selected from:
radioactive isotopes, enzymes such as peroxidase, alkaline
phosphatase, and enzymes able to hydrolyze a chromogenic,
30 fluorogenic, or luminescent substrate, compounds that are
chromogenic, fluorogenic, or luminescent, nucleotide base
analogs, and biotin.
Probes of the invention are ue>ed in any conventional
hybridization technique, such as dot :blat (Maniatis et al.,

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
36
Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York), Southern blot
(Southern, J. Mol. Biol. (1975) 98:503), northern blot
(identical to Southern blot with the exception that RNA is used
as a target), or the sandwich technique (Dune et a.t., Cell
(1977) 12:23). The latter technique involves the use of a
specific capture probe. and/or a specific detection probe with
nucleotide sequences that at least partially differ from each
other.
A primer is a probe of usually about 10 to about
40 nucleotides that is used to initiate enzymatic polymerization
of DNA in an amplification process (e. g., PCR), in an elongation
process, or in a reverse transcription method. Primers used in
diagnostic methods involving PCR axe 1_abeled by methods known in
the art.
As described herein, the invention also encompasses (i) a
reagent comprising a probe of the invention for detecting and/or
identifying the presence of Chlamydia in a biological material;
(ii) a method for detecting and/or identifying the presence of
Chlamydia in a biological material, in which (a) a sample is
recovered or derived from the biological material; (b) DNA or
RNA is extracted from the material anc~ denatured, and (c)
exposed to a probe of the invention, f:or example, a capture,
detection probe or both, under stringent hybridization
conditions, such that hybridization i:> detected; and (iii) a
method for detecting and/or identifying the presence of
Chlamydia in a biological material, in which (a) a sample is
recovered or derived from the biological material, (b) DNA is
extracted therefrom, (c) the extracted DNA is primed with at
least one, and preferably two, primer; of the invention and
amplified by polymerase chain reaction, and (d) the amplified
DNA fragment is produced.
It is apparent that disclosure of polynucleotide
sequences of SEQ ID Nos: 1 to 10, the:Lr homolog, and partial

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
37
sequences of either enable their corresponding amino acid
sequences. Accordingly, a sixth aspect of the invention
features a substantially purified polypeptide or polypeptide
derivative having an amino acid sequence encoded by a
polynucleotide of the invention.
A "substantially purified polypeptide" as used herein is
defined as a polypeptide that is sepal°ated from the environment
in which it naturally occurs and/or that is free of the majority
of the polypeptides that are present in the environment in which
it was synthesized. For example, a substantially purified
polypeptide is free from cytoplasmic polypeptides. Those
skilled. in the art would readily undei:stand that the
polypeptides of the invention may be purified from a natural
source, .i.e., a Chlamydia strain, or produced by recombinant
means.
Consistent with the sixth aspect of the invention are
polypeptides, homologs or fragments which are modified or
treated to enhance their immunogenicit:y in the target animal, in
whom the polypeptide, homolog or fragments are intended to
confer protection against Chlamydia. Such modifications or
treatments include: amino acid substitutions with an amino acid
derivative such as 3-methyhistidine, ~I-hydroxyproline, 5-
hydroxylysine etc., modifications or deletions which are carried
out after preparation of the polypept~'_de, homoZog or fragment,
such as the modification of free amino, carboxyl or hydroxyl
side groups of the amino acids.
Identification of homologous polypeptides or polypeptide
derivatives encoded by polynucleotide;~ of the invention which
have specific antigenicity is achieved by screening for cross-
reactivity with an antiserum raised against the polypeptide of
reference having an amino acid sequen<:e of any one of SEQ ID
Nos: 11 to 16. The procedure is as follows: a monospecific
hyperimmune antiserum is raised against a purified reference
polypeptide, a fusion polypeptide (for example, an expression

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147~
38
product of MBP, GST, or His-tag systems), or a synthetic peptide
predicted to be antigenic. Where an antiserum is raised against
a fusion polypeptide, two different fusion systems are employed.
Specific antigenicity can be determinE:d according to a number of
methods, including Western blot (Towb~.n et al:, Proc. Natl.
Acad. Sci. USA (1979) 76:4350), dot b~.ot, and ELISA, as
described below.
In a Western blot assay, the product to be screened,
either as a purified preparation or a total E. coli extract, is
submitted to SDS-Page electrophoresis as described by Laemmli
(Nature (1970) 227:680). After transfer to a nitrocellulose
membrane, the material is further incubated with the
monospecific hyperimmune antiserum di~.uted in the range of
dilutions from about 1:5 to about 1:5CI00, preferably from about
1:100 to about 1:500. Specific antige;nicity is shown once a
band corresponding to the product exhibits reactivity at any of
the dilutions in the above range.
In an ELISA assay, the product to be screened is
preferably used as the coating antigen. A purified preparation
is preferred, although a whole cell e~aract can also be used.
Briefly, about 100 ul of a preparation at about 10 ug protein/ml
are distributed into wells of a 96-well polycarbonate ELISA
plate. The plate is incubated for 2 riours at 37°C then
overnight at 4°C. The plate is washed with phosphate buffer
saline (PBS) containing 0.05% Tween 20 {PBS/Tween buffer). The
wells are saturated with 250 ul PBS containing 1~ bovine serum
albumin (BSA) to prevent non-specific antibody binding. After 1
hour incubation at 37°C, the plate is washed with PBS/Tween
buffer. The antiserum is serially di~.uted in PBS/Tween buffer
containing 0.5~ BSA. 100 ul of dilutions are added per well.
The plate is incubated for 90 minutes at 3?°C, washed and
evaluated according to standard procedures. For example, a goat
anti-rabbit peroxidase conjugate is added to the wells when
specific antibodies were raised in rabbits. Incubation is

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
39
carried out for 90 minutes at 37°C and the plate is washed. The
reaction is developed with the appropriate substrate and the
reaction is measured by colorimetry (absorbance measured
spectrophotometrically). Under the ax>ove experimental
conditions, a positive reaction is shown by O.D. values greater
than a non immune control serum.
In a dot blot assay, a purified product is preferred,
although a whole cell extract can also be used. Briefly, a
solution of the product at about 100 pg/ml is serially two-fold
diluted in 50 mM Tris-HC1 (pH 7.5). 1.00 ul of each dilution are
applied to a nitrocellulose membrane Cl.45 um set in a 96-well
dot blot apparatus (Biorad). The buffer is removed by applying
vacuum to the system. Wells are washed by addition of 50 mM
Tris-HC1 (pH 7.5) and the membrane is air-dried. The membrane
is saturated in blocking buffer (50 mM Tris-HC1 (pH 7.5) 0.15 M
NaCl, 10 g/L skim milk) and incubated with an antiserum dilution
from about 1:50 to about 1:5000, preferably about 1:500. The
reaction is revealed according to standard procedures. For
example, a goat anti-rabbit peroxidase; conjugate is added to the
wells when rabbit antibodies are used. Incubation is carried
out 90 minutes at 37°C and the blot i~~ washed. The reaction is
developed with the appropriate substrate and stopped. The
reaction is measured visually by the appearance of a colored
spot, e. g. , by colorimetry. t7nder thE; above experimental
conditions, a positive reaction is shown once a colored spot is
associated with a dilution of at least; about 1:5, preferably of
at least about 1:500.
Therapeutic or prophylactic efficacy of a polypeptide or
derivative of the invention can be evaluated as described below.
A seventh aspect of the invention provides (i) a composition of
matter comprising a polypeptide of the: invention together with a
diluent or carrier; specifically (ii) a pharmaceutical
composition containing a therapeutica7_ly or prophylactically
effective amount of a polypeptide of t:he invention; (iii) a

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
method for inducing an immune responsE: against Chlamydia in a
mammal, by administering to the mammal. an immunogenically
effective amount of a polypeptide of t:he invention to elicit a
protective immune response to Chlamyd~ia~ and particularly, (iv)
5 a method for preventing and/or treating a Chlamydia (e. g.,
C, trachomatis. C. psittac.i, C. pneumoniae, or C. pecoruin)
infection, by administering a prophylactic or therapeutic amount
of a polypeptide of the invention to an infected individual.
Additionally, the seventh aspect of tree invention encompasses
10 the use of a polypeptide of the invention in the preparation of
a medicament for preventing and/or treating Chlamyd.ia infection.
As used herein, the immunogenic compositions of the
invention are administered by conventional routes known the
vaccine field, in particular to a mucosal (e. g., ocular,
15 intx:anasal, pulmonary, oral, gastric, intestinal, rectal,
vaginal, or urinary tract) surface or via the parenteral (e. g.,
subcutaneous, intradermal, intramuscu).ar, intravenous, or
intraperitoneal) route. The choice of: administration route
depends upon a number of parameters, :>uch as the adjuvant
20 associated with the polypeptide. If a mucosal adjuvant is used,
the intranasal or oral route is preferred. If a lipid.
formulation or an aluminum compound i:> used, the parenteral
route is preferred with the sub-cutane:ous or intramuscular route
being most preferred. The choice also depends upon the nature
25 of the vaccine agent. For example, a polypeptide of the
invention fused to CTB or ZTB is best administered to a mucosal
surface.
As used herein, the composition of the invention contains
one or several polypeptides or derivatives of the invention.
30 The composition optionally contains at: least one additional
Chlamydia antigen, or a subunit, fragment, homolog, mutant, or
derivative thereof.
For use in a composition of the invention, a polypeptide
or derivative thereof is formulated into or with liposomes,

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
41
preferably neutral or anionic liposome~s, microspheres, TSCOMS,
or virus-like-particles (VLPs) to facilitate delivery and/or
enhance the immune response. These compounds are readily
available to one skilled in the arty for example, see Liposomes:
A Practical Approach, RPC New Ed, IRL press (1990).
Adjuvants other than liposomes and the like are also used
and are known in the art. Adjuvants m,ay protect the antigen
from rapid dispersal by sequestering it in a local deposit, or
they may contain substances that stimulate the host to secrete
factors that are chemotactic for macrophages and other
components of the immune system. An appropriate selection can
conventionally be made by those skilled in the art, for example,
from those described below (see the eleventh aspect of the
invention).
Treatment is achieved in a single dose or repeated as
necessary at intervals, as can be determined readily by one
skilled in the art. For example, a priming dose is followed by
three booster doses at weekly or monthly intervals. An
appropriate dose depends on various parameters including the
recipient (e. g., adult or infant), the particular vaccine
antigen, the route and frequency of administration, the
presence/absence or type of adjuvant, and the desired effect
(e.g., protection and/or treatment), as can be determined by one
skilled in the art. In general, a vaccine antigen of the
invention is administered by a mucosal route in an amount from
about 10 ug to about 500 mg, preferably from about 1 mg to about
200 mg. Fox the parenteral route of administration, the dose
usually does not exceed about 1 mg, preferably about 100 ug.
When used as vaccine agents, polynucleotides and
polypeptides of the invention may be used sequentially as part
of a multistep immunization process. For example, a mammal is
initially primed with a vaccine vector of the invention such as
a pox virus, e.g., via the parenteral route, and then boosted
twice with the polypeptide encoded by the vaccine vector, e.g.,

CA 02352759 2001-05-31
WO 00!32794 PCT/CA99/01147
42
via the mucosal route. In another example, liposomes associated
with a polypeptide or derivative of the invention is also used
for priming, with boosting being carried out mucosally using a
soluble polypeptide or derivative of the invention in
combination with a mucosal adjuvant (e. g., LT).
A polypeptide derivative of the, invention is also used in
accordance with the seventh aspect as a diagnostic reagent for
detecting the presence of anti-Ch.~amya'ia antibodies, e: g. , in a
blood sample. Such polypeptides are about 5 to about ~0,
preferably about 10 to about 50 amino acids in length. They are
either labeled or unlabeled, depending upon the diagnostic
method. Diagnostic methods involving such a reagent axe
described below.
Upon expression of a DNA molecule of the invention, a
polypeptide or polypeptide derivative is produced and purified
using known laboratory techniques. As described above, the
polypeptide or polypeptide derivative may be produced as a
fusion protein containing a fused tail that facilitates
purification. The fusion product is used to immunize a small
mammal, e.g., a mouse or a rabbit, in order to raise antibodies
against the polypeptide or polypeptide derivative (monospecific
antibodies). Accordingly, an eighth aspect of the invention
provides a monospecific antibody that binds to a polypeptide or
polypeptide derivative of the invention.
By "monospecific antibody" is meant an antibody that is
capable of reacting with a unique naturally-occurring Chlamydia
polypeptide. An antibody of the invention is either polyclonal
or monoclonal. Monospecific antibodies may be recombinant,
e.g., chimeric (e. g., constituted by a variable region of murine
origin associated with a human constant region), humanized (a
human immunoglobulin constant backbone together with
hypervariable region of animal, e.g., murine, origin), and/or
single chain. Both polyclonal and mon.ospecific antibodies may
also be in the form of immunoglobulin fragments, e.g., F(ab)'2

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
43
or Fab fragments. The antibodies of the invention are of any
isotype, e.g., IgG or IgA, and polyclonal antibodies are of a
single isotype or a mixture of isotypes.
Antibodies against the polypept:ides, homologs ar
fragments of the present invention are generated by immunization
of a mammal with a composition comprising said polypeptide,
homolog ar fragment. Scu antibodies may be polyclonal ar
monoclonal. Methods to produce polyclonal or monoclonal
antibodies are well known in the art. For a review, see
"Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory,
Eds. E. Harlow and D. Lane (1988), and D.E. Yelton et al., 19$1.
Ann. Rev. Biochem. 50:657-680. For monoclonal antibodies, see
Kohler and Milstein (1975) Nature. 256:495-497.
The antibodies of the invention, which are raised to a
polypeptide or polypeptide derivative of the invention, are
produced and identified using standard immunological assays,
e.g., Western blot analysis, dot blot assay, or ELISA (see,
e.g., Coligan et al., Current Protocols in Immunology (1994)
John Wiley & Sons, Inc., New York, NY). The antibodies are used
in diagnostic methods to detect the presence of a Chlamydia
antigen in a sample, such as a biological sample. The
antibodies are also used in affinity chromatography for
purifying a polypeptide or polypeptide derivative of the
invention. As is discussed further below, such antibodies may
25: be used in prophylactic and therapeutic passive immunization
methods.
Accordingly, a ninth aspect of the invention provides
(i) a reagent for detecting the presence of Ch~Iamydia in a
biological sample that contains an antibody, polypeptide, or
polypeptide derivative of the invention; and (ii) a diagnostic
method far detecting the presence of Chlamydia in a biological
sample, by contacting the biological sample with an antibody, a
polypeptide, or a polypeptide derivative of the invention, such
that an immune complex is formed, and by detecting such complex

CA 02352759 2001-05-31
WO 00132794 PCT/CA99/01147
44
to indicate the presence of Chlamydia in the sample or the
organism from which the sample is derived.
Those skilled in the art will readily understand that the
immune complex is formed between a component of the sample and
the antibody, polypeptide, or polypept:ide derivative, whichever
is used, and that any unbound material. is removed prior to
detecting the complex. It is understood that a polypeptide
reagent is useful for detecting the presence of anti-Chlamydia
antibodies in a sample, e.g., a blood sample, while an antibody
of the invention is used for screening a sample, such as a
gastric extract or biopsy, for the preaence of Chlamydia
polypeptides.
For diagnostic applications, t:he reagent (i.e., the
antibody, polypeptide, or polypeptide derivative of the
invention) is either in a free state c>r immobilized on a solid
support, such as a tube, a bead, or any other conventional
support used in the field. Immobilization is achieved using
direct or indirect means. Direct means include passive
adsorption (non-covalent binding) or covalent binding between
the support and the reagent. By "indi.rect means" is meant that
an anti-reagent compound that interacts with a reagent is first
attached to the solid support. For ex:ample, it a polypeptide
reagent is used, an antibody that binds to it can serve as an
anti-reagent, provided that it binds t:o an epitope that is not
involved in the recognition of antibodies in biological samples.
Indirect means may also employ a ligar.~d-receptor system, for
example, where a molecule such as a vitamin is grafted onto the
polypeptide reagent and the corresponding receptor immobilized
on the solid phase. This is illustrated by the biotin-
streptavidin system. Alternatively, a peptide tail is added
chemically or by genetic engineering t;o the reagent and the
grafted or fused product immobilized by passive adsorption or
covalent linkage of the peptide tail.

