CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
COMPOSITIONS AND METHODS FOR THE TREATMENT OF TUMOR
Field of the Invention
The present invention relates to compositions and methods for the diagnosis
and treatment of tumor.
Backeround of the Invention
Malignant tumors (cancers) are the second leading cause of death in the United
States, after heart disease
(Boring et al., CA Cancel J. Clin., 43:7 [1993]).
Cancer is characterized by an increase in the number of abnormal, or
neoplastic cells derived from a normal
tissue which proliferate to form a tumor mass, the invasion of adjacent
tissues by these neoplastic tumor cells, and
the generation of malignant cells which eventually spread via the blood or
lymphatic system to regional lymph nodes
and to distant sites (metastasis). In a cancerous state, a cell proliferates
under conditions in which normal cells
would not grow. Cancer manifests itself in a wide variety of forms,
characterized by different degrees of
invasiveness and aggressiveness.
Alteration of gene expression is intimately related to the uncontrolled cell
growth and de-differentiation
which are a common feature of all cancers. The genomes of certain well studied
tumors have been found to show
decreased expression of recessive genes, usually referred to as tumor
suppression genes, which would normally
function to prevent malignant cell growth, and/or overexpression of certain
dominant genes, such as oncogenes,
that act to promote malignant growth. Each of these genetic changes appears to
be responsible for importing some
of the traits that, in aggregate, represent the full neoplastic phenotype
(Hunter, Cell, 64:1129 [1991 ] and Bishop,
Cell, 64:235-248 [1991]).
A well known mechanism of gene (e.g., oncogene) overexpression in cancer cells
is gene amplification.
This is a process where in the chromosome of the ancestral cell multiple
copies of a particular gene are produced.
The process involves unscheduled replication of the region of chromosome
comprising the gene, followed by
recombination of the replicated segments back into the chromosome (Alitalo et
al., Adv. Cancer Res., 47:235-281
[1986]). It is believed that the overexpression of the gene parallels gene
amplification, i.e., is proportionate to the
number of copies made.
Proto-oncogenes that encode growth factors and growth factor receptors have
been identified to play
important roles in the pathogenesis of various human malignancies, including
breast cancer. For example, it has
been found that the human ErbB2 gene (erbB2, also known as her2, or c-erbB-2),
which encodes a 185-kd
transmembrane glycoprotein rc~eptor (p 185"E'~; HER2) related to the epidermal
growth factor receptor EGFR), is
overexpressed in about 25% to 30% of human breast cancer (Slamon et al.,
Science, 235:177-182 [1987]; Slamon
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
et al., Science, 244:707-712 [ 1989]).
It has been reported that gene amplification of a proto-oncogene is an event
typically involved in the more
malignant forms of cancer, and could act as a predictor of clinical outcome
(Schwab et al., Genes Chromosomes
Cancer, l :181-193 [1990]; Alitalo et al., supra). Thus, erbB2 overexpression
is commonly regarded as a predictor
of a poor prognosis, especially in patients with primary disease that involves
axiIlary lymph nodes (Slamon et al.,
[ 1987] and [1989], supra; Ravdin and Chamness, Gene.159:19-27 [ 1995]; and
Hynes and Stern, Biochim. Bionhvs.
Acta, 1198:165-184 [1994]), and has been linked to sensitivity and/or
resistance to hom~one therapy and
chemotherapeutic regimens, including CMF (cyclophosphamide, methotrexate, and
fluoruracil) and anthracyclines
(Baselga etal., Oncoioev, l l (3 Suppl I):43-48 [1997]). However, despite the
association of erbB2 overexpression
with poor prognosis, the odds of HER2-positive patients responding clinically
to treatment with taxanes were
greater than three times those of HER2-negative patients (Ibis!). A
recombinant humanized anti-ErbB2 (anti-HER2)
monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody
4D5, referred to as rhuMAb HER2
or HerceptinT"') has been clinically active in patients with ErbB2-
overexpressing metastatic breast cancers that had
received extensive prior anticancer therapy. (Baselga et al., J. Clin. Oncol.,
14:737-744 [ 1996]).
In light of the above, there is obvious interest in identifying novel methods
and compositions which are
useful for diagnosing and treating tumors which are associated with gene
amplification.
Summarv of the Invention
A. Embodiments
The present invention concerns compositions and methods for the diagnosis and
treatment of neoplastic
cell growth and proliferation in mammals, including humans. The present
invention is based on the identification
of genes that are amplified in the genome of tumor cells. Such gene
amplification is expected to be associated with
the overexpression of the gene product and contribute to tumorigenesis.
Accordingly, the proteins encoded by the
amplified genes are believed to be useful targets for the diagnosis and/or
treatment (including prevention) of certain
cancers, and may act as predictors of the prognosis of tumor treatment.
In one embodiment, the present invention concerns an isolated antibody which
binds to a polypeptide
designated herein as a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR07I5,
PRO1 OI7, PR01112, PR0509, PR0853 or PR0882 polypeptide. In one aspect, the
isolated antibody specifically
binds to a PR0201, PR0292, PR0327, PRO1265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PR01112, PR0509, PR0853 or PR0882 polypeptide. In another aspect, the antibody
induces the death of a cell
which expresses a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide. Often, the cell that
expresses the PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI
112, PR0509,
PR0853 or PR0882 poiypeptide is a tumor cell that overexpresses the
polypeptide as compared to a normal cell
of the same tissue type. In yet another aspect, the antibody is a monoclonal
antibody, which preferably has non-
human complementarity determining region (CDR) residues and human framework
region (FR) residues. 'Ihe
antibody may be labeled and may be immobilized on a solid support. In yet
another aspect, the antibody is an
antibody fragment, a single-chain antibody, or a humanized antibody which
binds, preferably specifically, to a
-2-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 polypeptide.
In another embodiment, the invention concerns a composition of matter which
comprises an antibody
which binds, preferably specifically, to a PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide in
admixture with a
pharmaceutically acceptable carrier. In one aspect, the composition of matter
comprises a therapeutically effective
amount of the antibody. In another aspect, the composition comprises a further
active ingredient, which may, for
example, .be a further antibody or a cytotoxic or chemotherapeutic agent.
Preferably, the composition is sterile.
In a further embodiment, the invention concerns isolated nucleic acid
molecules which encode anti-
PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357,
anti-PR0715, anti-PROl0I7, anti-PRO1 I 12, anti-PR0509, anti-PR0853 or anti-
PR0882 antibodies, and vectors
and recombinant host cells comprising such nucleic acid molecules.
In a still further embodiment, the invention concerns a method for producing
an anti-PR0201, anti-
PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-
PR0357, anti-PR0715,
anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-PR0882 antibody,
wherein the method
comprises culturing a host cell transformed with a nucleic acid molecule which
encodes the antibody under
conditions sufficient to allow expression of the antibody, and recovering the
antibody from the cell culture.
The invention further concerns antagonists of a PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112, PR0509, PR0853 or PR0882
polypeptide that inhibit
one or more of the biological and/or immunological functions or activities of
a PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO I 112, PR0509,
PR0853 or PR0882
polypeptide.
In a further embodiment, the invention concerns an isolated nucleic acid
molecule that hybridizes to a
nucleic acid molecule encoding a PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide or the
complement thereof. The isolated
nucleic acid molecule is preferably DNA, and hybridization preferably occurs
under stringent hybridization and
wash conditions. Such nucleic acid molecules can act as antisense molecules of
the amplified genes identified
herein, which, in turn, can find use in the modulation of the transcription
and/or translation of the respective
amplified genes, or as antisense primers in amplification reactions.
Furthermore, such sequences can be used as
part of a ribozyme and/or a triple helix sequence which, in turn, may be used
in regulation of the amplified genes.
In another embodiment, the invention provides a method for determining the
presence of a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide in a sample suspected of containing a PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide,
wherein the method comprises exposing the sample to an anti-PR0201, anti-
PR0292, anti-PR0327, anti-PRO 1265,
anti-PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-PR01017,
anti-PR01112, anti-
PR0509, anti-PR0853 or anti-PR0882 antibody and determining binding of the
antibody to a PR0201, PR0292,
PR0327, PROI 265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112,
PR0509, PR0853 or
-3-
CA 02353775 2001-06-04
WO 00/37640 PCTNS99/30095
PR0882 polypeptide in the sample. In another embodiment, the invention
provides a method for determining the
presence of a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1017,
PR01112, PR0509, PR0853 or PR0882 polypeptide in a cell, wherein the method
comprises exposing the cell
to an anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-
PR0343, anti-PR0347, anti-
s PR0357, anti-PR0715, anti-PR01017, anti-PRO1 I 12, anti-PR0509, anti-PR0853
or anti-PR0882 antibody and
determining binding of the antibody to the cell.
In yet another embodiment, the present invention concerns a method of
diagnosing tumor in a mammal,
comprising detecting the level of expression of a gene encoding a PR0201,
PR0292, PR0327, PRO 1265, PR0344,
PR0343, PR0347, PR0357, PR0715, PROI 017, PROI 112, PR0509, PR0853 or PR0882
polypeptide (a) in a
test sample of tissue cells obtained from the mammal, and (b) in a control
sample of known normal tissue cells of
the same cell type, wherein a higher expression level in the test sample as
compared to the control sample, is
indicative of the presence of tumor in the mammal from which the test tissue
cells were obtained.
In another embodiment, the present invention concerns a method of diagnosing
tumor in a mammal,
comprising (a) contacting an anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO
1265, anti-PR0344, anti-PR0343,
anti-PR0347, anti-PR0357, anti-PR0715, anti-PR01017, anti-PR01112, anti-
PR0509, anti-PR0853 or anti-
PR0882 antibody with a test sample of tissue cells obtained from the mammal,
and (b) detecting the formation of
a complex between the anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO 1265,
anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357, anti-PR0715, anti-PRO 1017, anti-PRO 1112, anti-PR0509,
anti-PR0853 or anti-PR0882
antibody and a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017,
PRO1 I I2, PR0509, PR0853 or PR0882 polypeptide in the test sample, wherein
the formation of a complex is
indicative of the presence of a tumor in said mammal. The detection may be
qualitative or quantitative, and may
be performed in comparison with monitoring the complex formation in a control
sample of known normal tissue
cells of the same cell type. A larger quantity of complexes formed in the test
sample indicates the presence of tumor
in the mammal from which the test tissue cells were obtained. The antibody
preferably carries a detectable label.
Complex formation can be monitored, for example, by light microscopy, flow
cytometry, fluorimetry, or other
techniques known in the art.
The test sample is usually obtained' from an individual suspected to have
neoplastic cell growth or
proliferation (e.g. cancerous cells).
In another embodiment, the present invention concerns a cancer diagnostic kit
comprising an and-PR0201,
anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347,
anti-PR0357, anti-PR0715,
anti-PR01017, anti-PRO 1112, anti-PR0509, anti-PR0853 or anti-PR0882 antibody
and a carrier (e.g., a buffer)
in suitable packaging. The kit preferably contains instructions for using the
antibody to detect the presence of a
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PROI 112,
PR0509, PR0853 or PR0882 polypeptide in a sample suspected of containing the
same.
In yet another embodiment, the invention concerns a method for inhibiting the
growth of tumor cells
comprising exposing tumor cells which express a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide
to an effective
amount of an agent which inhibits a biological and/or immunological activity
and/or the expression of a PR0201,
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide, wherein growth of the tumor cells is thereby
inhibited. The agent preferably is
an anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO 1265, anti-PR0344, anti-
PR0343, anti-PR0347, anti-
PR0357, anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or
anti-PR0882 antibody, a
small organic and inorganic molecule, peptide, phosphopeptide, antisense or
ribozyme molecule, or a triple helix
molecule. In a specific aspect, the agent, e.g., the anti-PR0201, anti-PR0292,
anti-PR0327, anti-PR01265, anti-
PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-PR01017, anti-
PR01112, anti-PR0509,
anti-PR0853 or anti-PR0882 antibody, induces cell death. In a further aspect,
the tumor cells are further exposed
to radiation treatment and/or a cytotoxic or chemotherapeutic agent.
In a further embodiment, the invention concerns an article of manufacture,
comprising:
a container;
a label on the container; and
a composition comprising an active agent contained within the container;
wherein the composition is
effective for inhibiting the growth of tumor cells and the label on the
container indicates that the composition can
IS be used for treating conditions characterized by overexpression of a
PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PROI Ol 7, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide
as compared to a normal cell of the same tissue type. In particular aspects,
the active agent in the composition is
an agent which inhibits an activity and/or the expression of a PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PRO11 I2, PR0509, PR0853 or PR0882
polypeptide. In
preferred aspects, the active agent is an anti-PR0201, anti-PR0292, anti-
PR0327, anti-PR01265, anti-PR0344,
anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-PR01017, anti-
PR01112, anti-PR0509, anti-
PR0853 or anti-PR0882 antibody or an antisense oligonucleotide.
The invention also provides a method for identifying a compound that inhibits
an activity of a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide, comprising contacting a candidate compound with
a PR0201, PR0292, PR0327,
PROl 265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PROI 112, PR0509,
PR0853 or PR0882
polypeptide under conditions and for a time sufficient to allow these two
components to interact and determining
whether a biological and/or immunological activity of the PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide is
inhibited. In a specific aspect, either the candidate compound or the PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO I 112, PR0509, PR0853 or
PR0882 polypeptide
is immobilized on a solid support. In another aspect, the non-immobilized
component carries a detectable label.
In a preferred aspect, this method comprises the steps of (a) contacting cells
and a candidate compound to be
screened in the presence of the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PROi017, PR01112, PR0509, PR0853 or PR0882 poiypeptide under
conditions suitable for the
induction of a cellular response normally induced by a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PROI 017, PR01112, PR0509, PR0853 orPR0882 polypeptide
and (b) determining
the induction of said cellular response to determine if the test compound is
an effective antagonist.
-5-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
In another embodiment, the invention provides a method for identifying a
compound that inhibits the
expression of a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PROI 1 l 2, PR0509, PR0853 or PR0882 polypeptide in cells that
express the polypeptide, wherein the
method comprises contacting, the cells with a candidate compound and
determining whether the expression of the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PROI 112,
PR0509, PR0853 or PR0882 polypeptide is inhibited. In a preferred aspect, this
method comprises the steps of
(a) contacting cells and a candidate compound to be screened under conditions
suitable for allowing expression of
the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PRO 1112,
PR0509, PR0853 or PR0882 polypeptide and (b) determining the inhibition of
expression of said polypeptide.
B. Additional Embodiments
In other embodiments of the present invention, the invention provides an
isolated nucleic acid molecule
comprising a nucleotide sequence that encodes a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PRO1017, PRO1 I 12, PR0509, PR0853 or PR0882
polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80% sequence identity, preferably at least about 81 % sequence identity, more
preferably at least about 82%
sequence identity, yet more preferably at least about 83% sequence identity,
yet more preferably at least about 84%
sequence identity, yet more preferably at least about 85% sequence identity,
yet more preferably at least about 86%
sequence identity, yet more preferably at least about 87% sequence identity,
yet more preferably at least about 88%
sequence identity, yet more preferably at least about 89% sequence identity,
yet more preferably at least about 90%
sequence identity, yet rr~re preferably at least about 91 % sequence identity,
yet more preferably at least about 92%
sequence identity, yet more preferably at least about 93% sequence identity,
yet more preferably at least about 94%
sequence identity, yet more preferably at least about 95% sequence identity,
yet more preferably at least about 96%
sequence identity, yet more preferably at least about 97% sequence identity,
yet more preferably at least about 98%
sequence identity and yet more preferably at least about 99% sequence identity
to (a) a DNA molecule encoding
a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PRO 1112,
PR0509, PR0853 or PR0882 polypeptide having a full-length amino acid sequence
as disclosed herein, an amino
acid sequence lacking the signal peptide as disclosed herein, an extracellular
domain of a transmembrane protein,
with or without the signal peptide, as disclosed herein or any other
specifically defined fragment of the full-length
amino acid sequence as disclosed herein, or (b) the complement of the DNA
molecule of (a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80% sequence identity, preferably at least about 81 % sequence identity, more
preferably at least about 82%
sequence identity, yet more preferably at least about 83% sequence identity,
yet more preferably at least about 84%
sequence identity, yet more preferably at least about 85% sequence identity,
yet more preferably at least about 86%
sequence identity, yet more preferably at least about 87°k sequence
identity, yet more preferably at least about 88%
sequence identity, yet more preferably at least about 89% sequence identity,
yet more preferably at least about 90%
sequence identity, yet more preferably at least about 91 % sequence identity,
yet more preferably at least about 92%
sequence identity, yet more preferably at least about 93% sequence identity,
yet more preferably at least about 94%
-6-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
sequence identity, yet more preferably at least about 95% sequence identity,
yet more preferably at least about 96%
sequence identity, yet more preferably at least about 97% sequence identity,
yet more preferably at least about 98%
sequence identity and yet more preferably at least about 99% sequence identity
to (a) a DNA molecule comprising
the coding sequence of a ful I-length PR0201, PR0292, PR0327, PRO 1265,
PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882 polypeptide cDNA as
disclosed herein, the coding
sequence of a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017,
PROI 1 I2, PR0509, PR0853 or PR0882 polypeptide lacking the signal peptide as
disclosed herein, the coding
sequence of an extracellular domain of a transmembrane PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112, PR0509, PR0853 or PR0882
polypeptide, with or
without the signal peptide, as disclosed herein or the coding sequence of any
other specifically defined fragment
of the full-length amino acid sequence as disclosed herein, or (b) the
complement of the DNA molecule of (a).
In a further aspect, the invention concerns an isolated nucleic acid molecule
comprising a nucleotide
sequence having at least about 80% sequence identity, preferably at least
about 81 % sequence identity, more
preferably at least about 82% sequence identity, yet more preferably at least
about 83% sequence identity, yet more
preferably at least about 84% sequence identity, yet more preferably at least
about 85% sequence identity, yet more
preferably at least about 86% sequence identity, yet more preferably at least
about 87% sequence identity, yet more
preferably at least about 88% sequence identity, yet more preferably at least
about 89% sequence identity, yet more
preferably at least about 90% sequence identity, yet more preferably at least
about 91 % sequence identity, yet more
preferably at least about 92% sequence identity, yet more preferably at least
about 93% sequence identity, yet more
preferably at least about 94% sequence identity, yet more preferably at least
about 95% sequence identity, yet more
preferably at least about 96% sequence identity, yet more preferably at least
about 97% sequence identity, yet more
preferably at least about 98% sequence identity and yet more preferably at
least about 99% sequence identity to (a)
a DNA molecule that encodes the same mature poiypeptide encoded by any of the
human protein cDNAs deposited
with the ATCC as disclosed herein, or (b) the complement of the DNA molecule
of (a).
Another aspect of the invention provides an isolated nucleic acid molecule
comprising a nucleotide
sequence encoding a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide which is either
transmembrane domain-deleted
or transmembrane domain-inactivated, or is complerr~entary to such encoding
nucleotide sequence, wherein the
transmembrane domains) of such polypeptide are disclosed herein. Therefore,
soluble extracellular domains of
the herein described PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptides are contemplated.
Another embodiment is directed to fragments of a PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide coding
sequence, or the complement thereof, that may find use as, for example,
hybridization probes, for encoding
fragments of a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1 Ol 7,
PROI 112, PR0509, PR0853 or PR0882 polypeptide that may optionally encode a
polypeptide comprising a
binding site for an anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-
PR0344, anti-PR0343, anti-
PR0347, anti-PR0357, anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509,
anti-PR0853 or anti-PR0882
_7-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
antibody or as antisense oligonucleotide probes. Such nucleic acid fragments
are usually at least about 20
nucleotides in length, preferably at least about 30 nucleotides in length,
more preferably at least about 40
nucleotides in length, yet more preferably at least about 50 nucleotides in
length, yet more preferably at least about
60 nucleotides in length, yet more preferably at least about 70 nucleotides in
length, yet more preferably at least
about 80 nucleotides in length, yet more preferably at least about 90
nucleotides in length, yet more preferably at
least about 100 nucleotides in length, yet more preferably at least about 110
nucleotides in length, yet more
preferably at least about 120 nucleotides in length, yet more preferably at
least about 130 nucleotides in length, yet
more preferably at least about 140 nucleotides in length, yet more preferably
at least about I 50 nucleotides in length,
yet more preferably at least about 160 nucleotides in length, yet more
preferably at least about 170 nucleotides in
length, yet more preferably at least about 180 nucleotides in length, yet more
preferably at least about 190
nucleotides in length, yet more preferably at least about 200 nucleotides in
length, yet ire preferably at least about
250 nucleotides in length, yet more preferably at least about 300 nucleotides
in iength, yet more preferably at least
about 350 nucleotides in length, yet more preferably at least about 400
nucleotides in length, yet more preferably
at least about 450 nucleotides in length, yet more preferably at least about
500 nucleotides in length, yet more
preferably at least about 600 nucleotides in length, yet more preferably at
least about 700 nucleotides in length, yet
more preferably at least about 800 nucleotides in length, yet more preferably
at least about 900 nucleotides in length
and yet more preferably at least about 1000 nucleotides in length, wherein in
this context the term "about" means
the referenced nucleotide sequence length plus or minus 10%a of that
referenced length. It is noted that novel
fragments of a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017,
PRO 1112, PR0509, PR0853 or PR0882 polypeptide-encoding nucleotide sequence
may be determined in a routine
manner by aligning the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide-encoding nucleotide
sequence with other known
nucleotide sequences using any of a number of well known sequence alignment
programs and determining which
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 polypeptide-encoding nucleotide sequence fragments)
are novel. All of such
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PROI 112,
PR0509, PR0853 or PR0882 polypeptide-encoding nucleotide sequences are
contemplated herein. Also
contemplated are the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 poiypeptide fragments encoded by
these nucleotide molecule
fragments, preferably those PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide fragments that
comprise a binding site
for an anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO 1265, anti-PR0344, anti-
PR0343, anti-PR0347, anti-
PR0357, anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or
anti-PR0882 antibody.
In another embodiment, the invention provides isolated PR0201, PR0292, PR0327,
PRO 1265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide encoded
by any of the isolated nucleic acid sequences hereinabove identified.
In a certain aspect, the invention concerns an isolated PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide,
_g_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
comprising an amino acid sequence having at least about 80% sequence identity,
preferably at least about 81 %
sequence identity, more preferably at least about 82% sequence identity, yet
more preferably at least about 83%
sequence identity, yet more preferably at least about 84% sequence identity,
yet more preferably at least about 85%
sequence identity, yet more preferably at least about 86% sequence identity,
yet more preferably at least about 87%
sequence identity, yet more preferably at least about 88% sequence identity,
yet more preferably at least about 89%
sequence identity, yet more preferably at least about 90% sequence identity,
yet more preferably at least about 91 %
sequence identity, yet more preferably at least about 92% sequence identity,
yet more preferably at least about 93%
. sequence identity, yet more preferably at least about 94% sequence identity,
yet more preferably at least about 95%
sequence identity, yet more preferably at least about 96% sequence identity,
yet more preferably at least about 97%
sequence identity, yet more preferably at least about 98% sequence identity
and yet more preferably at least about
99% sequence identity to a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide having a full-
length amino acid
sequence as disclosed herein, an amino acid sequence lacking the signal
peptide as disclosed herein, an extracellular
domain of a transmembrane protein, with or without the signal peptide, as
disclosed herein or any other specifically
defined fragment of the full-length amino acid sequence as disclosed herein.
In a further aspect, the invention concerns an isolated PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide
comprising an amino acid sequence having at least about 80% sequence identity,
preferably at least about 81 %
sequence identity, more preferably at least about 82% sequence identity, yet
more preferably at least about 83%
sequence identity, yet more preferably at least about 84% sequence identity,
yet more preferably at least about 85%
sequence identity, yet more preferably at least about 86% sequence identity,
yet more preferably at least about 87%
sequence identity, yet more preferably at least about 88% sequence identity,
yet more preferably at least about 89%
sequence identity, yet more preferably at least about 90% sequence identity,
yet more preferably at least about 91 %
sequence identity, yet more preferably at least about 92% sequence identity,
yet more preferably at least about 93%
sequence identity, yet more preferably at least about 94% sequence identity,
yet more preferably at least about 95%
sequence identity, yet more preferably at least about 96% sequence identity,
yet more preferably at least about 97%
sequence identity, yet more preferably at least about 98% sequence identity
and yet more preferably at least about
99% sequence identity to an amino acid sequence encoded by any of the human
protein cDNAs deposited with the
ATCC as disclosed herein.
In a further aspect, the invention concerns an isolated PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide
comprising an amino acid sequence scoring at least about 80% positives,
preferably at least about 81 % positives,
more preferably at least about 82% positives, yet more preferably at least
about 83% positives, yet more preferably
at least about 84% positives, yet more preferably at least about 85%
positives, yet more preferably at least about
86% positives, yet more preferably at least about 87% positives, yet more
preferably at least about 88% positives,
yet more preferably at least about 89% positives, yet more preferably at least
about 90% positives, yet more
preferably at least about 91 % positives, yet more preferably at least about
92% positives, yet more preferably at least
about 93% positives, yet more preferably at least about 94% positives, yet
more preferably at least about 95%
-9-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
positives, yet more preferably at least about 96% positives, yet more
preferably at least about 97% positives, yet
more preferably at least about 98% positives and yet more preferably at (east
about 99% positives when compared
with the amino acid sequence of a PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PRO11 12, PR0509, PR0853 or PR0882 polypeptide having a full-
length amino acid
sequence as disclosed herein, an amino acid sequence lacking the signal
peptide as disclosed herein, an extracellular
domain of a transmembrane protein, with or without the signal peptide, as
disclosed herein or any other specifically
defined fragment of the full-length amino acid sequence as disclosed herein.
In a specific aspect, the invention provides an isolated PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882
polypeptide without
the N-terminal signal sequence and/or the initiating methionine and is encoded
by a nucleotide sequence that
encodes such an amino acid sequence as hereinbefore described. Processes for
producing the same are also herein
described, wherein those processes comprise culturing a host cell comprising a
vector which comprises the
appropriate encoding nucleic acid molecule under conditions suitable for
expression of the PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112,
PR0509, PR0853 or
PR0882 polypeptide and recovering the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide from
the cell culture.
Another aspect of the invention provides an isolated PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide which
is either transmembrane domain-deleted or transmembrane domain-inactivated.
Processes for producing the same
are also herein described, wherein those processes comprise culturing a host
cell comprising a vector which
comprises the appropriate encoding nucleic acid molecule under conditions
suitable for expression of the PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide and recovering the PR0201, PR0292, PR0327, PROI
265, PR0344, PR0343,
PR0347, PR0357, PR0715, PRO 1017, PRO I 112, PR0509, PR0853 or PR0882
polypeptide from the cell culture.
In yet another embodiment, the invention concerns antagonists of a native
PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO1 Ol 7, PR01112, PR0509,
PR0853 or PR0882
polypeptide as defined herein. In a particular embodiment, the antagonist is
an anti-PR0241, anti-PR0292, anti-
PR0327, anti-PRO 1265, anti-PR0344, anti-PR0343, anti-PR0347, anti-PR0357,
anti-PR0715, anti-PR01017,
anti-PROI 112, anti-PR0509, anti-PR0853 or anti-PR0882 antibody or a small
molecule.
In a further embodiment, the invention concerns a method of identifying
antagonists to a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide which comprise contacting the PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide with a
candidate molecule and monitoring a biological activity mediated by said
PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide.
Preferably, the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1017,
PROI 112, PR0509, PR0853 or PR0882 polypeptide is a native PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or PRO882
polypeptide.
-10-
CA 02353775 2001-06-04
WO 00137640 PCT/US99/30095
In a still further embodiment, the invention concerns a composition of matter
comprising a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide, or an antagonist of a PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343,
PR0347, PR0357, PR0715, PRO 1017,,PR01112, PR0509, PR0853 or PR0882
polypeptide as herein described,
or an anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-
PR0343, anti-PR0347, anti-
PR0357, anti-PR0715, anti-PR01017, anti-PRO 1112, anti-PR0509, anti-PR0853 or
anti-PR0882 antibody, in
combination with a carrier. Optionally, the carrier is a pharmaceutically
acceptable carrier.
Another embodiment of the present invention is directed to the use of a
PR020I, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PROI 017, PRO 1112, PR0509,
PR0853 or PR0882
polypeptide, or an antagonist thereof as hereinbefore described, or an anti-
PR0201, anti-PR0292, anti-PR0327,
anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715,
anti-PR01017, anti-
PR01112, anti-PR0509, anti-PR0853 or anti-PR0882 antibody, for the preparation
of a medicament useful in the
treatment of a condition which is responsive to the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide, an antagonist
thereof or an anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO 1265, anti-
PR0344, anti-PR0343, anti-PR0347,
anti-PR0357, anti-PR0715, anti-PRO 1017, anti-PRO 1112, anti-PR0509, anti-
PR0853 or anti-PR0882 antibody.
In other embodiments of the present invention, the invention provides vectors
comprising DNA encoding
any of the herein described polypeptides. Host cell comprising any such vector
are also provided. By way of
example, the host cells may be CHO cells, E. coli, yeast, or Baculovirus-
infected insect cells. A process for
producing any of the herein described polypeptides is further provided and
comprises culturing host cells under
conditions suitable for expression of the desired polypeptide and recovering
the desired polypeptide from the cell
culture.
In other embodiments, the invention provides chimeric molecules comprising any
of the herein described
polypeptides fused to a heterologous polypeptide or amino acid sequence.
Example of such chimeric molecules
comprise any of the herein described polypeptides fused to an epitope tag
sequence or a Fc region of an
immunoglobulin.
In another embodiment, the invention provides an antibody which specifically
binds to any of the above
or below described polypeptides. Optionally, the antibody is a monoclonal
antibody, humanized antibody, antibody
fragment or single-chain antibody.
In yet other embodiments, the invention provides oligonucleotide probes useful
for isolating genomic and
cDNA nucleotide sequences or as antisense probes, wherein those probes may be
derived from any of the above
or below described nucleotide sequences.
Brief Description of the Figures
Figure 1 shows the nucleotide sequence (SEQ ID NO:1 ) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0201, wherein the nucleotide sequence (SEQ ID NO:I
) is a clone designated herein
as DNA30676-1223. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 2 shows the amino acid sequence (SEQ ID N0:2) of a native sequence
PR0201 polypeptide as
-I 1-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
derived from the coding sequence of SEQ ID NO:I shown in Figure 1.
Figure 3 shows the nucleotide sequence (SEQ ID NO:S) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0292, wherein the nucleotide sequence (SEQ ID NO:S)
is a clone designated herein
as DNA35617. Also presented in bold font and underlined are the positions of
the respective start and stop codons.
Figure 4 shows the amino acid sequence (SEQ ID N0:6) of a native sequence
PR0292 polypeptide as
derived from the coding sequence of SEQ ID NO:S shown in Figure 3.
Figure 5 shows the nucleotide sequence (SEQ ID N0:7) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0327, wherein the nucleotide sequence (SEQ ID N0:7)
is a clone designated herein
as DNA38113-1230. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 6 shows the amino acid sequence (SEQ ID NO:8) of a native sequence
PR0327 polypeptide as
derived from the coding sequence of SEQ ID N0:7 shown in Figure 5.
Figure 7 shows the nucleotide sequence (SEQ ID N0:12) of a cDNA containing a
nucleotide sequence
encoding native sequence PROI 265, wherein the nucleotide sequence (SEQ ID
N0:12) is a clone designated herein
as DNA60764-1533. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 8 shows the amino acid sequence (SEQ ID N0:13) of a native sequence
PROt265 polypeptide as
derived from the coding sequence of SEQ ID N0:12 shown in Figure ?.
Figure 9 shows the nucleotide sequence (SEQ ID N0:14) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0344, wherein the nucleotide sequence (SEQ ID
N0:14) is a clone designated herein
as DNA40592-1242. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 10 shows the amino acid sequence (SEQ ID NO:15) of a native sequence
PR0344 polypeptide as
derived from the coding sequence of SEQ ID N0:14 shown in Figure 9.
Figure 11 shows the nucleotide sequence (SEQ ID N0:22) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0343, wherein the nucleotide sequence (SEQ ID
N0:22) is a clone designated herein
as DNA43318-1217. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 12 shows the amino acid sequence (SEQ ID N0:23) of a native sequence
PR0343 polypeptide as
derived from the coding sequence of SEQ ID N0:22 shown in Figure 11.
Figure 13 shows the nucleotide sequence (SEQ ID N0:27) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0347, wherein the nucleotide sequence (SEQ ID
N0:27) is a clone designated herein
as DNA44176-1244. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 14 shows the amino acid sequence (SEQ ID N0:28) of a native sequence
PR0347 polypeptide as
derived from the coding sequence of SEQ ID N0:27 shown in Figure 13.
Figure 15 shows the nucleotide sequence (SEQ ID N0:32) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0357, wherein the nucleotide sequence (SEQ ID
N0:32) is a clone designated herein
as DNA44804-1248. Also presented in bold font and underlined are the positions
of the respective start and stop
-12-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
colons.
Figure 16 shows the amino acid sequence (SEQ ID N0:33) of a native sequence
PR0357 polypeptide as
derived from the coding sequence of SEQ ID N0:32 shown in Figure I5.
Figure 17 shows the nucleotide sequence (SEQ ID N0:39) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0715, wherein the nucleotide sequence (SEQ ID
N0:39) is a clone designated herein
as DNA52722-1229. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 18 shows the amino acid sequence (SEQ ID N0:40) of a native sequence
PR0715 polypeptide as
derived from the coding sequence of SEQ ID N0:39 shown in Figure 17.
Figure 19 shows the nucleotide sequence (SEQ ID N0:41 ) of a cDNA containing a
nucleotide sequence
encoding native sequence PRO1 O 17, wherein the nucleotide sequence (SEQ ID
N0:41 ) is a clone designated herein
as DNA56112-1379. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 20 shows the amino acid sequence (SEQ ID N0:42) of a native sequence
PR01017 polypeptide
as derived from the coding sequence of SEQ ID N0:41 shown in Figure 19.
Figure 21 shows the nucleotide sequence (SEQ ID N0:43) of a cDNA containing a
nucleotide sequence
encoding native sequence PRO 1112, wherein the nucleotide sequence (SEQ ID
N0:43) is a clone designated herein
as DNA57702-1476. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 22 shows the amino acid sequence (SEQ ID N0:44) of a native sequence
PR01112 polypeptide
as derived from the coding sequence of SEQ ID N0:43 shown in Figure 21.
Figure 23 shows the nucleotide sequence (SEQ ID N0:45) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0509, wherein the nucleotide sequence (SEQ ID
N0:45) is a clone designated herein
as DNA50148. Also presented in bold font and underlined are the positions of
the respective start and stop colons.
Figure 24 shows the amino acid sequence (SEQ ID N0:46) of a native sequence
PR0509 polypeptide as
derived from the coding sequence of SEQ ID N0:45 shown in Figure 23.
Figure 25 shows the nucleotide sequence (SEQ ID N0:47) of a cDNA containing a
nucleotide sequence
encoding native sequence PRO853, wherein the nucleotide sequence (SEQ ID
N0:47) is a clone designated herein
as DNA48227-1350. Also presented in bold font and underlined are the positions
of the respective start and stop
colons.
Figure 26 shows the amino acid sequence (SEQ ID N0:48) of a native sequence
PR0853 polypeptide as
derived from the coding sequence of SEQ ID N0:47 shown in Figure 25.
Figure 27 shows the nucleotide sequence (SEQ ID N0:52) of a cDNA containing a
nucleotide sequence
encoding native sequence PR0882, wherein the nucleotide sequence (SEQ ID
N0:52) is a clone designated herein
as DNA58125. Also presented in bold font and underlined are the positions of
the respective start and stop colons.
Figure 28 shows the amino acid sequence (SEQ ID N0:53) of a native sequence
PR0882 polypeptide as
derived from the coding sequence of SEQ ID N0:52 shown in Figure 27.
Figure 29 is a map of chromosome 19 showingthe mapping regions of DNA30676-
1223, DNA38113-1230
and DNA60764-1533.
-13-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Figure 30 is a map of chromosome 11 showing the mapping region of DNA35617.
Figure 31 is a map of chromosome 16 showing the mapping region of DNA43318-
1217and DNA58125.
Figure 32 is a map of chromosome 7 showing the mapping region of DNA56112-
1379.
Figure 33A is map of chromosome 17 showing the mapping region of DNA52722-
1229.
Figure 33B is a map of chromosome 17 showing the mapping region of DNA48227-
1350.
Figure 34 is a map of chromosome 16 showing the mapping region of DNA44804-
1248.
Detailed Description of the Invention
I. Definitions
The phrases "gene amplification" and "gene duplication" are used
interchangeably and refer to a process
by which multiple copies of a gene or gene fragment are formed in a particular
cell or cell line. The duplicated
region (a stretch of amplified DNA) is often referred to as "amplicon."
Usually, the amount of the messenger RNA
(mRNA) produced, i. e., the level of gene expression, also increases in the
proportion of the number of copies made
of the particular gene expressed.
"Tumor", as used herein, refers to all neoplastic cell growth and
proliferation, whether malignant or benign,
and all pre-cancerous and cancerous cells and tissues.
The terms "cancer" and "cancerous" refer to or describe the physiological
condition in mammals that is
typically characterized by unregulated cell growth. Examples of cancer include
but are not limited to, carcinoma,
lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such
cancers include breast cancer,
prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer,
non-small cell lung cancer,
gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer,
ovarian cancer, liver cancer, bladder cancer,
hepatoma, colorectal cancer, endometrial carcinoma, salivary gland carcinoma,
kidney cancer, liver cancer, vulval
cancer, thyroid cancer, hepatic carcinoma and various types of head and neck
cancer.
"Treatment" is an intervention performed with the intention of preventing the
development or altering the
pathology of a disorder. Accordingly, "treatment" refers to both therapeutic
treatment and prophylactic or
preventative measures. Those in need of treatment include those already with
the disorder as well as those in which
the disorder is to be prevented. In tumor (e.g., cancer) treatment, a
therapeutic agent may directly decrease the
pathology of tumor cells, or render the tumor cells more susceptible to
treatment by other therapeutic agents, e.g.,
radiation and/or chemotherapy.
The "pathology" of cancer includes all phenomena that compromise the well-
being of the patient. This
includes, without limitation, abnormal or uncontrollable cell growth,
metastasis, interference with the normal
functioning of neighboring cells, release of cytokines or other secretory
products at abnormal levels, suppression
or aggravation of inflammatory or immunologicat response, etc.
"Mammal" for purposes of treatment refers to any animal classified as a
mammal, including humans,
domestic and farm animals, and zoo, sports, or pet animals, such as dogs,
horses, cats, cattle, pigs, sheep, etc.
Preferably, the mammal is human.
"Carriers" as used herein include pharmaceutically acceptable carriers,
excipients, or stabilizers which are
nontoxic to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often the
physiologically acceptable carrier is an aqueous pH buffered solution.
Examples of physiologically acceptable
-14-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
carriers include buffers such as phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid;
low molecular weight (less than about 10 residues) polypeptides; proteins,
such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpytrolidone; amino
acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and other
carbohydrates including glucose,
mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as TWEENT"',
polyethylene glycol (PEG), and
PLURONICST"'.
Administration "in combination with" one or more further therapeutic agents
includes simultaneous
(concurrent) and consecutive administration in any order.
The term "cytotoxic agent" as used herein refers to a substance that inhibits
or prevents the function of
cells and/or causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., I"', I'25, Y~" and
Re"'6), chemotherapeutic agents, and toxins such as enzymatically active
toxins of bacterial, fungal, plant or animal
origin, or fragments thereof.
A "chemotherapeutic agent" is a chemical compound useful in the treatment of
cancer. Examples of
chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-
fluorouracil, cytosine arabinoside ("Ara-
C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g., paclitaxel
(Taxol, Bristol-Myers Squibb
Oncology, Princeton, N1), and doxetaxel (Taxotere, Rhone-Poulenc Rorer,
Antony, Rnace}, toxotere, methotrexate,
cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin
C, mitoxantrone, vincristine,
vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin,
dactinomycin, mitomycins,
esperamicins (see U.S. Pat. No. 4,675,187), 5-FU, 6-thioguanine, 6-
mercaptopurine, actinomycin D, VP-16,
chlorambucil, melphalan, and other related nitrogen mustards. Also included in
this definition are hormonal agents
that act to regulate or inhibit hormone action on tumors such as tamoxifen and
onapristone.
A "growth inhibitory agent" when used herein refers to a compound or
composition which inhibits growth
of a cell, especially cancer cell overexpressing any of the genes identified
herein, either in vitro or in viva. Thus,
the growth inhibitory agent is one which significantly reduces the percentage
of cells overexpressing such genes
in S phase. Examples of growth inhibitory agents include agents that block
cell cycle progression (at a place other
than S phase), such as agents that induce G1 arrest and M-phase wrest.
Classical M-phase blockers include the
vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as
doxorubicin, epirubicin, daunorubicin,
etoposide, and bleomycin. Those agents that arrest G1 also spill over into S-
phase arrest, for example, DNA
alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine,
cisplatin, methotrexate, 5-
fluorouracil, and ara-C. Further information can be found in The Molecular
Basis of Cancer, Mendelsohn and
Israel, eds., Chapter 1, entitled "Cell cycle regulation, oncogens, and
antineoplastic drugs" by Murakami et al., (WB
Saunders: Philadelphia, 1995), especially p. 13.
"Doxorubicin" is an anthracycline antibiotic. The full chemical name of
doxorubicin is (8S-cis)-10-[(3-
amino-2,3,6-trideoxy-a-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8>I1-
trihydroxy-8-(hydroxyacetyl)-1-
methoxy-5,12-naphthacenedione.
The term "cytokine" is a generic term for proteins released by one cell
population which act on another
cell as intercellularmediators. Examples of such cytokines are lymphokines,
monokines, and traditional polypeptide
hormones. Included among the cytokines are growth hormone such as human growth
hormone, N-methionyl human
-15-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine;
insulin; proinsulin; relaxin;
prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH),
thyroid stimulating hormone (TSH),
and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor;
prolactin; placental lactogen; tutr~or
necrosis factor-a and -Vii; mullerian-inhibiting substance; mouse gonadotropin-
associated peptide; inhibin; activin;
vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve
growth factors such as NGF-(3; platelet-
growth factor; transforming growth factors (TGFs) such as TGF-a and TGF-(i;
insulin-like growth factor-I and -II;
erythropoietin (EPO); osteoinductive factors; interferons such as interferon -
a, -(3, and -y; colony stimulating factors
(CSFs) such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF (GM-CSF);
and granulocyte-CSF (G-
CSF); interleukins (ILs) such as IL-1, IL- la, IL-2, IL-3, IL-4, IL-S, IL-6,
IL-7, IL-8, IL-9, IL-11, IL-12; a tumor
necrosis factor such as TNF-a or TNF-f3; and other polypeptide factors
including LIF and kit ligand (KL,). As used
herein, the term cytokine includes proteins from natural sources or from
recombinant cell culture and biologically
active equivalents of the native sequence cytokines.
