Note: Descriptions are shown in the official language in which they were submitted.
CA 02353306 2001-05-29
WO 00!44909 PCT/USOO/OI772
TITLE
NUCLEIC ACID SEQUENCES ENCODING ISOFLAVONE SYNTHASE
This application claims the benefit of U.S. Provisional Application No.
60/117,769,
filed ~anuary 27, 1999, U.S. Provisional Application No. 60/144,783, filed
July 20. 1999,
and U.S. Provisional Application No. 60/156,094, filed September 24, 1999.
FIELD OF THE INVENTION
This invention is in the field of plant molecular biology. More specifically,
this
invention pertains to nucleic acid sequences encoding isoflavone synthase and
their use in
producing isoflavones.
BACKGROUND OF THE INVENTION
Isoflavonoids represent a class of secondary metabolites produced in legumes
by a
branch of the phenylpropanoid pathway and include such compounds as
isoflavones,
isoflavanones, rotenoids, pterocarpans, isoflavans, quinone derivatives, 3-
aryl-4-hydroxy-
coumarins, 3-arylcoumarins, isoflav-3-enes, coumestans, alpha-
methyldeoxybenzoins,
1 ~ 2-arylbenzofurans, isoflavanol, coumaronochromone and the like. In plants,
these
compounds are known to be involved in interactions with other organisms and to
participate
in the defense responses of legumes against phytopathogenic microorganisms
(Dewick,
P. M. (1993) in The Flavonoids, Advances in Research Since 1986, Harbome, J.
B. Ed.,
pp. 117-238, Chapman and Hall, London). Isoflavonoid-derived compounds also
are
involved in symbiotic relationships between roots and rhizobial bacteria which
eventually
result in nodulation and nitrogen-fixation (Phillips, D. A. ( 1992) in Recent
Advances in
Phytochemistry. Vol. 26, pp 201-231, Stafford, H. A. and Ibrahim, R. K., Eds,
Pleneum
Press, New York), and overall they have been shown to act as antibiotics,
repellents,
attractants, and signal compounds (Bart, W. and Welle, R. (1992) Phenolic
Metabolism in
Plants, pg 139-164, Ed by H. A. Stafford and R. K. Ibrahim, Plenum Press, New
York).
Isoflavonoids have also been reported to have physiological activity in animal
and
human studies. For example, it has been reported that the isoflavones found in
soybean
seeds possess antihemolytic (Maim, M., et al. (1976) J. Agric. Food Chem.
2:1174-1177),
antifungal (Maim, M., et al. ( 1974) J. Agr. Food Chem. 22:806-810),
estrogenic (Price, K. R.
and Fenwick, G. R. (1985) Food Addit. Contam. 2:73-106), tumor-suppressing
(Messina, M.
and Barnes, S. ( 1991 ) J. Natl. Cancer Inst. 83:54 I -546; Peterson, G., et
al. ( I 991 ) Biochem.
Biophys. Res. Commun. 179:661-667), hypolipidemic (Mathur, K., et al. (1964)
J. Nutr.
84:201-204), and serum cholesterol-lowering (Sharma, R. D. (1979) Lipids
14:535-540)
effects. These epidemiological studies indicate that isoflavones in soybean
protein products,
3 S when taken as a dietary supplement, may produce many significant health
benefits.
Free isoflavones rarely accumulate to high levels in soybeans. Instead they
are usually
conjugated to carbohydrates or organic acids. Soybean seeds contain three
types of
1
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
isoflavones in four different forms: the aglycones, daidzein, genistein and
glycitein; the
glucosides, daidzin, genistin and glycitin; the acetylgucosides, 6"-O-
acetyldaidzin, 6"-O-
acetylgenistin and 6"-O-acetylglycitin; and the malonylglucosides, 6"-O-
malonyldaidzin,
6"-O-malonylgenistin and 6"-O-malonylglycitin. In accordance with the present
invention.
all of these compounds are included in the term isoflavonoids. The content of
isoflavonoids
in soybean seeds is quite variable and is affected by both genetics and
environmental
conditions such as growing location and temperature during seed fill
(Tsukamoto, C., et al. ,
(1995) J. Agric. Food Chem. 43:1184-I 192; Wang, H. and Murphy, P. A. (1994)
J. Agric.
Food Chem. 42:1674-1677). In addition, isoflavonoid content in legumes can be
stress-
induced by pathogenic attack, wounding, high UV light exposure and pollution
(Dixon, R.
A. and Paiva, N. L. (1995) Plant Cell 7:1085-1097).
The biosynthetic pathway for isoflavonoids in soybean and their relationship
with
several other classes of phenylpropanoids is presented in Figure 1. Many of
the enzymes
involved in the synthesis of isoflavonoids in legumes have been identified and
many of the
I 5 genes in the pathway have been cloned. These include three P450-dependent
monooxygenases, cinnamate 4-hydoxylase (Potts, J. R. M., et al. (1974) J.
Biol. Chem.
249: 5019-5026), isoflavone 2'-hydroxylase (Akashi, T. et al. ( I 998)
Biochem. Biophys. Res.
Commun. 251: 67-70), and dihydroxypterocarpan 6a-hydroxylase (Schopfer, C. R.,
et. al.
(1998) FEBSLett. 432:182-186). However. to date the gene encoding isoflavone
synthase,
the first step in the phenylpropanoid branch that commits metabolic
intermediates to the
synthesis of isoflavonoids, has been neither identified nor cloned from any
species. In this
central reaction, 2S-flavanone is converted into an isoflavonoid such as
genistein and
daidzein. The enzymatic reaction for this oxidative aryl migration step was
first reported by
Hagmann, M. L. and Grisebach, H. ((1984) FEBSLett. 175:199-202). The reaction
involves
a P450 monoxygenase-mediated conversion of the 2S-flavanone to a 2-
hydroxyisoflavanone,
followed by conversion to the isoflavonoid. This last step is possibly
mediated by a soluble
dehydratase (Kochs, G. and Grisenbach, H. (1985) Eur. J. Biochem. 155:311-
318).
However, the 2-hydroxyisoflavanone intermediate was described as unstable and
could
convert directly to genistein.
Cytochrome P450-dependant monooxygenases comprise a large group of heme-
containing enzymes, most of which catalyze NADPH- and 02-dependant
hydroxylation
reactions. Most of these enzymes do not use NADPH directly, but rely upon an
interaction
with a flavoprotein known as a P450 reductase that transfers electrons from
the cofactor to
the P450. Cloning of plant P450s by traditional protein purification
strategies has been
difficult, as these membrane-bound proteins are often very unstable and are
typically present
in low abundance. PCR-based cloning strategies using sequence homologies
between P450s
has increased dramatically the number of P450 genes cloned. However, the in
vivo activity
2
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
of many of these cloned genes remains unknown and they are classified simply
as P450s,
and are grouped into families based solely on sequence homology (Chapple, C.
(1998) Annu.
Rev. Plant Physiol. Plant Mol. Bio. 49: 311-343). Proteins that are greater
than 55%
identical are designated as members of the same subfamily, while P450s that
are 97%
identical, or greater, are assumed to be allelic variants of the same gene
{Chapple, C. ( 1998)
Annu. Rev. Plant Physiol. Plant Mol. Bio. 49: 311-343).
Efforts to determine in vivo activities of existing P450 clones are
increasing. Most
efforts involve expressing genes or cDNAs for P450s in yeast or insect cell
systems, and
then screening for a particular activity. For example, isoflavone 2'-
hydroxylase (Akashi, T.,
et al. (1998) Biochem. Biophys. Res. Commun. 251:67-70) and
dihydroxypterocarpan
6a-hydroxylase (Schopfer, C. R., et al. (1998) FEBSLetters 432:182-186) were
identified in
this manner.
The physiological activities associated with isoflavonoids in both plants and
humans
makes the manipulation of their contents in crop plants highly desirable. For
example,
increasing levels of isoflavonoid in soybean seeds would increase the
efficiency of
extraction and lower the cost of isoflavone-related products sold today for
use in either
reduction of serum cholesterol or in estrogen replacement therapy. Decreasing
levels of
isoflavonoid in soybean seeds would be beneficial for production of soy-based
infant
formulas where the estrogenic effects of isoflavonoid are undesirable. Raising
levels of
isoflavonoid phytoalexins in vegetative plant tissue could increase plant
defenses to
pathogen attack, thereby improving plant disease resistance and lowering
pesticide use rates.
Manipulation of isoflavonoid levels, in roots could lead to improved
nodulation and
increased efficiencies of nitrogen fixation. To date, however, it has proven
difficult to
develop soybean or other plant lines with consistently high levels of
isoflavonoid. Because
isoflavone synthase is the central reaction in pathways producing
isoflavonoids,
identification of this functional gene is extremely important, and its
manipulation via
molecular techniques is expected to allow production of soybeans and other
plants with
high, stable levels of isoflavonoid. Introduction of the isoflavone synthase
gene in non-
legume crop species including, but not limited to, corn, wheat, rice,
sunflower, and canola
could lead to synthesis of isoflavonoids. The expression of isoflavonoids
would confer to
these species disease resistance and/or properties which produce
human/livestock health
benefits.
Substrates for isoflavone synthase may be limiting for synthesizing very high
levels of
isoflavonoids in soybean, or for synthesizing isoflavonoids in non-legumes. It
is desirable to
increase the flux of metabolites through the phenylpropanoid pathway to
provide additional
amounts of substrate to those occurring naturally. Different stress conditions
such as UV
irradiation, phosphate starvation, prolonged exposure to cold, and chemical
(such as
3
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
herbicide) treatment can cause activation of the phenylpropanoid pathway.
While these
treatments may produce the desired substrate availability, it is more
desirable to have a
genetic means of activating the phenylpropanoid pathway. It is known that
expression of
genes encoding certain transcription factors can regulate the expression of
various genes that
encode enzymes of the phenylpropanoid pathway. These include, but are not
limited to, the
C1 myb-type transcription factor of maize and the AmMyb305 of Antirrhinum
majus. The
C 1 myb-type transcription factor of maize, in conjunction with the myc-type
transcription
factor R, activates chalcone synthase and chalcone isomerase genes (Grotewold,
E., et al.
(1998) Plant Cell 10:721-740). The Antirrhinum majus AmMyb305 activates the
phenylalanine ammonia lyase promoter (Sablowski, R. W., et al. ( 1994) EMBO J.
13:128-137). Transcription factors such as these may be expressed in host
plant cells to
activate expression of genes in the phenylpropanoid pathway thereby increasing
the encoded
enzyme activities and the flux of compounds through the pathway. Increases in
the
precursors to substrates of isoflavone synthase would enhance the production
of
1 ~ isoflavonoids.
SUMMARY OF THE INVENTION
The instant invention relates to isolated nucleic acid sequences encoding
isoflavone
synthase. In addition, this invention relates to nucleic acid sequences that
are
complementary to nucleic acid sequences encoding isoflavone synthase. The
nucleic acid
sequences may be of genomic or cDNA origin and may contain introns.
In another embodiment, the instant invention relates to chimeric genes
encoding
isoflavone synthase or to chimeric genes that comprise nucleic acid sequences
that are
complementary to the nucleic acid sequences encoding the enzyme, operably
linked to
suitable regulatory sequences, wherein expression of the chimeric genes
results in
production of levels of isoflavone synthase in transformed host cells that are
altered (i.e.,
increased or decreased) from the levels produced in untransformed host cells.
In a further embodiment, the instant invention concerns a transformed host
cell
comprising in its genome a chimeric gene encoding an isoflavone synthase that
is operably
linked to suitable regulatory sequences. Expression of the chimeric gene
results in
production of altered levels of the enzyme in the transformed host cell. The
transformed
host cell can be of eukaryotic or prokaryotic origin, and includes cells
derived from higher
plants and microorganisms. The invention also includes transformed plants that
arise from
transformed host cells of higher plants, and seeds derived from such
transformed plants.
An additional embodiment of the instant invention concerns a method of
altering the
level of expression of a plant isoflavone synthase in a transformed host cell
comprising
transforming a host cell with a chimeric gene comprising a nucleic acid
sequence (cDNA or
genomic DNA) encoding an isoflavone synthase operably linked to suitable
regulatory
4
CA 02353306 2001-05-29
WO 00/44909 PC'f/US00/01772
sequences and growing the transformed host cell under conditions that are
suitable for
expression of the chimeric gene wherein expression of the chimeric gene
results in
production of altered levels of isoflavone synthase in the transformed host
cell. The altered
levels of isoflavone synthase may be higher due to overexpression, or may be
lower due to
cosuppression or anti sense suppression.
A further embodiment of the instant invention is a method for increasing the
amount of
one or more isoflavonoids in a host cell. The method comprising the steps of
transforming a
host cell with a chimeric gene comprising a nucleic acid sequence encoding an
isoflavone
synthase operably linked to suitable regulatory sequences and growing the
transformed host
cell under conditions that are suitable for expression of the chimeric gene
wherein
expression of the chimeric gene results in production of an amount of
isoflavonoids in the
transformed host cell that is greater than the amount of isoflavonoids that
are produced in a
cell that is not transformed with the chimeric gene.
A further embodiment of the instant invention is a method for decreasing the
amount
1 ~ of one or more isoflavonoids in a host cell. The method comprising the
steps of
transforming a host cell with a chimeric gene comprising a nucleic acid
sequence encoding
all or a substantial portion of an isoflavone synthase operably linked to
suitable regulatory
sequences and growing the transformed host cell under conditions that are
suitable for
expression of the chimeric gene wherein expression of the chimeric gene
results in
production of an amount of isoflavonoids in the transformed host cell that is
less than the
amount of isoflavonoids that are produced in a cell that is not transformed
with the chimeric
gene. The invention also includes transformed plants that arise from
transformed host cells
of higher plants, and seeds derived from such transformed plants.
An additional embodiment of the instant invention concerns a method for
obtaining a
nucleic acid sequence encoding all or substantially all of an amino acid
sequence encoding
isoflavone synthase.
A still further embodiment of the instant invention concerns a transformed
host cell
comprising a chimeric gene encoding isoflavone synthase and at least one
chimeric gene
encoding a transcription factor that can regulate expression of one or more
genes in the
phenylpropanoid pathway. The invention also includes transformed plants that
arise from
transformed host cells of higher plants, and seeds derived from such
transformed plants.
A further embodiment is a method of increasing the amount of one or mare
isoflavonoids in a host cell comprising transforming a host cell with a
chimeric gene having
a nucleic acid sequence encoding an isoflavone synthase operably linked to
suitable
regulatory sequences and with at least one chimeric gene having a nucleic acid
sequence
encoding a transcription factor that regulates expression of genes in the
phenylpropanoid
pathway, and growing the transformed host cell under conditions that are
suitable for
CA 02353306 2001-05-29
WO 00/44909 PCT/US00l01772
expression of the chimeric genes wherein expression of the chimeric genes
result in
production of an amount of one or more isoflavonoids in the transformed host
cell that is
greater than the amount of the isoflavonoids that are produced in a cell that
is not
transformed with the chimeric genes. The invention also includes transformed
plants that
arise from transformed host cells of higher plants, and seeds derived from
such transformed
plants.
Yet a further embodiment of the present invention is a method of altering the
level of
isoflavonoids in a plant cell that is transformed with a chimeric isoflavone
synthase gene
comprising exposing said cell to a phenylpropanoid pathway-altering agent. The
phenylpropanoid pathway-altering agent may be a transcription factor or
stress, for example.
Stress includes and is not limited to ultraviolet light, temperature,
pressure, phosphate level,
and herbicide treatment. The transcription factors may be a C 1 myb-type
transcription factor
of maize and a myc-type transcription factor R, or a chimera containing the
maize R region
between the C 1 DNA binding domain and the C 1 activation domain.
1 ~ BIOLOGICAL DEPOSIT
The following transformed yeast strain and vector plasmid have been deposited
with
the American Type Culture Collection (ATCC), 10801 University Boulevard,
Manassas, VA
20110-2209, and bears the following designation, accession number and date of
deposit.
Yeast Strain Accession Number Date of Deposit
Isoflavone Synthase GM1 ATCC 203606 January 27, 1999
Plasmid DP7951 ATCC PTA-371 July 20, 1999
BRIEF DESCRIPTION OF THE
DRAWINGS AND SEQUENCE DESCRIPTIONS
The invention can be more fully understood from the following detailed
description
and the accompanying drawings and Sequence Listing which form a part of this
application.
Figure 1 depicts the phenylpropanoid metabolic pathway, and illustrates
particularly
the biosynthesis of isoflavonoids.
Figure 2A and B presents the results of HPLC analyses of naringenin standards.
Figure 2A presents the absorption spectra recorded at 260 nm and Figure2B
presents the
absorption spectra recorded at 280 nm.
Figure 3A and B presents the results of HPLC analyses of genistein standards.
Figure
3A presents the absorption spectra recorded at 260 nm and Figure 3B presents
the absorption
spectra recorded at 280 nm.
Figure 4A and B presents the results of HPLC analyses of genistein and
naringenin
from microsomes derived from elicitor-treated soybean hypocotyls. Absorption
spectra was
6
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
recorded at 260 nm (Figure 4A) and 280 nm (Figure 4B). Naringenin and
genistein peaks
are indicated.
Figure SA and B presents the results of HPLC analyses of genistein and
naringenin
from microsomes derived from non-treated soybean hypocotyls. Absorption
spectra was
recorded at 260 nm (Figure ~A) and 280 nm (Figure ~B). Naringenin and
genistein peaks
are indicated.
Figure 6A and B presents the results of HPLC analyses of genistein and
naringenin
from microsomes derived from elicitor-treated soybean cell suspension
cultures. Absorption
spectra was recorded at 260 nm (Figure 6A) and 280 nm (Figure 6B). Naringenin
and
genistein peaks are indicated.
Figure 7A and B presents the results of HPLC analyses of genistein and
naringenin
from microsomes derived from non-treated soybean cell suspension cultures.
Absorption
spectra was recorded at 260 nm (Figure 7A) and 280 nm (Figure 7B). Naringenin
peak is
indicated.
Figure 8A and B presents the results of HPLC analyses of genistein and
naringenin in
75 ~,g of yeast microsomal proteins prior to incubation in the presence of
NADPH cofactor
(negative control). Absorption spectra was recorded at 260 nm (Figure 8A) and
280 nm
(Figure 8B).
Figure 9A and B presents the results of HPLC analyses of genistein and
naringenin in
75 p,g of yeast microsomal proteins after 1 h incubation in the presence of
NADPH cofactor.
Absorption spectra was recorded at 260 nm (Figure 9A) and 280 nrn (Figure 9B).
Figure l0A and B presents the results of HPLC analyses of genistein and
naringenin in
75 ~g of yeast microsomal proteins after 2 h incubation in the presence of
NADPH cofactor.
Absorption spectra was recorded at 260 nm (Figure l0A) and 280 nm (Figure 1
OB).
Figure 11 A and B presents the results of HPLC analyses of genistein and
naringenin in
75 pg of yeast microsomal proteins after 3 h incubation in the presence of
NADPH cofactor.
Absorption spectra was recorded at 260 nm (Figure 11A) and 280 nm (Figure
11B).
Figure I2 A and B presents the results of HPLC analyses of genistein and
naringenin
in 75 ~g of yeast microsomal proteins after 4 h incubation in the presence of
NADPH
cofactor. Absorption spectra was recorded at 260 nm (Figure 12A) and 280 nm
(Figure 12B).
Figure 13A and B presents the results of HPLC analyses of genistein and
naringcnin in
75 pg of yeast microsomal proteins after 14 h incubation in the presence of
NADPH
cofactor. Absorption spectra was recorded at 260 nm (Figure 13A) and 280 run
(Figure 13B).
Figure 14A and B presents the results of HPLC analyses of genistein and
naringenin in
75 ~g of yeast microsomal proteins after 40 minutes incubation in the presence
of NADPH
7
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
cofactor. Absorption spectra was recorded at 260 nm (Figure 14A) and 280 nm
(Figure 14B).
Figure 15A and B presents the results of HPLC analyses of genistein and
naringenin in
150 pg of yeast microsomal proteins after 40 minutes incubation in the
presence of NADPH
cofactor. Absorption spectra was recorded at 260 nm (Figure 1 ~A) and 280 nm
(Figure 15B).
Figure 16A and B presents the results of HPLC analyses of genistein and
naringenin in
75 pg of yeast microsomal proteins after 4 h incubation in the absence of
NADPH cofactor.
Absorption spectra was recorded at 260 nm (Figure 16A) and 280 nm (Figure
16B).
Figure 17A and B presents a comparison of the absorption spectra recorded by a
diode
array detector of a genistein standard (Figure 17A; with an HPLC retention
time of 3.128),
and a reference spectrum (Figure 17B).
Figure 18A and B presents a comparison of the absorption spectra recorded by a
diode
array detector of the newly synthesized peak located at the retention time of
3.131 in the
HPLC analysis of yeast microsomes incubated for 14 h in the presence of NADPH
on
Figure 18A and the reference spectrum on Figure 18B.
Figure 19A, B. C, D and E presents the electropositive mass spectrum obtained
for the
peaks observed by HPLC analysis of yeast microsome samples incubated with
liquiritigenin.
Figure 19A corresponds to the peak at 273.2 m/z, Figure 19B corresponds to the
peak at
271 m/z, Figure 19C corresponds to "peak 2", Figure 19D corresponds to
liquiritigenin
standard (the substrate), and Figure 19E corresponds to daidzein standard (the
product).
Figure 20 depicts the plasmid map of pOY160.
Figure 21 depicts the plasmid map of pOY206.
Figure 22 depicts the plasmid map of pDP7951, having an ATCC accession
No. PTA-371.
Figure 23 depicts the plasmid map of pOY162.
Figure 24 depicts the plasmid map of pKS93s.
Figure 25 depicts the distribution of the isoflavonoid content of 25
transgenic lines
transformed with the isoflavone synthase sequence from clone sgs 1 c.pk006.o20
and a
control line. Bars represent the mean of three analyses for each line. The
result of single
factor ANOVA is presented along with the least significant difference (LSD) at
P _<0.01.
The asterisk above the bars represents those lines with mean isoflavonoid
concentrations
significantly lower than control (bars 1 through 6), or those lines with mean
isoflavonoid
concentrations significantly greater than control (bars 15 through 25) based
on the LSD test
atP<0.01.
Figure 26 depicts the comparison of the rates of genistein and daidzein
synthesis by
microsomes of the yeast transformant GM1. Samples representing incubation
periods of 2,
8
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
4, 6, 8 and 10 h were analyzed by HPLC and the peak areas for genistein and
daidzein were
quantitated by calibration with authentic genistein and daidzein standards.
Assays were
repeated three times and the average amount of isoflavonoid synthesized at
each time point
was plotted, with vertical lines representing error bars.
Figure 27 presents the results of HPLC analyses of daidzein and liquiritigenin
in
extracts from BMS cells before incubation in the presence of NADPH cofactor
(Panels A
and B) and after 10 h incubation in the presence of NADPH cofactor (Panels C
and D).
Absorption spectra was recorded at 260 nm (Panels A and C) and 280 nm (Panels
B and D).
Figure 28 depicts the plasmid map of pCW 109-IFS.
The following sequence descriptions and Sequences Listing attached hereto
comply
with the rules governing nucleotide and/or amino acid sequence disclosures in
patent
applications as set forth in 37 C.F.R. ~1.821-1.825. The Sequence Listing
contains the one
letter code for nucleotide sequence characters and the three letter codes for
amino acids as
defined in conformity with the IUPAC-IUB standards described in Nucleic Acids
Research
IS 13:3021-3030 (1985) and in the Biochemical Journal 219 (No. 2):345-373
(1984) which are
herein incorporated by reference. The symbols and format used for nucleotide
and amino
acid sequence data comply with the rules set forth in 37 C.F.R. ~ 1.822.
SEQ ID NO:1 is the nucleotide sequence comprising the soybean cDNA insert in
clone
sgslc.pk006.o20 encoding an enzymatically active isoflavone synthase.
SEQ ID N0:2 is the deduced amino acid sequence of an enzymatically active
soybean
isoflavone synthase derived from the nucleotide sequence of SEQ ID NO:1.
SEQ ID N0:3 is the nucleotide sequence of an oligonucleotide primer used in
the
construction of yeast strain WHTI.
SEQ ID N0:4 is the nucleotide sequence of an oligonucleotide primer used in
the
construction of the yeast strain WHT1.
SEQ ID NO:S is the nucleotide sequence of an oligonucleotide primer used to
amplify
the cDNA insert from clone sgs 1 c.pk006.o20.
SEQ ID N0:6 is the nucleotide sequence of an oligonucleotide primer used to
amplify
the cDNA insert from clone sgslc.pk006.o20.
SEQ ID N0:7 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the soybean clone with sequence corresponding to the one
found in NCBI
General Identifier No. 2739005. This oligonucleotide sequence corresponds to
nucleotides 3
to 26 of the NCBI sequence.
SEQ ID N0:8 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the soybean clone with sequence corresponding to the one
found in NCBI
General Identifier No. 2739005. This oligonucleotide sequence corresponds to
the
complement of nucleotides 1798 to 1824 of the NCBI sequence.
9
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
SEQ ID N0:9 is the nucleotide sequence of an enzymatically active soybean
isoflavone synthase having an NCBI General Identifier No. 2739005.
SEQ ID NO:10 is the deduced amino acid sequence of an enzymatically active
soybean isoflavone synthase derived from of SEQ ID N0:9 and having an NCBI
General
Identifier No. 2739006.
SEQ ID NO:11 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the isoflavone synthase genes from mung bean, red clover,
white clover,
lentil, hairy vetch, alfalfa, lupine and snow pea.
SEQ ID N0:12 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the isoflavone synthase genes from mung bean, red clover,
white clover,
lentil, hairy vetch, alfalfa, lupine and snow pea.
SEQ ID N0:13 is the nucleotide sequence of an oligonucleotide primer used in
the
second round of PCR amplification of the white clover, lentil, hairy vetch,
alfalfa and lupine
isoflavone synthase genes:
1 ~ SEQ ID N0:14 is the nucleotide sequence of an oligonucleotide primer used
in the
second round of PCR amplification of the white clover, lentil, hairy vetch,
alfalfa and lupine
isoflavone synthase genes.
SEQ ID NO:15 is the nucleotide sequence comprising the alfalfa cDNA insert in
clone
alfalfal encoding an almost entire alfalfa isoflavone synthase.
SEQ ID N0:16 is the deduced amino acid sequence of an almost entire alfalfa
isoflavone synthase derived from the nucleotide sequence of SEQ ID NO:1 S.
SEQ ID N0:17 is the nucleotide sequence comprising the hairy vetch cDNA insert
in
clone hairy vetch 1 encoding an almost entire hairy vetch isoflavone synthase.
SEQ ID NO:18 is the deduced amino acid sequence of an almost entire hairy
vetch
isoflavone synthase derived from the nucleotide sequence of SEQ ID N0:17.
SEQ ID N0:19 is the nucleotide sequence comprising the lentil cDNA insert in
clone
lentill encoding an almost entire lentil isoflavone synthase.
SEQ ID N0:20 is the deduced amino acid sequence of an almost entire lentil
isoflavone synthase derived from the nucleotide sequence of SEQ ID N0:19.
SEQ ID N0:21 is the nucleotide sequence comprising the lentil cDNA insert in
clone
lentil2 encoding an almost entire lentil isoflavone synthase.
SEQ ID N0:22 is the deduced amino acid sequence of an almost entire lentil
isoflavone synthase derived from the nucleotide sequence of SEQ ID N0:21.
SEQ ID N0:23 is the nucleotide sequence comprising the mung bean cDNA insert
in
clone mung beam encoding an entire mung bean isoflavone synthase.
SEQ ID N0:24 is the deduced amino acid sequence of an entire mung bean
isoflavone
synthase derived from SEQ ID N0:23.
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
SEQ ID N0:25 is the nucleotide sequence comprising the mung bean cDNA insert
in
clone mung bean2 encoding an entire mung bean isoflavone synthase.
SEQ ID NC :26 is the deduced amino acid sequence of an entire mung bean
isoflavone
synthase derived from SEQ ID N0:25.
SEQ ID N0:27 is the nucleotide sequence comprising the mung bean cDNA insert
in
clone mung bean3 encoding an entire mung bean isoflavone synthase.
SEQ ID N0:28 is the deduced amino acid sequence of an entire mung bean
isoflavone
synthase derived from SEQ ID N0:27.
SEQ ID N0:29 is the nucleotide sequence comprising the mung bean cDNA insert
in
clone mung bean4 encoding an entire mung bean isoflavone synthase.
SEQ ID N0:30 is the deduced amino acid sequence of an entire mung bean
isoflavone
synthase derived from SEQ ID N0:30.
SEQ ID N0:31 is the nucleotide sequence comprising the red clover cDNA insert
in
clone red cloverl encoding an entire red clover isoflavone synthase.
SEQ ID N0:32 is the deduced amino acid sequence of an entire red clover
isoflavone
synthase derived from SEQ ID N0:31.
SEQ ID N0:33 is the nucleotide sequence comprising the red clover cDNA insert
in
clone red clover2 encoding an entire red clover isoflavone synthase.
SEQ ID N0:34 is the deduced amino acid sequence of an entire red clover
isoflavone
synthase derived from SEQ ID N0:33.
SEQ ID N0:35 is the nucleotide sequence comprising the snow pea cDNA insert in
clone snow peal encoding an entire snow pea isoflavone synthase.
SEQ ID N0:36 is the deduced amino acid sequence of an entire snow pea
isoflavone
synthase derived from SEQ ID N0:37.
SEQ ID N0:37 is the nucleotide sequence comprising the white clover cDNA
insert in
clone white cloverl encoding an almost entire white clover isoflavone
svnthase.
SEQ ID N0:38 is the deduced amino acid sequence of an almost entire white
clover
isoflavone synthase derived from SEQ ID N0:37.
SEQ ID N0:39 is the nucleotide sequence comprising the white clover cDNA
insert in
clone white clover2 encoding an almost entire white clover isoflavone
synthase.
SEQ ID N0:40 is the deduced amino acid sequence of an almost entire white
clover
isoflavone synthase derived from SEQ ID N0:39.
SEQ ID N0:41 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the isoflavone synthase coding region in clone sgs i
c.pk006.o20.
SEQ ID N0:42 is the nucleotide sequence of an oligonucleotide primer used for
PCR
amplification of the isoflavone synthase coding region in clone sgs 1
c.pk006.o20.
I1
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
SEQ ID N0:43 is the nucleotide sequence of an oligonucleotide primer used to
determine the transcription of the soybean isoflavone synthase in transgenic
tobacco.
SEQ ID N0:44 is the nucleotide sequence of an oligonucleotide primer used to
determine the transcription of the soybean isoflavone synthase in transgenic
tobacco.
SEQ ID N0:45 is the nucleotide sequence of an oligonucleotide primer to the
maize R
coding region used to amplify genomic DNA to determine the presence of a
chimera
containing the maize R region between the region encoding the C I DNA binding
domain
and the C 1 activation domain (CRC) in transgenic corn cells.
SEQ ID N0:46 is the nucleotide sequence of an oligonucleotide primer to the 3'
untranslated region from potato protease inhibitor II gene used to amplify
genomic DNA to
determine the presence of CRC in transgenic corn cells.
SEQ ID N0:47 is the nucleotide sequence comprising the sugarbeet cDNA insert
in
clone sugarbeetl, encoding an almost entire sugarbeet isoflavone synthase.
SEQ ID N0:48 is the deduced amino acid sequence of an almost entire sugarbeet
I5 isoflavone synthase derived from SEQ ID N0:47.
SEQ ID N0:49 is the, nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean isoflavone synthase coding region in clone
sgs 1 c.pk006.o20.
SEQ ID NO:50 is the nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean isoflavone synthase coding region in clone
sgs 1 c.pk006.o20.
SEQ ID NO:51 is the nucleotide sequence of an oligonucleotide primer used to
amplify the genomic sequence comprising the isoflavone synthase in clone sgs 1
c.pk006.o20.
SEQ ID N0:52 is the nucleotide sequence of a genomic fragment encoding the
isoflavone synthase in clone sgs 1 c.pk006.o20.
SEQ ID N0:53 is the nucleotide sequence of a genomic fragment encoding the
CYP93C1 isoflavone synthase.
SEQ ID N0:54 is the nucleotide sequence comprising the lupine cDNA insert in
clone
lupine 1 encoding an entire lupine isoflavone synthase.
SEQ ID N0:55 is the deduced amino acid sequence of an entire lupine isoflavone
synthase derived from SEQ ID N0:54.
SEQ ID N0:56 is the nucleotide sequence comprising the alfalfa cDNA insert in
clone
alfalfa2 encoding an almost entire alfalfa isoflavone synthase.
SEQ ID N0:57 is the amino acid sequence of an almost entire alfalfa isoflavone
synthase derived from SEQ ID N0:56.
SEQ ID N0:58 is the nucleotide sequence comprising the alfalfa cDNA insert in
clone
alfalfa3 encoding an almost entire alfalfa isoflavone synthase.
12
CA 02353306 2001-05-29
WO 00144909 PCT/US00/OI772
SEQ ID N0:59 is the amino acid sequence of an almost entire alfalfa isoflavone
synthase derived from SEQ ID N0:58.
SEQ ID N0:60 is th°. amino acid sequence comprising the sugarbeet cDNA
insert in
clone sugarbeet2, encoding an almost entire sugarbeet isoflavone synthase.
SEQ ID N0:61 is the deduced amino acid sequence of an almost entire sugarbeet
isoflavone synthase derived from SEQ ID N0:60.
SEQ ID N0:62 is the nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean chalcone reductase coding region in clone
src3c.pk009.e4.
SEQ ID N0:63 is the nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean chalcone reductase coding region in clone
src3c.pk009.e4.
SEQ ID N0:64 is the nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean chalcone reductase present in monocot cells.
SEQ ID N0:65 is the nucleotide sequence of an oligonucleotide primer used for
the
PCR amplification of the soybean chalcone reductase present in monocot cells.