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
Such diagnostic agents may be :included in a kit which
also comprises instructions for use. The reagent are labeled
with a detection means which allows fc~r the detection of the
reagent when it is bound to its target. The detection means may
5 be a fluorescent agent such as fluorescein isocyanate or
fluorescein isothiocyanate, or an enzyme such as horse radish
peroxidase or luciferase or alkaline phosphatase, or a
radioactive element such as lzsl or S1C~:.
Accordingly, a tenth aspect of the invention provides a
10 process for purifying, from a biological sample, a polypeptide
or polypeptide derivative of the invention, which involves
carrying out antibody-based affinity chromatography with the
biological sample, wherein the antibody is a monospecific
antibody of the invention.
15 For use in a purification procEsss of the invention, the
antibody is either polyclonal or monospecific, and preferably is
of the TgG type. Purified IgGs is prepared from an antiserum
using standard methods (see, e.g., Coligan et al., Current
Protocols in Immunology (1994) John Wiley & Sons, Inc., New
20 York, NY). Conventional chromatography supports, as well as
standard methods for grafting antibodies, are described in,
e.g., Antibodies: A Laboratory Manual, D. Lane, E. Harlow, Eds.
(2988) and outlined below.
Briefly, a biological sample, ouch as an C. pneumon.iae
25 extract preferably in a buffer solution, is applied to a
chromatography material, preferably eg~uilibrated with the buffer
used to dilute the biological sample s.o that the polypeptide or
polypeptide derivative of the invention (i.e., the antigen) is
allowed to adsorb onto the material. The chromatography
30 material, such as a gel ar a resin coupled to an antibody of the
invention, is in either a batch form or a column. The unbound
components are washed off and the antigen is then eluted with an
appropriate elution buffer, such as a glycine buffer or a buffer
containing a chaotropic agent, e.g., guanidine HCl, or high salt

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
46
concentration (e. g., 3 M MgCl2). Eluted fractions are recovered
and the presence of the antigen is detected, e.g., by measuring
the absorbance at 280 nm.
An eleventh aspect of the invention provides (i) a
composition of matter comprising a mon.ospecific antibody of the
invention, together with a diluent or carrier; (ii) a
pharmaceutical composition comprising a therapeutically or
prophylactically effective amount of a monospecific antibody of
the invention, and (iii) a method for treating or preventing a
Chlamydia (e.g., C. trachomatis, C. psittac.i, C. pneurnoniae or
C. pecoruin) infection, by administering a therapeutic or
prophylactic amount of a monospecific antibody of the invention
to an infected individual. Additionally, the eleventh aspect of
the invention encompasses the use of a monospecific antibody of
the invention in the preparation of a medicament for treating or
preventing Chlamydia infection.
The monospecific antibody is either polyclonal or
monoclonal, preferably of the IgA isotype (predominantly). In
passive immunization, the antibody is administered to a mucosal
surface of a mammal, e.g., the gastric: mucosa, e.g., orally or
intragastrically, advantageously, in the presence of a
bicarbonate buffer. Alternatively, systemic administration, not
requiring a bicarbonate buffer, is carried out. A monospecific
antibody of the invention is administered as a single active
component or as a mixture with at least one monospecific
antibody specific for a different Chla:mydia polypeptide. The
amount of antibody and the particular regimen used are readily
determined by one skilled in the art. for example, daily
administration of about 100 to 1,000 mg of antibodies over one
week, or three doses per day of about 100 to 1,000 mg of
antibodies over two or three days, are: effective regimens for
most purposes.
Therapeutic or prophylactic efficacy are evaluated using
standard methods in the art, e.g., by measuring induction of a

CA 02352759 2001-05-31
WO 00/32794 PCTlCA99/01147
47
mucosal immune response or induction of protective and/or
therapeutic immunity, using, e.g., the C. pneumoniae mouse
model. Those skilled in the art will readily recognize that the
C. pne~moniae strain of the model may be replaced with another
Chlamydia strain. Fox example, the efficacy of DNA molecules
and polypeptides from C. pneumoniae is preferably evaluated in a
mouse model using C. pneumoniae strain. Protection is
determined by comparing the degree of Ch.iamydia infection to
that of a control group. Protection is shown when infection is
reduced by comparison to the control group. Such an evaluation
is made for polynucleotides, vaccine vectors, polypeptides and
derivatives thereof, as well as antibodies of the invention.
Adjuvants useful in any of the vaccine compositions
described above are as follows.
Adjuvants for parenteral administration include aluminum
compounds, such as aluminum hydroxide, aluminum phosphate, and
aluminum hydroxy phosphate. The antigen is precipitated with,
or adsorbed onto, the aluminum compound according to standard
protocols. Other adjuvants, such as R.IBI (ImmunoChem, Hamilton,
MT), is used in parenteral administration.
Adjuvants for mucosal administ~cation include bacterial
toxins, e.g., the cholera toxin (CT), the E. coli heat-labile
toxin (LT), the Clostridium difficile toxin A and the pertussis
toxin (PT), or combinations, subunits, toxoids, or mutants
thereof such as a purified preparation of native cholera toxin
subunit B (CTB). Fragments, homologs, derivatives, and fusions
to any of these toxins are also suitable, provided that they
retain adjuvant activity. Preferably, a mutant having reduced
toxicity is used. Suitable mutants are described, e.g., in WO
95/17211 (Arg-?-Lys CT mutant), WO 96/0&627 (Arg-192-Gly LT
mutant), and WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant).
Additional LT mutants that are used in the methods and
compositions of the invention include, e.g., Ser-63-Lys, Ala-69-
Gly, Glu-110-Asp, and Glu-112-Asp mutants. Other adjuvants,

CA 02352759 2001-05-31
WO 00132794 PCTICA99101147
48 -
such as a bacterial monophosphoryl lipid A (MPLA) of, e.g., E.
coli, Salmonella minnesota, Salmonella typhimurium, or Shigella
flexneri; saponins, or polylactide glyc:olide (PLGA)
microspheres, is also be used in mucosa,l administration.
Adjuvants useful for both mucos.al and parenteral
administrations include polyphosphazene: (W0 95102415), DC-chol
(3 b-(N-(N',N'-dimethyl aminomethane)-c:arbamoyl) cholesterol;
U.S. Patent No. 5,283,185 and W0 96/14E331) and QS-21 (WO
88/09336).
Any pharmaceutical composition of the invention
containing a polynucleotide, a polypept:.ide, a polypeptide r
derivative, or an antibody of the invention, is manufactured in
a conventional manner. In particular, it is formulated with a
pharmaceutically acceptable diluent or carrier, e.g., water or a
saline solution such as phosphate buffer saline. In general, a
diluent or carrier is selected on the basis of the mode and
route of administration, and standard ~~harmaceutical practice.
Suitable pharmaceutical carriers or di:luents, as well as
pharmaceutical necessities for their u,se in pharmaceutical
formulations, are described in Remington's Pharmaceutical
Sciences, a standard reference text in this field and in the
USP/NF.
The invention also includes methods in which Chlamydia
infection are treated by oral administration of a Chlamydia
polypeptide of the invention and a mucasal adjuvant, in
combination with an antibiotic, an antacid, sucralfate, or a
combination thereof. Examples of such compounds that can be
administered with the vaccine antigen and the adjuvant are
antibiotics, including, e.g., macrolid.es, tetracyclines, and
derivatives thereof (specific examples of antibiotics that can
be used include azithromycin or doxicyclin or immunomodulators
such as cytokines or steroids). In addition, compounds
containing more than one of the above-listed components coupled
together, are used. The invention al~;o includes compositions

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
49
for carrying out these methods, i.e., compositions containing a
Chlamydia antigen (or antigens) of the invention, an adjuvant,
and one or more of the above-listed compounds, in a
pharmaceutically acceptable carrier or diluent.
Amounts of the above-listed compounds used in the methods
and compositions of the invention are :readily determined by one
skilled in the art. Treatment/immuniz.ation schedules are also
known and readily designed by one skilled in the art. For
example, the non-vaccine components can be administered on days
1-14, and the vaccine antigen + adjuvant can be administered on
days 7, 14, 21, and 28.

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
SEQUENCE LISTING
<110> Connaught Laboratories Limited
<120> Chlamydia antigens and corresponding DNA fragments and uses thereof
<130> 77813-2
<140>
<141>
<150> US 60/110,427
<150> US 60/110,438
<150> US 60/110,339
<150> US 60/110,428
<150> US 60/110,340
<151> December 1, 1998
<160> 16
<170> Patentln Ver. 2.0
<210> 1
<211> 2950
<212> DNA
<213> Chlamydia pneumoniae w
<220>
<221> CDS
<222> (101)..(2884)
<400> 1
gataaaaatt cttgacagct gttttgtcat ctttaacttg atttacttat tttgtttcta 60
tattgatgcg aatagttctc taaaaaacaa aagcattacc atg aag act tcg att 115
Met Lys Thr Ser I1e
1 5
cct tgg gtt tta gtt tcc tcc gtg tta get ttc tca tgt cac eta cag 163
Pro Trp Val Leu Val Ser Ser Val Leu Ala Phe Ser Cys His Leu Gln
25 20
tca cta get aac gag gaa ctt tta tca cct gat gat agc ttt aat gga 211
Ser Leu Ala Asn Glu Glu Leu Leu Ser Pro Asp Asp Ser Phe Asn Gly
25 30 35
aat atc gat tca gga acg ttt act cca aaa act tca. gcc aca aca tat 259
Asn Ile Asp Ser Gly Thr Phe Thr Pro Lys Thr Ser Ala Thr Thr Tyr
40 45 50
tct cta aca gga gat gtc ttc ttt tac gag cct gga aaa ggc act ccc 307
Ser Leu Thr Gly Asp Val Phe Phe Tyr Glu Pro Gly Lys Gly Thr Pro
55 60 6'.
tta tct gac agt tgt ttt aag caa acc acg gac aat; ctt acc ttc ttg 355
Leu Ser Asp Ser Cys Phe Lys Gln Thr Thr Asp Asn Leu Thr Phe Leu
70 75 80 85
ggg aac ggt cat agc tta acg ttt gge ttt ata gat: get ggc act cat 403
Gly Asn Gly His Ser Leu Thr Phe Gly Phe Ile Asp Ala Gly Thr His
90 95 100
1
SUBSTITUTE SHEET {E3UE.E 26)

CA 02352759 2001-05-31
WO 00/32794 PC'i'/CA99/01 i47
gcaggt getgetgca tctacaaca gcaaataag aat:cttace ttctca 451
AlaGly AlaAlaAla SerThrThr AlaAsnLys AsnLeuThr PheSer
105 110 115
gggttt tccttactg agttttgat tcctctcct agc:acaacg gttact 499
GlyPhe SerLeuLeu SerPheAsp SerSerPro SerThrThr ValThr
120 125 130
acaggt cagggaacg ctttcctca gcaggaggc gtaaattta gaaaat 547
ThrGly GlnGlyThr LeuSerSer AlaGl.yGly Va:CAsnLeu GluAsn
I35 140 14!i
attcgt aaaettgta gttgetggg aatttttct acl~gcagat ggtgga 595
IleArg LysLeuVal ValAlaGly AsnPheSer ThrAlaAsp GlyGly
150 155 160 165
getatc aaaggagcg tctttcett ttaactggc acttctgga gatget 643
AlaIle LysGlyAla SerPheLeu LeuThrGly Th:rSerGly AspAla
170 175 180
cttttt agtaacaac tettcatca acaaaggga ggagcaatt getact 691
LeuPhe SerAsnAsn SerSerSer ThrLysGly GlyAlaTle AlaThr
185 190 195
acagca ggcgetcge atagcaaat aacacaggt tatgttaga ttccta 739
ThrAla GlyAlaArg IleAlaAsn AsnThrGly Ty:rValArg PheLeu
200 205 210
tetaac atagcgtct acgtcagga ggcgetatc gatgatgaa ggcacg 787
SerAsn IleAlaSex ThrSerGly GlyAlaIle AspAspGlu GlyThr
215 220 22.5
tcgata ctatcgaac aacaaattt ctatatttt ga,agggaat gcagcg 835
SerIle LeuSerAsn AsnLysPhe LeuTyrPhe GluGlyAsn AlaAla
230 235 240 245
aaaact actggcggt gcgatctgc aacaccaag gcgagtgga tctcct 883
LysThr ThrGlyGly AlaIleCys AsnThrLys AlaSerGly SerPro
250 255 260
gaactg ataatctct aacaataag actctgatc tttgettca aacgta 931
GluLeu IleIleSer AsnAsnLys ThrLeuIle PheAlaSer AsnVal
265 270 275
gcagaa acaagcggt ggcgccatc catgetaaa aagctagcc ctttcc 979
AlaGlu ThrSerGly GlyAlaIle HisAlaLys LysLeuAla LeuSer
280 285 290
tctgga ggctttaca gagtttcta cgaaataat gtctcatca gcaact 1027
SerG3.yGlyPheThr GluPheLeu ArgAsnAsn ValSerSer AlaThr
295 300 305
cctaag gggggtget atcagcatc gatgcctca ggagagctc agtctt 1075
ProLys GlyGlyAla IleSerIle AspAlaSer GlyGluLeu SexLeu
310 315 320 325
2
S~J6STtTUTE SHEE3 f;RULE 26)

CA 02352759 2001-05-31
WO 00132794 PCTICA99101147
tCtgcagagaca gga.aacatt acctttgta agaaatacc cttacaaca 1123
SerAlaGluThr GlyAsnIle ThrPheVal ArgAsnThr LeuThrThr
330 335 340
accggaagtacc gatactcct aaacgtaat gcgatcaac ataggaagt 1171
ThrGlySexThr AspThrPro LysArgAsn AlaIleAsn IleGlySer
345 350 355
aaegggaaattc acggaatta egggetget aaaaatcat acaattttc 1219
AsnGlyLysPhe ThrGluLeu ArgAlaAla LysAsnHis ThrIlePhe
360 365 370
ttctatgatccc atcacttca gaaggaacc tcatcagac gtattgaag 1267
PheTyrAspPro IleThrSer GluGlyThr SerSerAsp ValLeuLys
375 380 385
ataaataacggc tctgcggga getctcaat ccatatcaa ggaacgatt 1315
IleAsnAsnG1y SerAlaGly AlaLeuAsn ProTyrGIn GlyThrIle
390 395 400 405
ctattttctgga gaaacceta acagcagat gaacttaaa gttgetgac 1363
LeuPheSerGly GluThrLeu ThrAlaAsp GluLeuLys ValAlaAsp
410 415 420
aatttaaaatct tcattcacg cagccagtc tccctatcc ggaggaaag 1411
AsnLeuLysSer SerPheThr GlnProVal SerLeuSer GlyGlyLys
425 430 435
ttattgctacaa aagggagtc actttagag agcacgagc ttctctcaa 1459
LeuLeuLeuGln LysGlyVal ThrLeuGlu SerThrSer PheSerGln
440 445 450
gaggccggttct ctcctcggc atggattca ggaacgaca ttatcaact 1.507
G1uAlaGlySer LeuLeuGly MetAspSer GlyThrThr LeuSerThr
455 460 465
aeagetgggagt attacaatc acgaaccta ggaatcaat gttgactcc 1555
ThrAlaGlySer IleThrIle ThrAsnLeu GlyIleAsn ValAspSer
470 975 480 485
ttaggtcttaag cagcccgtc agcctaaca gcaaaaggt gettcaaat 1603
LeuGlyLeuLys GlnProVal SerLeuThr AlaLysGly AlaSerAsn
490 495 500
aaagtgatcgta tctgggaag ctcaacctg attgatatt gaagggaac 1651
LysValIleVal SerGlyLys LeuAsnLeu IleAspIle GluGlyAsn
505 510 515
atttatgaaagt catatgttc agccatgac cagctc.ttc tctctatta 1699
IleTyrGluSer HisMetPhe SerHisAsp GlnLeuPhe SerLeuLeu
520 525 530
aaaatcacggtt gatgetgat gttgatact aacgttgac atcagcagc 1747
LysIleThrVal AspAlaAsp ValAspThr AsnValAsp IleSerSer
535 540 545
3
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00132794 PCT/CA99/01147
cttatccct gttcctget gaggatcct aattcagaa tacggattc caa 1795
LeuIlePro ValProA1a GluAspPro AsnSerGlu.TyrGlyPhe Gln
550 555 560 565
ggacaatgg aatgttaat tggactacg gatacagct.acaaataca aaa 1843
GlyGlnTrp AsnValAsn TrpThrThr AspThrAla.ThrAsnThr Lys
570 575 580
gaggccacg gcaacttgg accaaaaca ggatttgtt.cccagc~cccgaa 1891
GluAlaThr AlaThrTrp ThrLysThr GlyPheVal,ProSerPro Glu
585 590 595
agaaaatct gcgttagta tgcaatacc ctatgggga~gtctttact gac 1939
ArgLysSer AlaLeuVal CysAsnThr LeuTrpGly ValPheThr Asp
600 605 610
attcgctct ctgcaacag cttgtagag atcggcgca actggtatg gaa 1987
IleArgSer LeuGlnGln LeuValGlu IleGlyAla ThrGlyMet Glu
615 620 62_'.
cacaaacaa ggtttctgg gtttcctcc atgacgaac:ttcctgcat aag 2035
HisLysGln GlyPheTrp ValSerSer MetThrAsn PheLeuHis Lys
630 635 640 695
actggagat gaaaatcgc aaaggcttc cgtcatacc:tctggaggc tac 2083
ThrGlyAsp GluAsnArg LysGlyPhe ArgHisThx:SerGlyGly Tyr
650 655 660
gtcatcggt ggaagtget cacactcet aaagacgac:ctatttacc ttt 2131
ValIleGly GlySerAla HisThrPro LysAspAsp LeuPheThr Phe
665 670 675
gegttetgc catctcttt getagagac aaagattgt:tttatcget cac 2179
AlaPheCys HisLeuPhe AlaArgAsp LysAspCys PheIleAla His
684 685 690
aacaactct agaacctac ggtggaact ttattcttc:aagcactct cat 2227
AsnAsnSex ArgThrTyr GlyGlyThr LeuPhePhe:LysHisSer His
695 700 705
accctacaa ccccaaaac tatttgaga ttaggaaga gcaaagttt tct 2275
ThrLeuGln ProGlnAsn TyrLeuArg LeuGlyArg AlaLysPhe Ser
710 715 72 0 725
gaatcaget atagaaaaa ttcectagg gaaattcc<:ctagccttg gat 2323
GluSerAla IleGluLys PheProArg GluIlePro LeuAlaLeu Asp
730 735 740
gtccaagtt tcgttcagc cattcagac aaccgt:atc~gaaacgcac tat 2371
ValGlnVa1 SerPheSer HisSerAsp AsnArgMet GluThrHis Tyr
745 750 755
acctcattg ccagaatcc gaaggttct tggagcaac gagtgtata get 2419
ThrSerLeu ProGluSer GluGlySer TrpSerAsn GluCysIle Ala
760 765 770
4
SUBSTITUTE SHEET (I~UI.E 26~