The term "prodrug" as used in this application refers to a precursor or
derivative form of a
pharmaceutically active substance that is less cytotoxic to tumor cells
compared to the parent drug and is capable
of being enzymatically activated or converted into the more active parent
form. See, e.g., Wilman, "Prodrugs in
Cancer Chemotherapy", Biochemical Society Transactions, 14:375-382, 615th
Meeting, Belfast ( 1986), and Stella
et al., "Prodrugs: A Chemical Approach to Targeted Drug Delivery", Directed
Drus Delivery, Borchardt et al.,
(ed.), pp. 147-267, Humana Press (1985). The prodrugs of this invention
include, but are not limited to, phosphate-
containingprodrugs, thiophosphate-containing prodrugs, sulfate-containing
prodrugs, peptide-containing prodrugs,
D-amino acid-modified prodrugs, glysocylated prodrugs, (3-lactam-containing
prodrugs, optionally substituted
phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-
containing prodrugs, 5-
fluorocytosine and other 5-fluorouridine prodrugs which can be converted into
the more active cytotoxic free drug.
Examples of cytotoxic drugs that can be derivatized into a prodrugs form for
use in this invention include, but are
not limited to, those chemotherapeutic agents described above.
An "effective amount" of a polypeptide disclosed herein or an antagonist
thereof, in reference to inhibition
of neoplastic cell growth, tumor growth or cancer cell growth, is an amount
capable of inhibiting, to some extent,
the growth of target cells. The term includes an amount capable of invoking a
growth inhibitory, cytostatic and/or
cytotoxic effect and/or apoptosis of the target cells. An "effective amount"
of a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509,
PR0853 or PR0882
polypeptide antagonist for purposes of inhibiting neoplastic cell growth,
tumor growth or cancer cell growth, may
be determined empirically and in a routine manner.
A "therapeutically effective amount", in reference to the treatment of tumor,
refers to an amount capable
of invoking one or more of the following effects: ( 1 ) inhibition, to some
extent, of tumor growth, including, slowing
down and complete growth arrest; (2) reduction in the number of tumor cells;
(3) reduction in tumor size; (4)
inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell
infiltration into peripheral organs; (5)
inhibition (i.e., reduction, slowing down or complete stopping) of metastasis;
(6) enhancement of anti-tumor
immune response, which may, but does not have to, result in the regression or
rejection of the tumor; and/or (7)
relief, to some extent, of one or more symptoms associated with the disorder.
A "therapeutically effective amount"
of a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017,
-16-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PRO1 I 12, PR0509, PR0853 or PR0882 polypeptide antagonist for purposes of
treatment of tumor may be
determined empirically and in a routine manner.
A "growth inhibitory amount" of a PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 antagonist is an
amount capable of
inhibiting the growth of a cell, especially tumor, e.g., cancer cell, either
in vitro or in vivo. A "growth inhibitory
amount" of a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715, PRO 1017,
PR01112, PR0509, PR0853 or PR0882 antagonist for purposes of inhibiting
neoplastic cell growth may be
determined empirically and in a routine manner.
A "cytotoxic amount" of a PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PRO11 I2, PR0509, PR0853 or PR0882 antagonist is an amount
capable of causing the
destruction of a cell, especially tumor, e.g., cancer cell, either in vitro or
in vivo. A "cytotoxic amount" of a
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 antagonist for purposes of inhibiting neoplastic cell
growth may be determined
empirically and in a routine manner.
The terms "PR0201 ", "PR0292", "PR0327", "PR01265", "PR0344", "PR0343",
"PR0347",
"PR0357", "PR0715", "PR01017", "PR01112", "PR0509", "PR0853" or "PR0882"
polypeptide or protein
when used herein encompass native sequence PR0201, PR0292, PR0327, PRO 1265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptides and
PR0201, PR0292,
PR0327, PRO I 265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO I 017, PRO 11 I
2, PR0509, PR0853 or
PR0882 polypeptide variants (which are further defined herein). The PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PROI 017, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide
may be isolated from a variety of sources, such as from human tissue types or
from another source, or prepared by
recombinant and/or synthetic methods.
A "native sequence PR0201 ", "native sequence PR0292", "native sequence
PR0327", "native sequence
PR01265", "native sequence PR0344", "native sequence PR0343", "native sequence
PR0347", "native sequence
PR0357", "native sequence PR0715", "native sequence PRO 1017", "native
sequence PRO 1112", "native sequence
PR0509", "native sequence PR0853" or "native sequence PR0882" comprises a
polypeptide having the same
amino acid sequence as the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PRO1 I 12, PR0509, PR0853 or PR0882 polypeptide as derived
from nature. Such native
sequence PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PROI 112, PR0509, PR0853 or PR0882 polypeptide can be isolated from nature or
can be produced by
recombinant and/or synthetic means. The term "native sequence" PR0201, PR0292,
PR0327, PROI 265, PR0344,
PR0343, PR0347, PR0357, PR071 S, PROI 017, PROI I 12, PR0509, PR0853 or PR0882
specifically
encompasses naturally-occurring truncated or secreted forms (e.g., an
extracellular domain sequence), naturally-
occurring variant forms (e.g., alternatively spliced forms) and naturally-
occurring allelic variants of the PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 and PR0882 polypeptides. In one embodiment of the invention, the native
sequence PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112,
PR0509, PR0853 or
PR0882 polypeptide is a mature or full-length native sequence PR0201, PR0292,
PR0327, PR01265, PR0344,
_17_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide as shown
in Figure 2 (SEQ ID N0:2), Figure 4 (SEQ ID N0:6), Figure 6 (SEQ ID N0:8),
Figure 8 (SEQ ID N0:13), Figure
(SEQ ID NO:15), Figure 12 (SEQ ID N0:23), Figure 14 (SEQ ID N0:28), Figure 16
(SEQ ID N0:33), Figure
18 (SEQ ID N0:40), Figure 20 (SEQ ID N0:42), Figure 22 (SEQ ID N0:44), Figure
24 (SEQ ID N0:46), Figure
S 26 (SEQ ID N0:48), or Figure 28 (SEQ ID N0:53), respectively. Also, while
the PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PROI 017, PRO 1112, PR0509,
PR0853 and PR0882
polypeptides disclosed in Figure 2 (SEQ ID N0:2), Figure 4 (SEQ ID N0:6),
Figure 6 (SEQ ID N0:8), Figure 8
(SEQ ID NO:13), Figure 10 (SEQ ID NO:15), Figure 12 (SEQ ID N0:23), Figure 14
(SEQ ID N0:28), Figure 16
(SEQ ID N0:33), Figure 18 (SEQ ID N0:40), Figure 20 (SEQ ID N0:42), Figure 22
(SEQ ID N0:44), Figure 24
10 (SEQ ID N0:46), Figure 26 (SEQ ID N0:48), or Figure 28 (SEQ ID N0:53),
respectively, are shown to begin with
the methionine residue designated therein as amino acid position 1, it is
conceivable and possible that another
methionine residue located either upstream or downstream from amino acid
position 1 in Figure 2 (SEQ ID N0:2),
Figure 4 (SEQ ID N0:6), Figure 6 (SEQ ID N0:8), Figure 8 (SEQ ID N0:13),
Figure 10 (SEQ ID NO: I5), Figure
12 (SEQ ID N0:23), Figure 14 (SEQ ID N0:28), Figure 16 (SEQ ID N0:33), Figure
18 (SEQ ID N0:40), Figure
20 (SEQ ID N0:42), Figure 22 (SEQ ID N0:44), Figure 24 (SEQ ID N0:46), Figure
26 (SEQ ID N0:48), or
Figure 28 (SEQ ID N0:53), respectively, may be employed as the starting amino
acid residue for the PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide.
The "extracellular domain" or "ECD" of a polypeptide disclosed herein refers
to a form of the polypeptide
which is essentially free of the transmembrane and cytoplasmic domains.
Ordinarily, a polypeptide ECD will have
less than about 1 % of such transmembrane and/or cytoplasmic domains and
preferably, will have less than about
0.5% of such domains. It will be understood that any transmembrane domains)
identified for the polypeptides of
the present invention are identified pursuant to criteria routinely employed
in the art for identifying that type of
hydrophobic domain. The exact boundaries of a transmembrane domain may vary
but most likely by no more than
about 5 amino acids at either end of the domain as initially identified and as
shown in the appended figures. As
such, in one embodiment of the present invention, the extraceltular domain of
a polypeptide of the present invention
comprises amino acids 1 to X of the mature amino acid sequence, wherein X is
any amino acid within 5 amino acids
on either side of the extracellular domain/transmembrane domain boundary.
The approximate location of the "signal peptides" of the various PRO
polypeptides disclosed herein are
shown in the accompanying figures. It is noted, however, that the C-terminal
boundary of a signal peptide may vary,
but most likely by no more than about 5 amino acids on either side of the
signal peptide C-terminal boundary as
initially identified herein, wherein the C-terminal boundary of the signal
peptide may be identified pursuant to
criteria routinely employed in the art for identifying that type of amino acid
sequence element (e.g., Nielsen et al.,
Prot. EnQ., 10:1-6 (1997) and von Heinje et al., Nucl. Acids. Res., 14:4683-
4690 (1986)). Moreover, it is also
recognized that, in some cases, cleavage of a signal sequence from a secreted
polypeptide is not entirely uniform,
resulting in more than one secreted species. These mature polypeptides, where
the signal peptide is cleaved within
no more than about 5 amino acids on either side of the C-terminal boundary of
the signal peptide as identified
herein, and the polynucleotides encoding them, are contemplated by the present
invention.
"PR0201 polypeptide variant", "PR0292 polypeptide variant", "PR0327
polypeptide variant", "PR01265
_18_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
polypeptide variant", "PR0344 polypeptide variant", "PR0343 polypeptide
variant", "PR0347 polypeptide
variant", "PR0357 polypeptide variant", "PR0715 polypeptide variant", "PR01017
polypepdde variant",
"PR01112 polypeptide variant", "PR0509 polypeptide variant", "PR0853
polypeptide variant" or "PR0882
polypeptide variant" means an active PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide as
defined above or below
having at least about 80% amino acid sequence identity with a full-length
native sequence PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I 12,
PR0509, PR0853 or
PR0882 polypeptide sequence as disclosed herein, a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide
sequence lacking
the signal peptide as disclosed herein, an extracellular domain of a PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide,
with or without the signal peptide, as disclosed herein or any other fragment
of a full-length PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I 12,
PR0509, PR0853 or
PR0882 polypeptide sequence as disclosed herein. Such PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide variants
include, for instance, PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptides wherein one or more
amino acid residues are
added, or deleted, at the N- or C-terminus of the full-length native amino
acid sequence. Ordinarily, a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide variant will have at least about 80% amino acid
sequence identity, preferably at
least about 81 % amino acid sequence identity, more preferably at least about
82% amino acid sequence identity,
more preferably at least about 83% amino acid sequence identity, more
preferably at least about 84% amino acid
sequence identity, more preferably at least about 85% amino acid sequence
identity, more preferably at least about
86% amino acid sequence identity, more preferably at least about 87% amino
acid sequence identity, more
preferably at least about 88% amino acid sequence identity, more preferably at
least about 89% amino acid sequence
identity, more preferably at least about 90% ami no acid sequence identity,
more preferably at least about 91 % amino
acid sequence identity, more preferably at least about 92% amino acid sequence
identity, more preferably at least
about 93% amino acid sequence identity, more preferably at least about 94%
amino acid sequence identity, more
preferably at least about 95% amino acid sequence identity, more preferably at
least about 96% amino acid sequence
identity, more preferably at least about 97% amino acid sequence identity,
more preferably at least about 98% amino
acid sequence identity and most preferably at least about 99% amino acid
sequence identity with a full-length native
sequence PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PRO 1 I I 2, PR0509, PR0853 or PR0882 potypeptide sequence as disclosed
herein, a PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PROI O 17, PRO 1112, PR0509,
PR0853 or PR0882
polypeptide sequence lacking the signal peptide as disclosed herein, an
extracel lular domain of a PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112,
PR0509, PR0853 or
PR0882 polypeptide, with or without the signal peptide, as disclosed herein or
any other fragment of a full-length
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO
1017, PRO 1112,
PR0509, PR0853 or PR0882 polypeptide sequence as disclosed herein. Ordinarily,
PR0201, PR0292, PR0327,
-19-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509,
PR0853 or PR0882
variant polypeptides are at least about 10 amino acids in length, often at
least about 20 amino acids in length, more
often at least about 30 amino acids in length, more often at least about 40
amino acids in length, more often at least
about 50 amino acids in length, more often at least about 60 amino acids in
length, more often at least about 70
amino acids in length, more often at least about 80 amino acids in length,
more often at least about 90 amino acids
in length, more often at least about 100 amino acids in length, more often at
least about 150 amino acids in length,
more often at least about 200 amino acids in length, more often at least about
300 amino acids in length, or more.
As shown below, Table 1 provides the complete source code for the ALIGN-2
sequence comparison
computer program. This source code may be routinely compiled for use on a UNIX
operating system to provide
the ALIGN-2 sequence comparison computer program.
In addition, Tables 2A-2D show hypothetical exemplifications for using the
below described method to
determine % amino acid sequence identity (Tables 2A-2B) and % nucleic acid
sequence identity (Tables 2C-2D)
using the ALIGN-2 sequence comparison computer program, wherein "PRO"
represents the amino acid sequence
of a hypothetical PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
I S PR01017, PROI 112, PR0509, PR0853 or PR0882 polypeptide of interest,
"Comparison Protein" represents the
amino acid sequence of a polypeptide against which the "PRO" polypeptide of
interest is being compared, "PRO-
DNA" represents a hypothetical PR0201-, PR0292-, PR0327-, PR01265-, PR0344-,
PR0343-, PR0347-,
PR0357-, PR0715-, PR01017-, PROI 112-, PR0509-, PR0853- or PR0882-encoding
nucleic acid sequence of
interest, "Comparison DNA" represents the nucleotide sequence of a nucleic
acid molecule against which the
"PRO-DNA" nucleic acid molecule of interest is being compared, "X", "Y", and
"Z" each represent different
hypothetical amino acid residues and "N", "L" and "V" each represent different
hypothetical nucleotides.
-20-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/*
Table 1
* C-C increased from 12 to 15
* Z is average of EQ
* B is average of ND
* match with stop is M; stop-stop = 0; J (joker) match = 0
*/
Nde6ne M -8 /* value of a match with a stop */
int day[26][26] _ {
/* A B C D B F G H I J K L M N O P Q R S T U V W X Y Z*!
/* A */ { 2, 0,-2, 0, 0,-4, 1,-1,-1, 0,-i,-2,-I, O, M, 1, 0,-2, 1, 1, 0, 0,-6,
0,-3, 0},
/* B */ { 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-2, 2,_M,-1, 1, 0, 0, 0, 0,-2,-5,
0,-3, 1},
/* C */ {-2,-4,15,-5,-5,-4,-3,-3,-2, 0,-5,-6,-5,-4, M,-3,-5,-4, 0; 2, 0,-2,-8,
0, 0,-5},
/* D */ { 0, 3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2,_M,-1, 2,-1, 0, 0, 0,-2,-7,
0,-4, 2},
1* E */ { 0, 2,-5, 3, 4,-5, 0, I,-2, 0, 0,-3,-2, I, M,-1, 2,-1, 0, 0, 0,-2,-7,
0,-4, 3},
1* F */ {-4,-5,-4,-6,-5, 9,-5,-2, 1, 0,-5, 2, 0,-4,_M,-5,-5,-4,-3,-3, 0,-1, 0,
0, 7,-5},
/* G */ { 1, 0,-3, I, 0,-5, 5,-2; 3, 0,-2,-4,-3, 0,_M,-1,-1,-3, 1, 0, 0,-1,-7,
0,-5, 0},
/* H */ {-1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2, M, 0, 3, 2,-I,-1, 0,-2,-3,
0, 0, 2},
/* I */ {-1,-2,-2,-2,-2, 1,-3,-2, 5, 0,-2, 2, 2,-2, M,-2,-2,-2,-1, 0, 0, 4,-5,
0,-I,-2},
/* J */ { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, O, M, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0},
/* K */ {-1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, 1, M,-1, 1, 3, 0, 0; 0,-2,-3,
0,-4, 0},
/* L */ {-2,-3,-6,-0,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3,_M,-3,-2,-3,-3,-1, 0, 2,-2,
0,-1,-2},
/* M */ {-1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2, M,-2,-1, 0; 2,-1, 0, 2,-4,
0,-2,-1},
/* N */ { 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2, 2,_M,-1, I, 0, 1, 0, 0,-2,-4,
0,-2, 1},
/* O */ { M,_M,_M,_M, M,_M, M,_M,_M,_M,_M,_M,_M,_M, 0,
M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M},
/* P */ { 1,-1,-3,-I,-1,-5,-1, 0,-2, 0,-1,-3,-2,-1, M, 6, 0, 0, 1, 0, 0,-1,-6,
0,-5, 0},
/* Q */ { 0, 1,-5, 2, 2,-5,-1, 3,-2, 0, I,-2,-1, 1, M, 0, 4, 1,-1,-1, 0,-2,-5,
0,-4, 3},
/* R */ {-2, 0,-4,-1,-1,-4,-3, 2,-2, 0, 3,-3, 0, 0,_M, 0, 1, 6, 0,-1, 0,-2, 2,
0,-4, 0},
l* S */ { 1, 0, 0, 0, 0,-3, 1,-I,-i, 0, 0,-3,-2, 1, M, 1,-1, 0, 2, I, 0,-1,-2,
0,-3, 0},
/* T */ { 1, 0,-2, 0, 0,-3, 0,-1, 0, 0, 0,-1,-1, O, M, 0,-I,-1, 1, 3, 0, 0,-5,
0,-3, 0},
/* U */ { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, O, M, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0},
/* V */ { 0,-2,-2,-2,-2,-1,-1,-2, 4, 0,-2, 2, 2,-2, M,-1,-2,-2,-1, 0, 0, 4,-6,
0,-2,-2},
/* W */ {-6,-5,-8,-7,-7, 0,-7,-3,-5, 0,-3,-2,-4,-4,_M,-6,-5, 2,-2,-5, 0,-6,17,
0, 0,-6},
/* X */ { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0},
/* Y */ {-3,-3, 0,-4,-4, 7,-5, 0,-1, 0,-4,-1,-2,-2,_M,-5,-4,-4,-3,-3, 0,-2, 0,
0,10,-4},
/* Z */ { 0, 1,-5, 2, 3,-5, 0, 2,-2, 0, 0,-2,-1, 1 =M, 0, 3, 0, 0, 0, 0,-2,-6,
0,-4, 4}
};
Page 1 of day.h
-2I-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/*
*/
#include
<
stdio.h
>
#include
<
ctype.
h
>
#defineMAXJMP 16 /* max jumps in a diag */
#defineMAXGAP 24 /* don't continue to penalize
gaps larger than this */
#defineJMPS 1024/* max jmps in an path */
#detineMX 4 /* save if there's at least
MX-1 bases since last jmp
*/
#deFneDMAT 3 /* value of matching bases
*/
#defineDMIS 0 /* penalty for mismatched
bases */
#detlneDINSO 8 /* penalty for a gap */
#defmeDINS1 1 /* penalty per base */
#de6nePINSO 8 /* penalty for a gap */
#definePINSL 4 /* penalty per residue */
struct
jmp
{
short n[MAX1MP];
I*
size
of
jmp
(neg
for
dely)
*I
unsigned x[MAXJMP];
short /*
base
no.
of
jmp
in
seq
x
*/
/* limits seq to 2"16 -1 */
struct
diag
{
int score;/* score at lastjmp */
long offset;I* offset of prev block *I
short ijmp;/* current jmp index *l
struct jp; /* list of jmps */
jmp
};
struct
path
{
int spc; /* number of leading spaces
*/
shortn[JMPS];/*
size
of
jmp
(gap)
*l
int x[JMPS];/*
loc
of
jmp
(last
elem
before
gap)
*/
};
char *ofile; /* output file name *1
char *namex[2]; /* seq names: getseqsQ *J
char *prog; /* prog name for err msgs
*1
char *seqx[2]; /* seqs: getseqsp *i
int dmax; /* best diag: nwQ */
int dmax0; /* final diag */
int dna; /* set if dna: main() */
int endgaps; /* set if penalizing end gaps
*/
int gapx, /* total gaps in seqs */
gapy;
int len0, ; /* seq lens */
lent
int ngapx, /* total size of gaps */
ngapy;
int smax; /* max score: nwQ */
int *xbm; /* bitmap for matching *I
long offset; /* current offset in jmp file
*/
structdiag *dx; /* holds diagonals */
structpath pp[2]; l* holds path for seqs *l
char *callocQ,*mallocQ, *indexQ, *strcpYQ;
char *getseqQ,*g
callocQ;
Page 1 of nw.h
-22-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/* Needleman-Wunsch alignment program
*
* usage: progs filet filet
* where filet and filet are two dna or two protein sequences.
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with '; ' >' or ' <' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with I/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align.out~
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650
*/
include "nw.h"
Ninclude "day.h"
static dbval[26] _ {
1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
static -pbval[26] _ {
1, 2~(1< < fD'-'A'))~(1< <('N'-'A')), 4, 8, 16, 32, 64,
128, 256, OxFFFFFFF, 1 < < 10, I < < 11, 1 < < 12, 1 < < 13, i < < 14,
.1«15, I«16, 1«17, 1«18, 1«19, 1«20, 1«21, 1«22,
1«23, I«24, 1«25~(I«('E'-'A'))~(I«('Q'-'A'))
};
main(ac, av) lri8ln
int ac;
char *avQ;
prog = av[0];
if (ac ! = 3) {
fprintf(stderr,~usage: 3bs filet filet\n", prog);
fprintf(stderr,"where filet and filet are two dna or two protein
sequences.\n");
fprintf(stderr,"The sequences can be in upper- or lower-casein");
fprintf(stderr,"Any lines beginning with ';' or ' <' are ignored\n");
fprintf(stderr,"Output is in the file \"align.out\"\n");
exit(1);
namex[0] = av[1];
namex[1] = av[2];
seqx[0] = getseq(namex[0], &len0);
seqx[1] = getseq(namex[I], &lenl);
xbm = (dna)? dbval : pbval;
endgaps = 0; /* 1 to penalize endgaps */
ofile = "align.out"; /* output file */
nwQ; /* fill in the matrix, get the possible jmps */
readjmpsQ; /* get the actual jmps */
printQ; 1* print slats, alignment */
cleanup(0); /* unlink any tmp files */
Page 1 of nw.c
-23-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/* do the alignment, return best score: main()
* dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*/
nwU 11W
f
char *px, *py; /* seqs and ptrs */
int *ndely, *dely;/* keep track of dely */
int ndelx, delx;/* keep track of delx */
int *tmp; /* for swapping row0, rowl */
int mis; /* score for each type */
int ins0, insl; /* insertion penalties */
register id; /* diagonal index */
register ij; /* jmp index */
register *col0, *coli;/* score for curr, last row */
register xx, yy; /* index into seqs */
dx = (struct diag *)g calloc("to get diags", len0+lenl+1, sizeof(struct
diag));
ndely = (int *)g calloc("to get ndely", lenl +I, sizeof(int));
dely = (int *)g calloc("to get dely", len I + 1, sizeof(int));
col0 = (int *)g calloc("to get col0", lenl+1, sizeof(int));
col l = (int *)g calloc("to get col l ", lenl + 1, sizeof(int));
ins0 = (dna)? DINSO : PINSO;
insl = (dna)? DINS1 : PINS1;
smax = -10000;
if (endgaps) {
for (col0[0] = dely[O] _ -ins0, yy = 1; yy < = lenl; yy++) {
col0[yy] = dely[yy] = col0[yy-1] - insl;
ndely[yy] = YY:
col0[0] = 0; /* Waterman Bull Math Biol 84 */
else
for (yy = 1; yy < = lenl; yy++)
dely[yy] _ -ins0;
/* fill in match matrix
*/
for (px = seqx[0], xx = 1; xx < = len0; px++, xx++) {
/* initialize first entry in col
*/
if (endgaps) {
if (xx == I)
coil[0] = delx = -(ins0+insl);
else
coil[0] = delx = col0[0] - insl;
ndeix = xx;
else {
col 1 [0] = 0;
delx = -ins0;
ndelx = 0;
Page 2 of nw.c
-24-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
...nw
for (py = seqx[1], yy = 1; yy < = lenl; py++, yy++) {
mis = col0[yy-1];
if (dna)
mis +_ (xbm[*px-'A']&xbm[*py-'A'])? DMAT : DMIS;
else
mis += day[*px-'A'][*py-'A'];
/* update penalty for del in x seq;
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps
*/
if (endgaps ~ ~ ndely[yy] < MAXGAP) {
if (col0[yy] - ins0 > = dely[yy]) {
dely[yy] = col0(yy] - (ins0+insl);
ndely[yY1 = 1;
} else {
dely[yyJ -= insl;
ndely[yy] + +;
} else {
if (col0[yy] - (ins0+insl) > = dely[yy]) {
dely[yy] = col0[yy] - (ins0+insl);
ndely[yy] = 1;
} else
ndely[yYl++;
}
/* update penalty for del in y seq;
* favor new del over ongong del
*1
if (endgaps ~ ~ ndelx < MAXGAP) {
if (colt[yy-1] - ins0 > = delx) {
delx = coli[yy-I] - (ins0+insl);
ndelx = 1;
} else {
delx -= insl;
ndelx++;
} else {
if (cull [yy-1] - (ins0+insl) > = delx) {
delx = coll[yy-I] - (ins0+insl);
ndelx = 1;
} else
}
ndelx++;
/* pick the maximum score; we're favoring
* mis over any del and delx over dely
*/
Page 3 of nw.c
-25-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
id = xx - yy + lenl - 1;
if (mis > = delx && mis > = dely[yy])
...nw
cull[yy] = mis;
else if (delx > = dely[yy]) {
col l [yy] = delx;
ij = dx(id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndelx > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx(id].score+DINSO)) {
dx[id].ijmp++;
if (++ij > = MAXJMP) {
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset + _ sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] = ndelx;
dx[id].jp.x[ij] = xx;
dx[id].score = delx;
else {
toll[yY] = dely[yY]:
ij = dx(id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndely[yy] > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) {
dx[id]. ijmp+ +;
if (++ij > = MAXJMP) {
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset += sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] _ -ndely[yy];
dx[id].jp.x[ij] = xx;
dx[id].score = dely[yy];
if (xx == IenO && yy < lenl) {
/* last col
*/
if (endgaps).
coll[yy] -= ins0+insl*(lenl-yy);
if (col l [yy] > smax) {
smax = toll[yy];
dmax = id;
if (endgaps && xx < IenO)
coll[yy-1] -= ins0+insl*(IenO-xx);
if (coil[yy-lJ > smax) {
smax = coil[yy-1];
dmax = id;
tmp = col0; col0 = col 1; col l = tmp;
(void) free((char *)ndely);
(void) free((char *)dely);
(void) free((char *xol0);
(void) free((char *xoll);
Page 4 of nw.t;
-26-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/*
* print() -- only routine visible outside this module
* static:
* getmatQ -- trace back best path, count matches: printQ
* pr align() -- print alignment of described in array p[j: print()
* dumpblockQ -- dump a block of lines with numbers, stars: pr align()
* nums() -- put out a number line: dumpblockQ
* putlineQ -- put out a line (name, [num], seq, (num]): dumpblockQ
* starsQ - -put a line of stars: dumpblockQ
* stripnameQ -- strip any path and prefix from a seqname
*/
i4~include "nw.h"
A~define SPC 3
Jfdefine P LINE 256 /* maximum output line */
~Ydefine P SPC 3 1* space between name or num and seq */
extern day[26J[26];
int olen; /* set output line length */
FILE *fx; 1* output file */
printQ
{ print
int lx, ly, firstgap, lastgap; /* overlap */
if ((fx = fopen(ofile, "w")) _ = 0) {
fprintf(stderr,"9is: can't write 96s\n", prog, ofile);
cleanup(1);
fprintf(fx, "<first sequence: 9i;s (length = 9bd)\n", namex[0], IenO);
fprintf(fx, "<secord sequence: q&s (length = 96d)\n", namex(IJ, lenl);
olen = 60;
Ix = len0;
ly = lenl;
firstgap = lastgap = 0;
if (dmax < lenl - 1) { /* leading gap in x */
pp[0].spc = firstgap = lenl - dmax - 1;
ly _= pP(0].sPc;
else if (dmax > lenl - 1) { /* leading gap in y */
pp[1].spc = firstgap = dmax - (lenl - 1);
lx -= pp[1].spc;
if (dmax0 < len0 - 1) { /* trailing gap in x */
lastgap = len0 - dmax0 -1;
Ix -= lastgap;
else if (dmax0 > IenO - I) { /* trailing gap in y */
lastgap = dmax0 - (IenO - 1);
ly -= lastgap;
getmat(Ix, ly, firstgap, lastgap);
pr alignQ;
Page 1 ofnwprint.c
-27-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
1*
* trace back the best path, count matches
*/
static
getmat(Ix, ly, firstgap, lastgap) getmat
int lx, ly; /* "core" (minus endgaps) *!
int firstgap, lastgap; /* leading trailing overlap */
{
int nm, i0, il, siz0, sizl;
char outx(32];
double pct;
register n0, nl;
register char *p0, *pl;
/* get total matches, score
*/
i0 = il = siz0 = sizl = 0;
p0 = seqx[0] + pp[lJ.spc;
pl = seqx[1] + pp[O].spc;
n0 = pp[1].spc + 1;
nl = pp[0].spc + 1;
nm = 0;
while ( *p0 && *pl ) {
if (siz0) {
pl++;
nl++;
siz0--;
else if (sizl) {
p0++;
n0++;
sizl--;
else {
if (xbm[*p0-'A']&xbm[*pl-'A'])
nm++;
If (n0++ _= pp[0].x[i0])
siz0 = pp[0].n[i0++];
if (nl++ _= pp[1].x[il])
sizl = pp[l].n[il++];
p0++;
pl++;
/* pct homology:
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core
*/
if (endgaps)
lx = (len0 < lenl)? IenO : lenl;
else
lx = (lx < ly)? Ix : ly;
pct = 100.*(double)nml(double)fx;
fprintf(fx, "1n");
fprintf(fx, " < ~d match96s in an overlap of 96d: ~.2f percent similarity\n",
nm, (nm == 1)? ", . "es", Ix, pct);
Page 2 of nwprint. c
-28-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
fprintf(fx, "<gaps in first sequence: ~d", gapx); ..getlriat
if (gapx) { '
(void) sprintf(outx, " (~d 9bs~s)",
ngapx, (dna)? "base":"residue", (ngapx = = 1)? "~:"s");
fprintf(fx,"~s", outx);
fprintf(fx ", gaps in second sequence: 56d", gapy);
if (gapY) {
(void) sprintf(outx, " (96d ~s96s)",
ngapy, (dna)? "base":"residue",(ngapy = = I)? "":"s");
fprintf(fx," ~6s", outx);
if (dna)
fprintf(fx,
"1n<score: ~d (match = qbd, mismatch = 96d, gap penalty = 96d + qbd per
base)\n",
smax, DMAT, DMIS, DINSO, DINS1);
else
fprintf(fx,
"\n < score: 96d (Dayhoff PAM 250 matrix, gap penalty = 96d + q&d per
residue)1n",
smax, PINSO, PINSI);
if (endgaps)
fprintf(fx,
"<endgaps penalized, left endgap: Ybd 96s9bs, right endgap: :~d ?&s9bs\n",
firstgap, (dna)? "base" : "residue", (firstgap == I)? "" ~ "s",
lastgap, (dna)? "base" : "residue", (lastgap == I)? "" . "s");
else
fprintf(fx, " < endgaps not penalized\n");
static nm; /* matches in core
-- for checking */
static Imax; /* lengths of stripped
file names */
static ij[2]; /* jmp index for a
path */
static nc[2]; 1* number at start
of current line */
static ni[2]; /* current elem number
-- for gapping */
static siz[2];
static *ps[2]; /* ptr to current element
char */
static *po[2]; /* ptr to next output
char char slot */
static out[2][P /* output line */
char LINE);
static star[P LINE];/* set by stars() */
char
/*
* print alignment of described in struct path pp[]
*/
static
pr align()
pr align
int nn; /* char count */
int more;
register i;
for (i = 0, Imax = 0; i < 2; i++) {
nn = stripname(namex[i]);
if (nn > lmax)
lmax = nn;
nc[i] = I;
ni[i] = I;
siz[i] = ij[i] = 0;
Ps(7 = seqx[i];
po[i] = out[i];
Page 3 of nwprint. c
-29-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
for (nn = ntn = 0, more = 1; more; ) { ...pr align
for (i = more = 0; i < 2; i++) {
/*
* do we have more of this sequence?
*/
if (!*Ps[i])
continue;
more++;
if (pp[i].spc) { /* leading space */
*po[i]++ _
PP[il.spc__~
else if (siz[i]) { I* in a gap *I
*po[i]++ _
siz[i]--;
else { /* we're putting a seq element
*/
*Po[i] _ *Ps[i];
if (islower(*ps[i]))
*ps[i] = toupper(*ps[i]);
po[i] + +;
ps[i]++;
/*
* are we at next gap for this seq?
*/
if (ni[i] _= pp[i].x[ij[i]D {
/*
* we need to merge all gaps
* at this location
*/
siz[i] = pp[i].n[ij[i]++];
while (ni[i] _ = pp[i].x[ij(i]D
siz[i] += pp[i].n[ij[i]++j;
ni[i] + +;
if (++nn == oleo ~ ~ !more && nn) {
dumpblockQ;
for (i = 0; i < 2; i++)
po[i] = out[i];
nn=0;
/*
* dump a block of lines, including numbers, stars: pr align()
*%
static
a~mpblockp dumpblock
{
register i;
for (i = 0; i < 2; i++)
*po[i]__ _ '\0';
Page 4 of nwprint. c
-30-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
(void) putc('\n', fx);
for (i = 0; i < 2; i++) {
if (*out[i] && (*out[i] ! _ ' ' ~ ~ *(po[i]) ! _ ' ')) {
if (i == 0)
nums(i);
if (i == 0 && *out[1])
starsQ;
putline(i);
if (i == 0 && *out[1])
fprintf(fx, star);
if (i == 1)
nums(i);
... dumpblock
/*
* put out a number line: dumpblockQ
*/
static
nums(ix) nums
int ix; /* index in outQ holding seq line */
f
char mine[P LINE];
register i, j;
register char *pn, *px, *py;
for (pn = nline, i = 0; i < lmax+P SPC; i++, pn++)
*pn = ",
for (i = nc[ix], py = out[ix]; *py; py++, pn++) {
if (*py =- ' ~ ~ *PY =_ -')
*Pn = ,
else {
if (i~10 == 0 ~ ~ (i == 1 && nc[ix] != 1)) {
j = (i < 0)? -i : i;
for (px = pn; j; j /= 10, px--)
*px = jqbl0 + '0';
if (i < 0)
*px=, ~~
else
*Pn = ,
i++;
*Pn = '\0~;
nc[ix] = i;
for (pn = nline; *pn; pn++)
(void) putc(*pn, fx);
(void) putc('\n', fx);
/*
* put out a line (name, [num], seq, [num]): dumpblockQ
*/
static
putline(ix) puthne
int ix;
{
Page 5 of nwprint-c
-31-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
int ;; ...putline
register char *px;
for (px = namex[ix], i = 0; *px && *px !_ ':'; px++, i++)
(void) putc(*px, fx);
for (; i < Imax+P SPC; i++)
(void) putc(' ', fx);
/* these count from 1:
* ni[] is current element (from 1)
* nc~ is number at start of current line
*/
for (px = out(ix]; *px; px++)
(void) putc(*px&Ox7F, fx);
(void) putc('\n', fx);
/*
* put a line of stars (seqs always in out[0], out[1]): dumpblockQ
*/
static
starsQ St81'S
{
int (;
register char *p0, *p 1, cx, *px;
if(!*out[0] I ~ (*out[0] __ ' &&, *(PoIO]) _- ' ') I I
r*out[1] I I (*out[1] _ _ ' && *(Pofll) _ - ' '))
return;
px = star;
for (i = Imax+P SPC; i; i--)
*px++ _ ,
for (p0 = out[0], pl = out[1]; *p0 8c8c *pl; p0++, pl++) {
if (isalpha(*p0) && isalpha(*pl)) {
if (xbm[*p0-'A']&xbm[*pl-'A']) {
cx = '*';
tun+ +;
else if (!dna 8c& day[*p0-'A'][*pl-'A'] > 0)
cx= .,
else
else
cx = ,
*px++ = cx;
*px++ _ '\n';
*Px = '\0';
cx = ,
Page 6 of nwprint. c
-32-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/*
* strip path or prefix from pn, return len: pr align()
*%
static
stripname(pn)
stripname
char *pn; /* file name (may be path) */
register char *px, *py;
PY = ~:
for (px = pn; *px; px++)
if (*Px =_ ~/~)
py=px+1;
if (pY)
(void) strcpy(pn, py);
return(strlen(pn));
Page 7 of nwprint.c
-33-
CA 02353775 2001-06-04
WO 00137640 PCT/US99/30095
/*
* cleanupQ -- cleanup any tmp file
* getseqQ -- read in seq, set dna, len, maxlen
* g callocQ -- calloc() with error checkin
* readjmpsQ -- get the good jmps, from tmp file if necessary
* writejmpsQ -- write a filled array of jmps to a tmp file: nwQ
*/
llinclude "nw.h"
include < sys/file.h >
char *jname = "/tmp/homgXXXXXX"; /* tmp file for jmps */
FILE *fj;
int cleanupQ; /* cleanup tmp file */
long lseekQ;
/*
* remove any tmp file if we blow
*/
cleanup(i)
int i; cleanup
if (fj)
(void) unlink(jname);
exit(i);
/*
* read, return ptr to seq, set dna, (en, maxlen
* skip lines starting with '; , ' <', or ' > '
* seq in upper or lower case
*/
char
getseq(file, len) getseq
char *file; /* file name */
int *len; /* seq len */
{
char line[1024], *pseq;
register char *px, *py;
int natgc, tlen;
FILE *fp;
if ((fp = fopen(file, "r")) _ = 0) {
fprintf(stderr,"~s: can't read 96s\n", prog, file);
exit(1 );
tlen = natgc = 0;
while (fgets(Iine, 1024, fp)) {
if (*line =_ ';' ~ ~ *line =.- ' <' ~ ~ *line =- ' >')
continue;
for (px = line; *px ! _ '1n'; px++)
if (isupper(*px) ~ ! islower(*px))
tlen++;
{
if ((pseq = malloc((unsigned)(tlen+6))) _ = 0) {
fprintf(stderr,"~s: mallocQ failed to get 96d bytes for 96s\n", prog, tlen+6,
file);
exit(1);
Pseq[01 = P~q[11 = P~9[21 = P~If3] _ '\0';
Page 1 of nwsubr. c
-34-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PY = P~9 + 4; ...getseq
*len = tlen;
rewind(fp);
while (fgets(line, 1024, fp)) {
if (*line =_ ''' ~ ~ *line =_ '<' ~ ~ *Iine =_ '>')
continue;
for (px = line; *px !_ '\n'; px++) {
if (isupper(*px))
*PY + + _ *Px>
else if (islower(*px))
*py++ = toupper(*px);
if (index("ATGCU",*(py-1)))
natgc+ +;
*py++ _ '\0';
*PY = ~\0';
(void) fclose(fp);
dna = natgc > (tlen/3);
return(pseq+4);
char
g calloc(msg, nx, sz)
char *msg; /* program, calling routine */
int nx, sz; /* number and size of elements */
{
char *px, *callocQ;
if ((px = calloc((unsigned)nx, (unsigned)sz)) _ = 0) {
if (*msg) {
fprintf(stderr, "9bs: g callocQ failed ~s (n= ~d, sz= bbd)\n", prog, msg, nx,
sz);
exit(1);
reWrn(px);
/*
* get final jmps from dx~ or tmp file, set pp[], reset dmax: main()
*/
readjmpsQ readjmps
{
int fd = -1;
int siz, i0, il;
register i, j, xx;
if (tj) {
(void) fclose(fj);
if ((fd = open(jname, O RDONLY, 0)) < 0) {
fprintf(stderr, "9bs: can't openQ ~s\n", prog, jname);
cleanup( 1 );
for (i = i0 = il = 0, dmax0 = dmax, xx = len0; ; i++) {
while (1) {
for (j = dx[dmaxJ.ijmp; j > = 0 && dx[dmax].jp.x[jJ > = xx; j--)
Page 2 of nwsubr. c
-35-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
...readjmps
if (j < 0 &.& dx[dmax].offset && fj) {
(void) Iseek(fd, dx[dmax].offset, 0);
(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp));
(void) read(fd, (char *)&dx[dmax].offset, sizeof(dx[dmax].offset));
dx[dmax].ijmp = MAXJMP-1;
else
break;
if (i > = JMPS) {
fprintf(stderr, "~s: too many gaps in alignment\n", prog);
cleanup( 1);
ifs >=o){
siz = dx[dmax].jp.n(j];
xx = dx[dmax].jp.x[j];
dmax += siz;
if (siz < 0) { /* gap in second seq */
pp[1].n[il] _ -siz;
xx + = siz;
/*id=xx-yy+lenl-1
*/
pp[1].x[il] = xx - dmax + lent - 1;
gapy++;
ngapy -= siz;
/* ignore MAXGAP when doing endgaps */
siz = (-siz < MAXGAP ~ ~ endgaps)? -siz : MAXGAP;
il++;
else if (siz > 0) { /* gap in first seq */
pp[0].n[i0] = siz;
pp[0].x[i0J = xx;
gapx++;
ngapx + = siz;
/* ignore MAXGAP when doing endgaps */
siz = (siz < MAXGAP ~ ~ endgaps)? siz : MAXGAP;
i0++;
else
break;
/* reverse the order of jmps
*/
for (j = 0, i0--; j < i0: j++, i0--) {
i = PP[OI.nGJ; PP[OJ.n[j] = pp[OJ.n[iOJ; PP[0].n[i0J = i;
i = PP[0].xG]: PP[Ol.xLIJ = PP[OJ.x[i0]; PP[OJ.x[i0J = i;
for (j = 0, il--; j < il; j++, il--) {
i = pp[1].n[jl: pp[11.n(j] = PP[1].n[il]: PP[1].n[il] = i;
i = pp[1].x[j]: PP[ll.xLl1 = PP[ll.x[ilJ: PP[1].x[il] = i;
if (fd > = 0)
(void) close(fd);
if (fj) {
(void) unlink(jname);
1j = 0;
offset = 0;
Page 3 of nwsubr.c
-36-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
/*
* write a filled jmp struct offset of the prev one (if any): nwQ
*/
writejmps(ix) vVritejmps
int ix;
char *mktempQ;
if (!1j) {
if (mktemp(jname) < 0) {
fprintf(stderr, "9Pos: can't mktempQ ~s\n", prog, jname);
c(eannp(1);
if ((fj = fopenQname, "w")) _ = 0) {
fprintf(stderr, "°.bs: can't write 9bs\n", prog, jname);
exit(1);
(void) fwrite((char *)&dx[ix].jp, sizeof(struct jmp), 1, fj);
(void) fwrite((char *)&dx[ix].offset, sizeof(dx[ix].offset), 1, fj);
Page 4 of nwsubr. c
-37-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 2A
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
divided by 15 = 33.3
-38-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 2B
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
~ amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
divided by 10 = SOl
-39-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 2C
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
6 divided by 14 = 42.9%
-40-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 2D
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides)
Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
~ nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
4 divided by 12 = 33.3
-41-
CA 02353775 2001-06-04
WO 00/37640
PCT/US99/30095
"Percent (%) amino acid sequence identity" with respect to the PR0201, PR0292,
PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509, PR0853 and
PR0882 polypepdde
sequences identified herein is defined as the percentage of amino acid
residues in a candidate sequence that are
identical with the amino acid residues in a PR0201, PR0292, PR0327, PROI 265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1 O 17, PRO 1112, PR0509, PR0853 or PR0882 sequence, after
al igning the sequences and
introducing gaps, if necessary, to achieve the maximum percent sequence
identity, and not considering any
conservative substitutions as part of the sequence identity. Alignment for
purposes of determining percent amino
acid sequence identity can be achieved in various ways that are within the
skill in the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign
(DNASTAR) software.