SEQ ID N0:66 is the amino acid sequence of the consensus sequence produced by
the
Megalign Program using the Clustal method and the amino acid sequences
depicted in SEQ
ID NOs:2, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 48, 55, 57, 59,
and 61.
DETAILED DESCRIPTION OF THE INVENTION
The instant invention discloses nucleotide and amino acid sequences for
isoflavone
synthases from legumes such as soybean, alfalfa, lupine, hairy vetch, lentil,
mung bean, red
clover, snow pea, and white clover and non-legumes such as sugarbeet. As the
enzyme that
catalyzes the first step of the isoflavonoid branch of the phenylpropanoid
pathway (see
Figure 1 ), altering the level of this enzyme may be useful for changing
isoflavonoid content.
Plant P450 enzymes catalyze a diverse range of reactions, including molecular
transformations in primary metabolism, and in the metabolism and
detoxification of
xenobiotics. Although tentative identification of any given gene or conceptual
translation
product as a P450 is relatively simple based on its similarity to other known
P450s, the
assignment of actual catalytic function cannot necessarily be inferred from
nucleic acid or
protein sequence information alone. The instant disclosure demonstrates and
teaches the
identification of a cDNA from soybean that encodes isoflavone synthase based
on the ability
of the encoded polypeptide to convert the normal substrate for the reaction,
2S-flavanone, to
genistein. Demonstration of activity has been accomplished in subcellular
fractions of a
yeast strain, WHT1, which has been specifically altered to also express a P450
reductase
from Hehanthus tuberosum. In this manner, and using the materials identified
and described
herein, other nucleic acid sequences from soybean and from other plants that
are predicted to
encode P450s may be tested to determine whether any of those P450's possess
isoflavone
synthase activity.
13
CA 02353306 2001-05-29
WO 00/449(19 PCTNS00/01772
"The isoflavonoids are biogeneticaly related to the flavonoids but constitute
a
distinctly separate class in that they contain a rearranged C 1 S skeleton and
may be regarded
as derivatives of 3-phenylchroman." Isoflavonoids.Dewick, P.M. (1982) in The
Flavonoids:
Advances in Research, Harborne, J. B. and Mabry, T.J., Ed., pp 535-640,
Chapman and Hall
Ltd, New York. Oxidative rearrangement of a flavanone precursor with a 2,3-
aryl shift
yields an isoflavonoid. Isoflavones are the most abundant of the natural
isoflavonoid
derivatives, with over 160 isoflavone aglycones being recognized.
In the context of this disclosure, a number of terms shall be utilized. As
used herein, a
"nucleic acid sequence" is a polymer of RNA or DNA that is single- or double-
stranded,
optionally containing synthetic, non-natural or altered nucleotide bases. A
nucleic acid
sequence in the form of a polymer of DNA may be comprised of one or more
segments of
cDNA, genomic DNA or synthetic DNA.
As used herein, "substantially similar" refers to nucleic acid sequences
wherein
changes in one or more nucleotide bases results in substitution of one or more
amino acids,
but do not affect the functional properties of the polypeptide encoded by the
nucleotide
sequence. "Substantially similar" also refers to nucleic acid sequences
wherein changes in
one or more nucleotide bases does not affect the ability of the nucleic acid
sequence to
mediate alteration of gene expression by gene silencing through for example
antisense or co-
suppression technology. "Substantially similar" also refers to modifications
of the nucleic
acid fragments of the instant invention such as deletion or insertion of one
or more
nucleotides that do not substantially affect the functional properties of the
resulting
transcript vis-a-vis the ability to mediate gene silencing or alteration of
the functional
properties of the resulting protein molecule. It is therefore understood that
the invention
encompasses more than the specific exemplary nucleotide or amino acid
sequences and
includes functional equivalents thereof.
For example, it is well known in the art that antisense suppression and co-
suppression
of gene expression may be accomplished using nucleic acid fragments
representing less than
the entire coding region of a gene, and by nucleic acid fragments that do not
share 100%
sequence identity with the gene to be suppressed. Moreover, alterations in a
nucleic acid
sequence which result in the production of a chemically equivalent amino acid
at a given
site, but do not effect the functional properties of the encoded polypeptide,
are well known in
the art. Thus, a codon for the amino acid alanine, a hydrophobic amino acid,
may be
substituted by a codon encoding another less hydrophobic residue, such as
glycine, or a more
hydrophobic residue, such as valine, leucine, or isoleucine. Similarly,
changes which result
in substitution of one negatively charged residue for another, such as
aspartic acid for
glutamic acid, or one positively charged residue for another, such as lysine
for arginine, can
also be expected to produce a functionally equivalent product. Nucleotide
changes which
14
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
result in alteration of the N-terminal and C-terminal portions of the
polypeptide molecule
would also not be expected to alter the activity of the polypeptide. Each of
the proposed
modifications is well within the routine skill in the art, as is determination
of retention of
biological activity of the encoded products.
Moreover, substantially similar nucleic acid sequences may also be
characterized by
their ability to hybridize. Estimates of such homology are provided by either
DNA-DNA or
DNA-RNA hybridization under conditions of stringency as is well understood by
those
skilled in the art (Homes and Higgins, Eds. ( 1985) Nucleic Acid
Hybridisation, IRL Press,
Oxford, U.K.). Stringency conditions can be adjusted to screen for moderately
similar
sequences, such as homologous sequences from distantly related organisms, to
highly similar
sequences, such as genes that duplicate functional enzymes from closely
related organisms.
Post-hybridization washes determine stringency conditions. One set of
preferred conditions
uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for
15 min,
then repeated with 2X SSC, 0.5% SDS at 45°C for 30 min, and then
repeated twice with
0.2X SSC, 0.5% SDS at 50°C for 30 min. A more preferred set of
stringent conditions uses
higher temperatures in which the washes are identical to those above except
for the
temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased
to 60°C.
Another preferred set of highly stringent conditions uses two final washes in
O.1X SSC,
0.1% SDS at 65°C.
Substantially similar nucleic acid sequences of the instant invention may also
be
characterized by their percent identity to the nucleic acid sequences
disclosed herein, as
determined by algorithms commonly employed by those skilled in this art.
Preferred are
those nucleic acid sequences whose sequences are at least about 85% identical
and more
preferably at least about 90% identical to the nucleotide sequences reported
herein. More
preferred are nucleic acid sequences that are at least about 90% identical and
more
preferably at least about 95% identical to the nucleotide sequences reported
herein. More
preferred are nucleic acid sequences that are 95% identical to the nucleotide
sequences
reported herein. Sequence alignments and percent identity calculations were
performed
using the Megalign program of the LASARGENE bioinformatics computing suite
(DNASTAR Inc., Madison, WI). Multiple alignment of the sequences was performed
using
the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153)
with the
default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default
parameters for pairwise alignments using the Clustal method were KTUPLE 2, GAP
PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4.
Substantially similar nucleic acid sequences of the instant invention may also
be
characterized by the percent identity of the amino acid sequences that they
encode to the
amino acid sequences disclosed herein, as determined by algorithms commonly
employed
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
by those skilled in this art. Preferred are those nucleic acid sequences whose
nucleotide
sequences encode amino acid sequences that are at least about 95% identical
and even more
preferably at least about 98% identical to the amino acid sequences reported
herein.
Sequence alignments and percent identity calculations were performed using the
Megalign
program of the LASARGENE bioinformatics computing suite (DNASTAR Inc..
Madison,
WI). Multiple alignment of the sequences was performed using the Clustal
method of
alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default
parameters
(GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5
and DIAGONALS SAVED=S.
A "substantial portion" of an amino acid or nucleotide sequence comprises an
amino
acid or a nucleotide sequence that is sufficient to afford putative
identification of the protein
or gene that the amino acid or nucleotide sequence comprises. Amino acid and
nucleotide
sequences can be evaluated either manually by one skilled in the art, or by
using computer-
based sequence comparison and identification tools that employ algorithms such
as BLAST
(Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see
also www.ncbi.nlm.nih.gov/BLAST/). In general, a sequence of ten or more
contiguous
amino acids or thirty or more contiguous nucleotides is necessary in order to
putatively
identify a polypeptide or nucleic acid sequence as homologous to a known
protein or gene.
Moreover, with respect to nucleotide sequences, gene-specific oligonucleotide
probes
comprising 30 or more contiguous nucleotides may be used in sequence-dependent
methods
of gene identification (e.g., Southern hybridization) and isolation (e.g., in
situ hybridization
of bacterial colonies or bacteriophage plaques). In addition, short
oligonucleotides of 12 or
more nucleotides may be used as amplification primers in PCR in order to
obtain a particular
nucleic acid sequence comprising the primers. Accordingly, a "substantial
portion" of a
nucleotide sequence comprises a nucleotide sequence that will afford specific
identif cation
and/or isolation of a nucleic acid sequence comprising the sequence. The
instant
specification teaches amino acid and nucleotide sequences encoding
polypeptides that
comprise one or more particular plant proteins. The skilled artisan, having
the benefit of the
sequences as reported herein, may now use all or a substantial portion of the
disclosed
sequences for purposes known to those skilled in this art. Accordingly, the
instant invention
comprises the complete sequences as reported in the accompanying Sequence
Listing, as
well as substantial portions of those sequences as defined above.
"Codon degeneracy" refers to divergence in the genetic code permitting
variation of
the nucleotide sequence without effecting the amino acid sequence of an
encoded
polypeptide. Accordingly, the instant invention relates to any nucleic acid
sequence
comprising a nucleotide sequence that encodes all or a substantial portion of
the amino acid
16
CA 02353306 2001-05-29
WO 00/44909 PC'T/US00/01772
sequences set forth herein. The skilled artisan is well aware of the "codon-
bias" exhibited
by a specific host cell in usage of nucleotide codons to specify a given amino
acid.
Therefore, when synthesizing a nucleic ac~d sequence for improved expression
in a host cell,
it is desirable to design the nucleic acid fragment such that its frequency of
codon usage
approaches the frequency of preferred codon usage of the host cell.
"Synthetic nucleic acid fragments" can be assembled from oligonucleotide
building
blocks that are chemically synthesized using procedures known to those skilled
in the art.
These building blocks are ligated and annealed to form larger nucleic acid
sequences which
may then be enzymatically assembled to construct the entire desired nucleic
acid sequence.
"Chemically synthesized", as related to nucleic acid sequence, means that the
component
nucleotides were assembled in vitro. Manual chemical synthesis of nucleic acid
sequences
may be accomplished using well established procedures, or automated chemical
synthesis
can be performed using one of a number of commercially available machines.
Accordingly,
the nucleic acid sequences can be tailored for optimal gene expression based
on optimization
of nucleotide sequence to reflect the codon bias of the host cell. The skilled
artisan
appreciates the likelihood of successful gene expression if codon usage is
biased towards
those codons favored by the host. Determination of preferred codons can be
based on a
survey of genes derived from the host cell where sequence information is
available.
"Gene" refers to a nucleic acid sequence that expresses a specific protein,
including
regulatory sequences preceding (S' non-coding sequences) and following (3' non-
coding
sequences) the coding sequence. "Native gene" refers to a gene as found in
nature with its
own regulatory sequences. "Chimeric gene" refers any gene that is not a native
gene,
comprising regulatory and coding sequences that are not found together in
nature.
Accordingly, a chimeric gene may comprise regulatory sequences and coding
sequences that
are derived from different sources, or regulatory sequences and coding
sequences derived
from the same source, but arranged in a manner different than that found in
nature.
"Endogenous gene" refers to a native gene in its natural location in the
genome of an
organism. A "foreign" gene refers to a gene not normally found in the host
organism, but
that is introduced into the host organism by gene transfer. Foreign genes can
comprise
native genes inserted into a non-native organism, or chimeric genes. A
"transgene" is a gene
that has been introduced into the genome by a transformation procedure.
"Coding sequence" refers to a nucleotide sequence that codes for a specific
amino acid
sequence. "Regulatory sequences" refer to nucleotide sequences located
upstream (5' non-
coding sequences), within, or downstream (3' non-coding sequences) of a coding
sequence,
and which influence the transcription, RNA processing or stability, or
translation of the
associated coding sequence. Regulatory sequences may include promoters,
translation
leader sequences, introns, and polyadenylation recognition sequences.
17
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
"Promoter" refers to a nucleotide sequence capable of controlling the
expression of a
coding sequence or functional RNA. In general, a coding sequence is located 3'
to a
promoter sequence. The promoter sequence consists of proximal and more distal
upstream
elements, the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a
nucleotide sequence which can stimulate promoter activity. It may be an innate
element of
the promoter or a heterologous element inserted to enhance the level and/or
tissue-specificity
of a promoter. Promoters may be derived in their entirety from a native gene,
or be
composed of different elements derived from different promoters found in
nature, or even
comprise synthetic nucleotide segments. It is understood by those skilled in
the art that
different promoters may direct the expression of a gene in different tissues
or cell types, or at
different stages of development, or in response to different environmental
conditions.
Promoters which cause a nucleic acid sequence to be expressed in most cell
types at most
times are commonly referred to as "constitutive promoters". "Organ-specific"
or
"development-specific" promoters are those that direct gene expression almost
exclusively in
1 ~ specific organs. such as leaves or seeds, or at specific development
stages in an organ, such
as in early or late embryogenesis, respectively. New promoters of various
types useful in
plant cells are constantly being discovered; numerous examples may be found in
the
compilation by Okamuro and Goldberg ( 1989) Biochemistry of Plants 1~:1-82. It
is further
recognized that since in most cases the exact boundaries of regulatory
sequences have not
been completely def ned, nucleic acid sequences of different lengths may have
identical
promoter activity.
The expression of foreign genes in plants is well established (De Blaere et
al. (1987)
Meth. Enrymol. 143: 277-291 ). Proper level of expression of mRNAs may require
the use of
different chimeric genes utilizing different promoters. Such chimeric genes
can be
transferred into host plants either together in a single expression vector or
sequentially using
more than one vector. Expression in plants will use regulatory sequences
functional in such
plants.
The origin of the promoter chosen to drive the expression of the coding
sequence is not
critical as long as it has sufficient transcriptional activity to accomplish
the invention by
expressing translatable mRNA for the desired protein genes in the desired host
tissue.
The "translation leader sequence" refers to a nucleotide sequence located
between the
promoter sequence of a gene and the coding sequence. The translation leader
sequence is
present in the fully processed mRNA upstream of the translation start
sequence. The
translation leader sequence may affect processing of the primary transcript to
mRNA,
mRNA stability or translation efficiency. Examples of translation leader
sequences have
been described (Turner and Foster (1995) Molecular Biotechnology 3:225-236).
18
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OI772
The "3' non-coding sequences" refer to nucleotide sequences located downstream
of a
coding sequence and include polyadenylation recognition sequences and other
sequences
encoding regulatory signals capable of affecting anRNA processing or gene
expression. The
polyadenylation signal is usually characterized by affecting the addition of
polyadenylic acid
S tracts to the 3' end of the mRNA precursor. The use of different 3' non-
coding sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
"RNA transcript" refers to the product resulting from RNA polymerase-catalyzed
transcription of a DNA sequence. When the RNA transcript is a perfect
complementary
copy of the DNA sequence, it is referred to as the primary transcript or it
may be a RNA
I 0 sequence derived from posttranscriptional processing of the primary
transcript and is
referred to as the mature RNA. "Messenger RNA (mRNA)" refers to the RNA that
is
without introns and that can be translated into polypeptide by the cell.
"cDNA" refers to a
double-stranded DNA that is complementary to and derived from mRNA. "Sense"
RNA
refers to an RNA transcript that includes the mRNA and so can be translated
into a
1 ~ polypeptide by the cell. ''Antisense RNA" refers to an RNA transcript that
is
complementary to all or part of a target primary transcript or mRNA and that
blocks the
expression of a target gene (see U.S. Patent No. x,107,065, incorporated
herein by
reference). The complementarity of an antisense RNA may be with any part of
the specific
nucleotide sequence, i.e., at the 5' non-coding sequence. 3' non-coding
sequence, introns, or
20 the coding sequence. "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme
RNA, or other RNA that may not be translated but yet has an effect on cellular
processes.
The term "operably linked" refers to the association of two or more nucleic
acid
sequences on a single nucleic acid sequence so that the function of one is
affected by the
other. For example, a promoter is operably linked with a coding sequence when
it is capable
25 of affecting the expression of that coding sequence (i.e., that the coding
sequence is under
the transcriptional control of the promoter). Coding sequences can be operably
linked to
regulatory sequences in sense or antisense orientation.
The term "expression", as used herein, refers to the transcription and stable
accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid
sequence of
30 the invention. Expression may also refer to translation of mRNA into a
polypeptide.
"Antisense inhibition" refers to the production of antisense RNA transcripts
capable of
suppressing the expression of the target protein. "Overexpression" refers to
the production
of a gene product in transgenic organisms that exceeds levels of production in
normal or
non-transformed organisms. "Co-suppression" refers to the production of sense
RNA
35 transcripts capable of suppressing the expression of identical or
substantially similar foreign
or endogenous genes (U.S. Patent No. 5,231,020, incorporated herein by
reference).
19
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
"Altered levels" refers to the production of gene products) in transgenic
organisms in
amounts or proportions that differ from that of normal or non-transformed
organisms.
"Transformation" refers to the transfer of a nucleic acid sequence into the
genome of a
host organism, resulting in genetically stable inheritance. Host organisms
containing the
transformed nucleic acid fragments are referred to as "transgenic" organisms.
Examples of
methods of plant transformation include Agrobacterium-mediated transformation
(De Blaere
et ai. ( 1987) Meth. Enzymol. 143:277) and particle-accelerated or "gene gun"
transformation
technology (Klein et al. (1987) Nature (London) 327:70-73; U.S. Patent No.
4,945,050,
incorporated herein by reference).
i 0 Standard recombinant DNA and molecular cloning techniques used herein are
well
known in the art and are described more fully in Sambrook et al. Molecular
Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor,
1989
(hereinafter "Sambrook").
A nucleic acid sequence encoding a soybean isoflavone synthase was isolated
and
15 identified from a cDNA library. Nucleic acid sequences encoding three
alfalfa, one hairy
vetch, one snow pea, one lupine, two lentil, two red clover, two white clover,
two sugarbeet,
and four mung bean isoflavone synthases have been isolated-using RT-PCR.
Nucleic acid
sequences encoding two soybean isoflavone synthases have been isolated from
genomic
DNA. The nucleic acid sequences of the instant invention may be used to
isolate cDNAs
20 and genes encoding homologous enzymes from the same or other plant species.
Isolation of
homologous genes using sequence-dependent protocols is well known in the art.
Examples
of sequence-dependent protocols include, but are not limited to, methods of
nucleic acid
hybridization, and methods of DNA and RNA amplification as exemplified by
various uses
of nucleic acid amplification technologies (e.g., polymerase chain reaction,
ligase chain
25 reaction).
For example, genes encoding other isoflavone synthase proteins, either as
cDNAs or
genomic DNAs, could be isolated directly by using all or a portion of the
instant nucleic acid
sequence as aDNA hybridization probe to screen libraries from any desired
plant employing
methodology well known to those skilled in the art. Specific oligonucleotide
probes based
30 upon the instant nucleic acid sequence can be designed and synthesized by
methods known
in the art (Sambrook). Moreover, the entire sequence can be used directly to
synthesize
DNA probes by methods known to the skilled artisan such as random primers DNA
labeling,
nick translation, or end-labeling techniques, or RNA probes using available in
vitro
transcription systems. In addition, specific primers can be designed and used
to amplify a
35 part of or full-length of the instant sequences. The resulting
amplification products can be
labeled directly during amplification reactions or labeled after amplification
reactions, and
CA 02353306 2001-05-29
WO 00!44909 PCT/US00/01772
used as probes to isolate full-length cDNA or genomic fragments under
conditions of
appropriate stringency.
In addition, two short segments of the instant nucleic acid sequences may be
used in
polymerase chain reaction protocols to amplify longer nucleic acid sequences
encoding
homologous genes from DNA or RNA. The polymerase chain reaction may also be
performed on a library of cloned nucleic acid sequences wherein the sequence
of one primer
is derived from the instant nucleic acid sequences, and the sequence of the
other primer takes
advantage of the presence of the polyadenyIic acid tracts to the 3' end of the
mRNA
precursor encoding plant genes. Alternatively, the second primer sequence may
be based
upon sequences derived from the cloning vector. For example, the skilled
artisan can follow
the RACE protocol (Frohman et al. (1988) Proc. Natl. Acad Sci. USA 85:8998-
9002) to
generate cDNAs by using PCR to amplify copies of the region between a single
point in the
transcript and the 3' or 5' end. Primers oriented in the 3' and 5' directions
can be designed
from the instant sequences. Using commercially available 3' RACE or 5' RACE
systems
(BRL}, specific 3' or 5' cDNA sequences can be isolated (Ohara et al. ( 1989)
Procr Natl.
Acad. Sci. USA 86:5673-5677; Loh et al. ( 1989) Science 243:217-220). Products
generated
by the 3' and 5' RACE procedures can be combined to generate full-length cDNAs
(Frohman
and Martin (1989) Techniques 1:165).
Availability of the instant nucleotide and deduced amino acid sequences
facilitates
immunological screening of cDNA expression libraries. Synthetic peptides
representing
portions of the instant amino acid sequences may be synthesized. These
peptides can be
used to immunize animals to produce polyclonal or monoclonal antibodies with
specificity
for peptides or proteins comprising the amino acid sequences. These antibodies
can be then
be used to screen cDNA expression libraries to isolate full-length cDNA clones
of interest
(Lerner (1984) Adv. Immunol. 36:1; Sambrook).
The nucleic acid sequence of the instant invention may be used to create
transgenic
plants and transgenic seeds in which expression of nucleic acid sequences (or
their
complements) encoding the disclosed enzyme result in levels of the
corresponding
endogenous enzyme that are higher or lower than normal. Alternatively,
expression of the
instant nucleic acid sequence may result in the production of the encoded
enzyme in cell
types or developmental stages in which they are not normally found. Either
strategy would
have the effect of altering the level of isoflavonoids.
For example, overexpression of isoflavone synthase may result in an increase
in
isoflavonoid content in legumes. Increased isoflavonoid content in legumes has
been shown
to be associated with beneficial health effects in humans. In contrast,
certain soy food
products would benefit from lower levels of isoflavonoid due to adverse
effects on flavor.
21
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OI772
Overexpression of the proteins of the instant invention may be accomplished by
first
constructing a chimeric gene in which the coding region is operably linked to
a promoter
capable of directing expression of a gene in the desired tissues at the
desired stage of
development. The chimeric gene may comprise promoter sequences and translation
leader
sequences derived from the same genes. 3' Non-coding sequences encoding
transcription
termination signals may also be provided. The instant chimeric gene may also
comprise one
or more introns in order to facilitate gene expression.
Plasmid vectors comprising the isolated polynucleotide (or chimeric gene) may
be
constructed. The choice of plasmid vector is dependent upon the method that
will be used to
transform host plants. The skilled artisan is well aware of the genetic
elements that must be
present on the plasmid vector in order to successfully transform, select and
propagate host
cells containing the chimeric gene. The skilled artisan will also recognize
that different
independent transformation events will result in different levels and patterns
of expression
(Jones et al. ( I 985) EMBO J. ~t:2411-2418; De Almeida et al. ( 1989) Mol.
Gen. Genetics
218:78-86), and thus that multiple events must be screened in order to obtain
lines
displaying the desired expression level and pattern. Such screening may be
accomplished by
Southern analysis of DNA, Northern analysis of mRNA expression, Western
analysis of
protein expression, or phenotypic analysis.
The nucleic acid sequence of the instant invention may be used to create
transgenic
plants that have increased expression of the disclosed enzyme and that are
additionally
transformed with a chimeric gene encoding a transcription factor that
regulates expression of
one or more genes in the phenyipropanoid pathway. The chimeric transcription
factor gene
has regulatory sequences such that its expression is coordinated with that of
the isoflavone
synthase gene developmentally and preferably within the same cell type. This
combination
of expression of isoflavone synthase and transcription factor regulating
phenylpropanoid
pathway genes has the effect of enhancing the level of isoflavonoid synthesis
due to
increased levels of substrates for isoflavone synthase. The chimeric
transcription factor
gene regulates expression of at least one gene in the phenylpropanoid pathway.
While not
intending to be bound by any theory or theories of operation it is believed to
regulate as
many as two, three or four genes in the phenylpropanoid pathway.
For example, a plant cell that does not naturally produce isoflavonoids and
does not
have an active phenylpropanoid pathway would not produce the substrates for
isoflavone
synthase to convert to isoflavonoids. Activation of the phenylpropanoid
pathway in the
desired cells or at the desired developmental stage would provide these
substrates allowing
the synthesis of isoflavonoids.
The present invention is also directed to a method of altering the level of
isoflavonoids
in a cell comprising exposing said cell to a phenylpropanoid pathway altering
agent. The
22
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
cell may be a plant cell such as a monocot, including and not limited to corn,
or a dicot, such
as soybean, for example. A phenylpropanoid pathway altering agent may be any
agent that
results in an increase or decrease in the level of expression of an
°.nzyme in the
phenylpropanoid pathway, such as isoflavone synthase, phenylalanine ammonia
lyase,
s chalcone synthase, among others. Such phenylpropanoid pathway altering
agents include
and are not limited to a transcription factor and stress. Transcription
factors include and are
not limited to chimeric transcription factors, a chimera containing the maize
R region
between the region encoding the C 1 DNA binding domain and the C 1 activation
domain
(CRC) for example. Stresses to a plant cell include ultraviolet light,
temperature, pressure,
chemicals including and not limited to herbicides, and phosphate level.
Phosphate levels
may be increased or decreased such that decreasing phosphate levels may result
in phosphate
starvation.
It may also be desirable to reduce or eliminate expression of genes encoding
the
instant polypeptides in plants for some applications. In order to accomplish
this, a chimeric
gene designed for co-suppression of the instant polypeptide can be constructed
by linking a
gene or gene sequence encoding that polypeptide to plant promoter sequences.
Alternatively, a chimeric gene designed to express antisense RNA for all or
part of the
instant nucleic acid sequence can be constructed by linking the gene or gene
sequence in
reverse orientation to plant promoter sequences. Either the co-suppression or
antisense
chimeric genes could be introduced into plants via transformation wherein
expression of the
corresponding endogenous genes are reduced or eliminated.
Molecular genetic solutions to the generation of plants with altered gene
expression
have a decided advantage over more traditional plant breeding approaches.
Changes in plant
phenotypes can be produced by specifically inhibiting expression of one or
more genes by
antisense inhibition or cosuppression (U. S. Patent Nos. 5,190,931, 5,107,065
and
5,283,323). An antisense or cosuppression construct would act as a dominant
negative
regulator of gene activity. While conventional mutations can yield negative
regulation of
gene activity these effects are most likely recessive. The dominant negative
regulation
available with a transgenic approach may be advantageous from a breeding
perspective. In
addition, the ability to restrict the expression of specific phenotype to the
reproductive
tissues of the plant by the use of tissue specific promoters may confer
agronomic advantages
relative to conventional mutations which may have an effect in all tissues in
which a mutant
gene is ordinarily expressed.
The person skilled in the art will know that special considerations are
associated with
the use of antisense or cosuppresion technologies in order to reduce
expression of particular
genes. For example, the proper level of expression of sense or antisense genes
may require
the use of different chimeric genes utilizing different regulatory elements
known to the
23
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
skilled artisan. Once transgenic plants are obtained by one of the methods
described above,
it will be necessary to screen individual transgenics for those that most
effectively display
the desired phenotype. Accordingly, the skilled artisan will develop methods
for screening
large numbers of transfonmants. The nature of these screens will generally be
chosen on
practical grounds. For example, one can screen by looking for changes in gene
expression
by using antibodies specific for the protein encoded by the gene being
suppressed, or one
could establish assays that specifically measure enzyme activity. A preferred
method will be
one which allows large numbers of samples to be processed rapidly, since it
will be expected
that a large number of transformants will be negative for the desired
phenotype.
The instant isoflavone synthases (or portions of the enzymes) may be produced
in
heterologous host cells, particularly in the cells of microbial hosts, and can
be used to
prepare antibodies to the enzymes by methods well known to those skilled in
the art. The
antibodies are useful for detecting the enzymes in situ in cells or in vitro
in cell extracts.
Preferred heterologous host cells for production of isoflavone synthase are
yeast hosts.
Yeast expression systems and expression vectors containing regulatory
sequences that direct
high level expression of foreign proteins are well known to those skilled in
the art. Any of
these could be used to construct chimeric genes for production of the instant
isoflavone
synthase. These chimeric genes could then be introduced into appropriate hosts
via
transformation to provide high level expression of the enzymes. An example of
a vector for
high level expression of the instant isoflavone synthase in a yeast host is
provided
(Example 5).
All or a substantial portion of the nucleic acid sequences of the instant
invention may
also be used as probes for genetically and physically mapping the genes that
they are a part
of, and as markers for traits linked to those genes. Such information may be
useful in plant
breeding in order to develop lines with desired phenotypes. For example, the
instant nucleic
acid sequences may be used as restriction sequence length polymorphism (RFLP)
markers.
Southern blots (Maniatis) of restriction-digested plant genomic DNA may be
probed with
the nucleic acid sequences of the instant invention. The resulting banding
patterns may then
be subjected to genetic analyses using computer programs such as MapMaker
(Larder et al.
(1987) Genomics 1:174-181) in order to construct a genetic map. In addition,
the nucleic
acid sequences of the instant invention may be used to probe Southern blots
containing
restriction endonuclease-treated genomic DNAs of a set of individuals
representing parent
and progeny of a defined genetic cross. Segregation of the DNA polymorphisms
is noted
and used to calculate the position of the instant nucleic acid sequence in the
genetic map
previously obtained using this population (Botstein et al. ( 1980) Am. J. Hum.
Genet.
32:314-331 ).
24
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
The production and use of plant gene-derived probes for use in genetic mapping
is
described in Bernatzky and Tanksley (1986) Plant Mol. Biol. Reporter 4(1):37-
4I.
Numerous publications describe genetic mapping of specific cDNA clones using
the
methodology outlined above or variations thereof. For example, F2 intercross
populations.
backcross populations, randomly mated populations, near isogenic lines, and
other sets of
individuals may be used for mapping. Such methodologies are well known to
those skilled
in the art.
Nucleic acid probes derived from the instant nucleic acid sequences may also
be used
for physical mapping (i.e., placement of sequences on physical maps; see
Hoheisel et al. In:
Nonmammalian Genomic Analysis: A Practical Guide, Academic press 1996, pp. 319-
346,
and references cited therein).
In another embodiment, nucleic acid probes derived from the instant nucleic
acid
sequences may be used in direct fluorescence in situ hybridization (FISH)
mapping (Trask
(1991) Trends Genet. 7:149-154). Although current methods of FISH mapping
favor use of
1~ large clones (several to several hundred KB; see Laan et al. (1995) Genome
Research
S:I3-20), improvements in sensitivity may allow performance of FISH mapping
using
shorter probes.
A variety of nucleic acid amplification-based methods of genetic and physical
mapping may be carried out using the instant nucleic acid sequences. Examples
include
allele-specific amplification (Kazazian (/989) J. Lab. Clin. Med 114(2):95-
96),
polymorphism of PCR-amplified fragments (CAPS; Sheffield et al. (1993)
Genomics
16:325-332), allele-specific ligation,(Landegren et al. (1988) Science
241:1077-1080),
nucleotide extension reactions (Sokolov ( 1990) Nucleic Acid Res. 18:3671 ).
Radiation
Hybrid Mapping (Walter et al. ( I 997) Nature Genetics 7:22-28) and Happy
Mapping (Dear
2~ and Cook ( 1989) Nucleic Acid Res. 17:6795-6807). For these methods, the
sequence of a
nucleic acid fragment is used to design and produce primer pairs for use in
the amplification
reaction or in primer extension reactions. The design of such primers is well
known to those
skilled in the art. In methods employing PCR-based genetic mapping, it may be
necessary to
identify DNA sequence differences between the parents of the mapping cross in
the region
corresponding to the instant nucleic acid sequence. This, however, is
generally not
necessary for mapping methods.
The physiological activities associated with isoflavonoids in both plants and
humans
makes the manipulation of their contents in crop plants highly desirable. For
example,
increasing levels of isoflavonoids in soybean seeds would increase the
efficiency of
extraction and lower the cost of isoflavonoid-related products sold.
Decreasing levels of
isoflavonoids in soybean seeds would be beneficial for production of soy-based
infant
formulas where the estrogenic effects of isoflavonoids are undesirable.
Decreasing levels of
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
isoflavonoids may also increase palatability of soy foods. Raising levels of
isoflavonoid
phytoalexins in vegetative plant tissue could increase plant defenses to
pathogen attack,
thereby improving resistance and lowering the need for pesticide use.
Manipulation of
isoflavonoid levels in roots could lead to improved nodulation and increased
efficiencies of
nitrogen fixation. To date, however, it has proven difficult to develop
soybean or other plant
lines with consistently high levels of isoflavonoids.
Identification of the functional isoflavone synthase gene is extremely
important
because isoflavone synthase catalyzes the central reaction in pathways
producing
isoflavonoids. Manipulation of the isoflavone synthase gene via molecular
techniques is
expected to allow production of soybeans and other plants with high, stable
levels of
isoflavonoids. Introduction of the isoflavone synthase gene in non-legume crop
species
including, but not limited to, corn, wheat, rice, sunflower, and canola could
lead to synthesis
of isoflavonoids in these species. Synthesis of isoflavonoids would 1 ) confer
disease
resistance to the crops and/or 2) produce crops which would benefit human
and/or livestock
health.
EXAMPLES
The present invention is further defined in the following Examples, in which
all parts
and percentages are by weight and degrees are Celsius, unless otherwise
stated. It should be
understood that these Examples, while indicating preferred embodiments of the
invention,
are given by way of illustration only. From the above discussion and these
Examples. one
skilled in the art can ascertain the essential characteristics of this
invention, and without
departing from the spirit and scope, thereof, can make various changes and
modifications of
the invention to adapt it to various usages and conditions.