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
ggt ggt atc ggc cta.gac ctt cct ttt gtt ctt tcc aac cca cat cct 2467
Gly Gly Ile Gly Leu Asp Leu Pro Phe Val Leu Ser Asn Pro His Pro
775 780 785
ctt ttc aag .acc ttc att cca cag atg aaa gtc gaa. atg gtt tat gta 2515
Leu Phe Lys Thr Phe Ile Pro Gln Met Lys Val Glu. Met Val Tyr Val
790 795 800 805
tca caa aat agc ttc ttc gaa agc tct agt gat ggc: cgt ggt ttt agt 2563
Ser Gln Asn Ser Phe Phe Glu Ser Ser Ser Asp Gly Arg Gly Phe Ser
810 815 820
att gga agg ctg ctt aac ctc tcg att cct gtg ggt: gcg aaa ttc gtg 2611
Ile Gly Arg Leu Leu Asn Leu Ser Ile Pro Val Gly Ala Lys Phe Val
825 830 835
cag ggg gat atc gga gat tcc tac acc tat gat ctc: tca gga ttc ttt 2659
Gln Gly Asp Ile G1y Asp Ser Tyr Thr Tyr Asp Leu Ser Gly Phe Phe
840 845 850
gtt tcc gat gtc tat cgt aac aat ccc caa tct aca gcg act ctt gtg 2707
Val Ser Asp Val Tyr Arg Asn Asn Pro G1n Ser Thr Ala Thr Leu Val
855 860 865
atg agc cca gac tct tgg aaa att cgc ggt ggc aat: ctt tca aga cag 2755
Met Ser Pro Asp Ser Trp Lys Ile Arg Gly Gly Asrc Leu Ser Arg Gln
870 875 880 885
gca ttt tta ctg agg ggt agc aac aac tac gtc tac; aac tcc aat tgt 2803
Ala Phe Leu Leu Arg Gly Ser Asn Asn Tyr Val Tyr Asn Ser Asn Cys
890 895 900
gag cte tte gga cat tac get atg gaa ctc cgt gga tct tca agg aac 2851
Glu Leu Phe Gly His Tyr Ala Met G1u Leu Arg Gly Ser Ser Arg Asn
905 910 915
tac aat gta gat gtt ggt acc aaa ctc cga ttc tagattgcta aaactcccta 2904
Tyr Asn Val Asp Val Gly Thr Lys Leu Arg Phe
920 925
gttcttctag ggagttttct catactttta gggaaatatt tgcaat 2950
<210> 2
<211> 2784
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> CDS
<222> (I)..(2784)
<400> 2
atgaagactt cgattccttg ggttttagtt tcctccgtgt tagctttctc atgtcaccta 60
cagtcactag ctaacgagga acttttatca cctgatgata gct~ttaatgg aaatatcgat 120
tcaggaacgt ttactccaaa aacttcagcc acaacatatt ctctaacagg agatgtcttc 180
SUBSTITUTE SHEET (IRULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
ttttacgagc ctggaaaagg cactccctta tctgacagtt gttt_taagca aaccacggac 240
aatcttacct tcttggggaa cggtcatagc ttaacgtttg gctttataga tgctggcact 300
catgcaggtg ctgctgcatc tacaacagca aataagaatc ttaccttctc agggttttcc 360
ttactgagtt ttgattcctc tcctagcaca acggttacta caggtcaggg aacgctttcc 420
tcagcaggag gcgtaaattt agaaaatatt cgtaaacttg tags~tgctgg gaatttttca 480
ctgcagatgg tggagctatc aaaggagcgt ctttccttta actggcactt ctggagatgc 540
tctttttagt aacaactctt catcaacaaa gggaggagca attgctacta cagcaggcgc 600
tcgcatagca aataacacag gttatgttag attcctatct aacatagcgt ctacgtcagg 660
aggcgctatc gatgatgaag gcacgtcgat actatcgaac aac;~aatttc tatattttga 720
agggaatgca gcgaaaacta ctggcggtgc gatctgcaac accaaggcga gtggatctcc 780
tgaactgata atctctaaca ataagactct gatctttgct tcaaacgtag cagaaacaag 890
cggtggcgcc atccatgcta aaaagctagc cctttcctct ggaggcttta cagagtttct 900
acgaaataat gtctcatcag caactcctaa ggggggtgct atcagcatcg atgcctcagg 960
agagctcagt ctttctgcag agacaggaaa cattaccttt gta;~gaaata cccttacaac 1020
aaccggaagt accgatactc ctaaacgtaa tgcgatcaac ataggaagta acgggaaatt 1080
cacggaatta cgggctgcta aaaatcatac aattttcttc tatgatccca tcacttcaga 1140
aggaacctca tcagacgtat tgaagataaa taacggctct gcgggagctc tcaatccata 1200
tcaaggaacg attctatttt ctggagaaac cctaacagca gatgaactta aagttgctga 1260
caatttaaaa tcttcattca cgcagccagt ctccctatcc ggaggaaagt tattgctaca 1320
aaagggagtc actttagaga gcacgagctt ctctcaagag gccggttctc tcctcggcat 1380
ggattcagga acgacattat caactacagc tgggagtatt acaatcacga acctaggaat 1440
caatgttgac tccttaggtc ttaagcagcc cgtcagccta acagcaaaag gtgcttcaaa 1500
taaagtgatc gtatctggga agctcaacct gattgatatt gaagggaaca tttatgaaag 1560
tcatatgttc agccatgacc agctcttctc tctattaaaa atc~acggttg atgctgatgt 1620
tgatactaac gttgacatca gcagccttat ccctgttcct gctgaggatc ctaattcaga 1680
atacggattc caaggacaat ggaatgttaa ttggactacg gat~acagcta caaatacaaa 1740
agaggccacg gcaacttgga ccaaaacagg atttgttccc agc-cccgaaa gaaaatctgc 1800
gttagtatgc aataccctat ggggagtctt tactgacatt cgct ctctgc aacagcttgt 1860
agagatcggc gcaactggta tggaacacaa acaaggtttc tgggtttcct ccatgacgaa 1920
cttcctgcat aagactggag atgaaaatcg caaaggcttc cgtcatacct ctggaggcta 1980
cgtcatcggt ggaagtgctc acactcctaa agacgaccta ttt.acctttg cgttctgcca 2040
tctctttgct agagacaaag attgttttat atcgctcaca aca.actctag aacctacggt 2100
ggaactttat tcttcaagca ctctcatacc ctacaacccc aaaactattt gagattagga 2160
agagcaaagt tttctgaatc agctatagaa aaattcccta gggaaattcc cctagccttg 2220
gatgtccaag tttcgttcag ccattcagac aaccgtatgg aaacgcacta tacctcattg 2280
ccagaatccg aaggttcttg gagcaacgag tgtatagctg gtggtatcgg cctagacctt 2340
ccttttgttc tttccaaccc acatcctctt ttcaagacct tcattccaca gatgaaagtc 2400
gaaatggttt atgtatcaca aaatagcttc ttcgaaagct ctagtgatgg ccgtggtttt 2460
agtattggaa ggctgcttaa cctctcgatt cctgtgggtg cgaaattcgt gcagggggat 2520
atcggagatt cctacaccta tgatctctca ggattctttg tttccgatgt ctatcgtaac 2580
aatccccaat ctacagcgac tcttgtgatg agcccagact cttggaaaat tcgcggtggc 2640
aatctttcaa gacaggcatt tttactgagg ggtagcaaca actacgtcta caactccaat 2700
tgtgagctct tcggacatta cgctatggaa ctccgtggat cttcaaggaa ctacaatgta 2760
gatgttggta ccaaactccg attc 2?84
<210> 3
<211> 2950
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> CDS
<222> (101)..(2884)
<400> 3
6
SUBSTITUTE SHEET (FiULE 26)

i~
CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
agttaaagat gacaaaacag ctgtcaagaa tttttatctt gact ctctga gttttctatt 60
ttatatgacg caagtaagaa tttaataata aagtgggttt atg aaa tcg caa ttt 115
Met Lys Ser Gln Phe
1 5
tcc tgg tta gtg ctc tct tcg aca ttg gca tgt ttt act agt tgt tcc 7.63
Ser Trp Leu Val Leu Ser Ser Thr Leu Ala Cys Phe Thr Ser Cys Ser
15 20
act gtt ttt get gca act get gaa aat ata gge ccc tct gat age ttt 211
Thr Val Phe Ala Ala Thr Ala Glu Asn Ile Gly Pro Ser Asp Ser Phe
25 30 35
gac gga agt act aac aca ggc acc tat act cct aaa aat acg act act 259
Asp Gly Ser Thr Asn Thr Gly Thr Tyr Thr Pro Lys Asn Thr Thr Thr
40 45 50
gga ata gac tat act ctg aca gga gat ata act ctg caa aac ctt ggg 307
Gly Ile Asp Tyr Thr Leu Thr Gly Asp Tle Thr Leu Gln Asn Leu Gly
55 60 65
gat tcg gca get tta acg aag ggt tgt ttt tct gac act acg gaa tct 355
Asp Ser Ala Ala Leu Thr Lys Gly Cys Phe Ser Asp Thr Thr Glu Ser
70 75 80 85
tta agc ttt gcc ggt aag ggg tac tca ctt tct ttt tta aat att aag 903
Leu Ser Phe Ala Gly Lys G1y Tyr Ser Leu Ser Phe Leu Asn Ile Lys
90 95 100
tct agt get gaa ggc gca gcc ctt tct gtt aca act gat aaa aat ctg 451
Ser Ser Ala Glu Gly Ala Ala Leu Ser Val Thr Thr Asp Lys Asn Leu
105 110 115
tcg cta aca gga ttt tcg agt ctt act ttc tta gcg gcc cca tca tcg 499
Sex Leu Thr Gly Phe Ser Ser Leu Thr Phe Leu Ala Ala Pro Ser Ser
120 125 130
gta atc aca acc ccc tca gga aaa ggt gca gtt aaa tgt gga ggg gat 54?
Val Ile Thr Thr Pro Ser Gly Lys Gly Ala Val Lys Cys Gly Gly Asp
135 140 145
ctt aca ttt gat aac aat gga act att tta ttt aaa caa gat tac tgt 595
Leu Thr Phe Asp Asn Asn Gly Thr Ile Leu Phe Lys Gln Asp Tyr Cys
150 155 160 265
gag gaa aat ggc gga gcc att tct acc aag aat ctt tct ttg aaa aac 643
Glu Glu Asn Gly Gly Ala Ile Ser Thr Lys Asn Leu Ser Leu Lys Asn
170 175 180
agc acg gga tcg att tct ttt gaa ggg aat aaa tcg agc gca aca ggg 691
Ser Thr Gly Ser Ile Ser Phe Glu Gly Asn Lys Ser Ser Ala Thr Gly
185 190 195
aaa aaa ggt ggg get att tgt get act ggt act gta gat att aca aat 739
Lys Lys Gly Gly Ala Ile Cys Ala Thr Gly Thr Val Asp Ile Thr Asn
200 205 210
7
SUBSTITUTE SHEET (F~IULE 2fi)

CA 02352759 2001-05-31
WO 00132794 PCTlCA99/01147
aat acg get cct acc ctc ttc tcg aac aat att get gaa get gca ggt 787
Asn Thr Ala Pro Thr Leu Phe Ser Asn Asn Ile Ala Glu Ala Ala Gly
215 220 225
gga get ata aat agc aca gga aac tgt aca att aca ggg aat aeg tct 835
Gly AIa Ile Asn Ser Thr Gly Asn Cys Thr Iie Thr Gly Asn Thr Ser
230 235 240 245
ctt gta ttt tct gaa aat agt gtg aca gcg acc qca gga aat gga gga 883
Leu Val Phe Ser Glu Asn Ser Val Thr Ala Thr Ala Gly Asn Gly Gly
250 255 260
get ctt tct gga gat gcc gat gtt acc ata tct ggg aat eag agt gta 931
Ala Leu Ser Gly Asp Ala Asp Val Thr Ile Ser Gly Asn Gln Ser Val
265 270 275
act tte tca gga aac caa get gta get aat ggc gga gcc att tat get 979
Thr Phe Ser Gly Asn Gln AIa Val Ala Asn Gly Gly Ala Ile Tyr Ala
280 285 290
aag aag ctt aca ctg get tcc ggg ggg ggg ggg ggg aat ccc ttt tct 102?
Lys Lys Leu Thr Leu Ala Ser Gly Gly Gly Gly Gly Asn Pro Phe Ser
295 300 305
aac aat ata gtc caa ggt acc act gca ggt aat ggt gga gcc att tct 1075
Asn Asn Ile Val Gln Gly Thr Thr Ala Gly Asn GIy Gly Ala Ile Ser
310 315 320 325
ata ctg gca get gga gag tgt agt ctt ttc agc gaa gca ggg gac cat 1123
Ile Leu Ala Ala Gly Glu Cys Ser Leu Phe Ser Glu Ala Gly Asp His
330 335 340
tac ctt aat ggg aat gcc att gtt gca act aca cca caa act aca aaa 1171
Tyr Leu Asn Gly Asn AIa Ile Val Ala Thr Thr Pro Gln Thr Thr Lys
345 350 355
aga aat tct att gac ata gga tct act ggc aaa gat cac gaa tta cgt 1219
Arg Asn Ser Ile Asp Ile Gly Ser Thr Gly Lys Asp His Glu Leu Arg
360 365 370
geaata tctgggcat agcatcttt ttctacgat ccgattact getaat 1267
AlaIle SerGlyHis SerIlePhe PheTyrAsp ProIleThr AlaAsn
375 380 385
aegget gcggattct acagatact ttaaatctc aataagget gatgca 1315
ThrAla AIaAspSer ThrAspThr LeuAsnLeu AsnLysAla AspRla
390 395 400 405
ggtaat agtacagat tatagtggg tcgattgtt ttttct-ggtgaaaag 1363
GlyAsn SerThrAsp TyrSerGly SerIleVal PheSerGly GIuLys
410 415 420
ctctct gaagatgaa gcaaaagtt gcagacaac ctcacttct acgctg 1411
LeuSer GluAspGlu AlaLysVal AlaAspAsn LeuThrSer ThrLeu
425 430 435
8
SUBSTITUTE SHEET (RULE 26j