Those skilled in the art can determine appropriate parameters for measuring
alignment, including any aIgorithrns
needed to achieve maximal alignment over the full-length of the sequences
being compared. For purposes herein,
however, % amino acid sequence identity values are obtained as described below
by using the sequence comparison
computer program ALIGN-2, wherein the complete source code for the ALIGN-2
program is provided in Table 1.
The ALIGN-2 sequence comparison computer program was authored by Genentech,
Inc., and the source code
shown in Table 1 has been filed with user documentation in the U.S. Copyright
Office, Washington D.C., 20559,
where it is registered under U.S. Copyright Registration No. TXU510087. The
ALIGN-2 program is publicly
available through Genentech, Inc., South San Francisco, California or may be
compiled from the source code
provided in Table 1. The ALIGN-2 program should be compiled for use on a UNIX
operating system, preferably
digital UNIX V4.OD. All sequence comparison parameters are set by the ALIGN-2
program and do not vary.
For purposes herein, the % amino acid sequence identity of a given amino acid
sequence A to, with, or
against a given amino acid sequence B (which can alternatively be phrased as a
given amino acid sequence A that
has or comprises a certain % amino acid sequence identity to, with, or against
a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
ALIGN-2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues in B.
It will be appreciated that where the length of amino acid sequence A is not
equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of B
to A. As examples of % amino acid sequence identity calculations, Tables 2A-2B
demonstrate how to calculate
the % amino acid sequence identity of the amino acid sequence designated
"Comparison Protein" to the amino acid
sequence designated "PRO".
Unless specifically stated otherwise, all % amino acid sequence identity
values used herein are obtained
as described above using the ALIGN-2 sequence comparison computer program.
However, % amino acid sequence
identity may also be determined using the sequence comparison program NCBI-
BLAST2 (Altschul et al., Nucleic
Acids Res., 25:3389-3402 ( 1997)). The NCBI-BLAST2 sequence comparison program
may be downloaded from
http:/lwww.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters,
wherein all of those search
-42-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
parameters are set to default values including, for example, unmask = yes,
strand = all, expected occurrences = 10,
minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for
multi-pass = 25, dropoff for final
gapped alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence
comparisons, the % amino acid
sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B (which can
alternatively be phrased as a given amino acid sequence A that has or
comprises a certain % amino acid sequence
identity to, with, or against a given amino acid sequence B) is calculated as
follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues
in B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of B
to A.
In addition, % amino acid sequence identity may also be determined using the
WU-BLAST-2 computer
program (Altschul et al., Methods in Enzymologv, 266:460-480 (1996)). Most of
the WU-BLAST-2 search
parameters are set to the default values. Those not set to default values,
i.e., the adjustable parameters, are set with
the following values: overlap span = 1, overlap fraction = 0.125, word
threshold (T) = 11, and scoring matrix =
BLOSUM62. For purposes herein, a % amino acid sequence identity value is
determined by dividing (a) the
number of matching identical amino acids residues between the amino acid
sequence of the PRO polypeptide of
interest having a sequence derived from the native PRO polypeptide and the
comparison amino acid sequence of
interest (i.e., the sequence against which the PRO polypeptide of interest is
being compared which may be a PRO
variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of
amino acid residues of the PRO
polypeptide of interest. For example, in the statement "a polypeptide
comprising an amino acid sequence A which
has or having at least 80% amino acid sequence identity to the amino acid
sequence B", the amino acid sequence
A is the comparison amino acid sequence of interest and the amino acid
sequence B is the amino acid sequence of
the PRO polypeptide of interest.
"PR0201 variant polypeptide", "PR0292 variant polypeptide", "PR0327 variant
polypeptide", "PRO 1265
variant polypeptide", "PR0344 variant polypeptide", "PR0343 variant
polypeptide", "PR0347 variant
polypeptide", "PR0357 variant polypeptide", "PR0715 variant polypeptide",
"PR01017 variant polypeptide",
"PRO1 I 12 variant polypeptide", "PR0509 variant polypeptide", "PR0853 variant
polypeptide" and "PR0882
variant polypeptide" or "PR0201 variant nucleic acid sequence", "PR0292
variant nucleic acid sequence",
"PR0327 variant nucleic acid sequence", "PR01265 variant nucleic acid
sequence", "PR0344 variant nucleic acid
sequence", "PR0343 variant nucleic acid sequence", "PR0347 variant nucleic
acid sequence", "PR0357 variant
nucleic acid sequence", "PR071 S variant nucleic acid sequence", "PRO 1017
variant nucleic acid sequence",
"PR01112 variant nucleic acid sequence", "PR0509 variant nucleic acid
sequence", "PR0853 variant nucleic acid
sequence" and "PR0882 variant nucleic acid sequence" means a nucleic acid
molecule which encodes an active
-43-
CA 02353775 2001-06-04
WO 00/37640 PC'T/US99/30095
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PROI 112,
PR0509, PR0853 and PR0882 polypeptide as defined below and which has at least
about 80% nucleic acid
sequence identity with a nucleotide acid sequence encoding a full-length
native sequence PR0201, PR0292,
PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO I 112,
PR0509, PR0853 and
PR0882 polypeptide sequence as disclosed herein, a full-length native sequence
PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 11 I 2,
PR0509, PR0853 and PR0882
polypeptide sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a PR0201, PR0292,
PR0327,1?R01265, PR0344, PR0343, PR0347, PR0357, PR071 S, PRO 1017, PRO 1112,
PR0509, PR0853 and
PR0882 polypeptide, with or without the signal peptide, as disclosed herein or
any other fragment of a full-length
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PRO 1 I 12,
PR0509, PR0853 and PR0882 polypeptide sequence as disclosed herein.
Ordinarily, a PR0201, PR0292,
PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112,
PR0509, PR0853 and
PR0882 variant polynucleotide will have at least about 80% nucleic acid
sequence identity, more preferably at least
about 81 % nucleic acid sequence identity, more preferably at least about 82%
nucleic acid sequence identity, more
preferably at least about 83% nucleic acid sequence identity, more preferably
at least about 84% nucleic acid
sequence identity, more preferably at least about 85% nucleic acid sequence
identity, more preferably at least about
86% nucleic acid sequence identity, more preferably at least about 87% nucleic
acid sequence identity, more
preferably at least about 88% nucleic acid sequence identity, more preferably
at least about 89% nucleic acid
sequence identity, more preferably at least about 90°!o nucleic acid
sequence identity, more preferably at least about
91 % nucleic acid sequence identity, more preferably at least about 92%
nucleic acid sequence identity, more
preferably at least about 93% nucleic acid sequence identity, more preferably
at least about 94% nucleic acid
sequence identity, more preferably at least about 95% nucleic acid sequence
identity, more preferably at least about
96% nucleic acid sequence identity, more preferably at least about 97% nucleic
acid sequence identity, more
preferably at least about 98% nucleic acid sequence identity and yet more
preferably at least about 99% nucleic acid
sequence identity with the nucleic acid sequence encoding a full-length native
sequence PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO I O 17, PRO I I
12, PR0509, PR0853 and
PR0882 polypeptide sequence as disclosed herein, a full-length native sequence
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 11 I2, PR0509,
PR0853 and PR0882
polypeptide sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a PR0201, PR0292,
PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112,
PR0509, PR0853 and
PR0882 polypeptide, with or without the signal sequence, as disclosed herein
or any other fragment of a ful l-length
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 and PR0882 polypeptide sequence as disclosed herein. Variants
do not encompass the native
nucleotide sequence.
Ordinarily, PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715,
PR01017, PR01112, PR0509, PR0853 and PR0882 variant polynucleotides are at
least about 30 nucleotides in
length, often at least about 60 nucleotides in length, more often at least
about 90 nucleotides in length, more often
at least about 120 nucleotides in length, more often at least about 150
nucleotides in length, more often at least about
-44-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
180 nucleotides in length, more often at least about 210 nucleotides in
length, more often at least about 240
nucleotides in length, more often at least about 270 nucleotides in length,
more often at least about 300 nucleotides
in length, more often at least about 450 nucleotides in length, more often at
least about 600 nucleotides in length,
more often at least about 900 nucleotides in length, or more.
"Percent (%) nucleic acid sequence identity" with respect to the PR0201,
PR0292, PR0327, PRO 1265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO / 017, PR41112, PR0509, PR0853and
PR0882 polypeptide-
encoding nucleic acid sequences identified herein is defined as the percentage
of nucleotides in a candidate
sequence that are identical with the nucleotides in a PR0201, PR0292, PR0327,
PRO/ 265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide-
encoding nucleic
acid sequence, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent
sequence identity. Alignment for purposes of determining percent nucleic acid
sequence identity can be achieved
in various ways that are within the skill in the art, for instance, using
publicly available computer software such as
BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Those skilled
in the art can determine
appropriate parameters for measuring alignment, including any algorithms
needed to achieve maximal alignment
over the full-length of the sequences being compared. For purposes herein,
however, % nucleic acid sequence
identity values are obtained as described below by using the sequence
comparison computer program ALIGN-2,
wherein the complete source code for the ALIGN-2 program is provided in Table
1. The ALIGN-2 sequence
comparison computer program was authored by Genentech, Inc., and the source
code shown in Table I has been
filed with user documentation in the U.S. Copyright Office, Washington D.C.,
20559, where it is registered under
U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly
available through Genentech,
Inc., South San Francisco, California or may be compiled from the source code
provided in Table 1. The ALIGN-2
program should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.OD. All sequence
comparison parameters are set by the ALIGN-2 program and do not vary.
For purposes herein, the % nucleic acid sequence identity of a given nucleic
acid sequence C to, with, or
against a given nucleic acid sequence D (which can alternatively be phrased as
a given nucleic acid sequence C that
has or comprises a certain %a nucleic acid sequence identity to, with, or
against a given nucleic acid sequence D)
is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program ALIGN-2
in that program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated
that where the length of nucleic acid sequence C is not equal to the length of
nucleic acid sequence D, the % nucleic
acid sequence identity of C to D will not equal the % nucleic acid sequence
identity of D to C. As examples of %
nucleic acid sequence identity calculations, Tables 2C-2D demonstrate how to
calculate the % nucleic acid sequence
identity of the nucleic acid sequence designated "Comparison DNA" to the
nucleic acid sequence designated "PRO
DNA".
Unless specifically stated otherwise, all % nucleic acid sequence identity
values used herein are obtained
-45-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
as described above using the ALIGN-2 sequence comparison computer program.
However, % nucleic acid
sequence identity may also be determined using the sequence comparison program
NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res., 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison
program may be
downloaded from http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search
parameters, wherein all of
those search parameters are set to default values including, for example,
unmask = yes, strand = all, expected
occurrences =10, minimum low complexity length =15/5, multi-pass e-value =
0.01, constant for multi-pass = 25,
dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for sequence comparisons, the %
nucleic acid sequence
identity of a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can
alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid sequence
identity to, with, or against a given nucleic acid sequence D) is calculated
as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program NCBI-
BLAST2 in that program's alignment of C and D, and where Z is the total number
of nucleotides in D. It will be
appreciated that where the length of nucleic acid sequence C is not equal to
the length of nucleic acid sequence D,
the % nucleic acid sequence identity of C to D will not equal the % nucleic
acid sequence identity of D to C.
In addition, % nucleic acid sequence identity values may also be generated
using the WU-BLAST-2
computer program (Altschul et al., Methods in Enzvmology, 266:460-480 (
1996)). Most of the WU-BLAST-2
search parameters are set to the default values. Those not set to default
values, i.e., the adjustable parameters, are
set with the following values: overlap span = I, overlap fraction = 0.125,
word threshold (T7 = 11, and scoring
matrix =BLOSUM62. For purposes herein, a % nucleic acid sequence identity
value is determined by dividing (a)
the number of matching identical nucleotides between the nucleic acid sequence
of the PRO polypeptide-encoding
nucleic acid molecule of interest having a sequence derived from the native
sequence PRO polypeptide-encoding
nucleic acid and the comparison nucleic acid molecule of interest (i.e., the
sequence against which the PRO
polypeptide-encoding nucleic acid molecule of interest is being compared which
may be a variant PRO
polynucleotide) as determined by WU-BLAST-2 by (b) the total number of
nucleotides of the PRO polypeptide-
encoding nucleic acid molecule of interest. For example, in the statement "an
isolated nucleic acid molecule
comprising a nucleic acid sequence A which has or having at least 80% nucleic
acid sequence identity to the nucleic
acid sequence B", the nucleic acid sequence A is the comparison nucleic acid
molecule of interest and the nucleic
acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding
nucleic acid molecule of interest.
In other embodiments, PR0201, PR0292, PR0327, PRO1265, PR0344, PR0343, PR0347,
PR0357,
PR071 S, PRO 1 Ol 7, PRO 1112, PR0509, PR0853 and PR0882 variant
polynucleotides are nucleic acid molecules
that encode an active PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide and which are capable
of hybridizing, preferably
under stringent hybridization and wash conditions, to nucleotide sequences
encoding the full-length PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
-46-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0853 or PR0882 polypeptide shown in Figure 2 (SEQ ID N0:2), Figure 4 (SEQ ID
N0:6), Figure 6 (SEQ ID
N0:8), Figure 8 (SEQ ID N0:13), Figure 10 (SEQ ID N0:15}, Figure 12 (SEQ ID
N0:23), Figure 14 (SEQ ID
N0:28}, Figure 16 (SEQ ID N0:33), Figure I 8 (SEQ ID N0:40), Figure 20 (SEQ ID
N0:42), Figure 22 (SEQ ID
N0:44), Figure 24 (SEQ ID N0:46), Figure 26 (SEQ ID N0:48), or Figure 28 (SEQ
ID N0:53), respectively.
PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347; PR0357, PR0715, PROI
017, PRO 1112,
PR0509, PR0853 or PR0882 variant polypeptides may be those that are encoded by
a PR0201, PR0292,
PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112,
PR0509, PR0853 or
PR0882 variant polynucleotide.
The term "positives", in the context of the amino acid sequence identity
comparisons performed as
described above, includes amino acid residues in the sequences compared that
are not only identical, but also those
that have similar properties. Amino acid residues that score a positive value
to an amino acid residue of interest
are those that are either identical to the amino acid residue of interest or
are a preferred substitution (as defined in
Table 3 below) of the amino acid residue of interest.
For purposes herein, the % value of positives of a given amino acid sequence A
to, with, or against a given
amino acid sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises
a certain % positives to, with, or against a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scoring a positive value as
defined above by the sequence alignment
program ALIGN-2 in that program's alignment of A and B, and where Y is the
total number of amino acid residues
in B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino acid
sequence B, the % positives of A to B will not equal the % positives of B to
A.
"Isolated," when used to describe the various polypeptides disclosed herein,
means polypeptide that has
been identified and separated and/or recovered from a component of its natural
environment. Preferably, the
isolated polypeptide is free of association with all components with which it
is naturally associated. Contaminant
components of its natural environment are materials that would typically
interfere with diagnostic or therapeutic
uses for the polypeptide, and may include enzymes, hormones, and other
proteinaceous or non-proteinaceous
solutes. In preferred embodiments, the polypeptide will be purified (1 ) to a
degree sufficient to obtain at least 15
residues of N-terminal or internal amino acid sequence by use of a spinning
cup sequenator, or (2) to homogeneity
by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or,
preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within recombinant cells,
since at least one component of the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 natural environment will not be present. Ordinarily,
however, isolated polypeptide
will be prepared by at least one purification step.
An "isolated" nucleic acid molecule encoding a PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide or an
"isolated" nucleic acid encoding an anti-PR0201, anti-PR0292, anti-PR0327,
anti-PRO 1265, anti-PR0344, anti-
-47-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-PROIOl7, anti-PR01112,
anti-PR0509, anti-PR0853
or anti-PR0882 antibody, is a nucleic acid molecule that is identified and
separated from at least one contaminant
nucleic acid molecule with which it is ordinarily associated in the natural
source of the PR0201-, PR0292-,
PR0327-, PR01265-, PR0344-, PR0343-, PR0347-, PR0357-, PR0715-, PR01017-, PROI
I 12-, PR0509-,
PR0853- or PR0882-encoding nucleic acid or the anti-PR0201-, anti-PR0292-,
anti-PR0327-, anti-PR01265-,
anti-PR0344-, and-PR0343-, anti-PR0347-, anti-PR0357-, anti-PR0715-, anti-PROI
017-, anti-PRO 1112-, anti-
PR0509-,anti- PR0853- or anti-PR0882-encoding nucleic acid. Preferably, the
isolated nucleic acid is free of
association with all components with which it is naturally associated. An
isolated PR0201-, PR0292-, PR0327-,
PR01265-, PR0344-, PR0343-, PR0347-, PR0357-, PR0715-, PR01017-, PROI 112-,
PR0509-, PR0853- or
PR0882-encoding nucleic acid molecule or an anti-PR0201-, anti-PR0292-, anti-
PR0327-, anti-PR01265-, anti-
PR0344-, anti-PR0343-, anti-PR0347-, anti-PR0357-, anti-PR0715-, anti-PR01017-
, anti-PR01112-, anti-
PR0509-, anti-PR0853- or anti-PR0882-encoding nucleic acid molecule is other
than in the form or setting in
which it is found in nature. Isolated nucleic acid molecules therefore are
distinguished from the PR0201-,
PR0292-, PR0327-, PR01265-, PR0344-, PR0343-, PR0347-, PR0357-, PR0715-,
PR01017-, PR01112-,
PR0509-, PR0853- or PR0882-encoding nucleic acid molecule or the anti-PR0201-,
anti-PR0292-, anti-PR0327-,
anti-PR01265-, anti-PR0344-, anti-PR0343-, anti-PR0347-, anti-PR0357-, anti-
PR0715-, anti-PR01017-, anti-
PR01112-, anti-PR0509-, anti-PR0853- or anti-PR0882-encoding nucleic acid
molecule as it exists in natural
cells. However, an isolated nucleic acid molecule encoding a PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide or an anti
PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357,
anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-
PR0882 antibody includes
PR0201-, PR0292-, PR0327-, PR01265-, PR0344-, PR0343-, PR0347-, PR0357-,
PR0715-, PR01017-,
PR01112-, PR0509-, PR0853- or PR0882-nucleic acid molecules and anti-PR0201-,
anti-PR0292-, anti
PR0327-, anti-PR01265-, anti-PR0344-, anti-PR0343-, anti-PR0347-, anti-PR0357-
, anti-PR0715-, anti
PR01017-, anti-PR01112-, anti-PR0509-, anti-PR0853- or anti-PR0882-encoding
nucleic acid molecules
contained in cells that ordinarily express PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or PR0882 polypeptides or
express anti-PR0201, anti-
PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-
PR0357, anti-PR0715,
anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-PR0882 antibodies
where, for example, the
nucleic acid molecule is in a chromosomal location different from that of
natural cells.
The term "control sequences" refers to DNA sequences necessary for the
expression of an operably linked
coding sequence in a particular host organism. The control sequences that are
suitable for prokaryotes, for example,
include a promoter, optionally an operator sequence, and a ribosome binding
site. Eukaryotic cells are known to
utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic acid
sequence. For example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide
if it is expressed as a preprotein that participates in the secretion of the
polypeptide; a promoter or enhancer is
operably linked to a coding sequence if it affects the transcription of the
sequence; or a ribosome binding site is
-48-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
operably linked to a coding sequence if it is positioned so as to facilitate
translation. Generally, "operably linked"
means that the DNA sequences being linked are contiguous, and, in the case of
a secretory leader, contiguous and
in reading phase. However, enhancers do not have to be contiguous. Linking is
accomplished by ligation at
convenient restriction sites. If such sites do not exist, the synthetic
oligonucleotide adaptors or linkers are used in
accordance with conventional practice.
The term "antibody" is used in the broadest sense and specifically covers, for
example, single anti-
PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357,
anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-
PR0882 monoclonal antibodies
(including antagonist, and neutralizing antibodies),anti-PR0201, anti-PR0292,
anti-PR0327, anti-PRO 1265, anti-
PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-PR01017, anti-
PR01112, anti-PR0509,
anti-PR0853 or anti-PR0882 antibody compositions with polyepitopic
specificity, single chain anti-PR0201, anti-
PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-
PR0357, anti-PR0715,
anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-PR0882
antibodies, and fragments of anti-
PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357,
anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853 or anti-
PR0882 antibodies (see below).
The term "monoclonal antibody" as used herein refers to an antibody obtained
from a population of substantially
homogeneous antibodies, i.e., the individual antibodies comprising the
population are identical except for possible
naturally-occurring mutations that may be present in minor amounts.
"Stringency" of hybridization reactions is readily determinable by one of
ordinary skill in the art, and
generally is an empirical calculation dependent upon probe length, washing
temperature, and salt concentration.
In general, longer probes require higher temperatures for proper annealing,
while shorter probes need lower
temperatures. Hybridization generally depends on the ability of denatured DNA
to reanneal when complementary
strands are present in an environment below their melting temperature. The
higher the degree of desired homology
between the probe and hybridizable sequence, the higher the relative
temperature which can be used. As a result,
it follows that higher relative temperatures would tend to make the reaction
conditions more stringent, while lower
temperatures less so. For additional details and explanation of stringency of
hybridization reactions, see Ausubel
et al., Current Protocols in Molecular BioloQV; Wiley Interscience Publishers,
(1995).
"Stringent conditions" or "high stringency conditions", as defined herein, may
be identified by those that:
(1 ) employ low ionic strength and high temperature for washing, for example
0.015 M sodium chloride/0.0015 M
sodium citrate/0.1 % sodium dodecyl sulfate at 50°C; (2) employ during
hybridization a denaturing agent, such as
formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum
albumin/0.1 % Ficoll/0.1 %
polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium
chloride, 75 mM sodium
citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCI,
0.075 M sodium citrate), 50 mM sodium
phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution,
sonicated salmon sperm DNA (50
~cg/ml), 0.1 % SDS, and 10% dextran sulfate at 42°C, with washes at
42"C in 0.2 x SSC (sodium chloride/sodium
citrate) and 50% formamide at 55°C, followed by a high-stringency wash
consisting of 0.1 x SSC containing EDTA
at 55°C.
"Moderately stringent conditions" may be identified as described by Sambrook
et al., Molecular Cloning:
-49-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
A Laborator~Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and
hybridization conditions (e.g., temperature, ionic strength and % SDS) less
stringent than those described above.
An example of moderately stringent conditions is overnight incubation at 37"C
in a solution comprising: 20°!0
formamide, 5 x SSC ( 150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium
phosphate (pH 7.6), 5 x Denhardt's
solution,10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters
in 1 x SSC at about 35°C-50"C. The skilled artisan will recognize how
to adjust the temperature, ionic strength,
etc. as necessary to accommodate factors such as probe length and the like.
The term "epitope tagged" when used herein refers to a chimeric polypeptide
comprising a PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343., PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide fused to a "tag polypeptide". The tag polypeptide
has enough residues to provide
an epitope against which an antibody can be made, yet is short enough such
that it does not interfere with activity
of the polypeptide to which it is fused. The tag polypeptide preferably also
is fairly unique so that the antibody does
not substantially cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino acid
residues and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid
residues).
"Active" or "activity" for the purposes herein refers to forms) of PR0201,
PR0292, PR0327, PROI 265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO I 017, PR01112, PR0509, PR0853 or
PR0882 polypeptides
which retain a biological and/or an immunological activity/property of a
native or naturally-occurring PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PROI 017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide, wherein "biological" activity refers to a
function (either inhibitory or stimulatory)
caused by a native or naturally-occurring PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PROI 017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide other
than the ability to induce
the production of an antibody against an antigenic epitope possessed by a a
native or naturally-occurring PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide and an "immunological" activity refers to the
ability to induce the production of
an antibody against an antigenic epitope possessed by a native or naturally-
occurring PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112, PR0509,
PR0853 or PR0882
polypeptide.
"Biological activity" in the context of an antibody or another antagonist
molecule that can be identified
by the screening assays disclosed herein (e.g., an organic or inorganic small
molecule, peptide, etc.) is used to refer
to the ability of such molecules to bind or complex with the polypeptides
encoded by the amplified genes identified
herein, or otherwise interfere with the interaction of the encoded
polypeptides with other cellular proteins or
otherwise interfere with the transcription or translation of a PR0201, PR0292,
PR0327, PRO 1265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 t I 2, PR0509, PR0853 or PR0882
polypeptide. A
preferred biological activity is growth inhibition of a target tumor cell.
Another preferred biological activity is
cytotoxic activity resulting in the death of the target tumor cell.
The term "biological activity" in the context of a PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide means
-50-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
the ability of a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR071 S, PRO 1 O 17,
PRO 1112, PR0509, PR08S3 or PR0882 polypeptide to induce neoplastic cell
growth or uncontrolled cell growth.
The phrase "immunological activity" means immunological cross-reactivity with
at least one epitope of
a PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR071 S,
PRO 1 O 17, PRO 1112,
PROS09, PR0853 or PR0882 polypeptide.
"Immunological cross-reactivity" as used herein means that the candidate
polypeptide is capable of
competitively inhibiting the Qualitative biological activity of a PR0201,
PR0292, PR0327, PR0126S, PR0344,
PR0343, PR0347, PR03S7, PR071 S, PRO 1017, PR01112, PR0509, PR0853 or PR0882
polypeptide having
this activity with polyclonal antisera raised against the known active PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR03S7, PR071 S, PRO 1017, PRO 1112, PROS09, PR0853 or
PR0882 polypeptide.
Such antisera are prepared in conventional fashion by injecting goats or
rabbits, for example, subcutaneously with
the known active analogue in complete Freund's adjuvant, followed by booster
intraperitoneal or subcutaneous
injection in incomplete Freunds. The immunological cross-reactivity preferably
is "specific", which means that the
binding affinity of the immunologically cross-reactive molecule (e.g.,
antibody) identified, to the corresponding
PR0201, PR0292, PR0327, PR0126S, PR0344, PR0343, PR0347, PR0357, PR071S,
PR01017, PR01112,
PR0509, PR0853 or PR0882 polypeptide is significantly higher (preferably at
least about 2-times, more preferably
at least about 4-times, even more preferably at least about 8-times, most
preferably at least about 10-tirt~s higher)
than the binding affinity of that molecule to any other known native
polypeptide.
The term "antagonist" is used in the broadest sense, and includes any molecule
that partially or fully blocks,
inhibits, or neutralizes a biological activity of a native PR0201, PR0292,
PR0327, PR0126S, PR0344, PR0343,
PR0347, PR03S7, PR071 S, PR01017, PR01112, PROS09, PR0853 or PR0882
polypeptide disclosed herein
or the transcription or translation thereof. Suitable antagonist molecules
specifically include antagonist antibodies
or antibody fragments, fragments, peptides, small organic molecules, anti-
sense nucleic acids, etc. Included are
methods for identifying antagonists of a PR0201, PR0292, PR0327, PR0126S,
PR0344, PR0343, PR0347,
PR03S7, PR071 S, PR01017, PR01112, PROS09, PR08S3 or PR0882 polypeptide with a
candidate antagonist
molecule and measuring a detectable change in one or more biological
activities normally associated with the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR03S7, PR0715,
PR01017, PROI 112,
PR0509, PR08S3 or PR0882 polypeptide.
A "small molecule" is defined herein to have a molecular weight below about
S00 Daltons.
"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the
same structural
characteristics. While antibodies exhibit binding specificity to a specific
antigen, immunoglobulins include both
antibodies and other antibody-like molecules which lack antigen specificity.
Polypeptides of the latter kind are, for
example, produced at low levels by the lymph system and at increased levels by
myelomas. The term "antibody"
is used in the broadest sense and specifically covers, without limitation,
intact monoclonal antibodies, polyclonal
antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from
at least two intact antibodies, and
antibody fragments so long as they exhibit the desired biological activity.
"Native antibodies" and "native immunoglobulins" are usually heterotetrameric
glycoproteins of about
150,000 daltons, composed of two identical light (L) chains and two identical
heavy (H) chains. Each light chain
-S 1-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
is linked to a heavy chain by one covalent disulfide bond, while the number of
disulfide linkages varies among the
heavy chains of different immunoglobulin isotypes. Each heavy and light chain
also has regularly spaced intrachain
disulfide bridges. Each heavy chain has at one end a variable domain (V")
followed by a number of constant
domains. Each light chain has a variable domain at one end (V,,) and a
constant domain at its other end; the constant
domain of the light chain is aligned with the first constant domain of the
heavy chain, and the light-chain variable
domain is aligned with the variable domain of the heavy chain. Particular
amino acid residues are believed to form
an interface between the sight- and heavy-chain variable domains.
The term "variable" refers to the fact that certain portions of the variable
domains differ extensively in
sequence among antibodies and are used in the binding and specificity of each
particular antibody for its particular
antigen. However, the variability is not evenly distributed throughout the
variable domains of antibodies. It is
concentrated in three segments called complementarity-determining regions
(CDRs) or hypervariable regions both
in the light-chain and the heavy-chain variable domains. The more highly
conserved portions of variable domains
are called the framework (FR) regions. The variable domains of native heavy
and light chains each comprise four
FR regions, largely adopting a (3-sheet configuration, connected by three
CDRs, which form loops connecting, and
in some cases forming part of, the ~3-sheet structure. The CDRs in each chain
are held together in close proximity
by the FR regions and, with the CDRs from the other chain, contribute to the
formation of the antigen-binding site
of antibodies (see Kabat et al., NIH Publ. No.91-3242, Vol. I, pages 647-669 (
1991 )). The constant domains are
not involved directly in binding an antibody to an antigen, but exhibit
various effector functions, such as
participation of the antibody in antibody-dependent cellular toxicity.
The term "hypervariable region" when used herein refers to the amino acid
residues of an antibody which
are responsible for antigen-binding. The hypervariable region comprises amino
acid residues from a
"complementarily determining region" or "CDR" (i.e., residues 24-34 (L1 ), 50-
56 (L2) and 89-97 (L3) in the light
chain variable domain and 31-35 (H 1 ), 50-65 (H2) and 95-102 (H3) in the
heavy chain variable domain; Kabat et
al., Seauences of Proteins of Immunological Interest, 5th Ed. Public Health
Service, National Institute of Health,
Bethesda, MD. [ 1991 ]) and/or those residues from a "hypervariable loop"
(i.e., residues 26-32 (Ll ), 50-52 (L2) and
91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55 (H2) and
96-101 (H3) in the heavy chain
variable domain ; Clothia and Lesk, J. Mol. Biol.; 196:901-917 [ 1987]).
"Framework" or "FR" residues are those
variable domain residues other than the hypervariable region residues as
herein defined.
"Antibody fragments" comprise a portion of an intact antibody, preferably the
antigen binding or variable
region of the intact antibody. Examples of antibody fragments include Fab,
Fab', F(ab'),, and Fv fragments;
diabodies; linearantibodies (Zapata etal., Protein Eng. , 8( 10):1057-1062 [
1995]}; single-chain antibody molecules;
and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antigen-binding
fragments, called "Fab" fragments,
each with a single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize
readily. Pepsin treatment yields an F(ab'), fragment that has two antigen-
combining sites and is still capable of
cross-linking antigen.
"Fv" is the minimum antibody fr aQment which contains a complete antigen-
recognition and -binding site.
This region consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association.
-52-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
It is in this configuration that the three CDRs of each variable domain
interact to define an antigen-binding site on
the surface of the V"-V~ dimer. Collectively, the six CDRs confer antigen-
binding specificity to the antibody.
However, even a single variable domain (or half of an Fv comprising only three
CDRs specific for an antigen) has
the ability to recognize and bind antigen, although at a lower affinity than
the entire binding site.
The Fab fragment also contains the constant domain of the light chain and the
first constant domain (CH 1 )
of the heavy chain. Fab fragments differ from Fab' fragments by the addition
of a few residues at the carboxy
terminus of the heavy chain CH 1 domain including one or more cysteines from
the antibody hinge region. Fab'-SH
is the designation herein for Fab' in which the cysteine residues) of the
constant domains bear a free thiol group.
F(ab'), antibody fragments originally were produced as pairs of Fab' fragments
which have hinge cysteines between
them. Other chemical couplings of antibody fragments are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species
can be assigned to one
of two clearly distinct types, called kappa (x) and lambda (~,), based on the
amino acid sequences of their constant
domains.
Depending on the amino acid sequence of the constant domain of their heavy
chains, immunoglobulins
I S can be assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and IgM,
and several of these may be further divided into subclasses (isotypes), e.g.,
IgG 1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different classes of
immunoglobulins are called a, b, e,
y, and ~,, respectively. The subunit structures and three-dimensional
configurations of different classes of
immunoglobulins are well known.
The term "monoclonal antibody" as used herein refers to an antibody obtained
from a population of
substantially homogeneous antibodies, i.e., the individual antibodies
comprising the population are identical except
for possible naturally occurring mutations that may be present in minor
amounts. Monoclonal antibodies are highly
specific, being directed against a single antigenic site. Furthermore, in
contrast to conventional (polyclonal)
antibody preparations which typically include different antibodies directed
against differentdeterminants (epitopes),
each monoclonal antibody is directed against a single determinant on the
antigen. In addition to their specificity,
the monoclonal antibodies are advantageous in that they are synthesized by the
hybridoma culture, uncontaminated
by other immunoglobulins. The modifier "monoclonal" indicates the character of
the antibody as being obtained
from a substantially homogeneous population of antibodies, and is not to be
construed as requiring production of
the antibody by any particular method. For example, the monoclonal antibodies
to be used in accordance with the
present invention may be made by the hybridoma method first described by
Kohler et al., Nature, 256:495 [ 1975],
or may be made by recombinant DNA methods (see, e.g., U.S. Patent No.
4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the techniques
described in Clackson et al., Nature,
352:624-628 ( 1991 ] and Marks et al., J. Mol. Biol., 222:581-597 ( 1991 ),
for example.
The monoclonal antibodies herein specifically include "chimeric" antibodies
(immunoglobulins) in which
a portion of the heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies
derived from a particular species or belonging to a particular antibody class
or subclass, while the remainder of the
chains) is identical with or homologous to corresponding sequences in
antibodies derived from another species or
belonging to another antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the
-53-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
desired biological activity (U.S. Patent No. 4,816,567; Morrison et al., Proc.
Natl. Acad. Sci. USA, 81:6851-6855
[ 1984]).
"Humanized" forms of non-human (e.g., murine) antibodies are chimeric
immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or
other antigen-binding subsequences
of antibodies) which contain minimal sequence derived from non-human
immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody) in which
residues from a CDR of the
recipient are replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit
having the .desired specificity, affinity, and capacity. In some instances, Fv
FR residues of the human
immunoglobulin are replaced by corresponding non-human residues. Furthermore,
humanized antibodies may
comprise residues which are found neither in the recipient antibody nor in the
imported CDR or framework
sequences. These modifications are made to further refine and maximize
antibody performance. In general, the
humanized antibody will comprise substantially all of at least one, and
typically two, variable domains, in which
all or substantially all of the CDR regions correspond to those of a non-human
immunoglobulin and all or
substantially all of the FR regions are those of a human immunoglobulin
sequence. The humanized antibody
optimally also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human
immunoglobulin. For further details, see, Jones et al., Nature, 321:522-525
(1986); Reichmann et al., Nature,
332:323-329 (1988]; and Presta, Curr. On. Struct. Biol., 2:593-596 (1992). The
humanized antibody includes a
PRIMATIZED'~"' antibody wherein the antigen-binding region of the antibody is
derived from an antibodyproduced
by immunizing macaque monkeys with the antigen of interest.
"Single-chain Fv"or "sFv" antibody fragments comprise the VH and V~ domains of
antibody, wherein these
domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypepdde
linker between the V" and VL domains which enables the sFv to form the desired
structure for antigen binding. For
a review of sFv see Pluckthun in The Pharmacoloey of Monoclonal Antibodies,
vol. 113, Rosenburg and Moore
eds., Springer-Verlag, New York, pp. 269-315 ( 1994).
The term "diabodies" refers to small antibody fragments with two antigen-
binding sites, which fragments
comprise a heavy-chain variable domain (V") connected to a light-chain
variable domain (V~) in the same
polypeptide chain (VH - V~). By using a linker that is too short to allow
pairing between the two domains on the
same chain, the domains are forced to pair with the complementary domains of
another chain and create two
antigen-binding sites. Diabodies are described more fully in, for example, EP
404,097; WO 93/11161; and
Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
An "isolated" antibody is one which has been identified and separated and/or
recovered from a component
of its natural environment. Contaminant components of its natural environment
are materials which would interfere
with diagnostic or therapeutic uses for the antibody, and may include enzymes,
hormones, and other proteinaceous
or nonproteinaceous solutes. In preferred embodiments, the antibody will be
purified (1 ) to greater than 95% by
weight of antibody as determined by the Lowry method, and most preferably more
than 99% by weight, (2) to a
degree sufficient to obtain at least 15 residues of N-terminal or internal
amino acid sequence by use of a spinning
cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or
nonreducing conditions using Coomassie
blue or, preferably, silver stain. Isolated antibody includes the antibody in
situ within recombinant cells since at
-54-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
least one component of the antibody's natural environment will not be present.
Ordinarily, however, isolated
antibody will be prepared by at least one purification step.
The word "label" when used herein refers to a detectable compound or
composition which is conjugated
directly or indirectly to the antibody so as to generate a "labeled" antibody.
The label may be detectable by itself
(e.g., radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration
of a substrate compound or composition which is detectable. Radionuclides that
can serve as detectable labels
include, for example, I-131, I-123, I-125, Y-90, Re-188, Re-186, At-21 I, Cu-
67, Bi-212, and Pd-109. The label
may also be a non-detectable entity such as a toxin.
By "solid phase" is meant a non-aqueous matrix to which the antibody of the
present invention can adhere.
Examples of solid phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled
pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene,
polyvinyl alcohol and silicones. In
certain embodiments, depending on the context, the solid phase can comprise
the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography column). This
term also includes a discontinuous solid
phase of discrete particles, such as those described in U.S. Patent No.
4,275,149.
A "liposome" is a small vesicle composed of various types of lipids,
phospholipids and/orsurfactant which
is useful for delivery of a drug (such as a PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide or
antibody thereto and,
optionally, a chemotherapeutic agent) to a mammal. The components of the
liposome are commonly arranged in
a bilayer formation, similar to the lipid arrangement of biological membranes.
As used herein, the term "immunoadhesin" designates antibody-like molecules
which combine the binding
specificity of a heteroiogous protein (an "adhesin") with the effector
functions of immunoglobulin constant
domains. Structurally, the immunoadhesins comprise a fusion of an amino acid
sequence with the desired binding
specificity which is other than the antigen recognition and binding site of an
antibody (i.e., is "heterologous"), and
an immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a
contiguous amino acid sequence comprising at least the binding site of a
receptor or a ligand. The immunoglobulin
constant domain sequence in the immunoadhesin may be obtained from any
immunoglobulin, such as IgG-I , IgG-2,
IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
II. Compositions and Methods of the Invention
A. Full-leneth PR0201, PR0292. PR0327. PR01265, PR0344, PR0343, PR0347. PR0357
PR0715
1?R01017, PROI 112, PR0509, PR0853 and PR0882 oolyneptides
The present invention provides newly identitied and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PRO1 I 12, PR0509, PR0853 and PR0882. In particular,
cDNA encoding
PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO
1017, PRO 1112,
PR0509, PR0853 and PR0882 polypeptides has been identified and isolated, as
disclosed in further detail in the
Examples below. It is noted that proteins produced in separate expression
rounds may be given different PRO
numbers but the UNQ number is unique for any given DNA and the encoded
protein, and will not be changed.
-55-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99l30095
However, for sake of simplicity, in the present specification the proteins
encoded by the herein disclosed nucleic
acid sequences as well as all further native homologues and variants included
in the foregoing definition of
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PRO 1112,
PR0509, PR0853 and PR0882 will be referred to as "PR0201, PR0292, PR0327, PRO
1265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882",
regardless of their origin or
mode of preparation.
As disclosed in the Examples below, cDNA clones have been deposited with the
ATCC. The actual
nucleotide sequence of the clones can readily be determined by the skilled
artisan by sequencing of the deposited
clone using routine methods in the art. The predicted amino acid sequences can
be determined from the nucleotide
sequences using routine skill. For the PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptides and
encoding nucleic acid
described herein, Applicants have identified what are believed to be the
reading frames best identifiable with the
sequence information available at the time.
B. PR0201. PR0292. PR0327. PR01265. PR0344. PR0343, PR0347. PR0357. PR0715.
PR01017,
PR01112. PR0509. PR0853 and PR0882 Variants
In addition to the full-length native sequence PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PRO 1 I I 2, PR0509, PR0853 and PR0882
polypeptides described herein,
it is contemplated that PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 and PR0882 variants can be prepared. PR020I,
PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112, PR0509,
PR0853 and PR0882
variants can be prepared by introducing appropriate nucleotide changes into
the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PROlOI 7, PR01112, PR0509,
PR0853 or PR0882
DNA, and/or by synthesis of the desired PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide. Those
skilled in the art will
appreciate that amino acid changes may alter post-translational processes of
the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509,
PR0853 or PR0882,
such as changing the number or position of glycosylation sites or altering the
membrane anchoring characteristics.