EXAMPLE 1
Microsome Preparation from Elicitor-Treated Soybean Hy_pocotyls
and Elicitor-Treated Cell Suspension Culture
Elicitor Treatment of Soybean Seeds
Soybean seeds were placed on a bed of vermiculite (5 to 6 cm thick) and
covered with
a layer of vermiculite about 2 cm thick. Seeds were germinated for five days
in a growth
chamber until the average length of hypocotyls reached to about 3 to 4 cm. The
growth
chamber was kept at a cycle that consisted of a 14 h light period at
25°C and a 10 h dark
period at 21 °C. Illumination was supplied from cool white fluorescent
and incandescent
lamps that provide a photon flux density of 450 pEm-2s-t. Soybean hypocotyls
were pulled
out from the vermiculite bed and were placed on wet paper towels. The soybean
hypocotyls
were divided into two groups: one of the groups was treated with elicitor and
the other was
not treated.
26
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Elicitor treatment was conducted as follows. The epidermal surfaces of the
hypocotyls
were opened using a razor blade. The incisions were approximately 2 cm long
and 1 to
2 mm deep; one was made on each hypocotyl. Fungal-derived elictors were
prepared by the
method of Sharp et al. (Sharp, J. K. et al. (1984) J. Biol. Chem. 259:1 I3I2-
11320). Twenty
micrograms of acidified fungal elicitors were dissolved in 20 pL of 10 mM
KH~P04, and
were then applied to the wound of a hypocotyl The treated hypocotyls were
incubated for
15 h in the dark at room temperature and 100% humidity. At the end of the
incubation
period, the hypocotyls were sectioned closely below the cotyledonal node and
were
immediately frozen in liquid nitrogen and stored at -76°C until used.
Non-elicitor-treated
hypocotyls were handled in the same manner as were elicitor-treated
hypocotyls, except for
wounding and elicitor application. The non-treated hypocotyls were used as a
negative
control of isoflavone synthase induction.
Elicitor Treatment of Soybean Cell Suspension Culture
Soybean suspension cell cultures were grown at 25°C in 250 mL flasks
that were
tightly covered with two layers of aluminum foil to prevent illumination.
Cells were grown
in 35 mL of Murashige and Skoog medium (Gibco BRL) supplemented with 0.75 mg/L
2,4-dichlorophenoxyacetic acid and 0.55 mg/mL 6-benzyl aminopurine. Cells were
diluted
{1:3 ratio) into fresh medium every 7 days and elicitor treatment was
conducted 3 days after
cell dilution. One hundred fifty milligrams of the same fungal elicitor used
to treat the
hypocotyls was dissolved in I S mL of 10 mM KH~P04 and was filter sterilized.
Five
milligrams of sterile fungal elicitor dissolved in 333 pL 10 mM KH2P04 was
added per
flask. Cells were harvested 15 h after addition of elicitor. The same
suspension culture
conditions were used before and after elicitor treatment. Cells were recovered
using a
Nalgene PES filter unit (0.2 pm) followed by 3 minutes of air flow. Filtered
cells were
immediately frozen in liquid nitrogen and kept at -76°C until used. Non-
elicitor-treated cells
were handled in the same manner, except for the addition of elicitor.
Microsome preparation from soybean hypocotyls and suspension-cultured cells
For preparation of the crude extracts, 3 to 5 g of previously frozen, elicitor-
treated and
non-treated soybean hypocotyls and elicitor-treated and non-treated suspension
cultured cells
were ground in liquid nitrogen using a pre-chilled pestle and mortar. The
powder was added
to 25 mL of extraction buffer (buffer A: O.1M Tris-HCI, pH 7.5, 14 mM ~3-
mercaptoethanol,
20% (w/v) sucrose and 0.8 g of Dowex 1 X2 resin (mesh 200-400)), and the
slurry was stirred
for 20 to 30 minutes in an ice-water bath. The slurry was transferred to
Nalgene Oak Ridge
tubes and centrifuged at 8000 g for 10 minutes at 4°C. The supernate
was carefully
transferred into 13 mL polyallomer tubes which fit into a Sorvall TH641 rotor
and
centrifuged at 160,000 g for 40 minutes to 2 h at 4°C. The precipitated
microsames were
washed twice with the storage buffer (buffer B: 80 mM KH~P04, pH 8.5, 14 mM
27
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
(3-mercaptoethanol, 30% (v/v) glycerol) and resuspended with storage buffer.
The
microsomal pellet was gently homogenized by hand using a disposable plastic
pestle, and the
suspension was divided into several aliquots which were frozen on dry-ice.
Bradford protein
micro assays were used to quantify the protein content of the microsomal
preparations (Bio-
Rad, Richmond, CA). Two microliters of a microsome preparation were diluted
with
198 ~L of distilled water. Forty microliters of this dilution was mixed with
10 uL of
Bio-Rad protein assay solution in a microtiter plate, and the total protein
concentration was
determined by reading the sample in a kinetic microplate reader (Molecular
Devices Inc.),
according to the manufacturer's instructions (Bio-Rad). Microsomes were stored
at -76°C
until used.
EXAMPLE 2
Development of Isoflavone Synthase Assay
An assay to measure isoflavone synthase activity was developed using either of
the two
substrates of isoflavone synthase, (~) naringenin (4',5,7-trihydroxyflavanone;
Sigma.
1 ~ N-5893) or liquiritigenin monohydrate (4',7-dihydroxyflavanone; Indofine,
02-1150S).
dissolved in 80% ethanol. The reaction mixture was prepared at room
temperature and
consisted of 100 p.M naringenin or liquiritigenin, 80 mM K~HP04, 0.5 mM
glutathione
(Sigma, G-4251 ), 20% w/v sucrose, and 30 to I50 p.g of microsome preparation.
The
reaction mixtures were preincubated for 5 minutes without NADPH (synthesis of
genistein
and daidzein requires NADPH as a co-factor). The volume of microsomes and
substrate
added to any one reaction did not exceed 5% and 1%, respectively, of the total
reaction
volume. A typical reaction volume .was 250 pL. The reaction was started by the
addition of
40 nmol of NADPH per each 100 ~L of final reaction volume. The pH of the
reaction
mixture was 8.0 before the addition of the substrate, NADPH and microsomes.
Microsomes were thawed, an aliquot removed and the remaining sample was
immediately frozen on dry ice and stored in the freezer. The reactions using
microsomes
prepared from soybean elicitor-treated hypocotyls were run for incubation
periods of up to
24 h, while the reactions using the yeast microsomes were allowed to run for
incubation
periods of up to 14 h. Following incubation, 200 ~L of ethyl acetate was added
directly to
the mixture and the mixture was shaken for 1 minute using a vortex mixer.
Separation of the
organic phase was accelerated by centrifugation for 2 minutes at 4°C.
The organic phase
was removed and analyzed.
Qualitative and quantitative analyses were performed using a Hewlett Packard I
100
series HPLC and a Hewlett-Packard/Micromass LC/MS. Samples were assayed on a
Hewlett Packard I 100 series HPLC system using either a Li-Chrospher 100 RP-18
column
(S p,m) or a Phenomenex Luna 3u C18 (2) column (150 X 4.6 mm). Using either
column,
samples from in vitro microsome assays in ethyl acetate, were isocratically
separated for
28
CA 02353306 2001-05-29
WO 00/44909 PCT/US00101772
minutes employing 65% methanol as the mobile phase. The second column was used
for
plant samples where the ethyl acetate was evaporated and the samples
resuspended in 80%
methanol. In these cases separation used a 10 minutes linear gradient from
20% methanol/80% 10 mM ammonium acetate, pH 8.3 to 100% methanol using a flow
rate
of 0.8 ml per minute. Genistein and daidzein were monitored by the absorbance
at 260 nm
and naringenin and liquiritigenin were monitored by the absorbance at 280 nm.
Peak areas
were converted to nanograms using, as standards for calibration, authentic
naringenin,
liquiritigenin, genistein, and daidzein (Indofine Chemical Company, Inc.,
Somerville, NJ)
dissolved in ethanol.
Analyses using LC/MS employed 10 ~L of the ethyl acetate phase that had been
first
evaporated with nitrogen gas and resuspended in 100 ~L of 25% acetonitrile in
water. These
samples were analyzed by a Hewlett-Packard/Micromass LC/MS instrument. A
twenty-five
microliter sample was run on a Zorbax Eclipse XDB-C8 reverse-phase column (3 X
150 mm, 3.5 micron) isocratically with 25% of solvent B in solvent A. Solvent
A was 0.1
formic acid in water, and solvent B was 0.1 % formic acid in acetonitrile.
Mass spectrometry
was carried out by electro-spray scanning from 200-400 m/e, using +60 volt
cone voltage.
The diode array signals were monitored between 200-400 nm in both instruments.
The genistein and liquiritigenin signals observed in the in vitro assay
samples were
verified by comparisons of retention time, diode array detected absorption
spectra and mass
spectrometry data to the standards. Figure 2 presents the results of HPLC
analyses of
naringenin standards and Figure 3 presents the results of HPLC analyses of
genistein
standards.
Incubations in the absence of an essential component required for isoflavone
synthase-catalyzed synthesis of isoflavonoid (e.g., NADPH, naringenin,
liquiritigenin, or
microsomes) were performed as negative controls.
Positive control samples consisting of soybean microsomes which were prepared
from
elicitor-treated hypocotyls and suspension culture cells were used to
establish the in vitro
assay system. Optimization of this in vitro assay system was critical for
validation of the
yeast expression system for functional cloning. We observed positive results
(i.e., the
synthesis of genistein) in assays that used either the microsomes of elicitor-
treated soybean
hypocotyls (Figure 4) or those obtained from elicitor-treated cell suspension
cultures
(Figure 6). We observed about six times higher specific enzyme activities of
isoflavone
synthase in the microsomes of elicitor-treated hypocotyls and cell cultures
(Figure 4 and
Figure 6, respectively) than in the microsomes obtained from non-treated
hypocotyls and cell
cultures (Figure 5 and Figure 7, respectively).
29
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OI772
EXAMPLE 3
Composition of Soybean cDNA Library,
Isolation and Seauencin~ of cDNA Clone
A cDNA library was prepared using mRNAs from soybean seeds that had been
allowed to germinate for 4 hours. The library was prepared in Uni-ZAPT"" XR
vector
according to the manufacturer's protocol (Stratagene Cloning Systems, La
Jolla, CA).
Conversion of the Uni-ZAPT"" XR library into a plasmid library was
accomplished according
to the protocol provided by Stratagene. Upon conversion, cDNA inserts were
contained in
the plasmid vector pBluescript. cDNA inserts from randomly picked bacterial
colonies
I O containing recombinant pBluescript plasmids were amplified via polymerase
chain reaction
using primers specific for vector sequences flanking the inserted cDNA
sequences or
plasmid DNA was prepared from cultured bacterial cells. Amplified insert DNAs
or plasmid
DNAs were sequenced in dye-primer sequencing reactions to generate partial
cDNA
sequences (expressed sequence tags or "ESTs"; see Adams, M. D. et al. ( 1991 )
Science
252: I65I-166). The resulting ESTs were analyzed using a Perkin Elmer Model
377
fluorescent sequencer.
EXAMPLE 4
Identification and Characterization of a
cDNA Clone for Isoflavone Synthase
ESTs encoding candidate isoflavone synthases were identified by conducting
BLAST
(Basic Local Alignment Search Tool; Altschul, S. F., et al., (1993) J. Mol.
Biol.
215:403-410; see also www.ncbi.nlm.nih.govBLAST~ searches for similarity to
sequences
contained in the BLAST "nr" database (comprising all non-redundant GenBank CDS
translations, sequences derived from the 3-dimensional structure Brookhaven
Protein Data
Bank, the last major release of the SWISS-PROT protein sequence database,
EMBL, and
DDBJ databases). The cDNA sequences obtained in Example 3 were analyzed for
similarity
to all publicly available DNA sequences contained in the "nr" database using
the BLASTN
algorithm provided by the National Center for Biotechnology Information
(NCBI). The
DNA sequences were translated in all reading frames and compared for
similarity to all
publicly available protein sequences contained in the "nr" database using the
BLASTX
algorithm (Gish, W. and States, D. J. (1993) Nature Genetics 3:266-272)
provided by the
NCBI.
The insert in cDNA clone sgslc.pk006.o20 was identified as a candidate
isoflavone
synthase gene by a BLAST search against the NCBI database. The 5' sequence of
this insert
was determined to be related to Glycine max cytochrome P450 monooxygenase
CYP93Clp
(CYP93C I ) mRNA, the complete coding sequence of which may be found as NCBI
General
Identifier No. 2739005. The CYP93CIp cDNA sequence was obtained using random
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
isolation and screening to identify soybean P450s involved in herbicide
metabolism
(Siminszky B., et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96:1750-1755).
Isoflavone
synthase catalyzes in soybeans the oxidation of 7,4'dihyroxyflavanone
(liquiritigenein) or
5,7,4'trihydroxyflananone (naringenin) to daidzein or genistein respectively.
Earlier
published work (Kochs and Griesbach (1986) Eur-. J. Biochem 1»:311-318; Hashim
et al.
(1990) FEBS 271:219-222) suggested that the enzyme that catalyzes this
reaction is a
cytochrome P450. Accordingly, in order to confirm the identity of the
polypeptide encoded
by the insert in cDNA clone sgslc.pk006.o20 as an isoflavone synthase, the
polypeptide
encoded by this insert was evaluated for its ability to catalyze the formation
of genistein
from naringenin.
The ability of the cDNA insert in clone sgslc.pk006.o20 to encode an
isoflavone
synthase was evaluated by expression of the encoded polypeptide in an
engineered yeast
(Saccharomyces cerivisae) strain. Microsomes prepared from the engineered
yeast strain
transformed with a plasmid encoding the putative isoflavone synthase were
assayed for their
1 S ability to mediate the synthesis of genistein in the presence of substrate
(naringenin).
Yeast strain W303-IB was used as the starting material and modified by
homologous
recombination. The coding sequence of the P450 reductase HT1 isolated from
Helianthus
tuberosus (NCBI General Identifier No. 1359894) was inserted into the
integrative plasmid
pYeDP 110 (Pompon, D. et al. ( 1996) Meth. Enz. 272:51-64). Insertion was
achieved after
PCR amplification for addition of Bam HI and Eco RI restriction sites 5' and
3' of the coding
region, respectively, using the primers listed as SEQ ID N0:3 and SEQ ID N0:4.
5'-CGGGATCCATGCAACCGGAAACCGTCG-3'
[SEQ ID N0:3]
5'-CCGGAATTCTCACCAAACATCACGGAGGTATC-3' [SEQ ID N0:4]
Transformation of W303-I B with the linearized plasmid led to homologous
recombination with the promoter and terminator sequences of the endogenous
yeast
reductase (CPR1 ) resulting in the disruption of the CPR1 gene and replacement
with the
URA3 gene and HTI under the control of the galactose-inducible promoter GAL10-
CYC1.
The resulting strain is designated WHT1.
Plasmid DNA (200 ng) from cDNA clone sgs 1 c.pk006.o20 was used as template
for
PCR with primers that are homologous to the vector sequences flanking the cDNA
cloning
site (SEQ ID NO:S and SEQ ID N0:6).
5'-TCAAGGAGAAAAAACCCCGGATCCATGTTGCTGGAACTTGCACTTGG-3' [SEQ ID NO:S1
5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGCG-3'
[SEQ ID N0:61
31
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OI772
Amplification was performed using the GC melt kit (Clontech) with a 1 M final
concentration of GC melt reagent. Amplification took place in a Perkin Elmer
9700
thermocycler for 30 cycles as follows: 94°C for 30 seconds, 60°C
for 30 seconds, and 72°C
for 1 minute. The amplified insert was then incubated with a modified pRS315
plasmid
(NCBI General Identifier No. 984798; Sikorski, R. S. and Hieter, P. ( 1989)
Genetics
122:19-27) that had been digested with Not I and Spe I. Plasmid pRS315 had
been
previously modified by the insertion of a bidirectional gall/10 promoter
between the Xho I
and Hind III sites. The plasmid was then transformed into the WHT1 yeast
strain using
standard procedures. The insert recombines though gap repair to form the
desired plasmid
(Hua, S. B., et al. (1997) Plasmid 38:91-96.). The resulting transformed yeast
strain is
named Isoflavone Synthase GM 1 (hereinafter referred to as "GM 1 "), and bears
ATCC
Accession No. 203606.
Yeast microsomes were prepared according to the methods of Pompon et al.
(Pompon, D., et al. (1996) Meth. Enz. 272:51-64). Briefly, a yeast colony was
grown
1 s overnight (to saturation) in SG (-Leucine) medium at 30°C with good
aeration. A 1:50
dilution of this culture was made into 500 mL of YPGE medium with adenine
supplementation and allowed to grow at 30°C with good aeration to an
OD6oo of 1.6
(24-30 h). Fifty mL of 20% galactose was added, and the culture was allowed to
grow
overnight at 30°C. The cells were recovered by centrifugation at 5,500
rpm for five minutes
in a Sorvall GS-3 rotor. The cell pellet was resuspended in 80 mL of TEK
buffer (0.1 M KCl
in TE) and left at room temperature for five minutes. The cells were recovered
by
centrifugation as described above. The cell pellet was resuspended in 5 mL of
TES-B (0.6M
sorbitol in TE), and glass beads (0.~ mm diameter) were gently added until
they reached the
surface of the suspension. The cells were disrupted by shaking up and down for
five
minutes, with an agitation frequency of at least once every 0.5 second. Five
mL of TES-B
were added to the crude extract, and the beads were washed with some
agitation. The
supernatant was withdrawn and saved. The wash was repeated twice and the
liquid fractions
were pooled. The combined fractions were clarified by spinning at 11,000 rpm
in a Sorvall
SS34 rotor. The pellet was discarded and the microsomes were precipitated by
the addition
of NaCI to a final concentration of 0.15 M. PEG 4000 was added to a final
concentration of
0.1 g/mL. The mixture was incubated on ice for at least 15 minutes, and the
microsomal
fraction was recovered by at 8,500 rpm for 10 minutes in an SS34 rotor. The
pellets were
resuspended in TEG (glycerol, 20% by volume, in TE) at a concentration of 20-
40 mgs of
protein per mL at which point they may be stored at -70°C for months
without any detectable
loss of activity.
32
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
EXAMPLE 5
Demonstration of Functional Expression of Isoflavone Synthase in Yeast
The synthesis of genistein or daidzein from either naringenin or
liquiritigenin was
observed in an in vitro assay that was mediated by yeast microsomes prepared
from the yeast
transformant GM 1 expressing the polypeptide encoded by the insert in soybean
cDNA clone
sgslc.pk006.o20. Samples were prepared and run on a LiChrospher 100 RP-18
column
(5 Vim) or a Phenomenex Luna 3u C18 (2) column (150 X 4.6 mm) as described in
Example 2. Peaks in the yeast microsome assay samples were identified as being
genistein
or daidzein by their HPLC retention time and absorption spectrum. The
retention time and
the absorption spectrum of the peak found in the expected location of
genistein was identical
to the retention time and spectrum of authentic genistein (compare Figures 3
and 4,
Figures 17 and 18). The daidzein peak also had identical retention time and
absorption
spectrum to the standard. More direct evidence was obtained using LC/MS. Data
for
daidzein is shown in Figure 19. The molecular weights of the materials
corresponding to the
expected genistein and daidzein peaks from the yeast microsome assay samples
were 270.32
and 255.2, respectively. The molecular weights of authentic genistein and
daidzein are
270.23 and 255.2, respectively.
The synthesis of genistein in yeast microsomes obtained from the yeast strain
Isoflavone Synthase GM 1 was monitored over the course of incubation with the
substrate
naringenin. Samples representing incubation periods of 0 minutes and l, 2, 3,
4 and 14 h
were analyzed. Results are presented in Figures 8 through 13. A simultaneous
increase of
genistein, the product, and decrease of naringenin, the substrate of
isoflavone synthase, was
observed. A detectable amount of genistein was synthesized as early as 40
minutes
(Figure 14). Incubation of microsomes with either naringenin or liquiritigenin
as substrate
shows an increase in accumulation of genistein and daidzein (the product) over
ten hours as
seen in Figure 26.
Genistein synthesis corresponds quantitatively with the amount of input GM 1
microsomes (Figure 14 and Figure 15). The genistein peak in the assay using
GM1 as a
source was about 10 times higher than the peak observed from soybean microsome
prepared
from elicitor-treated hypocotyls (compare Figure 4 and Figure 13). Genistein
synthesis by
yeast microsomes using GM 1 also demonstrated an absolute requirement for
NADPH.
Without the cofactor, the reaction ~:iixture did not synthesize any detectable
genistein over a
4-h incubation (Figure 16).
An unidentified peak, designated "peak 2," with a retention time of 1.59, was
also
detected during monitoring of reactions catalyzed by yeast microsomes at 280
nm (see
Figure 9 to Figure 15). This peak was not significant in negative controls
(Figure 8 and
Figure 16). Koch and Grisebach proposed a hypothesis for the synthesis of an
intermediate
33
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
during the conversion of naringenin to genistein (Kochs, G. and Grisenbach, H.
( 1985) Eur.
J. Biochem. 155:311-318). This proposal stated that the oxidative aryl
migration required to
convert naringenin to genistein proceeds via a cytochrome P450 monooxygenase-
mediated
conversion of the 2S-flavanone to a 2-hydroxyisoflavone, followed by
dehydration to the
isoflavonoid, possibly mediated by a soluble dehydratase. The 2-
hydroxyisoflavone
intermediate was described as unstable and could spontaneously convert to
genistein. In
electrospray LC/MS the most prominent peak in the spectrum of "peak 2" is at
m/z = 289,
consistent with it being the [MH]+ form of the proposed hydroxylated
intermediate. The
height of "peak 2" detected in the 4 h incubation sample was bigger than that
for "peak 2" in
the 14 h incubation sample. That sample showed the largest genistein peak
among the
microsome assays that were performed. It is suspected that "peak 2" may
represent this
proposed intermediate that may be formed transiently during the synthesis of
genistein by
isoflavone synthase. A similar intermediate (at m/z = 273) was also detected
in the
conversion of liquiritigenin to daidzein (Figure 19).
To compare the rates of genistein and daidzein synthesis by microsomes of the
yeast
transformant GM1, samples representing incubation periods of 2, 4, 6, 8 and 10
h were
analyzed. The peak areas for genistein and daidzein were quantitated by
calibration with
authentic genistein and daidzein standards. Assays were repeated three times
and the
average amount of isoflavonoid synthesized at each time point was plotted,
with vertical
lines representing error bars (Figure 26).
EXAMPLE 6
Identification of CYP93C1 as a Soybean Isoflavone Synthase
The sequence of the mRNA encoding CYP93C 1, a cytochrome P450 monooxygenase,
is found in the NCBI database having General Identifier No. 2739005. The
function of the
protein encoded by this mRNA has yet to be identified. The cDNA insert in
clone
sgs 1 c.pk006.o20 encodes an isoflavone synthase and has sequence similarities
with
CYP93C1. To determine whether CYP93C1 encodes a functional isoflavone
synthase,
cDNA was prepared and cloned into the yeast vector pRS315-gal and transformed
into yeast
strain WHT1 to assay for its ability to produce genistein. The CYP93C1 mRNA
was
amplified from RNA isolated from soybean tissue (cv. S 1990) infected with the
fungal
pathogen Sclerotinia slerotiorum using RT-PCR. Fungal infection causes an
increase in the
amount of isoflavonoid produced and thus the amount of isoflavone synthase
transcript was
increased in the infected tissue. Soybean plants were infected 45 days after
planting seeds
and were harvested two days later. Total RNA was prepared using the TRIzoI
Reagent
following the manufacturer's instructions (Gibco BRL) and 1 p.g of the
resulting total RNA
was converted into a first strand cDNA using the SuperscriptT""
Preamplification system and
34
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
using oligodT as the reverse transcription primer. One microliter of first
strand cDNA was
amplified by PCR using the primers listed as SEQ ID N0:7 and SEQ ID N0:8:
5'-AAAATTAGCCTCACAAAAGCAAAG-3' [SEQ ID N0:7]
5'-ATATAAGGATTGATAGTTTATAGTAGG-3' [SEQ ID N0:8]
The nucleotide sequence in SEQ ID N0:7 corresponds to nucleotides 3 to 26 of
the
sequence found in NCBI General Identifier No. 2739005. The nucleotide sequence
in SEQ
ID N0:8 corresponds to the complement of nucleotides 1798 to 1824 of the
sequence found
in NCBI General Identifier No. 2739005. Amplification was performed on a
Perkin Elmer
Applied Biosystems GeneAmp PCR System using the Advantage-GC cDNA polymerase
mix (Clontech), following the manufacturer's instructions, with a 1 M final
concentration of
GC melt reagent. Previous to amplification, the mixture was incubated at
94°C for
5 minutes. Amplification was performed using 30 cycles of: 94°C for 30
seconds, 53°C for
30 seconds and 72°C for 2 minutes. Following amplification, the mixture
was incubated at
72°C for 7 minutes. The amplified product was then cloned into pCR2.1
using "The
Original TA Cloning Kit" (Invitrogen). Plasmid DNA was purified using
QIAFilter
cartridges (Qiagen Inc) according to the manufacturer's instructions. Sequence
was
generated on an ABI Automatic sequences using dye terminator technology and
using a
combination of vector and insert-specific primers. Sequence editing was
performed using
DNAStar (DNASTAR, Inc.). The sequence generated represents coverage at least
two times
in each direction. The sequence of the resulting clone, presented in SEQ ID
N0:9, was
identical with that of CYP93C1 (NCBI General Identifier No. 2739005); the
deduced amino
acid sequence of this cDNA is shown in SEQ ID NO:10.
The above plasmid was then cloned into the yeast vector pRS31 ~-gal using gap
repair
as described in Example 4. Standard procedures were used to transform the
resulting
plasmid into the WHT1 yeast strain. Microsomes were prepared from the WHT1
yeast strain
containing the soybean CYP93C 1 sequence and assayed for the production of
genistein and
daidzein as described in Example 5. The resulting microsomes exhibited
isoflavone synthase
activities. To compare the rates of genistein and daidzein synthesis by
microsomes of the
yeast transformant containing the soybean CYP93C1 sequence, samples
representing
incubation periods of 2, 4, 6, 8 and 10 h w~:re analyzed. The peak areas for
genistein and
daidzein were quantitated by calibration with authentic genistein and daidzein
standards as
prepared in Example 2. Daidzein and genistein accumulated linearly over the
time course.
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
EXAMPLE 7
Amplification and ldentification of
Isoflavone Svnthase From Other Le;eume Species
Nucleic acid sequences encoding isoflavone synthases from lupine, mung bean,
snow
pea, alfalfa, red clover, white clover, hairy vetch and lentil were derived
from total RNA
prepared from young seedlings. Mung bean sprouts and snow pea sprouts were
obtained
from the local grocery store. Seeds for alfalfa, red clover, white clover,
hairy vetch, and
lentil were obtained from Pinetree Garden Seeds while seeds for lupine {cv
Russell Mix)
were obtained from Botanical Interests, Inc. Seedlings were germinated in a
controlled
temperature growth chamber ( I 4 h light at 25 °C and 1 U h dark at 21
°C) and harvested after
approximately two weeks except for lupine, which was harvested after
approximately three
weeks. Total RNA was prepared using TRIzoI Reagent (Gibco BRL) according to
the
manufacturer's instructions. For each plant, a first strand cDNA was prepared
from 1 pg
total RNA using the SuperscriptT"" Preamplification System (Gibco BRL)
following the
1 S manufacturer's instructions. OligodT was used as the reverse transcription
primer in all cases
except white clover where random hexamers were used.
Amplification was performed on a Perkin-Elmer Applied Biosystems GeneAmp PCR
System 9700PCR using Advantage-GC cDNA polymerase mix (Clontech) according to
the
manufacturer's instructions and with a final concentration of GC melt reagent
equal to 1 M.
Amplification was preceded in all cases by incubation at 94°C for 5
minutes and was
followed by incubation at 72°C for 7 minutes. Two sets of primers were
used for PCR
amplification. Primer set one is composed of SEQ ID NO:1 l and SEQ ID NO: I2
and primer
set two is composed of SEQ ID NO: I3 and SEQ ID NO: I4:
5'-ATGTTGCTGGAACTTGCACTT-3' [SEQ ID NO: I 1 )
5'-TTAAGAAAGGAGTTTAGATGCAACG-3' [SEQ ID N0:12]
5'-TGTTTCTGCACTTGCGTCCCAC-3' [SEQ ID N0:13]
S'-CCGATCCTTGCAAGTGGAACAC-3' [SEQ ID N0:14]
The initial amplification of all samples was done using 1 ~L of first strand
cDNA and
pnmer set one (SEQ ID NO:11 and SEQ ID N0:12). Amplification of mung bean was
performed using 30 cycles of 94°C for 30 seconds, 48°C for 30
seconds and 72°C for .
2 minutes. Amplification of red clover was performed using 30 cycles of
94°C for
30 seconds, 50°C for 30 seconds and 72°C for 1 minute.
Amplification of white clover, .
lentil, hairy vetch, alfalfa and lupine was carried out in two steps. The
first amplification
reaction was performed using 30 cycles of 94°C for 30 seconds,
50°C for 30 seconds and
36
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
72°C for one minute. A second amplification reaction was done with 1 ~L
of the resulting
product and primer set two (SEQ ID N0:13 and SEQ ID N0:14) using 30 cycles of
94°C for
30 seconds, 50.5°C for 30 seconds and 72°C for one minute.
Amplification of snow pea was
performed in three different PCR reactions. The first reaction was performed
using 30 cycles
of 94°C 30 seconds, 50.5°C for 30 seconds and 72°C for
one minute. One microliter from
the resulting product was used for a second amplification reaction using
primer set one and
30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and
72°C for one minute. The
resulting reaction was analyzed on a 1 % agarose gel and the band at the
expected size was
gel purified using the QIAquick Gel Extraction Kit (Qiagen). The purified DNA
was
resuspended in 30 ~L of water and 1 pL was used as a template for a third PCR
reaction
using primer set one with 30 cycles of 94°C for 30 seconds, 60°C
for 30 seconds and 72°C
for 90 seconds.
The resulting mung bean, red clover and snow pea PCR sequences were cloned
into
pCR2.l using "The Original TA Cloning Kit" (Invitrogen). The resulting white
clover,
I S lentil, hairy vetch, alfalfa and lupine PCR sequences were cloned into
pCR2. I using TOPOT""
TA Cloning Kit (Invitrogen). Plasmid DNA was purified using QIAFilter
cartridges (Qiagen
Inc) or Wizard Plus Minipreps DNA Purification System (Promega) following the
manufacturer's instructions. Sequence was generated on an ABI Automatic
sequencer using
dye terminator technology and using a combination of vector and insert-
specific primers.
Sequence editing was performed using DNAStar (DNASTAR, Inc.). All sequences
represent coverage at least two times in both directions.
The nucleotide sequence of comprising the cDNA insert in clone alfalfa I is
shown in
SEQ ID NO:15; the deduced amino acid sequence of this DNA is shown in SEQ ID
NO: I6.
The nucleotide sequence comprising the cDNA insert in clone alfalfa 2 is shown
in SEQ ID
N0:57; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:58.
The
nucleotide sequence comprising the cDNA insert in clone alfalfa 3 is shown in
SEQ ID
N0:59; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:60.
The
nucleotide sequence comprising the cDNA insert in clone hairy vetch 1 is shown
in SEQ ID
N0:17; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:18.
The
nucleotide sequence comprising the cDNA insert in clone lentil 1 is shown in
SEQ ID
N0:19; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:20.
The
nucleotide sequence comprising the cDNA insert in clone lentil 2 is shown in
SEQ ID
N0:21; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:22.
The
nucleotide sequence comprising the cDNA insert in clone mung bean 1 is shown
in SEQ ID
N0:23; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:24.
The
nucleotide sequence comprising the cDNA insert in clone mung bean 2 is shown
in SEQ ID
N0:25; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:26.
The
37
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
nucleotide sequence comprising the cDNA insert in clone mung bean 3 is shown
in SEQ ID
N0:27; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:28.
The
nucleotide sequence comprising the cDNA insert in clone mung bean 4 is shown
in SEQ ID
N0:29; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:30.
The
nucleotide sequence comprising the cDNA insert in clone red clover I is shown
in SEQ ID
N0:31; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:32.
The
nucleotide sequence comprising the cDNA insert in clone red clover 2 is shown
in SEQ ID
N0:33; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:34.
The
nucleotide sequence comprising the cDNA insert in clone snow pea 1 is shown in
SEQ ID
N0:35; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:36.
The
nucleotide sequence comprising the cDNA insert in clone white clover 1 is
shown in SEQ ID
N0:37; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:38.
The
nucleotide sequence comprising the cDNA insert in clone white clover 2 is
shown in SEQ ID
N0:39; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:40.
The
I S nucleotide sequence comprising the cDNA insert in clone lupine I is shown
in SEQ ID
N0:54; the deduced amino acid sequence of this DNA is shown in SEQ ID NO:55.
Plasmids corresponding to mung bean 2, red clover 2 and snow pea I were
amplified
and the plant-specific DNA (corresponding to SEQ ID N0:25, SEQ ID N0:33 and
SEQ ID
N0:35) were transferred to the yeast vector pRS31 S-gal following the gap
repair method
explained in Example 4 to produce the yeast expression strains isoflavone
synthase VR2,
isoflavone synthase TP2, and isoflavone synthase PS1, respectively. The eight
amino acids
at the amino- and carboxy-terminus correspond to those translated from the
primers used in
PCR amplification and not necessarily belong to the endogenous genes.