CA 02352759 2001-05-31
WO OUi32794 PCT/CA99/01147
aagcagcct gtaactcta actgcagga aatttagta,cttaaacgt ggt 1459
LysGlnPro ValThrLeu ThrAlaGly AsnLeuVal LeuLysArg Gly
490 445 450
gtcactctc gatacgaaa ggctttact cagaccgcc~ggttcctct gtt 1507
ValThrLeu AspThrLys GlyPheThr GlnThrAla.GlySerSer Val
455 4 4
60 65
attatggat gcgggcaca acgttaaaa gcaagtaca~gaggaggtc act 1555
IleMetAsp AlaGlyThr ThrLeuLys AlaSerThr GluGluVal Thr
470 475 480 485
ttaacaggt ctttccatt cctgtagac tctttaggc;gagggtaag aaa 1603
LeuThrGly LeuSerIle ProValAsp SerLeuGly GluGlyLys Lys
490 495 500
gttgtaatt getgettct gcagcaagt ~aaaaatgta gcccttagt ggt 1651
ValValIle AlaAlaSer AlaAlaSer LysAsnVat.AlaLeuSer Gly
505 510 515
ccgattctt cttttggat aaccaaggg aatgct.tat:gaaaatcac gac 1699
ProIleLeu LeuLeuAsp AsnGlnG1y AsnAlaTyr GluAsnHis Asp
520 525 530
ttaggaaaa actcaagac ttttcattt gtgcagctc;tctgetctg ggt 1747
LeuGlyLys ThrGlnAsp PheSerPhe ValGlnLetsSerAlaLeu Gly
535 540 54i
actgcaaca actacagat gttccagcg gttcctaca gtagcaact cct 1795
ThrAlaThr ThrThrAsp ValProAla ValProThx-ValAlaThr Pro
550 555 560 565
acgcactat gggtatcaa ggtacttgg ggaatgact:tgggttgat gat 1843
ThrHisTyr GlyTyrGln GlyThrTrp GlyMetThx-TrpValAsp Asp
570 575 580
accgcaagc actccaaag actaagaca gcgacatta gettggacc aat 1891
ThrAlaSer ThrProLys ThrLysThr AlaThrLeesAlaTrpThr Asn
585 590 595
acaggctac cttccgaat cctgagcgt caaggacct;ttagttcct aat 1939
ThrGlyTyr LeuProAsn ProGluArg GlnGlyPrc>LeuValPro Asn
600 605 610
agcctttgg ggatctttt tcagacatc caagcgatt;caaggtgtc ata 1987
SerLeuTrp GlySerPhe SerAspIle GlnAlaIlE:GlnGlyVal Ile
615 620 625
gagagaagt getttgact ctttgttea gatcgaggc:ttctggget gcg 2035
GluArgSer AlaLeuThr LeuCysSer AspArgGly PheTrpAla Ala
630 635 640 695
ggagtcgcc aatttctta gataaagat aagaaaggg gaaaaacgc aaa 2083
GlyValAla AsnPheLeu AspLysAsp LysLysGly GluLysArg Lys
650 655 660
9
SUHSTfTUTE SHEET (f~ULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
taccgtcat aaatct ggtggatatget atcggaggt:gcagcgcaa act 2131
TyrArgHis LysSer GlyGlyTyrAla IleGlyGly AlaAlaGln Thr
665 670 675
tgttctgaa aactta attagctttgcc ttttgccaa ctctttggt agc 2179
CysSerG1u AsnLeu IleSerPheAla PheCysGln LeuPheGly Ser
sso s85 690
gataaagat ttctta gtcgetaaaaat catactgat:acctatgca gga 2227
AspLysAsp PheLeu ValAlaLysAsn HisThrAsp ThrTyrAla G1y
695 700 70Fi
gccttctat atccaa cacattacagaa tgtagtggcfttcataggt tgt 2275
AlaPheTyr IleGln HisIleThrGlu CysSerGly PheIleGly Cys
710 715 720 725
ctcttagat aaactt cctggctcttgg ~agtcataaa cccctcgtt tta 2323
LeuLeuAsp LysLeu ProGlySerTrp SerHisLy:>ProLeuVal Leu
730 735 740
gaagggcag ctcget tatagccacgtc agtaatgat:ctgaagaca aag 2371
GluGlyGin LeuAla TyrSerHisVal SerAsnAsp LeuLysThr Lys
745 750 755
tatactgcg tatcct gaggtgaaaggt tcttggggg aataatget ttt 2419
TyrThrAla TyrPro GluVaILysGly SerTrpGlSrAsnAsnAla Phe
760 765 770
aacatgatg ttggga gettcttctcat tcttatcct:gaatacctg cat 2467
AsnMetMet LeuGly AlaSerSerHis SerTyrPro GluTyrLeu His
775 780 78.i
tgttttgat acctat getccatacatc aaactgaai~ctgacctat ata 2515
CysPheAsp ThrTyr AlaProTyrIle LysLeuAsn LeuThrTyr Ile
790 795 800 805
cgtcaggac agcttc tcggagaaaggt acagaaggz~agatctttt gat 2563
ArgGlnAsp SerPhe SerGluLysGly ThrGluGly ArgSerPhe Asp
y
810 815 820
gacagcaac ctcttc aatttatctttg cctataggg gtgaagttt gag 2611
AspSerAsn LeuPhe AsnLeuSerLeu ProIleGly ValLysPhe Glu
825 830 835
aagttctct gattgt aatgacttttct tatgatctg actttatcc tat 2659
LysPheSex AspCys AsnAspPheSer TyrAspLeu ThrLeuSer Tyr
840 845 850
gttcetgat cttatc cgcaatgatccc aaatgcaci:acagcactt gta 2707
ValProAsp LeuIle ArgAsnAspPro LysCysThe:ThrAlaLeu Val
855 860 86!i
atcagcgga gcctct tgggaaacttat gccaataac ttagcacga cag 2755
IleSerGly AlaSer TrpGluThrTyr AlaAsnAsn LeuAlaArg Gln
870 875 880 885
SUBSTITUTE SHEET (IRULE 2S)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
gcc ttg caa gtg cgt gca ggc agt cac tae gcc tt.c tct cct at g ttt 2803
Ala Leu Gln Val Arg Ala Gly Ser His Tyr Ala Phe Ser Pro Met Phe
gg0 895 900
gaa gtg ctc.ggc cag ttt gtc ttt gaa gtt cgt gc~a tcc tca cgg att 2851
Glu Val Leu Gly Gln Phe Val Phe Glu Val Arg GLy Ser Ser Arg Ile
905 910 915
tat aat gta gat ctt ggg ggt aag ttc caa ttc taggagcgtc tctcatgtct 2904
Tyr Asn Val Asp Leu Gly Gly Lys Phe Gln Phe
920 925
cagaaattct gagagagatc gcatttagga ttttcttaaa cacgac 2950
<210>4
<211>2950
<212>DI3A
<213>Chlamydiapneumoniae
<220>
<221>CDS
<222>(101)..(2784)
<400>4
atgaaatcgc aattttcctg gttagtgctc tcttcgacat tggcatgttt tactagttgt 60
tccactgttt ttgctgcaac tgctgaaaat ataggcccct ct:gatagctt tgacggaagt 120
actaacacag gcacctatac tcctaaaaat acgactactg gaatagacta tactctgaca 180
ggagatataa ctctgcaaaa ccttggggat tcggcagctt taacgaaggg ttgtttttct 240
gacactacgg aatctttaag ctttgccggt aaggggtact cactttcttt tttaaatatt 300
aagtctagtg ctgaaggcgc agccctttct gttacaactg ai:aaaaatct gtcgctaaca 360
ggattttcga gtcttacttt cttagcggcc ccatcatcgg t<3atcacaac cccctcagga 420
aaaggtgcag ttaaatgtgg aggggatctt acatttgata acaatggaac tattttattt 480
aaacaagatt actgtgagga aaatggcgga gccatttcta ccaagaatct ttctttgaaa 540
aacagcacgg gatcgatttc ttttgaaggg aataaatcga g~~gcaacagg gaaaaaaggt 600
ggggctattt gtgctactgg tactgtagat attacaaata atacggctcc taccctcttc 660
tcgaacaata ttgctgaagc tgcaggtgga gctataaata gc~acaggaaa ctgtacaatt 720
acagggaata cgtctcttgt attttctgaa aatagtgtga cagcgaccgc aggaaatgga 780
ggagctcttt ctggagatgc cgatgttacc atatctggga at=cagagtgt aactttctca 840
ggaaaccaag ctgtagctaa tggcggagcc atttatgcta agaagcttac actggcttcc 900
gggggggggg gggggaatcc cttttctaac aatatagtcc aaggtaccac tgcaggtaat 960
ggtggagcca tttctatact ggcagctgga gagtgtagtc t1=ttcagcga agcaggggac 1020
cattacctta atgggaatgc cattgttgca actacaccac aaactacaaa aagaaattca 1080
ttgacatagg atctactggc aaagatcacg attacgtgca atatctgggc atagcatctt 1190
tttctacgat ccgattactg ctaatacggc tgcggattct acagatactt taaatctcaa 1200
taaggctgat gcaggtaata gtacagatta tagtgggtcg attgtttttt ctggtgaaaa 1260
gctctctgaa gatgaagcaa aagttgcaga caacctcact tctacgctga agcagcctgt 1320
aactctaact gcaggaaatt tagtacttaa acgtggtgtc actctcgata cgaaaggctt 1380
tactcagacc gcgggttcct ctgttattat ggatgcgggc acaacgttaa aagcaagtac 1440
agaggaggtc actttaacag gtctttccat tcctgtagac tctttaggcg agggtaagaa 1500
agttgtaatt gctgcttctg cagcaagtaa aaatgtagcc cttagtggtc cgattcttct 1560
tttggataac caagggaatg cttatgaaaa tcacgactta ggaaaaactc aagacttttc 1620
atttgtgcag ctctctgctc tgggtactgc aacaactaca gatgttccag cggttcctac 1680
agtagcaact cctacgcact atgggtatca aggtacttgg ggaatgactt gggttgatga 1740
taccgcaagc actccaaaga ctaagacagc gacattagct tggaccaatc aggctacctt 1800
ccgaatcctg agcgtcaagg acctttagtt cctaatagcc tttggggatc tttttcagac 1860
11
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
atccaagcga ttcaaggt.gt catagagaga agtgctttga ct~~tttgttc agatcgaggc 1910
ttctgggctg cgggagtcgc caatttctta gataaagata ag,aaagggga aaaacgcaaa 1980
taccgtcata aatctggtgg atatgctatc ggaggtgcag cgcaaacttg ttctgaaaac 2040
ttaattagct ttgccttttg ccaactcttt ggtagcgata aagatttctt agtcgctaaa 2100
aatcatactg atacctatgc aggagccttc tatatccaac ac~attacaga atgtagtggg 2160
ttcataggtt gtctcttaga taaacttcct ggctcttgga gt~~ataaacc cctcgtttta 2220
gaagggcagc tcgcttatag ccacgtcagt aatgatctga ag,acaaagta tactgcgtat 2280
cctgaggtga aaggttcttg ggggaataat gcttttaaca tgatgttggg agcttcttct 2340
cattcttatc ctgaatacct gcattgtttt gatacctatg ct~ccatacat caaactgaat 2400
ctgacctata tacgtcagga cagcttctcg gagaaagtac ag,aaggaaga tcttttgatg 2460
acagcaacct cttcaattta tctttgccta taggggtgaa gtttgagaag ttctctgatt 2520
gtaatgactt ttcttatgat ctgactttat cctatgttcc tg,atcttatc cgcaatgatc 2580
ccaaatgcac tacagcactt gtaatcagcg gagcccactt cttgggaaac ttatgccaat 2640
aacttagcac gacaggcctt gcaagtgcgt gcaggcagtc actacgcctt ctctcctatg 2700
tttgaagtgc tcggccagtt tgtctttgaa gttcgtggat cctcacggat ttataatgta 2760
gatcttgggg gtaagttcca attc . 2784
<210> 5
<211> 2950
<212> DI3A
<213> Chlamyclia pneumoniae
<220>
<221> CDS
<222> (101)..(2884)
<400> 5
tgtagattct taacttacta gtctctcctt tcctcttgct ttctttaatt tattgcagta 60
tgtggtgaaa taatttgtta aaccacctat agccctctac atg aaa tcc tct ctt 115
Met Lys Ser Ser Leu
1 5
cat tgg ttt tta atc tcg tca tct tta gca ctt ccc ttg tca cta aat 163
His Trp Phe Leu Ile Ser Ser Ser Leu A1a Leu Pro Leu Ser Leu Asn
20 15 20
ttc tct gcg ttt get get gtt gtt gaa atc aat cta gga cct acc aat 2II
Phe Ser Ala Phe Ala Ala Val Val Glu Ile Asn Leu Gly Pro Thr Asn
25 30 35
agc ttc tct gga cca gga acc tac act cct cca gcc caa aca aca aat 259
Ser Phe Ser Gly Pro Gly Thr Tyr Thr Pro Pro Ala Gln Thr Thr Asn
40 45 50
gca gat gga act atc tat aat cta aca ggg gat gtc tca atc acc aat 307
Ala Asp Gly Thr Ile Tyr Asn Leu Thr Gly Asp Val Ser Ile Thr Asn
55 60 65
gca gga tct ccg aca get cta acc get tcc tgc ttt aaa gaa act act 355
Ala Gly Ser Pro Thr Ala Leu Thr Ala Ser Cys Phe Lys Glu Thr Thr
70 75 80 85
12
SUBSTITUTE SHEET (;RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
gggaat ctttct ttccaaggc cacggctaccaa tttctccta caaaat 903
GlyAsn LeuSer PheGlnGly HisGlyTyrGln Ph~LeuLeu GlnAsn
90 95 ~ 100
atcgat gcggga gcgaactgt acctttaccaat ac,sgetgca aataag 451
IIeAsp AlaGly AlaAsnCys ThrPheThrAsn Th:rAlaAla AsnLys
105 110 115
cttctc tccttt tcaggattc tcctatttgtca ctaatacaa accacg 999
LeuLeu SerPhe SerGlyPhe SerTyrLeuSer LevIleG1n ThrThr
120 125 130
aatget accaca ggaacagga gccatcaagtcc ac.aggaget tgttct 597
AsnAla ThrThr GlyThrGly AlaIleLysSer ThrGlyAla CysSer
135 140 145
attcag tcgaac tatagttgc tacttt.ggccaa aacttttct aatgac 595
IleGln SerAsn TyrSerCys TyrPheGlyGln AssnPheSer AsnAsp
150 155 160 i65
aatgga ggcgcc ctccaaggc agctctatcagt ctatcgcta aacccc 643
AsnGly GlyAla LeuGlnGly SerSerIleSer LeuSerLeu AsnPro
170 175 180
aaccta acgttt gccaaaaac aaagcaacgcaa aaagggggt gccctc 691
AsnLeu ThrPhe AlaLysAsn LysAlaThrGln LysGlyGly AlaLeu
185 190 195
tattcc acggga gggattaca attaacaatacg ttaaactca gcatca ?39
TyrSer ThrGly GlyIleThr IleAsnAsnThr LeuAsnSer AlaSer
200 205 210
ttttct gaaaat accgcggcg aacaatggcgga gccatttac acggaa 787
PheSer GluAsn ThrAlaAla AsnAsnGlyGly AlaIleTyr ThrGlu
215 220 225
getagc agtttt attagcagc aacaaagcaatt agctttata aacaat 835
AlaSer SerPhe IleSerSer AsnLysAlaIle SexPheIle AsnAsn
230 235 290 245
agtgtg accgca acctcaget acagggggagcc atttactgt agtagt 883
SerVal ThrAla ThrSerAla ThrGlyGlyAla IleTyrCys SerSer
250 255 260
acatca gccccc aaaccagtc ttaactctatca gacaacggg gaactg 931
ThrSer AlaPro LysProVal LeuThrLeuSer AspAsnGly GluLeu
265 270 275
aacttt atagga aatacagca attactagtggt ggggcgatt tatact 979
AsnPhe IleGly AsnThrAla IleThrSerGly GlyAlaIle TyrThr
280 285 290
gacaat ctagtt ctttcttct ggaggacctacg ctttttaaa aacaac 1027
AspAsn LeuVal LeuSerSer GlyGlyProThr LeuPheLys AsnAsn
295 300 305
13
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA9910i 147
tctggc tatgatact.gcagetccc ttaggagga gc<3attgcg attget 1075
SexGly TyrAspThr AlaAlaPro LeuG1yGly AlaIleAla IleAla
310 315 320 325
gactct ggatctttg agtetttcg getcttggt ggagacatc actttt 1123
AspSer GlySerLeu SerLeuSer AlaLeuGly Gl:,rAspIle ThrPhe
330 335 340
gaagga aacacagta gtcaaagga gettettcg agi~cagace actacc 1271
G1uG1y AsnThrVal ValLysGly AlaSerSer Se:rGlnThr ThrThr
345 350 355
agaaat tctattaac atcggaaac accaatget aagattgta cagctg 1219
ArgAsn SerIleAsn IleGlyAsn ThrAsnAla Ly;sIleVal GlnLeu
360 365 370
cgagcc tctcaaggc aatactatc tacttctat gatcctata acaact 1267
ArgAla SerGlnGly AsnThrIle TyrPheTyr AspProZle ThrThr
3?5 380 38!5
agcatc actgcaget ctctcagat getctaaac ttaaatggt cctgac 1315
SerTle ThrAlaAla LeuSerAsp AlaLeuAsn LeuAsnGly ProAsp
390 395 400 405
cttgca gggaatcct gcatatcaa ggaaccatc gtattttct ggagag 1363
LeuAla GlyAsnPro AlaTyrGln G1yThrIle Va:LPheSer GlyGlu
410 415 420
aagetc tcggaagca gaagetgca gaagetgat aatctcaaa tctaca 1411
LysLeu SerGluAla GluAlaAla GluAlaAsp AsnLeuLys SerThr
425 430 435
attcag caacctcta actcttgcg ggagggcaa ctctctctt aaatca 1459
IleGln GlnProLeu ThrLeuAla GlyGlyGln LeuSerLeu LysSer
440 445 450
ggagtc actctagtt getaagtec ttttcgcaa tctccgggc tctacc 1507
GlyVal ThrLeuVal AlaLysSer PheSerGln Se:rProGly SerThr
455 460 46:5
ctcctc atggatgca gggaccaca ttagaaacc getgatggg atcact 1555
LeuLeu MetAspAla GlyThrThr LeuGluThr AlaAspGly IleThr
470 975 480 485
atcaat aatcttgtt ctcaatgta gattcctta aa,agagacc aagaag 1603
IleAsn AsnLeuVal LeuAsnVal AspSerLeu Ly.sGluThr LysLys
490 495 500
ggcacg ctaaaagca acacaagca agtcagaca gt~~acttta tctgga 1651
GlyThr LeuLysAla ThrGlnAla SerGlnThr Va.lThrLeu SerGly
505 510 515
tcgctc tctcttgta gatccttct ggaaatgtc ta~~gaagat gtctct '
1699
SerLeu SerLeuVal AspProSer GlyAsnVal TyrGluAsp ValSer
520 525 530
14
SUBSTITUTE SHEET' tiRUE.E 26)