Variations in the native full-length sequence PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 or in
various domains of the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 described herein, can be made, for example, using any
of the techniques and
guidelines for conservative and non-conservative mutations set forth, for
instance, in U.S. Patent No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or more codons
encoding the PR0201, PR0292,
PR0327, PROI 265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112,
PR0509, PR0853 or
PR0882 that results in a change in the amino acid sequence of the PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or
PR0882 as compared
with the native sequence PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343,
PR0347, PR0357, PR0715,
-56-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR01017, PROI 112, PR0509, PR0853 or PR0882. Optionally the variation is by
substitution of at least one
amino acid with any other amino acid in one or more of the domains of the
PR0201, PR0292, PR0327, PRO 1265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or
PR0882. Guidance
in determining which amino acid residue may be inserted, substituted or
deleted without adversely affecting the
desired activity may be found by comparing the sequence of the PR0201, PR0292,
PR0327, PROI 265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
with that of
homologous known protein molecules and minimizing the number of amino acid
sequence changes made in regions
of high homology. Amino acid substitutions can be the result of replacing one
amino acid with another amino acid
having similar structural andlor chemical properties, such as the replacement
of a leucine with a serine, i.e.,
conservative amino acid replacements. Insertions or deletions may optionally
be in the range of about 1 to 5 amino
acids. The variation allowed may be determined by systematically making
insertions, deletions or substitutions of
amino acids in the sequence and testing the resulting variants for activity
exhibited by the full-length or mature
native sequence.
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017,
PR01112, PR0509, PR0853 and PR0882 polypeptide fragments are provided herein.
Such fragments may be
truncated at the N-terminus or C-terminus, or may lack internal residues, for
example, when compared with a full-
length native protein. Certain fragments lack amino acid residues that are not
essential for a desired biological
activity of the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1017,
PR01112, PR0509, PR0853 or PR0882 polypeptide.
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017,
PRO1 I 12, PR0509, PR0853 or PR0882 fragments may be prepared by any of a
number of conventional
techniques. Desired peptide fragments may be chemically synthesized. An
alternative approach involves generating
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 fragments by enzymatic digestion, e.g., by treating
the protein with an enzyme known
to cleave proteins at sites defined by particular amino acid residues, or by
digesting the DNA with suitable
restriction enzymes and isolating the desired fragment. Yet another suitable
technique involves isolating and
amplifying a DNA fragment encoding a desired polypeptide fragment, by
polymerase chain reaction (PCR).
Oligonucleotides that define the desired termini of the DNA fragment are
employed at the 5' and 3' primers in the
PCR. Preferably, PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PROI 112, PR0509, PR0853 or PR0882 polypeptide fragments share at
least one biological and/or
immunological activity with the native PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PROI 1 I 2, PR0509, PR0853 or PR0882 polypeptide.
In particular embodiments, conservative substitutions of interest are shown in
Table 3 under the heading
of preferred substitutions. If such substitutions result in a change in
biological activity, then more substantial
changes, denominated exemplary substitutions in Table 3, or as further
described below in reference to amino acid
classes, are introduced and the products screened.
-57-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 3
OriginalExemplary Preferred
Residue Substitutions Substitutions
Ala (A) vat; leu; ile val
Arg (R) lys; gln; asn lys
Asn (N) gln; his; lys; arg gln
Asp (D) glu glu
Cys (C} ser ser
Gln (Q) asn asn
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn; gln; lys; arg arg
Ile (I) leu; val; met; ala; phe;
norleucine leu
Leu (L) norleucine; ile; val;
met; ala; phe ile
Lys (K) arg; gln; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala
Ser(S) thr thr
Thr (T) ser ser
Trp (W) tyr; phe tyr
Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
ala; norleucine leu
Substantial modifications in function or immunological identity of the
polypeptide are accomplished by
selecting substitutions that differ significantly in their effect on
maintaining (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk of the side
chain. Naturally occurring residues are
divided into groups based on common side-chain properties:
(1) hydrophobic: norleucine, met, ala, vai, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gln, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these
classes for another class.
Such substituted residues also may be introduced into the conservative
substitution sites or, more preferably, into
the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as
oligonucleotide-mediated (site-
directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed
mutagenesis [Carter et al., Nucl.
Acids Res., 13:4331 ( 1986); Zoller et al., Nucl. Acids Res., 10:6487 (
1987)], cassette mutagenesis [Wells et al.,
Gene, 34:315 ( 1985)], restriction selection mutagenesis [Wells etal., Philos.
Trans. R. Soc. London SerA, 317:415
-58-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
(1986)] or other known techniques can be performed on the cloned DNA to
produce the PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112,
PR0509, PR0853 or
PR0882 variant DNA.
Scanning amino acid analysis can also be employed to identify one or more
amino acids along a contiguous
sequence. Among the preferred scanning amino acids are relatively small,
neutral amino acids. Such amino acids
include alanine, glycine, serine, and cysteine. Alanine is typically a
preferred scanning amino acid among this group
because it eliminates the side-chain beyond the beta-carbon and is less likely
to alter the main-chain conformation
of the variant [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine
is also typically preferred
because it is the most common amino acid. Further, it is frequently found in
both buried and exposed positions
[Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol.,
150:1 ( 1976)]. If alanine
substitution does not yield adequate amounts of variant, an isoteric amino
acid can be used.
C. Modifications of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347.
PR0357
PR071 S, PR01017, PROI 112, PR0509. PR0853 and PR0882
Covalent modifications of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PROI 112, PR0509, PR0853 and PR0882 are included within the
scope of this invention.
One type of covalent modification includes reacting targeted amino acid
residues of a PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO I I 12, PR0509,
PR0853 or PR0882
polypeptide with an organic derivatizing agent that is capable of reacting
with selected side chains or the N- or C-
terminal residues of the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PRO 1017, PR01112, PR0509, PR0853 or PR0882. Derivatization with bifunctional
agents is useful, for instance,
for crosslinking PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 to a water-insoluble support matrix
or surface for use in the
method for purifying anti-PR0201, anti-PR0292, anti-PR0327, anti-PRO 1265,
anti-PR0344, anti-PR0343, anti-
PR0347, anti-PR0357, anti-PR0715, anti-PRO I 017, anti-PRO 11 I 2, anti-
PR0509, anti-PR0853 or anti-PR0882
antibodies, and vice-versa. Commonly used crosslinking agents include,
e.g.,1,1-bis(diazoacetyl)-2-phenylethane,
glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-
azidosaticylic acid, homobifunctional
imidoesters, including disuccinimidyl esters such as 3,3'-
dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as methyl-3-[(p-
azidophenyl~ithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the corresponding
glutamyl and aspartyl residues, respectively, hydroxylation of proline and
lysine, phosphorylation of hydroxyl
groups of Beryl or threonyl residues, methylation of the a-amino groups of
lysine, arginine, and histidine side chains
[T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman &
Co., San Francisco, pp. 79-86
(1983)], acetylation of the N-terminal amine, and amidation of any C-terminal
carboxyl group.
Another type of covalent modification of the PR0201, PR0292, PR0327, PROI 265,
PR0344, PR0343,
PR0347, PR0357, PR0715, PRO 1017, PRO1 I 12, PR0509, PR0853 or PR0882
polypeptide included within the
scope of this invention comprises altering the native glycosylation pattern of
the polypeptide. "Altering the native
glycosylation pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties found
-59-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
in native sequence PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PRO1 I 12, PR0509, PR0853 or PR0882 (either by removing the
underlying glycosylation site or by
deleting the glycosylation by chemical and/or enzymatic means), and/or adding
one or more glycosylation sites that
are not present in the native sequence PR0201, PR0292, PR0327, PROI 265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882. In addition, the
phrase includes
qualitative changes in the glycosylation of the native proteins, involving a
change in the nature and proportions of
the various carbohydrate moieties present.
Addition of glycosylation sites to the PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide may be
accomplished by
altering the amino acid sequence. The alteration may be made, for example, by
the addition of, or substitution by,
one or more serine or threonine residues to the native sequence PR0201,
PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
(for O-linked
glycosylation sites). The PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 amino acid sequence may optionally
be altered through
changes at the DNA level, particularly by mutating the DNA encoding the
PR0201, PR0292, PR0327, PRO 1265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO I I I 2, PR0509, PR0853
or PR0882 poiypeptide
at preselected bases such that colons are generated that will translate into
the desired amino acids.
Another means of increasing the number of carbohydrate moieties on the PR0201,
PR0292, PR0327,
PROI265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509,
PR0853 or PR0882
polypeptide is by chemical or enzymatic coupling of glycosides to the
polypeptide. Such methods are described
in the art, e.g., in WO 87/05330 published 11 September 1987, and in Aplin and
Wriston, CRC Crit. Rev. Biochem.,
pp. 259-306 ( 1981 ).
Removal of carbohydrate moieties present on the PR0201, PR0292, PR0327, PRO
1265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide may be
accomplished chemically or enzymatically or by mutational substitution of
colons encoding for amino acid residues
that serve as targets for glycosylation. Chemical deglycosylation techniques
are known in the art and described,
for instance, by Hakimuddin, et al., Arch. Biochem. Bionhys., 259:52 (1987)
and by Edge et al., Anal. Biochem.,
118:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides
can be achieved by the use of a
variety of endo- and exo-glycosidases as described by Thotakura et al., Meth.
Enzvmol., 138:350 (1987).
Another type of covalent modification of PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343,
PR0347, PR0357, PR0715, PRO I 017, PRO 1112, PR0509, PR0853 or PR0882
comprises linking the PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 polypeptide to one of a variety of nonproteinaceous polymers,
e.g., polyethylene glycol (PEG),
polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S.
Patent Nos. 4,640,835; 4,496,689;
4,301,144; 4,670,417; 4,791,192 or 4,179,337.
The PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715,
PRO 1 O l 7,
PRO 1112, PR0509, PR0853 or PR0882 of the present invention may also be
modified in a way to form a chimeric
molecule comprising PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
-60-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR01017, PR01112, PR0509, PR0853 or PR0882 fused to another, heterologous
polypeptide or amino acid
sequence.
In one embodiment, such a chimeric molecule comprises a fusion of the PR0201,
PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509,
PR0853 or PR0882
with a tag polypeptide which provides an epitope to which an anti-tag antibody
can selectively bind. The epitope
tag is generally placed at the amino- or carboxyl-terminus of the PRO201,
PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 11 I 2, PR0509, PR0853 or
PR0882. The presence of such
epitope-tagged forms of the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 can be detected using an
antibody against the tag
polypeptide. Also, provision of the epitope tag enables the PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 to
be readily purified
by affinity purification using an anti-tag antibody or another type of
affinity matrix that binds to the epitope tag.
Various tag polypeptides and their respective antibodies are well known in the
art. Examples include poly-histidine
(poly-His) or poly-histidine-glycine (poly-His-gly) tags; the flu HA tag
polypeptide and its antibody 12CA5 [Field
et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7,
6E10, G4, B7 and 9E10 antibodies
thereto [Evan et al., Molecular and Cellular Bioloey, 5:3610-3616 (1985)]; and
the Herpes Simplex virus
glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
EnQineerin~, x:547-553 (1990)]. Other tag
polypeptides _include the Flag-peptide [Hopp et al., BioTechnoloey, 6:1204-
1210 ( 1988)]; the KT3 epitope peptide
[Martin et al., Science, 255:192-194 (1992)]; an a-tubulin epitope peptide
[Skinner et al., J. Biol. Chem.,
266:15163-15166 ( 1991 )]; and the T7 gene 10 protein peptide tag [Lutz-
Freyermuth et al., Proc. Natl. Acad. Sci.
USA. 87:6393-6397 (1990)].
In an alternative embodiment, the chimeric molecule may comprise a fusion of
the PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112,
PR0509, PR0853 or
PR0882 with an immunoglobulin or a particular region of an immunoglobulin. For
a bivalent form of the chimeric
molecule (also referred to as an "immunoadhesin"), such a fusion could be to
the Fc region of an IgG molecule.
The Ig fusions preferably include the substitution of a soluble (transmembrane
domain deleted or inactivated) form
of a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017,
PRO I 1 I 2, PR0509, PR0853 or PR0882 polypeptide in place of at least one
variable region within an Ig molecule.
In a particularly preferred embodiment, the immunoglobulin fusion includes the
hinge, CH2 and CH3, or the hinge,
CH1, CH2 and CH3 regions of an IgGI molecule. For the production of
immunoglobulin fusions see also, US
Patent No. 5,428,130 issued June 27, 1995.
D. Preparation of PR0201 -PR0292 PR0327. PR01265, PR0344. PR0343, PR0347.
PR0357,
PR0715 PR01017 PR01112 PR0509 PR0853 and PR0882 Polyneptides
The description below relates primarily to production of PR0201, PR0292,
PR0327, PRO 1265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882 by
culturing cells
transformed or transfected with a vector containing PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 nucleic
acid. It is, of course,
-61-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
contemplated that alternative rr~thods, which are well known in the art, may
be employed to prepare PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or 1?R0882. For instance, the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347,
PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882 sequence, or
portions thereof, may be
produced by direct peptide synthesis using solid-phase techniques [see, e.g.,
Stewart et al., Solid-Phase Peptide
Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am.
Chem. Soc.. 85:2149-2154 (1963)].
In vitro protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may
be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer
(Foster City, CA) using
manufacturer's instructions. Various portions of the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 may be
chemically synthesized
separately and combined using chemical or enzymatic methods to produce the
full-length PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I I 2,
PR0509, PR0853 or
PR0882.
a. Isolation of DNA Encoding a PR0201. PR0292. PR0327, PR01265, PR0344.
PR0343,
PR0347. PR0357. PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 Polvneptide
DNA encoding PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357,
PR0715,
PR01017, PRO1 I 12, PR0509, PR0853 or PR0882 may be obtained from a cDNA
library prepared from tissue
believed to possess the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 mRNA and to express it at a
detectable level. Accordingly,
human PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017,
PR01112, PR0509, PR0853 or PR0882 DNA can be conveniently obtained from a cDNA
library prepared from
human tissue, such as described in the Examples. PR0201-, PR0292-, PR0327-,
PR01265-, PR0344-, PR0343-,
PR0347-, PR0357-, PR0715-, PR01017-, PR01112-, PR0509-, PR0853- or PR0882-
encoding gene may also
be obtained from a genomic library or by oligonucleotide synthesis.
Libraries can be screened with probes (such as antibodies to the PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PROI Ol 7, PR01112, PR0509, PR0853 or
PR0882 polypeptide,
or oligonucleotides of at least about 20-80 bases) designed to identify the
gene of interest or the protein encoded
by it. Screening the cDNA or genomic library with the selected probe may be
conducted using standard procedures,
such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual
(New York: Cold Spring Harbor
Laboratory Press,1989). An alternative means to isolate the gene encoding
PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or
PR0882 is to use
PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer: A
Laboratory Manual (Cold Spring
Harbor Laboratory Press, 1995)].
The Examples below describe techniques for screening a cDNA library. The
oligonucleotide sequences
selected as probes should be of sufficient length and sufficiently unambiguous
that false positives are minimized.
The oligonucleotide is preferably labeled such that it can be detected upon
hybridization to DNA in the library being
screened. Methods of labeling are well known in the art, and include the use
of radiolabels like '2P-labeled ATP,
-62-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
biotinylation or enzyme labeling. Hybridization conditions, including moderate
stringency and high stringency, are
provided in Sambrook et al., supra.
Sequences identified in such library screening methods can be compared and
aligned to other known
sequences deposited and available in public databases such as GenBank or other
private sequence databases.
Sequence identity (at either the amino acid or nucleotide level) within
defined regions of the molecule or across the
full-length sequence can be determined using methods known in the art and as
described herein.
Nucleic acid having protein coding sequence may be obtained by screening
selected cDNA or genomic
libraries using the deduced amino acid sequence disclosed herein for the first
time, and, if necessary, using
conventional primer extension procedures as described in Sambrook et al.,
supra, to detect precursors and
processing intermediates of mRNA that may not have been reverse-transcribed
into cDNA.
b. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors
described herein for PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 production and cultured in conventional nutrient media
modified as appropriate for inducing
promoters,selectingtransformants,oramplifyingthegenesencodingthedesiredsequence
s. The culture conditions,
such as media, temperature, pH and the like, can be selected by the skilled
artisan without undue experimentation.
In general, principles, protocols, and practical techniques for maximizing the
productivity of cell cultures can be
found in Mammalian Cell Biotechnolo~y: a Practical Approach, M. Butler, ed.
(IRL Press, 1991 ) and Sambrook
et al., supra.
Methods of eukaryotic cell transfection and prokaryotic cell transformation
are known to the ordinarily
skilled artisan, for example, CaCl2, CaP04, liposome-mediated and
electroporation. Depending on the host cell
used, transformation is performed using standard techniques appropriate to
such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra, or
electroporation is generally used for
prokaryotes. Infection with Agrobacterium tumefaciens is used for
transformation of certain plant cells, as
described by Shaw etal., Gene, 23:315 (1983) and WO 89/05859 published 29 June
1989. For mammalian cells
without such cell walls, the calcium phosphate precipitation method of Graham
and van der Eb, Virology, 52:456-
457 (1978) can be employed. General aspects of mammalian cell host system
transfections have been described
in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried
out according to the method of Van
Solingen etal., J. Bact.,130:946 (1977) and Hsiao et al., Proc. Natl. Acad.
Sci. (USA), 76:3829 (1979). However,
other methods for introducing DNA into cells, such as by nuclear
microinjection, electroporation, bacterial
protoplast fusion with intact cells, or polycations, e.g., polybrene,
polyornithine, may also be used. For various
techniques for transforming mammalian cells, see, Keown etal., Methods in
Enzvmoloey, 185:527-537 ( 1990) and
Mansour et al., Nature. 336:348-352 (1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein
include prokaryote, yeast, or
higher eukaryote cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or
Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
Various E. toll strains are publicly
available, such as E. toll Kl 2 strain MM294 (ATCC 31,446); E. toll X 1776
(ATCC 31,537); E. toll strain W3110
-63-
CA 02353775 2001-06-04
WO 00137640 PCT/US99/30095
(ATCC 27,325) and E. coli strain KS 772 (ATCC 53,635). Other suitable
prokaryotic host cells include
Enterobacteriaceae such as Eschericltia, e.g., E. coli, Enterobacter, Erwinia,
Klebsiella, Proteus, Salmonella, e.g.,
Salnaonella r)phimuriunr, Serratia, e.g., Serratia marcescans, and Shigella,
as well as Bacilli such as B. subtilis and
B. liclteniformis (e.g., B. licheniforntis 41 P disclosed in DD 266,710
published 12 April 1989), Pseudomonas such
as P. aeruginosa, and Streptomyces. These examples are illustrative rather
than limiting. Strain W3110 is one
particularly preferred host or parent host because it is a common host strain
for recombinant DNA product
fermentations. Preferably, the host cell secretes minimal amounts of
proteolytic enzymes. For example, strain
W3110 may be modified to effect a genetic mutation in the genes encoding
proteins endogenous to the host, with
examples of such hosts including E. toll W3110 strain I A2, which has the
complete genotype tonA ; E. coli W3110
strain 9E4, which has the complete genotype tonA ptr3; E. toll W3110 strain
27C7 (ATCC 55,244), which has the
complete genotype tonA ptr3 phoA El5 (argF-lac)l69 degP ompT kan ; E. toll
W3110 strain 37D6, which has
the complete genotype tortA ptr 3 phoA El S (argF-lac)169 degP ompT rbs7 ilvG
kan ; E. toll W3110 strain 40B4,
which is strain 37D6 with a non-kanamycin resistant degP deletion mutation;
and an E. toll strain having mutant
periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August
1990. Alternatively, in vitro methods
of cloning, e.g., PCR or other nucleic acid polymerase reactions, are
suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or
yeast are suitable cloning or
expression hosts for PR0201-, PR0292-, PR0327-, PR01265-, PR0344-, PR0343-,
PR0347-, PR0357-,
PR0715-, PROI 017-, PR01112-, PR0509-, PR0853- or PR0882-encoding vectors.
Saccharomyces cerevisiae
is a commonly used lower eukaryotic host microorganism. Others include
Schizosaccharomyces pombe (Beach
and Nurse, Nature, 290: 140 [ 1981 ]; EP 139,383 published 2 May 1985);
Kluyveromyces hosts (U.S. Patent No.
4,943,529; Fleer etal., Bio/TechnoloQV, 9: 968-975 ( 1991 )) such as, e.g., K.
lactis (MW98-8C, CBS683, CBS4574;
Louvencourt et al., J. Bacteriol., 737 [1983]), K. fragilis (ATCC 12,424), K.
bulgaricus (ATCC 16,045), K.
wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC
36,906; Vanden Berg et al.,
BioITechnolo~y, 8:135 ( 1990)), K . thermotolerans, and K. marxianus; yarrowia
(EP 402,226); Pichia pastoris
(EP 183,070; Sreekrishna et al., J. Basic Microbiol., 28:265-278 [1988]);
Candida; Trichoderma reesia (EP
244,234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76:5259-
5263 [1979]); Schwanniomyces
such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990);
and fiiamentous fungi such as, e.g.,
Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January
1991), andAspergillus hosts such
as A. rtidulans (Ballance et al., Biochem. Biouhvs. Res. Commun., 112:284-289
[1983]; Tilburn et al., Gene,
26:205-221 [ 1983]; Yelton etal., Proc. Natl. Acad. Sci. USA, 81:1470-1474 [
1984]) andA. niger (Kelly and Hynes,
EMBO J., 4:475-479 [1985]). Methylotropic yeasts are suitable herein and
include, but are not limited to, yeast
capable of growth on methanol selected from the genera consisting of
Hansenula, Cartdida, Kloeckera, Pichia,
Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species that
are exemplary of this class of yeasts
may be found in C. Anthony, The Biochemistry of Methylotronhs, 269 ( 1982).
Suitable host cells for the expression of glycosylated PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 are
derived from
multicellular organisms. Examples of invertebrate cells include insect cells
such as Drosophila S2 and Spodoptera
Sf9, as well as plant cells. Examples of useful mammalian host cell lines
include Chinese hamster ovary (CHO)
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
and COS cells. More specific examples include monkey kidney CV1 line
transformed by SV40 (COS-7, ATCC
CRL 1651 ); human embryonic kidney line (293 or 293 cells subcloned for growth
in suspension culture, Graham
et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO),
Urlaub and Chasin, Proc. Natl.
Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol.
Reprod., 23:243-251 (1980)); human
lung cells (W 138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and
mouse mammary tumor (MMT
060562, ATCC CCL51 ). The selection of the appropriate host cell is deemed to
be within the skill in the art.
Selection and Use of a Renlicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding PR0201, PR0292, PR0327,
PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or
PR0882 may be
inserted into a replicable vector for cloning (amplification of the DNA) or
for expression. Various vectors are
publicly available. The vector may, for example, be in the form of a plasmid,
cosmid, viral particle, or phage. The
appropriate nucleic acid sequence may be inserted into the vector by a variety
of procedures. In general, DNA is
inserted into an appropriate restriction endonuclease sites) using techniques
known in the art. Vector components
generally include, but are not limited to, one or more of a signal sequence,
an origin of replication, one or more
marker genes, an enhancer element, a promoter, and a transcription termination
sequence. Construction of suitable
vectors containing one or more of these components employs standard ligation
techniques which are known to the
skilled artisan.
The PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715,
PROI 017,
PR01112, PR0509, PR0853 or PR0882 may be produced recombinantly not only
directly, but also as a fusion
polypeptide with a heterologous polypeptide, which may be a signal sequence or
other polypeptide having a specific
cleavage site at the N-terminus of the mature protein or polypeptide. In
general, the signal sequence may be a
component of the vector, or it may be a part of the PR0201-, PR0292-, PR0327-,
PRO 1265-, PR0344-, PR0343-,
PR0347-, PR0357-, PR0715-, PR01017-, PR01112-, PR0509-, PR0853- or PR0882-
encoding DNA that is
inserted into the vector. The signal sequence may be a prokaryotic signal
sequence selected, for example, from the
group of the alkaline phosphatase, penicillinase, lpp, or heat-stable
enterotoxin II leaders. For yeast secretion the
signal sequence may be, e.g., the yeast invertase leader, alpha factor leader
(including Saccharomyces and
Kluyveromyces a-factor leaders, the latter described in U.S. Patent No.
5,010,182), or acid phosphatase leader, the
C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the
signal described in WO 90/13646
published 15 November 1990. In mammalian cell expression, mammalian signal
sequences may be used to direct
secretion of the protein, such as signal sequences from secreted polypeptides
of the same or related species, as well
as viral secretory leaders.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the vector to replicate
in one or more selected host cells. Such sequences are well known for a
variety of bacteria, yeast, and viruses. The
origin of replication from the plasmid pBR322 is suitable for most Gram-
negative bacteria, the 2~ plasmid origin
is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus,
VSV or BPV) are useful for cloning
vectors in mammalian cells.
Expression and cloning vectors will typically contain a selection gene, also
termed a selectable marker.
-65-
CA 02353775 2001-06-04
WO 00/37640 , PCT/US99/30095
Typical selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g., ampicillin,
neomycin, methotrexate, or tetracycline, (b) complement auxotrophic
deficiencies, or (c) supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine racemase
for Bacilli.
An example of suitable selectable markers for mammalian cells are those that
enable the identification of
cells competent to take up the PR0201-, PR0292-, PR0327-, PRO 1265-, PR0344-,
PR0343-, PR0347-,PR0357-,
PR0715-, PR01017-, PROI 112-, PR0509-, PR0853- or PR0882-encoding nucleic
acid, such as DHFR or
thymidine kinase. An appropriate host cell when wild-type DHFR is employed is
the CHO cell line deficient in
DHFR activity, prepared and propagated as described by Urlaub etal., Proc.
Natl. Acad. Sci. USA, 77:4216 (1980).
A suitable selection gene for use in yeast is the trpl gene present in the
yeast plasmid YRp7 [Stinchcomb et al.,
Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al.,
Gene, 10:157 (1980)]. The trpl
gene provides a selection marker for a mutant strain of yeast lacking the
ability to grow in tryptophan, for example,
ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 ( 1977)].
Expression and cloning vectors usually contain a promoter operably linked to
the PR0201-, PR0292-,
PR0327-, PR01265-, PR0344-, PR0343-, PR0347-, PR0357-, PR0715-, PRO1017-,
PR01112-, PR0509-,
PR0853-or PR0882-encoding nucleic acid sequence to direct mRNA synthesis.
Promoters recognized by a variety
of potential host cells are well known. Promoters suitable for use with
prokaryotic hosts include the [3-lactamase
and lactose promoter systems [Chang et al., Nature, 275:615 ( 1978); Goeddel
et al., Nature, 281:544 ( 1979)],
alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic
Acids Res., 8:4057 ( 1980); EP 36,776],
and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl.
Acad. Sci. USA, 80:21-25 (1983)].
Promoters for use in bacterial systems also will contain a Shine-Dalgarno
(S.D.) sequence operably linked to the
DNA encoding PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882.
Examples of suitable promoting sequences for use with yeast hosts include the
promoters for 3-
phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255:2073 ( 1980)] or
other glycolytic enzymes [Hess et
al., J. Adv. Enzvme Rep., 7:149 ( 1968); Holland, Biochemistry, 17:4900 (
1978)], such as enolase, glyceraldehyde-
3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate
isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and
glucokinase.
Other yeast promoters, which are inducible promoters having the additional
advantage of transcription
controlled by growth conditions, are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-
phosphate dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP 73,657.
PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO
1017,
PROI 112, PR0509, PR0853 or PRO882 transcription from vectors in mammalian
host cells is controlled, for
example, by promoters obtained from the genomes of viruses such as polyoma
virus, fowlpox virus (UK 2,211,504
published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma
virus, avian sarcoma virus,
cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40),
from heterologous mammalian
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
promoters, e.g., the actin promoter or an immunoglobulin promoter, and from
heat-shock promoters, provided such
promoters are compatible with the host cell systems.
Transcription of a DNA encoding the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343,
PR0347, PR0357, PR0715, PR01017, PROI 1 I2, PR0509, PR0853 or PR0882 by higher
eukaryotes may be
increased by inserting an enhancer sequence into the vector. Enhancers are cis-
acting elements of DNA, usually
about from 10 to 300 bp, that act on a promoter to increase its transcription.
Many enhancer sequences are now
known from mammalian genes (globin, elastase, albumin, a-fetoprotein, and
insulin). Typically, however, one will
use an enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the
replication origin (bp 100-270), the cytomegaIovirus early promoter enhancer,
the polyoma enhancer on the late side
of the replication origin, and adenovirus enhancers. The enhancer may be
spliced into the vector at a position 5'
or 3' to the PR0201, PR0292, PR0327, PROI 265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PR01112, PR0509, PR0853 or PR0882 coding sequence, but is preferably located
at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal, human, or nucleated
cells from other multicellular organisms) will also contain sequences
necessary for the termination of transcription
and for stabilizing the mRNA. Such sequences are commonly available from the
5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions
contain nucleotide segments transcribed
as polyadenylated fragments in the untranslated portion of the mRNA encoding
PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509,
PR0853 or PR0882.
Still other methods, vectors, and host cells suitable for adaptation to the
synthesis of PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PR01112,
PR0509, PR0853 or
PR0882 in recombinant vertebrate cell culture are described in Gething et al.,
Nature, 293:620-625 ( 1981 ); Mantei
et al., Nature, 281:40-46 ( 1979); EP 117,060; and EP 117,058.
d. Detecting Gene Amolification/Exoression
Gene amplification and/or expression may be measured in a sample directly, for
example, by conventional
Southern blotting, Northern blotting to quantitate the transcription of mRNA
[Thomas, Proc. Natl. Acad. Sci. USA,
77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization,
using an appropriately labeled probe,
based on the sequences provided herein. Alternatively, antibodies may be
employed that can recognize specific
duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or
DNA-protein duplexes.
The antibodies in turn may be labeled and the assay may be carried out where
the duplex is bound to a surface, so
that upon the formation of duplex on the surface, the presence of antibody
bound to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such
as
immunohistochemical staining of cells or tissue sections and assay of cell
culture or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be prepared in
any mammal. Conveniently, the
antibodies may be prepared against a native sequence PRO201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide
or against a
synthetic peptide based on the DNA sequences provided herein or against an
exogenous sequence fused to PR0201,
-67-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI
112, PR0509,
PR0853 or PR0882 DNA and encoding a specific antibody epitope.
e. Purification of Polvee~tide
Forms of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715,
PROI OI 7, PR01112, PR0509, PR0853 or PR0882 may be recovered from culture
medium or from host cell
lysates. If membrane-bound, it can be released from the membrane using a
suitable detergent solution (e.g., Triton
X 100) or by enzymatic cleavage. Cells employed in expression of PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or
PR0882 can be
disrupted by various physical or chemical means, such as freeze-thaw cycling,
sonication, mechanical disruption,
or cell lysing agents.
It may be desired to purify PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PRO 1 O l 7, PRO 1112, PR0509, PR0853 or PR0882 from recombinant cel l
proteins or polypeptides. The
following procedures are exemplary of suitable purification procedures: by
fractionation on an ion-exchange
column; ethanol precipitation; reverse phase HPLC; chromatography on silica or
on a cation-exchange resin such
as DEAF; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel
filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG;
and metal chelating columns
to bind epitope-tagged forms of the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882. Various methods of protein
purification may be
employed and such methods are known in the art and described for example in
Deutscher, Methods in Enzvmolo~y,
182 ( 1990); Scopes, Protein Purification: Principles and Practice, Springer-
Verlag, New York ( 1982). The
purification steps) selected will depend, for example, on the nature of the
production process used and the
particular PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357,
PR0715, PRO 1017,
PR01112, PR0509, PR0853 or PR0882 produced.
E. Amplification of Genes Encodine the PR0201. PR0292 PR0327 PROI 265 PR0344
PR0343
PR0347, PR0357, PR0715, PR01017, PROI I I2. PR0509 PR0853 or PR0882
Polvaentides in Tumor Tissues
and Cell Lines
The present invention is based on the identification and characterization of
genes that are amplified in
certain cancer cells.
The genome of prokaryotic and eukaryotic organisms is subjected to two
seemingly conflicting
requirements. One is the preservation and propagation of DNA as the genetic
information in its original form, to
guarantee stable inheritance through multiple generations. On the other hand,
cells or organisms must be able to
adapt to lasting environmental changes. The adaptive mechanisms can include
qualitative or quantitative
modifications of the genetic material. Qualitative modifications include DNA
mutations, in which coding sequences
are altered resulting in a structurally and/or functionally different protein.
Gene amplification is a quantitative
modification, whereby the actual number of complete coding sequence, i.e., a
gene, increases, leading to an
increased number of available templates for transcription, an increased number
of translatable transcripts, and,
-68-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
ultimately, to an increased abundance of the protein encoded by the amplified
gene.
The phenomenon of gene amplification and its underlying mechanisms have been
investigated in vitro in
several prokaryotic and eukaryotic culture systems. The best-characterized
example of gene amplification involves
the culture of eukaryotic cells in medium containing variable concentrations
of the cytotoxic drug methotrexate
(MTX). MTX is a folic acid analogue and interferes with DNA synthesis by
blocking the enzyme dihydrofolate
reductase (DHFR). During the initial exposure to low concentrations of MTX
most cells (>99.9%) will die. A
small number of cells survive, and are capable of growing in increasing
concentrations of MTX by producing large
amounts of DHhR-RNA and protein. The basis of this overproduction is the
amplification of the single DHFR
gene. The additional copies of the gene are found as extrachromosomal copies
in the form of small, supernumerary
chromosomes (double minutes) or as integrated chromosomal copies.
Gene amplification is most commonly encountered in the developrr~nt of
resistance to cytotoxic drugs
(antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells)
and neoplastic transformatian.
Transformation of a eukaryotic cell as a spontaneous event or due to a viral
or chemicalJenvironmental insult is
typically associated with changes in the genetic material of that cell. One of
the most common genetic changes
observed in human malignancies are mutations of the p53 protein. p53 controls
the transition of cells from the
stationary (G1 ) to the replicative (S) phase and prevents this transition in
the presence of DNA damage. In other
words, one of the main consequences of disabling p53 mutations is the
accumulation and propagation of DNA
damage, i.e., genetic changes. Common types of genetic changes in neoplastic
cells are, in addition to point
mutations, amplifications and gross, suuctural alterations, such as
translocations.
The amplification of DNA sequences may indicate a specific functional
requirement as illustrated in the
DHFR experimental system. Therefore, the amplification of certain oncogenes in
malignancies points toward a
causative role of these genes in the process of malignant transformation and
maintenance of the transformed
phenotype. This hypothesis has gained support in recent studies. For example,
the bcl-2 protein was found to be
amplified in certain types of non-Hodgkin's lymphoma. This protein inhibits
apoptosis and leads to the progressive
accumulation of neoplastic cells. Members of the gene family of growth factor
receptors have been found to be
amplified in various types of cancers suggesting that overexpression of these
receptors may make neoplastic cells
less susceptible to limiting amounts of available growth factor. Examples
include the amplification of the androgen
receptor in recurrent prostate cancer during androgen deprivation therapy and
the amplification of the growth factor
receptor homologue ERB2 in breast cancer. Lastly, genes involved in
intracellular signaling and control of cell
cycle progression can undergo amplification during malignant transformation.
This is illustrated by the
amplification of the bcl-I and ras genes in various epithelial and lymphoid
neoplasms.
These earlier studies illustrate the feasibility of identifying amplified DNA
sequences in neoplasms,
because this approach can identify genes important for malignant
transformation. The case of ERB2 also
demonstrates the feasibility from a therapeutic standpoint, since transforming
proteins may represent novel and
specific targets for tumor therapy.
Several different techniques can be used to demonstrate amplified genomic
sequences. Classical
cytogenetic analysis of chromosome spreads prepared from cancer cells is
adequate to identify gross structural
alterations, such as translocations, deletions and inversions. Amplified
genomic regions can only be visualized, if
-69-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
they involve large regions with high copy numbers or are present as
extrachromosomal material. While cytogenetics
was the first technique to demonstrate the consistent association of specific
chromosomal changes with particular
neoplasms, it is inadequate for the identification and isolation of manageable
DNA sequences. The more recently
developed technique of comparative genomic hybridization (CGH) has illustrated
the widespread phenomenon of
genomic amplification in neoplasms. Tumor and normal DNA are hybridized
simultaneously onto metaphases of
normal cells and the entire genome can be screened by image analysis for DNA
sequences that are present in the
tumor at an increased frequency. (WO 93/18,186; Gray et al., Radiation Res., l
37:275-289 [ 1994]). As a screening
method, this type of analysis has revealed a large number of recurring
amplicons (a stretch of amplified DNA) in
a variety of human neoplasms. Although CGH is more sensitive than classical
cytogenetic analysis in identifying
amplified stretches of DNA, it does not allow a rapid identification and
isolation of coding sequences within the
ampiicon by standard molecular genetic techniques.
The most sensitive methods to detect gene amplification are polyrr>erase chain
reaction (PCR)-based assays.
These assays utilize very small amount of tumor DNA as starting material, are
exquisitely sensitive, provide DNA
that is amenable to further analysis, such as sequencing and are suitable for
high-volume throughput analysis.
The above-mentioned assays are not mutually exclusive, but are frequently used
in combination to identify
amplifications in neoplasms. While cytogenetic analysis and CGH represent
screening methods to survey the entire
genome for amplified regions, PCR-based assays are most suitable for the final
identification of coding sequences,
i.e., genes in amplified regions.
According to the present invention, such genes have been identified by
quantitative PCR (S. Gelmini et
al., Clin. Chem., 43:752 [1997]), by comparing DNA from a variety of primary
tumors, including breast, lung,
colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis,
ovary, uterus, etc., tumor, or tumor cell lines,
with pooled DNA from healthy donors. Quantitative PCR was performed using a
TaqMan instrument (ABI).
Gene-specific primers and fluorogenic probes were designed based upon the
coding sequences of the DNAs.
Human lung carcinoma cell lines include A549 (SRCC768), Calu-1 (SRCC769), Calu-
6 (SRCC770), H 157
(SRCC771), H441 (SRCC772), H460 (SRCC773), SKMES-1 (SRCC774), SW900 (SRCC775),
H522
(SRCC832),and H810 (SRCC833), all available from ATCC. Primary human lung
tumor cells usually derive from
adenocarcinomas, squamous cell carcinomas, large cell carcinomas, non-small
cell carcinomas, small cell
carcinomas, and broncho alveolar carcinomas, and include, for example, SRCC724
(adenocarcinoma, abbreviated
as "AdenoCa")(LTl), SRCC725 (squamous cell carcinoma, abbreviated as
"SqCCa)(LTIa), SRCC726
(adenocarcinoma)(LT2), SRCC727 (adenocarcinoma)(LT3), SRCC728
(adenocarcinoma)(LT4), SRCC729
(squamous cell carcinoma)(LT6), SRCC730 (adeno/squamous cell carcinoma)(LT7),
SRCC731
(adenocarcinoma)(LT9), SRCC732 (squamous cell carcinoma)(LT10), SRCC733
(squamous cell
carcinoma)(LTl 1 ), SRCC734 (adenocarcinoma)(LT12), SRCC735 (adeno/squamous
cell carcinoma)(LT13),
SRCC736 (squamous cell carcinoma)(LT15), SRCC737 (squamous cell
carcinoma)(LTl6), SRCC738 (squamous
cell carcinoma)(LT17), SRCC739 (squamous cell carcinoma)(LT18), SRCC740
(squamous cell carcinoma)(LT19),
SRCC741 (lung cell carcinoma, abbreviated as "LCCa")(LT21 ), SRCC811
(adenocarcinoma)(LT22), SRCC825
(adenocarcinoma)(LT8), SRCC886 (adenocarcinoma)(LT25), SRCC887 (squamous cell
carcinoma) (LT26),
SRCC888 (adeno-BAC carcinoma) (LT27), SRCC889 (squamous cell carcinoma)
(LT28), SRCC890 (squamous
-70-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
cell carcinoma) (LT29), SRCC891 (adenocarcinoma) (LT30), SRCC892 (squamous
cell carcinoma) (LT31 ),
SRCC894 (adenocarcinoma) (LT33). Also included are human lung tumors
designated SRCC1125 [HF-000631 ],
SRCC1127 [HF-000641], SRCC1129 [HF-000643], SRCC1133 [HF-000840], SRCClI35 [HF-
000842],
SRCC1227 [HF-001291], SRCC1229 [HF-001293], SRCC1230 [HF-001294], SRCC1231 [HF-
001295],
SRCC1232 [HF-001296], SRCC1233 [HF-001297], SRCC1235 [HF-001299], and SRCC1236
[HF-001300].
Colon cancer cell lines include, for example, ATCC cell lines SW480
(adenocarcinoma, SRCC776),
SW620 (lymph node metastasis of colon adenocarcinoma, SRCC777), Co1o320
(carcinoma, SRCC778), HT29
(adenocarcinoma, SRCC779), HM7 (a high mucin producing variant of ATCC colon
adenocarcinoma cell line,
SRCC780, obtained from Dr. Robert Warren, UCSF), CaWiDr (adenocarcinoma,
SRCC781 ), HCTI 16 (carcinoma,
SRCC782), SKCO1 (adenocarcinoma, SRCC783), SW403 (adenocarcinoma, SRCC784),
LS174T (carcinoma,
SRCC785), Co1o205 (carcinoma, SRCC828), HCT15 (carcinoma, SRCC829), HCC2998
(carcinoma, SRCC830),
and KMI2 (carcinoma, SRCC831). Primary colon tumors include colon
adenocarcinomas designated CT2
(SRCC742), CT3 (SRCC743) ,CTS (SRCC744), CT10 (SRCC745),.CT12 (SRCC746), CT14
(SRCC747), CT15
(SRCC748), CT16 (SRCC749), CT17 (SRCC750), CTl (SRCC751), CT4 (SRCC752), CT5
(SRCC753), CT6
(SRCC754), CT7 (SRCC755), CT9 (SRCC756), CTl l (SRCC757), CT18 (SRCC758), CT19
(adenocarcinoma,
SRCC906), CT20 (adenocarcinoma, SRCC907), CT21 (adenocarcinoma, SRCC908), CT22
(adenocarcinoma,
SRCC909), CT23 (adenocarcinoma, SRCC910), CT24 (adenocarcinoma, SRCC911 ),
CT25 (adenocarcinoma,
SRCC912), CT26 (adenocarcinoma, SRCC913), CT27 (adenocarcinoma, SRCC914),CT28
(adenocarcinoma,
SRCC915), CT29 (adenocarcinoma, SRCC916), CT30 (adenocarcinoma, SRCC917), CT31
(adenocarcinoma,
SRCC918), CT32 (adenocarcinoma, SRCC919), CT33 (adenocarcinoma, SRCC920), CT35
(adenocarcinoma,
SRCC921 ), and CT36 (adenocarcinoma, SRCC922). Also included are human colon
tumor centers designated
SRCC1051 [HF-000499], SRCC1052 [HF-000539], SRCC1053 [HF-000575], SRCC1054 (HF-
000698],
SRCC1142 [HF-000762], SRCC1144 [HF-000789], SRCC1146 [HF-000795] and
SRCC1148[HF-000811].