Microsomes were
isolated from the resulting yeast WHT1 strains containing the mung bean, red
clover or snow
pea genes, and assayed for isoflavone synthase activity as described in
Example 5. with
minor modifications. After incubation for 16 hours, 200 ~L of ethyl acetate
was added to
recover the isoflavonoids from the assay solution, the ethyl acetate was
evaporated under
nitrogen using a heating module evaporation system and the sample resuspended
in 200 JCL
of 80% methanol. A I O pL sample of this solution was injected into a
Phenomenex Luna
3 p C18 (2) column (size: 150 x 4.6 mm. The samples were eluted over 10
minutes using an
increasing methanol gradient (from 20% methanol/80% 100 mM ammonium acetate
buffer
(pH 5.9) to 100% methanol (v/v)) at a flow rate of 1 mL per minute. The levels
of genistein
and naringenin in the eluted samples were monitored through the absorption
spectrum at 260
and 290 nm. The genistein signal was verified by comparisons of retention
time, diode array
detected absorption spectra. As seen in Table 1, microsomes from all three
strains produced
genistein and therefore exhibited isoflavone synthase activity.
38
CA 02353306 2001-05-29
WO 00!44909 PCT/US00/01772
TABLE 1
Genistein Synthesis Using in vitro Yeast Assay Svstem
Yeast expression strain Genistein Synthesized
Isoflavone Synthase VR2 1298 ng
Isoflavone Synthase TP2 ~9 ng
Isoflavone Synthase PS 1 19 ng
pRS315-gal Not detectable
EXAMPLE 8
Amplification and Identification of
Isoflavone Synthase From Non-Le ug me Species
Isoflavonoids are most often found in the legumes, although there are
occasional
examples of isoflavonoids in non-legume plants (Dewick, P. M., Isoflavonoids
in The
Flavonoids: Advances in Research edited by J. B. Harborne and T. J. Mabry pp.
535-640).
To obtain isoflavone synthases with greater molecular diversity, isoflavone
synthase genes
from Beta vulgaris (sugarbeet) were cloned and their activity tested.
Sugarbeet, a member of
the family Chenopodiaceae, is one of the few non-legume species to have been
shown to
have isoflavonoids present (Geigert, et al. (1973) Tetrahedron.29:2703-2706).
Sugarbeet seeds were germinated in a growth chamber as described in Example 7
( 14 h
light at 25°C and 10 h dark at 21 °C) and harvested after two
weeks. Total RNA was
prepared using TRIzoI Reagent (Gibco BRL) according to the manufacturer's
instructions.
First strand cDNA was prepared from 1 p.g total RNA using the SuperscriptT""
Preamplification System (Gibco BRL) following the manufacturer's instructions
with
OligodT as the reverse transcription primer.
Amplification was performed on a Perkin-Elmer Applied Biosystems GeneAmp PCR
System 9700PCR using Advantage-GC cDNA polymerase mix (Clontech) according to
the
manufacturer's instructions and with a final concentration of GC melt reagent
equal to 1 M.
Amplification was preceded in all cases by incubation at 94°C for 5
minutes and was
followed by incubation at 72°C for 7 minutes.
Amplification was carried out in two steps. The first amplification reaction
was
performed using 1 ~L of first strand cDNA and primer set one (SEQ ID NO:11 and
SEQ ID
N0:12) with 30 cycles of 94°C for 30 seconds, 50°C for 3G
seconds and 72°C for one
minute. A second amplification reaction was done with 1 ~L of the resulting
product with
primer set two (SEQ iD N0:13 and SEQ ID N0:14) and using 30 cycles of
94°C for
30 seconds, 50.5°C for 30 seconds and 72°C for one minute. The
resulting PCR sequence
was cloned into pCR2.1 using TOPOT"" TA Cloning Kit (Invitrogen). Plasmid DNA
was
purified using QIAFilter cartridges (Qiagen Inc) or Wizard Plus Minipreps DNA
Purification
System (Promega) following the manufacturer's instructions. Sequence was
generated on an
39
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
ABI Automatic sequencer using dye terminator technology and using a
combination of
vector and insert-specific primers. Sequence editing was performed using
DNAStar
(DNASTAR, Inc.). All sequences represent coverage at least two times in both
directions.
The nucleotide sequence comprising the cDNA insert in clone sugarbeet 1 is
shown in SEQ
ID N0:47; the deduced amino acid sequence of this DNA is shown in SEQ ID
N0:48. The
nucleotide sequence comprising the cDNA insert in clone sugarbeet 2 is shown
in SEQ ID
N0:61; the deduced amino acid sequence of this DNA is shown in SEQ ID N0:61.
The data in Table 2 summarizes the relationship of the isoflavone synthase
nucleotide
and amino acid sequences disclosed herein. Reported are the percent identity
of the
nucleotide sequences set forth in SEQ ID NOs:9, 15, 17, 19, 21, 23, 25, 27,
29, 3I, 33, 35,
37, 39, 47 and 54 to instant soybean isoflavone synthase sequence set forth in
SEQ ID NO:1.
In addition, the percent identity of the amino acid sequences deduced from the
instant
nucleotide sequences as set forth in SEQ ID NOs:10, 16, 18, 20, 22, 24, 26,
28, 30, 32, 34,
36 38, 40, 48 and 55 are compared to the amino acid sequence set forth in SEQ
ID N0:2.
IS
TABLE 2
Percent Identity of Nucleotide Coding Sequences and Amino Acid Sequences of
Polypeptides Homolo ous to Isoflavone Svnthase
SEQ length Percent Identity
ID to SEQ ID
NO. NO: l/2
nt as Crop (nts)* nucleotides amino acids
(nt) (aa)
9 10 Soybean 1824 85.9 96.7
16 Alfalfal 1501 99.5 99.0**
56 57 Alfalfa2 1501 92.2 96.2**
58 59 Alfalfa3 1501 92.3 96.6**
17 18 Hairy vetch 1501 92.3 96.2**
19 20 Lentill 1501 97.9 98.8**
21 22 Lentil2 1501 92.3 96.4**
23 24 Mung beanl 1566 92.5 96.7
26 Mung bean2 1566 92.5 96.7
27 28 Mung bean3 1566 92.6 96.7
29 30 Mung bean4 1566 92.7 96.7
31 32 Red clover 1566 92.5 96.4
33 34 Red clover 1566 92.6 96.7
36 Snow pea 1563 99.3 99.0
37 38 White cloverl1496 99.3 98.4**
39 40 White clover21501 98.3 99.0**
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
SEQ ID NO. length Percent Identity to SEQ ID
N0:1/2
nt as Crop (nts)* nucleotides (nt) amino acids
(aa)
_ Sugarbeetl 1497 91.9 95.6**
60 61
47 48 Sugarbeet2 1501 92.3 96.6**
54 55 Lupine 1501 92.2 96.2**
*SEQ ID NO:1 contains 1756 nucleotides.
**These sequences are 22 amino acids shorter because the primers used for PCR
were
derived from the soybean sequence.
The data presented in Table 2 indicates that the nucleotide and amino acid
sequences
encoding the various isoflavone synthases are highly conserved among divergent
species.
Sequence alignments and percent identity calculations were performed using the
Megalign
program of the LASARGENE bioinformatics computing suite (DNASTAR Inc.,
Madison,
WI). Multiple alignment of the sequences was performed using the Clustal
method of
alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default
parameters
(GAP PENALTY=10, GAP LENGTH PENALTY=10).
A consensus sequence was determined by aligning the amino acid sequences of
the
present invention using the Clustal method of alignment and this sequence is
shown in SEQ
ID N0:66. Amino acids not conserved are indicated by Xaa. These are:
Xaa ~ o Phe or Leu
Xaal6 Ser or Leu
Xaa23 Ser or Thr
Xaa25 Ile or Lys
Xaa39 Lys or Arg
Xaa4g Pro or Leu
Xaabo Pro or Leu
Xaa73 Leu or His
Xaa74 Ser or Tyr
XaagS Ala or Thr
Xaag6 Asn or His
Xaalo2 Asn or Ser
X~t to Ile, Val, or Thr
X112 ~'g or His
X117 Asn or Ser
Xaal lg Ser or Leu
X121 Met or Arg
X122 Ala or Val
41
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Xaa ~ 24 Phe or I
le
Xaa129 Lys or Arg
Xaal4~ Lys or Glu
X159 Leu or Phe
Xaa~62 Ala or Val
X166 Ser or GIy
Xaa ~ ~p Gln or Arg
Xaa~~s Va1 or Leu
Xaal g3 Ala or Thr
Xaa~ g~ Thr or Ile
Xaai9~ Met or Val
X~2o9 Phe or Tyr
Xaa219 ~'g or Trp
Xaa223 Tyr or His
Xaa253 Gly or Glu
Xaa259 Lys or Glu
Xaa263 Val or Asp
X264 Val, Asp,
or Ile
Xaa26g Ala or Val
Xaa2~2 Phe or Leu
Xaa2g5 Thr or Met
X293 Glu or Asp
Xaa294 Thr, or Ile
Xaa3p ~ Phe or Leu
X~3o6 Thr or Ile
Xaa3 ~ 1 Val or Glu
X312 Val or AIa
X325 ~'g or Lys
Xaa32g Gln or Glu
X334 Val or Ala
X342 ~'g or Ile
Xaa3~~ Thr or Ile
Xaa3g1 Glu or Gly
Xaa3g5 Tyr, His,
or Cys
Xaa3g~ IIe or Thr
X393 Val or Ile
x394 Leu or Pro
42
T.
CA 02353306 2001-05-29
WO 00/44909 PCT/US00101772
Xaa40~ Arg or Lys
X404 Ser or Pro
Xaa413 Ser or Phe
Xaa4~~ Glu or Gly
j Xaa42g Gly or Arg
Xaa429 Pro or Leu
X435 Gln or Arg
Xaa44~ Arg or Gly
x453 Asn, Ser, or Ile
X459 Met or Thr, and
Xaa4g5 Asp or Gly
To verify that the similarity between the isoflavone synthase nucleotide
sequences
from soybean and from sugarbeet were not due to artifacts of PCR, a nucleic
acid sequence
containing the soybean isoflavone synthase set forth in SEQ ID NO:1 was used
as a probe
1 ~ for Southern blot analysis against sugarbeet genomic DNA. Hybridization
was done
overnight at 65°C in 6X SSC, SX Denhardts. Filters were washed 2 times
in 2X SSC, 1%
SDS at room temperature and 2 times in 0.2X SSC, 0.5% SDS at 65°C.
Hybridizing bands
were detected indicating that sugarbeet does contain genes with high homology
to the
soybean isoflavone synthase sequence.
EXAMPLE 9
Preparation of Transonic Tobacco with Chimeric Isoflavone Svnthase Gene
The ability to obtain isoflavone synthase activity by expressing the gene from
soybean
clone sgslc.pk006.o20 in other plants was tested by preparing transgenic
tobacco plants
expressing the isoflavone synthase gene and assaying for genistein production.
The 1.6 Kb
isoflavone synthase coding region from clone sgs 1 c.pk006.o20 (SEQ ID NO:1 )
was
amplified using a standard PCR reaction in a GeneAmp PCR System with the
primers shown
in SEQ ID N0:41 and SEQ ID N0:42:
5'-TTGCTGGAACTTGCACTTGGT-3' [SEQ ID N0:41]
5'-GTATATGATGGGTACCTTAATTAAGAAAGGAG-3'
[SEQ ID N0:42]
The resulting DNA sequence (IFS) contains from the second codor~ to the stop
codon
of the soybean isoflavone synthase gene sequence followed by a Kpn I site. The
following
three sequences (m S' to 3' order) were assembled in pUC 18 vector (New
England Biolabs)
to yield plasmid pOY 160 (depicted in Figure 20):
~ 35S/cabL, a promoter sequence comprising 1.3 Kb from the cauliflower mosaic
virus (CaMV) 35S promoter extending to 8 by downstream from the transcription
43
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/0l772
start site followed by a 60 by leader sequence derived from the chlorophyll
a/b
binding protein gene 22L (Harpster M. H. et al. (1988) Mol. Gen. Genet.
212:182-190);
~ IFS, the isoflavone synthase gene fragment generated by PCR amplification
using
the primers from SEQ ID N0:41 and SEQ ID N0:42.
~ Nos3'; an 800 by fragment which contains the polyadenylation signal sequence
from the nopaline synthase gene (Depicker A. et al. (19820 J. Mol. Appl.
Genet.
1:561-573 ).
The 5' end of IFS was ligated to Nco I-digested, filled-in, 35S/cabL. The 3'
end of IFS
was digested with Kpn I and ligated to Kpn I-digested Nos3'.
The following three fragments were ligated to create plasmid pOY204:
1) The Hind III/Pst I fragment comprising the 35S/cabL-5'IFS from pOY160,
2) The Pst I/Sal I fragment comprising the 3'IFS-Nos3' from p0Y160,
3) The Hind III/Sal I fragment from vector pPZP211.
The vector pPZP211 contains an npt II gene fragment under the control of the
355
CaMV promoter conferring kanamycin resistance as the plant selectable marker
(Hajdukiewicz P. et al. (1994) Plant Mol. Biol. 25:989-994).
The plasmid pOY204 was transformed into the Agrobacterium tumefaciens strain
LBA4404 and was subsequently introduced into Nicotiana tobaccum by leaf disc
co-cultivation following standard procedures (De Blaere et al. 1987 Meth.
Enrymol.
143:277). The leaf discs were incubated for three weeks on selection medium
(MS salts with
vitamins (Gibco BRL), 1 mg/L 6-benzylaminopurine (BA), 100 mg/L kanamycin, and
500 mg/L Claforan). The regenerating plants were transferred to rooting medium
(selection
medium without BA) for another two weeks. Transformed plants were identified
by the
2~ appearance of roots in this selection media. Following standard protocols,
DNA samples
were prepared from six randomly-selected shoots and used as templates for PCR
using the
primers from SEQ ID N0:41 and SEQ ID N0:42. Verification of the presence of
the
isoflavone synthase coding region in the genome of the tested tobacco shoots
was done by
separating the reaction product using a 1 % agarose gel and staining with
ethidium bromide.
The expected 1.6 Kb fragment was obtained as the reaction product in all the
transgenic
tobacco shoots and not in the untransformed tobacco controls.
Transcription of Soybean IsoJlavone Synthase in Transgenic Tobacco Shoots
Transcription of the isoflavone synthase gene in the transgenic tobacco shoots
was
confirmed using RT-PCR. Total steady-state plant RNA was extracted from four
randomly-selected tobacco shoots resulting from transformation with pOY204
using the
RNeasy Plant Mini Kit (Qiagen) following standard protocols. RT-PCR
amplification was
performed using "The Superscript One Step RT-PCR Kit" (Gibco BRL) with the
primers:
44
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
5'-GACGCCTCACTTACGACAACTCTGTG-3' [SEQ ID N0:43]
5'-CCTCTCGGGACGGAATTCTGATGGT-3' [SEQ ID N0:44]
After incubation at 50°C for 45 minutes. amplification was carried out
using 37 cycles
of 93°C for 30 seconds, 64°C for 30 seconds and 72°C for
1 minute. The resulting DNA was
separated on a 1% agarose gel. Samples from the putative isoflavone synthase-
containing
tobacco showed an 840 by band not seen in the sample from the untransformed
tobacco
control.
EXAMPLE 10
Expression of Soybean Isoflavone Synthase in Trans~enic Tobacco
Activity of Soybean Isoflavone Synthase in Tobacco Shoots
The activity of the soybean isoflavone synthase in the transgenic tobacco was
determined by analyzing shoots for the presence of genistein. Approximately
one gram of
1 ~ tissue from shoots of five-week-old rooting transformants and from
untransformed tobacco
plants were ground in liquid nitrogen and extracted for 20 minutes at room
temperature using
10 mL of 80% ethanol. After filtration through Acrodisc CR-PTFE syringe
filters (Gelman
Sciences), 3 mL from each extraction solution were concentrated to 1 mL by
evaporation
under nitrogen gas flow using a SO°C heating block. To hydrolyze any
malonyl or
giucosyl-derivatized compounds present, 3 mL of 1 N HCl were added and the
samples
incubated at 95°C for 2 h followed by extraction using 1 mL ethyl
acetate. Five hundred ~L
of the ethyl acetate phase were dried under nitrogen and resuspended in 20 ~L
chloroform.
The presence of genistein in the samples was determined by gas
chromatography/mass
spectroscopy (GC/MS) analysis.
Before injection into a Hewlett Packard 6890 gas chromatograph, the hydroxyl
groups
in the samples were derivatized to trimethylsilylate by the addition of 100
p.L of BSTFA (N,
O-bis(trimethylsilyl)-trifluoroacetamide; Supelco) and incubation at
37°C for 1 h. The
samples were dried under nitrogen gas and re-dissolved in 20 ~L chloroform
immediately
before manual injection into the gas chromatograph. Two pL of sample were
manually
injected onto a 15 meter dry bed GC capillary column ( J&W, Jones
Chromatography, Mid
Glamorgan, UK) through an injector port operated in the split mode (5:1). The
initial oven
temperature was set at 200°C and the column was set at a linear
temperature gradient from
200°C to 300°C in 20 minutes with a helium gas flow rate of 1.5
mL/minute. The mass
spectrum was monitored using a Hewlett Packard 5973 mass-selective detector at
an
ionization potential of 70 eV. The mass ions identified from the cracking
pattern of pure
genistein treated as mentioned above are 414 and 399 m/z. These peaks
represent the
products of partially derivatized genistein, the form obtained following the
above procedure.
Twenty nine of thirty three tobacco transformants analyzed by gas
chromatography had an
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
identifiable genistein peak at 8.7 minutes. The presence of genistein in these
peaks was
confirmed by the detection of peaks at 414 and 399 m/z in the mass spectra.
These results
confirmed that the soybean isoflavone synthase coding region is expressed in
tobacco plants
under control of the 35S CaMV promoter and causes novel production of
genistein in
tobacco shoot tissue.
Presence of Genistein in Tobacco Flowers
Flowers from the tobacco transformants were assayed for the presence of
genistein.
Extracts were prepared as described above, except that after hydrolysis, the
dried ethyl
acetate extracts were resuspended in 1 mL of 80% methanol. The HPLC protocol
was the
same as in Example 2 using a Phenomenex Luna 3u C18 (2) column (150 X 4.6 mm).
As
compared to extracts from wild type plants, the transformant flowers contained
two
additional large peaks in the HPLC profile. One of these peaks was identified
as genistein
while the other is unknown. Detection of the large genistein peak in the HPLC
profile of the
tobacco flower extracts indicated that there was a much higher amount of
genistein present in
1 ~ the tobacco flowers than in the tobacco shoots, since the genistein in the
shoot samples was
only detectable by GC/MS. The prevalence of genistein in the flowers relates
to the
expression of the anthocyanin biosynthetic pathway, which is active in the
flowers as
indicated by the pink flower color. An active anthocyanin pathway produces the
naringenin
substrate for isoflavone synthase.
EXAMPLE 11
Expression of Soybean Isoflavone Synthase in Trans~enic Arabidobsis
Arabidopsis thaliana was transformed with the plasmid pOY204 via in planta
vacuum
infiltration following standard protocols (Bechtold et al. (1993) CR Life
Sciences
316:1194-1199). Briefly, three-week-old Arabidopsis thaliana ectotype WS
plants were
submerged in 500 mL of Agrobacterium, strain GV3101 harboring pOY204,
suspended in
basic MS media (Gibco BRL) and vacuum was applied repeatedly for 10 minutes.
The
infiltrated plants were allowed to set seeds for another three weeks. The
harvested seeds
were surface-sterilized. then germinated and grown for three weeks on plates
containing
75 mg/L kanamycin. Approximately 120 green healthy plants were recovered in
the first
round of screening and were transferred to soil for two more weeks. The plants
at this stage
had green immature pods and few leaves. Extracts were prepared and analyzed by
HPLC
and GC/MS as described in Example 2, except that after hydrolysis, the dried
ethyl acetate
extracts were resuspended in 1 mL of 80% methanol. Five of twelve randomly-
selected
Arabidopsis transformants analyzed by HPLC had an identifiable genistein peak
at
8.7 minutes. GC MS analysis confirmed the presence of genistein in these peaks
by
detection of the characteristic peaks at 414 and 399 m/z in the mass spectra.
These results
46
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
show that the soybean isoflavone synthase gene is functional in the
Arabidopsis plants and
genistein is produced.
EXAMPLE 12
Enhancine Isoflavonoid Levels in Trans~genic Arabidopsis
To determine whether activation of the phenylpropanoid pathway results in
increased
accumulation of isoflavonoids in IFS-transformed Arabidopsis, the pathway was
activated by
UV light treatments. Homozygous Arabidopsis transformants of line A109-4,
which
synthesize genistein, were identified through germination on kanamycin-
containing medium
by first selecting a transformant that segregated kanamycin resistance in a
3:1 ratio. A
resistant progeny from this generation that then produced 100% resistant
progeny was
identified as a homozygote. Plants from this population and wild type
Arabidopsis plants
were transferred to 2-inch pots 10 days after germination and grown for 10
more days.
Plants were placed directly under 366 nm UV light for 16 h (46 mWatt/cm2,
using an
UVL-56 BLAK-Ray Lamp from UV Products, Inc., San Gabriel, CA). Control plants
were
1 ~ placed under the same described environment except for the UV
illumination. The above
ground parts of Arabidopsis plants were pulverized in liquid nitrogen to fine
powder
immediately after UV treatment. The tissues were extracted with 10 mL 80%
methanol per
1 gram of fresh weight. The genistein content from tissue extracts of UV-
treated and
untreated plants was determined by HPLC using a Phenomenex Luna 3u (2) column
(150 X
4.6 mm) and a mobil phase linear gradient which goes in 15 minutes from 20%
methanol,
80% 10 mM ammonium acetate, pH 8.3 to 100% methanol followed by 100% methanol
for
S minutes as described in Example 2. Aliquots from the same extracts were also
assayed for
anthocyanin accumulation using photospectrometry as described by Bariola, P.
A., et. al.
((1999) Plant Physiol. 119:331-342). Briefly, one mL of extract was mixed with
one mL of
0.5% (v/v) HCl followed by the addition of two mL of chloroform and vortexing
for ten
seconds. The mixture was allowed to separate to two phases at room
temperature. The
absorbance of the aqueous phase was assayed at 530 nm and 657 nm. The
anthocyanin
content was calculated by subtracting the absorbance value at 657 from the
absorbance value
at 530 and normalizing to fresh weight. As seen in Table 3, the anthocyanin
content and
genistein level in IFS-transformed Arabidopsis varies with UV treatment (The
average and
standard deviations of four independent plants from each group are shown).
47
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
TABLE 3
Anthocyanin Content and Genistein Levels in
TT811CfIP1'11(' ,4Y/ljti~nncic pl~r~t~
Sample Anthocyanin Genistein
(A530-A657) (by HPLC)
~ (mAu
/ 25uL)
Control UV Control UV
Control Plants0.0463 0.01480.0591 0.02020 0
no IFS ene
A109-4 0.0339 0.01000.0368 0.0116121 -~ 303 58
355-IFS 41
Anthocyanins are products of one branch of the phenylpropanoid pathway, and
the
level of their accumulation is an indication of the activity of this pathway.
As seen in the
table above, genistein was not detectable and the anthocyanin levels increased
by about 28%
after UV treatment in the control plants. In plants expressing IFS the
anthocyanin levels
were not significantly increased while the genistein levels more than doubled.
A duplication
of this experiment also showed an increase in genistein level (anthocyanin
levels without UV
treatment: 0.1426 +/- 0.0245; and with UV treatment: 0.1463 +/- 0.0145 (units
as described
above); genistein without UV treatment: 602+/-94; and with UV treatment: 857+/-
46 (units
as described above)). In this case the level of anthocyanins in non-treated
plants was much
higher, probably due to insect infestation. The level of genistein was higher
in non-treated
plants and the increase with UV treatment was not as large as in the first
experiment. These
results demonstrate that activation of the phenylpropanoid pathway, in this
case by stress
treatment (UV or insect infestation), results in an increased level of
genistein accumulation
in transformants expressing isoflavone synthase.
EXAMPLE 13
Expression of Soybean Isoflavone Svnthase in Monocot Cells
The ability to obtain isoflavone synthase activity in monocot cells was tested
by
transforming the soybean gene from clone sgs 1 c.pk006.o20 into corn
suspension cells and
assaying for genistein production. The soybean isoflavone synthase gene was
cloned in a
vector for expression in monocot cells and its activity determined by the
expression of
genistein in corn. A chimeric isoflavone synthase gene plasmid was prepared
(pOY206)
using the pGEM9Zf cloning vector (Promega) for expression of the instant
isoflavone
synthase in monocots. The following fragments were inserted between two copies
of the
3 Kb SAR fragment (the A element, originally located between 8.7 and 11.7 kb
upstream of
the chicken lysozyme gene coding region (Loc P. V. and Stratling W. H. ( 1988)
ENIBO J.
7:655-664):
1. the 35S/cabL promoter fragment from Example 9,
48
CA 02353306 2001-05-29
WO 00/44909 PCT/US00101772
2. a 490 by fragment containing the sixth intron from the maize Adh 1 gene
(Mascarenhas, D. et al. (1990) Plant Mol. Biol. 15:913-920) and ending with an
N "o I site,
3. IFS, the isoflavone synthase fragment from Example 9,
4. a 285 by fragment containing the polyadenylation signal sequence from the
nopaline synthase gene (Depicker A. et al. ( 1982) J. Mol. Appl. Genet.
1:561-573).
Gene Combinations used for Corn Cell Transformation
The plasmid pOY206 (Figure 21 ) containing the chimeric isoflavone synthase
gene for
expression in monocots was transformed into corn cells in conjunction with
plasmid
pDETRIC. Plasmid pDETRIC contains the bar gene from Streptomyces hygroscopicus
that
confers resistance to the herbicide glufosinate (Thompson et al. (1987) EMBOJ.
6:2519). In
the pDETRIC plasmid the bar gene is under the control of the CaMV 35S
promoter, its
translation-initiation codon has been changed from GTG to ATG for proper
translation
initiation in plants (De Block et al. ( 1987) EMBO J. 6:2513), and uses the
Agrobacterium
tumefaciens octopine synthase polyadenylation signal.
Since the phenylpropanoid pathway is not active in corn suspension cells a
third
plasmid containing a gene encoding a transcription factor that activates the
phenylpropanoid
pathway was, in some cases, bombarded into the corn cells in conjunction with
isoflavone
synthase gene. This plasmid, pDP79~ 1 (depicted in Figure 22 and bearing ATCC
accession
number PTA-371 ), contains in the 5'-3' orientation:
- the Agrobacterium nopaline synthase gene promoter region,
- a tobacco mosaic virus (TMV) omega enhancer sequence,
- the fifth intron from the maize adhl gene,
- CRC (a chimera containing the maize R region between the region encoding the
C 1 DNA binding domain and the C 1 activation domain),
- the potato protease inhibitor II polyadenylation signal sequence.
Additionally, a chimeric gene consisting of the CRC coding region expressed
from the
CaMV 35S promoter was prepared and used in corn cell transformations. The Sma
I
fragment of DP7951 containing CRC was Iigated to Nco I and Kpn I ends that had
been
blunt ended with Mung bean nuclease (New England Biolabs) to create the
chimeric gene:
35S/cabL-IFS-Nos3'. This plasmid is called pOY162, and its restriction enzyme
map is
shown in Figure 23.
Transformation of monocot cells
Black Mexican Sweet (BMS) suspension culture is a commonly used, corn-derived,
monocot cell line. Cultures were maintained in MS2D medium (MS salts with
vitamins
(Gibco BRL), 20 g/L sucrose, 2 mg/L 2,4-dichlorophenoxyacetic acid, pI-i 5.8),
incubated
49
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/017?2
with shaking (125 rpm) at 26°C in the dark, and subcultured with fresh
medium every
five days.
Transformations were performed by microprojectile bombardment using a DuPont
Biolistic PDS 1000/He system (Klein T. M. et al. (1987) Nature 327:70-73).
Gold particles
(0.6 microns) were coated with mixtures of plasmid DNAs as indicated in Table
4:
TABLE 4
Plasmid Groups used in Maize Transformations
Group Plasmids
I 3 pg pDETRIC + 6 ~g pOY206
2 3 p,g pDETRIC + 6 p.g pOY206 + 6 pg pDP7951
3 3 pg pDETRIC + 6 ~g pDP7951
4 3 pg pDETRIC + 6 ~g pOY206 + 6 pg pOY162
Two days after subculture, BMS suspension culture aliquots (6 mL each), were
evenly
distributed over Whatman# I filter disks, transferred onto solid MS2D medium
(MS2D, 7 g/L
agar) and incubated at 26°C overnight. Filter disks containing the BMS
cells were
positioned approximately 3.5 inches away from the retaining screen and
bombarded twice.
Membrane rupture pressure was set at 1,100 psi and the chamber was evacuated
to
-28 inches of mercury. Bombarded tissues were incubated for four days at
26°C in the dark
and then transferred to MS2D selection medium (solid MS2D medium containing 3
mg/L
Bialaphos). Resistant tissue was transferred to fresh MS2D selection medium
after seven
weeks and tissue was harvested for analysis two weeks later.
Analysis of transformed corn cells for synthesis of anthocyanins and genistein
All control tissue and BMS lines transformed with group 1 were white in color.
Approximately half of the Bialaphos-selected resistant tissue that grew in
plates bombarded
with groups containing CRC (groups 2 and 3) showed the wild type white color,
while the
other half showed various degrees of red coloration, a visual indication of
anthocyanin
accumulation. The red phenotype indicates that expression of CRC in these
lines is
sufficient to transcriptionally activate the expression of genes in the
phenylpropanoid
pathway leading to anthocyanin synthesis and accumulation (GrotewoId E. et al.
( 1998)
Plant Cell 10:721-740). Presence of the isoflavone synthase gene in these
tissues was
confirmed by the appearance of the appropriate sized fragments when performing
PCR on
genomic DNA using primers from SEQ ID N0:43 and SEQ ID N0:44. The presence of
the
CRC coding region in these tissues was verified by the production of an
appropriate
fragment when performing PCR on genomic DNA using the primers from SEQ ID
N0:45
(to the R region) and SEQ ID N0:46 (to the 3' untranslated region from potato
protease
inhibitor II gene).
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
5'-GCGGTGCACGGGCGGACTCTTCTTC-3' [SEQ ID N0:45]
5'-CGCCCAATACGCAAACCGCCTCTCC-3' [SEQ ID N0:46]
Tissue from 25 lines transformed with Group 1, 5 white lines resulting from
transformation with Group 2, 7 red lines transformed with Group 2, 6 white
lines
transformed with Group 3, and 6 red Iines transformed with Group 3 was
harvested and
analyzed for the presence of genistein using HPLC and GC-MS. Extracts were
prepared and
analyzed as described in Example 2. The genistein HPLC peak and the
identifying 414 and
399 m/z MS peaks were detected in the extracts from all seven red lines
transformed with
Group 2 while no genistein was detected in any of the white lines transformed
with the same
plasmids. Lines transformed with Group 3 did not have genistein whether they
were red or
white. Sixteen lines transformed with Group 4 also produced genistein. A
summary of these
results is shown in Table 5.
TABLE 5
Genistein Synthesis in Transformed BMS Tissue
Group No. Tissue Color Naringenin Produced Genistein Produced
1 25 White NO NO
2 5 White NO NO
2 7 Red YES YES
3 6 White NO NO
3 6 Red YES NO
4 16 Red YES YES
The synthesis of genistein in BMS lines transformed with a soybean isoflavone
synthase-containing construct indicated that the soybean protein was expressed
and was
functional in monocot cells. Genistein was only produced in cell lines
producing naringenin
indicating that the soybean isoflavone synthase gene was only effective in the
presence of an
activated phenylpropanoid pathway. The intermediate naringenin in the
phenylpropanoid
pathway provided the substrate for isoflavone synthase to produce genistein.
EXAMPLE 14
~nthesis of Daidzein in Monocot Cells
The activity of chalcone reductase determines the relative levels of
substrates available
for isoflavone synthase to produce genistein or daidzein (see Figure 1 ).
Chalcone reductase
reduces 4,2',4',6'-tetrahydroxychalcone to 4,2',4'-trihydroxychalcone, thus
producing
liquiritigenin as the substrate for isoflavone synthase to produce daidzein.
Chalcone
reductases are present in legumes, but have not been found in most non-legume
plants
51
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
including Arabidopsis, tobacco, and corn. To produce daidzein in non-legume
plants, a
plasmid DNA containing a soybean chalcone reductase gene was introduced into
corn
suspension cells by microprojectile bombardment, together with a selection
marker, CRC,
and IFS constructs as described in Example I3.
A soybean cDNA clone encoding chalcone reductase was identified by homology to
known chalcone reductase genes of alfalfa (Ballance and Dixon ( 1995) Plant
Phys.
107:1027-1028). The cDNA library was prepared using mRNAs from eight-day-old
soybean
roots inoculated with cyst Nematode for four days, and sequenced as described
in
Example 3. BLAST analysis was performed as described in Example 4. The DNA
containing the entire coding region from the identified clone, src3c.pk009.e4,
was amplified
using PCR with the primers shown in SEQ ID N0:62 and SEQ ID N0:63
5'-GTTACCATGGCTGCTGCTATTG-3' [SEQ ID N0:62]
1 S 5'-TTAAACGTAAAATGAAACAAGAGG-3' [SEQ ID N0:63]
The 5' primer had an Nco I site at the start of the coding region. The 1.3 kb
PCR
product was subcloned into the pTOP02.1 vector (Invitrogen Inc., CarIsbad,
CA). The
1.3 kb coding region fragment was excised as a Nco I/Kpn I fragment, using the
Nco I site
and the Kpn I site from the vector. This fragment was isolated and ligated
between the
35S/CabL promoter and Nos 3' polyadenylation signal sequence in the pUCI8
vector as
described in Example 9, to produce plasmid pCHR40, which was used in the BMS
transformation experiments. %
Transformation of corn suspension cells was done as described in Example 13,
using
pDETRIC, pCHR40, pOY206 and pOY162. Selection and culturing were as described
in
Example 13. Each selected line was assayed for the presence of the IFS and CRC
genes
using PCR as in Example 13. The presence of the CHR gene was determined by the
appearance of a 0.6 kb fragment when performing PCR on the tissues using the
primers
shown in SEQ ID N0:64 and SEQ ID N0:65:
5'-GACACTTCGACACTGCTGCTGCTTAT-3' [SEQ ID N0:64]
5'-TCTCAAACTCACCTGGGCTATGGAT-3' [SEQ ID N0:65]
Of 32 lines screened, five carried all three transgenes. Extracts were
prepared, as
described in Example 13, from these 32 lines and a control line that carnes
the CRC and IFS
genes, but not the CHR gene. All of the extracts were treated with 1 N HCl to
hydrolyze all
possible oligosaccharide derivatives as described in Example 10. HPLC and GC-
MS were
performed as described in Examples 2 and 10. One out of the five lines was
shown to
52
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
produce daidzein. In the HPLC assay, in addition to the peaks of naringenin
and genistein, a
small peak occurred at the same retention time as the daidzein standard (9.6
min)
(Figure 27C and D). This peak was not present in the control samples (Figure
27A and B).