CA 02352759 2001-05-31
WO 00/32794 PC'f/CA99/01147
tggaataaccct caagtcttt tettgtctc actcttact getgacgac 1747
TrpAsnAsnPro GlnValPhe SerCysLeu ThrLeuThr AlaAspAsp
535 540 545
cccgcgaatatt cacatcaca gacttaget getga.tccc ctagaaaaa 1795
ProAlaAsnIle HisIleThr AspLeuAla AlaAspPro LeuGluLys
550 555 560 565
aatcctatccat tggggatac caagggaat tgggcatta tcttggcaa 1843
AsnProIleHis TrpGlyTyr GlnGlyAsn TrpAlaLeu SexTrpGln
570 575 580
gaggatactgcg actaaatcc aaagcagcg actcttacc tggacaaaa 1891
GluAspThrAla ThrLysSer LysAlaAla ThrLe:uThr TrpThrLys
585 590 595
acaggatacaat ccgaatcct ,gagcgtcgt ggaac:ctta gttgetaac 1939
ThrGlyTyrAsn ProAsnPro GiuArgArg GlyTr.rLeu ValAlaAsn
600 605 610
acgctatgggga tcctttgtt gatgtgcgc tccat.acaa cagcttgta 1987
ThrLeuTrpGly SerPheVal AspValArg SerTl.eGln GlnLeuVal
615 620 62.5
gccactaaagta cgccaatct caagaaact cgcgGCatc tggtgtgaa 2035
AlaThrLysVal ArgGlnSer GlnGluThr ArgGl.yIle TrpCysGlu
630 635 640 645
gggatctcgaac ttcttccat aaagatagc acgaa,gata aataaaggt 2083
GlyIleSerAsn PhePheHis LysAspSer ThrLysIle AsnLysGly
650 655 660
tttcgccacata agtgcaggt tatgttgta ggagc:gact acaacatta 2131
PheArgHisIle SerAlaGly TyrValVal GlyAl.aThr ThrThrLeu
665 670 675
gettctgataat cttatcact gcagcettc tgeco,atta ttcgggaaa 2179
AlaSexAspAsn LeuIleThx AlaAlaPhe CysGl.nLeu PheGlyLys
680 685 690
gatagagatcac tttataaat aaaaataga gettcagcc tatgcaget 2227
AspArgAspHis PheIleAsn LysAsnArg AlaSerAla TyrAlaA1a
695 700 705
tctctccatctc cagcatcta gcgaccttg tcttcacca agcttgtta 2275
SerLeuHisLeu GlnHisLeu AlaThrLeu SerSerPro SerLeuLeu
710 715 720 725
cgctaccttcct ggatetgaa agtgagcag cctgt:cctc tttgatget 2323
ArgTyrLeuPro GlySerGlu SerGluGln ProValLeu PheAspAla
730 735 740
cag atc agc tat atc tat agt aaa aat act atg aaa acc tat tac acc 2371
Gln Ile Ser Tyr Ile Tyr Ser Lys Asn Thr Met Lys Thr Tyr Tyr Thr
745 750 755
SUHSTtTUTE SHED'!' ;RULE 2Sj

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
caa gca cca aag gga gag age tcg tgg tat aat gac ggt tgc get ctg 2419
Gln Ala Pro Lys Gly Glu Ser Ser Trp Tyr Asn Asp Gly Cys Ala Leu
760 765 770
gaa ctt gcg agc tcc cta cca cac act get tta agc: cat gag ggt etc 2467
Glu Leu Ala Ser Ser Leu Pro His Thr Ala Leu Ser His Glu Gly Leu
775 780 ?85
0
ttc cac gcg tat ttt cct ttc atc aaa gta gaa get tcg tac ata cac 2515
Phe His Ala Tyr Phe Pro Phe Ile Lys Val Glu Ala Ser Tyr Ile His
790 795 800 805
caa gat agc ttc aaa gaa cgt aat act acc ttg gta. cga tct ttc gat 2563
Gln Asp Ser Phe Lys G1u Arg Asn Thr Thr Leu Val Arg Ser Phe Asp
810 815 820
agc ggt gat tta att aac gtc tct gtg cct att gga~ att acc ttc gag 2611
Ser Gly Asp Leu Ile Asn Val Ser Val Pro Ile Gly Ile Thr Phe Glu
825 830 835
aga ttc tcg aga aac gag cgt gcg tct tac gaa gct. act gtc atc tac 2659
Arg Phe Ser Arg Asn Glu Arg Ala Ser Tyr Glu Ala: Thr Val Ile Tyr
840 845 850
gtt gcc gat gtc tat egt aag aat cct gac tgc acct aca get ctc eta 2707
Val Ala Asp Val Tyr Arg Lys Asn Pro Asp Cys Thr Thr Ala Leu Leu
855 860 865
atc aac aat acc tcg tgg aaa act aca gga acg aat; ctc tca aga caa 2755
Ile Asn Asn Thr Ser Trp Lys Thr Thr Gly Thr Asn Leu Ser Arg Gln
870 875 880 885
get ggt ate gga aga gca ggg atc ttt tat gcc ttc; tct cca aat ctt 2803
Ala Gly Ile Gly Arg Ala Gly Ile Phe Tyr Ala Phe; Ser Pro Asn Leu
890 895 900
gag gtc aca agt aac cta tct atg gaa att cgt gga tct tca cgc agc 2851
Glu Val Thr Ser Asn Leu Ser Met Glu Ile Arg Gly Ser Ser Arg Ser
905 910 915
tac aat gca gat ctt gga ggt aag ttc cag ttc taaaagcgtt cctgatccct 2904
Tyr Asn Ala Asp Leu Gly Gly Lys Phe Gln Phe
920 925
tagaaattct aagagatcct gagtgtatct agggacttct caa~aga 2950
<210>6
<212>2784
<212>DNA
<213>Chlamydiapneumoniae
<220>
<221>CDS
<222>(1)..(2?84)
<900>6
16
SUBSTITUTE SHEET (F;ULE 28)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
atgaaatcct ctcttcattg gtttttaatc tcgtcatctt tagcacttcc cttgtcacta 60
aatttctctg cgtttgctgc tgttgttgaa atcaatctag gacctaccaa tagcttctct 120
ggaccaggaa cctacactcc tccagcccaa acaacaaatg cagatggaac tatctataat 180
ctaacagggg atgtctcaat caccaatgca ggatctccga cagctctaac cgcttcctgc 240
tttaaagaaa ctactgggaa tctttctttc caaggccacg gctaccaatt tctcctacaa 300
aatatcgatg cgggagcgaa ctgtaccttt accaatacag ctgcaaataa gcttctctcc 360
ttttcaggat tctcctattt gtcactaata caaaccacga atgctaccac aggaacagga 420
gccatcaagt ccacaggagc ttgttctatt cagtcgaact atagttgcta ctttggccaa 480
aacttttcta atgacaatgg aggcgccctc caaggcagct ctatcagtct atcgctaaac 540
cccaacctaa cgtttgccaa aaacaaagca acgcaaaaag ggggtgccct ctattcaacg 600
ggagggatta caattaacaa tacgttaaac tcagcatcat tttctgaaaa taccgcggcg 660
aacaatggcg gagccattta cacggaagct agcagtttta ttagcagcaa caaagcaatt 720
agctttataa acaatagtgt gaccgcaacc tcagctacag ggggagccat ttactgtagt 780
agtacatcag cccccaaacc agtcttaact ctatcagaca acggggaact gaactttata 890
ggaaatacag caattactag tggtggggcg atttatactg acaatctagt tctttcttct 900
ggaggaccta cgctttttaa aaacaactct ggctatgata ctgcagctcc cttaggagga 960
gcaattgcga ttgctgactc tggatctttg agtctttcgg ctcttggtgg agacatcact 1020
tttgaaggaa acacagtagt caaaggagct tcttcgagtc agaccactac cagaaattct 1080
attaacatcg gaaacaccaa tgctaagatt gtacagctgc gagcctctca aggcaatact 1140
atctacttct atgatcctat aacaactagc atcactgcag ctctctcaga tgctctaaac 1200
ttaaatggtc ctgaccttgc agggaatcct gcatatcaag gaaccatcgt attttctgga 1260
gagaagctct cggaagcaga agctgcagaa gctgataatc tc:aaatctac aattcagcaa 1320
cctctaactc ttgcgggagg gcaactctct cttaaatcag ga.gtcactct agttgctaag 1380
tccttttcgc aatctccggg ctctaccctc ctcatggatg ca.gggaccac attagaaacc 1440
gctgatggga tcactatcaa taatcttgtt ctcaatgtag attccttaaa agagaccaag 1500
aagggcacgc taaaagcaac acaagcaagt cagacagtca ctttatctgg atcgctctct 1560
cttgtagatc cttctggaaa tgtctacgaa gatgtctctt gg~aataaccc tcaagtcttt 1620
tcttgtctca ctcttactgc tgacgacccc gcgaatattc ac:atcacaga cttagctgct 1680
gatcccctag aaaaaaatcc tatccattgg ggataccaag gg~aattgggc attatcttgg 1740
caagaggata ctgcgactaa atccaaagca gcgactctta ccaggacaaa aacaggatac 1800
aatccgaatc ctgagcgtcg tggaacctta gttgctaaca cgctatgggg atcctttgtt 1860
gatgtgcgct ccatacaaca gcttgtagcc actaaagtac gc:caatctca agaaactcgc 1920
ggcatctggt gtgaagggat ctcgaacttc ttccataaag at.agcacgaa gataaataaa 1980
ggttttcgcc acataagtgc aggttatgtt gtaggagcga ct.acaacatt agcttctgat 2040
aatcttatca ctgcagcctt ctgccaatta ttcgggaaag at.agagatca ctttataaat 2100
aaaaatagag cttctgccta tgcagcttct ctccatctcc agcatctagc gaccttgtct 2160
tctccaagct tgttacgcta ccttcctgga tctgaaagtg agcagcctgt cctctttgat 2220
gctcagatca gctatatcta tagtaaaaat actatgaaaa cca attacac ccaagcacca 2280
aagggagaga gctcgtggta taatgacggt tgcgctctgg aa~cttgcgag ctccctacca 2340
cacactgctt taagccatga gggtctcttc cacgcgtatt tt:cctttcat caaagtagaa 2400
gcttcgtaca tacaccaaga tagcttcaaa gaacgtaata ct:accttggt acgatctttc 2460
gatagcggtg atttaattaa cgtctctgtg cctattggaa tt:accttcga gagattctcg 2520
agaaacgagc gtgcgtctta cgaagctact gtcatctacg ttgccgatgt ctatcgtaag 2580
aatcctgact gcacgacagc tctcctaatc aacaatacct cc~tggaaaac tacaggaacg 2640
aatctctcaa gacaagctgg tatcggaaga gcagggatct tta atgcctt ctctccaaat 2700
cttgaggtca caagtaacct atctatggaa attcgtggat ctacacgcag ctacaatgca 2?60
gatcttggag gtaagttcca gttc 2784
17
SUBSTITUTE SHEET i(RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PC'H'/CA99/01147
<210> 7
<211> 3000
<212> DNA
<213.> Chlamydia pneumoniae
<220>
<22I> CDS
<222> (201'..(2890>
<400> 7
gtacgaagtt cttcacgaaa ttataataca aacctaggct ctaagttttg tttctagatt 60
atcgaaaacg tgttaattaa ttgaacccaa gcatctttct atg aaa ata ccc ttg 115
Met Lys Ile Pro Leu
1 5
cac aaa ctc ctg atc tct tcg act ctt,gtc act ccc att cta ttg agc 163
His Lys Leu Leu Ile Ser Ser Thr Leu Val Thr Pro Ile Leu Leu Ser
15 20
att gca act tac gga gca gat get tct tta tcc ect aca gat agc ttt 211
Ile Ala Thr Tyr Gly Ala Asp Ala Ser Leu Ser Pro Thr Asp Ser Phe
25 30 35 '
gat gga gcg ggc ggc tct aca ttt act cca aaa tct aca gca gat gcc 259
Asp Gly Ala Gly Gly Ser Thr Phe Thr Pro Lys Ser Thr Ala Asp Ala
40 45 50
aat gga acg aac tat gtc tta tca gga aat gtc tat ata aac gat get 307
Asn Gly Thr Asn Tyr Val Leu Ser Gly Asn Val Tyr Ile Asn Asp Ala
55 60 65
ggg aaa ggc aca gca tta aca ggc tgc tgc ttt aca gaa act acg ggt 355
Gly Lys Gly Thr Ala Leu Thr Gly Cys Cys Phe Thr Glu Thr Thr Gly
70 ?5 80 85
gat ctg aca ttt act gga aag gga tac tca ttt tca ttc aac acg gta 403
Asp Leu Thr Phe Thr GIy Lys Gly Tyr Ser Phe Ser Phe Asn Thr Val
90 95 100
gat gcg ggt tcg aat gca gga get gcg gca agc aca act get gat aaa 45i
Asp Ala Gly Ser Asn Ala Gly Ala Ala Ala Ser Thr Thr Ala Asp Lys
105 110 115
gcc cta atc ttc aca gga ttt tct aac ctt tcc ttc att gca get cct 499
Ala Leu Ile Phe Thr Gly Phe Ser Asn Leu Ser Phe Iie Ala Ala Pro
120 125 130
gga act aca gtt get tca gga aaa agt act tta agt tct gea gga gcc 547
Gly Thr Thr Val Ala Ser Gly Lys Ser Thr Leu Ser Ser Ala Gly Ala
135 140 145
tta aat ctt acc gat aat gga acg att ctc ttt agc caa aac gtc tcc 595
Leu Asn Leu Thr Asp Asn Gly Thr Ile Leu Phe Ser Gln Asn Val Ser
150 155 160 165
18
SUBSTITUTE SHEET ;RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
aatgaaget aataacaat ggcggagcg atcaccaec~aaaactctt tct 643
AsnGluAla AsnAsnAsn GlyGlyAla IleThrThr LysThrLeu Ser
170 175 lao
atttctggg aatacctct tctataacc ttcactagt:aatagcgca aaa 691
IleSerGly AsnThrSer SerIleThr PheThrSer AsnSerAla Lys
185 190 195
aaattaggt ggagegate tatagctct gcggetgea agtatttca gga 739
LysLeuGly GlyAlaIle TyrSerSer AlaAlaAla SerIleSer Gly
200 205 210
aacaccggc cagttagtc tttatgaat aataaagga gaaactggg ggt 787
AsnThrGly GlnLeuVal PheMetAsn AsnLysGly GluThrGly Gly
215 220 22
i
ggggetctg ggctttgaa gccagctcc ,tcgattact:caaaatagc tcc 835
GlyAlaLeu GlyPheGlu AlaSerSer SerIleThr GlnAsnSer Sex
230 235 240 295
cttttette tctggaaac actgcaaca gatgetgca ggcaagggc ggg 883
LeuPhePhe SerGlyAsn ThrAlaThr AspAlaAla GlyLysGly Gly
250 255 260
gccatttat tgtgaaaaa acaggagag actcctact:cttactatc tct 931
AlaIleTyr CysGluLys ThrGlyGlu ThrProThr LeuThrIle Ser
265 270 275
ggaaataaa agtctgacc ttcgc.cgag aactcttca gtaactcaa ggc 979
GlyAsnLys SerLeuThr PheAlaGlu AsnSerSex-ValThrGln Gly
280 285 290
ggagcaatc tgtgcccat ggtctagat ctttccgct:getggccct acc 1027
GlyAlaIle CysAlaHis GlyLeuAsp LeuSerAla AlaGlyPro Thr
295 30 0 305
ctattttca aataataga tgcgggaac acagetgca ggcaagggc ggc 1075
LeuPheSer AsnAsnArg CysGlyAsn ThrAlaAla GlyLysGly Gly
310 3I5 320 325
getattgca attgecgac tctggatct ttaagtct<:tctgcaaat caa 1123
AlaIleAla IleAlaAsp SerGlySer LeuSerLeu SerAlaAsn Gln
330 335 340
ggagacatc acgttcctt ggcaacact ctaacctca acctccgcg cca 1171
GlyAspIle ThrPheLeu GlyAsnThr LeuThrSer ThrSerAla Pro
345 350 355
acategaca eggaatget atctacctg ggategtca gcaaaaatt acg 121.9
ThrSerThr ArgAsnAla IleTyrLeu GlySerSer AlaLysIle Thr
360 365 370
aacttaagg gcagcccaa ggccaatct atctatttc:tatgatccg att 1267
AsnLeuArg AlaAlaGln GlyGlnSer ileTyrPhe:TyrAspPro Ile
375 380 38'i
19
SUBSTITUTE SHEET (f~ULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99I01147
gcatetaacace acaggaget tcagacgttctg accatcaac caaecg 1315
AlaSerAsnThr ThrGlyAla SerAspValLeu ThrIleAsn GlnPro
390 395 400 405
gatagcaactcg cctttagat tattcaggaacg attgtattt tctggg 1363
AspSerAsnSer ProLeuAsp TyrSerGlyThr IleValPhe SerGly
410 415 420
gaaaagctctct gcagatgaa gcgaaagetget gataacttc acatet 1411
GluLysLeuSer AlaAspGlu AlaLysAlaAla AspAsnPhe ThrSer
425 430 435
atattaaagcaa ccattgget ctagcctctgga acc.ttagca ctcaaa 1459
IleLeuLysGln ProLeuAla LeuAlaSerGly ThrLeuAla LeuLys
440 445 450
ggaaatgtcgag ttagatgtc aatggt.ttcaca cagactgaa ggctct 1507
GlyAsnValGlu LeuAspVal AsnGlyPheThr Gln.ThrG1u GlySer
455 460 465
acactcctcatg caaccagga acaaagctcaaa gcagatact gaaget 1555
ThrLeuLeuMet GlnProGly ThrLysLeuLys AlaAspThr GluAla
470 475 480 485
atcagtcttacc aaacttgtc gttgatctttct gcc:ttagag ggaaat 1603
ileSerLeuThr LysLeuVal ValAspLeuSer Ala.LeuGlu GlyAsn
490 495 500
aagagtgtgtcc attgaaaca gcaggagccaac aaa,actata actcta 1651
LysSerValSer IleGluThr AlaGlyAlaAsn LysThrIle ThrLeu
505 510 515
acctctcctctt gttttccaa gatagtagcggc aatttttat gaaagc 1699
ThrSerProLeu ValPheGln AspSerSerGly AsnPheTyr GluSer
520 525 530
catacgataaac caagccttc acgcagcctttg gtc~gtattc actget 1747
HisThrIleAsn GlnAlaPhe ThrGlnProLeu ValValPhe ThrAla
535 540 545
getactgetget agegatatt tatatcgatgcg ctteteact tetcca 1795
AlaThrAiaAla SerAspIle TyrIleAspAla LeuLeuThr SexPro
550 555 560 565
gtacaaactcca gaacctcat tacggg'tatcag ggacattgg gaagcc 1843
VaiGlnThrPro GluProHis TyrGlyTyrGln GlyHisTrp GluAla
570 575 580
act tgg gca gac aca tca act gca aaa tca gga act atg act tgg gta T891
Thr Trp Ala Asp Thr Ser Thr A1a Lys Ser Gly Thr Met Thr Trp Val
585 590 595
act_acg ggc tac aac cct aat cct gag cgt aga gct: tcc gta gtt ccc 1939
Thr Thr Gly Tyr Asn Pro Asn Pro Glu Arg Arg Ala Ser Val Va2 Pro
600 605 610
SU9STiTUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO fl0/32794 PCT/CA99/flIl4?
gat tca tta tgg gca tcc ttt act gac att cgc act: cta cag cag atc 1987
Asp Ser Leu Trp Ala Ser Phe Thr Asp Ile Arg Thr Leu G1n Gln Ile
515 620 625
atg aca tct_caa gcg aat agt atc tat cag caa cga gga ctc tgg gca 2035
Met Thr Sex Gln Ala Asn Ser Ile Tyr G1n Gln Arch Gly Leu Trp Ala
630 635 640 645
tca gga act gcg aat ttc ttc cat aag gat aaa tca gga act aac caa 2083
Ser Gly Thr Ala Asn Phe Phe His Lys Asp Lys Sez: Gly Thr Asn Gln
650 655 660
gcatte cgacataaa agctacggc tatattgtt ggaggaagt getgaa 2131
AlaPhe ArgHisLys SerTyrGly TyrIleVal GlyGlySer AlaGlu
665 670 675
gatttt tctgaaaat atcttcagt gtagetttc tgccagctc ttcggt 2179
AspPhe SerGluAsn IlePheSer ValAlaPhe CysGlnLeu PheGly
680 685 690
aaagat aaagacctg tttatagtt gaaaatacc tctcataac tattta 2227
LysAsp LysAspLeu PheIleVal GluAsnThr Sei:HisAsn TyrLeu
695 700 70'.i
gcgtcg ctatacctg caacatcga gcattccta ggaggactt cccatg 2275
AlaSer LeuTyrLeu GlnHisArg AlaPheLeu GlyGlyLeu ProMet
710 715 720 725
ccctca tttggaagt atcaccgac atgctgaaa gat_attcct ctcatt 2323
ProSer PheGlySer IleThrAsp MetLeuLys AspIlePro LeuIle
730 735 740
ttgaat gcccagcta agctacagc tacactaaa aat:gatatg gatact 2371
LeuAsn AlaGlnLeu SerTyrSer TyrThrLys AsnAspMet AspThr
745 750 755
cgctat acttcctat cctgaaget caaggctct tggaccaat aactct 2419
ArgTyr ThrSerTyr ProGluAla GlnGlySer TrpThrAsn AsnSer
760 765 ?70
gggget ctagagete ggaggatct ctggetcta tai.ctcect aaagaa 2467
GlyAla LeuGluLeu GlyGlySer LeuAlaLeu TyrLeuPro LysGlu
775 780 785
gcaccg ttcttccag ggatatttc cccttctta aagttccag gcagtc 2515
AlaPro PhePheGln GlyTyrPhe ProPheLeu LysPheGln AlaVal
790 795 800 805
tacagc cgecaacaa aactttaaa gagagtggc gci:gaagcc cgtget 2563
TyrSer ArgGlnGln AsnPheLys GluSerGly AlaGluAla ArgAla
810 815 820
tttgat gatggagac ctagtgaac tgctctatc cctgtcggc attcgg 2611
PheAsp AspGlyAsp LeuValAsn CysSerIle ProValG1y IleArg
825 830 835
21
SUBSTITUTE SHEET (MULE 26)