Human breast carcinomaceli lines include, for example, HBL100 (SRCC759),
MB435s (SRCC760), T47D
(SRCC761), MB468(SRCC762), MB 175 (SRCC763), MB361 (SRCC764), BT20 (SRCC765),
MCF7 (SRCC766),
and SKBR3 (SRCC767), and human breast tumor center designated SRCC 1057 [HF-
000545]. Also included are
human breast tumors designated SRCC1094, SRCC1095, SRCC1096, SRCC1097,
SRCC1098, SRCC1099,
SRCC1100, SRCC1101, and human breast-met-lung-NS tumor designated SRCC893 [LT
32].
Human kidney tumor centers include SRCC989 [HF-000611] and SRCC1014 [HF-
000613].
Human testis tumor center includes SRCC1001 [HF-000733] and testis tumor
margin SRCC999 [HF-
000716].
Human parathyroid tumor includes SRCC1002 [HF-000831] and SRCC1003 [HF-
000832].
F. Tissue Distribution
The results of the gene amplification assays herein can be verified by further
studies, such as, by
determining mRNA expression in various human tissues.
As noted before, gene amplification and/or gene expression in various tissues
may be measured by
conventional Southern blotting, Northern blotting to quantitate the
transcription of mRNA (Thomas, Proc. Natl.
_71 _
CA 02353775 2001-06-04
wo oor~7sao pcT/~rs99r~oo9s
Acad. Sci. USA, 77:5201-5205 [ 1980]), dot blotting (DNA analysis), or in situ
hybridization, using an appropriately
labeled probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can
recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA
hybrid duplexes or
DNA-protein duplexes.
Gene expression in various tissues, alternatively, may be measured by
immunological methods, such as
immunohistochemical staining of tissue sections and assay of cell culture or
body fluids, to quantitate directly the
expression of gene product. Antibodies useful for immunohistochemical staining
and/or assay of sample fluids may
be either monoclonal or polyclonal, and may be prepared in any mammal.
Conveniently, the antibodies may be
prepared against a native sequence PR0201, PR0292, PR0327, PRO 1265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PRO 1017, PRO I 112, PR0509, PR0853 or PR0882 polypeptide or against a
synthetic peptide based on
the DNA sequences provided herein or against exogenous sequence fused to
sequence PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI I 12, PR0509,
PR0853 or PR0882
DNA and encoding a specific antibody epitope. General techniques for
generating antibodies, and special protocols
for Northern blotting and in situ hybridization are provided hereinbelow.
G. Chromosome Mapping
If the amplification of a given gene is functionally relevant, then that gene
should be amplified more than
neighboring genomic regions which are not important for tumor survival. To
test this, the gene can be mapped to
a particular chromosome, e.g., by radiation-hybrid analysis. The amplification
level is then determined at the
location identified, and at the neighboring genomic region. Selective or
preferential amplification at the genomic
region to which the gene has been mapped is consistent with the possibility
that the gene amplification observed
promotes tumor growth or survival. Chromosome mapping includes both framework
and epicenter mapping. For
further details see, e.g., Stewart et al., Genome Research, 7:422-433 (1997).
H. Antibody Bindine Studies
The results of the gene amplification study can be further verified by
antibody binding studies, in which
the ability of anti-PR0201, anti-PR0292, anti-PR0327, anti-PROI 265, anti-
PR0344, anti-PR0343, anti-PR0347,
anti-PR0357, anti-PR0715, anti-PRO 1017, anti-PR01112, anti-PR0509, anti-
PR0853 or anti-PR0882 antibodies
to inhibit the expression of PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptides on tumor
(cancer) cells is tested.
Exemplary antibodies include polyclonal, monoclonal, humanized, bispeciflc,
and heteroconjugate antibodies, the
preparation of which will be described hereinbelow.
Antibody binding studies may be carried out in any known assay method, such as
competitive binding
assays, direct and indirect sandwich assays, and immunoprecipitation assays.
Zola, Monoclonal Antibodies: A
Manual of Techniaues, pp.147-158 (CRC Press, Inc., 1987).
Competitive binding assays rely on the ability of a labeled standard to
compete with the test sample analyte
for binding with a limited amount of antibody. The amount of target protein
(encoded by a gene amplified in a
tumor cell) in the test sample is inversely proportional to the amount of
standard that becomes bound to the
-72-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
antibodies. To facilitate determining the amount of standard that becomes
bound, the antibodies preferably are
insolubilized before or after the competition, so that the standard and
analyze that are bound to the antibodies may
conveniently be separated from the standard and analyte which remain unbound.
Sandwich assays involve the use of two antibodies, each capable of binding to
a different immunogenic
portion, or epitope, of the protein to be detected. In a sandwich assay, the
test sample analyte is bound by a first
antibody which is immobilized on a solid support, and thereafter a second
antibody binds to the analyte, thus
forming an insoluble three-part complex. See, e.g., U.S. Patent No. 4,376,110.
The second antibody may itself be
labeled with a detectable moiety (direct sandwich assays) or may be measured
using an anti-immunoglobulin
antibody that is labeled with a detectable moiety (indirect sandwich assay).
For example, one type of sandwich
IO assay is an ELISA assay, in which case the detectable moiety is an enzyme.
For immunohistochemistry, the tumor sample may be fresh or frozen or may be
embedded in paraffin and
fixed with a preservative such as formalin, for example.
I. Cell-Based Tumor Assavs
Cell-based assays and animal models for tumors (e.g., cancers) can be used to
verify the findings of the
IS gene amplification assay, and further understand the relationship between
the genes identified herein and the
development and pathogenesis of neoplastic cell growth. The role of gene
products identified herein in the
development and pathology of tumor or cancer can be tested by using primary
tumor cells or cells lines that have
been identified to amplify the genes herein. Such cells include, for example,
the breast, colon and lung cancer cells
and cell lines listed above.
20 In a different approach, cells of a cell type known to be involved in a
particular tumor are transfected with
the cDNAs herein, and the ability of these cDNAs to induce excessive growth is
analyzed. Suitable cells include,
for example, stable tumor cells lines such as, the B104-1-1 cell line (stable
NIH-3T3 cell line transfected with the
neu protooncogene) and ras-transfected NIH-3T3 cells, which can be transfected
with the desired gene, and
monitored for tumorogenic growth. Such transfected cell lines can then be used
to test the ability of poly- or
25 monoclonal antibodies or antibody compositions to inhibit tumorogenic cell
growth by exerting cytostatic or
cytotoxic activity on the growth of the transformed cells, or by mediating
antibody-dependent cellular cytotoxicity
(ADCC). Cells transfected with the coding sequences of the genes identified
herein can further be used to identify
drug candidates for the treatment of cancer.
In addition, primary cultures derived from tumors in transgenic animals (as
described below) can be used
30 in the cell-based assays herein, although stable cell lines are preferred.
Techniques to derive continuous cell lines
from transgenic animals are well known in the art (see, e.g., Small et al.,
Mol. Cell. Biol., 5_:642-648 [1985]).
Animal Models
A variety of well known animal models can be used to further understand the
role of the genes identified
herein in the development and pathogenesis of tumors, and to test the efficacy
of candidate therapeutic agents,
35 including antibodies, and other antagonists of the native polypeptides,
including small molecule antagonists. The
in vivo nature of such models makes them particularly predictive of responses
in human patients. Animal models
-73-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
of tumors and cancers (e.g., breast cancer, colon cancer, prostate cancer,
lung cancer, etc.) include both non-
recombinant and recombinant (transgenic) animals. Non-recombinant animal
models include, for example, rodent,
e.g., murine models. Such models can be generated by introducing tumor cells
into syngeneic mice using standard
techniques, e.g., subcutaneous injection, tail vein injection, spleen
implantation, intraperitoneal implantation,
implantation under the renal capsule, or orthopin implantation, e.g., colon
cancer cells implanted in colonic tissue.
(See, e.g., PCT publication No. WO 97133551, published September 18, 1997).
Probably the most often used anima) species in oncological studies are
immunodeficient mice and, in
particular, nude mice. The observation that the nude mouse with hypo/aplasia
could successfully act as a host for
human tumor xenografts has lead to its widespread use for this purpose. The
autosomal recessive nu gene has been
introduced into a very large number of distinct congenic strains of nude
mouse, including, for example, ASW, A/He,
AKR, BALB/c, B lO.LP, C 17, C3H, C57BL, C57, CBA, DBA, DDD, l/st, NC, NFR,
NFS, NFS/N, NZB, NZC,
NZW, P, RIII and SJL. In addition, a wide variety of other animals with
inherited i mmunological defects other than
the nude mouse have been bred and used as recipients of tumor xenografts. For
further details see, e.g., The Nude
Mouse in Oncology Research, E. Boven and B. Winograd, eds., CRC Press, Inc.,
1991.
The cells introduced into such animals can be derived from known tumor/cancer
cell lines, such as, any
of the above-listed tumor cell lines, and, for example, the B104-1-1 cell line
(stable NIH-3T3 cell line transfected
with the neu protooncogene); ras-uansfected NIH-3T3 cells; Caco-2 (ATCC HTB-
37); a moderately well-
differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-
38), or from tumors and cancers.
Samples of tumor or cancer cells can be obtained from patients undergoing
surgery, 'using standard conditions,
involving freezing and storing in liquid nitrogen (ICarmali et al., Br. J.
Cancer. 48:689-696 (1983]).
Tumor cells can be introduced into animals, such as nude mice, by a variety of
procedures. The
subcutaneous (s.c.) space in mice is very suitable for tumor implantation.
Tumors can be transplanted s.c. as solid
blocks, as needle biopsies by use of a trochar, or as cell suspensions. For
solid block or trochar implantation, tumor
tissue fragments of suitable size are introduced into the s.c. space. Cell
suspensions are freshly prepared from
primary tumors or stable tumor cell lines, and injected subcutaneously. Tumor
cells can also be injected as
subdermal implants. In this location, the inoculum is deposited between the
lower part of the dermal connective
tissue and the s.c. tissue. Boven and Winograd ( 1991 ), supra.
Animal models of breast cancer can be generated, for example, by implanting
rat neuroblastoma cells (from
which the neu oncogen was initially isolated), or neu-transformed NIH-3T3
cells into nude mice, essentially as
described by Drebin et al., PNAS USA, 83:9129-9133 ( 1986).
Similarly, animal models of colon cancercan be generated bypassagingcolon
cancercells in animals, e.g.,
nude mice, leading to the appearance of tumors in these animals. An orthotopic
transplant model of human colon
cancer in nude mice has been described, for example, by Wang et al., Cancer
Research, 54:4726-4728 (1994) and
Too et al., Cancer Research, 55:681-684 (1995). This model is based on the so-
called "METAMOUSE" sold by
Anticancer, Inc., (San Diego, California).
Tumors that arise in animals can be removed and cultured in vitro. Cells from
the in vitro cultures can then
be passaged to animals. Such tumors can serve as targets for further testing
or drug screening. Alternatively, the
tumors resulting from the passage can be isolated and RNA from pre-passage
cells and cells isolated after one or
-74-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
more rounds of passage analyzed for differential expression of genes of
interest. Such passaging techniques can
be performed with any known tumor or cancer cell lines.
For example, Meth A, CMS4, CMSS, CMS21, and WEHI-164 are chemically induced
fibrosarcomas of
BALB/c female mice (DeLeo et al., J. Exp. Med., 146:720 ( 1977]), which
provide a highly controllable model
system for studying the anti-tumor activities of various agents (Palladino et
al., J. Immunol., 138:4023-4032
[ 1987]). Briefly, tumor cells are propagated in vitro in cell culture. Prior
to injection into the animals, the cell lines
are washed and suspended in buffer, at a cell density of about IOxlO~ to
10x10' cells/ml. The animals are then
infected subcutaneously with 10 to 100 ~1 of the cell suspension, allowing one
to three weeks for a tumor to appear.
In addition, the Lewis lung (3LL) carcinoma of mice, which is one of the most
thoroughly studied
experimental tumors, can be used as an investigational tumor model. Efficacy
in this tumor model has been
correlated with beneficial effects in the treatment of human patients
diagnosed with small cell carcinoma of the lung
(SCCL). This tumor can be introduced in normal mice upon injection of tumor
fragments from an affected mouse
or of cells maintained in culture (Zupi et al., Br. J. Cancer, 41 auppl. 4:309
[ 1980]), and evidence indicates that
tumors can be started from injection of even a single cell and that a very
high proportion of infected tumor cells
survive. For further information about this tumor model see, Zacharski,
Haemostasis, 16:300-320 [ 1986]).
One way of evaluating the efficacy of a test compound in an animal model on an
implanted tumor is to
measure the size of the tumor before and after treatment. Traditionally, the
size of implanted tumors has been
measured with a slide caliper in two or three dimensions. The measure limited
to two dimensions does not
accurately reflect the size of the tumor, therefore, it is usually converted
into the corresponding volume by using
a mathematical formula. However, the measurement of tumor size is very
inaccurate. The therapeutic effects of
a drug candidate can be better described as treatment-induced growth delay and
specific growth delay. Another
important variable in the description of tumor growth is the tumor volume
doubling time. Computer programs for
the calculation and description of tumor growth are also available, such as
the program reported by Rygaard and
Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animals, Wu and
Sheng eds., Basel, 1989, 301.
It is noted, however, that necrosis and inflammatory responses following
treatment may actually result in an increase
in tumor size, at least initially. Therefore, these changes need to be
carefully monitored, by a combination of a
morphometric method and flow cytometric analysis.
Recombinant (transgenic) animal models can be engineered by introducing the
coding portion of the genes
identified herein into the genome of animals of interest, using standard
techniques for producing transgenic animals.
Animals that can serve as a target for transgenic manipulation include,
without limitation, mice, rats, rabbits, guinea
pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees
and monkeys. Techniques known
in the art to introduce a transgene into such animals include pronucleic
microinjection (Hoppe and Wanger, U.S.
Patent No. 4,873,191 ); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc. Natl.
Acad. Sci. USA, 82:6148-615 [ 1985]); gene targeting in embryonic stem cells
(Thompson et al., Cell, 56:313-321
[1989]); electroporation of embryos (Lo, Mol. Cell Biol., 3:1803-1814 [1983]);
sperm-mediated gene transfer
(Lavitrano et al., Cell, 57:717-73 [1989]). For review, see, for example, U.S.
Patent No. 4,736,866.
For the purpose of the present invention, transgenic animals include those
that carry the transgene only
in part of their cells ("mosaic animals"). The transgene can be integrated
either as a single transgene, or in
-75-
CA 02353775 2001-06-04
WO 00/37640 PCT/I1S99/30095
concatamers, e.g., head-to-head or head-to-tail tandems. Selective
introduction of a transgene into a particular cell
type is also possible by following, for example, the technique of Lasko er
al., Proc. Natl. Acad. Sci. USA, 89:6232-
636 ( 1992).
The expression of the transgene in transgenic animals can be monitored by
standard techniques. For
example, Southern blot analysis or PCR amplification can be used to verify the
integration of the transgene. The
level of mRNA expression can then be analyzed using techniques such as in situ
hybridization, Northern blot
analysis, PCR, or immunocytochemistry. The animals are further examined for
signs of tumor or cancer
development.
Alternatively, "knock out" animals can be constructed which have a defective
or altered gene encoding a
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PROI 112,
PR0509, PR0853 or PR0882 polypeptide identified herein, as a result of
homologous recombination between the
endogenous gene encoding the polypeptide and altered genomic DNA encoding the
same polypeptide introduced
into an embryonic cell of the animal. For example, cDNA encoding a PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO11 I 2, PR0509, PR0853 or
PR0882 polypeptide
can be used to clone genomic DNA encoding that polypeptide in accordance with
established techniques. A portion
of the genomic DNA encoding a particular PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide can be
deleted or replaced
with another gene, such as a gene encoding a selectable marker which can be
used to monitor integration. Typically,
several kilobases of unaltered flanking DNA (both at the S' and 3' ends) are
included in the vector [see, e.g., Thomas
and Capecchi, Cell, 51:503 ( 1987) for a description of homologous
recombination vectors]. The vector is
introduced into an embryonic stem cell line (e.g., by electroporation} and
cells in which the introduced DNA has
homologously --'recombined with the endogenous DNA are selected [see, e.g., Li
et al., Cell, 69:915 (1992)]. The
selected cells are then injected into a blastocyst of an animal (e.g., a mouse
or rat) to form aggregation chimeras
[see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical
Annroach, E. J. Robertson, ed.
(IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted
into a suitable pseudopregnant
female foster animal and the embryo brought to term to create a "knock out"
animal. Progeny harboring the
homologously recombined DNA in their germ cells can be identified by standard
techniques and used to breed
animals in which all cells of the animal contain the homologously recombined
DNA. Knockout animals can be
characterized for instance, by their ability to defend against certain
pathological conditions and by their development
of pathological conditions due to absence of the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide.
The efficacy of antibodies specifically binding the polypeptides identified
herein and other drug candidates,
can be tested also in the treatment of spontaneous animal tumors. A suitable
target for such studies is the feline oral
squamous cell carcinoma (SCC). Feline oral SCC is a highly invasive, malignant
tumor that is the most common
oral malignancy of cats, accounting for over 60% of the oral tumors reported
in this species. It rarely metastasizes
to distant sites, although this low incidence of metastasis may merely be a
reflection of the short survival times for
cats with this tumor. These tumors are usually not amenable to surgery,
primarily because of the anatomy of the
feline oral cavity. At present, there is no effective treatment for this
tumor. Prior to entry into the study, each cat
-76-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
undergoes complete clinical examination, biopsy, and is scanned by computed
tomography (CT). Cats diagnosed
with sublingual oral squamous cell tumors are excluded from the study. The
tongue can become paralyzed as a
result of such tumor, and even if the treatment kills the tumor, the animals
may not be able to feed themselves. Each
cat is treated repeatedly, over a longer period of time. Photographs of the
tumors will be taken daily during the
treatment period, and at each subsequent recheck. After treatment, each cat
undergoes another CT scan. CT scans
and thoracic radiograms are evaluated every 8 weeks thereafter. The data are
evaluated for differences in survival,
response and toxicity as compared to control groups. Positive response may
require evidence of tumor regression,
preferably with improvement of quality of life and/or increased life span.
In addition, other spontaneous animal tumors, such as fibrosarcoma,
adenocarcinoma, lymphoma,
chrondroma, leiomyosarcoma of dogs, cats, and baboons can also be tested. Of
these mammary adenocarcinoma
in dogs and cats is a preferred model as its appearance and behavior are very
similar to those in humans. However,
the use of this model is limited by the rare occurrence of this type of tumor
in animals.
K. Screening Assays for Drug Candidates
Screening assays for drug candidates are designed to identify compounds that
bind or complex with the
polypeptides encoded by the genes identified herein, or otherwise interfere
with the interaction of the encoded
polypeptides with other cellular proteins. Such screening assays will include
assays amenable to high-throughput
screening of chemical libraries, making them particularly suitable for
identifying small molecule drug candidates.
Small molecules contemplated include synthetic organic or inorganic compounds,
including peptides, preferably
solublepeptides, (poly)peptide-immunoglobulin fusions, and, in particular,
antibodies including, without limitation,
poly- and monoclonal antibodies and antibody fragments, single-chain
antibodies, anti-idiotypic antibodies, and
chimeric or humanized versions of such antibodies or fragments, as well as
human antibodies and antibody
fragments. The assays can be performed in a variety of formats, including
protein-protein binding assays,
biochemical screening assays, immunoassays and cell based assays, which are
well characterized in the art.
All assays are common in that they call for contacting the drug candidate with
a polypeptide encoded by
a nucleic acid identified herein under conditions and for a time sufficient to
allow these two components to interact.
In binding assays, the interaction is binding and the complex formed can be
isolated or detected in the
reaction mixture. In a particular embodiment, the polypeptide encoded by the
gene identified herein or the drug
candidate is immobilized on a solid phase, e.g., on a microtiter plate, by
covalent or non-covalent attachments. Non-
covalent attachment generally is accomplished by coating the solid surface
with a solution of the pofypeptide and
drying. Alternatively, an immobilized antibody, e.g., a monoclonal antibody,
specific for the polypeptide to be
immobilized can be used to anchor it to a solid surface. The assay is
performed by adding the non-immobilized
component, which may be labeled by a detectable label, to the immobilized
component, e.g., the coated surface
containing the anchored component. When the reaction is complete, the non-
reacted components are removed, e.g.,
by washing, and complexes anchored on the solid surface are detected. When the
originally non-immobilized
component carries a detectable label, the detection of label immobilized on
the surface indicates that complexing
occurred. Where the originally non-immobilized component does not carry a
label, complexing can be detected,
for example, by using a labeled antibody specifically binding the immobilized
complex.
_77_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
If the candidate compound interacts with but does not bind to a particular
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509,
PR0853 or PR0882
polypeptide encoded by a gene identified herein, its interaction with that
polypeptide can be assayed by methods
well known for detecting protein-protein interactions. Such assays include
traditional approaches, such as, cross-
linking, co-immunoprecipitation, and co-purification through gradients or
chromatographic columns. In addition,
protein-protein interactions can be monitored by using a yeast-based genetic
system described by Fields and co-
workers [Fields and Song, Nature, 340:245-246 (1989); Chien et al., Proc.
Natl. Acad. Sci. USA, 88: 9578-9582
(1991)], as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA,
89:5789-5793 (1991)]. Many
transcriptional activators, such as yeast GAL4, consist of two physically
discrete modular domains, one acting as
the DNA-binding domain, while the other one functioning as the transcription
activation domain. The yeast
expression system described in the foregoing publications (generally referred
to as the "two-hybrid system") takes
advantage of this property, and employs two hybrid proteins, one in which the
target protein is fused to the DNA-
binding domain of GAL4, and another, in which candidate activating proteins
are fused to the activation domain.
The expression of a GAL1-IacZ reporter gene under control of a GAL4-activated
promoter depends on
reconstitution of GAL4 activity via protein-protein interaction. Colonies
containing interacting polypeptides are
detected with a chromogenic substrate for ~3-galactosidase. A complete kit
(MATCHMAKERT"') for identifying
protein-protein interactions between two specific proteins using the two-
hybrid technique is commercially available
from Clontech. This system can also be extended to map protein domains
involved in specific protein interactions
as well as to pinpoint amino acid residues that are crucial for these
interactions.
Compounds that interfere with the interaction of a PR0201-, PR0292-, PR0327-,
PRO 1265-, PR0344-,
PR0343-, PR0347-, PR0357-, PR0715-, PRO 1017-, PRO 1112-, PR0509-, PR0853-or
PR0882-encoding gene
identified herein and other infra- or extracellular components can be tested
as follows: usually a reaction mixture
is prepared containing the product of the amplified gene and the infra- or
extracellular component under conditions
and for a time allowing for the interaction and binding of the two products.
To test the ability of a test compound
to inhibit binding, the reaction is run in the absence and in the presence of
the test compound. In addition, a placebo
may be added to a third reaction mixture, to serve as positive control. The
binding (complex formation) between
the test compound and the infra- or extracellular component present in the
mixture is monitored as described
hereinabove. The formation of a complex in the control reactions) but not in
the reaction mixture containing the
test compound indicates that the test compound interferes with the interaction
of the test compound and its reaction
partner.
To assay for antagonists, the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347,
PR0357, PR0715, PRO 1017, PR01112, PR0509, PR0853 or PR0882 poiypeptide may be
added to a cell along
with the compound to be screened for a particular activity and the ability of
the compound to inhibit the activity of
interest in the presence of the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882 polypeptide indicates that
the compound is an
antagonist to the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PRO1 I 12, PR0509, PR0853 or PR0882 polypeptide. Alternatively,
antagonists may be detected by
combining the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO 1017,
_78_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PRO 1112, PR0509, PR0853 or PR0882 polypeptide and a potential antagonist with
membrane-bound PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI
112, PR0509,
PR0853 or PR0882 polypeptide receptors or recombinant receptors under
appropriate conditions for a competitive
inhibition assay. The PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide can be labeled, such as
by radioactivity, such that
the number of PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR07 I 5, PRO 1017,
PR01112, PR0509, PR0853 or PR0882 polypeptide molecules bound to the receptor
can be used to determine
the effectiveness of the potential antagonist. The gene encoding the receptor
can be identified by numerous methods
known to those of skill in the art, for example, ligand panning and FACS
sorting. Coligan et al., Current Protocols
in Immun., )~: Chapter 5 (1991). Preferably, expression cloning is employed
wherein polyadenylated R~lA is
prepared from a cell responsive to the PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide and a
cDNA library created
from this RNA is divided into pools and used to transfect COS cells or other
cells that are not responsive to the
PR0201, PR0292, PR0327, PROI265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 polypeptide. Transfected cells that are grown on
glass slides are exposed to labeled
PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO
1017, PR01112,
PR0509, PR0853 or PR0882 polypeptide. The PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide
can be labeled by
a variety of means including iodination or inclusion of a recognition site for
a site-specific protein kinase.
Following fixation and incubation, the slides are subjected to
autoradiographic analysis. Positive pools are
identified and sub-pools are prepared and re-transfected using an interactive
sub-pooling and re-screening process,
eventually yielding a single clone that encodes the putative receptor.
As an alternative approach for receptor identification, labeled PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or
PR0882 polypeptide
can be photoaffinity-linked with cell membrane or extract preparations that
express the receptor molecule. Cross-
linked material is resolved by PAGE and exposed to X-ray film. The labeled
complex containing the receptor can
be excised, resolved into peptide fragments, and'subjected to protein micro-
sequencing. The amino acid sequence
obtained from micro-sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a
cDNA library to identify the gene encoding the putative receptor.
In another assay for antagonists, mammalian cells or a membrane preparation
expressing the receptor
would be incubated with labeled PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PROI 112, PR0509, PR0853 or PR0882 polypeptide in the
presence of the candidate
compound. The ability of the compound to enhance or block this interaction
could then be measured.
More specific examples of potential antagonists include an oligonucleotide
that binds to the fusions of
immunoglobulin with the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PROI 017, PRO1 I 12, PR0509, PR0853 or PR0882 polypeptide, and, in particular,
antibodies including, without
limitation, poly- and monoclonal antibodies and antibody fragments, single-
chain antibodies, anti-idiotypic
antibodies, and chimeric or humanized versions of such antibodies or
fragments, as well as human antibodies and
-79-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
antibody fragments. Alternatively, a potential antagonist may be a closely
related protein, for example, a mutated
form of the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PR01112, PR0509, PR0853 or PR0882 polypeptide that recognizes the receptor but
imparts no effect, thereby
competitively inhibiting the action of the PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PROI 017, PR01112, PR0509, PR0853 or PR0882 polypeptide.
Another potential PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357,
PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide antagonist is
an antisense RNA or DNA
construct prepared using antisense technology, where, e.g., an antisense RNA
or DNA molecule acts to block
directly the translation of mRNA by hybridizing to targeted mRNA and
preventing protein translation. Antisense
technology can be used to control gene expression through triple-helix
formation or antisense DNA or RNA, both
of which methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion
of the polynucleotide sequence, which encodes the mature PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882
polypeptide herein,
is used to design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved in transcription (triple helix - see,
Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al., Science, 241: 456
(1988); Dervan et al., Science,
251:1360 (1991)), thereby preventing transcription and the production of the
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509,
PR0853 or PR0882
polypeptide. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation of the
mRNA molecule into the PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PROI 017, PRO 1112, PR0509, PR0853 or PR0882 polypeptide (antisense - Okano,
Neurochem., 56:560 ( 1991 );
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press:
Boca Raton, FL, 1988). The
oligonuchtides described above can also be delivered to cells such that the
antisense RNA or DNA may be
expressed in vivo to inhibit production of the PR0201, PR0292, PR0327, PRO
1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide. When
antisense DNA is
used, oligodeoxyribonucleotides derived from the translation-initiation site,
e.g., between about -10 and +10
positions of the target gene nucleotide sequence; are preferred.
Antisense RNA or DNA molecules are generally at least about 5 bases in length,
about 10 bases in length,
about 15 bases in length, about 20 bases in length, about 25 bases in length,
about 30 bases in length, about 35 bases
in length, about 40 bases in length, about 45 bases in length, about 50 bases
in length, about 55 bases in length,
about 60 bases in length, about 65 bases in length, about 70 bases in length,
about 75 bases in length, about 80 bases
in length, about 85 bases in length, about 90 bases in length, about 95 bases
in length, about 100 bases in length,
or more.
Potential antagonists include small molecules that bind to the active site,
the receptor binding site, or
growth factor or other relevant binding site of the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882
polypeptide, thereby blocking
the normal biological activity of the PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide. Examples of
small molecules include,
-80-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
but are not limited to, small peptides or peptide-like molecules, preferably
soluble peptides, and synthetic non-
peptidyl organic or inorganic compounds.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA. Ribozymes
act by sequence-specific hybridization to the complementary target RNA,
followed by endonucleoiytic cleavage.
Specific ribozyme cleavage sites within a potential RNA target can be
identified by known techniques. For further
details see, e.g., Rossi, Current Bioloey, 4:469-471 (1994), and PCT
publication No. WO 97/33551 (published
September 18, 1997).
Nucleic acid molecules in triple-helix formation used to inhibit transcription
should be single-stranded and
composed of deoxynucleotides. The base composition of these oligonucleotides
is designed such that it promotes
triple-helix formation via Hoogsteen base-pairing rules, which generally
require sizeable stretches of purines or
pyrimidines on one strand of a duplex. For further details see, e.g., PCT
publication No. WO 97/33551, supra.
These small molecules can be identified by any one or more of the screening
assays discussed hereinabove
and/or by any other screening techniques well known for those skilled in the
art.
L. Compositions and Methods for the Treatment of Tumors
The compositions useful in the treatment of tumors associated with the
amplification of the genes identified
herein include, without limitation, antibodies, small organic and inorganic
molecules, peptides, phosphopeptides,
antisense and ribozyme molecules, triple helix molecules, etc., that inhibit
the expression and/or activity of the target
gene product.
For example, antisense RNA and RNA molecules act to directly block the
translation of mRNA by
hybridizing to targeted mRNA and preventing protein translation. When
antisense DNA is used,
oligodeoxyribonucleotides derived from the translation initiation site, e.g.,
between about -10 and +10 positions
of the target gene nucleotide sequence, are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA. Ribozymes
act by sequence-specific hybridization to the complementary target RNA,
followed by endonucleolytic cleavage.
Specific ribozyme cleavage sites within a potential RNA target can be
identified by known techniques. For further
details see, e.g., Rossi, Current Biolow, 4:469-471 (1994), and PCT
publication No. WO 97/33551 (published
September 18, 1997).
Nucleic acid molecules in triple helix formation used to inhibit transcription
should be single-stranded and
composed of deoxynucleotides. The base composition of these oligonucleotides
is designed such that it promotes
triple helix formation via Hoogsteen base pairing rules, which generally
require sizeable stretches of purines or
pyrimidines on one strand of a duplex. For further details see, e.g., PCT
publication No. WO 97/33551, supra.
These molecules can be identified by any or any combination of the screening
assays discussed
hereinabove and/or by any other screening techniques well known for those
skilled in the art.
M. Antibodies
Some of the most promising drug candidates according to the present invention
are antibodies and antibody
fragments which may inhibit the production or the gene product of the
amplified genes identified herein and/or
_81-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
reduce the activity of the gene products.
1. Polvclonal Antibodies
Methods of preparing polyclonal antibodies are known to the skilled artisan.
Polyclonal antibodies can
be raised in a mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant.
Typically, the immunizing agent and/or adjavant will be injected in the mammal
by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the PR0201,
PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or PR0882
polypeptide or a fusion
protein thereof. It may be useful to conjugate the immunizing agent to a
protein known to be immunogenic in the
mammal being immunized. Examples of such immunogenic proteins include but are
not limited to keyhole limpet
hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin
inhibitor. Examples of adjuvants which
may be employed include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic
trehalose dicorynomycolate). The immunization protocol may be selected by one
skilled in the art without undue
experimentation.
2. Monoclonal Antibodies
The anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-
PR0343, anti-PR0347,
anti-PR0357, anti-PR0715, anti-PRO 1017, anti-PRO 1112, anti-PR0509, anti-
PR0853 or anti-PR0882 antibodies
may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be
prepared using hybridoma methods,
such as those described by Kohler and Milstein, Nature, 256:495 ( 1975). In a
hybridoma method, a mouse, hamster,
or other appropriate host animal, is typically immunized with an immunizing
agent to elicit lymphocytes that
produce or are capable of producing antibodies that will specifically bind to
the immunizing agent. Alternatively,
the lymphocytes may be immunized iia vitro.
The immunizing agent will typically include the PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO I 112, PR0509, PR0853 or PR0882
polypeptide, including
fragments, or a fusion protein of such protein or a fragment thereof.
Generally, either peripheral blood lymphocytes
("PBLs") are used if cells of human origin are desired, or spleen cells or
lymph node cells are used if non-human
mammalian sources are desired. The lymphocytes are then fused with an
immortalized cell line using a suitable
fusing agent, such as polyethylene glycol, to form a hybridoma cell [coding,
Monoclonal Antibodies: Princiules
and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are
usually transformed mammalian
cells, particularly myeloma cells of rodent, bovine and human origin. Usually,
rat or mouse myeloma cell lines are
employed. The hybridoma cells may be cultured in a suitable culture medium
that preferably contains one or more
substances that inhibit the growth or survival of the unfused, immortalized
cells. For example, if the parental cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or
HPRT), the culture medium for the
hybridomas typically will include hypoxanthine, aminopterin, and thymidine
("HAT medium"), which substances
prevent the growth of HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support
stable high level expression of
antibody by the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More
-82-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
preferred immortalized cell lines are murine myeloma lines, which can be
obtained, for instance, from the Salk
Institute Cell Distribution Center, San Diego, California and the American
Type Culture Collection (ATCC),
Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines
also have been described for
the production of human monoclonal antibodies [Kozbor, J. Immunol.,133:3001 (
1984); Brodeur etal., Monoclonal
Antibody Production Techniaues and Annlications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of
monoclonal antibodies directed against PR0201, PR0292, PR0327, PROI 265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882. Preferably, the
binding specificity of
monoclonal antibodies produced by the hybridoma cells is determined by
imrnunoprecipitation or by an in vitro
binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent
assay (ELISA). Such
techniques and assays are known in the art. The binding affinity of the
monoclonal antibody can, for example, be
determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem.,
107:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned
by limiting dilution
procedures and grown by standard methods [coding, supra]. Suitable culture
media for this purpose include, for
example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma cells may
be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or
purified from the culture medium
or ascites fluid by conventional immunoglobulin purification procedures such
as, forexample, protein A-Sepharose,
hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity
chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as
those described in
U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the
invention can be readily isolated and
sequenced using conventional procedures (e.g., by using oligonucleotide probes
that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the
invention serve as a preferred source of such DNA. Once isolated, the DNA may
be placed into expression vectors,
which are then transfected into host cells such as simian COS cells, Chinese
hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein, to obtain
the synthesis of monoclonal
antibodies in the recombinant host cells. The DNA also may be modified, for
example, by substituting the coding
sequence for human heavy and light chain constant domains in place of the
homologous murine sequences [U.S.
Patent No. 4,816,567; Morrison et al., supra] or by covalently joining to the
immunoglobulin coding sequence all
or pan of the coding sequence for a non-immunoglobulin polypeptide. Such a non-
immunoglobulin polypeptide
can be substituted for the constant domains of an antibody of the invention,
or can be substituted for the variable
domains of one antigen-combining site of an antibody of the invention to
create a chimeric bivalent antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent
antibodies are well
known in the art. For example, one method involves recombinant expression of
immunoglobulin light chain and
modified heavy chain. The heavy chain is truncated generally at any point in
the Fc region so as to prevent heavy
chain crossIinking. Alternatively, the relevant cysteine residues are
substituted with another amino acid residue or
are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies.
Digestion of antibodies to produce
-83-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
fragments thereof, particularly, Fab fragments, can be accomplished using
routine techniques known in the art.
3. Human and Humanized Antibodies
The anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265, anti-PR0344, anti-
PR0343, anti-PR0347,
anti-PR0357, anti-PR0715, anti-PR01017, anti-PR01112, anti-PR0509, anti-PR0853
or anti-PR0882 antibodies
may further comprise humanized antibodies or human antibodies. Humanized forms
of non-human (e.g., murine)
antibodies are chimeric imrnunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab',
F(ab'), or other antigen-binding subsequences of antibodies) which contain
minimal sequence derived from non-
human immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which
residues from a complementary determining region (CDR) of the recipient are
replaced by residues from a CDR
of a non-human species (donor antibody) such as mouse, rat or rabbit having
the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human immunoglobulin
are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues which are
found neither in the recipient
antibody nor in the imported CDR or framework sequences. In general, the
humanized antibody will comprise
substantially all of at least one, and typically two, variable domains, in
which all or substantially all of the CDR
1 S regions correspond to those of a non-human immunoglobulin and all or
substantially all of the FR regions are those
of a human immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least
a portion of an immunoglobulin constant region (Fc), typically that of a human
immunoglobulin [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and
Presta, Curr. Op. Struct. Biol.,
2:593-596 ( 1992)].
Methods for humanizing non-human antibodies are well known in the art.
Generally, a humanized
antibody has one or more amino acid residues introduced into it from a source
which is non-human. These non-
human amino acid residues are often referred to as "import" residues, which
are typically taken from an "import"
variable domain. Humanization can be essentially performed following the
method of Winter and co-workers
[Jones et al., Nature. 321:522-525 (1986); Riechmann et al., Nature, 332:323-
327 (1988); Verhoeyen et al.,
Science, 239:1534-1536 ( 1988)], by substituting rodent CDRs or CDR sequences
for the corresponding sequences
of a human antibody. Accordingly, such "humanized" antibodies are chimeric
antibodies (U.S. Patent No.
4,816,567), wherein substantially less than an intact human variable domain
has been substituted by the
corresponding sequence from a non-human species. In practice, humanized
antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues are
substituted by residues from analogous
sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the
art, including phage display
libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991 ); Marks et
al., J. Mol. Biol., 222:581 (1991 )].
The techniques of Cole et al., and Boerner et al., are also available for the
preparation of human monoclonal
antibodies (Cole et al., Monoclonal Antibodies and Cancer Theranv, Alan R.
Liss, p. 77 ( 1985) and Boerner et al.,
J. ImmunoL, 147(1):86-95 (1991)]. Similarly, human antibodies can be made by
introducing of human
immunoglobulin loci into transgenic animals, e.g., mice in which the
endogenous immunoglobulin genes have been
partially or completely inactivated. Upon challenge, human antibody production
is observed, which closely
-84-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
resembles that seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire.
This approach is described, for example, in U.S. Patent Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126;
5,633,425; 5,661,016, and in the following scientific publications: Marks et
al., Bio/Technoloey, 10:779-783
( 1992); Lonberg et al., Nature, 368:856-859 ( 1994); Morrison, Nature,
368:812-13 ( 1994); Fishwild et al., Nature
Biotechnology, 14:845-51 ( 1996); Neuberger, Nature Biotechnolow, 14:826 (
1996); Lonberg and Huszar, Intern.
Rev. Immunol., 13:65-93 (1995).
4. Antibody Dependent Enzyme Mediated ProdruQ Therapy (ADEPT)
The antibodies of the present invention may also be used in ADEPT by
conjugating the antibody to a
prodrug-activating enzyme which converts a prodrug (e.g., a peptidyl
chemotherapeutic agent, see WO 81/01145)
to an active anti-cancer drug. See, for example, WO 88/07378 and U. S. Patent
No. 4,975,278.
The enzyme component of the immunoconj ugate useful for ADEPT includes any
enzyme capable of acting
on a prodrug in such as way so as to convert it into its more active,
cytotoxic form.
Enzymes that are useful in the method of this invention include, but are not
limited to, glycosidase, glucose
oxidase, human lysosyme, human glucuronidase, alkaline phosphatase useful for
converting phosphate-containing
prodrugs into free drugs; arylsulfatase useful for converting sulfate-
containing prodrugs into free drugs; cytosine
deaminase useful forconverting non-toxic 5-fluorocytosine into the anti-
cancerdrug 5-fluorouracil; proteases, such
as serratia protease, thermolysin, subtilisin, carboxypeptidases (e.g.,
carboxypeptidase G2 and carboxypeptidase
A) and cathepsins (such as cathepsins B and L), that are useful for converting
peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs that contain
D-amino acid substituents;
carbohydrate-cleaving enzymes such as ~i-galactosidase and neuraminidase
useful for converting glycosylated
prodrugs into free drugs; ~i-lactamase useful for converting drugs derivatized
with ~i-lactams into free drugs; and
penicillin amidases, such as penicillin Vamidase or penicillin G amidase,
useful for converting drugs derivatized
at their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Alternatively,
antibodies with enzymatic activity, also known in the art as "abzymes" can be
used to convert the prodrugs of the
invention into free active drugs (see, e.g., Massey, Nature, 328:457-458 (
1987)). Antibody-abzyme conjugates can
be prepared as described herein for delivery of the abzyme to a tumor cell
population.
The enzymes of this invention can be covalently bound to the anti-PR0201, anti-
PR0292, anti-PR0327,
anti-PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715,
anti-PR01017, anti-
PRO 1112, anti-PR0509, anti-PR0853 or anti-PR0882 antibodies by techniques
well known in the art such as the
use of the heterobifunctional cross-linking agents discussed above.
Alternatively, fusion proteins comprising at
least the antigen binding region of the antibody of the invention linked to at
least a functionally active portion of
an enzyme of the invention can be constructed using recombinant DNA techniques
well known in the art (see, e.g.,
Neuberger et al., Nature, 312:604-608 ( 1984)}.
5. Bisnecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized,
antibodies that have binding
specificities for at feast two different antigens. In the present case, one of
the binding specificities is for the
-85-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PROl0I7, PR01112,
PR0509, PR0853 or PR0882 the other one is for any other antigen, and
preferably for a cell-surface protein or
receptor or receptor subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the recombinant production
of bispecific antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where
the two heavy chains have different specificities (Milstein and Cuello,
Nature, 305:537-539 [1983]). Because of
the random assortment of immunoglobulin heavy and Light chains, these
hybridomas (quadromas) produce a
potential mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The
purification of the correct molecule is usually accomplished by affinity
chromatography steps. Similar procedures
are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al.,
EMBO J., 10:3655-3659 ( 1991 ).