In the GC-MS assay, the daidzein-specific cracking pattern was found at the
same retention
time as the standard (8.0 min). All of the major ions of the daidzein spectrum
were present
(m/z: 398, 383, 218, 97). This example shows that introduction of the soybean
chalcone
reductase gene into corn cells together with the isoflavone synthase and CRC
genes results in
the production of both daidzein and genistein.
EXAMPLE 15
Alteration of Isoflavonoid Levels-in Soybean Somatic Embryos
The ability to change the levels of isoflavonoids by overexpressing the gene
from
soybean clone sgs 1 c.pk006.o20 in soybean somatic embryos was tested by
preparing
transgenic soybean somatic embryos and assaying the isoflavonoid levels. The
entire insert
from clone sgs 1 c.pk006.o20 (SEQ ID NO: l ) was amplified in a standard PCR
reaction on a
Perkin Elmer Applied Biosystems GeneAmp PCR System using Pfu polymerase
(Stratagene) with the primers shown in SEQ ID N0:49 and SEQ ID NO:50:
5'-GAATTCGCGGCCGCTCTAGAACTAGTGGAT-3' [SEQ ID N0:49J
5'-GAATTCGCGGCCGCGAATTGGGTACCGGGC-3'
[SEQ ID NO:50]
The resulting fragment is bound by Not I sites in the primer sequences and
contains a
5' leader sequence, the coding region for isoflavone synthase, the
untranslated 3' region from
SEQ ID NO:1, and a stretch of 18 A residues at the 3' end. This fragment was
digested with
Not I and ligated to Not I-digested and phosphatase-treated pKS67. The plasmid
pKS67 was
prepared by replacing in pRB20 (described in U.S. 5,846,784) the 800 by Nos 3'
fragment,
described in Example 9, with the 285 by Nos 3' fragment, described in Example
12. Clones
were screened for the sense orientation of the isoflavone synthase insert
fragment by
digestion with Bam HI. The resulting plasmid pKS93s, shown in Figure 24, has
the beta-
conglycinin promoter operably linked to the fragment encoding isoflavone
synthase followed
by the Nos 3'end. Plasmid pKS93s contains a T7 promoter/HPTlT7 tenminator
cassette for
expression of the HPT enzyme in certain strains of E. coli, such as NovaBiue
(DE3) (from
Novagen), that are lysogenic for lambda DE3 (which carries the T7 RNA
Polyme~ase gene
under lacVS control). Plasmid pK93s also contains the 35S/HPT/NOS 3' cassette
for
constitutive expression of the HPT enzyme in plants. These two expression
systems allow
selection for growth in the presence of hygromycin to be used as a means of
identifying cells
that contain plasmid DNA sequences in both bacterial and plant systems.
53
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Transformation of Soybean Somatic Embryo Cultures
The following stock solutions and media were used for transformation and
propagation
of soybean somatic embryos:
Stock Solutions Media
MS Sulfate 100x stock /~L SB55 (per Liter)
MgS04.7H20 37.0 10 mL of each MS stock
MnS04.H20 1.69 I mL of B5 Vitamin stock
ZnS04.7H20 0.86 0.8 g NH4N03
CuS04.5H20 0.0025 3.033 g KNO;
I mL 2,4-D ( 10 mg/mL stock)
MS Halides I OOx stock 0.667 g asparagine
CaC12.2H20 44.0 pH 5.7
0.083
CoC12.6H~0 0.00125 SB 103 (per Liter)
KH~P04 17.0 I pk. Murashige & Skoog salt mixture*
H3BO3 0.62 60 g maltose
Na2Mo04.2H~0 0.025 2 g gelrite
Na2EDTA 3.724 pH 5.7
FeS04.7H~0 2.784
Stock Solutions Media
SB 148 (per Liters
B5 Vitamin stock 1 pk. Murashige & Skoog salt mixture*
myo-inositol 100.0 60 g maltose
nicotinic acid I .0 1 mL B5 vitamin stock
pyridoxine HCI I.0 7 g agarose
thiamine 10.0 pH 5.7
*(Gibco BRL)
Soybean embryonic suspension cultures were maintained in 35 mL liquid media
(SB55) on a rotary shaker (150 rpm) at 28°C with a mix of fluorescent
and incandescent
lights providing a 16 h day 8 h night cycle. Cultures were subcultured every 2
to 3 weeks by
inoculating approximately 35 mg of tissue into 35 mL of fresh liquid media.
Soybean embryonic suspension cultures were transformed with pKS93s by the
method
of particle gun bombardment (see Klein et al. (1987) Nature 327:70-73) using a
DuPont
Biolistic PDS I 000/He instrument. Five p.L of pKS93s plasmid DNA ( 1 g/L), 50
~L CaCI-,
I5 (2.5 M), and 20 ~L spermidine (0.1 M) were added to 50 ~L of a 60 mg/mL 1
mm gold
54
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
particle suspension. The particle preparation was agitated for 3 minutes, spun
in a microfuge
for 10 seconds and the supernate removed. The DNA-coated particles were then
washed
once with 400 ~L of 70% ethanol and resuspended in 40 pL of anhydrous ethanol.
The
DNAlparticle suspension was sonicated three times for 1 second each. Five ~L
of the
DNA-coated gold particles were then loaded on each macro carrier disk.
Approximately 300 to 400 mg of two-week-old suspension culture was placed in
an
empty 60 mm X 15 mm petri dish and the residual liquid removed from the tissue
using a
pipette. The tissue was placed about 3.5 inches away from the retaining screen
and
bombarded twice. Membrane rupture pressure was set at 1100 psi and the chamber
was
evacuated to -28 inches of Hg. Two plates were bombarded , and following
bombardment,
the tissue was divided in half, placed back into liquid media, and cultured as
described
above.
Fifteen days after bombardment, the liquid media was exchanged with fresh SB55
containing 50 mg/mL hygromycin. The selective media was refreshed weekly. Six
weeks
1 ~ after bombardment, green, transformed tissue was isolated and inoculated
into flasks to
generate new transformed embryonic suspension cultures.
Transformed embryonic clusters were removed from liquid culture media and
placed
on a solid agar media, SB 103, containing 0.5% charcoal to begin maturation.
After 1 week,
embryos were transferred to SB 103 media minus charcoal. After 5 weeks on SB
103 media,
maturing embryos were separated and placed onto SB 148 media. During
maturation
embryos were kept at 26°C with a mix of fluorescent and incandescent
lights providing a
16 h day 8 h night cycle. After 3 weeks on SB 148 media, embryos were analyzed
for the
expression of the isoflavonoids. Each embryonic cluster gave rise to 5 to 20
somatic
embryos.
Non-transformed somatic embryos were cultured by the same method as used for
the
transformed somatic embryos.
Analysis of Transformed Somatic Embryos
At the end of the 8"' week on SB 103 medium somatic embryos were harvested
from 12
independently transformed lines. Somatic embryos were collected individually
and stored in
96-well plates at -80° until lyophilized. Somatic embryos were
lyophilized for 24 hours.
Three to five lyophilized somatic embryos were pooled in a micro centrifuge
tube and the
dry weight was measured three times. Three samples of dried embryos were
assayed for
each transformed line. An 80% methanol solution was added to the lyophilized
somatic
embryos and the samples incubated for 24 h in the dark at room temperature to
extract
isoflavonoids. The 80% methanol solution was filtered through a Costar nylon
membrane
microcentrifuge filter with 0.22 ~tm pore size (Sigma).
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
For HPLC analysis of the extracts, twenty p,l of the 80% methanol sample was
applied to a Phenomenex Luna 3p C18 (2) column (size: I50 x 4.6 mm).
Separation
occurred during the gradient elution of 10 mM ammonium buffer, pH 8.35
(solvent A) and
methanol (solvent B) as the mobile phase. Continuous increasing of solvent B
in solvent A,
from 20 to 100% for 10 min was employed. Standards for the isoflavonoids
daidzin,
daidzein, glycitin, glycitein, genistin, genistein, liquiritigenin and
naringenin were prepared
by the gradual addition of 80% methanol to each powder. The peaks and spectra
corresponding to daidzein, glycitin and genistein conjugated with malonylated
glucosides
were determined by LC/MS. Isoflaovonoids were monitored through the absorption
spectra
at 260 and 280 nm. The isoflavonoid signals observed in the soybean somatic
embryo
samples were verified by comparisons of the retention times and diode array
detected
absorption spectra with those of the standards. The areas of all peaks
corresponding to the
isoflaovones in a sample were added and divided by the dry weight of that
sample. These
dry weight based normalized area sums were used for statistical analysis.
I S An analysis of variance test (ANOVA; Steel, R. G. D. and Torrie, J. H. (
1996)
Principles and Procedures of Statistics : A Biometrical Approach (McGraw-Hill
Series in
Probability and Statistics, New York) was conducted using Microsoft Excel 97
(Microsoft).
Data were analyzed as a single factor design with single gene transformation
as the main
effect. Experimental units were the sum of peak areas of identified
isoflavonoids normalized
to dry weight. The mean square from the ANOVA was used to calculate the least
significant
difference (LSD) for each comparison. The sum of isoflavonoid peak areas of
samples from
a non-transformed control line were compared with those of 25 independent
pKS93s-
transformed, hygromycin resistant lines. Figure 25 shows a graph depicting the
distribution
of the sum of isoflavone area per mg of dry weight of soybean somatic embryos
transgenic
for the isoflavone synthase gene and a control Line. The results are depicted
in the graph in
ascending order of the amount of total isoflavones produced. Some lines, such
as the ones
represented in bars 7 through 14, contained approximately the same levels of
isoflavones as
the control line. While most of the lines showed intermediate increases or
decreases in the
amounts of isoflavones produced, there are clear examples of lines having
markedly
increased or decreased amounts of isoflavones. For example, bar 25 represents
a line which
expresses 208% as much isoflavones as the control line, bar 24 represents a
line which
expresses I 84% as much isoflavones as the control line, and bar 1 represents
a Iine which
produces only 25% of the isoflavones as the control line. These differences in
the amounts
of isoflavones produced may be caused by the position of the transgene in the
chromosome,
the number of copies of the gene that are integrated in the chromosome, DNA
methylation,
gene silencing, etc. These results indicate that transgenic expression of
isoflavone synthase
affords the ability to manipulate isoflavonoid levels as desired for a
particular application;
56
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
i.e., transformants may be chosen for advancement that have large changes in
isoflavonoid
levels (i.e., very high as in IS 19 or very low as in IS6) or more subtle
changes in the content
of isoflavonoads.
EXAMPLE 16
Amplification and Analysis of Soybean Genomic Isoflavone Synthase DNA
Genomic sequences encoding isoflavone synthase may be used to express
isoflavone
synthase as well as the cDNA sequences. Therefore the genomic sequences
containing the
coding regions for the soybean isoflavone synthase genes were isolated.
Soybean genomic DNA was prepared from Glycine max cv. Wye following standard
protocols (DNeasy Plant Maxi Kit, Qiagen, Valencia, CA). Using this DNA as
template, a
genomic DNA fragment including the sequence corresponding to the soybean
insert in
sgs 1 c.pk006.o20 was produced by PCR with the primers listed as SEQ ID N0:41
and SEQ
ID N0:42. A genomic DNA fragment including the sequence of CYP93C1 was
produced
with the primers listed as SEQ ID N0:7 and SEQ ID NO:51:
IS
~'-AAAATTAGCCTCACAAAAGCAAAG-3' [SEQ ID N0:7]
5'-GCAAACGAAGACAAATGGGAGATGATA-3' [SEQ ID NO:S 1 ]
Amplification was performed on a Perkin Elmer Applied Biosystems GeneAmp PCR
System using the ExpandTM Hi fidelity PCR system from Boehringer Mannheim
(Indianapolis, Indiana). These PCR fragments were cloned into the pCR2.1
vector
(Invitrogen) and sequenced as described in Example 6. The nucleotide sequence
of the
genomic fragment comprising the isoflavone synthase sequence from clone sgs 1
c.pk006.o20
is given in SEQ ID N0:52. The nucleotide sequence of the genomic fragment
comprising
the isoflavone synthase sequence of CYP93C1 is given in SEQ ID N0:53. Both
genes were
found to contain one intron. The splice junction for both introns is within
the codon for
amino acid 300. The intron sequence in SEQ ID N0:52 corresponds to nucleotides
895 to
1112 (217 nucleotides), while the intron sequence in SEQ ID N0:53 corresponds
to
nucleotides 947 to 1082 (135 nucleotides) in SEQ ID N0:53. Alignment of the
intron
nucleotide sequences using the Clustal method of alignment and the default
parameters
(KTUPLE 2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4) shows that
the intron sequences are 46.3% identical.
EXAMPLE 17
Alteration of Isoflavonoid Levels in Soybean Plants
The ability to alter the isoflavonoid levels in transgenic soybean plants
expressing the
gene from soybean clone sgs 1 c.pk006.o20 was tested by transforming somatic
embryo
cultures with a vector containing the gene, allowing the plant to regenerate,
and meassuring
57
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
the levels of isoflavonoids produced. In addition, the soybean IFS gene was
transformed in
conjunction with the CRC gene.
Construction of Vectors for Transformation of Glycine max
A vector containing a chimeric isoflavone synthase gene was constructed as
follows.
The 1.6 Kb isoflavone synthase coding region from clone sgs 1 c.pk006.o20 (SEQ
ID NO: l )
was amplified using a standard PCR reaction in a GeneAmp PCR System using Pfu
polymerase (Stratagene) with the primers shown in SEQ ID N0:41 and SEQ ID
N0:42 as in
Example 9. The plasmid pCW109 (World Patent Publication No. W094/11516) was
digested with Nco I. The resulting DNA fragments were treated with T4 DNA
polymerase
in the presence of dATP; dCTP, dGTP and dTTP to obtain blunt ends followed by
digestion
with Kpn I. The ligation of these two DNA fragments created the plasmid pCW109-
IFS,
shown in Figure 28, which has operably linked:
~ the beta -conglycinin promoter
~ the isoflavone synthase coding region
~ the phaseolin 3' end
The 3.2 Kb fragment containing the beta-conglycinin/P-IFS-phaseolin 3'
chimeric gene
was purified from pCW109-IFS as a Hind III fragment and ligated with Hind III-
digested
and phosphatase-treated pZBL 102. pZBL 102 is derived from pKS 18HH (described
in US
Patent No. 5,846,784) by replacing the long Nos 3' fragment in pKS 18HH with
the short Nos
3' fragment described in Example 13. The Sal I site between the two hygromycin
phosphotransferase coding regions was deleted, and a Not I site was added
between the
Hind III and Sal I sites 5' to the 35S promoter of the 35S-HPT gene.
The resulting plasmid, named pWSJ001, has a T7 promoterfHPT/T7 terminator
cassette for expression of the HPT enzyme in certain strains of E. coli that
are lysogenic for
lambda DE3. The lambda DE3 carries the T7 RNA Polymerase gene under lacVS
control
and is found in commercially available E. coli strains such as NovaBlue (DE3)
(from
Novagen). Plasmid pWSJ001 also contains the 35S/HPT/NOS 3' cassette for
constitutive
expression of the HPT enzyme in plants. These two expression systems allow
selection for
growth in the presence of hygromycin to be used as a means of identifying
cells that contain
plasmid DNA sequences in both bacterial and plant systems.
A vector containing a chimeric CRC gene was constructed as follows. The
plasmid
pDP7951 of Example 13, Figure 22, was digested with SmaI and the fragment
containing the
CRC coding region was purified. This CRC fragment was ligated to a modified
vector
containing the sequences of pCW 109 (World Patent Publication No. W094/11516)
with the
substitution of a phaseolin promoter fragment extending to -410 and including
leader
sequences to +77 (Slightom et al., 1991 Plant Mol Biol Man B 16:1 ) instead of
the beta-
conglycinin promoter. Modification included digestion with NcoI and S 1
nuclease treatment
58
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
followed by religation to remove the ATG sequence of the NcoI site that
follows the
promoter fragment. The vector was then digested with KpnI and the ends filled
in so that the
SmaI CRC fragment was inserted in a blunt-end ligation. From the resulting
plasmid, the
HindIII fragment containing the phaseolin promoter-CRC-phaseolin 3' chimeric
gene was
isolated and ligated with HindIII digested pZBL 102 (described above). The
resulting
plasmid was called pOY203.
Transformation Of Somatic Soybean Embryo Cultures and Regeneration Of Soybean
Plants
Soybean embryogenic suspension cultures were transformed with pWSJ001 or
pWSJ001 in conjunction with pOY203 by the method of particle gun bombardment
as in
Example 15. Besides the media used for the soybean somatic embryo cultures
described in
Example 15, the following media were used:
Media
SBP6
SB55 with only 0.5 mL 2,4-D
SB71-1 filer liter)
B5 salts
lml B5 vitamin stock
30 g sucrose
750mg MgCl2
2 g gelrite
pH 5.7
Eleven days post bombardment, the liquid media was exchanged with fresh SB55
containing SO mg/mL hygromycin. The selective media was refreshed weekly.
Seven weeks
post bombardment, green, transformed tissue was observed growing from
untransformed,
necrotic embryogenic clusters. Isolated green tissue was removed and
inoculated into
individual flasks to generate new, clonally propagated, transformed
embryogenic suspension
cultures. Thus each new line was treated as independent transformation event.
These
suspensions can then be maintained as suspensions of embryos clustered in an
immature
developmental stage through subculture or regenerated into whole plants by
maturation and
germination of individual somatic embryos.
Transformed embryogeruc clusters were removed from liquid culture and placed
on a
solid agar media (SB103) containing no hormones or antibiotics. Embryos were
cultured for
eight weeks at 26°C with mixed florescent and incandescent lights on a
16:8 h day/night
schedule. During this period, individual embryos were removed from the
clusters and
analyzed at various stages of embryo development. Selected lines were assayed
by PCR for
59
CA 02353306 2001-05-29
WO 00/44909
PCT/US00/01772
the presence of the an additional IFS gene using the primers shown in SEQ ID
N0:43 and
SEQ ID N0:44. Separation of the PCR products on an agarose gel yielded a 1062
by
fragment indicative of the endogenous IFS gene (i.e., containing introns) and
an 845 by
fragment in the embryos containing the transgene IFS. Somatic embryos become
suitable
for germination after eight weeks and were then removed from the maturation
medium and
dried in empty petri dishes for I to S days. The dried embryos were then
planted in SB7I-1
medium where they were allowed to germinate under the same lighting and
germination
conditions described above. Germinated embryos were transferred to sterile
soil and grown
to maturity. Seed were harvested.
Seed from IFS-transformed and IFS + CRC-transformed soybean plants are
analyzed
for isoflavonoid levels. Extracts are prepared and analyzed by HPLC as
described in
Example I 5 except that a I50 to 200 mg chip of soybean seed is used for the
analysis. Seeds
with statistically significant variation in the level of isoflavonoid
concentration are further
analyzed.
I 5 Various modifications of the invention in addition to those shown and
described herein
will be apparent to those skilled in the art from the foregoing description.
Such
modifications are also intended to fall within the scope of the appended
claims.
The disclosure of each reference set forth above is incorporated herein by
reference in
its entirety.
60
CA 02353306 2001-05-29
WO 00144909 PCT/US00/01772
fYDICATIONS RE:LrITI~IC TO A DEPOSITED ~IICROORCAiVISI~1
(PCT Rule l3bi.r)
The indtcauuns made below relate to the microorganism referred to in the
dcscripUun
on page 6 , line 19
B. IDENTIFICATION OF DEPOSIT Further deposits arc identified on an additional
sheet
Name of dcpositary institution
:~.'IERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including posral code and country)
10801 University Blvd.
Manassas, Virginia 20110-2209
USA
Date of deposit Accession iVumher
27 January 1999 ATCC 203606
C. :~DDITIOVAL IYDICATIOi'1S (leave blank rjnot applicable) This information
is continued on an additional sheet
In respect of those designations in which a European patent is sought,
a sample of the deposited microorganism will be made available until
the publication of the mention of the grant of the European patent or
until the date on which the application has been refused or withdrawn
or is deemed to be withdrawn, only by the issue of such a sample to an
expert nominated by the person requesting the sample. (Rule 28(4) EPC)
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE 111:1DE (ijthe indications are
not jor rrll designated States)
E. SEPAR.~TE FURNISHING OF INDICATIONS (leave blank ijnot applicable)
Thr inJications listed below will be submitted to the lntcmauonal Bureau later
(speafvtlregemralnatureojtlreiru~icarrome.g.. '~Iccess:on
rVtrmber nj Depatlt' J
For receiving Office use only ---~ 1------ For International Bureau use onlv
This sheet was received with the international application I ~ a This sheet
was received by the lntematiunal Bureau on:
.luthorized officer / / Authorized officer
i=orm PCTlR0t13d (July 1992)
61
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
INDICATIONS REL.1TINC TO A DEPOSITED ;~tICROORCANISht
(PCT Rulc l3bis)
i :~. The indications made below
relate to the microorganism referred
to in the description
on page 6 , tine 20
Q. IDENTIFICATION OF DEPOSIT Further
deposits are identified on an additional
sheet
Name of d::positary institution
A.vLERICrIi~I TYPE CULTURE COLLECTION
Address of depositary institution
(including postal code and country)
10801 University Blvd.
Manassas, Virginia 20110-2209
USr1 -
Dais of deposit Accession Number
20 July 1999 ATCC PTA-371
C. :1DDITIONAL INDICATIONS (leove
blonk tjnot applrcable) This information
is continued on an additional sheet
In respect of those designations
in which a European patent is sou
ht
g
,
a sample of the deposited microorganism
will be made available until
the publication of the mention of
the grant of the European
at
p
ent or
until the date on which the application
has been ref
d
use
or withdrawn
or is deemed to be withdrawn, only
by the i
f
ssue o
such a sample to an
e:cpert nominated by the
erso
p
n requesting the sample. (Rule 28(4)
EPC)
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE hIADE (iJthe indications are
not jor al! designated States)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank ijnot applicable)
Thr indications listed below will
be submtttcd to the International
Bureau later (spec~tlregeneral
mature ojrhe imdicarroru e
'~cces
V
b
'
.g..
sron
,
tum
er t f Depastl
)
ror recctvmg Uttrce use only For International Bureau use only
This sheet was received with the international application ~ This sheet wa_s
received by the lntematiunal Bureau on:
.luthorized o~cer ~ Authorized officer
Dorm PCTlROli34 (luly 1992)
62
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
SEQUENCE LISTING
<110> E. I. du Pont de Nemours and Company
<120> Nucleic Acid Sequences Encoding Isoflavone Synthase
<130> BB1339 PCT
<i40>
<141>
<150> 60/117,769
<151> 1999-O1-27
<150> 60/199,783
'<151> 1999-07-20
<150> 60/156,094
<151> 1999-09-24
<160> 66
<170> Microsoft Office 97
<210> 1
<211> 1756
<212> DNA
<213> Glycine max
<400> 1
gtaattaacc tcactcaaac tcgggatcac agaaaccaac aacagttctt gcactgaggt 60
ttcacgatgt tgctggaact tgcacttggt ttgtttgtgt tagctttgtt tctgcacttg 120
cgtcccacac caagtgcaaa atcaaaagca cttcgccacc tcccaaaccc tccaagccca 180
aagcctcgtc ttcccttcat tggccacctt cacctcttaa aagataaact tctccactat 290
gcactcatcg atctctccaa aaagcatggc cccttattct ctctctcctt cggctccatg 300
ccaaccgtcg ttgcctccac ccctgagttg ttcaagctct tcctccaaac ccacgaggca 360
acttccttca acacaaggtt ccaaacctct gccataagac gcctcactta cgacaactct 920
gtggccatgg ttccattcgg accttactgg aagttcgtga ggaagctcat catgaacgac 980
cttctcaacg ccaccaccgt caacaagctc aggcctttga ggacccaaca gatccgcaag 590
ttccttaggg ttatggccca aagcgcagag gcccagaagc cccttgacgt caccgaggag 600
cttctcaaat ggaccaacag caccatctcc atgatgatgc tcggcgaggc tgaggagatc 660
agagacatcg ctcgcgaggt tcttaagatc ttcggcgaat acagcctcac tgacttcatc 720
tggcctttga agtatctcaa ggttggaaag tatgagaaga ggattgatga catcttgaac 780
aagttcgacc ctgtcgttga aagggtcatc aagaagcgcc gtgagatcgt cagaaggaga 890
aagaacggag aagttgttga gggcgaggcc agcggcgtct tcctcgacac tttgcttgaa 900
ttcgctgagg acgagaccat ggagatcaaa attaccaagg agcaaatcaa gggccttgtt 960
gtcgactttt tctctgcagg gacagattcc acagcggtgg caacagagtg ggcattggca 1020
gagctcatca acaatcccag ggtgttgcaa aaggctcgtg aggaggtcta cagtgttgtg 1080
ggcaaagata gactcgttga cgaagttgac actcaaaacc ttccttacat tagggccatt 1140
gtgaaggaga cattccgaat gcacccacca ctcccagtgg tcaaaagaaa gtgcacagaa 1200
gagtgtgaga ttaatgggta tgtgatccca gagggagcat tggttctttt caatgtttgg 1260
caagtaggaa gggaccccaa atactgggac agaccatcag aattccgtcc cgagaggttc 1320
ttagaaactg gtgctgaagg ggaagcaggg cctcttgatc ttaggggcca gcatttccaa 1380
ctcctcccat ttgggtctgg gaggagaatg tgccctggtg tcaatttggc tacttcagga 1940
atggcaacac ttcttgcatc tcttatccaa tgc~ttgacc tgcaagtgct gggccctcaa 1500
ggacaaatat tgaaaggtga tgatgccaaa gttagcatgg aagagagagc tggcctcaca 1560
gttccaaggg cacatagtct cgtttgtgtt ccacttgcaa ggatcggcgt tgcatctaaa 1620
ctcctttctt aattaagata atcatcatat acaatagtag tgtcttgcca tcgcagttgc 1680
tttttatgta ttcataatca tcatttcaat aaggtgtgac tggtacttaa tcaagtaatt 1790
aaggttacat acatgc 1756
<210> 2
<211> 521
<212> PRT
<213> Glycine max
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<400> 2
Met Leu Leu Glu Leu Ala Leu Gly Leu Phe Val Leu Ala Leu Phe Leu
1 5 10 15
His Leu Arg Pro Thr Pro Ser Ala Lys Ser Lys Ala Leu Arg His Leu
20 25 30
Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly His Leu
35 40 ;;,;
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp Leu Ser
50 55 60
Lys Lys His Giy Pro Leu Phe Ser Leu Ser Phe Gly Ser Met Pro Thr
65 70 75 80
Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln Thr His
85 90 95
Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile Arg Arg
100 105 110
Leu Thr Tyr Asp Asn Sex Val Ala Met Val Pro Phe Gly Pro Tyr Trp
115 120 125
Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala Thr Thr
130 135 140
Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys Phe Leu
195 150 155 160
Arg Val Met Ala Gln Ser Ala Glu Ala Gln Lys Pro Leu Asp Val Thr
165 170 175
Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met Met Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu Lys Ile
195 200 205
Phe Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys Tyr Leu
210 215 220
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 240
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile Val Arg
295 250 255
Arg Arg Lys Asn Gly Glu Val Val Glu Gly Glu Ala Ser Gly Val Phe
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Met Glu Ile Lys
275 280 285
Ile Thr Lys Glu Gln Ile Lys Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Arg Val Leu Gln Lys Ala Arg Glu Glu Val Tyr Ser
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
390 395 350
2
CA 02353306 2001-05-29
WO 00/44909 PCT/USOO/OI772
ProTyr IleArgAla IleValLys GluThrPhe ArgMetHisPro Pro
355 360 365
LeuPro ValValLys ArgLysCys ThrGluGlu CysGluIleAsn Gly
370 375 380
TvrVal ileProGlu GlyAlaLeu ValLeuPhe AsnValTrpGln Val
;a 3gp 395 400
GlyArg AspProLys TyrTrpAsp ArgProSer GluPheArgPro Glu
q05 910 415
ArgPhe LeuGluThr GlyAlaGiu GlyGluAla GlyProLeuAsp Leu
420 425 430
ArgGly GlnHisPhe GlnLeuLeu ProPheGly SerGlyArgArg Met
935 440 445
CysPro GlyValAsn LeuAlaThr SerGlyMet AlaThrLeuLeu Ala
450 455 960
SerLeu IleGlnCys PheAspLeu GlnValLeu GlyProGlnGly Gln
965 470 475 480
IleLeu LysGlyAsp AspAlaLys ValSerMet GluGluArgAla Gly
qg5 990 495
LeuThr ValProArg AlaHisSer LeuValCys ValProLeuAla Arg
500 505 510
IleGly ValAlaSer LysLeuLeu Ser
515 520
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<900> 3
cgggatccat gcaaccggaa accgtcg 2%
<210> 4
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<900> 4
ccggaattct caccaaacat cacggaggta tc 32
<210> 5
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 5
tcaaggagaa aaaaccccgg atccatgttg ctggaacttg cacttgg 47
J
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
<210> 6
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucieotide
<900> 6
ggccagtgaa ttgtaatacg actcactata gggcg 35
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<900> 7
aaaattagcc tcacaaaagc aaag 29
<210> 8
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 8