CA 02352759 2001-05-31
WO OOI32794 PCT/CA99101147
tta gaa aaa atc tcc gaa gat gaa aaa aat aat ttc: gag att tct cta 2659
Leu Glu Lys Ile Ser Glu Asp Glu Lys Asn Asn Phe~ Glu Ile Ser Leu
840 845 850
gcc tac att.ggt gat gtg tat cgt aaa aat ccc cgt tcg cgt act tct 2707
Ala Tyr Ile Gly Asp Val Tyr Arg Lys Asn Pro Arch Ser Arg Thr Ser
855 860 86E~
cta atg gtc agt gga gcc tct tgg act tcg cta tgt: aaa aac ctc gca 2755
Leu Met Val Ser Gly Ala Ser Trp Thr Ser Leu Cys Lys Asn Leu Ala
870 875 880 885
ega caa gcc ttc tta gca agt get gga agc cat ctg act ctc tcc cct 2803
Arg Gln Ala Phe Leu Ala Ser Ala Gly Ser His Leu Thr Leu Ser Pro
890 895 900
cat gta gaa ctc tct ggg gaa get get tat gag ctt: cgt ggc tca gca 2851
His Val Glu Leu Ser Gly Glu Ala Ala Tyr Glu Leu Arg Gly Ser Ala
905 910 915
cac atc tac aat gta gat tgt ggg cta aga tac tca ttc tagttcctac 2900
His Ile Tyr Asn Val Asp Cys Gly Leu Arg Tyr Ser Phe
920 925 930
tttcctccct aaacttttag ggaggaattc ttataaaaac cct:gtagatt cttaacttac 2960
tagtctctcc tttcctcttg ctttctttaa tttattgcag 3000
<210>8
<211>2790
<212>DNA
<213>Chlamydiapneumoniae
<220>
<221>CDS
<222>(1)..(2790)
<400>8
atgaaaatac ccttgcacaa actcctgatc tcttcgactc ttc~tcactcc cattctattg 60
agcattgcaa cttacggagc agatgcttct ttatccccta cagatagctt tgatggagcg 120
ggcggctcta catttactcc aaaatctaca gcagatgcca atggaacgaa ctatgtctta 180
tcaggaaatg tctatataaa cgatgctggg aaaggcacag cattaacagg ctgctgcttt 240
acagaaacta cgggtgatct gacatttact ggaaagggat act:cattttc attcaacacg 300
gtagatgcgg gttcgaatgc aggagctgcg gcaagcacaa ctc~ctgataa agccctaatc 360
ttcacaggat tttctaacct ttccttcatt gcagctcctg gaactacagt tgcttcagga 420
aaaagtactt taagttctgc aggagcctta aatcttaccg ataatggaac gattctcttt 480
agccaaaacg tctccaatga agctaataac aatggcggag cgatcaccac aaaaactctt 540
tctatttctg ggaatacctc ttctataacc ttcactagta atagcgcaaa aaaattaggt 600
ggagcgatct atagctctgc ggctgcaagt atttcaggaa acaccggcca gttagtcttt 660
atgaataata aaggagaaac tgggggtggg gctctgggct ttgaagccag ctcctcgatt 720
actcaaaata gctccctttt cttctctgga aacactgcaa cagatgctgc aggcaagggc 780
ggggccattt attgtgaaaa aacaggagag actcctactc ttactatctc tggaaataaa 840
agtctgacct tcgccgagaa ctcttcagta actcaaggcg gagcaatctg tgcccatggt 900
ctagatcttt ccgctgctgg ccctacccta ttttcaaata atagatgcgg gaacacagct 960
gcaggcaagg gcggcgctat tgcaattgcc gactctggat ctttaagtct ctctgcaaat 1020
2z
SUBSTITUTE SHEET (RUtE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
caaggagaca tcacgttcct tggcaacact ctaacctcaa cctccgcgcc aacatcgaca 1080
cggaatgcta tctacctggg atcgtcagca aaaattacga acr.taagggc agcccaaggc 1140
caatctatct atttctatga tccgattgca tctaacacca caggagcttc agacgttctg 1200
accatcaacc aaccggatag caactcgcct ttagattatt caggaacgat tgtattttct 1260
ggggaaaagc tctctgcaga tgaagcgaaa gctgctgata acttcacatc tatattaaag 1320
caaccattgg ctctagcctc tggaacctta gcactcaaag gaaatgtcga gttagatgtc 1380
aatggtttca cacagactga aggctctaca ctcctcatgc aaccaggaac aaagctcaaa 1440
gcagatactg aagctatcag tcttaccaaa cttgtcgttg atctttctgc cttagaggga 1500
aataagagtg tgtccattga aacagcagga gccaacaaaa ctataactct aacctctcct 1560
cttgttttcc aagatagtag cggcaatttt tatgaaagcc atacgataaa ccaagccttc 1620
acgcagcctt tggtggtatt actgctgcta ctgctgctag cgatatttat atcgatgcgc 1680
tt,ctcacttc tccagtacaa actccagaac ctcattacgg gtaLCaggga cattgggaag 1?40
ccacttgggc agacacatca actgcaaaat caggaactat gacttgggta actacgggct 1800
acaaccctaa tcctgagcgt agagcttccg tagttcccga ttc:attatgg gcatccttta 1860
ctgacattcg cactctacag cagatcatga catctcaagc gaatagtatc tatcagcaac 1920
gaggactctg ggcatcagga actgcgaatt tcttccataa ggataaatca ggaactaacc 1980
aagcattccg acataaaagc tacggctata ttgttggagg aagtgctgaa gatttttctg 2040
aaaatatctt cagtgtagct ttctgccagc tcttcggtaa agataaagac ctgtttatag 2100
ttgaaaatac ctctcataac tatttagcgt cgctatacct gcaacatcga gcattcctag 2160
gaggacttcc catgccctca tttggaagta tcaccgacat gctgaaagat attcctctca 2220
ttttgaatgc ccagctaagc tacagctaca ctaaaaatga tat_ggatact cgctatactt 2280
cctatcctga agctcaaggc tcttggacca ataactctgg ggctctagag ctcggaggat 2340
ctctggctct atatctccct aaagaagcac cgttcttcca ggc~atatttc cccttcttaa 2400
agttccaggc agtctacagc cgccaacaaa actttaaaga gagtggcgct gaagcccgtg 2460
cttttgatga tggagaccta gtgaactgct ctatccctgt cggcattcgg ttagaaaaaa 2520
tctccgaaga tgaaaaaaat aatttcgaga tttctctagc ctacattggt gatgtgtatc 2580
gtaaaaatcc ccgttcgcgt acttctctaa tggtctcagt ggagcctctt ggacttcgct 2040
tagtaaaaac ctcgcacgac aagccttctt agcaagtgct ggaagccatc tgactctctc 2700
cctcatgtag aactctctgg ggaagctgct tatgagcttc gtggctcagc acacatctac 2760
aatgtagatt gtgggctaag atactcattc 2790
<210> 9
<211> 1100
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> CDS
<222> (101)..(979)
<400> 9
ataaagtttt ttatatgaac aaaactttga cttcattggc agacacttcg accttaacag 60
accaattttg ttgtcatccc tataaaaatc aggaattttc atg ctc tcc tca cta 115
Mei~ Leu Ser Ser Leu
:L 5
atc cgt gat tca ttt CCC Ctt ctt att tta ctt CCC aca ttc cta gcg 163
Ile Arg Asp Ser Phe Pro Leu Leu Ile Leu Leu Pro Thr Phe Leu Ala
15 20
gca tta gga gce tcc gta get ggc ggc gtt atg gga acc tat atc gtt 211
Ala Leu Gly Ala Ser Val Ala Gly Gly Val Met Gly Thr Tyr Ile Val
25 30 35
SU9STITUTE SHEET (IRUi.E 2S~

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
gtaaaacgtatt gtttcaatt agtggaagt atatctcat gcaattcta 259
ValLysArgIle ValSerIle SerGlySer Ile.SerHis AlaIleLeu
40 45 50
ggaggaattggc ctcacccta tggatacaa tataagctt catctctct 307
GlyGlyIIeGly LeuThrLeu TrpIleGln TyrLysLeu HisLeuSer
55 60 65
tttttccctatg tatggaget attgtagga getattttt ctagetctt 355
PhePheProMet TyrGlyAla IleValGly AlaIlePhe LeuAlaLeu
70 75 80 85
tgcatcggcaag atccacctg aaataccaa gaaagggaa gactctttg 403
CysIleGlyLys IieHisLeu LysTyrGln GluArgGlu AspSerLeu
90 95 100
attgcgatgatt tggtctgtg ggcatg~gcaattggaatt atattcatt 451
IleAlaMetIle TrpSerVal GlyMetAla IleGlyIle IlePheIle
105 110 115
tccaggcttccc acctttaat ggagagctc atcaatttt ctatttggg 499
SerArgLeuPro ThrPheAsn GlyGluLeu IleAsnPhe LeuPheGly
120 125 130
aacattctctgg gtcacccct tcagacctc tatagctta ggaatcttt 547
AsnIleLeuTrp ValThrPro SerAspLeu TyrSerLeu GlyIlePhe
135 140 145
gatcttcttgtt ttaggaatt gtggtcctt tgccacacc cggttcctt 595
AspLeuLeuVal LeuGlyIle ValValLeu CysHisThr ArgPheLeu
150 155 160 165
getctttgcttt gatgagagg tacacgget ttaaaccat tgttctgta 643
AlaLeuCysPhe AspGluArg TyrThrAla LeuAsnHis CysSerVal
170 175 180
cagctgtggtat ttcctactt cttgttctg acagcaatc acgattgtg 691
GlnLeuTrpTyr PheLeuLeu LeuValLeu ThrAlaIle ThrIleVal
185 190 195
atgttgatttat gtgatggga acgattctg atgcttagc atgctcgtc 739
MetLeu21eTyr ValMetGly ThrIleLeu MetLeuSex MetLeuVal
200 205 220
ttacctgttget atagcgtgt agattttcg tacaagatg acacgaatt 787
LeuProValAla IleAlaCys ArgPheSer TyrLysMet ThrArgIle
215 220 225
atgttcatctcg gtcctcttg aatatctta tgttctttt tctggaatt 835
MetPheIleSer ValLeuLeu AsnIleLeu CysSerPhe SerGlyIle
230 235 240 295
tgcatcgcctac tgtttagat ttcccagta ggtcctacg atatcattg 883
CysIleAlaTyr CysLeuAsp PheProVal GlyProThr IieSerLeu
250 255 260
24
SUBSTITUTE SHEET (FtULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99101147
ctg atg ggg tta ggt tat aca gcg agt ctt tgt gtgr aag aag cgg tac 931
Leu Met Gly Leu Gly Tyr Thr Ala Ser Leu Cys Val Lys Lys Arg Tyr
265 270 275
aat ccg tcg acg cct tct cct gta agt cct gaa atc: aat aca aat gta 979
Asn Pro Sex Thr Pro Ser Pro Val Ser Pro Glu Ile Asn Thr Asn Val
280 285 290
tagctaggga agcgcttttg gaagctttgg aggcattctt cctgttcgtc aggaagaaga 1039
tcatcaattt tatttaaagc taccagcata tctttctttt caa;aatctgg ctgatgagag 1099
t 1100
<210> 10
<211> 880
<212> DNA
<213> Chlamydiapneumoniae
<220>
<221> CDS
<222> (1)..(880}
<400> 10
atgctctcctcactaatccgtgattcatttccccttcttattttacttcc cacattccta60
gcggcattaggagcctccgtagctggcggcgttatgggaacctatatcgt tgtaaaacgt120
attgtttcaattagtggaagtatatctcatgcaattctaggaggaattgg cctcacccta180
tggatacaatataagcttcatctctcttttttccctatgtatggagctat tgtaggagct240
atttttctagctctttgcatcggcaagatccacctgaaataccaagaaag ggaagactct300
ttgattgcgatgatttggtctgtgggcatggcaattggaattatattcat ttccaggctt360
cccacctttaatggagagctcatcaattttctatttgggaacattctctg ggtcacccct420
tcagacctctatagcttaggaatctttgatcttcttgttttaggaattgt ggtcctttgc480
cacacccggttccttgctctttgctttgatgagaggtacacgc~ctttaaa ccattgttct540
gtacagctgtggtatttcctacttcttgttctgacagcaatcacgattgt gatgttgatt600
tatgtgatgggaacgattctgatgcttagcatgctcgtcttacctgttgc tatagcgtgt660
agattttcgtacaagatgacacgaattatgttcatctcggtcca cttgaa tatcttatgt720
tctttttctggaatttgcatcgcctactgtttagatttcccagtaggtcc tacgatatca780
ttgctgatggggttaggttatacagcgagtctttgtgtagaagaagcggt acaatccgtc840
gacgccttctcctgtaagtcctgaaatcaatacaaatgta 880
<210> 11
<211> 928
<212> PRT
<213> Chlamydia pneumoniae
<400> 11
Met Lys Thr Ser Ile Pro Trp Val Leu Val Ser Ser Val Leu Ala Phe
1 5 10 15
Ser Cys His Leu Gln Ser Leu Ala Asn Glu Glu Leu Leu Ser Pro Asp
20 25 30
SUBSTITUTE SHEET (1RULE 25)