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites) can
be fused to immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-
chain constant domain, comprising at least part of the hinge, CH2, and CH3
regions. It is preferred to have the first
heavy-chain constant region (CH1) containing the site necessary for light-
chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if
desired, the immunoglobulin light
chain, are inserted into separate expression vectors, and are co-transfected
into a suitable host organism. For further
details of generating bispecific antibodies see, for example, Suresh etal.,
Methods in EnzvmoloQV,121:210 (1986).
According to another approach described in WO 96/2701 l, the interface between
a pair of antibody
molecules can be engineered to maximize the percentage of heterodimers which
are recovered from recombinant
cell culture. The preferred interface comprises at least a part of the CH3
region of an antibody constant domain.
In this method, one or more small amino acid side chains from the interface of
the first antibody molecule are
replaced with larger side chains (e.g., tyrosine or tryptophan). Compensatory
"cavities" of identical or similar size
to the large side chains) are created on the interface of the second antibody
molecule by replacing large amino acid
side chains with smaller ones (e.g., alanine or threonine). This provides a
mechanism for increasing the yield of
the heterodimer over other unwanted end-products such as homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody
fragments (e.g., F(ab'),
bispecific antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been
described in the literature. For example, bispecific antibodies can be
prepared using chemical linkage. Brennan
et al., Science, 229:81 ( 1985) describe a procedure wherein intact antibodies
are proteolytically cleaved to generate
F(ab'), fragments. These fragments are reduced in the presence of the dithiol
complexing agent sodium arsenite
to stabilize vicinal dithiols and prevent intermolecular disulfide formation.
The Fab' fragments generated are then
converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-
thiol by reduction with mercaptoethylamine and is mixed with an equimolar
amount of the other Fab'-TNB
derivative to form the bispecific antibody. The bispecific antibodies produced
can be used as agents for the
selective immobilization of enzymes.
Fab' fragments may be directly recovered from E. coli and chemically coupled
to form bispecific
antibodies. Shalaby et al., J. Exn. Med., 175:217-225 (1992) describe the
production of a fully humanized
bispecific antibody F(ab')2 molecule. Each Fab' fragment was separately
secreted from E. coli and subjected to
-86-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
directed chemical coupling in vitro to form the bispecific antibody. The
bispecific antibody thus formed was able
to bind to cells overexpressing the ErbB2 receptor and normal human T cells,
as well as trigger the lytic activity
of human cytotoxic lymphocytes against human breast tumor targets.
Various techniques for making and isolating bispecific antibody fragments
directly from recombinant cell
culture have also been described. For example, bispecific antibodies have been
produced using leucine zippers.
Kostelny er al., J. Immunol., 148 S :1547-I 553 ( 1992). The leucine zipper
peptides from the Fos and Jun proteins
were linked to the Fab' portions of two different antibodies by gene fusion.
The antibody homodimers were reduced
at the hinge region to form monomers and then re-oxidized to form the antibody
heterodimers. This method can
also be utilized for the production of antibody homodimers. The "diabody"
technology described by Hollinger et
al., Proc. Natl. Acad. Sci. USA. 90:6444-6448 ( 1993) has provided an
alternative mechanism for making bispecific
antibody fragments. The fragments comprise a heavy-chain variable domain (V")
connected to a light-chain
variable domain (V~) by a linker which is too short to allow pairing between
the two domains on the same chain.
Accordingly, the VH and V~ domains of one fragment are forced to pair with the
complementary V~ and V" domains
of another fragment, thereby forming two antigen-binding sites. Another
strategy for making bispecific antibody
fragments by the use of single-chain Fv (sFv) dimers has also been reported.
See, Gruber et al., J. Immunol.,
152:5368 ( 1994).
Antibodies wish more than two valencies are contemplated. For example,
trispecific antibodies can be
prepared. Tutt et al., J. Immunol., 147:60 (1991 ).
Exemplary bispecific antibodies may bind to two different epitopes on a given
polypeptide herein.
Alternatively, an anti-polypeptide arm may be combined with an arm which binds
to a triggering molecule on a
leukocyte such as a T-cell receptor molecule (e.g., CD2, CD3, CD28, or B7), or
Fc receptors for IgG (FcyR), such
as FcyRI (CD64), FcyRII (CD32) and FcyRIII (CD16) so as to focus cellular
defense mechanisms to the cell
expressing the particular polypeptide. Bispecitic antibodies may also be used
to localize cytotoxic agents to cells
which express a particular polypeptide. These antibodies possess a polypeptide-
binding arm and an arm which
binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA,
DOTA, or TETA. Another bispecific
antibody of interest binds the polypeptide and further binds tissue factor
(TF).
6. Heteroconiugate Antibodies
Heteroconjugate antibodies are composed of two covalently joined antibodies.
Such antibodies have, for
example, been proposed to target immune system cells to unwanted cells [U.S.
Patent No. 4,676,980], and for
treatment of HIV infection [WO 91 /00360; WO 92/200373; EP 03089]. It is
contemplated that the antibodies may
be prepared in vitro using known methods in synthetic protein chemistry,
including those involving crosslinking
agents. For example, immunotoxins may be constructed using a disulfide
exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-
mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No.
4,676,980.
7. Effector function enaineerinQ
It may be desirable to modify the antibody of the invention with respect to
effector function, so as to
_87_
CA 02353775 2001-06-04
WO 00/3'7640 PCTNS99/30095
enhance the effectiveness of the antibody in treating cancer, for example. For
example, cysteine residues) may be
introduced in the Fc region, thereby allowing interchain disulfide bond
formation in this region. The homodimeric
antibody thus generated may have improved internalization capability and/or
increased complement-mediated cell
killing and antibody-dependent cellular cytotoxicity (ADCC). See, Caron et
al., J. Exn. Med., 176:1191-1195
( 1992) and Shopes, J. Immunol.,148:2918-2922 ( 1992). Homodimeric antibodies
with enhanced anti-tumor activity
may also be prepared using heterobifunctional cross-linkers as described in
Wolff et al., Cancer Research, S3:2S60-
2565 (1993). Alternatively, an antibody can be engineered which has dual Fc
regions and may thereby have
enhanced complement lysis and ADCC capabilities. See, Stevenson et al., Anti-
Cancer Drug Design, 3:219-230
( 1989).
8. Immunoconiugates
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic agent
such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin
of bacterial, fungal, plant or animal
origin, or fragments thereof, or a small molecule toxin), or a radioactive
isotope (i.e., a radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described above.
Enzymatically active protein toxins and fragments thereof which can be used
include diphtheria A chain, nonbinding
active fragments of diphtheria toxin, cholera toxin, botulinus toxin, exotoxin
A chain (from Pseudomonas
aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPA, and PAP-S), momordica
charantia inhibitor, curcin, crotin,
sapaonaria officinalis inhibitor, gelonin, saporin, mitogellin, restrictocin,
phenomycin, enomycin and the
tricothecenes. Small molecule toxins include, for example, calicheamicins,
maytansinoids, palytoxin and CC106S.
A variety of radionuclides are available for the production of radioconjugated
antibodies. Examples include Z'213i,
~3~I,~ ~3~In, ~'Y and ~"~Re.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein coupling
agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives
of imidoesters (such as dimethyl adipimidate HCL), active esters (such as
disuccinimidyl suberate), aldehydes (such
as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl)
hexanediamine), bis-diazonium derivatives
(such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as
tolyene 2,6-diisocyanate), and bis-
active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be
prepared as described in Vitetta et al., Science, 238:1098 (1987). Carbon-14-
labeled 1-isothiocyanatobenzyl-3-
methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating
agent for conjugation of
radionucleotide to the antibody. See, W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such as
streptavidin) for
utilization in tumor pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed
by removal of unbound conjugate from the circulation using a clearing agent
and then administration of a "ligand"
(e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a
radionucleotide).
_88_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
9. Immunolinosomes
The antibodies disclosed herein may also be formulated as immunoliposomes.
Liposomes containing the
antibody are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad. Sci. USA,
82:3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77:4030 ( 1980); and
U.S. Patent Nos. 4,485,045 and
4,544,545. Liposomes with enhanced circulation time are disclosed in U.S.
Patent No. 5,013,556.
Particularly useful liposomes can be generated by the reverse phase
evaporation method with a lipid
composition comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-
PE). Liposomes are extruded through filters of defined pore size to yield
liposomes with the desired diameter. Fab'
fragments of the antibody of the present invention can be conjugated to the
liposomes as described in Martin etal.,
1. Biol. Chem., 257:286-288 (1982) via a disulfide interchange reaction. A
chemotherapeutic agent (such as
Doxorubicin) is optionally contained within the liposome. See, Gabizon etal.,
J. National CancerInst., 81 ( 19}:1484
( 1989).
N. Pharmaceutical COmDOSIti011S
Antibodies specifically binding the product of an amplified gene identified
herein, as well as other
molecules identified by the screening assays disclosed hereinbefore, can be
administered for the treatment of
tumors, including cancers, in the form of pharmaceutical compositions.
If the protein encoded by the amplified gene is intracellular and whole
antibodies are used as inhibitors,
internalizing antibodies are preferred. However, lipofections or liposomes can
also be used to deliver the antibody,
or an antibody fragment, into cells. Where antibody fragments are used, the
smallest inhibitory fragment which
specifically binds to the binding domain of the target protein is preferred.
For example, based upon the variable
region sequences of an antibody, peptide molecules can be designed which
retain the ability to bind the target
protein sequence. Such peptides can be synthesized chemically and/or produced
by recombinant DNA technology
(see, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 [ 1993]).
Therapeutic formulations of the antibody are prepared for storage by mixing
the antibody having the
desired degree of purity with optional pharmaceutically acceptable carriers,
excipients or stabilizers (Remington's
Pharmaceutical Sciences, 16th edition, Osol, A'. ed. [1980]), in the form of
lyophilized formulations or aqueous
solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to
recipients at the dosages and concentrations
employed, and include buffers such as phosphate, citrate, and other organic
acids; antioxidants including ascorbic
acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium
chloride; hexarr~thoniumchloride;
benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol;
alkyl parabens such as methyl or
propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol);
low molecular weight (less than
about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic
polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or
lysine; monosaccharides, disaccharides, and other carbohydrates including
glucose, mannose, or dextrins; chelating
agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol;
salt-forming counter-ions such as
sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic
surfactants such as TWEENT"',
PLURONICST"' or polyethylene glycol (PEG).
-89-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Non-antibody compounds identified by the screening assays of the present
invention can be formulated
in an analogous manner, using standard techniques well known in the art.
The formulation herein may also contain more than one active compound as
necessary for the particular
indication being treated, preferably those with complementary activities that
do not adversely affect each other.
Alternatively, or in addition, the composition may comprise a cytotoxic agent,
cytokine or growth inhibitory agent.
Such molecules are suitably present in combination in amounts that are
effective for the purpose intended.
The active ingredients may also be entrapped in microcapsules prepared, for
example, by coacervation
techniques or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsules and poly-
(methylmethacylate) microcapsules, respectively, in colloidal drug delivery
systems (for example, liposomes,
albumin microspheres, microemulsions, nano-particles and nanocapsules) or in
macroemuisions. Such techniques
are disclosed in Remingtori s Pharmaceutical Sciences, 16th edition, Osol, A.
ed. (1980).
The formulations to be used for in vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-
release preparations
include semiperrneable matrices of solid hydrophobic polymers containing the
antibody, which matrices are in the
form of shaped articles, e.g., films or microcapsules. Examples of sustained-
release matrices include polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides (U.S. Pat. No.
3,773,919), copolymers of L-glutanuc acid and ethyl-L-glutamate,
non~iegradable ethylene-vinyl acetate,
degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT T""
(injectable microspheres
composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid.
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid
enable release of molecules for over 100
days, certain hydrogels release proteins for shorter time periods. When
encapsulated antibodies remain in the body
for a long time, they may denature or aggregate as a result of exposure to
moisture at 37°C, resulting in a loss of
biological activity and possible changes in immunogenicity. Rational
strategies can be devised for stabilization
depending on the mechanism involved. For example, if the aggregation mechanism
is discovered to be
intermolecular S-S bond formation through thio-disulfide interchange,
stabilization may be achieved by modifying
sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture
content, using appropriate additives,
and developing specific polymer matrix compositions.
O. Methods of Treatment
It is contemplated that the antibodies and other anti-tumor compounds of the
present invention may be used
to treat various conditions, including those characterized by overexpression
and/or activation of the amplified genes
identified herein. Exemplary conditions or disorders to be treated with such
antibodies and other compounds,
including, but not limited to, small organic and inorganic molecules,
peptides, antisense molecules, etc., include
benign or malignant tumors (e.g., renal, liver, kidney, bladder, breast,
gastric, ovarian, colorectal, prostate,
pancreatic, lung, vulval, thyroid, hepatic carcinomas; sarcomas;
glioblastomas; and various head and neck tumors);
leukemias and lymphoid malignancies; other disorders such as neuronal, glial,
astrocytal, hypothalamic and other
glandular, macrophagal, epithelial, stromal and blastocoelic disorders; and
inflammatory, angiogenic and
=90-
CA 02353775 2001-06-04
WO 00/37640 PCTlUS99/30095
immunologic disorders.
The anti-tumor agents of the present invention, e.g., antibodies, are
administered to a mammal, preferably
a human, in accord with known methods, such as intravenous administration as a
bolus or by continuous infusion
over a period of time, by intramuscular, intraperitoneal, intracerobrospinal,
subcutaneous, intra-articular,
intrasynovial, intrathecal, oral, topical, or inhalation routes. Intravenous
administration of the antibody is preferred.
Other therapeutic regimens may be combined with the administration of the anti-
cancer agents, e.g.,
antibodies of the instant invention. For example, the patient to be treated
with such anti-cancer agents may also
receive radiation therapy. Alternatively, or in addition, a chemotherapeutic
agent may be administered to the
patient. Preparation and dosing schedules for such chemotherapeutic agents may
be used according to
manufacturers' instructions or as determined empirically by the skilled
practitioner. Preparation and dosing
schedules for such chemotherapy are also described in Chemotherapy Service
Ed., M.C. Perry, Williams & Wilkins,
Baltimore, MD ( 1992). The chemotherapeutic agent may precede, or follow
administration of the anti-tumor agent,
e.g., antibody, or may be given simultaneously therewith. The antibody may be
combined with an anti-oestrogen
compound such as tamoxifen or an anti-progesterone such as onapristone (see,
EP 616812) in dosages known for
such molecules.
It may be desirable to also administer antibodies against other tumor
associated antigens, such as antibodies
which bind to the ErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor
(VEGF). Alternatively, or in
addition, two or more antibodies binding the same or two or more different
antigens disclosed herein may be co-
administered to the patient. Sometimes, it may be beneficial to also
administer one or more cytokines to the patient.
In a preferred embodiment, the antibodies herein are co-administered with a
growth inhibitory agent. For example,
the growth inhibitory agent may be administered first, followed by an antibody
of the present invention. However,
simultaneous administration or administration of the antibody of the present
invention first is also contemplated.
Suitable dosages for the growth inhibitory agent are those presently used and
may be lowered due to the combined
action (synergy) of the growth inhibitory agent and the antibody herein.
For the prevention or treatment of disease, the appropriate dosage of an anti-
tumor agent, e.g., an antibody
herein will depend on the type of disease to be treated, as defined above, the
severity and course of the disease,
whether the agent is administered for preventive or therapeutic purposes,
previous therapy, the patient's clinical
history and response to the agent, and the discretion of the attending
physician. The agent is suitably administered
to the patient at one time or over a series of treatments.
For example, depending on the type and severity of the disease, about 1 ~g/kg
to 15 mg/kg (e.g., 0.1-20
mg/kg) of antibody is an initial candidate dosage for administration to the
patient, whether, for example, by one or
more separate administrations, or by continuous infusion. A typical daily
dosage might range from about 1 ~g/kg
to 100 mg/kg or more, depending on the factors mentioned above. For repeated
administrations over several days
or longer, depending on the condition, the treatment is sustained until a
desired suppression of disease symptoms
occurs. However, other dosage regimens may be useful. The progress of this
therapy is easily monitored by
conventional techniques and assays.
-91-
CA 02353775 2001-06-04
WO 00/37640 PGT/L1S99/30095
P. Articles of Manufacture
In another embodiment of the invention, an article of manufacture containing
materials useful for the
diagnosis or treatment of the disorders described above is provided. The
article of manufacture comprises a
container and a label. Suitable containers include, for example, bottles,
vials, syringes, and test tubes. The
containers may be formed from a variety of materials such as glass or plastic.
The container holds a composition
which is effective for diagnosing or treating the condirion and may have a
sterile access port (for example the
container may be an intravenous solution bag or a vial having a stopper
pierceabie by a hypodermic injection
needle). The active agent in the composition is usually an anti-tumor agent
capable of interfering with the activity
of a gene product identified herein, e.g., an antibody. The label on, or
associated with, the container indicates that
the composition is used for diagnosing or treating the condition of choice.
The article of manufacture may further
comprise a second container comprising a pharmaceutically-acceptable buffer,
such as phosphate-buffered saline,
Ringer's solution and dextrose solution. It may further include other
materials desirable from a commercial and user
standpoint, including other buffers, diluents, filters, needles, syringes, and
package inserts with instructions for use.
Q. Diaenosis and Prog-nosis of Tumors
While cell surface proteins, such as growth receptors overexpressed in certain
tumors are excellent targets
for drug candidates or tumor (e.g., cancer) treatment, the same proteins along
with secreted proteins encoded by
the genes amplified in tumor cells find additional use in the diagnosis and
prognosis of tumors. For example,
antibodies directed against the protein products of genes amplified in tumor
cells can be used as tumor diagnostics
or prognostics.
For example, antibodies, including antibody fragments, can be used to
qualitatively or quantitatively detect
the expression of proteins encoded by the amplified genes ("marker gene
products"). The antibody preferably is
equipped with a detectable, e.g., fluorescent label, and binding can be
monitored by light microscopy, flow
cytometry, fluorimetry, or other techniques known in the art. These techniques
are particularly suitable, if the
amplified gene encodes a cell surface protein, e.g., a growth factor. Such
binding assays are performed essentially
as described in section 5 above.
In situ detection of antibody binding to the marker gene products can be
performed, for example, by
immunofluorescence or immunoelectron microscopy. For this purpose, a
histological specimen is removed from
the patient, and a labeled antibody is applied to it, preferably by overlaying
the antibody on a biological sample.
This procedure also allows for determining the distribution of the marker gene
product in the tissue examined. It
will be apparent for those skilled in the art that a wide variety of
histological methods are readily available for ira
situ detection.
The following examples are offered for illustrative purposes only, and are not
intended to limit the scope
of the present invention in any way.
All patent and literature references cited in the present specification are
hereby incorporated by reference
in their entirety.
-92-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
EXAMPLES
Comrnercially available reagents referred to in the examples were used
according to manufacturer's
instructions unless otherwise indicated. The source of those cells identified
in the following examples, and
throughout the specification, by ATCC accession numbers is the American Type
Culture Collection, 10801
University Blvd., Manassas, VA 20110-2209. All original deposits referred to
in the present application were made
under the provisions of the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms for
the Purpose of Patent Procedure and the Regulations thereunder (Budapest
Treaty). This assures maintenance of
a viable culture of the deposit for 30 years from the date of deposit. The
deposit will be made available by ATCC
under the terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc., and ATCC, which
IO assures permanent and unrestricted availability of the progeny of the
culture of the deposit to the public upon
issuance of the pertinent U.S. patent or upon laying open to the public of any
U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to one
determined by the U.S. Commissioner of
Patents and Trademarks to be entitled thereto according to 35 USC ~ 122 and
the Commissioner's rules pursuant
thereto (including 37 CFR ~ 1.14 with particular reference to 886 OG 638).
Unless otherwise noted, the present invention uses standard procedures of
recombinant DNA technology,
such as those described hereinabove and in the following textbooks: Sambrook
et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Press N.Y., 1989; Ausubel et al.,
Current Protocols in Molecular Bioloav,
Green Publishing Associates and Wiley Interscience, N.Y., 1989; Innis et al.,
PCR Protocols: A Guide to Methods
and Applications, Academic Press, Inc., N.Y., 1990; Harlow etal., Antibodies:
A Laboratory Manual, Cold Sorins
Harbor Press, Cold Spring Harbor,1988; Gait, Oli~onucleotide Synthesis, IRL
Press, Oxford, 1984; R.I. Freshney,
Animal Cell Culture, 1987; Coligan et al., Current Protocols in Immunoloey,
1991.
EXAMPLE 1
Extracellular Domain Homolosv Screenins to Identify Novel Polvpeutides and
cDNA Encodins Therefor
The extracellular domain (ECD) sequences (including the secretion signal
sequence, if any) from about
950 known secreted proteins from the Swiss-Prot public database were used to
search EST databases. The EST
databases included public databases (e.g., Dayhoff, GenBank), and proprietary
databases (e.g. LIFESEQ~, Incyte
Pharmaceuticals, Palo Alto, CA). The search was performed using the computer
program BLAST or BLAST-2
(Altschul et al., Methods in Enzyrnoloay, 266:460-480 ( 1996)) as a comparison
of the ECD protein sequences to
a 6 frame translation of the EST sequences. Those comparisons with a BLAST
score of 70 (or in some cases 90)
or greater that did not encode known proteins were clustered and assembled
into consensus DNA sequences with
the program "phrap" (Phil Green, University of Washington, Seattle,
Washington).
Using this extracellular domain homology screen, consensus DNA sequences were
assembled relative to
the other identified EST sequences using phrap. In addition, the consensus DNA
sequences obtained were often
(but not always) extended using repeated cycles of BLAST or BLAST-2 and phrap
to extend the consensus
sequence as far as possible using the sources of EST sequences discussed
above.
Based upon the consensus sequences obtained as described above,
oligonucleotides were then synthesized
and used to identify by PCR a cDNA library that contained the sequence of
interest and for use as probes to isolate
-93-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
a clone of the full-length coding sequence for a PRO polypeptide. Forward and
reverse PCR primers generally
range from 20 to 30 nucleotides and are often designed to give a PCR product
of about 100-1000 by in length. The
probe sequences are typically 40-55 by in length. In sorry cases, additional
oligonucleotides are synthesized when
the consensus sequence is greater than about 1-1.5 kbp. In order to screen
several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per Ausubel et
al., Current Protocols in Molecular
Biology, with the PCR primer pair. A positive library was then used to isolate
clones encoding the gene of interest
using the probe oligonucleotide and one of the primer pairs.
The cDNA libraries used to isolate the cDNA clones were constructed by
standard methods using
commercially available reagents such as those from Invitrogen, San Diego, CA.
The cDNA was primed with oligo
dT containing a NotI site, linked with blunt to SaII hemikinased adaptors,
cleaved with Notl, sized appropriately
by gel electrophoresis, and cloned in a defined orientation into a suitable
cloning vector (such as pRKB or pRKD;
pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes
et al., Science, 253:1278-1280
(1991)) in the unique XhoI and NotI sites.
EXAMPLE 2
Isolation of cDNA Clones Usine Signal Aleorithm Analysis
Various polypeptide-encoding nucleic acid sequences were identified by
applying a proprietary signal
sequence finding algorithm developed by Genentech, Inc., (South San Francisco,
CA) upon ESTs as well as
clustered and assembled EST fragments from public (e.g., GenBank) and/or
private (LIFESEQ~, Incyte
Pharmaceuticals, Inc., Palo Alto, CA) databases. The signal sequence algorithm
computes a secretion signal score
based on the character of the DNA nucleotides surrounding the first and
optionally the second methionine codon(s)
(ATG) at the S'-end of the sequence or sequence fragment under consideration.
The nucleotides following the first
ATG must code for at least 35 unambiguous amino acids without any stop codons.
If the first ATG has the required
amino acids, the second is not examined. If neither meets the requirement, the
candidate sequence is not scored.
In order to determine whether the EST sequence contains an authentic signal
sequence, the DNA and corresponding
amino acid sequences surrounding the ATG codon are scored using a set of seven
sensors (evaluation parameters)
known to be associated with secretion signals. Use of this algorithm resulted
in the identification of numerous
polypeptide-encoding nucleic acid sequences.
EXAMPLE 3
Isolation of cDNA Clones Encodine Human PR0201
An expressed sequence tag (EST) DNA database ( LIFESEQ~, Incyte
Pharmaceuticals, Palo Alto, CA)
was searched and an EST was identified (1328938, also designated DNA28710)
which was in a fetal pancreas
library and which shared significant identity with the adaptor protein Shc.
A full length cDNA corresponding to the isolated EST was cloned from a human
fetal kidney library using
an in vivo cloning technique in pRICS. The cDNA libraries used to isolate the
cDNA clones encoding human
PR0201 were constructed by standard methods using commercially available
reagents such as those from
Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI
site, linked with blunt to SaII
-94-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
hemikinased adaptors, cleaved with NotI, sized appropriately by gel
electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRICB or pRICD; pRKSB is a
precursor of pRKSD that does not
contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991 )) in
the unique XhoI and NotI.
Probes based on the Incyte EST no. 1328938 were used to screen a cDNA library
derived from the human
fetal kidney library:
cloning primer:
5'-ACTGAGGCCTGTTGAAAGTGCAGAGCTCAG-3' (SEQ ID N0:3)
enrichment primer:
5'-GCTGAAGAAGAGCTTCAG-3' (SEQ ID N0:4)
A full length clone [DNA30676-1223jwas identified that contained a single open
reading frame with an
apparent translational initiation site at nucleotide positions 152-I54 and a
stop signal at nucleotide positions 1880-
1882 (Figure 1, SEQ ID NO:I ). The predicted polypeptide precursor is 576
amino acids long, has a calculated
molecular weight of approximately 63,094 daltons and an estimated pI of
approximately 7.26. Analysis of the
full-length PR0201 sequence shown in Figure 2 (SEQ ID N0:2) evidences the
presence of a variety of important
polypeptide domains as shown in Figure 2, wherein the locations given for
those important polypeptide domains
are approximate as described above. Analysis of the full-length PR0201
polypeptide shown in Figure 2 evidences
the presence of the following: a cAMP- and cGMP-dependent protein kinase
phosphorylation site from about amino
acid 142 to about amino acid 146; N-myristoylation sites from about amino acid
41 to about amino acid 47, from
about amino acid 107 to about amino acid 11 I, from about amino acid 164 to
about amino acid 170, from about
amino acid 203 to about amino acid 209, from about amino acid 243 to about
amino acid 249, from about amino
acid 343 to about amino acid 349, from about amino acid 460 to about amino
acid 466, from about amino acid 546
to about amino acid 552, and from about amino acid 551 to about amino acid
557; an amidation site from about
amino acid 97 to about amino acid 101; a prokaryotic membrane lipoprotein
lipid attachment site from about amino
acid 371 to about amino acid 382; and a leucine zipper pattern from about
amino acid 184 to about amino acid 206.
Clone DNA30676-1223 has been deposited with ATCC on September 23, 1997 and is
assigned ATCC deposit no.
209567.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence shown in Figure
2 (SEQ ID N0:2}, PR0201 shows amino acid sequence identity to both Sck and Shc
proteins.
EXAMPLE 4
Isolation of cDNA Clones Encodinf~ Human PR0292
PR0292 is identical with the human death asscoiated protein DAP-7, also called
cathepsin D. The amino
acid sequence of this 412 amino acid protein is present in the public Dayhoff
database under Accession Nos.
CATD_HUMAN and P_R74207, and is shown in Figure 4 (SEQ ID N0:6). The
nucleotide sequence of the DNA
encoding PR0292 is shown in Figure 3 (SEQ ID NO:S).
Analysis of the full-length PR0292 sequence shown in Figure 4 (SEQ ID N0:6)
evidences the presence
of a variety of important polypeptide domains as shown in Figure 4, wherein
the locations given for those important
-95-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
polypeptide domains are approximate as described above. Analysis of the full-
length PR0292 polypeptide shown
in Figure 4 evidences the presence of the following: a signal peptide from
about amino acid 1 to about amino acid
20; N-glycosylation sites from about amino acid 134 to about amino acid 138,
and from about amino acid 263 to
about amino acid 267; a tyrosine Itinase phosphorylation site from about amino
acid 72 to about amino acid 81;
N-myristoylation sites from about amino acid 145 to about amino acid I51, from
about amino acid 248 to about
amino acid 254, and from about amino acid 282 to about amino acid 288; and a
leucine zipper pattern from about
amino acid 335 to about amino acid 357.
DAP-7 has also been disclosed in WO 95/i 0630 published on April 20, 1995, and
in Faust et al., Proc.
Natl. Acad. Sci. USA, 82:4910914 (1985).
~ EXAMPLE 5
Isolation of cDNA Clones Encodi~ Human PR0327
An expressed sequence tag (EST) DNA database (LIFESEQ~, Incyte
Pharmaceuticals, Palo Alto, CA) was
searched and various EST sequences were identified which showed certain
degrees of homology to human prolactin
receptor protein.
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This consensus sequence is designated herein as DNA38110.
Based on the DNA38110
consensus sequence, oligonucleotides were synthesized: I ) to identify by PCR
a cDNA library that contained the
sequence of interest, and 2) for use as probes to isolate a clone of the full-
length coding sequence for PR0327.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer:
5'-CCCGCCCGACGTGCACGTGAGCC-3' (SEQ ID N0:9)
reverse PCR primer:
5'-TGAGCCAGCCCAGGAACTGCTTG-3' (SEQ ID NO:10)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA38110
sequence which had the following nucleotide sequence:
hybridization probe:
5'-CAAGTGCGCTGCAACCCCT1TGGCATCTATGGCTCCAAGAAAGCCGGGAT-3' (SEQ ID NO:I I )
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primer pair identified above. A positive
Library was then used to isolate clones
encoding the PR0327 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal lung tissue (LIB26).
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA38113-1230 [Figure 5, SEQ ID N0:7]; and the derived protein sequence
for PR0327.
The entire coding sequence of DNA38113-1230 is included in Figure 5 (SEQ ID
N0:7). Clone
DNA38113-1230 contains a single open reading frame with an apparent
translational initiation site at nucleotide
-96-
CA 02353775 2001-06-04
..~.a..~,.~ ,~",.~r<N.,.. .....z~ a.~~m"-~ . 0 :it ~ ,a ....
positions 131-133, and an apparent stop codon at nucleotide positions 1397-
1399. The predicbad polypeptide
pt~ecursor is 422 amino acids long. Analysis of the full-length PR0327
sequence shown in Fgune 6 (SEQ ID N0:8)
evidences the presence of a variety of important polypeptide domains, wherein
the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0327
polypeptide shown in Figure 6 evidences the presence of the following. a
signal peptide from about amino acid 1
to about amino acid 30; N-glycosylation sites from about amino acid 92 to
about amino acid 96, from about amino
acid 104 to about amino acid 108, from about amino acid 140 to about amino
acid 144, from about amino acid 168
to about amino acid 172, from about amino acid 292 to about amino acid 296,
and from about amino acid 382 to
about amino acid 386; a cAMP- and cGMP-dependent protein lcinase
phosphorylation site from about amino acid
I O 413 to about amino acid 417; casein kinase II phosphorylation sites from
about amino acid 44 to about amino acid
48, from about amino acid 183 to about amino acid 187, and from about amino
acid 205 to about amino acid 209;
N-myristoylation sites from about amino acid 30 to about amino acid 36, from
about amino acid 37 to about amino
acid 43, from about amino acid 73 to about amino acid 79, from about amino
acid 121 to about amino acid 127,
from about amino acid 179 to about amino acid 185, from about amino acid 218
to about amino acid 224, from
about amino acid 300 to about amino acid 306, from about amino acid 317 to
about amino acid 323, from about
amino acid 320 to about amino acid 326, from about amino acid 347 to about
amino acid 353, from about amino
acid 355 to about amino acid 361, and from about amino acid 407 to about amino
acid 413; amidation sites from
about amino acid 3 to about amino acid 7, from about amino acid 79 to about
amino acid 83, and fromabout amino
acid 4I 1 to about amino acid 415; and a growth factor and cytokine receptor
family signature 2 from about amino
acid 325 to about amino acid 332. Clone DNA38113-1230 has been deposited with
the ATCC on September 10,
1997 and is assigned ATCC deposit no. 209530. The full-length PR0327 protein
shown in Figure 6 has an
estimated molecular weight of about 46,302 daltons and a pI of about 9.42.
An analysis of the full-length PR0327 sequence shown in Figure 6 (SEQ ID
N0:8), suggests that it
possesses significant homology to the human prolactin receptor binding
protein, thereby indicating that PR0327
may be a novel prolactin binding protein.
ExAMPLE 6
Isolation of cDNAs Encodine Human PR01265
DNA60764-1533 was identified by applying the proprietary signal sequence
finding algorithm described
in Example 2 above. Use of the above described signal sequence algorithm
allowed identification of an ESTctuster
sequence from the LIFESEQ~ database, designated Incyte EST cluster no. 86995.
This EST cluster sequence was
then compared to a variety of expressed sequence tag (EST) databases which
included public EST databases (e.g.,
GenBank) and a proprietary EST DNA database (I~ESEQ~, Incyte Pharmaceuticals,
Palo Alto, CA) to identify
existing homologies. The homology search was performed using the computer
program BLAST or BLASTZ
(Altshul et aL, Methods in Enzvmoloav, 266:46080 (1996)). Those comparisons
resulting in a BLAST score
of 70 (or is some cases 90) or greater that did not encode known proteins were
clustered and assembled into a
consensus DNA sequence with the program "phrap" (Phil Green, University of
Washington, Seattle, Washington).
The consensus sequence obtained therefrom is heroin designated as DNA55717.
-97-
Printed:l l-04-2001 AMENDED SHEET
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
In light of the sequence homology between the DNA55717 sequence and Incyte EST
no. 20965, Incyte
EST no. 20965 was purchased and the cDNA insert was obtained and sequenced.
The sequence of this cDNA
insert is shown in Figure 7 {SEQ ID N0:12) and is herein designated as
DNA60764-1533.
The entire coding sequence of DNA60764-1533 is included in Figure 7 (SEQ ID
N0:12). Clone
DNA60764-1533 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 79-81 and ending at the stop codon at nucleotide positions 1780-1782
(Figure 7). The predicted
polypeptide precursor is 567 amino acids long (Figure 8; SEQ ID N0:13). The
full-length PR01265 protein shown
in Figure 8 has an estimated molecular weight of about 62,881 daltons and a pI
of about 8.97. Analysis of the full-
length PR01265 sequence shown in Figure 8 (SEQ ID N0:13) evidences the
presence of a variety of important
polypeptide domains, wherein the locations given for those important
polypeptide domains are approximate as
described above. Analysis of the full-length PR01265 sequence shown in Figure
8 evidences the presence of the
following: a signal peptide from about amino acid I to about amino acid 21; a
transmembrane domain from about
amino acid 59 to about amino acid 75; N-glycosylation sites from about amino
acid 54 to about amino acid 58, from
about amino acid 134 to about amino acid I 38, from about amino acid 220 to
about amino acid 224, and from about
1$ amino acid 559 to about amino acid 563; tyrosine lcinase phosphorylation
sites from about amino acid 35 to about
amino acid 43, and from about amino acid 161 to about amino acid 169; and a D-
amino acid oxidase proteins site
from about amino acid 61 to about amino acid 81. Clone DNA60764-1533 has been
deposited with ATCC on
November 10, 1998 and is assigned ATCC deposit no. 203452.
An analysis of the Dayhoff database (version 35.45 SwissProt 35), using a WU-
BLAST2 sequence
alignment analysis of the full-length sequence shown in Figure 8 (SEQ ID
NO:13), evidenced significant sequence
identity between the PR01265 amino acid sequence and Dayhoff sequence no..
MMU70429_l. Sequence
homology was also found to exist between the full-length sequence shown in
Figure 8 (SEQ ID NO:13) and the
following Dayhoff sequences: BC542A_1, E69899, 576290, MTV014_14, AOFB_HUMAN,
ZMJ002204_l,
S45812_I, DBRNAPD_1, andCRT1 SOYBN.
EXAMPLE 7
Isolation of cDNA Clones Encodins Human PR0344
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This assembled consensus sequence is herein identified as
DNA34398. Based on the
DNA34398 consensus sequence, oligonucleotides were synthesized: 1 ) to
identify by PCR a cDNA library that
contained the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence for
PR0344.
PCR primers (forward and reverse) were synthesized:
forward PCR primer (34398.f1):
5'-TACAGGCCCAGTCAGGACCAGGGG-3' (SEQ ID N0:16)
forward PCR primer (34398.f2):
5'-AGCCAGCCTCGCTCTCGG-3' (SEQ ID N0:17)
forward PCR primer (34398.f3):
-98-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
5'-GTCTGCGATCAGGTCTGG-3' (SEQ ID N0:18)
reverse PCR primer 134398.r1 ):
5'-GAAAGAGGCAATGGATTCGC-3' (SEQ ID N0:19)
reverse PCR primer (34398.r2~
S 5'-GACTTACACTTGCCAGCACAGCAC-3' (SEQ ID N0:20)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the DNA34398 consensus
sequence which had the following nucleotide sequence:
hybridization probe (34398 ~~1 ):
5'-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3' (SEQ ID N0:21 )
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primerpairs identified above. A positive
library was then used to isolate clones
encoding the PR0344 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal kidney tissue.
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA40592-1242 [Figure 9, SEQ ID N0:14J; and the derived protein sequence
for PR0344.
The entire coding sequence of DNA40592-1242 is included in Figure 9 (SEQ ID
N0:14). Clone
DNA40592-1242 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 227-229, and an apparent stop codon at nucleotide positions 956-958.
The predicted polypeptide
precursor is 243 amino acids long. Analysis of the full-length PR0344 sequence
shown in Figure 10 (SEQ ID
NO:15) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0344
polypeptide shown in Figure 10 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 15; N-myristoylation sites from about amino acid 11 to
about amino acid 17, from about
amino acid 68 to about amino acid 74, and from about amino acid 216 to about
amino acid 222; and a cell
attachment sequence from about amino acid 77 to about amino acid 80. Clone
DNA40592-1242 has been deposited
with the ATCC on November 21,1997 and is assigned ATCC deposit no. 209492. The
full-length PR0344 protein
shown in Figure 10 has an estimated molecular weight of about 25,298 daltons
and a pI of about 6.44.
An analysis of the full-length PR0344 sequence shown in Figure 10 (SEQ ID
NO:IS), suggests that
portions of it possess significant homology to the human and murine complement
proteins, thereby indicating that
PR0344 may be a novel complement protein.
EXAMPLE 8
Isolation of cDNA Clones Encoding Human PR0343
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This assembled consensus sequence is herein identified as
DNA30895. Based on the
DNA30895 consensus sequence, oligonucleotides were synthesized: I) to identify
by PCR a cDNA library that
-99-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
contained the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence for
PR0343.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer:
5'-CGTCTCGAGCGCTCCATACAGTTCCCTTGCCCCA-3' (SEQ ID N0:24)
reverse PCR primer:
5'-TGGAGGGGGAGCGGGATGCTTGTCTGGGCGACTCCGGGGGCCCCCTCATGTGCCAGGTGGA-3'
(SEQ ID N0:25)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the DNA30895 consensus
sequence:
5'-CCCTCAGACCCTGCAGAAGCTGAAGGTTCCTATCATCGACTCGGAAGTCTGCAGCCATCTGTA
CTGGCGGGGAGCAGGACAGGGACCCATCACTGAGGACATGCT~GTGTGCCGGCTACT-3'(SEQ)D N0:2b)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primer pair identified above. A positive
library was then used to isolate clones
encoding the PR0343 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal lung tissue (LIB26).
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA43318-1217 [Figure 11, SEQ ID N0:22]; and the derived protein sequence
for PR0343.
The entire coding sequence of DNA43318-1217 is included in Figure 11 (SEQ ID
N0:22). Clone
DNA43318-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 53-55, and an apparent stop codon at nucleotide positions 1004-1006.
The predicted polypeptide
precursor is 317 amino acids long. Analysis of the full-length PR0343 sequence
shown in Figure 12 (SEQ ID
N0:23) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0343
polypeptide shown in Figure 12 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 32; an N-glycosylation site from about amino acid 70 to
about amino acid 74; a
glycosaminoglycan attachment site from about amino acid 178 to about amino
acid 182; N-myristoylation sites from
about amino acid 5 to about amino acid 11, from about amino acid 12 io about
amino acid 18, from about amino
acid 13 to about amino acid 19, from about amino acid 16 to about amino acid
22, from about amino acid 52 to
about amino acid 58, from about amino acid 71 to about amino acid 77, from
about amino acid 77 to about amino
acid 83, from about amino acid I 12 to about amino acid 118, from about amino
acid 273 to about amino acid 279,
and from about amino acid 310 to about amino acid 316; a prokaryotic membrane
lipoprotein lipid attachment site
from about amino acid 4 to about amino acid 15; and a serine proteases,
trypsin family, histidine active site from
about amino acid 86 to about amino acid 92. Clone DNA43318-1217 has been
deposited with the ATCC on
November 21, I 997 and is assigned ATCC deposit no. 209481. The full-length
PR0343 protein shown in Figure
12 has an estimated molecular weight of about 33,732 daltons and a pI of about
7.90.
_100_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
EXAMPLE 9
Isolation of cDNA Clones Encoding Human PR0347
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This assembled consensus sequence is herein designated
"<consen0l >" and as DNA39499.
Based on the "<consen0l >" and DNA39499 consensus sequences, oligonucleotides
were synthesized: 1 ) to
identify by PCR a cDNA library that contained the sequence of interest, and 2)
for use as probes to isolate a clone
of the full-length coding sequence for PR0347.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer:
S'-AGGAAC1TCTGGATCGGGCTCACC-3' (SEQ ID N0:29)
reverse PCR arimer:
5'-GGGTCTGGGCCAGGTGGAAGAGAG-3' (SEQ ID N0:30)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the DNA39499 consensus
sequence:
5'-GCCAAGGACTCCTTCCGCTGGGCCACAGGGGAGCACCAGGCCTTC-3' (SEQID N0:31 )
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primer pair identified above. A positive
library was then used to isolate clones
encoding the PR0347 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal kidney tissue (LIB228).
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA44176-1244 [Figure 13, SEQ ID N0:27]; and the derived protein sequence
for PR0347.