atataaggat tgatagttta tagtagg 27
<210> 9
<211> 1824
<212> DNA
<213> Glycine max
<400> 9
ggaaaattag cctcacaaaa gcaaagatca aacaaaccaa ggacgagaac acgatgttgc 60
ttgaacttgc acttggttta ttggttttgg ctctgtttct gcacttgcgt cccacaccca 120
ctgcaaaatc aaaagcactt cgccatctcc caaacccacc aagcccaaag cctcgtcttc 2B0
ccttcatagg acaccttcat ctcttaaaag acaaacttct ccactacgca ctcatcgacc 240
tctccaaaaa acatggtccc ttattctctc tctactttgg ctccatgcca accgttgttg 300
cctccacacc agaattgttc aagctcttcc tccaaacgca cgaggcaact tccttcaaca 360
caaggttcca aacctcagcc ataagacgcc tcacctatga tagctcagtg gccatggttc 420
ccttcggacc ttactggaag ttcgtgagga agctcatcat gaacgacctt cccaacgcca 480
ccactgtaaa caagttgagg cctttgagga cccaacagac ccgcaagttc cttagggtta 540
tggcccaagg cgcagaggca cagaagcccc ttgacttgac cgaggagctt ctgaaatgga 600
ccaacagcac catctccatg atgatgctcg gcgaggctga ggagatcaga gacatcgctc 660
gcgaggttct taagatcttt ggcgaataca gcctcactga cttcatctgg ccattgaagc 720
atctcaaggt tggaaagtat gagaagagga tcgacgacat cttgaacaag ttcgaccctg 780
tcgttgaaag ggtcatcaag aagcgccgtg agatcgtgag gaggagaaag aacggagagg 840
ttgttgaggg tgaggtcagc ggggttttcc ttgacacttt gcttgaattc gctgaggatg 900
agaccatgga gatcaaaatc accaaggacc acatcgaggg tcttgttgtc gactttttct 960
cggcaggaac agactccaca gcggtggcaa cagagtgggc attggcagaa ctcatcaaca 1020
atcctaaggt gttggaaaag gctcgtgagg aggtctacag tgttgtggga aaggacagac 1080
ttgtggacga agttgacact caaaaccttc cttacattag agcaatcgtg aaggagacat 1140
tccgcatgca cccgccactc ccagtggtca aaagaaagtg cacagaagag tgtgagatta 1200
atggatatgt gatcccagag ggagcattga ttctcttcaa tgtatggcaa gtaggaagag 1260
accccaaata ctgggacaga ccatcggagt tccgtcctga gaggttccta gagacagggg 1320
ctgaagggga agcagggcct cttgatctta ggggacaaca ttttcaactt ctcccatttg 1380
ggtctgggag gagaatgtgc cctggagtca atctggctac ttcgggaatg gcaacacttc 1990
ttgcatctct tattcagtgc ttcgacttgc aagtgctggg tccacaagga cagatattga 1500
agggtggtga cgccaaagtt agcatggaag agagagccgg cctcactgtt ccaagggcac 1560
4
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
atagtcttgtctgtgttc ca ttgcaagga ttgcatctaaactcctttcttaat1620
c tcggcg
taagatcatcatcatatata tatttactt tgtgtgttgataatcatcatttcaataa1680
a tt
ggtctcgttcatctactt tt atgaagtat aagcccttccatgcacattgtatcatct1740
t at
cccatttgtcttcgtttg ct cctaaggca ctttttttttttagaatcacatcatcct1800
a at
actataaactatcaatcc tt tat 1824
a
<210> 10
<211> 521
<212> PRT
<213> Glycine max
<900> 10
Met LeuGlu LeuAlaLeuGly LeuLeuVal LeuAlaLeuPhe Leu
Leu
1 5 10 15
His ArgPro ThrProThrAla LysSerLys AlaLeuArgHis Leu
Leu
20 25 30
Pro ProPro SerProLysPro ArgLeuPro PheIleGlyHis Leu
Asn
35 40 45
His LeuLys AspLysLeuLeu HisTyrAla LeuIleAspLeu Ser
Leu
50 55 60
Lys HisGly ProLeuPheSer LeuTyrPhe GlySerMetPro Thr
Lys
65 70 75 80
Val AlaSer ThrProGluLeu PheLysLeu PheLeuGlnThr His
Val
85 90 95
Glu ThrSer PheAsnThrArg PheGlnThr SerAlaIleArg Arg
Ala
100 105 110
Leu TyrAsp SerSerValAla MetValPro PheGlyProTyr Trp
Thr
115 120 125
Lys ValArg LysLeuIleMet AsnAspLeu ProAsnAlaThr Thr
Phe
130 135 140
Val LysLeu ArgProLeuArg ThrGlnGln ThrArgLysPhe Leu
Asn
145 150 155 160
Arg MetAla GlnGlyAlaGlu AlaGlnLys ProLeuAspLeu Thr
Val
165 170 175
Glu LeuLeu LysTrpThrAsn SerThrIle SerMetMetMet Leu
Giu
180 185 190
Gly AlaGlu GluIleArgAsp IleAlaArg GluValLeuLys Ile
Glu
195 200 205
Phe GluTyr SerLeuThrAsp PheIleTrp ProLeuLysHis Leu
Gly
210 215 220
Lys GlyLys TyrGluLysArg IleAspAsp IleLeuAsnLys Phe
Val
225 230 235 290
Asp ValVal GluArgValIle LysLysArg ArgGluIleVal Arg
Pro
245 250 255
Arg LysAsn Glv_FluValVal GluGlyGlu ValSerGlyVal.Phe
Arg
260 2E5 270
Leu ThrLeu LeuGluPheAla GluAspGlu ThrMetGluIle Lys
Asp
275 280 285
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Ile Thr Lys Asp His Ile Glu Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val Tyr Ser
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
390 345 350
Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn Gly
370 375 380
Tyr Val Ile Pro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp Gln Val
385 390 395 400
Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro Glu
405 41G 915
Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Gly Pro Leu Asp Leu
420 425 430
Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Met
935 440 945
Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu Leu Ala
450 955 460
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly Gln
965 470 975 ggp
Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg Ala Gly
485 490 495
Leu Thr Val Pro Arg Ala His Ser Leu Va1 Cys Val Pro Leu Ala Arg
500 505 510
Ile Gly Val Ala Ser Lys Leu Leu Ser
515 520
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 11
atgttgctgg aacttgcact t 21
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 12
ttaagaaagg agtttagatg caacg 25
6
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<210> 13
<211> 22
<212> D?~1A
<213> F:rtificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 13
~gtttctgca cttgcgtccc ac 22
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<900> 14
ccgatccttg caagtggaac ac 22
<210> i5
<211> 1501
<212> DNA
<213> Medicago sativa
<400> 15
tgtttctgca cttgcgtccc acaccaagtg caaaatcaaa agcacttcgc cacctcccaa 60
accccccaag cccaaagcct cgtcttccct tcattggcca ccttcacctc ttaaaagata 120
aacttctcca ctatgcactc atcgatctct ccaaaaagca tggcccctta ttctctctct 180
ccttcggctc catgccaacc gtcgttgcct ccacccctga gttgttcaag ctcttcctcc 290
aaacccacga ggcaacttcc ttcaacacaa ggttccaaac ctctgccaca agacgcctca 300
cttacgacaa ctctgtggcc atggttccat tcggacctta ctggaggttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ccgtcaacaa gctcaggcct ttgaggaccc 920
aacagatccg caagttcctt agggttatgg cccaaagcgc agaggcccag aagccccttg 980
acgtcaccga ggagcttctc aaatggacca acagcaccat ctccatgatg atgctcggcg 540
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatcttcggc gaatacagcc 600
tcactgactt catctggcct ttgaagtatc tcaaggttgg aaagtatgag aagaggattg 660
atgacatctt gaacaagttc gaccctgtcg ttgaaagggt catcaagaag cgccgtggga 720
tcgtcagaag gagagagaac ggagaagttg ttgagggcga ggccagcggc gtcttcctcg 780
acactttgct tgaattcgct gaggacgaga ccatggagat caaaattacc aaggagcaaa 890
tcaagggcct tgttgtcgac cttttctctg cagggacaga ttccacagcg gtggcaacag 900
agtgggcatt ggcagagctc atcaacaatc ccagggtgtt gcaaaaggct cgtgaggagg 960
tctacagtgt tgtgggcaaa gatagactcg ttgacgaagt tgacactcaa aaccttcctt 1020
acattagggc cattgtgaag gagacattcc gaatgcaccc accactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg ggtatgtgat cccagaggga gcattggttc 1140
ttttcaatgt ttggcaagta ggaagggacc ccaaatactg ggacagacca tccgaattcc 1200
gtcccgagag gttcttagaa actggtgctg aaggggaagc agggcctctt gatcttaggg 1260
gccagcattt ccaactcctc ccatttgggt ctgggaggag aatgtgccct ggtgtcaatt 1320
tggctacttc aggaatggca acacttcttg catctcttat ccaatgcttt gacctgcaag 1380
tgctgggccc tcaaggacaa atattgaaag gtgatgatgc caaagttagc atggaagaga 1440
gagctggcct cacagttcca agggcacata gtctcgtttg tgttccactt gcaaggatcg 1500
g 1501
<210> 16
<211> 499
<212> PRT
<213> Medicago sativa
<400> 16
Phe Leu His Leu Arg Pro Thr Pro Ser Ala Lys Ser Lys Ala Leu Arg
1 5 10 15
7
CA 02353306 2001-05-29
WO PC'T/US00/01772
00/44909
HisLeuProAsn ProProSer ProLysProArg LeuProPheIle Gly
20 25 30
HisLeuHis'~euLeuLysAsp LysLeuLeuHis TyrAlaLeuIle Asp
35 40 45
LeuSerLysLys HisGlyPro LeuPheSerLeu SerPheGlySer Met
50 55 60
ProThrValVal AlaSerThr ProGluLeuPhe LysLeuPheLeu Gln
65 70 75 80
ThrHisGluAla ThrSerPhe AsnThrArgPhe GlnThrSerAla Thr
85 90 95
ArgArgLeuThr TyrAspAsn SerValAlaMet ValProPheGly Pro
100 105 110
TyrTrpArgPhe ValArgLys LeuIleMetAsn AspLeuLeuAsn Ala
115 120 125
ThrThrValAsn LysLeuArg ProLeuArgThr GlnGlnIleArg Lys
130 135 140
PheLeuArgVal MetAlaGln SerAlaGluAla GlnLysProLeu Asp
145 150 155 io0
ValThrGluGlu LeuLeuLys TrpThrAsnSer ThrIleSerMet Met
165 170 175
MetLeuGlyGlu AlaGluGlu IleArgAspIle AlaArgGluVal Leu
180 185 190
LysIlePheGly GluTyrSer LeuThrAspPhe IleTrpProLeu Lys
195 200 205
TyrLeuLysVal GlyLysTyr GluLysArgIle AspAspIleLeu Asn
210 215 220
LysPheAspPro ValValGlu ArgValIleLys LysArgArgGly Ile
225 230 235 240
ValArgArgArg GluAsnGly GluValValGlu GlyGluAlaSer Gly
245 250 255
ValPheLeuAsp ThrLeuLeu GluPheAlaGlu AspGluThrMet Glu
260 265 270
IleLysIleThr LysGluGln IleLysGlyLeu ValValAspLeu Phe
275 280 285
SerAlaGlyThr AspSerThr AlaValAlaThr GluTrpAlaLeu Ala
290 295 300
GluLeuIleAsn AsnProArg ValLeuGlnLys AlaArgGluGlu Val
305 310 315 320
TyrSerValVal GlyLysAsp ArgLeuValAsp GluValAspThr Gln
325 330 335
AsnLeuProTyr IleArgAla IleValLysGlu ThrPheArgMet His
340 345 350
ProProLeuPro ValValLys ArgLysCysThr GluGluCysGlu Ile
355 360 365
g
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Asn Gly Tyr Val Ile Pro Glu Gly Ala Leu Val Leu Phe Asn Val Trp
370 375 380
Gln Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg
385 X90 395 900
Pro Glu Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Gly Pro Leu
405 410 915
Asp Leu Arg Giy Gln His Phe Gln Leu Leu Fro Phe Gly Ser Gly Arg
920 425 430
Arg Met Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu
935 940 495
Leu Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln
950 455 460
Gly Gln Ile Leu Lys Gly Asp Asp Ala Lys Val Ser Met Glu Glu Arg
965 970 975 980
Ala Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Fro Leu
985 490 495
Ala Arg Ile
<210> 17
<211> 1501
<212> DNA
<213> Vicia villosa
<400> 17
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 240
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag cttagtggcc atggttccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 920
aacagatccg caagttcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 980
acttgaccga ggagcttctg aaatggacca acagcaccat ctctatgatg atgctcggcg 540
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatctatggc gaatacagcc 600
tcactgactt catctggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggttg ttgagggtga ggtcagcggg gttttccttg 780
acactttgct tgaattcgct gaggatgaga ccacggagat caaaatcacc aaggaccaca 890
tcaagggtct tgttgtcgac tttttctcgg caggaataga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt tgacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gccactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg gatatgtgat cccagaggga gcattgattc 1140
tcttcaatgt atggcaagta ggaagggacc ccaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acaggggctg aaggggaagc aaggcctctt gatcttaggg 1260
gacaacattt tcaacttctc ccatttgggt ctgggagggg aatgtgccct ggagtcaatc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcaag 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1440
gggccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
9 1501
<210> 18
<211> 999
<212> PRT
<213> Vicia villosa
9
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<400> 18
Phe Leu His Leu Arg Pro Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg
1 5 10 15
His Leu Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly
20 25 30
His Leu His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp_
35 90 s5
Leu Ser Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met
50 55 60
Pro Thr Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln
65 70 75 80
Thr His Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile
85 90 95
Arg Arg Leu Thr Tyr Asp Ser Leu Val Ala Met Val Pro Phe Gly Pro
100 105 110
Tyr Trp Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala
115 120 125
Thr Thr Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys
130 135 140
Phe Leu Arg Val Met Ala Gln Gly Ala Glu Ala Gln Lys Pro Leu Asp
145 150 155 160
Leu Thr Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met
165 170 175
Met Leu Gly Glu Ala Glu Glu Iie Arg Asp Ile Ala Arg Glu Val Leu
180 185 190
Lys Ile Tyr Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys
195 200 205
His Leu Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn
210 215 220
Lys Phe Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile
225 230 235 240
Val Arg Arg Arg Lys Asn Gly Glu Vai Val Glu Gly Glu Val Ser Gly
245 250 255
Val Phe Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Thr Glu
260 265 270
Ile Lys Ile Thr Lys Asp His Ile Lys Gly Leu Val Val Asp Phe Phe
275 280 285
Ser Ala Gly Ile Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala
290 295 300
Glu Leu Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val
305 310 315 320
Tyr Ser Val Val Gly Lys Asp Arg Leu Val Asp Gl.u Val Asp Thr Gln
325 330 335
Asn Leu Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His
340 395 350
1~
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Pro Pro Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile
355 360 365
Asn Gly Tyr Val Ile Pro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp
370 375 380
uln Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg
38~ 390 ~9~ 400
Pro Glu Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Arg Pro Leu
405 410 415
Asp Leu Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg
920 925 430
Gly Met Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu
935 440 445
Leu Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln
450 455 960
Gly Gln Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg
965 970 475 480
Ala Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu
485 490 495
Ala Arg Ile
<210> 19
<211> 1501
<212> DNA
<213> Lens culinaris
<900> 19
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccctcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctccctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 290
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc atggttccat tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ccgtcaacaa gctcaggcct ttgaggaccc 420
aacagatccg caagttcctt agggttatgg cccaaagcgc agaggcccag aagccccttg 980
acgtcaccga ggagcttctc aaatggacca acagcaccat ctccatgatg atgctcggcg 540
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatcttcggc gaatacagcc 600
tcactgactt catctggcct ttgaagtatc tcaaggttgg aaagtatgag aagaggattg 660
atgacatctt gaacaagttc gaccctgtcg ttgaaagggt catcaagaag cgccgtgaga 720
tcgtcagaag gagaaagaac ggagaagttg ttgagggcga ggccagcggc gtcttcctcg 780
acactttgct tgaattcgct gaggacgaga ccatggagat caaaattacc aaggagcaaa 840
tcaagggcct tgttgtcgac tttttctctg cagggacaga ttccacagcg gtggcaacag 900
agtgggcatt ggcagagctc atcaacaatc ccagggtgtt gcaaaaggct cgtgaggagg 960
tctacagtgt tgtgggcaaa gatatactcg ttgacgaagt tgacactcaa aaccttcctt 1020
acattagggc cattgtgaag gagacattcc gaatgcaccc accactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg ggcatgtgat cccagaggga gcattggttc 1140
ttttcaatgt ttggcaagta ggaagggacc ccaaatactg ggacagacca tcagaattcc 1200
gtcccgagag gttcttagaa actggtgctg aaggggaagc agggcctctt gatcttaggg 1260
gccagcattt ccaactcctc ccatttgggt ctgggaggag aatgtgccct ggtgtcaatt 1320
tggctacttc aggaatggca acacttcttg catctcttat ccaatgcttt gacctgcaag 1380
tgctgggccc tcaaggacaa atattgaaag gtgatgatgc caaagttagc atggaagaga 1940
gagctggcct cacagttcca agggcacata gtctcgtttg tgttccactt gcaaggatcg 1500
g 1501
<210> 20
<211> 499
il
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/0177Z
<212> PRT
<213> Lens culinaris
<400> 20
Phe Leu His Leu Arg Pro Thr Pro Thr Als Lys Ser Lys Ala Leu Arg
1 5 10 15
His Leu Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly
L. J j
His Pro His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp
35 40 45
Leu Ser Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met
50 55 60
Pro Thr Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln
65 70 75 80
Thr His Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile
8 5 90 95
Arg Arg Leu Thr Tyr Asp Ser Ser Val Ala Met Val Pro Phe Gly Pro
100 105 110
Tyr Trp Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala
115 120 125
Thr Thr Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Iie Arg Lys
130 135 140
Phe Leu Arg Val Met Ala Gln Ser Ala Glu Ala Gln Lys Pro Leu Asp
145 150 i55 160
Val Thr Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met
165 170 175
Met Leu Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu
180 185 190
Lys Ile Phe Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys
195 2C0 205
Tyr Leu Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn
210 215 220
Lys Phe Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile
225 230 235 240
Val Arg Arg Arg Lys Asn Gly Glu Val Val Glu Gly Glu Ala Ser Gly
245 250 255
Val Phe Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Met Glu
260 265 270
Ile Lys Ile Thr Lys Glu Gln Ile Lys Gly Leu Val Val Asp Phe Phe
275 280 285
Ser Ala Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala
290 295 300
Glu Leu Ile Asn Asn Pro Arg Val Leu Gln Lys Ala Arg Glu Glu Val
305 310 315 320
Tyr Ser Val Val Gly Lys Asp Ile Leu Val Asp Glu Val Asp Thr Gln
325 330 335
12
CA 02353306 2001-05-29
WO PCT/US00/01772
00!44909
AsnLeu TyrIle ArgAlaIleVal LysGluThrPhe ArgMetHis
Pro
390 395 350
ProPro ProVal ValLysArgLys CysThrGl~aGlu CysGluIle
Leu
355 360 365
AsnGly ValIle ProGluGlyAla LeuValLeuPhe AsnValTrD
His
_
370 375 380
GlnVal ArgAsp ProLysTyrTrp AspArgProSer GluPheArg
Gly
385 390 395 400
ProGlu PheLeu GluThrGlyAla GluGlyGluAla GlyProLeu
Arg
405 410 415
AspLeu GlyGln HisPheGlnLeu LeuProPheGly SerGlyArg
Arg
420 425 430
ArgMet ProGly ValAsnLeuAla ThrSerGlyMet AlaThrLeu
Cys
435 440 995
LeuAla LeuIle GlnCysPheAsp LeuG1nValLeu GlyProGln
Ser
450 455 460
GlyG1n LeuLys GlyAspAspAla LysValSerMet GluGluArg
Ile
465 970 975 480
AlaGly ThrVal ProArgAlaHis SerLeuValCys VolProLeu
Leu
485 490 qg5
AlaArg
Ile
<210>
21
<211> 1501
<212> DNA
<213> Lensculinaris
<900> 21
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 290
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc atggttccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 920
aacagatccg caagttcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 980
acttgaccga ggagcttctg aaatggacca acagcaccat ctccatgatg gtgctcggcg 590
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatctttggc gaatacagcc 600
tcactgactt catctggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggttg ttgagggtga ggtcagcggg gttttccttg 780
acactttgct tgaattcgct gaggatgaga ccatggagat caaaatcacc aaggaccaca 840
tcaagggtct tgttgtcgac tttttctcgg caggaacaga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt tgacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gccactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg gatgtgtgac cccagaggga gcattgattc 1140
tcttcaatgt atggcaagta ggaagagacc ccaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acaggggctg aaggggaagc aaggcctctt gatcttaggg 1260
gacgacattt tcaacttctc ccatttgggt ctgggaggag aatgtgccct ggagtcaatc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcagg 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1440
gagccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
g 1501
13
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<210> 22
<211> 499
<212> PRT
<213> Lens culinaris
<900> 22
Phe Leu His Leu Arg Pro Trr Pro Thr Ala Lys Ser Lys Ala Leu Arg
1 5 i0 15
His Leu Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly
20 25 30
His Leu His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp
35 40 45
Leu Ser Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met
50 55 60
Pro Thr Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln
65 70 75 80
Thr His Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile
85 90 95
Arg Arg Leu Thr Tyr Asp Ser Ser Val Ala Met Val Pro Phe Gly Pro
100 105 110
Tyr Trp Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala
115 120 125
Thr Thr Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys
130 135 190
Phe Leu Arg Val Met Ala Gln Gly Ala Glu Ala Gln Lys Pro Leu Asp
145 150 155 160
Leu Thr Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met
165 170 175
Val Leu Gly Glu AIa Giu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu
180 185 190
Lys Ile Phe Gly Glu Tyr Ser Leu Thr Asp Phe Iie Trp Pro Leu Lys
195 200 205
His Leu Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn
210 215 220
Lys Phe Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile
225 230 235 240
Val Arg Arg Arg Lys Asn Gly Glu Val Val Glu Gly Glu Val Ser Gly
245 250 255
Val Phe Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Met Glu
260 265 270
Ile Lys Ile Thr Lys Asp His Ile Lys Gly Leu Val Val Asp Phe Phe
275 280 285
Ser Ala Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala
290 295 300
Glu Leu Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val
305 310 315 320
14
CA 02353306 2001-05-29
WO PCTNS00/01772
00/44909
TyrSerValVal GlyLysAspArgLeu ValAspGlu ValAspThrGln
325 330 335
AsnLeuProTyr IleArgAlaIleVal LysGluThr PheArgMetHis
390 395 350
ro ProLeuPro ValValLysAraLys CysThrGlu GluCvsGluIle
.. 36G 365
i5
AsnGlyCysVal ThrProGluGlyAia LeuIleLeu PheAsnValTrp
370 375 380
GlnValGlyArg AspProLysTyrTrp AspArgPro SerGluPheArg
385 390 395 400
ProGluArgPhe LeuGIuThrGlyAla GluGlyGlu AlaArgProLeu
405 410 915
AspLeuArgGly ArgHisPheGlnLeu LeuProPhe GlySerGlyArg
920 925 930
ArgMetCysPro GlyValAsnLeuAla ThrSerGly MetAlaThrLeu
935 440 qq5
LeuAlaSerLeu IleGlnCysPheAsp LeuGlnVal LeuGlyProGln
950 455 460
GlyGlnIleLeu LysGlyGlyAspAla LysValSer MetGluGluArg
965 470 475 480
AlaGlyLeuThr ValProArgAlaHis SerLeuVal CysValProLeu
485 490 495
AlaArgIle
<210>
23
<211> 566
1
<212>
DNA
<213> aureus
Phaseolus
<900> 23
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
actcccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ccttcatctc ttaaaagaca aacttctcca ctacgcactc 180
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 240
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccct tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt 480
agggttatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 540
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg ttgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 840
gaggatgaga ccatggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
tttttctcgg caggaacaga ctccacagcg gtggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg cctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac agaagagtgt 1190
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
acacttctcgatctcttat agtgctttgacttgcaag tgctgggtcc caaggacag1940
c tc a
atattgaaggtggtgacgc aagttagcatggaagaga gagccggcct actgttcca1500
g ca c
agggcacatatcttgtctg acttgcaaggatcg gcgttgcatc aaactcctt1560
g tgttcc t
tctaaa 1566
<210> 29
<211> 522
~;212> PRT
:213> Phaseolus aureus
<400> 24
MetLeu Glu LeuAlaLeu GlyLeuLeu ValLeuAiaLeu PheLeu
Leu
I 5 10 15
HisLeu Pro ThrProThr AlaLysSer LysAlaLeuArg HisLeu
Arg
20 25 30
ProAsn Pro SerProLys ProArgLeu ProPheIleGly HisLeu
Pro
35 q0 95
HisLeu Lys AspLysLeu LeuHisTyr AlaLeuIleAsp LeuSer
Leu
50 55 60
LysLys Gly ProLeuPhe SerLeuTyr PheGlySerMet ProThr
His
65 70 75 80
ValVal Ser ThrProGlu LeuPheLys LeuPheLeuGln ThrHis
Ala
85 90 95
GluAla Ser PheAsnThr ArgPheGln ThrSerAlaIle ArgArg
Thr
100 105 110
LeuThr Asp SerSerVal AlaMetVal ProPheGlyPro TyrTrp
Tyr
115 120 I25
LysPhe Arg LysLeuIle MetAsnAsp LeuLeuAsnAla ThrThr
Val
130 135 140
ValAsn Leu ArgProLeu ArgThrGln GlnIleArgLys PheLeu
Lys
195 150 155 160
ArgVaI Ala GlnGlyAla GluAlaGln LysProLeuAsp LeuThr
Met
165 170 175
GluGlu Leu LysTrpThr AsnSerThr IleSerMetMet MetLeu
Leu
180 185 190
GlyGlu Glu GluIleArg AspIleAla ArgGluValLeu LysIle
Ala
195 200 205
PheGly Tyr SerLeuThr AspPheIle TrpProLeuLys HisLeu
Glu
210 215 220
LysVaJ Lys TyrGluLys ArgIleAsp AspIleLeuAsn LysPhe
Gly
225 230 235 290
AspPro Val GluArgVal IleLysLys ArgArgGluIle Va1Arg
Val
245 250 255
ArgArg Asn GlyGluVal ValGluGly GluValSerGly ValPhe
Lys
260 265 270
LeuAsp Leu LeuGluPhe AlaGluAsp G1uThrMetGlu IleLys
Thr
275 280 285
16
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
IleThr LysAspHisIle LysGlyLeuVal ValAspPhePhe SerAla
2g0 295 300
GlyThr AspSerThrAla ValAlaThrGlu TrpAlaLeuAla GluLeu
305 310 315 320
IleAsn AsnProLysVal LeuGluLysAla ArgGluGluAla TyrSer
325 330 335
ValVal GlyLysAspArg LeuValAspGlu ValAspThrGln AsnLeu
340 345 350
ProTyr IleArgAlaIle ValLysGluThr PheArgMetHis ProPro
355 360 365
LeuPro ValValLysArg LysCysThrGlu GluCysGluIle AsnGly
370 375 380
TyrVal IleProGluGly AlaLeuIleLeu PheAsnValTrp GlnVal
385 390 395 400
GlyArg AspProLysTyr TrpAspArgPro SerGluPheArg ProGlu
905 910 915
ArgPhe LeuGluThrGly AlaGluGlyGlu AlaArgProLeu AspLeu
420 425 430
ArgGly GlnHisPheGln LeuLeuProPhe GlySerGlyArg ArgMet
435 440 445
CysPro GlyValAsnLeu AlaThrSerGly MetAlaThrLeu LeuAla
450 455 460
SerLeu IleGlnCysPhe AspLeuGlnVal LeuGlyProGln GlyGln
465 470 975 480
IleLeu LysGlyGlyAsp AlaLysValSer MetGluGluArg AlaGly
485 490 495
Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala Arg
500 505 510
Ile Gly Val Ala Ser Lys Leu Leu Ser Lys
515 520
<210> 25
<211> 1566
<212> DNA
<213> Phaseolus aureus
<400> 25
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
acacccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ccttcatctc ttaaaagaca aacttctcca ctacgcgctc 180
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 240
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccct tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt 980
agggctatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 590
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg ttgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 890
gaggatgaga ccatggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
17
CA 02353306 2001-05-29
WO 00/44909 PC'T/US00101772
tttttctcgg caggaacaga ctccacagcg gtggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg tctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac ggaagagtgt 1140
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
acacttcttg catctcttat tcagtgcttt gacttgcaag tgctgggtcc acaaggacag 1490
atattgaagg gtggtgacgc caaagttagc atggaagaga gagccggcct cactgttcca 1506
agggcacata gtcttgtctg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
1566
tcttaa
<210> 26
<211> 521
<212> PRT
<213> Phaseolus aureus
<900>
26
Met Leu Val Leu Leu
Leu Glu Leu Phe
Leu Ala
Ala
Leu
Gly
Leu
Leu
1 5 10 15
HisLeu ProThrPro SerLys LeuArgHisLeu
Arg Thr Ala
Ala
Lys
20 25 30
ProAsn ProProSerPro LysProArg LeuProPhe IleGlyHisLeu
35 40 45
HisLeu LeuLysAspLys LeuLeuHis TyrAlaLeu IleAspLeuSer
50 55 60
LysLys HisGlyProLeu PheSerLeu TyrPheGly SerMetProThr
65 70 75 80
ValVal AlaSerThrPro GluLeuPhe LysLeuPhe LeuGlnThrHis
85 90 95
GluAla ThrSerPheAsn ThrArgPhe GlnThrSer AlaIleArgArg
100 105 110
LeuThr TyrAspSerSer ValAlaMet ValProPhe GlyProTyrTrp
115 120 125
LysPhe ValArgLysLeu IleMetAsn AspLeuLeu AsnAlaThrThr
130 135 140
ValAsn LysLeuArgPro LeuArgThr GlnGlnIle ArgLysPheLeu
145 150 155 160
ArgAla MetAlaGlnGly AlaGluAla GlnLysPro LeuAspLeuThr
165 170 175
GluGlu LeuLeuLysTrp ThrAsnSer ThrIleSer MetMetMetLeu
180 185 190
GlyGlu AlaGluGluIle ArgAspIle AlaArgGlu ValLeuLysIle
195 200 205
PheGly GluTyrSerLeu ThrAspPhe IleTrpPro LeuLysHisLeu
210 215 220
LysVal GlyLysTyrGlu LysArgIle AspAspIle LeuAsnLysPhe
225 230 235 240
AspPro ValValGluArg ValIleLys LysArgArg GluIleValArg
245 250 255
18
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
ArgArg Lys GluValValGlu GlyGluValSer GlyValPhe
Asn
Gly
260 265 270
LeuAsp ThrLeu LeuGluPheAlaGlu AspGluThrMet GluIleLys
275 280 285
TieThr LysAsp HisIleLysGlyLeu ValVaiAspPhe PheSerAla
__
290 295 300
GlyThr AspSer ThrAlaValAlaThr GluTrpAlaLeu AlaGluLeu
305 310 315 320
IleAsn AsnPro LysValLeuGluLys AlaArgGluGlu ValTyrSer
325 330 335
ValVal GlyLys AspArgLeuValAsp GluValAspThr GlnAsnLeu
340 395 350
ProTyr IleArg AlaIleValLysGlu ThrPheArgMet HisProPro
355 360 365
LeuPro ValVal LysArgLysCysThr GluGluCysGlu I1eAsnGly
370 375 380
TyrVal ilePro GluGlyAlaLeuIie LeuPheAsnVal TrpGlnVal
385 390 395 400
GlyArg AspPro LysTyrTrpAspArg ProSerGluPhe ArgProGlu
905 410 415
ArgPhe LeuGlu ThrGlyAiaGluGly GluAlaArgPro LeuAspLeu
420 925 430
ArgGly GlnHis PheGlnLeuLeuPro PheGlySerGly ArgArgMet
435 440 945
CysPro GlyVal AsnLeuAlaThrSer GlyMetAlaThr LeuLeuAla
950 955 460
SerLeu IleGln CysPheAspLeuGln ValLeuGlyPro GlnGlyGln
965 470 975 980
IleLeu LysGiy GlyAspAlaLysVal SerMetGluGlu ArgAlaGly
qg5 490 495
LeuThr ValPro ArgAlaHisSerLeu ValCysValPro LeuAlaArg
500 505 510
IleGly ValAla SerLysLeuLeuSer
515 520
<210> 27
<211> 1566
<212> DNA
<213> Phaseolus
aureus
<400> 27
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
acacccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ccttcatctc ttaaaagaca aacttctcca ctacgcactc 180
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 240
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccct tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt 480
19
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
agggttatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 540
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg ttgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 890
gaggatgaga ccacggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