CA 02352759 2001-05-31
WO OOI32794 PCTlCA99/01147
Asp Ser Phe Asn Gly.Asn Ile Asp Ser Gly Thr Phe Thr Pro Lys Thr
35 40 45
Ser Ala Thr Thr Tyr Sex Leu Thr Gly Asp Val Phe: Phe Tyr Glu Pro
50 55 60
Gly Lys Gly Thr Pro Leu Ser Asp Ser Cys Phe Ly~~ Gln Thr Thr Asp
65 70 75 80
Asn Leu Thr Phe Leu Gly Asn Gly His Ser Leu Thr Phe Gly Phe Ile
85 90 95
Asp Ala Gly Thr His Ala Gly Ala Ala Ala Ser Thr Thr Ala Asn Lys
100 105 110
Asn Leu Thr Phe Ser Gly Phe Ser Leu.Leu Ser Phe Asp Ser Ser Pro
I15 120 125
Ser Thr Thr Val Thr Thr Gly Gln Gly Thr Leu Sexy Ser Ala Gly Gly
130 135 140
Val Asn Leu Glu Asn Ile Arg Lys Leu Val Val Ala Gly Asn Phe Ser
145 I50 155 160
Thr Ala Asp Gly Gly Ala Ile Lys Gly Ala Ser Phe Leu Leu Thr Gly
165 170 175
Thr Ser Gly Asp Ala Leu Phe Ser Asn Asn Ser Sei: Ser Thr Lys Gly
I80 I85 190
Gly Ala Ile Ala Thr Thr Ala GIy Ala Arg Ile Ala Asn Asn Thr Gly
195 200 205
Tyr Val Arg Phe Leu Ser Asn Ile Ala Ser Thr Sea: Gly Gly Ala Ile
210 215 220
Asp Asp Glu Gly Thr Ser Ile Leu Ser Asn Asn Lys Phe Leu Tyr Phe
225 230 235 290
Glu Gly Asn Ala Ala Lys Thr Thr Gly Gly Ala Ile Cys Asn Thr Lys
245 250 255
Ala Ser Gly Ser Pro Glu Leu IIe Ile Ser Asn Asn Lys Thr Leu Ile
260 265 270
Phe Ala Ser Asn Val Ala Glu Thr Sex Gly Gly Ala Ile His Ala Lys
275 280 285
Lys Leu Ala Leu Ser Ser Gly Gly Phe Thr Glu Phe Leu Arg Asn Asn
290 295 300
Val Ser Ser Ala Thr Pro Lys Gly Gly Ala Ile Se:r Ile Asp Ala Ser
305 310 3I5 320
Gly G3u Leu Ser Leu Ser Ala Glu Thr Gly Asn Ile Thr Phe Val Arg
325 330 335
26
SUBSTITUTE SHEET (iRULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99101147
Asn Thr Leu Thr Thr Thr Gly Ser Thr Asp Thr Pro Lys Arg Asn Ala
340 345 350
Ile Asn Ile Gly Ser Asn Gly Lys Phe Thr Glu Leu Arg Ala Ala hys
355 360 365
Asn His Thr Tie Phe Phe Tyr Asp Pro Ile Thr Ser Glu Gly Thr Ser
370 375 380
Ser Asp Val Leu Lys Ile Asn Asn Gly Ser Ala G1y Ala Leu Asn Pro
385 390 395 400
Tyr Gln Gly Thr Ile Leu Phe Ser Gly Glu Thr Leu Thr Ala Asp Glu
405 410 415
Leu Lys Val Ala Asp Asn Leu Lys Ser,Ser Phe Th.r Gln Pro Val Ser
420 425 430
Leu Ser Gly Gly Lys Leu Leu Leu Gln Lys Gly Val Thr Leu Glu Ser
435 440 445
Thr Ser Phe Ser Gln Glu A1a Gly Ser Leu Leu Gly Met Asp Ser Gly
450 455 460
Thr Thr Leu Ser Thr Thr Ala Gly Ser Ile Thr Ile Thr Asn Leu Gly
465 4?0 475 480
Ile Asn Val Asp Ser Leu Gly Leu Lys Gln Pro Va:1 Ser Leu Thr Ala
485 490 995
Lys Gly Ala Ser Asn Lys Val Ile Val Sex Gly Ly.~, Leu Asn Leu Ile
500 505 510
Asp Ile Glu Gly Asn Ile Tyr Glu Ser His Met Phe Ser His Asp Gln
5i5 520 525
Leu Phe Ser Leu Leu Lys Ile Thr Val Asp Ala Asp Val Asp Thr Asn
530 535 540
Val Asp Ile Ser Ser Leu Ile Pro Val Pro Ala Glll Asp Pro Asn Ser
545 550 555 560
Glu Tyr Gly Phe Gln Gly Gln Trp Asn Val Asn Trp Thr Thr Asp Thr
565 570 575
Ala Thr Asn Thr Lys Glu Ala Thr Ala Thr Trp T'.:r Lys Thr Gly Phe
580 585 590
Val Pro Ser Pro Glu Arg Lys Ser Ala Leu Val Cys Asn Thr Leu Trp
595 600 605
Gly Val Phe Thr Asp Ile Arg Ser Leu G1n Gln Leu Val Glu Ile Gly
610 615 620
Ala Thr Gly Met Glu His Lys Gln Gly Phe Trp Val Ser Ser Met Thr
625 630 635 640
27
SUBSTITUTE SHEE'3' (RULE 26~

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
Asn Phe Leu His Lys Thr Gly Asp Giu Asn Arg Lys Gly Phe Arg His
695 650 655
Thr Ser Gly Gly Tyr Val Ile Gly Gly Ser Ala His Thr Pro Lys Asp
660 665 670
Asp Leu Phe Thr Phe Ala Phe Cys His Leu Phe Ala Arg Asp Lys Asp
675 680 685
Cys Phe Ile Ala His Asn Asn Ser Arg Thr Tyr Gly Gly Thr Leu Phe
690 695 700
Phe Lys His Ser His Thr Leu Gln Pro Gln Asn Tyr Leu Arg Leu Gly
705 710 715 720
Arg Ala Lys Phe Ser Glu Ser Ala Ile Glu Lys Phe Pro Arg Glu Ile
725 ?30 735
Pro Leu Ala Leu Asp Val Gln Val Sex Phe Ser His Ser Asp Asn Arg
740 795 750
Met Glu Thr His Tyr Thr Ser Leu Pro Glu Ser Glu Gly Ser Trp Ser
755 760 765
Asn Glu Cys Ile Ala Gly Gly Ile Gly Leu Asp Leu Pro Phe Val Leu
770 775 780
Ser Asn Pro His Pro Leu Phe Lys Thr Phe Ile Pro Gln Met Lys Val
?85 790 795 800
Glu Met Val Tyr Val Ser Gln Asn Ser Phe Phe Glu Ser Ser Ser Asp
805 810 815
Gly Arg Gly Phe Ser Ile Gly Arg Leu Leu Asn Leu Ser Ile Pro Val
820 825 830
Gly Ala Lys Phe Val Gln Gly Asp Ile Gly Asp Ser Tyr Thr Tyr Asp
835 840 845
Leu Ser Gly Phe Phe Val Ser Asp Val Tyr Arg Asn Asn Pro Gln Ser
850 855 860
Thr Ala Thr Leu Val Met Ser Pro Asp Ser Trp Lys Ile Arg Gly Gly
865 870 875 880
Asn Leu Ser Arg Gln Ala Phe Leu Leu Arg Gly Ser Asn Asn Tyr Val
885 890 895
Tyr Asn Ser Asn Cys Glu Leu Phe Gly His Tyr Ala Met Glu Leu Arg
900 905 910
Gly Ser Ser Arg Asn Tyr Asn Val Asp VaI Gly Thr Lys Leu Arg Phe
915 920 925
28
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01 ! 47
<210> 13
<211> 885
<212> PRT
<213> Chlamydia pneumoniae
<400> 13
Gly Thr Tyr Thr Pro Lys Asn Thr Thr Thr Gly Ile Asp Tyr Thr Leu
I 5 10 15
Thr Gly Asp Ile Thr Leu Gln Asn Leu Gly Asp Ser Ala Ala Leu Thr
20 25 30
Lys Gly Cys Phe Ser Asp Thr Thr Glu Ser Leu Ser Phe Ala Gly Lys
35 40 45
Gly Tyr Ser Leu Ser Phe Leu Asn Ile.Lys Ser Ser Ala Glu Gly Ala
50 55 60
Ala Leu Ser Val Thr Thr Asp Lys Asn Leu Ser Leu Thr Gly Phe Ser
65 70 75 80
Ser Leu Thr Phe Leu Ala Ala Pro Ser Ser Val Ile Thr Thr Pro Ser
85 90 95
Gly Lys Gly Ala Val Lys Cys Gly Gly Asp Leu Thr Phe Asp Asn Asn
100 105 - 110
Gly.Thr Ile Leu Phe Lys Gln Asp Tyr Cys Glu Glu Asn Gly Gly Ala
I15 120 125
Ile Ser Thr Lys Asn Leu Ser Leu Lys Asn Ser Thr Gly Ser Ile Ser
130 135 140
Phe Glu Gly Asn Lys Ser Ser Ala Thr Gly Lys Lys Gly Gly Ala Ile
145 150 155 160
Cys Ala Thr Gly Thr Val Asp Ile Thr Asn Asn Thr Ala Pro Thr Leu
165 170 175
Phe Ser Asn Asn Ile Ala Glu Ala Ala Gly Gly Ala Ile Asn Sex Thr
180 185 190
Gly Asn Cys Thr Ile Thr Gly Asn Thr Ser Leu Va.l Phe Ser Glu Asn
195 200 205
Ser Val Thr Ala Thr Ala Gly Asn Gly Gly Ala Leu Ser Gly Asp Ala
210 215 220
Asp Val Thr Ile Ser Gly Asn Gln Ser Val Thr Phe Ser Gly Asn Gln
225 230 235 240
Ala Val Ala Asn Gly Gly Ala Ile Tyr Ala Lys Lys Leu Thr Leu Ala
245 250 255
Ser Gly Gly Gly Gly Gly Asn Pro Phe Ser Asn Asn Ile Val Gln Gly
260 265 270
2~
SUBSTITUTE SHEET (~3ULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
Thr Thr Ala Gly Asn Gly Gly Ala Ile Ser Ile Leu Ala Ala Gly Glu
275 280 285
Cys Ser Leu Phe Ser Glu Ala Gly Asp His Tyr Le~u Asn Gly Asn Ala
290 295 300
Ile Val Ala Thr Thr Pro Gln Thr Thr Lys Arg Asn Ser Ile Asp Ile
305 310 315 320
Gly Ser Thr Gly Lys Asp His Glu Leu Arg Ala Ile Ser Gly His Ser
325 330 335
Ile Phe Phe Tyr Asp Pro Ile Thr Ala Asn Thr Ala Ala Asp Ser Thr
340 345 350
Asp Thr Leu Asn Leu Asn Lys Ala Asp.Ala Gly Asn Ser Thr Asp Tyr
355 3 60 365
Ser Gly Ser Ile Val Phe Ser Gly Glu Lys Leu Ser. Glu Asp Glu Ala
370 375 38t)
Lys Val Ala Asp Asn Leu Thr Ser Thr Leu Lys G1T1 Pro Val Thr Leu
385 390 395 400
Thr Ala Gly Asn Leu Vai Leu Lys Arg Gly Val Thr Leu Asp Thr Lys
405 410 415
Gly Phe Thr Gln Thr Ala Gly Ser Ser Val Ile Mei: Asp Ala Gly Thr
420 925 430
Thr Leu Lys Ala Ser Thr Glu Glu Val Thr Leu Thr Gly Leu Ser Ile
435 440 445
Pro Val Asp Ser Leu Gly Glu Gly Lys Lys Val VaL Ile AIa Ala Ser
450 455 46()
Ala Ala Ser Lys Asn Val Ala Leu Ser Gly Pro IIE: Leu Leu Leu Asp
465 470 475 480
Asn Gln Gly Asn Ala Tyr Glu Asn His Asp Leu Gly Lys Thr Gln Asp
485 490 y 495
Phe Ser Phe Val Gln Leu Ser Ala Leu Gly Thr Ala Thr Thr Thr Asp
500 505 510
Val Pro Ala Val Pro Thr Val Ala Thr Pro Thr His Tyr Gly Tyr Gln
515 520 525
Gly Thr Trp Gly Met Thr Trp Val Asp Asp Thr Ala Ser Thr Pro Lys
530 535 540
Thr Lys Thr Ala Thr Leu Ala Trp Thr Asn Thr Gly Tyr Leu Pro Asn
545 550 555 560
Pro Glu Arg Gln Gly Pro Leu Val Pro Asn Ser Leu Trp Gly Ser Phe
565 570 575
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/Ol 147
Ser Asp Ile Gln Ala Ile Gin Gly Val Ile Glu Arg Ser Ala Leu Thr
580 585 590
Leu Cys Ser Asp Arg Gly Phe Trp Ala Ala Gly Val. Ala Asn Phe Leu
595 600 605
Asp Lys Asp Lys Lys Gly Glu Lys Arg Lys Tyr Arch His Lys Ser Gly
610 615 62CI
Gly Tyr Ala Ile Gly Gly Ala Ala Gln.Thr Cys Ser Glu Asn Leu Ile
625 630 635 640
Ser Phe Ala Phe Cys Gln Leu Phe Gly Ser Asp Lys~ Asp Phe Leu Val
64S 650 655
Ala Lys Asn His Thr Asp Thr Tyr Ala.~ly Ala Phe: Tyr Ile Gln His
660 665 670
Ile Thr Glu Cys Ser Gly Phe Ile Gly Cys Leu LeL2 Asp Lys Leu Pro
675 680 685
G1y Ser Trp Ser His Lys Pro Leu Val Leu Glu Gly Gln Leu Ala Tyr
690 695 700
Ser His Vai Ser Asn Asp Leu Lys Thr Lys Tyr Thr Ala Tyr Pro Glu
705 710 715 720
Val Lys Gly Ser Trp Gly Asn Asn Ala Phe Asn Met. Met Leu Gly Ala
725 730 735
Ser Ser His Ser Tyr Pro Glu Tyr Leu His Cys Phe Asp Thr Tyr Ala
740 745 750
Pro Tyr Ile Lys Leu Asn Leu Thr Tyr Ile Arg G1n Asp Ser Phe Ser
755 760 765
Glu Lys Gly Thr Glu Gly Arg Ser Phe Asp Asp Sex' Asn Leu Phe Asn
770 775 780
Leu Ser Leu Pro Ile Gly Val Lys Phe Glu Lys Phe Ser Asp Cys Asn
785 790 795 800
Asp Phe Ser Tyr Asp Leu Thr Leu Ser Tyr Val Pro Asp Leu I1e Arg
805 810 815
Asn Asp Pro Lys Cys Thr Thr Ala Leu Val Ile Ser Gly Ala Ser Trp
820 825 830
Glu Thr Tyr Ala Asn Asn Leu Ala Arg Gln Ala Leu Gln Val Arg Ala
835 840 845
Gly Ser His Tyr Ala Phe Ser Pro Met Phe Glu Val Leu Gly Gln Phe
850 855 860
Val Phe Glu Vai Arg Gly Ser Ser Arg Ile Tyr Asn Val Asp Leu Gly
865 870 875 880
31
SU9STITUTE SHEET tF~ULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/Ol 14'7
Gly Lys Phe Gln Phe
885
<210> 14
<211> 928
<212> PRT
<213> Chlamydia pneumoniae
<400> 14
Met Lys Ser Ser Leu His Trp Phe Leu Ile Ser Ser Ser Leu Ala Leu
1 S 10 15
Pro Leu Ser Leu Asn Phe Ser Ala Phe Ala Ala Val Val Glu Ile Asn
20 25 ~ 30
Leu Gly Pro Thr Asn Ser Phe Ser Gly Pro Gly Thr Tyr Thr Pro Pro
35 40 45
Ala Gln Thr Thr Asn Ala Asp Gly Thr Ile Tyr Asn Leu Thr Gly Asp
50 55 60
Val Ser Ile Thr Asn Ala Gly Ser Pro Thr Ala Leu Thr Ala Ser Cys
65 70 75 80
Phe Lys Glu Thr Thr Gly Asn Leu Ser Phe Gln Gly His Gly Tyr Gln
85 90 95
Phe Leu Leu Gln Asn Tle Asp Ala Gly Ala Asn Cys Thr Phe Thr Asn
100 105 110
Thr Ala Ala Asn Lys Leu Leu Ser Phe Ser Gly Phe Ser Tyr Leu Ser
115 120 125
Leu Ile Gln Thr Thr Asn Ala Thr Thr Gly Thr Gly Ala Ile Lys Ser
i30 135 190
Thr Gly Ala Cys Ser Ile Gln Ser Asn Tyr Ser Cys Tyr Phe Gly Gln
145 150 155 160
Asn Phe Ser Asn Asp Asn Gly Gly Ala Leu Gln Gly Ser Ser Ile Ser
165 170 175
Leu Ser Leu Asn Pro Asn Leu Thr Phe Ala Lys Asn Lys Ala Thr Gln
180 185 190
Lys Gly Gly Ala Leu Tyr Ser Thr Gly Gly Ile Thr Ile Asn Asn Thr
195 200 205
Leu Asn Ser Ala Ser Phe Ser Glu Asn Thr Ala Ala Asn Asn Gly Gly
210 215 220
Aia Ile Tyr Thr Glu Ala Sex Ser Phe Ile Sex Ser Asn Lys Ala Ile
225 230 235 240
32
SUBSTITUTE SHEET (RULE 26)