The entire coding sequence of DNA44176-1244 is included in Figure 13 (SEQ ID
N0:27). Clone
DNA44176-1244 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 123-125, and an apparent stop codon at nucleotide positions 1488-
1490. The predicted polypeptide
precursor is 455 amino acids long. Analysis of the full-length PR0347 sequence
shown in Figure 14 (SEQ ID
N0:28) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0347
polypeptide shown in Figure 14 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 26; N-glycosylation sites from about amino acid 144 to
about amino acid 148, and from about
amino acid 243 to about amino acid 247; a cAMP- and cGMP-dependent protein
kinase phosphorylation site from
about amino acid 45 to about amino acid 49; N-myristoylation sites from about
amino acid 22 to about amino acid
28, from about amino acid 99 to about amino acid 105, from about amino acid
I31 to about amino acid 137, from
about amino acid 201 to about amino acid 207, from about amino acid 213 to
about amino acid 219, from about
amino acid 287 to about amino acid 293, from about amino acid 288 to about
amino acid 294, from about amino
acid 331 to about amino acid 337, and from about amino acid 398 to about amino
acid 404; a prokaryotic membrane
lipoprotein lipid attachment site from about amino acid 204 to about amino
acid 215; EGF-like domain cysteine
pattern signatures from about amino acid 249 to about amino acid 261, and from
about amino acid 280 to about
-101-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
amino acid 292; and a C-type lectin domain signature from about amino acid 417
to about amino acid 442. Clone
DNA44176-1244 has been deposited with the ATCC on December 10, 1997 and is
assigned ATCC deposit no.
209532. The full-length PR0347 protein shown in Figure 14 has an estimated
molecular weight of about 50,478
daltons and a pI of about 8.44.
Analysis of the amino acid sequence of the full-length PR0347 polypeptide
suggests that portions of it
possess significant homology to various cysteine-rich secretory proteins,
thereby indicating that PR0347 may be
a novel cysteine-rich secretory protein.
EXAMPLE 10
Isolation of cDNA Clones Encoding Human PR0357
The sequence expression tag "2452972" by Incyte Pharmaceuticals, Palo Alto,
CA, was used to begin a
database search for ESTs which overlapped with a portion of "2452972". A
consensus DNA sequence was
assembled relative to other EST sequences usingphrap as described in Example 1
above. This assembled consensus
sequence is herein designated as DNA37162. Based on the DNA37162 consensus
sequence, oligonucleotides were
synthesized: 1 ) to identify by PCR a cDNA library that contained the sequence
of interest, and 2) for use as probes
to isolate a clone of the full-length coding sequence for PR0357.
PCR primers (forward and reverse) were synthesized:
forward PCR primer 1:
5'-CCCTCCACTGCCCCACCGACTG-3' (SEQ ID N0:34)
reverse PCR urimer 1:
5'-CGGTTCTGGGGACGTTAGGGCTCG-3' (SEQ ID N0:35)
forward PCR primer 2:
5'-CTGCCCACCGTCCACCTGCCTCAAT-3' (SEQ ID N0:36)
Additionally, two synthetic oligonucleotide hybridization probes were
constructed from the DNA37162 consensus
sequence:
hybridization probe 1:
5'-AGGACTGCCCACCGTCCACCTGCCTCAATGGGGGCACATGCCACC-3' (SEQID N0:37)
hybridization probe 2:
5'-ACGCAAAGCCCTACATCTAAGCCAGAGAGAGACAGGGCAGCTGGG-3' (SEQ ID N0:38)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primer pairs identified above. A positive
library was then used to isolate clones
encoding the PR0357 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal liver tissue.
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA44804-1248 [Figure 15, SEQ ID N0:32]; and the derived protein sequence
for PR0357.
The entire coding sequence of DNA44804-1248 is included in Figure 15 (SEQ ID
N0:32). Clone
DNA44804-1248 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 137-139, and an apparent stop codon at nucleotide positions 1931-
1933. The predicted polypeptide
-I02-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
precursor is 598 amino acids long. Analysis of the full-length PR0357 sequence
shown in Figure 16 (SEQ ID
N0:33) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0357
polypeptide shown in Figure 16 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 23; a transmembrane domain from about amino acid 501 fo
about amino acid 520; N-
glycosylation sites from about amino acid 198 to about amino acid 202, from
about amino acid 425 to about amino
acid 429, and from about amino acid 453 to about amino acid 457; a tyrosine
kinase phosphorylation site from about
amino acid 262 to about amino acid 270; N-myristoylation sites from about
amino acid 23 to about amino acid 29,
from about amino acid 27 to about amino acid 33, from about amino acid 112 to
about amino acid 118, from about
amino acid 273 to about amino acid 279, from about amino acid 519 to about
amino acid 525, and from about amino
acid 565 to about amino acid 571; a prokaryotic membrane lipoprotein lipid
attachment site from about amino acid
14 to about amino acid 25; an EGF-like domain cysteine pattern signature from
about amino acid 355 to about
amino acid 367; and leucine zipper patterns from about amino acid 122 to about
amino acid 144, and from about
amino acid 194 to about amino acid 216. Clone DNA44804-1248 has been deposited
with the ATCC on December
10, 1997 and is assigned ATCC deposit no. 209527. The full-length PR0357
protein shown in Figure 16 has an
estimated molecular weight of about 63,030 daltons and a p1 of about 7.24.
Anaylsis of the amino acid sequence of the full-length PR0357 polypeptide
suggests that portions of it
possess significant homology to ALS, thereby indicating that PR0357 may be a
novel leucine rich repeat protein
related to ALS.
EXAMPLE 11
Isolation of cDNA Clones Encoding Human PR0715
An expressed sequence tag (EST) DNA database (LIFESEQ~, Incyte
Pharmaceuticals, Palo Alto, CA) was
searched and various EST sequences were identified which showed homology to
human TNF-a. This search
resulted in the identification of Incyte EST No. 2099855.
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This consensus sequence is designated herein as DNA52092.
Based upon the alignment of the
various EST clones described above, a single clone (725887, Accession no.
AA292358) was identified and was
sequenced.
DNA sequencing of the isolated clone isolated as described above gave the full-
length DNA sequence for
DNA52722-1229 [Figure 17, SEQ ID N0:39]; and the derived protein sequence for
PR0715.
The entire coding sequence of DNA52722-1229 is included in Figure 17 (SEQ ID
N0:39). Clone
DNA52722-1229 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 114-116, and an apparent stop codon at nucleotide positions 864-866.
The predicted polypeptide
precursor is 250 amino acids long. Analysis of the full-length PR0715 sequence
shown in Figure 18 (SEQ ID
N0:40) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0715
poiypeptide shown in Figure 18 evidences the presence of the following: a
signal peptide from about amino acid
-103-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
l to about amino acid 40; an N-glycosylation site from about amino acid 124 to
about amino acid 128; a tyrosine
kinase phosphorylation site from about amino acid 156 to about amino acid 164;
N-myristoylation sites from about
amino acid 36 to about amino acid 42, from about amino acid 40 to about amino
acid 46, from about amino acid
179 to about amino acid 185, and from about amino acid 242 to about amino acid
248; and a prokaryotic membrane
lipoprotein lipid attachment site from about amino acid 34 to about amino acid
45. Clone DNA52722-1229 has
been deposited with the ATCC on January 7, 1998 and is assigned ATCC deposit
no. 209883. The full-length
PR0715 protein shown in Figure I 8 has an estimated molecular weight of about
27,433 daltons and a pI of about
9.85.
An analysis of the full-length PR0715 sequence shown in Figure 18 (SEQ ID
N0:40), suggests that it
possesses significant homology to members of the tumor necrosis factor family
of proteins, thereby indicating that
PR0715 is a novel tumor necrosis factor protein.
EXAMPLE 12
Isolation of cDNA Clones Encoding Human PR01017
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. This assembled consensus sequence is herein designated
"<consen0l>", sometimes called
DNA53235. Based on the assemblies presented herein and the consensus
sequences, EST AA243086 (Merck clone
664402) was further examined and sequenced.
DNA sequencing of the isolated clone isolated as described above gave the full-
length DNA sequence for
DNA56112-1379 [Figure 19, SEQ ID N0:41 J; and the derived protein sequence for
PROl0I7.
The entire coding sequence of DNA56112-1379 is included in Figure 19 (SEQ ID
N0:41 ). Clone
DNA56112-1379 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 128-130, and an apparent stop codon at nucleotide positions 1370-
1372. The predicted polypeptide
precursor is 414 amino acids long. Analysis of the full-length PR01017
sequence shown in Figure 20 (SEQ ID
N0:42) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR01017
polypeptide shown in Figure 20 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 31; N-glycosylation sites from about amino acid 134 to
about amino acid 138, from about
amino acid 209 to about amino acid 213, from about amino acid 280 to about
amino acid 284, and from about amino
acid 370 to about amino acid 374; cAMP- and cGMP-dependent protein kinase
phosphorylation sites from about
amino acid 85 to about amino acid 89, and from about amino acid 236 to about
amino acid 240; and N-
myristoylation sites from about amino acid 77 to about amino acid 83, from
about amino acid 164 to about amino
acid 170, and from about amino acid 295 to about amino acid 301. Clone
DNA56112-I 379 has been deposited with
the ATCC on May 20, 1998 and is assigned ATCC deposit no. 209883. The full-
length PR01017 protein shown
in Figure 20 has an estimated molecular weight of about 48,414 daltons and a
pI of about 9.54.
Analysis of the amino acid sequence of the full-length PR01017 polypeptide
suggests that portions of it
possess sequence identity with HNK-1 sulfotransferase, thereby indicating that
PR01017 may be a novel
sulfotransferase.
-104-
CA 02353775 2001-06-04
EXAM LE I3
Isolation of cDNA Clones Encodias Human PROI112
r
p ..,
DNA57702-1476 was identified by applying the proprietary signal sequence
finding algorithm described
in Example 2 above. Use of the above described signal sequence algorithm
allowed identification of an EST cluster
sequence from public (e.g., GenBank) andlor private LIFESEQ~ Incyte
Pharmaceuticals, Inc., Palo Alto, CA)
databases. The clustering and assembling of the public and private ESTs into
one or several consensus sequences
to create a candidate sequence was performed using repeated cycles of the
computer progmna phrap. (Phil Green,
UniversityofWashington,SeattleWashington). Candidate
sequenceswithasuf8cientscorewerefurtherexamined
The homology search was performed using the computer program BLAST or BLAST2
(Altshul et al., Methods
in EnZVmoloev. 266:460-480 ( 1996)}. Those comparisons resulting in a BLAST
score of 70 (or in some cases 90)
or greater that did not encode known proteins were clustered and assembled
into a consensus DNA sequence. The
consensus sequence obtained therefrom is herein designated as DNA56108.
Based on the discoveries and information provided herein, Merck EST AA223646,
clone 650953, from
library 318, a human neuroepithelium tissue library, was further examined DNA
sequencing of the clone gave
DNA57702-1476 figure 21, SEQ ID N0:43), which includes the full-length DNA
sequence for PR01112.
The entire coding sequence of DNA57702-1476 is included in Figure 21 (SEQ ID
N0:43). Clone
DNA57702-1476 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 20-22 and ending at the stop colon at nucleotide positions 806-808
(Figure 21). The predicted
polypeptide precursor is 262 amino acids Long (Figure 22; SEQ 1D N0:44). The
full-length PRO1112 protein
shown in Figure 22 has an estimated molecular weight of about 29,379 daltons
and a pI of about 8.93. Analysis
of the full-length PR01112 sequence shown in Figure 22 (SEQ ID N0:44)
evidences the presence of a variety of
important polypeptide domains, wherein the locations given for those important
polypeptide domains are
approximate as described above. Analysis of the full-length PR01112 sequence
shown in Figure 22 evidences the
presence of the following: a signal peptide from about amino acid 1 to about
amino acid 13; transmembrane
domains from about amino acid 58 to about amino acid 76, from about amino acid
99 to about amino acid I 13,
from about amino acid 141 to about amino acid 159, and from about amino acid
203 to about amino acid 222; and
N-myristoylation sites from about amino acid 37 to about amino acid 43, from
about amino acid 42 to about amino
acid 48, and from about amino acid 229 to about amino acid 235. Clone DNA57702-
1476 bas been deposited with
ATCC on June 9,1998 and is assigaed ATCC deposit no. 209951.
An analysis of the Dayhoff database (version 35.45 SwissProt 35), using a WLT-
BLAST2 sequence
alignment analysis of the full-length sequence shown in Figure 22 (SEQ ID
N0:44), evidenced significant sequence
identity between the PR01112 amino acid sequence and the following Dayhoff
sequences: MTY20B 11._I3 (a
mycobacterium tuberculosis peptide), F64471, AE000690_6, XLU16364_l, E43259
(H+-transporting ATP
synthase) and PIGSLADRXE_1 (MfiC class II histocompatibility antigen).
EXAMPLE 14
Isolation of cDNA Clones Encoding Human PR0509
To isolate a cDNA for PR0509 (also called HVEM), a bacteriophage library of
human retinal cDNA
-105-
AMENDED SHEET-'
Printeda 1-04-2001
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
(commercially available from Clontech) was screened by hybridization with a
synthetic oligonucleotide probe based
on an EST sequence (GenBank locus AA021617), which showed some degree of
homology to members of the
TNFR family. Five positive clones (containing cDNA inserts of 1.8-1.9 kb) were
identified in the cDNA library,
and the positive clones were confirmed to be specific by PCR using the above
hybridization probe as a PCR primer.
Single phage plaques containing each of the five positive clones were isolated
by limiting dilution and the DNA
was purified using a Wizard Lambda Prep DNA purification kit (commercially
available from Promega).
The cDNA inserts from three of the five bacteriophage clones were excised from
the vector arms by
digestion with EcoRI, gel-purified, and subcloned into pRICS and sequenced on
both strands. The three clones
contained an identical open reading frame (with the exception of an intros
found in one of the clones).
The entire sequence of DNA50148 (HVEM) is shown in Figure 23 (SEQ ID N0:45).
The cDNA
contained one open reading frame with a translational initiation site assigned
to the ATG colon at nucleotide
positions 82-84. The open reading frame ends at the termination colon TGA at
nucleotide positions 931-933.
The predicted amino acid sequence of the ful I-length PR0509 (HVEM) contains
283 amino acids as shown
in Figure 24 (SEQ ID N0:46). The full-length PR0509 protein shown in Figure 24
has an estimated molecular
weight of about 30,420 daltons and a pI of about 7.34. Analysis of the full-
length PR0509 sequence shown in
Figure 24 (SEQ ID N0:46) evidences the presence of a variety of important
polypeptide domains, wherein the
locations given for those important polypeptide domains are approximate as
described above. Analysis of the full-
length PR0509 sequence shown in Figure 24 evidences the presence of the
following: a signal peptide from about
amino acid 1 to about amino acid 36; a transmembrane domain from about amino
acid 203 to about amino acid 222;
N-glycosylation sites from about amino acid 110 to about amino acid 114, and
from about amino acid 173 to about
amino acid 177; and N-myristoylation sites from about amino acid 81 to about
amino acid 87, from about amino
acid 89 to about amino acid 95, from about amino acid 104 to about amino acid
110, from about amino acid 120
to about amino acid 126, from about amino acid 153 to about amino acid 159,
from about amino acid 193 to about
amino acid 199, from about amino acid 195 to about amino acid 201, and from
about amino acid 220 to about amino
acid 226.
The sequence differs from the PR0509 (HVEM) sequence reported in Montgomery et
al., supra, in at least
two amino acids: colon 108 encodes a serine and colon 140 encodes an alanine.
An alignment (using the ALIGN
computer program) of a 58 amino acid long cytoplasmic region of PR0509 (HVEM)
with other known members
of the human TNF receptor family showed some similarity, in particular to CD40
(12 identities) and LT-beta
receptor (11 identities).
EXAMPLE 15
Isolation of cDNA Clones Encodine Human PR0853
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described in
Example 1 above. The analysis identified the single Incyte clone no. 2645134.
The Incyte 2645134 sequence was
then extended using repeated cycles of BLAST and phrap to extend the sequence
as far as possible using the sources
of EST sequences discussed above. This extended assembled consensus sequence
is herein designated
"<consen0i >" or DNA43050. Based on the DNA43050 consensus sequence,
oligonucleotides were synthesized:
-106-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
1) to identify by PCR a cDNA library that contained the sequence of interest,
and 2) for use as probes to isolate
a clone of the full-length coding sequence for PR0853.
A pair of PCR primers (forward and reverse} were synthesized:
forward PCR arimer (43050.f 1 ):
5'-CTTCATGGCCTTGGACTTGGCCAG-3' (SEQ ID N0:49)
reverse PCR primer (43050.r1 ):
5'-ACGCCAGTGGCCTCAAGCTGGTTG-3' (SEQ ID NO:50)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the DNA43050 consensus
sequence:
1 O 5'-CTTTCTGAGCTCTGAGCCACGGTTGGACATCCTCATCCACAATGC-3' (SEQID N0:51 )
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was screened
by PCR amplification with the PCR primer pair identified above. A positive
library was then used to isolate clones
encoding the PR0853 gene using the probe oligonucleotide and one of the PCR
primers. RNA for construction
of the cDNA libraries was isolated from human fetal kidney tissue (LIB228).
DNA sequencing of the isolated clones isolated as described above gave the
full-length DNA sequence
for DNA48227-1350 [Figure 25, SEQ ID N0:47]; and the derived protein sequence
for PR0853.
The entire coding sequence of DNA48227-1350 is included in Figure 25 (SEQ ID
N0:47). Clone
DNA48227-1350 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 128-130, and an apparent stop colon at nucleotide positions 1259-
1261. The predicted polypeptide
precursor is 377 amino acids long. Analysis of the full-length PR0853 sequence
shown in Figure 26 (SEQ ID
N0:48) evidences the presence of a variety of important polypeptide domains,
wherein the locations given for those
important polypeptide domains are approximate as described above. Analysis of
the full-length PR0853
polypeptide shown in Figure 26 evidences the presence of the following: a
signal peptide from about amino acid
1 to about amino acid 16; a glycosaminoglycan attachment site from about amino
acid 46 to about amino acid 50;
N-myristoylation sites from about amino acid 9 to about amino acid 15, from
about amino acid 29 to about amino
acid 35, from about amino acid 32 to about amino acid 38, from about amino
acid 43 to about amino acid 49, from
about amino acid 124 to about amino acid 130, and from about amino acid 312 to
about amino acid 318; a
prokaryotic membrane lipoprotein lipid attachment site from about amino acid
118 to about amino acid 129; and
short-chain alcohol dehydrogenase family sites from about amino acid 37 to
about amino acid S0, and from about
amino acid 114 to about amino acid 125. Clone DNA48227-1350 has been deposited
with the ATCC on April 28,
1998 and is assigned ATCC deposit no. 209812. The full-length PR0853 protein
shown in Figure 26 has an
estimated molecular weight of about 40,849 daltons and a pI of about 7.98.
EXAMPLE 16
Isolation of cDNA Clones Encodine Human PR0882
PR0882 (DNA58125) is identical with cardiotrophin-1. The amino acid sequence
of this 201 amino acid
protein is present in the public Dayhoff database under Accession Nos.
P_R83967, P W29238 and
-107-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
CTF1 HUMAN, among others. The nucleotide sequence of DNA58125 encoding the
PR0882 is shown in Figure
27 (SEQ ID N0:52).
Analysis of the full-:length PR0882 sequence shown in Figure 28 (SEQ ID N0:53)
evidences the presence
of a variety of important polypeptide domains, wherein the locations given for
those important polypeptide domains
are approximate as described above. Analysis of the full-length PR0882
polypeptide shown in Figure 28 evidences
the presence of the following: N-myristoylation sites from about amino acid
166 to about amino acid 172, and
from about amino acid 174 to about amino acidl 80; and a leucine zipper
pattern from about amino acid 37 to about
amino acid 59. The full-length PR0882 protein shown in Figure 28 has an
estimated molecular weight of about
21,227 daltons and a pI of about 9.30. Cardiotrophin-1 has also been disclosed
in W09730146, published on 21
August 1997 and W09529237, published on 2 November 1995.
EXAMPLE 17
Gene Amplification
This example shows that the PR0201-, PR0292-, PR0327-, PR01265-, PR0344-,
PR0343-, PR0347-,
PR0357-, PR0715-, PR01017-, PR01112-, PR0509-, PR0853- or PR0882-encoding
genes are amplified in the
genome of certain human lung, colon and/or breast cancers and/or cell lines.
Amplification is associated with
overexpression of the gene product, indicating that the polypeptides are
useful targets for therapeutic intervention
in certain cancers such as colon, lung, breast and other cancers. Therapeutic
agents may take the form of
antagonists of PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017,
PRO 11 I 2, PR0509, PR0853 or PR0882 polypeptides, for example, murine-human
chimeric, humanized or human
antibodies against a PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 polypeptide.
The starting material for the screen was genomic DNA isolated from a variety
of cancers. The DNA is
quantitated precisely, e.g., fluorometrically. As a negative control, DNA was
isolated from the cells of ten normal
healthy individuals which was pooled and used as assay controls for the gene
copy in healthy individuals (not
shown). The 5' nuclease assay (for example, TaqMan'~"') and real-time
quantitative PCR (for example, ABI Prizm
7700 Sequence Detection SystemT"' (Perkin Elmer, Applied Biosystems Division,
Foster City, CA)), were used
to find genes potentially amplified in certain cancers. The results were used
to determine whether the DNA
encoding PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715, PR01017,
PROI I 12, PR0509, PR0853 or PR0882 is over-represented in any of the primary
lung or colon cancers or cancer
cell lines or breast cancer cell lines that were screened. The primary lung
cancers were obtained from individuals
with tumors of the type and stage as indicated in Table 4. An explanation of
the abbreviations used for the
designation of the primary tumors listed in Table 4 and the primary tumors and
cell lines referred to throughout this
example has been given hereinbefore.
The results of the TaqManT"' are reported in delta (0) Ct units. One unit
corresponds to 1 PCR cycle or
approximately a 2-fold amplification relative to normal, two units corresponds
to 4-fold, 3 units to 8-fold
amplification and so on. Quantitation was obtained using primers and a
TaqMan'~"' fluorescent probe derived from
-108-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
the PR0201-, PR0292-, PR0327-, PRO 1265-, PR0344-, PR0343-, PR0347-, PR0357-,
PR0715-, PRO 1017-,
PR01112-, PR0509-, PR0853- or PR0882-encoding gene. Regions of PR0201, PR0292,
PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or
PR0882 which are
most likely to contain unique nucleic acid sequences and which are least
likely to have spliced out introns are
preferred for the primer and probe derivation, e.g., 3'-untranstated regions.
The sequences for the primers and
probes (forward, reverse and probe) used for the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343,
PR0347, PR0357, PR0715, PRO 1017, PROI 112, PR0509, PR0853 or PR0882 gene
amplification analysis were
as follows:
PR0201 (DNA30676-1223):
30676.tm.f
5'-CGCAGACACCCTTCTTCACA-3' (SEQ ID NO: 54)
30676.tm.r
5'-CGACTCCTTTGGTCTCTTCTGG-3' (SEQ ID NO: 55)
30676.tm.p
5'-CCGGGACCCCCAGGZTITTGC-3' (SEQ ID NO: 56)
PR0292 (DNA35617):
35617.tm.f
5'-GATCCTGGG CGACGTCTTC-3' (SEQ ID NO: 57)
35617.tm.p
5'-TCGGCCGCTACTACACTGTGTTTGACC-3' (SEQ ID NO: 58)
35617.tm.r
5'-GCCCACCCTGTTGTTGTCA-3' (SEQ ID NO: 59)
PR0327 (DNA38113-1230):
38113.tm.f
5'-CTCAAGAAGCACG CGTACTGC-3' (SEQ ID NO: 60)
38113.tm.p
5'-CCAACCTCAGCTTCCGCCTCTACGA-3' (SEQ ID NO: 61 )
381 I 3.tm.r
5'-CATCCAGGCTCGCCACTG-3' (SEQ ID NO: 62)
PR01265 (DNA6(?764-1533):
60764.tm.f 1
5'-TGACCTGGCAAAGGAAGAA-3' (SEQ ID NO: 63)
60764.tm.p 1
5'-CAGCCACCCTCCAGTCCAAGG-3' (SEQ ID NO: 64)
-109_
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
60764.tm.rl
5'-GGGTCGTGTTTTGGAGAGA-3' (SEQ ID NO: 65)
PR0344 (DNA40592-1242):
40592.tm.f 1
5'-TGGCAAGGAATGGGAACAGT-3' (SEQ ID NO: 66)
40592.tm.p 1
5'-ATGCTGC CAGACCTGAT CGCAGACA-3' (SEQ ID NO: 67)
40592.tm.r 1
5'-G GGCAGAAATC CAGCCACT-3' (SEQ ID NO: 68)
PR0343 (DNA43318-1217):
43318.tm.f l
5'-TCTACATCAGCCTCTCTGCGC-3' (SEQ ID NO: 69)
43318.tm.p 1
5'-CGATCTTCTCCACCCAGGAGCGG-3' (SEQ ID NO: 70)
43318.tm.r 1
5'-GGAGCTGCACCCCTTGC-3' (SEQ ID NO: 71 )
PR0347 (DNA44176-1244):
44176.tm.f l
5'-CCCTTCGCCTGCTI?TGA-3' (SEQ ID NO: 72)
44176.tm.p1
5'-GCCATCTAATTGAAGCCCATCTTCCCA-3' (SEQ ID NO: 73)
44176.tm.rl
5'-CTGGCGGTGT CCTCTCCTT-3' (SEQ ID NO: 74)
PR0357 (DNA44804-1248):
44804.tm.f1
5'-CCTCGGTCTCCTCATCTGTGA-3' (SEQ ID NO: 75)
44804.tm.p 1
5'-TGGCCCAGCTGACGAGCCCT-3' (SEQ ID NO: 76)
44804.tm.r1
5'-CTCATAGGCACTCGGTTCTGG-3' (SEQ ID NO: 77)
PR0715 (DNA52722-1229):
52722.tm.f1
-110-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
5'-TGGCTCCCAGCTTGGAAGA-3' (SEQ ID NO: 78)
52722.tm.p 1
5'-CAGCTCTTGGCTGTCTCCAGTATGTACCCA-3' (SEQ ID NO: 79)
52722.tm.rl
5'-GATGCCTCTGTTCCTGCACAT-3' (SEQ ID NO: 80)
PR01017 lDNASbI 12-1379):
Sb112.tm.f1
5'-CCTCCTCCGAGACTGAAAGCT-3' (SEQ ID NO: 81 )
56112.tm.pl
5'-TCGCGTTGCTI'IZTCTCGCGTG-3' (SEQ ID NO: 82)
Sbl l2.tm.r1
5'-GCGTGCGTC AGGTTCCA-3' (SEQ ID NO: 83)
PR01112 (DNA57702-147b):
57702.tm.f 1
5'-GTCCCTTCACTGTTTAGAGCATGA-3' (SEQ ID NO: 84)
57702.tm.p 1
5'-ACTCTCCCCCTCAACAGCCTCCTGAG-3' (SEQ ID NO: 85)
57702.tm.rl
5'-GTGG TCAGGGCAGA TCCTTT-3' (SEQ ID NO: 86)
PR0509 (DNA50148):
50148.tm.f 1
5'-GGAGGAGACAATACCCTCATTCA-3' (SEQ ID NO: 87)
50148.tm.p 1
5'-AGCAGCCGTCGCTCCAGGTATCTC-3' (SEQ ID NO: 88)
50148.tm.r1
5'-CCA GGTGGACAGCCTCTTTC-3' (SEQ ID NO: 89)
PR0853 (DNA48227-1350)
48227.tm.f 1
5'-GGCACTTCATGGTCCTTGAAA-3' (SEQ ID NO: 90)
48227.tm.p l
5'-CGGATGTGTGTGAGGCCATGCC-3' (SEQ ID NO: 91 )
48227.tm.r 1
5'-GAAAGTA ACCACGGAGG TCAAGAT-3' (SEQ ID NO: 92)
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0882 (DNA58125)
58125.tm.f 1
5'-TTCCCAGCCTCTCTTTGCTTT-3' (SEQ ID NO: 93)
58125.tm.pl
5'-TGCCCCGTTCTCTTAACTCTTGGACCC-3' (SEQ ID NO: 94)
58125.tm.r1
5'-TCAGACGGAGTTACCATGCAGA-3' (SEQ ID NO: 95)
The 5' nuclease assay reaction is a fluorescent PCR-based technique which
makes use of the 5' exonuclease
activity of Taq DNA polymerase enzyme to monitor amplification in real time.
Two oligonucleotide primers are
used to generate an amplicon typical of a PCR reaction. A third
oligonucleotide, or probe, is designed to detect
nucleotide sequence located between the two PCR primers. The probe is non-
extendible by Taq DNA polymerase
enzyme, and is labeled with a reporter fluorescent dye and a quencher
fluorescent dye. Any laser-induced emission
from the reporter dye is quenched by the quenching dye when the two dyes are
located close together as they are
on the probe. During the amplification reaction, the Taq DNA polymerase enzyme
cleaves the probe in a
template-dependent manner. The resultant probe fragments disassociate in
solution, and signal from the released
reporter dye is free from the quenching effect of the second fluorophore. One
molecule of reporter dye is liberated
for each new molecule synthesized, and detection of the unquenched reporter
dye provides the basis for quantitative
interpretation of the data.
The 5' nuclease procedure is run on a real-time quantitative PCR device such
as the ABI Prism 7?OOTM
Sequence Detection. The system consists of a thermocycler, laser, charge-
coupled device (CCD) camera and
computer. The system ampl ifies samples in a 96-well format on a thermocycler.
During amplification, laser-induced
fluorescent signal is collected in real-time through fiber optics cables for
all 96 wells, and detected at the CCD. The
system includes software for running the instrument and for analyzing the
data.
5' Nuclease assay data are initially expressed as Ct, or the threshold cycle.
This is defined as the cycle at
which the reporter signal accumulates above the background level of
fluorescence. The ACt values are used as
quantitative measurement of the relative number of starting copies of a
particular target sequence in a nucleic acid
sample when comparing cancer DNA results to normal human DNA results.
Table 4 describes the stage, T stage and N stage of various primary tumors
which were used to screen the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PROI017, PROI 112,
PR0509, PR0853 or PR0882 compounds of the invention.
-112-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 4
Primary Lung and Colon Tumor Profiles
Primary Tumor StageOther Stave Dukes
Stale T Stave N_
Stave
Human lung tumor AdenoCa (SRCC724)IIA T1 N1
[LTl ]
Human lung tumor SqCCa (SRCC725)IIB T3 NO
[LTIa]
Human lung tumor AdenoCa (SRCC726)IB T2 NO
[LT2]
Human lung tumor AdenoCa (SRCC727)IIIATl N2
[LT3]
Human lung tumor AdenoCa (SRCC728)IB T2 NO
[LT4]
Human lung tumor SqCCa (SRCC729)IB T2 NO
[LT6]
10Human lung tumor Aden/SqCCa IA T1 NO
(SRCC730) (LT7]
Human lung tumor AdenoCa (SRCC731IB T2 NO
) [LT9]
Human lung tumor SqCCa (SRCC732)IIB T2 Nl
[LT10]
Human lung tumor SqCCa (SRCC733)IIA TI N1
[LTl l]
Human lung tumor AdenoCa (SRCC734)IV T2 NO
[LTI2]
15Human lung tumor AdenoSqCCa T2 NO
(SRCC735)[LTI 3] IB
Human lung tumor SqCCa (SRCC736)IB T2 NO
[LT15]
Human lung tumor SqCCa (SRCC737)IB T2 NO
[LTl6]
Human lung tumor SqCCa (SRCC738)IIB T2 N 1
[LT17]
Human lung tumor SqCCa (SRCC739)IB T2 NO
[LTI8]
20Human lung tumor SqCCa (SRCC740)IB T2 NO
[LT19]
Human lung tumor LCCa (SRCC741 IIB T3 N I
) [LT21 ]
Human lung AdenoCa (SRCC811 1 Tl NO
) [LT22] A
Human colon AdenoCa (SRCC742) M 1 D pT4 NO
[CT2]
Human colon AdenoCa (SRCC743) B pT3 NO
[CT3]
25Human colon AdenoCa (SRCC 744) B T3 NO
[CT8]
Human colon AdenoCa (SRCC745) A pT2 NO
[CT10]
Human colon AdenoCa (SRCC746) MO, R1 B T3 NO
[CT12]
Human colon AdenoCa (SRCC747) pMO, RO B pT3 pN0
[CTI4]
Human colon AdenoCa (SRCC748) M1, R2 D T4 N2
[CT15]
30Human colon AdenoCa (SRCC749) pM0 B pT3 pN0
[CTl6]
Human.colon AdenoCa (SRCC750) C1 pT3 pNl
[CT17]
Human colon AdenoCa (SRCC751 MO, R 1 B pT3 NO
) [CTl ]
Human colon AdenoCa (SRCC752) B pT3 MO
[CT4]
Human colon AdenoCa (SRCC753) G2 C1 pT3 pN0
[CTS]
35Human colon AdenoCa (SRCC754) pMO, RO B pT3 pN0
[CT6]
Human colon AdenoCa (SRCC755) G1 A pT2 pN0
[CT7]
Human colon AdenoCa (SRCC756) G3 D pT4 pN2
[CT9]
Human colon AdenoCa (SRCC757) B T3 NO
[CTl l]
Human colon AdenoCa (SRCC758) MO, RO B pT3 pN0
[CT18]
40 DNA Preparation:
DNA was prepared from cultured cell lines, primary tumors, and normal human
blood. The isolation was
performed using purification kit, buffer set and protease and all from
Quiagen, according to the manufacturer's
instructions and the description below.
Cell culture lysis:
45 Cells were washed and trypsinized at a concentration of 7.5 x 10~ per tip
and pelieted by centrifuging at
1000 rpm for 5 minutes at 4°C, followed by washing again with 1/2
volume of PBS and recentrifugation. The
pellets were washed a third time, the suspended cells collected and washed 2x
with PBS. The cells were then
suspended into 10 ml PBS. Buffer C1 was equilibrated at 4°C. Quiagen
protease #19155 was diluted into 6.25 ml
cold ddH,O to a final concentration of 20 mg/ml and equilibrated at
4°C. 10 ml of G2 Buffer was prepared by
-113-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
diluting Quiagen RNAse A stock (100 mglml) to a final concentration of 200
~cg/ml.
Buffer C1 (10 ml, 4"C) and ddH20 (40 m1, 4"C) were then added to the 10 ml of
cell suspension, mixed
by inverting and incubated on ice for 10 minutes. The cell nuclei were
pelleted by centrifuging in a Beckman
swinging bucket rotor at 2500 rpm at 4°C for 15 minutes. The
supernatant was discarded and the nuclei were
suspended with a vortex into 2 ml Buffer C 1 (at 4°C) and 6 ml ddH20,
followed by a second 4°C centrifugation at
2500 rpm for 15 minutes. The nuclei were then resuspended into the residual
buffer using 200 ~l per tip. G2 buffer
(10 ml) was added to the suspended nuclei while gentle vortexing was applied.
Upon completion of buffer addition,
vigorous vortexing was applied for 30 seconds. Quiagen protease (200 ~1,
prepared as indicated above) was added
and incubated at 50"C for 60 minutes. The incubation and centrifugation were
repeated until the lysates were clear
(e.g., incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min.,
4°C).
Solid human tumor sample preparation and lysis:
Tumor samples were weighed and placed into SO ml conical tubes and held on
ice. Processing was limited
to no more than 250 mg tissue per preparation ( 1 tip/preparation). The
protease solution was freshly prepared by
diluting into 6.25 ml cold ddH,O to a final concentration of 20 mg/ml and
stored at 4°C. G2 buffer (20 ml) was
prepared by diluting DNAse A to a final concentration of 200 mg/ml (from 100
mg/ml stock). The tumor tissue
was homogenated in 19 ml G2 buffer for 60 seconds using the large tip of the
polytron in a laminar-flow TC hood
in order to avoid inhalation of aerosols, and held at room temperature.
Between samples, the polytron was cleaned
by spinning at 2 x 30 seconds each in 2L ddH20, followed by G2 buffer (50 ml).
If tissue was still present on the
generator tip, the apparatus was disassembled and cleaned.
Quiagen protease (prepared as indicated above, 1.0 ml) was added, followed by
vortexing and incubation
at 50"C for 3 hours. The incubation and centrifugation were repeated until the
lysates were clear (e.g., incubating
additional 30-60 minutes, pelleting at 3000 x g for 10 min., 4°C).
Human blood preparation and lysis:
Blood was drawn from healthy volunteers using standard infectious agent
protocols and citrated into 10
ml samples per tip. Quiagen protease was freshly prepared by dilution into
6.25 ml cold ddH20 to a final
concentration of 20 mg/ml and stored at 4°C. G2 buffer was prepared by
diluting RNAse A to a final concentration
of 200 ~g/ml from 100 mg/ml stock. The blood (10 ml) was placed into a 50 ml
conical tube and 10 ml C1 buffer
and 30 ml ddHzO (both previously equilibrated to 4°C) were added, and
the components mixed by inverting and
held on ice for 10 minutes. The nuclei were pelleted with a Beckman swinging
bucket rotor at 2500 rpm, 4°C for
15 minutes and the supernatant discarded. With a vortex, the nuclei were
suspended into 2 ml C1 buffer (4°C) and
6 ml ddH~O (4°C). Vortexing was repeated until the pellet was white.
The nuclei were then suspended into the
residual buffer using a 200 ~1 tip. G2 buffer (10 ml) was added to the
suspended nuclei while gently vortexing,
followed by vigorous vortexing for 30 seconds. Quiagen protease was added (200
ul) and incubated at 50"C for
60 minutes. The incubation and centrifugation were repeated until the lysates
were clear (e.g., incubating additional
30-60 minutes, pelleting at 3000 x g for 10 min., 4"C).
Purification of cleared lysates:
(1 ) Isolation of senomic DNA:
Genomic DNA was equilibrated ( 1 sample per maxi tip preparation) with 10 ml
QBT buffer. QF elution
-114-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
buffer was equilibrated at 50"C. The samples were vortexed for 30 seconds,
then loaded onto equilibrated tips and
drained by gravity. The tips were washed with 2 x 15 ml QC buffer. The DNA was
eluted into 30 ml silanized,
autoclaved 30 ml Corex tubes with 15 ml QF buffer (50~C). Isopropanol (10.5
ml) was added to each sample, the
tubes covered with parafin and mixed by repeated inversion until the DNA
precipitated. Samples were pelleted by
centrifugation in the SS-34 rotor at 15,000 rpm for 10 minutes at 4"C. The
pellet location was marked, the
supernatant discarded, and 10 ml 70% ethanol (4~C) was added. Samples were
pelleted again by centrifugation on
the SS-34 rotor at 10,000 rpm for 10 minutes at 4~C. The pellet location was
marked and the supernatant discarded.
The tubes were then placed on their side in a drying rack and dried 10 minutes
at 37~C, taking care not to overdry
the samples.
After drying, the pellets were dissolved into 1.0 ml TE (pH 8.5) and placed at
50"C for I -2 hours. Samples
were held overnight at 4~C as dissolution continued. The DNA solution was then
transferred to 1.5 ml tubes with
a 26 gauge needle on a tuberculin syringe. The transfer was repeated 5x in
order to shear the DNA. Samples were
then placed at 50°C for 1-2 hours.
(2) Quantitation of senomic DNA and preparation for gene amplification assay:
The DNA levels in each tube were quantified by standard A2~,/ A2g"
spectrophotometry on a 1:20 dilution
(5 ~cl DNA + 95 ~1 ddH20) using the 0.1 ml quartz cuvettes in the Beckman
DU640 spectrophotometer. Az~"/AZ~"
ratios were in the range of 1.8-1.9. Each DNA sample was then diluted further
to approximately 200 ng/ml in TE
(pH 8.5). If the original material was highly concentrated (about 700 ng/~cl),
the material was placed at 50~C for
several hours until resuspended.
Fluorometric DNA quantitation was then performed on the diluted material (20-
600 ng/ml) using the
manufacturer's guidelines as modified below. This was accomplished by allowing
a Hoeffer DyNA Quant 20(1
fluorometer to warm-up for about 15 minutes. The Hoechst dye working solution
(#H33258,10 ~cl, prepared within
12 hours of use) was diluted into 100 ml 1 x THE buffer. A 2 ml cuvette was
filled with the fluorometer solution,
placed into the machine, and the machine was zeroed. pGEM 3Zf(+) (2 ~cl, lot
#360851026) was added to 2 ml of
fluorometer solution and calibrated at 200 units. An additional 2 ~1 of pGEM
3Zf(+) DNA was then tested and the
reading confirmed at 400 +/-10 units. Each sample was then read at least in
triplicate. When 3 samples were found
to be within 10% of each other, their average was taken and this value was
used as the quantification value.
The fluorometricly determined concentration was then used to dilute each
sample to 10 ng/~1 in ddH20.
This was done simultaneously on all template samples for a single TaqMan plate
assay, and with enough material
to run 500-1000 assays. The samples were tested in triplicate with TaqmanT'"
primers and probe both B-actin and
GAPDH on a single plate with normal human DNA and no-template controls. The
diluted samples were used
provided that the CT value of normal human DNA subtracted from test DNA was +/-
1 Ct. The diluted, lot-
qualified genomic DNA was stored in 1.0 ml aliquots at -80"C. Aliquots which
were subsequently to be used in
the gene amplification assay were stored at 4°C. Each 1 ml aliquot is
enough for 8-9 plates or 64 tests:
Gene amplification assa~~:
The PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715,
PRO 1017,
PRO1 I 12, PR0509, PR0853 or PR0882 compounds of the invention were screened
in the following primary
tumors and the resulting ACt values are reported in Table 5.
-115-
CA 02353775 2001-06-04
WO 00/37640 PCTNS99/30095
N
M
N
Q ~. O~ N V1
~ ~ ~
M M ~ , n ~ ~
i i fV N
.. ~
O ' ' '
i i ; i i ' ' ' ~
a ' ' '
~
h n _ M 'n
d'
M O , i
OG ~ N n ' ~ ' '
a -- ' ~
N
M N
O ' '
a ; . ~ ~ . t ~ ~.. _.
' f
n
c 'n v~ ~n
v~ v, ~ m
M
p oo r ~ c m ~n o~
-
Vi 0. I ~ N N M N
~'
N ' ~ ' N
.
U O N ~ N N
C
~
'
' i ~ ~ ...
i
a~ a ~ ~
U
C
~
cd y ~ v1
-,
~~ N
vp 'd V, 00
Ov v1
N M M ~ N
M N M
T
c0
r
M ~ N ~ ~ M M
M N ~
C1 O o0 ' ~ . p
Os d.