_ttttctcgg caggaacaga ctccacagcg gtggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg tctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac agaagagtgt 1140
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
acacttcttg catctcttat tcagtgcttt gacttgcaag tgctgggtcc acaaggacag 1440
atattgaagg gtggtgacgc caaagttagc atggaagaga gggccggcct cactgttcca 1500
agggcacata gtcttgtctg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
tcttaa 1566
<210> 2B
<211> 521
<212> PRT
<213> Phaseolus aureus
<900> 28
Met Leu Leu Glu Leu Ala Leu Gly Leu Leu Val Leu Ala Leu Phe Leu
1 5 10 15
His Leu Arg Pro Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg His Leu
20 25 30
Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly His Leu
35 40 45
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp Leu Ser
50 55 60
Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met Pro Thr
65 70 75 80
Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln Thr His
85 90 95
Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile Arg Arg
100 105 110
Leu Thr Tyr Asp Ser Ser Val Ala Met Val Pro Phe Gly Pro Tyr Trp
I15 120 125
Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala Thr Thr
130 135 190
Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys Phe Leu
145 150 155 160
Arg Val Met Ala Gln Gly Ala Glu Ala Gln Lys Pro Leu Asp Leu Thr
165 170 175
Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met Met Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu Lys Ile
195 200 205
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Phe Giy Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys His Leu
210 215 220
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 240
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile Val Arg
245 250 255
Arg Arg Lys Asn Gly Glu Val Val Glu Gly Giu Val Ser Gly Val Phe
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Thr Glu Ile Lys
275 280 285
Ile Thr Lys Asp His Ile Lys Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val Tyr 5er
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
340 345 350
Pro Tyr Ile Arg Ala I1e Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn Gly
370 375 380
Tyr Val Ile Pro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp Gln Val
385 390 395 900
Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro Glu
405 410 915
Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Arg Pro Leu Asp Leu
420 425 430
Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Met
935 490 495
Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu Leu Ala
950 955 460
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly Gln
465 970 975 480
Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg Ala Gly
985 490 495
Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala Arg
500 505 510
Ile Gly Val Ala Ser Lys Leu Leu Ser
515 520
<210> 29
<211> 1566
<212> DNA
<213> Phaseolus aureus
21
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<400> 29
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
acacccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ~cttcatctc ttaaaagaca aacttctcca ctacgcactc 1B0
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 290
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccct tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 920
aacgccacca c~gtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt -i80
agggttatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 540
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg ttgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 890
gaggatgaga ccatggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
tttttctcgg caggaacaga ctccacagcg gaggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg tctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac agaagagtgt 1140
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
acacttcttg catctcttat tcagtgcttt gacttgcaag tgctgggtcc acaaggacag 1440
atattgaagg gtggtgacgc caaagttagc atggaagaga gagccggcct cactgttcca 1500
agggcacata gtcttgtctg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
tcttaa 1566
<210> 30
<211> 521
<212> PRT
<213> Phaseolus aureus
<900> 30
Met Leu Leu Glu Leu Ala Leu Gly Leu Leu Val Leu Ala Leu Phe Leu
1 5 10 15
His Leu Arg Prc Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg His Leu
20 25 30
Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly His Leu
35 90 45
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp Leu Ser
50 55 60
Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met Pro Thr
65 70 75 BO
Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln Thr His
B5 90 95
Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile Arg Arg
100 105 110
Leu Thr Tyr Asp Ser Ser Val Ala Met Val Pro Phe Gly Pro Tyr Trp
115 120 125
Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Al.a Thr Thr
130 135 140
Val Asn Lys Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys Phe Leu
195 150 155 160
22
CA 02353306 2001-05-29
WO 00144909 PCT/US00/01772
Arg Val Met Ala Gln Gly Ala Glu Ala Gln Lys Pro Leu Asp Leu Thr
165 170 175
Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met Met Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu Lys Ile
195 200 205
Phe Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys His Leu
210 215 220
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 240
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile Val Arg
245 250 255
Arg Arg Lys Asn Gly Glu Val Val Glu Gly Glu Val Ser Gly Val Phe
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Giu Thr Met Glu Ile Lys
275 280 285
Ile Thr Lys Asp His Ile Lys Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Glu Aia Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val Tyr Ser
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
340 345 350
Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn Gly
370 375 380
Tyr Val Ile Pro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp Gln Val
385 390 395 400
Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro Glu
405 410 415
Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Arg Pro Leu Asp Leu
420 425 430
Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Met
435 440 995
Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu Leu Ala
450 455 960
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly Gln
465 470 975 480
Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg Ala Gly
485 990 495
Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala Arg
500 505 510
23
CA 02353306 2001-05-29
WO 00144909 PCT/US00/01772
Ile Gly Val Ala Ser Lys Leu Leu Ser
515 520
<210> 31
<211> 1566
<212> DNA
<213> Trifolium pratense
~400> 31
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
acacccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ccttcatctc ttaaaagaca aacttctcca ctacgcactc 180
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 290
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccca tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt 480
agggttatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 540
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg atgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 840
gaggatgaga ccacggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
tttttctcgg cagggacaga ctccacagcg gtggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg tctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac agaagagtgt 1190
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
acacttcttg catctcttat tcagtgcttt gacttgcaag tgctgggtcc acaaggacag 1940
atattgaagg gtggtgacgc caaagttagc atggaagaga gggccggcct cactgttcca 1500
agggcacata gtcttgtctg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
tcttaa 1566
<210> 32
<211> 521
<212> PRT
<213> Trifolium pratense
<400> 32
Met Leu Leu Glu Leu Ala Leu Gly Leu Leu Val Leu Ala Leu Phe Leu
1 5 10 15
His Leu Arg Pro Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg His Leu
20 25 30
Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly His Leu
35 40 45
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Ile Asp Leu Ser
50 55 60
Lys Lys His Gly Pro Leu Phe Ser Leu Tyr Phe Gly Ser Met Pro Thr
65 70 75 80
Val Val Ala Ser Thr Pro Glu Leu Phe Lys Leu Phe Leu Gln Thr His
85 90 95
Glu Ala Thr Ser Phe Asn Thr Arg Phe Gln Thr Ser Ala Ile Arg Arg
100 105 110
Leu Thr Tyr Asp Ser Ser Val Ala Met Val Pro Ile Gly Pro Tyr Trp
115. 120 125
24
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala Thr Thr
130 135 140
Val Asn Lys Leu Arg Pro Leu Arg Thr Gln ~ln Ile Arg Lys Phe Leu
195 150 155 160
Arg Val Met Ala Gln Gly Ala Glu Ala Gln Lys Pro Leu Asp Leu Thr
165 170 _75
Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met Met Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu Lys Ile
195 200 205
Phe Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys His Leu
210 215 220
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 290
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile Val Arg
245 250 255
Arg Arg Lys Asn Gly Glu Val Asp Glu Gly Glu Val Ser Gly Val Phe
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Thr Glu Ile Lys
275 280 285
Ile Thr Lys Asp His Ile Lys Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Lys Val Leu Glu Lys Ala Arg Glu Glu Val Tyr Ser
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
390 345 350
Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn Gly
370 375 380
Tyr Val Ile Fro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp Gln Val
3B5 390 395 400
Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro Glu
405 410 415
Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Arg Pro Leu Asp Leu
420 425 930
Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Met
435 440 445
Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu Leu Ala
450 955 960
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly Gln
965 970 975 980
CA 02353306 2001-05-29
WO 00/44909 PCT/US00101772
Ile Lys GlyGly Asp LysVal Ser Met Glu Glu Arg
Leu Ala Ala Gly
485 490 495
Leu Val ProArg Ala SerLeu Val Cys Vai Pro Leu
Thr His Ala Arg
500 505 510
Ile Val AlaSer Lys LeuSer
Giy Leu
515 520
<210>33
<211>1566
<212>DNA
<213>Trifolium
pratense
<400> 33
atgttgctgg aacttgcact tggtttattg gttttggctc tgtttctgca cttgcgtccc 60
acacccactg caaaatcaaa agcacttcgc catctcccaa acccaccaag cccaaagcct 120
cgtcttccct tcataggaca ccttcatctc ttaaaagaca aacttctcca ctacgcactc 180
atcgacctct ccaaaaaaca tggtccctta ttctctctct actttggctc catgccaacc 240
gttgttgcct ccacaccaga attgttcaag ctcttcctcc aaacgcacga ggcaacttcc 300
ttcaacacaa ggttccaaac ctcagccata agacgcctca cctatgatag ctcagtggcc 360
atggttccct tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc aacagatccg caagttcctt 480
agggttatgg cccaaggcgc agaggcacag aagccccttg acttgaccga ggagcttctg 590
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggttcttaa gatctttggc gaatacagcc tcactgactt catctggcca 660
ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg acgacatctt gaacaagttc 720
gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga tcgtgaggag gagaaagaac 780
ggagaggttg ttgagggtga ggtcagcggg gttttccttg acactttgct tgaattcgct 840
gaggatgaga ccacggagat caaaatcacc aaggaccaca tcaagggtct tgttgtcgac 900
tttttctcgg caggaacaga ctccacagcg gtggcaacag agtgggcatt ggcagaactc 960
atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg tctacagtgt tgtgggaaag 1020
gacagacttg tggacgaagt tgacactcaa aaccttcctt acattagagc aatcgtgaag 1080
gagacattcc gcatgcaccc gccactccca gtggtcaaaa gaaagtgcac agaagagtgt 1140
gagattaatg gatatgtgat cccagaggga gcattgattc tcttcaatgt atggcaagta 1200
ggaagagacc ccaaatactg ggacagacca tcggagttcc gtcctgagag gttcctagag 1260
acaggggctg aaggggaagc aaggcctctt gatcttaggg gacaacattt tcaacttctc 1320
ccatttgggt ctgggaggag aatgtgccct ggagtcaatc tggctacttc gggaatggca 1380
acacttcttg catctcttat tcagtgcttt gacttgcaag tgctgggtcc acaaggacag 1490
atattgaagg gtggtgacgc caaagttagc atggaagaga gggccggcct cactgttcca 1500
agggcacata gtcttgtctg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
tcttaa 1566
<210>34
<211>521
<212>PRT
<213>Trifolium
pratense
<400>39
Met Leu GluLeuAla LeuGlyLeuLeu ValLeuAlaLeu PheLeu
Leu
1 5 10 15
His Arg ProThrPro ThrAlaLysSer LysAlaLeuArg HisLeu
Leu
20 25 30
Pro Pro ProSerPro LysProArgLeu ProPheIleGly HisLeu
Asn
35 40 45
His Leu LysAspLys LeuLeuHisTyr AlaLeuIleAsp LeuSer
Leu
50 55 60
Lys His GlyProLeu PheSerLeuTyr PheGlySerMet ProThr
Lys
65 70 75 80
26
CA 02353306 2001-05-29
WO PCTNS00/01772
00/44909
ValValAlaSer ThrProGlu LeuPheLys LeuPheLeu GlnThrHis
85 90 95
GluAlaThrSer PheAsnThr ArgPheGln ThrSerAla IleArgArg
100 105 110
LeuThrTyrAsp SerSerVal AlaMetVal ProPheGly ProTyrTrp
115 12G 125
LysPheValArg LysLeuIle MetAsnAsp LeuLeuAsn AlaThrThr
13D 135 190
ValAsnLysLeu ArgProLeu ArgThrGln GlnIleArg LysPheLeu
195 150 155 160
ArgVa1MetAla GlnGlyAla GluAlaGln LysProLeu AspLeuThr
165 170 175
GluGluLeuLeu LysTrpThr AsnSerThr IleSerMet MetMetLeu
180 185 190
GlyGluAlaGlu GluIleArg AspIleAla ArgGluVal LeuLysIle
195 200 205
PheGlyGluTyr SerLeuThr AspPheIie TrpProLeu LysHisLeu
210 215 220
LysValGlyLys TyrGluLys ArgIleAsp AspIleLeu AsnLysPhe
225 230 235 290
AspProValVal GluArgVal IleLysLys ArgArgGlu IleValArg
245 250 255
ArgArgLysAsn GlyGluVal ValGluGly GluValSer GlyValPhe
260 265 27p
LeuAspThrLeu LeuGluPhe AlaGluAsp GluThrThr GluIleLys
275 280 285
IleThrLysAsp HisIieLys GlyLeuVal ValAspPhe PheSerAla
290 295 300
GlyThrAspSer ThrAlaVal AlaThrGlu TrpAlaLeu AlaGluLeu
305 310 315 320
IleAsnAsnPro LysValLeu GluLysAla ArgGluGlu ValTyrSer
325 330 335
ValValGlyLys AspArgLeu ValAspGlu ValAspThr GlnAsnLeu
340 345 350
ProTyrIleArg AlaIleVal LysGluThr PheArgMet HisProPro
355 360 365
LeuProValVal LysArgLys CysThrGlu GluCysGlu IleAsnGly
370 375 380
TyrValIlePro GluGlyAla LeuIleLeu PheAsnVal TrpGlnVal
385 390 395 400
GlyArgAspPro LysTyrTrp AspArgPro SerGluPhe ArgProGlu
405 410 415
ArgPheLeuGlu ThrGlyAla GluGlyGlu AlaArgPro LeuAspLeu
420 425 430
27
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Arg Gly HisPheGlnLeuLeu ProPheGlySer GlyArgArg Met
Gln
435 490 495
Cys Pro ValAsnLeuAlaThr SerGlyMetAla ThrLeuLeu Ala
Gly
450 455 460
Ser Leu GlnCysPheAspLeu GlnValLeuGly ProGlnGly Gln
Ile
965 470 475 480
Ile Leu GlyGlyAspAlaLys ValSerMetGlu GluArgAla Gly
Lys
485 490 995
Leu Thr ProArgAlaHisSer LeuValCysVal ProLeuAla Arg
Val
500 505 510
Ile Gly AlaSerLysLeuLeu Ser
Val
515 520
<210> 35
<211> 1563
<212> DNA
<213> Pisumsativum
<900> 35
atgttgctgg aacttgcact tggtttgttt gtgttagctt tgtttctgca cttgcgtccc 60
acaccaagcg caaaatcaaa agcacttcgc cacctcccaa accctccaag cccaaagcct 120
cgtcttccct tcattggcca ccttcacctc ttaaaagata aacttctcca ctatgcactc 180
atcgatctct ccaaaaagca tggcccctta ttctctctct ccttcggctc catgccaacc 290
gtcgttgcct ccacccctga gttgttcaag ctcttcctcc aagcccacga ggcaacttcc 300
ttcagcacaa ggttccaaac ctctgccgta agacgcctca cttacgacaa ctctgtggcc 360
atggttccat tcggacctta ctggaagttc gtgaggaagc tcatcatgaa cgaccttctc 420
aacgccacca ccgtcaacga gctcaggcct ttgaggaccc aacagatccg caagttcctt 980
agggttatgg cccaaagcgc agaggcccag aagccccttg acgtcaccga ggagcttctc 590
aaatggacca acagcaccat ctccatgatg atgctcggcg aggctgagga gatcagagac 600
atcgctcgcg aggtccttaa gatcttcggc gaatacagcc tcactgactt catctggcct 660
ttgaagtatc tcaaggttgg aaagtatgag aagaggattg atgacatctt gaacaagttc 720
gaccctgtcg ttgaaagggt catcaagaag cgccgtgaga tcgtcagaag gagaaagaac 780
ggagaagttg ttgagggcga ggccagcggc gtcttcctcg acactttgct tgaattcgct 840
gaggacgaga ccatggagat caaaattacc aaggagcaaa tcaagggcct tgttgtcgac 900
tttttctctg cagggacaga ttccacagcg gtggcaacag agtgggcatt ggcagagctc 960
atcaacaatc ccagggtgtt gcaaaaggct cgtgaggagg tctacagtgt tgtgggcaaa 1020
gatagactcg ttgacgaagt cgacactcaa aaccttcctt acattagggc cattgtgaag 1080
gagacattcc gaatgcaccc accactccca gtggtcaaaa gaaagtgcac agaagagtgt 1190
gagattaatg ggtatgtgat cccagaggga gcattggttc ttttcaatgt ttggcaagta 1200
ggaaaggacc ccaaatactg ggacagacca tcagaattcc gtcccgagag gttcttagaa 1260
actggcgctg aaggggaagc agggcctctt gatcttaggg gccagcattt ccaactcctc 1320
ccatttgggt ctgggaggag aatgtgccct ggtgtcaatt tggctacttc aggaatggca 1380
acacttcttg catctcttat ccaatgcttt gacctgcaag tgctgggccc tcaaggacaa 1440
atattgaaag gtgacgatgc caaagttagc atggaagaga gagctggcct caccgttcca 1500
agggcacata gtctcgtttg tgttccactt gcaaggatcg gcgttgcatc taaactcctt 1560
t ct
1563
<210> 36
<211> 521
<212~ PRT
<213> Pisum
sativum
<900> 36
Met LeuGlu Leu Leu Leu PheVal Leu LeuPhe
Leu Ala Gly Ala Leu
1 5 10 15
His ArgPro Thr Ser Lys SerLys Ala ArgHis
Leu Pro Ala Leu Leu
20 25 30
Pro ProPro Ser Lys Arg LeuPro Phe GlyHis
Asn Pro Pro Ile Leu
35 90 95
28
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Leu Iie Asp Leu Ser
50 55 60
Lys Lys His Gly Pro Leu Phe Ser Leu Ser Phe Gly Ser Met Pro Thr
65 70 75 80
'~Ial Val Ala Ser Thr Pro Glu Leu Phe Lvs Leu Phe Leu Gln Ala His
85 90
Glu Ala Thr Ser Phe Ser Thr Arg Phe Gln Thr Ser Ala Val Arg Arg
100 105 110
Leu Thr Tyr Asp Asn Ser Val Ala Met Val Pro Phe Gly Pro Tyr Trp
115 120 125
Lys Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala Thr Thr
130 135 140
Val Asn Glu Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys Phe Leu
145 150 155 160
Arg Val Met Ala Gln Ser Ala Glu Ala Gln Lys Pro Leu Asp Val Thr
165 170 175
Glu Glu Leu Leu Lys Trp Thr Asn Ser Thr Ile Ser Met Met Met Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Iie Ala Arg Glu Val Leu Lys Ile
195 200 205
Phe Gly Glu Tyr Ser Leu Thr Asp Phe Ile Trp Pro Leu Lys Tyr Leu
210 215 220
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 240
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Glu Ile Val Arg
245 250 255
Arg Arg Lys Asn Gly Glu Val Val Glu Gly Glu Ala Ser Gly Val Phe
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Met Glu Ile Lys
275 280 285
Ile Thr Lys Glu Gln Ile Lys Gly Leu Val Val Asp Phe Phe Ser Ala
290 295 300
Gly Thr Asp Ser Thr Ala Val Ala Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Arg Val Leu Gln Lys Ala Arg Glu Glu Val Tyr Ser
325 330 335
Val Val Gly Lys Asp Arg Leu Val Asp Glu Val Asp Thr Gln Asn Leu
340 395 350
Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn Gly
370 375 380
Tyr Val Ile Pro Glu Gly Al.a Leu Val Leu Phe Asn Val Trp Gln Val
385 390 395 900
29
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OZ772
Gly Lys Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro Glu
905 410 415
Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Gly Pro Leu Asp Leu
920 425 430
Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Met
435 440 995
Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu Leu Ala
450 455 960
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly Gln
465 470 475 980
Ile Leu Lys Gly Asp Asp Ala Lys Val Ser Met Glu Glu Arg Ala Gly
985 490 4g5
Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala Arg
500 505 510
Ile Gly Val Ala Ser Lys Leu Leu Ser
515 520
<210> 37
<211> 1996
<212> DNA
<213> Trifolium repens
<400> 37
tctcacttgc gtcccacacc aagtgcaata tcaaaagcac ttcgccacct cccaaaccct 60
ccaagcccaa ggcctcgtct tcccttcatt ggccaccttc acctcttaaa agataaactt 120
ctccactatg cacccatcga tctctccaaa aagcatggcc ccttattctc tctctccttc 180
ggctccatgc caaccgtcgt tgcctccacc cctgagttgt tcaagctctt cctccaaacc 290
cacgaggcaa cttccttcaa cacaaggttc caaacctctg ccataagaca cctcacttac 300
gacaactctg tggccatggt tccattcgga ccttactgga agttcgtgag gaagctcatc 360
atgaacgacc ttctcaacgc caccaccgtc aacaagctca ggcctttgag gacccaacag 920
atccgcaagt tccttagggt tatggcccaa agcgcagagg cccagaagcc ccttgacgtc 980
accgaggagc ttctcaaatg gaccaacagc accatctcca tgatgatgct cggcgaggct 590
gaggagatca gagacatcgc tcgcgaggtt cttaagatct tcggcgaata cagcctcact 600
gacttcatct ggcctttgaa gtacctcaag gttggaaagt atgagaagag gattgatgac 660
atcttgaaca agttcgaccc tgtcgttgaa agggtcatca agaagcgccg tgagatcgtc 720
agaaggagaa agaacggaga agttgttgag ggcgaggcca gcggcgtctt cctcgacact 780
ttgcttgaat tcgctgagga cgagaccatg gagatcaaaa ttaccaagga gcaaatcaag 840
ggccttgttg tcgacttttt ctctgcaggg acagattcca cagcggtggt aacagagtgg 900
gcattggcag agctcatcaa caatcccagg gtgttgcaaa aggctcgtga ggaggtctac 960
agtgttgtgg gcaaagatag actcgttgac gaagttgaca ctcaaaacct tccttacatt 1020
agggccattg tgaaggagac attccgaatg cacccaccac tcccagtggt caaaagaaag 1080
tgcacagaag agtgtgagat taatgggtat gtgatcccag agggagcatt ggttcttttc 1140
aatgtttggc aagtaggaag ggaccccaaa tactgggaca gaccatcaga atcccgtccc 1200
gagaggttct tagaaactgg tgctgaaggg gaagcagggc ctcttgatct taggggccag 1260
catttccaac tcctcccatt tgggtctggg aggagaatgt gccctggtgt cagtttggct 1320
acttcaggaa tggcaacact tcttgcatct cttatccaat gctttgacct gcaagtgctg 1380
ggccctcaag gacaaatatt gaaaggtgat gatgccaaag ttagcatgga agagagagct 1490
ggcctcacag ttccaagggc acatagtctc gtttgtgttc cacttgcaag gatcgg 1496
<210> 38
<211> 998
<212> PRT
<213> Trifolium repens
<400> 38
Ser His Leu Arg Pro Thr Pro Ser Ala Ile Ser Lys Ala Leu Arg His
1 5 10 15
3U
CA 02353306 2001-05-29
WO PCT/US00101772
00/44909
LeuProAsn ProProSerPro ArgProArg LeuPro PheIleGlyHis
20 25 30
LeuHisLeu LeuLysAspLys LeuLeuHis TyrAla ProIleAspLeu
35 40 45
SerLysLys HisGlyProLeu PheSerLeu SerPhe GlySerMetPro
50 55 60
ThrValVal AlaSerThrPro GluLeuPhe LysLeu PheLeuGlnThr
65 70 75 80
HisGluAla ThrSerPheAsn ThrArgPhe GlnThr SerAlaIleArg
85 90 95
HisLeuThr TyrAspAsnSer ValAlaMet ValPro PheGlyProTyr
100 105 110
TrpLysPhe ValArgLysLeu IleMetAsn AspLeu LeuAsnAlaThr
115 120 125
ThrValAsn LysLeuArgPro LeuArgThr GlnGln IleArgLysPhe
130 135 19
0
LeuArgVal MetAlaGlnSer AlaGluAla GlnLys ProLeuAspVal
145 150 155 160
ThrGluGlu LeuLeuLysTrp ThrAsnSer ThrIle SerMetMetMet
165 170 175
LeuGlyGlu AlaGluGluIle ArgAspIle AlaArg GluValLeuLys
180 185 190
IlePheGly GluTyrSerLeu ThrAspPhe IleTrp ProLeuLysTyr
195 200 205
LeuLysVal GlyLysTyrGlu LysArgIle AspAsp IleLeuAsnLys
210 215 220
PheAspPro ValValGluArg ValIleLys LysArg ArgGluIleVal
225 230 235 240
ArgArgArg LysAsnGlyGlu ValValGlu GlyGlu AlaSerGlyVal
295 250 255
PheLeuAsp ThrLeuLeuGlu PheAlaGlu AspGlu ThrMetGluIle
260 265 270
LysIleThr LysGluGlnIle LysGlyLeu ValVal AspPhePheSer
275 280 285
AlaGlyThr AspSerThrAla ValValThr GluTrp AlaLeuAlaGlu
290 295 300
LeuIleAsn AsnProA=gVal LeuGlnLys AlaArg GluGluValTyr
305 310 315 320
SerValVal GlyLysAspArg LeuValAsp GluVal AspThrGlnAsn
325 330 335
LeuProTyr IleArgAlaIle ValLysGlu ThrPhe ArgMetHisPro
340 345 350
ProLeuPro ValValLysArg LysCysThr GluGlu CysGluIleAsn
355 360 365
31
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
Gly Tyr Val Ile Pro Glu Gly Ala Leu Val Leu Phe Asn Val Trp Gln
370 375 380
Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Ser Arg Pro
385 390 395 400
Glu Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Gly Pro Leu Asp
905 410 915
Leu Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg
420 925 430
Met Cys Pro Gly Val Ser Leu Ala Thr Ser Gly Met Ala Thr Leu Leu
935 440 945
Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly
950 955 960
Gln Ile Leu Lys Gly Asp Asp Ala Lys Val Ser Met Glu Glu Arg Ala
465 470 475 480
Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala
485 990 495
Arg Ile
<210> 39
<211> 1501
<212> DNA
<213> Trifolium repens
<400> 39
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 240
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctacgacaa ctctgtggcc atggttccat tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ccgtcaacaa gctcaggcct ttgaggaccc 420
aacagatccg caagttcctt agggttatgg cccaaagcgc agaggcccag aagccccttg 480
acgtcaccga ggagcttctc aaatggacca acagcaccat ctccatgatg atgctcggcg 540
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatcttcggc gaatacagcc 600
tcactgactt catctggcct ttgaagtatc tcaaggttgg aaagtatgag aagaggattg 660
atgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtcagaag gagaaagaac ggagaagttg ttgagggcga ggccagcggc gtcttcctcg 780
acactttgct tgaattcgct gaggacgaga ccatggagat caaaattacc aaggagcaaa 840
tcaagggcct tgttgtcgac tttttctctg cagggacaga ttccacagcg gtggcaacag 900
agtgggcatt ggcagagctc atcaacaatc ccaaggtgtt gcaaaaggct cgtgaggagg 960
cctacagtgt tgtgggcaaa gatagactcg ttgacgaagt tgacactcaa aaccttcctt 1020
acattagggc cattgtgaag gagacattcc gaatgcaccc accactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gggattaatg ggtatgtgat cccagaggga gcattggttc 1140
ttttcaatgt ttggcaagta ggaagggacc ccaaatactg ggacagacca tcagaattcc 1200
gtcccgagag gttcttagaa actggtgctg aaggggaagc agggcctctt gatcttaggg 1260
gccagcattt ccaactcctc ccattt5ggt ctgggaggag aatgtgccct ggtgtcaatt 1320
tggctacttc aggaatggca acacttcttg catctcttat ccaatgcttt gacctgcaag 1380
tgctgggccc tcaaggacaa atattgaaag gtgatgatgc caaagttagc atggaagaga 1490
gagctggcct cacagttcca agggcacata gtctcgtttg tgttccactt gcaaggatcg 1500
g 1501
<210> 40
<211> 499
<212> PRT
<213> Trifolium repens
32
CA 02353306 2001-05-29
WO PCTNS00/01772
00144909
<400> 40
PheLeuHisLeuArg ProThrPro ThrAlaLys SerLysAla LeuArg
1 5 10 15
HisLeuProAsnPro ProSerPro LysProArg LeuProPhe IleGly
20 25 30
fitsLeuHisLeuLeu LysAspLys LeuLeuHis TyrAlaLeu IleAsp
35 40 ~5
LeuSerLysLysHis GlyProLeu PheSerLeu TyrPheGly SerMet
50 55 60
ProThrValValAla SerThrPro GluLeuPhe LysLeuPhe LeuGln
65 70 75 80
ThrHisGluAlaThr SerPheAsn ThrArgPhe GlnThrSer AlaIle
85 90 95
ArgArgLeuThrTyr AspAsnSex ValAlaMet ValProPhe GlyPro
100 105 110
TyrTrpLysPheVal ArgLysLeu IleMetAsn AspLeuLeu AsnAla
115 120 125
ThrThrValAsnLys LeuArgPro LeuArgThr GlnGlnIle ArgLys
130 135 140
PheLeuArgValMet AlaGlnSer AlaGluAla GlnLysPro LeuAsp
145 150 155 160
ValThrGluGluLeu LeuLysTrp ThrAsnSer ThrIleSer MetMet
165 170 175
MetLeuGlyGluAla GluGluIle ArgAspIle AlaArgGlu ValLeu
180 185 190
LysIlePheGlyGlu TyrSerLeu ThrAspPhe IleTrpPro LeuLys
195 200 205
TyrLeuLysValGly LysTyrGlu LysArgIle AspAspIle LeuAsn
210 215 220
LysPheAspProVal ValGluArg ValIleLys LysArgArg GluIle
225 230 235 240
ValArgArgArgLys AsnGlyGlu ValValGlu GlyGluAla SerGly
245 250 255
ValPheLeuAspThr LeuLeuGlu PheAlaGlu AspGluThr MetGlu
260 265 270
IleLysIleThrLys GluGlnIle LysGlyLeu ValValAsp PhePhe
275 280 285
SerAlaGlyThrAsp SerThrAla ValAlaThr GluTrpAla LeuAla
290 295 300
GluLeuIleAsnAsn ProLysVal LeuGlnLys AlaArgGlu GluAla
305 310 315 320
TyrSerValValGly LysAspArg LeuValAsp GluValAsp ThrGln
325 330 335
AsnLeuProTyrIle ArgAlaIle ValLysGlu ThrPheArg MetHis
390 345 350
33
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Pro Pro Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Gly Ile
355 360 365
Asn Gly Tyr Val Ile Pro Glu Gly Ala Leu Val Leu Phe Asn Val Trp
370 375 380
Gln Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg
385 390 395 400
Pro Glu Arg Phe Leu Glu Thr Gly Ala Glu Gly Glu Ala Gly Pro Leu
405 410 415
Asp Leu Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg
420 925 930
Arg Met Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu
435 440 495
Leu Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln
450 955 960
Gly Gln Ile Leu Lys Gly Asp Asp Ala Lys Val Ser Met Glu Glu Arg
465 470 975 480
Ala Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu
485 490 495
Ala Arg Ile
<210> 41
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 41
ttgctggaac ttgcacttgg t 21
<210> 42
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 42
gtatatgatg ggtaccttaa ttaagaaagg ag 32
<210> 93
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<900> 93
gacgcctcac ttacgacaac tctgtg 26
<210> 44
<211> 25
34
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/OI772
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 49
cctctcggga cggaattctg atggt 25
<210> 95
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 45
gcggtgcacg ggcggactct tcttc 25
<210> 46
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description cf Artificial Sequence:PCR primer
<400> 46
cgcccaatac gcaaaccgcc tctcc 25
<210> 47
<211> 1501
<212> DNA
<213> Beta vulgaris
<400> 97
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 290
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc atggttccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 920
aacagatccg caagttcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 980
acttgaccga ggagcttctg aaatggacca acagcaccat ctccatgatg atgctcggcg 590
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatctttggc gaatacagcc 600
tcactgactt catctggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggatg ttgagggtga ggtcagcggg gttttccttg 780
acactttgct tgaattcgct gaggatgaga ccatggagat caaaatcacc aaggaccaca 840
tcaagggtct tgttgtcgac tttttctcgg caggaacaga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt agacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gcca~tccca gtggtcaaaa 1080
gaaagtgcat agaagagtgt gagattaatg gatatgtgat cccagaggga gcattgattc 1140
tcttcaatgt atggcaagta ggaagagacc ctaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acaggggctg aaggggaagc aaggcttctt gatcttaggg 1260