CA 02352759 2001-05-31
WO 00/32794 - PCT/CA99/01147
5er Phe Ile Asn Asn Ser Val Thr Ala Thr Ser Ala Thr Gly Gly Ala
245 250 255
Iie Tyr Cys Ser Ser Thr Ser Ala Pro Lys Pro Vai Leu Thr Leu Sex
260 265 270
Asp Asn Gly Giu Leu Asn Phe Ile G1y Asn Thr Ala Ile Thr Ser Gly
275 280 285
GIy Ala Ile Tyr Thr Asp Asn Leu Val Leu Ser Se:r Gly Gly Pro Thr
290 295 300
Leu Phe Lys Asn Asn Ser Gly Tyr Asp Thr Ala Ala Pro Leu Gly GIy
305 310 315 320
Ala Ile Ala Ile Ala Asp Ser Gly Ser,Leu Ser Leu Ser Ala Leu Gly
325 330 335
Gly Asp Ile Thr Phe Glu Gly Asn Thr Val Val Ly;s Gly Ala Ser Ser
340 345 350
Ser Gln Thr Thr Thr Arg Asn Ser Ile Asn Ile Gly Asn Thr Asn Aia
355 350 365
Lys Ile Val Gln Leu Arg Ala Ser Gln Gly Asn Thr_ Ile Tyr Phe Tyr
370 375 38c)
Asp Pro Ile Thr Thr Ser IIe Thr Ala Ala Leu Ser Asp Ala Leu Asn
385 390 395 400
Leu Asn Gly Pro Asp Leu Ala Gly Asn Pro Ala Tyr Gln Gly Thr Ile
405 910 415
VaI Phe Ser Gly Glu Lys Leu Ser Glu Ala Glu Aia Ala Glu Ala Asp
420 425 430
Asn Leu Lys Ser Thr Ile Gin Gln Pro Leu Thr Leu Aia Giy Gly Gin
435 440 445
Leu Ser Leu Lys Ser Gly Val Thr Leu Val Ala Ly~~ Ser Phe Ser Gln
450 455 46()
Ser Pro Gly Ser Thr Leu Leu Met Asp Aia Giy Thr Thr Leu Giu Thr
465 ~ 470 475 480
Ala Asp Gly Ile Thr Ile Asn Asn Leu Val Leu Asn Val Asp Ser Leu
485 990 495
Lys GIu Thr Lys Lys Gly Thr Leu Lys Ala Thr Gin Ala Ser Gln Thr
500 505 510
Vai Thr Leu Ser Gly Ser Leu Ser Leu Val Asp Pro Ser Gly Asn Val
515 520 525
Tyr Glu Asp Val Ser Trp Asn Asn Pro Gln Val Phe Ser Cys Leu Thr
530 535 540
33
SUBSTITUTE SHEET (~~ULE 26)

CA 02352759 2001-05-31
WO 00/32?94 PCT/CA99/0114?
Leu Thr Ala Asp Asp Pro Ala Asn Iie His Ile Thr Asp Leu Ala Ala
545 550 555 560
Asp Pro Leu Glu Lys Asn Pro Ile His Trp Gly Tyr Gln Gly Asn Trp
565 570 575
Ala Leu Ser Trp Gln Glu Asp Thr Ala Thr Lys Ser Lys Ala Ala Thr
580 585 590
Leu Thr Trp Thr Lys Thr Gly Tyr Asn Pro Asn Pra Glu Arg Arg Gly
595 600 605
Thr Leu Val Ala Asn Thr Leu Trp Gly Ser Phe Val Asp Val Arg Ser
610 615 620
Ile Gln Gln Leu Val Ala Thr Lys Val Arg Gln Ser Gln Glu Thr Arg
625 630 635 640
Gly Ile Trp Cys Glu Gly Ile Ser Asn Phe Phe His Lys Asp Ser Thr
645 650 655
Lys Ile Asn Lys Gly Phe Arg His Ile Ser Ala Gly Tyr Val Va1 Gly
660 665 670
Ala Thr Thr Thr Leu Ala Ser Asp Asn Leu Ile Thr Ala Ala Phe Cys
675 680 685
Gln Leu Phe Gly Lys Asp Arg Asp His Phe Ile Asn Lys Asn Arg Ala
690 695 700
Ser Ala Tyr Ala Ala Ser Leu His Leu Gln His Leu Ala Thr Leu Ser
705 720 715 720
Ser Pro Ser Leu Leu Arg Tyr Leu Pro Gly Ser Glu Ser Glu Gln Pro
725 730 735
Val Leu Fhe Asp Ala Gln Ile Ser Tyr Ile Tyr Ser Lys Asn Thr Met
740 745 750
Lys Thr Tyr Tyr Thr Gln Ala Pro Lys Gly Glu Ser Ser Trp Tyr Asn
?55 760 765
Asp Gly Cys Ala Leu Glu Leu Ala Ser Ser Leu Pro His Thr Ala Leu
770 775 780
Ser His Glu Gly Leu Phe His Ala Tyr Phe Pro Phe Ile Lys Val Glu
785 ?90 795 800
Ala Ser Tyr Ile His Gln Asp Ser Phe Lys Glu Arg Asn Thr Thr Leu
805 810 815
Val Arg Ser Phe Asp Ser Gly Asp Leu Ile Asn Val Ser Val Pro Ile
820 825 830
Gly Ile Thr Phe Glu Arg Phe Ser Arg Asn Glu Arg Ala Ser Tyr Glu
835 890 845
34
SUBSTITUTE SHEET (R;ULE 2B)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
Ala Thr Val Ile Tyr Val Ala Asp Val Tyr Arg Lys Asn Pro Asp Cys
850 855 860
Thr Thr Ala Leu Leu Ile Asn Asn Thr Ser Trp Lys Thr Thr Gly Thr
865 870 875 880
Asn Leu Ser Arg Gln Ala Gly Ile Gly Arg AIa Gly Ile Phe Tyr Ala
885 890 895
Phe Ser Pro Asn Leu Glu Val Thr Ser Asn Leu Se:r Met Glu Ile Arg
900 905 910
Gly Ser Ser Arg Ser Tyr Asn Ala Asp Leu Gly Gl:y Lys Phe Gln Phe
915 920 925
<210> 15
<211> 930
<212> PRT
<213> Chlamydia pneumoniae
<400> 15
Met Lys Ile Pro Leu His Lys Leu Leu Ile Ser Ser Thr Leu Val Thr
1 5 10 15
Pro Ile Leu Leu Ser Ile Ala Thr Tyr Gly Ala Asp Ala Ser Leu Ser
20 25 30
Pro Thr Asp Ser Phe Asp Gly Ala GIy Gly Ser Th:r Phe Thr Pro Lys
35 40 45
Ser Thr Ala Asp Ala Asn Gly Thr Asn Tyr Val Leu Ser Gly Asn Val
50 55 60
Tyr Ile Asn Asp Ala Gly Lys Gly Thr Ala Leu Th:r Gly Cys Cys Phe
65 70 75 80
Thr Glu Thr Thr Gly Asp Leu Thr Phe Thr Gly Ly., Gly Tyr Ser Phe
85 90 95
Ser Phe Asn Thr Val Asp Ala Gly Ser Asn Ala Gly Ala Ala Ala Ser
100 105 110
Thr Thr Ala Asp Lys Ala Leu Ile Phe Thr Gly Phi Ser Asn Leu Ser
115 120 125
Phe Ile Ala Ala Pro Gly Thr Thr Val Ala Ser Gly Lys Ser Thr Leu
130 135 140
Ser Ser Ala Gly Ala Leu Asn Leu Thr Asp Asn Gl~,r Thr Ile Leu Phe
145 150 155 160
Ser Gln Asn Val Ser Asn Glu Ala Asn Asn Asn G1_~ Gly Ala I1e Thr
165 170 175
SUBSTITUTE SHEET (13ULE 26)

CA 02352759 2001-05-31
WO 00/32794 PCT/CA99/01147
Thr Lys Thr Leu Ser Ile Ser Gly Asn Thr Ser Ser Ile Thr Phe Thr
180 185 190
Ser Asn Ser Ala Lys Lys Leu Gly Gly Ala Ile Tyr Ser Ser Ala Ala
195 200 205
Ala Ser Ile Ser Gly Asn Thr Gly Gln Le.u Val Phe Met Asn Asn Lys
210 215 220
Gly Glu Thr Gly Gly Gly Ala Leu Gly Phe Giu Ala Ser Ser Ser Ile
225 230 235 240
Thr Gln Asn Ser Ser Leu Phe Phe Ser Gly Asn Thr Ala Thr Asp Ala
245 250 2S5
Ala Gly Lys Gly Gly Ala Ile Tyr Cys Glu Lys Thr Gly Glu Thr Pro
260 265 ~ 270
Thr Leu Thr Tle Ser Gly Asn Lys Ser Leu Thr Phe Al.a Glu Asn Ser
275 280 285
Ser Val Thr Gln Gly Gly Ala Ile Cys Ala His Gly Leu Asp Leu Ser
290 295 300
Ala Ala Gly Pro Thr Leu Phe Ser Asn Asn Arg Cys Gly Asn Thr Ala
305 310 3I5 320
A1a Gly Lys Gly Gly Ala Ile Ala Ile Ala Asp Ser Gly Ser Leu Ser
325 330 335
Leu Ser Ala Asn Gln Gly Asp I1e Thr Phe Leu Gly Asn Thr Leu Thr
390 345 350
Ser Thr Ser Ala Pro Thr Ser Thr Arg Asn Ala Ile Tyr Leu Gly Ser
355 360 365
Ser Ala Lys Ile Thr Asn Leu Arg Ala Ala Gln Gly Gln Ser Ile Tyr
370 375 380
Phe Tyr Asp Pro Ile Ala Ser Asn Thr Thr Gly Ala Ser Asp Val Leu
385 390 395 400
Thr Ile Asn Gln Pro Asp Ser Asn Ser Pro Leu Asp Tyr Ser Gly Thr
405 410 415
ile Val Phe Ser Gly Glu Lys Leu Ser Ala Asp Glu Ala Lys Ala Ala
420 425 430
Asp Asn Phe Thr Ser Ile Leu Lys Gln Pro Leu Ala Leu Ala Ser Gly
435 440 445
Thr Leu Ala Leu Lys Gly Asn Val Glu Leu Asp Val Asn Gly Phe Thr
450 455 460
Gin Thr Glu Gly Ser Thr Leu Leu Met Gln Pro Gly Thr Lys Leu Lys
465 470 475 480
38
SUBSTITUTE SHEET (R~JLE 26)

CA 02352759 2001-05-31
WO 00/32794 PCTICA99/01147
Ala Asp Thr Glu Ala Ile Ser Leu Thr Lys Leu Val Val Asp Leu Ser
485 490 495
Ala Leu Glu Gly Asn Lys Ser Val Sex IIe Glu Thr Ala GIy Ala Asn
500 505 510
Lys Thr Ile Thr Leu Thr Ser Pro Leu Val Phe Gln Asp Ser Ser Gly
515 520 525
Asn Phe Tyr Glu Ser His Thr I1e Asn Gln Ala Phe Thr Gln Pro Leu
530 535 540
Val Val Phe Thr Ala Ala Thr Ala Ala Ser Asp Ile Tyr Ile Asp Ala
545 550 555 560
Leu Leu Thr Ser Pro Val Gln Thr Pro Glu Pro His Tyr Gly Tyr Gln
565 570 575
Gly His Trp Glu Ala Thr Trp Ala Asp Thr Ser Thr Ala Lys Ser Gly
580 585 590
Thr Met Thr Trp Val Thr Thr Gly Tyr Asn Pro Asn Pro Glu Arg Arg
595 600 605
Ala Ser Val Val Pro Asp Ser Leu Trp Ala Ser Phe Thr Asp Ile Arg
610 615 620
Thr Leu Gln Gln Ile Met Thr Ser Gln Ala Asn Ser Ile Tyr Gln Gln
625 630 635 640
Arg Gly Leu Trp Ala Ser Gly Thr Ala Asn Phe Phe His Lys Asp Lys
645 650 655
Ser Gly Thr Asn Gln Ala Phe Arg His Lys Ser Tyr Gly Tyr Ile VaI
660 665 670
Gly Gly Ser Ala Glu Asp Phe Ser Glu Asn Ile Phe Ser Val Ala Phe
675 680 685
Cys Gln Leu Phe Gly Lys Asp Lys Asp Leu Phe Iie Val Glu Asn Thr
690 695 700
Ser His Asn Tyr Leu Ala Ser Leu Tyr Leu Gln His Arg Ala Phe Leu
705 7.10 715 720
Gly Gly Leu Pro Met Pro Ser Phe Gly Ser Ile Thr Asp Met Leu Lys
725 730 735
Asp Ile Pro Leu Ile Leu Asn Ala Gln Leu Ser Tyr Ser Tyr Thr Lys
740 745 750
Asn Asp Met Asp Thr Arg Tyr Thr Ser Tyr Pro Glu Ala Gln Gly Ser
755 760 765
Trp Thr Asn Asn Ser Gly Ala Leu Glu Leu Gly Gly Ser Leu A1a Leu
770 775 780
37
SU9ST3TUTE SHEET (R~11.E 26~

CA 02352759 2001-05-31
WO 00/32794 PCTICA99I01147
Tyr Leu Pro Lys Glu Ala Pro Phe Phe Gln Gly Tyr Phe Pro Phe Leu
785 790 795 800
Lys Phe Gln Ala Val Tyr Ser Arg Gln Gln Asn Phe Lys Glu Ser Gly
805 810 815
Ala Glu Ala Arg Ala Phe Asp Asp Gly Asp Leu Vai. Asn Cys Ser.Ile
820 825 830
Pro Val Gly Ile Arg Leu Glu Lys Ile Ser Glu AsF~ Glu Lys Asn Asn
835 840 845
Phe Glu Ile Ser Leu Ala Tyr Ile Gly Asp Val Tyr Arg Lys Asn Pro
850 $55 860
Arg Ser Arg Thr Ser Leu Met Val Ser,Gly Ala Ser Trp Thr Ser Leu
865 870 875 880
Cys Lys Asn Leu Ala Arg Gln Ala Phe Leu Ala Sex' Ala Gly Ser His
885 890 895
Leu Thr Leu Ser Pro His Val Glu Leu Ser Gly Glu. Ala Ala Tyr Glu
900 905 910
Leu Arg Gly Ser Ala His Ile Tyr Asn Val Asp Cys Gly Leu Arg Tyr
915 920 925
Ser Phe
930
<210> 16
<211> 293
<212> PRT
<213> Chlamydia pneumoniae
<400> lb
Met Leu Ser Ser Leu Ile Arg Asp Ser Phe Pro Leu Leu Ile Leu Leu
1 5 10 15
Pro Thr Phe Leu Ala Ala Leu G1y Ala Ser Val Ala Gly Gly Val.Met
20 25 30
Gly Thr Tyr Ile Val Val Lys Arg Ile Val Ser Ile Ser Gly Ser Ile
35 40 45
Ser His Ala Ile Leu Gly Gly Ile Gly Leu Thr Leu Trp Ile Gln Tyr
50 55 60
Lys Leu His Leu Ser Phe Phe Pro Met Tyr Gly Ala Ile Val Gly Ala
b5 70 75 80
Iie Phe Leu Ala Leu Cys Ile Gly Lys Ile His Leu Lys Tyr Gln Glu
85 90 95
$$
SUBSTITUTE SHEET (RULE 25j

CA 02352759 2001-05-31
WO OO132~94 PCT/CA99/OI I47
Arg Glu Asp Ser Leu Ile Ala Met I1e Trp Sex Val Gly Met Ala Ile
100 105 110
Gly Ile Ile Phe Ile Sex Arg Leu Pro Thr Phe Asn Gly Glu Leu Ile
115 120 125
Asn Phe Leu Phe Gly Asn Ile Leu Trp Val Thr Pro Ser Asp Leu Tyr
130 135 190
Ser Leu Gly Ile Phe Asp Leu Leu Val Leu Gly Ile Val Val Leu Cys
145 150 155 160
His Thr Arg Phe Leu Ala Leu Cys Phe Asp Glu Arg '.Pyr Thr Ala Leu
165 170 175
Asn His Cys Ser Val Gln Leu Trp Tyr Phe Leu Leu heu Val Leu Thr
180 185 190
Ala Ile Thr Ile Val Met Leu Ile Tyr Val Met Gly 7"hr Ile Leu Met
195 200 205
Leu Ser Met Leu Val Leu Pro Val Ala Ile Ala Cys Arg Phe Ser Tyr
210 215 220
Lys Met Thr Arg Ile Met Phe I1e Ser Val Leu Leu Asn Ile Leu Cys
225 230 235 240
Ser Phe Ser Gly Ile Cys Ile Ala Tyr Cys Leu Asp Phe Pro Val Gly
245 250 255
Pro Thr Ile Ser Leu Leu Met Gly Leu Gly Tyr Thr Ala Ser Leu Cys
260 265 270
Val Lys Lys Arg Tyr Asn Pro Ser Thr Pro Ser Pro Val Ser Pro GIu
275 280 285
Ile Asn Thr Asn Val
290
39
sussTrru~ sHE~r tau~.F 2s~
$$
SUBSTITUTE SHEET (RUL