gacaacattt tcaacttctc ccatttgggt ctgggaggag aatgtgccct ggagtcaatc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcaag 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1990
gagccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
9
1501
<210> 98
<211> 999
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<212> PRT
<213> vulgaris
Beta
<400> 98
PheLeuHis LeuArgPro ThrProThr AlaLysSerLys AlaLeuArg
1 5 10 15
HisLeuPro AsnProPro SerProLys ProArgLeuPro PheIleGly
20 25 30
HisLeuHis LeuLeuLys AspLysLeu LeuHisTyrAla LeuIleAsp
35 40 95
LeuSerLys LysHisGly ProLeuPhe SerLeuTyrPhe GlySerMet
50 55 60
ProThrVal ValAlaSer ThrProGlu LeuPheLysLeu PheLeuGln
65 70 75 80
ThrHisGlu AlaThrSer PheAsnThr ArgPheGlnThr SerAlaIle
85 90 95
ArgArgLeu ThrTyrAsp SerSerVal AlaMetValPro PheGlyPro
100 105 110
TyrTrpLys PheValArg LysLeuIle MetAsnAspLeu LeuAsnAla
115 120 125
ThrThrVal AsnLysLeu ArgProLeu ArgThrGlnGln IleArgLys
130 135 140
PheLeuArg ValMetAla GlnGlyAla GluAlaGlnLys ProLeuAsp
145 150 155 160
LeuThrGlu GluLeuLeu LysTrpThr AsnSerThrIle SerMetMet
165 170 175
MetLeuGly GluAlaGlu GluIleArg AspIleAlaArg GluValLeu
180 185 190
LysIlePhe GlyGluTyr SerLeuThr AspPheIleTrp ProLeuLys
195 200 205
HisLeuLys ValGlyLys TyrGluLys ArgIleAspAsp IleLeuAsn
210 215 220
LysPheAsp ProValVal GluArgVal ;leLysLysArg ArgGluIle
225 230 235 290
ValArgArg ArgLysAsn GlyGluAsp ValGluGlyGlu ValSerGly
295 250 255
ValPheLeu AspThrLeu LeuGluPhe AlaGluAspGlu ThrMetGlu
260 265 270
IleLysIle ThrLysAsp HisIleLys GlyLeuValVal AspPhePhe
275 280 285
SerAlaGly ThrAspSer ThrAlaVal AlaThrGluTrp AlaLeuAla
290 295 300
GluLeuIle AsnAsnPro LysValLeu GluLysAlaArg GluGluVal
305 310 315 320
TyrSerVal ValGlyLys AspArgLeu ValAspGluVal AspThrGln
325 330 335
36
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
Asn Leu Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His
340 345 350
Pro Pro Leu Pro Val Val Lys Arg Lys Cys Ile Glu Glu Cys Glu Ile
355 360 365
Asn Gly Tyr Val Ile Pro Glu Gly Ala Leu Ile Leu Phe Asn Val Trp
370 375 380
Gln Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg
385 390 395 400
Pro Glu Arg Phe Leu Glu Thr Gly Ala G1u Gly Glu Ala Arg Leu Leu
405 910 415
Asp Leu Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg
420 425 430
Arg Met Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Met Ala Thr Leu
435 940 445
Leu Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln
450 455 460
Gly Gln Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg
465 470 475 480
Ala Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu
485 490 495
Ala Arg Ile
<210> 49
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<400> 49
gaattcgcgg ccgctctaga actagtggat 30
<210> 50
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<900> 50
gaattcgcgg ccgcgaattg ggtaccgggc 30
<210> 51
<211> 27
<212> DNA
<2I3> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR primer
<900> 51
gcaaacgaag acaaatggga gatgata 27
37
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
<210> 52
<2i1> 1801
<212> DNA
<213> Glycine max
<220>
<221> intron
<222> (895)..(1112)
<900> 52
ttgctggaac ttgcacttgg tttgtttgtg ttagctttgt ttctgcactt gcgtcccaca 60
ccaagtgcaa aatcaaaagc acttcgccac ctcccaaacc ctccaagccc aaagcctcgt 120
cttcccttca ttggccacct tcacctctta aaagataaac ttctccacta tgcactcatc 180
gatctctcca aaaagcatgg ccccttattc tctctctcct tcggctccat gccaaccgtc 240
gttgcctcca cccctgagtt gttcaagctc ttcctccaaa cccacgaggc aacttccttc 300
aacacaaggt tccaaacctc tgccataaga cgcctcactt acgacaactc tgtggccatg 360
gttccattcg gaccttactg gaagttcgtg aggaagctca tcatgaacga ccttctcaac 920
gccaccaccg tcaacaagct caggcctttg aggacccaac agatccgcaa gttccttagg 980
gttatggccc aaagcgcaga ggcccagaag ccccttgacg tcaccgagga gcttctcaaa 590
tggaccaaca gcaccatctc catgatgatg ctcggcgagg ctgaggagat cagagacatc 600
gctcgcgagg ttcttaagat cttcggcgaa tacagcctca ctgacttcat ctggcctttg 660
aagtatctca aggttggaaa gtatgagaag aggattgatg acatcttgaa caagttcgac 720
cctgtcgttg aaagggtcat caagaagcgc cgtgagatcg tcagaaggag aaagaacgga 780
gaagttgttg agggcgaggc cagcggcgtc ttcctcgaca ctttgcttga attcgctgag 840
gacgagacca tggagatcaa aattaccaag gagcaaatca agggccttgt tgtcgtaagt 900
ttccttcttc tctcctactt tattactttc tttcattcat catatgtatt ggcattaaat 960
agtatactat atgagaaaat atgttacgca ctcacggtgt aaagatatgt ggtgtttttt 1020
taaaaagaga tacagaagtt gcttttatgc atgtatgtta acgtatattt actcaagtgg 1080
aaactaatta attctcaatt ttgggtatgt aggacttttt ctctgcaggg acagattcca 1140
cagcggtggc aacagagtgg gcattggcag agctcatcaa caatcccagg gtgttgcaaa 1200
aggctcgtga ggaggtctac agtgttgtgg gcaaagatag actcgttgac gaagttgaca 1260
ctcaaaacct tccttacatt agggccattg tgaaggagac attccgaatg cacccaccac 1320
tcccagtggt caaaagaaag tgcacagaag agtgLgagat taatgggtat gtgatcccag 1380
agggagcatt ggttcttttc aatgtttggc aagtaggaag ggaccccaaa tactgggaca 1440
gaccatcaga attccgtccc gagaggttct tagaaactgg tgctgaaggg gaagcagggc 1500
ctcttgatct taggggccag catttccaac tcctcccatt tgggtctggg aggagaatgt 1560
gccctggtgt caatttggct acttcaggaa tggcaacact tcttgcatct cttatccaat 1620
gctttgacct gcaagtgctg ggccctcaag gacaaatatt gaaaggtgat gatgccaaag 1680
ttagcatgga agagagagct ggcctcacag ttccaagggc acatagtctc gtttgtgttc 1790
cacttgcaag gatcggcgtt gcatctaaac tcctttctta attaagggat ccatcatata 1800
c
1801
<210> 53
<211> 1900
<212> DNA
<2I3> Glycine max
<220>
<221> intron
<222> (947)..(1082)
<400> 53
aattagcctc acaaaagcaa agatcaaaca aaccaaggac gagaacacga tgttgcttga 60
acttgcactt ggtttattgg ttttggctct gtttctgcac ttgcgtccca cacccactgc 120
aaaatcaaaa gcacttcgcc atctcccaaa cccaccaagc ccaaagcctc gtcttccctt 180
cataggacac cttcatctct taaaagacaa acttctccac tacgcactca tcgacctctc 240
caaaaaacat ggtcccttat tctctctcta ctttggctcc atgccaaccg ttgttgcctc 300
cacaccagaa ttgttcaagc tcttcctcca aacgcacgag gcaacttcct tcaacacaag 360
gttccaaacc tcagccataa gacgcctcac ctatgatagc tcagtggcca tggttccctt 420
cggaccttac tggaagttcg tgaggaagct catcatgaac gaccttccca acgccaccac 480
tgtaaacaag ttgaggcctt tgaggaccca acagacccgc aagttcctta gggttatggc 540
ccaaggcgca gaggcacaga agccccttga cttgaccgag gagcttctga aatggaccaa 600
cagcaccatc tccatgatga tgctcggcga ggctgaggag atcagagaca tcgctcgcga 660
ggttcttaag atctttggcg aatacagcct cactgacttc atctggccat tgaagcatct 720
caaggttgga aagtatgaga agaggatcga cgacatcttg aacaagttcg accctgtcgt 780
38
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
tgaaagggtc atcaagaagc gccgtgagat cgtgaggagg agaaagaacg gagaggttgt 890
tgagggtgag gtcagcgggg ttttccttga cactttgctt gaattcgctg aggatgagac 900
catggagatc aaaatcacca aggaccacat cgagggtctt gttgtcgtga gtttcctgct 960
tcattcattg atcgaaatat gcagtatttt gttaacaaga gatcgagaat tgacatttat 1020
atatt~atgt ggtggcaatt aattaacggt acgcattctt aatcgatatt gtgtatgtgc 1080
aggacttttt ctcggcagga acagactcca cagcggtggc aacagagtgg gcattggcag 1140
aactcatcaa caatcctaag gtgttggaaa aggctcgtga ggaggtctac agtgttgtgg 1200
gaaaggacag acttgtggac gaagttgaca ctcaaaacct tccttacatt agagcaatcg 1260
tgaaggagac attccgcatg cacccgccac tcccagtggt caaaagaaag tgcacagaag 1320
agtgtgagat taatggatat gtgatcccag agggagcatt gattctcttc aatgtatggc 1380
aagtaggaag agaccccaaa tactgggaca gaccatcgga gttccgtcct gagaggttcc 1490
tagagacagg ggctgaaggg gaagcagggc ctcttgatct taggggacaa cattttcaac 1500
ttctcccatt tgggtctggg aggagaatgt gccctggagt caatctggct acttcgggaa 1560
tggcaacact tcttgcatct cttattcagt gcttcgactt gcaagtgctg ggtccacaag 1620
gacagatatt gaagggtggt gacgccaaag ttagcatgga agagagagcc ggcctcactg 1680
ttccaagggc acatagtctt gtctgtgttc cacttgcaag gatcggcgtt gcatctaaac 1740
tcctttctta attaagatca tcgtcatcat catcatatat aatatttact ttttgtgtgt 1800
tgataatcat catttcaata aggtctcgtt catctacttt ttatgaagta tataagccct 1860
tccatgcaca ttgtatcatc tcccatttgt cttcgtttgc 1900
<210> 54
<211> 1501
<212> DNA
<213> Lupinus albus
<900> 59
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 240
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc agggttccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctt aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 420
aacagatccg caagttcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 480
acttgaccga ggagcttctg aaatggacca acagcaccat ctccatgatg atgctcggcg 540
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatctttggc gaatacagcc 600
tcactgactt catctggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggttg ttgagggtga ggtcagcggg gttctccttg 780
acactttgct tgaattcgct gaggatgaga ccatggagat caaaatcacc aaggaccaca 840
tcaagggtct tgttgtcgac tttttctcgg caggaacaga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggaaagggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt tgacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gccactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg gatatgtgat cccagaggga gcattgattc 1140
tcttcaatgt atggcaagta ggaagagacc ccaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acagaggctg aaggggaagc aaggcctctt gatcttaggg 1260
gacaacattt tcaacttctc ccatttgggt ctgggaggag aatgtgccct ggagtcattc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcaag 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1490
gagccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
9
1501
<210> 55
<211> 499
<212> PRT
<213> Lupinus albus
<400> 99
Phe Leu His Leu Arg Pro Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg
1 5 10 15
His Leu Pro Asn Pro Pro Ser Pro Lys Pro Arg Leu Pro Phe Ile Gly
20 25 30
39
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
HisLeuHis LeuLeuLys AspLysLeu LeuHisTyr AlaLeuIle
Asp
35 90 q5
LeuSerLys l~ysHisGly ProLeuPhe SerLeuTyr PheGlySer
Met
50 55 60
ProThrVal ValAlaSer ThrProGlu LeuPheLys LeuPheLeuGln
65 70 75 80
ThrHisGlu AlaThrSer PheAsnThr ArgPheGln ThrSerAlaIle
85 90 95
ArgArgLeu ThrTyrAsp SerSerVal AlaArgVal ProPheGlyPro
100 105 110
TyrTrpLys PheValArg LysLeuIle MetAsnAsp LeuLeuAsnAla
115 120 125
ThrThrVal AsnLysLeu ArgProLeu ArgThrGln GlnIleArgLys
130 135 140
PheLeuArg ValMetAla GlnGlyAla GluAlaGln LysProLeuAsp
145 150 155 160
LeuThrGlu GiuLeuLeu LysTrpThr AsnSerThr IleSerMetMet
165 170 175
MetLeuGly GluAlaGlu GluIleArg AspIleAla ArgGluValLeu
180 185 i90
LysIlePhe GlyGluTyr SerLeuThr AspPheIle TrpProLeuLys
195 200 205
HisLeuLys ValGlyLys TyrGluLys ArgIleAsp AspIleLeuAsn
210 215 220
LysPheAsp ProValVal GluArgVal IleLysLys ArgArgGluIle
225 230 235 240
ValArgArg ArgLysAsn GlyGluVal ValGluGly GluValSerGly
245 250 255
ValLeuLeu AspThrLeu LeuGluPhe AlaGluAsp GluThrMetGlu
260 265 270
IleLysIle ThrLysAsp HisIleLys GlyLeuVal ValAspPhePhe
275 280 285
SerAlaGly ThrAspSer ThrAlaVal AlaThrGlu TrpAlaLeuAla
290 295 300
GluLeuIle AsnAsnPro LysValLeu GluArgAla ArgGluGluVal
305 31D 315 320
TyrSerVal ValGlyLys AspArgLeu ValAspGlu ValAspThrGln
325 330 335
AsnLeuPro TyrIleArg AlaIleVal LysGluThr PheArgMetHis
390 395 350
ProProLeu ProValVal LysArgLys CysThrGlu GluCysGluIle
355 360 365
AsnGlyTyr ValIlePro GluGlyAla LeuIleLeu Phe ValTrp
Asn
370 375 380
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
GlnValGlyArgAsp ProLysTyrTrp AspArgProSer GluPheArg
385 390 395 900
ProGluArgPheLeu GluThrGluAla GluGlyGluAla ArgProLeu
405 410 415
AspLeuArgGlyGln HisPheGlnLeu LeuProPheGly SerGlyArg
420 425 930
ArgMetCysProGly ValIleLeuAla ThrSerGiyMet AlaThrLeu
435 990 445
LeuAlaSerLeuIle GlnCysPheAsp LeuGlnValLeu GlyProGln
450 455 960
GlyGlnIleLeuLys GlyGlyAspAla LysValSerMet GluGluArg
965 970 475 980
AlaGlyLeuThrVal ProArgAlaHis SerLeuValCys ValProLeu
485 490 995
AlaArgIle
<210> 56
<211> 1501
<212> DNA
<213> Medicago sativa
<400> 56
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttccttc 290
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc atggctccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 420
aacagatccg caagttcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 480
acttgaccga ggagcttctg aaatggacca acagcaccac ctccatgatg atgctcggcg 540
aggctgagga gatcagagac atcgcccgcg aggttcttaa gatctttggc gaatacagcc 600
tcactgactt catccggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggttg ttgagggtga ggtcagcggg gttttccttg 780
acactttgct tgaattcgct gaggatgaga ccacggagat caaaatcacc aaggaccaca 890
tcaagggtct tgttgtcgac tttttctcgg caggaacaga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggaaaaggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt tgacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gccactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg gatatgtgat cccagaggga gcattgattc 1140
tcttcaatgt atggcaagta ggaagagact ccaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acaggggctg aaggggaagc aaggcctctt gatcttaggg 1260
gacaacattt tcaacttctc ccatttgggt ctgggaggag aatgtgccct ggagtcaatc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcaag 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1440
gggccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
g 1501
<210> 57
<211> 999
<212> PRT
<213> Medicago sativa
<400> 57
Phe Leu His Leu Arg Pro Thr Pro Thr Ala Lys Ser Lys Ala Leu Arg
1 5 10 15
41
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
HisLeu ProAsnProPro SerProLys ProArgLeu ProPheIleGly
20 25 30
HisLeu HisLeuLeuLys AspLysLeu LeuHisTyr AlaLeuIleAsp
35 40 95
LeuSer LysLysHisGly ProLeuPhe SerLeuTyr PheGlySerMet
50 55 60
ProThr ValValAlaSer ThrProGlu LeuPheLys LeuPheLeuGln
65 70 75 80
ThrHis GluAlaThrSer PheAsnThr ArgPheGln ThrSerAlaIle
85 90 95
ArgArg LeuThrTyrAsp SerSerVal AlaMetAla ProPheGlyPro
100 105 110
TyrTrp LysPheValArg LysLeuIle MetAsnAsp LeuLeuAsnAla
115 120 125
ThrThr ValAsnLysLeu ArgProLeu ArgThrGln GlnIleArgLys
130 135 190
PheLeu ArgValMetAla GlnGlyAla GluAlaGln LysProLeuAsp
145 150 155 160
LeuThr GluGluLeuLeu LysTrpThr AsnSerThr ThrSerMetMet
165 170 175
MetLeu GlyGluAlaGlu GluIleArg AspIleAla ArgGluValLeu
180 185 190
LysIle PheGlyGluTyr SerLeuThr AspPheIle ArgProLeuLys
195 200 205
HisLeu LysValGlyLys TyrGluLys ArgIleAsp AspIleLeuAsn
210 215 220
LysPhe AspProValVal GluArgVal IleLysLys ArgArgGluIle
225 230 235 290
ValArg ArgArgLysAsn GlyGluVal ValGluGly GluValSerGly
295 250 255
ValPhe LeuAspThrLeu LeuGluPhe AlaGluAsp GluThrThrGlu
260 265 270
IleLys IleThrLysAsp HisIleLys GlyLeuVal ValAspPhePhe
275 280 285
SerAla GlyThrAspSer ThrAlaVal AlaThrGlu TrpAlaLeuAla
290 295 300
GluLeu IleAsnAsnPro LysValLeu GluLysAla ArgGluGluVal
305 310 315 320
TyrSer ValValGlyLys AspArgLeu ValAspGlu ValAspThrGl.n
325 330 335
AsnLeu ProTyrIleArg AlaIleVal LysGluThr PheArgMetHis
390 345 350
ProPro LeuProValVal LysArgLys CysThrGlu GluCysGluIle
355 360 365
42
CA 02353306 2001-05-29
WO PCTNS00/01772
00/44909
AsnGlyTyr ValIlePro GluGlyAlaLeu IleLeuPheAsn ValTrp
370 375 380
GlnValGly ArgAspSer LysTyrTrpAsp ArgProSerGlu PheArg
385 390 395 900
ProGluArg PheLeuGlu ThrGlyAlaGlu GlyGluAlaArg ProLeu
905 410 415
AspLeuArg GlyGlnHis PheGlnLeuLeu ProPheGlySer GlyArg
920 925 430
ArgMetCys ProGlyVal AsnLeuAlaThr SerGlyMetAla ThrLeu
935 940 445
LeuAlaSer LeuIleGln CysPheAspLeu GlnValLeuGly ProGln
450 455 960
GlyGlnIle LeuLysGly GIyAspAlaLys ValSerMetGlu GluArg
965 470 975 980
AlaGlyLeu ThrValPro ArgAlaHisSer LeuValCysVal ProLeu
985 490 495
AlaArgIle
<210> 58
<211> 1501
<212> DNA
<213> Medicago sativa
<400> 58
tgtttctgca cttgcgtccc acacccactg caaaatcaaa agcacttcgc catctcccaa 60
acccaccaag cccaaagcct cgtcttccct tcataggaca ccttcatctc ttaaaagaca 120
aacttctcca ctacgcactc atcgacctct ccaaaaaaca tggtccctta ttctctctct 180
actttggctc catgccaacc gttgttgcct ccacaccaga attgttcaag ctcttcctcc 290
aaacgcacga ggcaacttcc ttcaacacaa ggttccaaac ctcagccata agacgcctca 300
cctatgatag ctcagtggcc atggttccct tcggacctta ctggaagttc gtgaggaagc 360
tcatcatgaa cgaccttctc aacgccacca ctgtaaacaa gttgaggcct ttgaggaccc 920
aacagatccg caagctcctt agggttatgg cccaaggcgc agaggcacag aagccccttg 480
acttgaccga ggagcttctg aaatggacca acagcaccat ctccatgatg atgctcggcg 590
aggctgagga gatcagagac atcgctcgcg aggttcttaa gatctttggc gaatacagcc 600
tcactgactt catctggcca ttgaagcatc tcaaggttgg aaagtatgag aagaggatcg 660
acgacatctt gaacaagttc gaccctgtcg ttgaaagagt catcaagaag cgccgtgaga 720
tcgtgaggag gagaaagaac ggagaggtta ttgagggtga ggtcagcggg gttttccttg 780
acactttgct tgaattcgct gaggatgaga ccacggagat caaaatcacc aaggaccaca 840
tcaagggtct tgttgtcgac tttttctcgg caggaacaga ctccacagcg gtggcaacag 900
agtgggcatt ggcagaactc atcaacaatc ctaaggtgtt ggagaaggct cgtgaggagg 960
tctacagtgt tgtgggaaag gacagacttg tggacgaagt tgacactcaa aaccttcctt 1020
acattagagc aatcgtgaag gagacattcc gcatgcaccc gccactccca gtggtcaaaa 1080
gaaagtgcac agaagagtgt gagattaatg gatatgtgat cccagaggga gcattgattc 1190
tcttcaatgt atggcaagta ggaagagacc ccaaatactg ggacagacca tcggagttcc 1200
gtcctgagag gttcctagag acaggggctg aaggggaagc aaggcctctt gatcttaggg 1260
gacaacattt tcaacttctc ccatttgggt ctgggaggag aatgtgccct ggagtcaatc 1320
tggctacttc gggaatggca acacttcttg catctcttat tcagtgcttt gacttgcaag 1380
tgctgggtcc acaaggacag atattgaagg gtggtgacgc caaagttagc atggaagaga 1490
gggccggcct cactgttcca agggcacata gtcttgtctg tgttccactt gcaaggatcg 1500
g
1501
<210> 59
<211> 499
<212> PRT
<213> Medicago sativa
43
CA 02353306 2001-05-29
WO PCTNS00/01772
00/44909
<900> 59
PheLeu HisLeuArgPro ThrProThr LysSer LysAlaLeu Arg
Ala
1 5 10 15
HisLeu ProAsnProPro SerProLys PryArgLeu ProPheIle Gly
20 25 30
HisLeu HisLeuLeuLys AspLysLeu LeuHisTyr AlaLeuIle Asp
y0 45
LeuSer LysLysHisGly ProLeuPhe SerLeuTyr PheGlySer Met
50 55 60
ProThr ValValAlaSer ThrProGlu LeuPheLys LeuPheLeu Gln
65 70 75 BO '
ThrHis GluAlaThrSer PheAsnThr ArgPheGln ThrSerAla Ile
85 90 95
ArgArg LeuThrTyrAsp SerSerVal AlaMetVal ProPheGly Pro
100 105 110
TyrTrp LysPheValArg LysLeuIle MetAsnAsp LeuLeuAsn Ala
115 120 125
ThrThr ValAsnLysLeu ArgFroLeu ArgThrGln GlnIleArg Lys
130 135 140
LeuLeu ArgValMetAla GlnGlyAla GluAlaGln LysProLeu Asp
145 I50 155 160
LeuThr GiuGluLeuLeu LysTrpThr AsnSerThr IleSerMet Met
165 170 175
MetLeu GlyGluAlaGlu GluIleArg AspIleAla ArgGluVal Leu
180 185 190
LysIle PheGlyGluTyr SerLeuThr AspPheIle TrpProLeu Lys
195 200 205
HisLeu LysValGlyLys TyrGluLys ArgIleAsp AspIleLeu Asn
210 215 220
LysPhe AspFroValVal GluArgVal IleLysLys ArgArgGlu Ile
225 230 235 240
ValArg ArgArgLysAsn GlyGluVal IleGluGly GluValSer Gly
245 250 255
ValPhe LeuAspThrLeu LeuGluPhe AlaGluAsp GluThrThr Glu
260 265 270
IleLys IleThrLysAsp HisIleLys GlyLeuVal ValAspPhe Phe
275 280 285
SerAla GlyThrAspSer ThrAlaVal AlaThrGlu TrpAlaLeu Ala
290 295 300
GluLeu IleAsnAsnPro LysValLeu GluLysAla ArgGluGlu Val
305 310 315 320
TyrSer ValGlyLys Asp Leu Val Glu ValAspThr Gln
Val Arg Asp
325 330 335
AsnLeu ProTyrIle IleVal Lys PheArgMet His
Arg Glu
Ala Thr
390 395 350
44
CA 02353306 2001-05-29
WO
00/44909
PCT/US00/01772
ProPro Pro ValVal LysArgLysCys ThrGluGluCys GluIle
Leu
355 360 365
AsnGly Val I1ePro GluGlyAlaLeu Ilel~euPheAsn ValTrp
Tyr
370 375 380
GlnVal Arg AspPro LysTyrTrpAsp ArgProSerGlu PheArg
Gly
385 39C 395 400
ProGlu Phe LeuGlu ThrGlyAlaGlu GlyGluAlaArg ProLeu
Arg
405 410 915
AspLeu Gly GlnHis PheGlnLeuLeu ProPheGlySer GlyArg
Arg
920 425 930
ArgMet Pro GlyVal AsnLeuAlaThr SerGlyMetAla ThrLeu
Cys
935 440 495
LeuAla Leu IleGln CysPheAspLeu GlnValLeuGly ProGln
Ser
950 955 460
GlyGln Leu LysGly GlyAspAlaLys ValSerMetGlu GluArg
Ile
465 970 475 980
AlaGly Thr ValPro ArgAlaHisSer LeuValCysVal ProLeu
Leu
485 490 995
AlaArg
Iie
<210> 60
<211> 1497
<212> DNA
<213> Betavulgaris
<400> 60
tctgcacttg cgtcccacac ccactgcaaa atcaaaagca cttcgccatc tcccaaaccc 60
accaagccca aagcctcgtc ttcccttcat aggacacctt catctcttaa aagacaaact 120
tctccactac gcactcatcg acctctccaa aaaacatggt cccttattct ctcactactt 180
tggctccatg ccaaccgttg ttgcctccac accagaattg ttcaagctct tcctccaaac 290
gaacgaggca acttccttca acacaaggtt ccaaacctca gccataagac gcctcaccta 300
tgatagctca gtggccatgg ttcccttcgg accttactgg aagttcgtga ggaagctcat 360
catgaacgac cttctcaacg ccaccactgt aaacaagttg aggcctttga ggacccaaca 420
gatccgcaag ttccttaggg ctatggccca aggcgcagag gcacggaagc cccttgactt 480
gaccgaggag cttctgaaat gggccaacag caccatctcc atgatgatgc tcggcgaggc 590
tgaggagatc agagacatcg ctcgcgaggt tcttaagatc tttggcgaat acagcctcac 600
tgacttcatc tggccattga agcatctcaa ggttggaaag tatgagaaga ggatcgacga 660
catcttgaac aagttcgacc ctgtcgttga aagagtcatc aagaagcgcc gtgagatcgt 720
gaggaggaga aagaacggag aggttgttga gggtgaggtc agcggggttt tccttgacac 780
tttgcttgaa ttcgctgagg atgagaccat ggagatcaaa atcaccaagg accacaccaa 890
gggtcttgtt gtcgacttct tctcggcagg aacagactcc acagcggtgg caacagagtg 900
ggcattggca gaactcatca acaatcctaa ggtgttggaa aaggctcgtg aggaggtcta 960
cagtgttgtg ggaaaggaca gacttgtgga cgaagttgac actcaaaacc ttccttacat 1020
tagagcaatc gtgaaggaga cattccgcat gcacccgcca ctcccagtgg tcaaaagaaa 1080
gtgcacagaa gagtgtgaga ttaatggata tgtgatccca gagggagcat tgattccctt 1140
caatgtatgg caagtaggaa gagaccccaa atactgggac agaccatcgg agttccgtcc 1200
tgagaggttc ctagagacag gggctgaagg ggaagcaagg cctcttgatc ttaggggaca 1260
acattttcaa cttctcccat ttgggtctgg gaggagaatg tgccctggag tcaatctggc 1320
tacttcggga acggcaacac ttcttgcatc tcttattcag tgctttgact tgcaagtgct 1380
gggtccacag ggacagatat tgaagggtgg tgacgccaaa gttagcatgg aagagagagc 1990
cggcctcact gttccaaggg cacatagtct tgtctgtgtt ccacttgcaa ggatcgg 1497
<210> 61
<211> 998
CA 02353306 2001-05-29
WO PCT/US00/01772
00/44909
<212> PRT
<213> Betavulgari s
<900> 61
Leu LeuArg Thr ProThrAla Ala,Leu
His Pro Lys Arg
Ser His
Lys
1 5 10 15
Leu ProProSer ProLysPrc Arg PheIleGly
Pro Leu His
Asn Pro
20 25 30
LeuHis LeuLeuLysAsp LysLeuLeu HisTyr LeuIleAsp
Aia Leu
35 40 45
SerLys LysHisGlyPro LeuPheSer HisTyrPhe GlySerMetPro
50 55 60
ThrVal ValAlaSerThr ProGluLeu PheLysLeu PheLeuGlnThr
65 70 75 80
AsnGlu AlaThrSerPhe AsnThrArg PheGlnThr SerAlaIleArg
85 90 95
ArgLeu ThrTyrAspSer SerValAla MetValPro PheGlyProTyr
100 105 110
TrpLys PheValArgLys LeuIleMet AsnAspLeu LeuAsnAlaThr
115 120 125
ThrVal AsnLysLeuArg ProLeuArg ThrGlnGln IleArgLysPhe
130 135 140
LeuArg AlaMetAlaGln GlyAlaGlu AlaArgLys ProLeuAspLeu
145 150 155 160
ThrGlu GluLeuLeuLys TrpAlaAsn SerThrIle SerMetMetMet
165 170 175
LeuGly GluAlaGluGlu IleArgAsp IleAlaArg GluValLeuLys
180 185 190
IlePhe GlyGluTyrSer LeuThrAsp PheIleTrp ProLeuLysHis
195 200 205
LeuLys ValGlyLysTyr GluLysArg IleAspAsp IleLeuAsnLys
210 215 220
PheAsp ProValValGlu ArgValIle LysLysArg ArgGluIleVal
225 230 235 240
ArgArg ArgLysAsnGly GluValVal GluGlyGlu ValSerGlyVal
245 250 255
PheLeu AspThrLeuLeu GluPheAla GluAspGlu ThrMetGIuIle
260 265 270
LysIle ThrLysAspHis ThrLysGly LeuValVal PhePheSer
Asp
275 280 285
AlaGly Thr SerThr AlaVal ThrGluTrp Leu Glu
Asp Ala Ala Ala
290 295 300
LeuIle Asn Pro LysAlaArg GluValTyr
Asn Lys Glu
Val
Leu
Glu
305 310 315 320
SerVal Val Lys GluVal Asn
Gly Asp Asp
Arg Thr
Leu Gln
Val
Asp
325 330 335
46
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
Leu Pro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro
390 345 350
Pro Leu Pro Val Val Lys Arg Lys Cys Thr Glu Glu Cys Glu Ile Asn
355 360 365
~~ly Tyr Val Ile Pro Glu Gly A1a Leu Ile Pro Phe Asn Val Trp Gln
370 375 380
Val Gly Arg Asp Pro Lys Tyr Trp Asp Arg Pro Ser Glu Phe Arg Pro
385 390 395 900
Glu Arg Phe Leu Glu Thr Gly Ala Giu Giy Glu Ala Arg Pro Leu Asp
405 910 915
Leu Arg Gly Gln His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg
920 425 430
Met Cys Pro Gly Val Asn Leu Ala Thr Ser Gly Thr Ala Thr Leu Leu
435 440 445
Ala Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gln Gly
450 455 960
Gln Ile Leu Lys Gly Gly Asp Ala Lys Val Ser Met Glu Glu Arg Ala
965 470 975 980
Gly Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala
485 490 495
Arg Ile
<210> 62
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR PRIMER
<400> 62
gttaccatgg ctgctgctat tg 22
<210> 63
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR PRIMER
<400> 63
ttaaacgtaa aatgaaacaa gagg 24
<210> 64
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR PRIMER
<900> 64
gacacttcga cactgctgct gcttat 26
4?
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<210> 65
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR PRIMER
<400> 65
tctcaaactc acctgggcta tggat 25
<210> 66
<211> 521
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Consensus
<220>
<221> UNSURE
<222> (10)
<220>
<221> UNSURE
<222> (16)
<220>
<221> UNSURE
<222> (23)
<220>
<221> UNSURE
<222> (25)
<220>
<221> UNSURE
<222> (39)
<220>
<221> UNSURE
<222> (98)
<220>
<221> UNSURE
<222> (60)
<220>
<221> UNSURE
<222> (73)
<220>
<221> UNSURE
<222> (74)
<220>
<221> UNSURE
<222> (95)
<220>
<221> UNSURE
<222> (102)
48
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/O1772
<220>
<221> UNSURE
<222> (110)
<220>
<221> UNSURE
<222> (112)
<220>
<221> UNSURE
<222> (117)
<220>
<221> UNSURE
<222> (118)
<220>
<221> UNSURE
<222> (121)
<220>
<221> UNSURE
<222> (122)
<220>
<221> UNSURE
<222> (124)
<220>
<221> UNSUR~
<222> (129)
<220>
<221> UNSURE
<222> (197)
<220>
<221> UNSURE
<222> (159)
<220>
<221> UNSURE
<222> (162)
<220>
<221> UNSURE
<222> 1166)
<220>
<221> UNSURE
<222> (170)
<220>
<221> UNSURE
<222> (175)
<220>
<221> UNSURE
<222> (183)
<220>
<221> UNSURE
<222> (187)
49
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
<220>
<221> UNSURE
<222> (191)
<220>
<221> UNSURE
<222> (209)
~:220>
<221> UNSURE
<222> (219)
<220>
<221> UNSURE
<222> (223)
<220>
<221> UNSURE
<222> (253)
<220>
<221> UNSURE
<222> (259)
<220>
<221> UNSURE
<222> (263)
<220>
<221> UNSURE
<222> (269)
<220>
<221> UNSURE
<222> (268)
<220>
<221> UNSURE
<222> (272)
<220>
<221> UNSURE
<222> (285)
<220>
<221> UNSURE
<222> (293)
<220>
<221> UNSURE
<222> (299)
<220>
<221> UNSURE
<222> (301)
<220>
<221> UNSURE
<222> (306)
<220>
<221> UNSURE
<222> (311)
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<220>
<221> UNSURE
<222> (312)
<220>
<221> UNSURE
<222> (325)
<220>
<221> UNSURE
<222> (328)
<220>
<22I> UNSURE
<222> (334)
<220>
<221> UNSURE
<222> (342)
<220>
<221> UNSURE
<222> (377)
<220>
<221> UNSURE
<222> (381)
<220>
<221> UNSURE
<222> (385)
<220>
<221> UNSURE
<222> (387)
<220>
<221> UNSURE
<222> (393)
<220>
<221> UNSURE
<222> (399)
<220>
<221> UNSURE
<222> (402)
<220>
<221> UNSURE
<222> (904)
<220>
<221> UNSURE
<222> (913)
<220>
<221> UNSURE
<222> (422)
<220>
<221> UNSURE
<222> (428)
51
CA 02353306 2001-05-29
WO 00/44909 PCT/US00/01772
<220>
<221> UNSURE
<222> t429)
<220>
<221> UNSURE
<222> (435)
<220>
<221> UNSURE
<222> (447)
<220>
<221> UNSURE
<222> (453)
<220>
<221> UNSURE
<222> (959)
<220>
<221> UNSURE
<222> (485)
<900> 66
Met Leu Leu Glu Leu Ala Leu Gly Leu Xaa Val Leu Ala Leu Phe Xaa
1 5 10 15
His Leu Arg Pro Thr Pro Xaa Ala Xaa Ser Lys Ala Leu Arg His Leu
20 25 30
Pro Asn Pro Pro Ser Pro Xaa Fro Arg Leu Pro Phe Ile Gly His Xaa
35 40 95
His Leu Leu Lys Asp Lys Leu Leu His Tyr Ala Xaa Ile Asp Leu Ser
50 55 60
Lys Lys His Gly Pro Leu Phe Ser Xaa Xaa Phe Gly Ser Met Pro Thr
65 70 75 80
Val Val Ala Ser Thr Pro Giu Leu Phe Lys Leu Phe Leu Gln Xaa Xaa
85 90 95
Glu Ala Thr Ser Phe Xaa Thr Arg Phe Gln Thr Ser Ala Xaa Arg Xaa
100 105 110
Leu Thr Tyr Asp Xaa Xaa Val Ala Xaa Xaa Pro Xaa Gly Pro Tyr Trp
115 120 125
Xaa Phe Val Arg Lys Leu Ile Met Asn Asp Leu Leu Asn Ala Thr Thr
130 135 190
Val Asn Xaa Leu Arg Pro Leu Arg Thr Gln Gln Ile Arg Lys Xaa Leu
145 150 155 160
Arg Xaa Met Ala Gln Xaa Ala Glu Ala Xaa Lys Pro Leu Asp Xaa Thr
165 170 175
Glu Glu Leu Leu Lys Trp Xaa Asn Ser Thr Xaa Ser Met Met Xaa Leu
180 185 190
Gly Glu Ala Glu Glu Ile Arg Asp Ile Ala Arg Glu Val Leu Lys Ile
195 200 205
Xaa Gly Glu Tyr Ser Leu Thr Asp Phe Ile Xaa Pro Leu Lys Xaa Leu
210 215 220
52
CA 02353306 2001-05-29
WO 00/44909 PCTNS00/01772
Lys Val Gly Lys Tyr Glu Lys Arg Ile Asp Asp Ile Leu Asn Lys Phe
225 230 235 290
Asp Pro Val Val Glu Arg Val Ile Lys Lys Arg Arg Xaa Ile Val Arg
245 250 255
Ara Arg Xaa Asn Gly Glu Xaa Xaa Glu Gly Glu Xaa Ser Gly Val Xaa
260 265 270
Leu Asp Thr Leu Leu Glu Phe Ala Glu Asp Glu Thr Xaa Glu Ile Lys
275 280 285
Ile Thr Lys Xaa Xaa Ile Lys Gly Leu Val Val Asp Xaa Phe Ser Ala
290 295 300
Gly Xaa Asp Ser Thr Ala Xaa Xaa Thr Glu Trp Ala Leu Ala Glu Leu
305 310 315 320
Ile Asn Asn Pro Xaa Val Leu Xaa Xaa Ala Arg Glu Glu Xaa Tyr Ser
325 330 335
Val Val Gly Lys Asp Xaa Leu Val Asp Glu Val Asp Thr Gln Asn Leu
340 395 350
Fro Tyr Ile Arg Ala Ile Val Lys Glu Thr Phe Arg Met His Pro Pro
355 360 365
Leu Pro Val Val Lys Arg Lys Cys Xaa Glu Glu Cys Xaa Ile Asn Gly
370 375 380
Xaa Val Xaa Pro Glu Gly Ala Leu Xaa Xaa Phe Asn Val Trp Gln Val
385 390 395 900
Gly Xaa Asp Xaa Lys Tyr Trp Asp Arg Pro Ser Glu Xaa Arg Pro Glu
405 410 415
Arg Phe Leu Glu Thr Xaa Ala Glu Gly Glu Ala Xaa Xaa Leu Asp Leu
920 425 930
Arg Gly Xaa His Phe Gln Leu Leu Pro Phe Gly Ser Gly Arg Xaa Met
435 440 445
Cys Pro Gly Val Xaa Leu Ala Thr Ser Gly Xaa Ala Thr Leu Leu Ala
450 455 460
Ser Leu Ile Gln Cys Phe Asp Leu Gln Val Leu Gly Pro Gl:: Gly Gln
465 470 475 480
Ile Leu Lys Gly Xaa Asp Ala Lys Val Ser Met Glu Giu Arg Ala Gly
485 490 495
Leu Thr Val Pro Arg Ala His Ser Leu Val Cys Val Pro Leu Ala Arg
500 505 510
Ile Gly Val Ala Ser Lys Leu Leu Ser
515 520
53