. ~ ~ ,..,' N ._ ., ._
a
c
O
U
'fl ~ Y1
O ,
'
' i i
C ' '
'
C
_
.N ~
N N
3 O , p
a ~ ~ ; 1 t ~ --
' '
4
N
O ~ ' i
OC ' ' ' i
~ 1 1 '
a ~ i .- '
M h
t!1 C~ O M
M
O 1 M i M 'f1
a ~ ~ -; ~ ' ., ..:
- - '
N
M ~ ' N
' ' '
a ~
N N M v0 v0 O N
.-. 0 ~
N
~ ~D O~ , ~D 0 r O
~. 00 O. ~
vW O
~ .. ...
N i ~
N
G. i .- i ~
~
O
p ~ t~
= ~ ~ ~ ~ ~ ~ .r.1~ ..~.1..~.7
a . -
t .~ -~
O
-116-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
N
OC
v7 ~ d ~G~ d ~ O~ N vM7t~ M
~
I~ et 00 00M N N N ~ V1 ~ ~D ~O O
O th
~ ~ -. ~ (V N N .~ - ~- ~ CV N
00 M 00 M
M N M
,
o. ~ _: .; ~ t
1'~ M 1~ 1~ ~~ 00
~p O, t~ M M N d
p,. ~ ~ ~ tV ~ ~ n N n
N
h ~ h ~ h
~ N
n ,
;
d _ ~ ~ ~ ~ ,
_ ~n ~_n v~ v~v~~_nvivz vi~nv~ ~_n ~n h v~ ~n
~O ~n d M N C~ l~~OC~ v~ M ~n
-- t~ t~
1~ O
Q t~ O V1 ~-O N H d O~l~00 ~C N v7 O~
00 ~D N
G. ~ M .- NICV (VCV fV.-.rj - M (V lV M
' -. N ~.~ .--~
b
O
N
N oM0 M OHO N ~ ~ cMn ~ can
d ~ ~ fV .- CV ~ ~ ~ ~ ~ tV n
N
U
b
C
cd
v~ v~ ~n ~Gm_n v~O~ vi h ~n ~n h v~ h
N N 00 O t~ _ V1 O~
N ~ V1 d N ~ ~O
0
O
d N N y 0 M fV00 (V ~ 0 fV (V cV fV
N N .- cV
--~
O
N M M 00h ~ M I~ d M V1 d
~
1f~ ~. et I~ O N ~-~O l~N , N , 00 M
C1,
y d .-~.- N N .~-~ N - n ~ i ~ ~-'
C
l~0
O
(~
U
C M V~ v~ _~r1
~ ~
by OC N ~ N ~O M l~ 00 i
C G. ~ (V (V M ~ N ~ ~ ~ M n
O
_
C
_
m
l1h N M M ~ d
. N 00 ~ O ~O M
> 0. ~ a ...~ ~ ~ .-. ~ i (V
w
U
4
N
N h M O ,
O. (V (V M M ~ i n n
n
N
Ov ~ d v0 O; 00 ~ v0t~ , Vt
d N N N ~ M N ~ N ~ ~~ n M i
N
O~
n ~ N ~ N cM~
O
y ~ i
d ~ fV .~ fV (V i - N
C
t~ d h O~ OvI~ M 00 v1 N V1 M Os
N d 00 l~O I~ M !~ N
V1
N
d i fV (V: fV N (V -~ fV ~~ ~- c'~1M
c~s N M ~1 ~O t~ 00
O
a tea ~ ~ 7 ~ ~ F
' ~ ~ 1 7
I- .. .. . . ,.
- . .. ., .
N
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
N
h h
00 ~ ~ N V1 O~
O ~D N N ,
" '
0. tV ~ ~ -- ~
O
N v'f !~ ~D ~n
h VI Os M h
d -. ~ --
N .- .~ ~ ~ .
~
p o
ac 1 ~ ~ ~ ~ ~ ~ ~
0. , ,
N_
'~ ~ ' V1
C
O ~ M O~O ~ N ,
et
~ N - ~ ~ ,
G N i .-- ~ .... .
.
h_
O
O
~ ~ ~ ' h 0~0v0 ~ M
d h V1Oy h N M ~ cY O ~ M M M
M N M ~ O 0
M M
~
U V'1h V1 h V7 M ~!h ,!1V1~7 V1~f1h V7
h
O O (~ M O 00 ~ V100 v0 h 00 h h ~
Y d ~ d h
N
M
2 v0 ~ N M N h , 1 :
N .-- .~ .r
U
.d
C
r
of
,r
r: _ n N O
O , -- _. y .- ~.. .- ,
V i
3 2 f .
C_
T
h
O ~
p, ~ M V1
U M '~
p O ", ~ C M M .-.M O ,
~ d " ~ . .- i
, i
U rj .~..-. .-. , r
G
O
~
O
U
'fl
~p
~ N ~ ~ ~ ~ M ~ ~ ~ I~~
d V O. h ,
G a .- 1 O .~ fV ~ fV .~.-. (V
-
~. M ~ .
C
_
H
M d. ~ h
00 ,
-- ~ , ,
~ , t , ,
U
4
N
0.~ ,
~ ~ ~ i
a , , ,
h
v, v W n v, ~n ~n v~ y n
~ n ~
o d
o, V
d M ~. .-~ N ~ f .-.
N
h h h
N M
O ~ ,n
h ~ ,
0. i ~ i i
M i -- ~ . ,
O
O
~ M h
0., OO M ~ "J
p. M N ~ M N M N N N
v O N ~ VI O l
V ~
O _ _
a ~ ~ U
=
!
N
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
N
M
~ v
~ ~ i
(V n i
ov V h d a~0
~ ~ .... ~ ;
~
g
d h
O O M M i
n n v i ~ ,
C. i i i ~ ~ '
N
d M I~ I~
00
M
N
N ~ O~ V1 n n
.... , (V i i
~ ~
n_
O y~ V1 h V1
O O N N
v~ ~ i
a ~ ~ ,
fV
U O ~ V1 V'1 ~!1 ~ h ~!1 Y1 h
C h ~ O M v1 00 d Ov
~ M l~ t~ d v1 N d
v0
00 00 l O; O M t~ ~ ~ h ~ v
N v0 M N 1~ N ~O O ~ i
O ~ V
' V
N Q r- .~ ~ nj ~ nl ~ .~ .-. i (
.-y .-. ._. (V l
.--
U
'C
n
V1 ~ O~ 00 M M
N ~O, O l
; ~ ~ ~
y o. ~ .
C
T
G
n
V N
. , , M ~,
O_ a ~ ~ ; ._
O ~ " .
(~
U
'b
ai p ~ 'o '
~ ~ ~
00 ,
._. cV ~ ~ ~ '
C
_
M
ea 0.' N d. ~ '
> a -: - -
V
d o
N
' i i i
a
n
r N O ~ M O
M N Y1 N ~
er V V M i
p .~ CV ( f v
",
N
O~
N
O ~ ,
i ~ i i i i
a f S ~ ' ~ '
0
N h M ~ _ ~ ~ O N M
00
d .-. M fV fV fV CVM fV CV
L~ ~_ 0_O
v ~ ~ ~ ~ ~ U
'
a ~
t-
N
-119-
CA 02353775 2001-06-04
WO 00/3~b40 PCT/US99/30095
N
v1~ h ~ N v_1M
~ ~
p vp N h ~ ~ ~ M n
i i
G. i i i i N ~
N:
ono ~ N
Q O O
~ '
' ' i ~ i i ~ '
a ~ i ~ ' ' '
'
g
a
' ~ ~ '
N
cue. ~ ~ ~ i ~ ~ . f ; ~ ~ ~ ~ ~ . 1
0
Vi '
~n a' ~ ~ _ , ' ; ~ ~ ~ ~ ~ ~ t
0. i i i i n i
' ' '
n n n
_ ~ n i n i n i i i i n
a~ a ~ ~ ~ ~ ~ . t ~ ~ . I
U
'd
C
, ' , ~ ' ' i ~ ~ ~ '
0. , i i i i i i n n
7
C
_
v
U O
'
' ~ , ;
a s ~ ~ i ~ ~ ~ ~ s
a t ~ ~
O
~
O
E..,
U
'b
C N:
' '
i ~ i i
a I ~ ~ ~ ~ ~ ~ ; t ~ ~ ~ ; ~ ~ '
c
.N
a~
o
a' ' ~ ' t 1 ' . I ; ~ ~ ~ ~ = 1
0. i i n n i n n = i
V
U
4
N
a , i ~ ~ ~ ; ~ ~ ~ ~ ~ ~ ~ ~ . S
N
M ~ N N ~ N O i n M v0 N
N O
2 i cV --~ N n n ~ i n i n '.'
~ n i
N
V_1V1 h 0
O
M ~h ff~ ~f1 n ~ n
o _
O v0M O n O '~ n , n n ~ n ~
O~ N Gv
d N fV fV i M ~ ~ ~ ' ' ' ' ' ' N
W O N O M E.., O v7 N
O O
a ~ l~ ~ O ~ V ~ N O U N
O V ~
' U ~ Z ~ ~ U Z ~ N ~ ~ U Z Y x
oo
a ~ ~
f-
O 'n
-120-
<IMG>
CA 02353775 2001-06-04
WO 00!37640 PCT/US99/30095
PR0201. PR0327 and PR01265:
PR0201 (DNA30676-1223), PR0327 (DNA38113-1230) and PR01265 (DNA60764-1533)
were also
reexamined along with selected tumors from the above initial screen with
framework mapping. Figure 29 and Table
6 indicate the chromosomal mapping of the framework markers that were used in
the present example. The
framework markers are located approximately every 20 megabases and were used
to control aneuploidy.
PR0201 (DNA30676-1223), PR0327 (DNA38113-1230) and PR01265 (DNA60764-1533)
were also
reexamined with epicenter mapping. The markers indicated in Tables 7A, 7B, and
7C are located in close proximity
(in the genome) to DNA30676, DNA38113 and DNA60764, respectively, and are used
to assess the relative
amplification in the immediate vicinity of Chromosome 19 wherein the
respective molecule is located. The distance
between individual markers is measured in centirays (cR), which is a radiation
breakage unit approximately equal
to a 1 % chance of a breakage between two markers. One cR is very roughly
equivalent to 20 kilobases. The marker
SHGC-35441 is the marker found to be the closest to the location on Chromosome
19 where DNA30676 maps, and
SHGC-33698 is closest to DNA60764.
Table 6
Framework Markers Along Chromosome 19
Map Position on Chromosome 19 Stanford Human Genome Center
Marker Name
S 12 AFMa 107xc9
S50 SHGC-31335
S 105 SHGC-34102
S155 SHGC-16175
Table 7A
Epicenter Markers Along Chromosome 19 Used For DNA30676
Map Position on ChromosomeStanford Human GenomeDistance to Next Marker
19 Center (cR)
Marker Name
S12 AFMa107xc9 22
S16 SHGC-1261 53
S 17 SHGC-2897 7
S 18 SHGC-35441 59
S 19 SHGC-6150 33
S21 AFM224ye9 21
S23 SHGC-31478 25
S24 SHGC-3921 25
-122-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 7B
Epicenter Markers Along Chromosome 19 Used For DNA38113
Map Position on ChromosomeStanford Human GenomeDistance to Next
19 Center Marker (cR)
Marker Name
S42 WI-7289
S S43 SHGC-32638 28
S44 SHGC-11753 7
DNA38113
S45 SHGC-14810 37
S46 AFM214YF6 15
S48 SHGC-36583
Table 7C
Epicenter Markers Along Chromosome 19 Used for DNA60764
Map Position On ChromosomeStanford Human GenomeDistance to Next Marker
19 Center (cR)
Marker Name
DNA34353 maps to S 158
DNA40620 maps to S 160
DNA54002 maps to S 160
S 160 SHGC-34723 21
DNA60764
S I61 SHGC-30929 15
S162 SHGC-10328 17
S 163 AFMa 11 SwgS
The ACt values of the above described framework markers along Chromosome 19
relative to PR0201, PR0327
and PR01265 are indicated for selected tumors in Table 8A, 8B and 8C,
respectively.
-123-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 8A
Amplification of Framework Markers Relative to DNA30676 (ACt )
Framework
Markers
Tumor S 12 DNA30676 S50 S 105 S 155
LTl 0.16 -0.18 0.06 -0.42 0.11
LTIa 0.05 0.79 -0.27 0.17 0.40
LT2 0.48 -0.09 0.41 0.52 0.13
LT3 0.27 1.04 0.83 0.11 0.50
LT4 0.48 -0.18 0.67 0.20 0.56
LT6 0.72 -0.23 0.74 0.32 0.35
LT7 0.82 -0.36 0.85 0.95 0.95
LT9 0.72 -0.75 0.61 0.19 0.64
LT10 0.82 0.05 0.98 0.62 0.53
LTl 1 0.13 0.64 0.25 0.55 -0.34
LT12 0.04 -0.60 0.60 0.21 -0.17
LT13 -0.06 0.67 0.57 -0.30 -0.05
LT15 -0.03 1.43 -0.77 O.I2 -0.04
LTl6 0.46 1.35 1.37 0.51 0.23
LT17 0.37 1.51 0.74 0.21 0.22
LT18 0.39 1.22 0.57 0.11 0.16
LT22 0.79 0.13 0.76 -0.05 0.16
CT2 0.25 2.81 0.29 0.37 -0.02
CT3 -0.17 2.03 -0.10 0.34 -0.28
CTg I .39 0.57 0.18 -0.16
CTto 0.15 2.21 0.51 -0.01 -0.81
CT12 0.135 1.93 0.57 0.41 0.20
CTI4 0.40 2.37 0.39 0.45 0.36
CT15 -0.23 1.27 -0.30 -0.06 0.56
CT16 0.38 1.76 0.31 0.24 0.04
CT17 0.25 1.65 0.71 0.32 0.22
-124-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 8B
Amplification of Framework Markers Relative to DNA38113 (ACt )
Framework
Markers
Tumor S 12 DNA38113 S50 S 105 S 155
LT1 0.16 -0.15 0.06 -0.42 0.11
LTl a 0.05 0.57 -0.27 0.17 0.40
LT2 0.48 0.57 0.41 0.52 0.13
LT3 0.27 0.77 0.83 0.11 0.50
LT4 0.48 0.08 0.67 0.20 0.56
LT6 0.72 0.33 0.74 0.32 0.35
LT7 0.82 0.29 0.85 0.95 0.95
LT9 0.72 -0.19 0.61 0.19 0.64
LT10 0.82 1.45 0.98 0.62 0.53
CT2 0.25 2.94 0.29 0.37 -0.02
CT3 -0.17 1.23 -0.10 0.34 -0.28
CT8 0.13 1.45 0.57 0.18 -0.16
CT10 0.15 1.72 0.51 -0.01 -0.81
CT12 0.13 1.60 0.57 0.41 0.20
CT14 0.40 2.03 0.39 0.45 0.36
CT15 -0.23 0.68 -0.30 -0.06 0.56
CT16 0.38 1.07 0.31 0.24 0.04
CTl7 0.25 0.50 0.71 0.32 0.09
-125-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 8C
Amplification of Framework Markers Relative to DNA60764 (ACt)
Framework
Markers
Tumor S 12 DNA60764 S50 S 105 S 155
LTI 0.16 0.06 -0.42 0.11 -1.56
LTIa 0.05 -0.27 0.17 0.40 0.00
LT2 0.48 0.41 0.52 0.13 -0.36
LT3 0.27 0.83 0.11 0.50 1.04
LT4 0.48 0.67 0.20 0.56 -0.35
LT6 0.72 0.74 0.32 0.35 0.24
LT7 0.82 0.85 0.95 0.95 0.75
LT9 0.72 0.61 0.19 0.64 -0.35
LT10 0.82 0.98 0.62 0.53 0.32
LTlI 0.13 0.25 0.55 -0.34 0.70
LT12 0.04 0.60 0.21 -0.17 2.17
LTI3 -0.06 0.57 -0.30 -0.05 2.24
LT15 -0.03 -0.77 0.12 -0.04 3.51
LT16 0.46 1.37 0.51 0.23 3.32
LT17 0.37 0.74 0.21 0.22 1.02
LT18 0.39 0.57 0.11 0.16 0.52
LT22 0.79 0.76 -0.05 0.16 0.59
Tables 9A, 9B and 9C indicate the ~Ct values for results of epicenter mapping
relative to DNA30676,
DNA38113, and DNA60764, respectively, indicating the relative amplification in
the region more immediate to the
actual location of DNA30676, DNA38113, and DNA60764 along Chromosome 19.
-126-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 9A
Amplification of Epicenter Markers Relative to DNA30676 (OCt)
Epicenter
Markers
Tumor S12 S16 S17 S18 DNA S19 S21 S23 S24
30676
LTl -- 0.22 -0.16 0.02 -0.29 0.00 0.40 -0.02 0.14
LTIa -- 0.11 -0.52 0.32 0.58 0.00 -0.55 0.04 -0.15
LT2 -- -0.07 -0.07 0.34 -0.04 0.00 0.07 0.13 0.12
LT3 -- 0.01 -0.46 0.47 1.87 0.00 0.16 0.24 0.02
LT4 -- -0.36 -0.96 0.93 -1.18 0.00 -0.54 -0.07 -0.23
LT6 -- -0.35 -0.70 -0.04 0.28 0.00 -0.24 -0.12 -0.01
LT7 -- -0.32 -0.34 -0.27 0.29 0.00 -0.74 -0.07 0.05
LT9 -- -0.42 -0.66 -0.36 0.07 0.00 -1.42 -0.26 -0.70
LT10 -- -0.26 -0.14 -0.07 0.55 0.00 -0.32 -0.04 -0.08
LTlI -- -0.22 -0.77 0.05 0.68 0.00 -0.85 -0.13 0.09
LT12 -- -0.94 -1.52 -1.26 0.13 0.00 -0.08 -0.09 0.24
LT13 -- 0.24 0.02 0.35 1.44 0.00 -0.08 0.50 0.49
LT15 -- -0.09 -0.64 0.26 1.99 0.00 0.03 0.09 -0.06
LT16 -- 0.06 -0.16 0.20 1.72 0.00 0.75 0.54 0.64
LT17 -- -0.91 -1.71 -0.78 -0.15 0.00 -2.89 -0.82 -0.42
LT18 -- 0.30 -0.20 0.71 1.09 0.00 -0.29 0.34 0.80
LT22 -- 0.37 -0.82 0.47 0.07 0.00 0.46 0.38 0.65
CTl 0.46 0.02 0.35 0.59 3.51 -- -0.15 0.53 0.05
0.18 0.19 0.32 0.57 1.61 0.75 0.56 0.14
CT3 -0.02 -0.24 0.05 0.13 2.19 -- -0.31 0.13 -0.34
CT4 0.29 0.20 0.42 0.64 3.22 -- 0.47 0.27 0.33
CTS -0.15 -0.16 0.12 -0.21 2.83 -- 0.09 -0.08 -0.17
CT6 0.13 0.17 0.87 0.26 2.93 -- 0.44 0.04 0.39
CT7 0.13 -0.03 0.78 -0.04 2.43 -- -0.68 -0.26 0.20
CT8 0.45 -0.03 0.58 0.22 1.95 -- 0.25 0.57 0.07
CT9 0.50 0.41 0.98 0.64 2.72 -- 0.24 0.06 0.66
CT10 0.11 -0.40 0.32 0.13 3.12 -- -0.16 0.28 -0.16
-127-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 9A Continued
Amplification of Epicenter Markers Relative to DNA30676 (ACt)
Epicenter
Markers
Tumor S12 S16 S17 S18 DNA S19 S21 S23 S24
30676
CT11 0.18 0.01 0.45 0.82 3.26 - 0.34 0.00 0.27
CT12 0.53 0.08 0.72 0.40 2.77 -- 0.36 0.67 0.09
CTl4 0.57 -0.13 0.87 0.63 2.88 -- 0.59 0.74 0.09
CTIS -0.09 -0.57 0.05 0.11 2.60 -- -0.07 0.20 -0.34
CT16 0.57 -0.21 0.80 0.36 2.61 -- 0.38 0.49 0.16
CT17 0.25 -0.26 0.38 0.29 2.24 --- -0.05 0.67 0.05
CT18 0.38 0.18 0.53 0.49 2.48 -- 0.41 -0.29 0.12
Table 9B
Amplification of Epicenter Markers Relative to DNA38113 (OCt)
Epicenter
Markers
Tumor S41 S42 S43 S44 DNA S45 S46 S48
38113 .
LT1 -1.03 -0.25 -0.18 -0.11 -0.31 0.13 0.26 0.29
LTIa 0.14 -0.30 -0.I1 -0.01 0.21 -0.44. 0.45 -0.30
LT2 0.03 0.06 0.06 0.12 0.14 0.16 0.11 0.65
LT3 -1.08 -0.08 -0.01 0.11 0.43 -0.37 0.33 0.56
LT4 0.66 -0.14 -0.48 -0.79 -0.28 -0.31 0.04 0.09
LT6 -0.88 -0.08 -0.12 -1.00 0.20 -0.43 0.48 0.63
LT7 0.65 -0.19 -0.19 -0.04 0.04 -0.42 0.43 0.57
LT9 0.66 -0.26 -0.01 -0.14 -0.06 -0.31 -16.48 0.16
LT10 1.16 -0.30 -0.11 -0.31 0.13 -0.33 0.34 0.50
LTIl 0.46 0.01 -0.04 -0.86 0.67 0.23 0.24 -0.57
LT12 1.39 -0.01 -0.22 -1.33 1.57 -0.25 0.26 0.07
LT13 1.62 -0.03 0.00 -0.08 1.22 -0.08 0.48 0.14
LT15 1.09 0.20 0.47 0.62 2.47 0.38 0.01 0.44
LTI6 1.51 0.04 -0.04 0.29 2.23 0.51 0.50 0.90
LT17 2.12 0.23 0.11 0.20 1.02 0.45 0.46 -0.41
-128-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99130095
Table 9B Continued
Amplification of Epicenter Markers Relative to DNA381 I 3 (OCt)
Epicenter
Markers
Tumor S41 S42 S43 S44 DNA S45 S46 S48
38113
LT18 1.80 -0.11 0.07 -0.70 0.90 0.10 0.00 -0.02
LT22 -0.12 0.06 0.41 -0.11 -0.06 0.34 0.03 0.52
CT1 -0.09 0.33 0.11 0.22 1.38 0.09 -0.25 -0.10
CT2 1.76 0.04 0.30 0.65 2.94 0.18 -0.04 0.01
CT3 1.10 -0.31 -0.24 0.16 1.23 -0.64 0.78 -0.17
CT4 1.63 0.22 0.32 -0.72 2.23 -0.04 0.44 0.72
CT5 2.22 0.02 0.21 0.10 2.51 0.02 0.18 0.24
CT6 0.48 0.20 0.22 -0.63 2.29 0.03 0.14 0.97
CT7 0.93 0.20 0.32 0.14 0.95 -0.O1 0.20 0.54
CT8 1.15 -0.50 -0.14 0.15 1.45 -0.31 0.54 0.07
~
CT9 0.82 0.38 0.64 -0.71 1.59 1.04 0.26 0.93
CT10 1.57 -0.41 -0.03 -0.14 1.72 -0.27 0.04 0.10
CTIl 1.49 -0.05 0.07 0.01 3.34 0.54 0.28 0.88
CTI2 0.89 -0.09 -0.01 -0.62 1.6 -0.07 1.16 0.92
CT14 2.16 0.32 0.37 0.47 2.03 -0.07 1.21 0.44
CT15 0.64 -0.52 -0.21 -0.12 0.68 -0.61 1.01 0.32
CT16 1.75 -0.31 0.28 0.47 1.07 0.04 1.01 -0.29
CT17 0.77 -0.18 0.13 -0.04 0.50 -0.27 0.93 0.31
CT18 0.91 0.05 0.14 0.60 1.08 0.22 -0.59 0.61
Table 9C indicates the OCt values for the results of epicenter mapping
relative to DNA60764, indicating
relative amplification in the region more immediate to the actual location of
DNA60764 along Chromosome 19.
DNA34353, DNA40620 and DNA54002 are other independently identified molecules
which have been observed
to map to the same region of Chromosome 19 as DNA60764.
-129=
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 9C
Amplification of Epicenter Markers Relative to DNA60764 (~Ct )
Epicenter
Markers
Tumor DNA DNA DNA S 160 DNA S 161 S 162 S 163
34353 40620 54002 60764
LT1 -0.22 -0.27 -2.62 0.03 -1.26 0.00 -0.33 -0.29
LTI 0.49 -0.08 0.13 -0.02 0.00 -0.26 -0.64
a
LT2 0.47 -0.22 -0.22 0.04 -0.09 0.00 -0.20 -0.23
LT3 0.81 -0.19 0.07 0.07 0.32 0.00 0.27 0.15
LT4 0.64 -0.16 0.04 0.37 -0.73 0.00 -0.12 -0.64
LT6 0.44 -0.36 -0.36 -0.20 -0.22 0.00 -0.12 -0.64
LT7 0.54 0.18 0.23 0.22 -0.47 0.00 0.16 -0.03
LT9 0.40 -0.26 0.13 -0.10 -0.27 0.00 -0.71 -0.24
LT10 0.89 0.10 -0.81 0.25 0.57 0.00 O.ll 0.01
LTI1 0.17 -0.43 0.22 -0.20 0.47 0.00 -0.06 0.30
LT12 0.91 -0.04 0.64 0.27 2.35 0.00 0.51 0.58
LT13 0.81 0.05 0.74 0.10 2.37 0.00 0.21 0.60
LT15 1.03 -0.06 0.54 0.49 3.88 0.00 0.21 0.64
LTI6 1.22 0.40 0.86 0.63 3.32 0.00 0.50 0.81
LT17 1.02 0.13 0.35 -0.39 0.88 0.00 0.23 0.73
LTI8 0.72 -0.32 -0.20 -0.30 0.18 0.00 -0.12 -0.04
LT22 -0.18 -0.54 0.56 -0.14 -0.75 0.00 0.02 -0.34
CTI 0.46 0.19 0.43 0.31 1.74 0.16 0.38
CT4 0.71 0.15 0.38 0.19 1.86 - 0.25 0.61
CT5 1.20 0.04 0.41 0.48 3.28 - 0.29 0.73
CT6 0.86 -0.04 0.45 0.36 0.93 -0.07 0.48
CT7 0.81 -0.07 0.02 -0.21 1.29 -0.16 0.38
CT9 1.00 0.43 0.18 0.50 -0.25 0.34 0.72
CTII 1.11 0.07 0.68 0.30 2.32 - 0.05 0.31
CT18 0.83 -0.10 0.11 0.21 0.39 - -0.04 0.04
PR0292:
PR0292 (DNA35617) was also examined with framework mapping. Figure 30 and
Table 10 indicate the
-130-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
chromosomal mapping of the framework markers that were used in this analysis.
The framework markers are
located approximately every 20 megabases and were used to control aneuploidy.
Table 10
Framework Markers Used on Chromosome 11 for DNA35617
Map Position on Chromosome 11 Stanford Human Genome Center
Marker Name
K7 SHGC-14668
K62 SHGC-31021
K113 SHGC-6028
KI62 SHGC-11920
K226 SHGC-6023
K282 SHGC-9000
K326 SHGC-I 2291
K365 SHGC-10796
K412 SHGC-6005
The ACt values of the above described framework markers along Chromosome 11
relative for PR0292
are indicated for selected tumors in Table 11.
-131-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 11
Amplification of Framework Markers Relative to DNA35617
Framework
Markers
Tumor DNA K7 K62 K113 K162 K226 K282
35617
LTI -1.56 -0.15 -2.31 -0.42 -0.44 -2.14 -0.57
LTl a -0.61 -1.11 -0.50 -1.71 -0.76 -0.09 -0.07
LT2 -0.23 0.00 -0.57 0.39 -0.20 0.12 0.09
LT3 0.39 -0.02 -0.38 0.08 -0.17 0.24 0.06
LT4 -0.18 0.21 -1.54 0.82 -0.35 0.66 O.19
LT6 -0.34 0.10 -0.64 -2.51 -0.24 0.29 -0.01
LT7 -0.45 -0.08 -0.44 0.56 0.08 -0.24 -0.65
LT'9 -0.36 -0.36 -1.63 0.36 -0.15 0.58 -0.11
LT10 -0.23 -0.07 -0.82 0.42 -0.87 0.24 -0.48
LTll 0.76 -0.24 0.71 0.00 -0.57 0.30 -0.09
LT12 1.61 -0.61 2.36 0.00 -0.55 -0.47 -0.22
LT13 1.95 -0.66 2.53 0.00 -0.64 -0.83 -0.13
LT15 2.86 -0.19 3.21 0.00 -0.68 0.01 -1.19
LT16 1.68 -0.65 3.02 0.00 -1.01 0.10 -0.29
LTl7 0.72 -0.21 -0.48 0.00 -0.32 -0.04 -0.20
LT18 0.34 0.13 -1.15 0.00 -0.25 -0.41 -0.13
LT22 -0.57 0.37 -0.46 0.00 0.1 S 0.26 0.57
-
CT2 3.75 0.40 4.19 0.28 0.27 0.47 0.26
CT3 0.63 0.16 0.75 0.10 0.04 0.28 0.19
CT8 1.76 0.18 1.21 0.79 -0.05 0.41 0.19
CT10 1.68 -0.32 1.98 -0.12 -0.32 0.23 -0.08
CT12 0.77 0.48 1.08 0.55 -0.36 0.35 0.15
CT14 1.75 -0.09 2.02 0.37 0.56 0.94 0.37
CT15 0.90 -0.11 0.56 0.37 0.02 0.48 0.05
CT16 0.80 0.12 0.76 0.02 -0.06 0.20 0.03
CT17 0.82 0.48 0.57 -0.07 -0.02 0.00 -0.27
-132-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0343 and PR0882:
PR0 343 (DNA43318-1217) and PR0882 (DNA58125) were also reexamined with both
framework and
epicenter mapping. Figure 31 and Table 12 indicate the chromosomal mapping of
the framework markers that were
used in this analysis. The framework markers are located approximately every
20 megabases and were used to
control aneuploidy. Tables 13A and 13B indicate the epicenter markers used for
the mapping of DNA43318 and
DNA58125. The markers shown in Tables 13A and 13B are located in close
proximity (in the genome) to DNAs
DNA43318 and DNA58125, respectively, and are used to assess the relative
amplification in the immediate vicinity
of Chromosome 16 wherein the respective molecules map. The distance between
individual markers is measured
in centirays (cR), which is equivalent to 20 kilobases. The markers AFMa061
yb5 and SHGC-36123 are located
the closest to the location on Chromosome 16 where DNA43318 and DNA58125,
respectively, map.
Table 12
Framework Markers Used on Chromosome 16 for DNA43318 and DNA58125
Map Position on Chrornosome Stanford Human Genome Center
16 Marker Name
p7 SHGC-2835
P55 SHGC-9643
P99 GATA7B02
P154 SHGC-33727
P208 SHGC-13574
Table 13A
Epicenter Markers Along Chromosome 16 Used for DNA43318
Map Position on ChromosomeStanford Human,GenomeDistance to next Marker
16 Center (cR)
Marker Name
P 106 AFM21 Oyg3 15
P107 CHLC.GATA81 B 12 17
P108 WI-1256 17
DNA43318
p 109 AFMa061 yb5 20
Pl 10 CHLC.GGAA23C09 31
P 111 AFMaI 83wd9 12
P 112 WI-7078
-133-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I30095
Table 13B
Epicenter Markers Aiong Chromosome 16 Used for DNA58125
Map Position on ChromosomeStanford Human GenomeDistance to Next Marker
16 Center (cR)
Marker Name
pg9 SHGC-11302 27
P90 ~T~g7
P92 SHGC-2726 23
DNA58125
P93 SHGC-36123 42
pc~4 SHGC-35326 23
P95 IB391
The ~Ct values of the framework markers of Table 12 along Chromosome 16
relative for PR0343 and
PR0882 are indicated for selected tumors in Table 14.
-134-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 14
Amplification of Framework Markers Relative to DNA43318 and DNA58125
Framework
Markers
Tumor P7 P55 DNA P99 DNA P154 P208
58125 43318
LT1 -3.62 -0.07 0.18 0.03 -1.04 -0.22 -0.06
LTI a -1.90 -0.13 0.75 0.10 -0.20 0.45 0.28
LT2 -0.41 -0.05 0.36 0.07 -0.44 -0.07 0.41
LT3 0.18 -0.37 1.02 -0.17 0.21 -0.18 0.19
LT4 -3.58 -0.25 0.65 -0.13 -0.38 -0.05 0.04
LT6 -0.57 -0.26 0.34 0.05 -0.33 -0.23 0.09
LT7 -1.60 -0.46 0.43 1.14 -0.37 0.25 -0.54
LT9 -0.77 -0.14 0.36 0.33 -0.39 -0.18 0.43
LT10 -2.60 -0.28 0.50 0.20 -0.12 -0.02 0.39
LTII -0.64 -0.15 0.86 -0.02 0.35 -0.08 -0.55
LT12 -1.19 -0.11 1.00 -0.50 1.16 -0.74 -0.97
LT13 -0.31 -0.27 1.33 0.02 1.72 -0.38 -0.40
LT15 -0.90 -1.90 1.83 -0.07 2.73 -O.18 -0.39
LTI6 -1.29 -0.92 0.97 -0.68 1.46 -0.43 -0.90
LT17 -0.13 -0.15 1.03 0.02 0.42 -0.15 -0.52
LT18 -1.24 -0.43 1.08 -0.04 1.06 -0.13 -0.45
LT22 -1.86 -0.29 0.05 -0.09 -0.66 -0.12 -0.26
CTl -0.73 0.35 1.08 -0.09 0.24 0.05 -0.03
CTZ 2.72 0.93 2.27 0.72 3.54 0.48 -0.13
CT3 0.01 0.07 1.34 0.53 0.42 -0.27 -0.52
CT4 -0.99 -0.07 1.13 -0.61 1.17 -0.43 -0.09
CTS 0.09 0.34 2.17 -0.04 2.63 -0.19 -0.01
CT6 -1.36 -0.29 1.41 -0.03 0.46 -0.16 0.27
CT7 -1.36 0.09 0.24 -0.18 -0.81 -0.17 -0.13
CT8 -1.01 1.05 I .23 0.69 1.44 0.60 0.04
CT10 0.95 0.84 1.74 0.75 1.36 -0.17 -0.57
CT12 -0.73 0.49 1.13 0.71 0.87 0.60 -0.88
-135-
CA 02353775 2001-06-04
W O 00/37640 PCT/US99/30095
Table 14 Continued
Amplification of Framework Markers Relative to DNA43318 and DNA58125
Framework
Markers
Tumor P7 P55 DNA P99 DNA P154 P208
58125 43318
CT14 -0.16 1.49 I.74 0.83 1.68 0.33 -0.38
CTI S -1.23 0.72 1.30 0.60 1.07 -0.29 -0.70
CTl6 0.05 1.07 0.93 0.59 1.01 -0.13 -0.66
CT17 0.27 1.06 0.91 0.83 0.67 -0.15 -0 77
CT18 0.32 0.81 1.04 0.74 0.79 0.55 0.36
Tables 15A and I SB indicate the ACt values from epicenter mapping relative to
DNA43318 and
DNA58125, respectively, indicating the relative amplification in the region
more immediate to the actual location
of the respective molecules along Chromosome 16.
Table 15A
Amplification of Epicenter Markers Relative to DNA43318 (OCt )
Epicenter
Marker
Tumor P106 P107 P108 DNA P109 P110 P111 P112
43318
LTl -0.30 0.56 -0.43 -1.50 -0.30 -1.52 -0.04 -0.09
LTl -0.80 0.79 0.48 -0.47 0.45 -1.52 -0.04 -0.09
a
LT2 -0.17 0.43 -0.17 -0.52 0.14 -1.52 1.05 0.47
LT3 -0.46 -0.53 -0.49 0.18 -0.02 -1.52 -0.03 -0.24
LT4 -0.06 0.56 -0.61 -0.77 -0.79 -1.52 0.38 -0.39
LT6 -0.19 1.24 -0.46 -0.38 -0.55 -1.52 0.38 -0.39
LT7 0.56 1.52 0.30 -0.43 1.02 -1.52 1.58 0.94
LT9 -0.47 -0.16 -0.13 -0.41 0.64 -0.12 0.32 -0.22
LT10 -0.24 -1.00 -0.35 -0.22 -1.54 -1.52 0.22 -0.16
LTII 0.18 0.79 -0.38 0.25 0.22 0.00 -0.01 0.00
LTl2 -0.61 0.47 -0.32 1.32 -0.09 0.00 -1.01 -0.37
LT13 0.28 1.41 0.03 1.94 -0.44 0.11 0.11 0.39
-136-
CA 02353775 2001-06-04
WO 00137640 PCT/US99I30095
Table 15A Continued
Amplification of Epicenter Markers Relative to DNA43318 (OCt )
Epicenter
Marker
Tumor P106 P107 P108 DNA P109 P110 P111 P112
43318
LT15 -0.23 -1.29 0.10 3.07 -0.80 0.00 -0.42 -0.O1
LTlb -0.44 -0.18 -0.53 1.83 -0.96 0.00 -0.15 -0.18
LT17 0.61 0.39 -0.12 0.45 -0.29 0.00 -0.13 0.24
LT18 0.26 0.77 -0.16 0.11 -1.07 0.00 -0.12 0.15
LT22 0.31 0.91 0.22 -0.52 0.11 0.00 0.24 0.21
CTl 0.17 1.09 -0.13 0.10 0.98 0.00 -0.13 -0.04
CT4 -0.63 0.69 0.07 1.02 0.61 0.00 -0.14 -0.06
CT5 0.03 0.78 -0.17 2.40 0.60 0.00 -0.28 -0.11
CT6 -0.21 -1.03 -0.38 3.78 -0.40 0.00 -0.84 -0.22
CT7 0.03 0.51 -0.08 0.64 0.16 0.00 0.00 -0.11
CT9 0.26 0.26 -0.55 -0.91 0.46 0.00 0.11 -0.09
CTl1 0.68 1.20 -0.08 1.51 0.68 0.00 0.09 0.05
CTl8 -0.13 1.13 0.09 0.46 0.96 0.00 -0.18 0.13
CT2 -0.47 0.19 -0.26 2.48 -0.39 0.00 -0.39 0.41
CT3 -0.58 1.33 0.03 -1.74 0.99 0.00 0.47 0.03
CT8 0.39 1.69 0.34 -1.04 I .12 0.00 0. I 0.34
1
CT10 0.03 0.29 0.54 -0.98 1.60 0.00 0.33 0.48
CT12 0.25 1.17 0.59 -1.61 0.64 0.00 0.54 0.52
CT14 0.41 1.71 0.38 -0.70 1.75 0.00 0.86 0.62
CT16 0.07 1.15 0.20 -1.41 0.71 0.00 0.14 0.43
CTl7 -0.13 0.91 0.29 -1.74 0.60 0.00 0.63 0.37
-137-
CA 02353775 2001-06-04
WO 00/37640 PCTlUS99/30095
Table 15B
Amplification of Epicenter Markers Relative to DNA58125 (ACt )
Epicenter
Marker
Tumor P89 P92 DNA P93 P94 P95
58125
LT1 -0.11 -0.10 -0.02 -0.52 -0.O1 -0.13
LTl a -0.03 0.06 0.65 0.19 -0.33 -0.25
LT2 0.02 0.17 0.38 -0.32 0.11 -0.13
LT3 -0.15 0.05 0.77 0.10 0.13 0.04
LT4 0.08 0.02 0.36 -0.72 0.15 -0.43
LT6 -0.82 -0.40 0.07 -1.18 0.09 0.23
LT7 0.09 -0.04 0.41 0.03 0.29 0.32
LT9 -0.09 0.12 0.40 0.04 0.18 0.09
LT10 -1.65 -0.79 -0.43 -0.78 0.00 -0.93
LTII 0.15 0.17 0.91 0.10 0.23 0.31
LT12 -1.03 -0.07 1.02 -0.30 0.29 0.27
LT13 0.42 0.44 1.52 -0.12 0.23 0.27
LTl s 0.48 0.35 2.04 0.37 0.00 0.22
LT16 -0.09 -0.47 1.09 -0.62 0.32 0.54
LT17 0.81 0.46 1.32 0.72 0.46 0.45
LT18 -0.10 -0.35 0.56 -0.56 0.33 -0.53
LT22 0.75 0.67 0.22 0.14 0.13 -0.16
CT1 0.40 0.22 2.29 0.33 0.21 0.68
CT4 -0.20 -0.21 1.49 0.81 0.13 -0.07
CT5 0.25 0.17 0.71 -0.30 0.14 -0.12
CT6 0.38 0.39 1.83 0.31 0.21 O.OI
CT7 0.37 0.19 1.20 0.44 0.27 -0.12
CT9 0.53 0.47 1.67 0.52 0.20 0.20
CT11 0.10 0.09 1.02 0.18 0.05 -0.08
CT18 0.02 0.12 0.78 0.21 0.05 -0.07
CT2 0.17 0.18 1.07 0.41 0.17 0.05
CT3 -0.73 -0.50 0.66 -1.04 0.21 -0.61
-138-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 15B Continued
Amplification of Epicenter Markers Relative to DNA58125 (ACt )
Epicenter
Marker
Tumor P89 P92 DNA P93 P94 P95
58125
CT8 0.54 0.59 2.27 0.76 0.46 0.52
CT10 0.46 0.29 1.50 0.32 0.46 0.12
CT12 0.09 -0.15 0.81 0.05 0.57 O.OI
CT14 0.37 0.22 0.47 -0.84 0.50 0.43
CTl6 0.50 0.14 2.24 0.15 0.64 0.08
CT17 0.15 0.26 0.82 -0.42 0.07 -0.02
PR01017:
PR01017 (DNA56112-1379) was also reexamined with framework mapping. Figure 32
and Table 16
indicate the chromosomal mapping of the framework markers that were used in
this analysis. The framework
markers are located approximately every 20 megabases and were used to control
aneuploidy.
PR01017 (DNA56112-1379) was also reexamined with epicenter mapping. Table 17
indicates the
epicenter markers which are located in close proximity to DNA56112 which were
employed to assess the relative
amplification in the immediate vicinity of Chromosome 7 wherein DNA56112 is
located. The distance between
individual markers is measured in centirays (cR), which is a radiation
breakage unit approximately equal to a 1 %
chance of a marker found to be the closest to the location on Chromosome 7
where DNA56112 maps.
Table 16
Framework Markers Used on Chromosome 7 for DNA56112
Map Position on Chromosome 7 Stanford Human Genome Center
Marker Name
Gl 1 xAFM21 Oxc7
G54 238558
G 113 WI-7675
6164 SHGC-33722
6205
6254 AFM036XG5
6302 WI-1841
6358 SHGC-35064
6419 Cda 16c 10
-I 39-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 17
Epicenter Markers Along Chromosome 7 Used for DNA56112
Map Stanford Human GenomeDistance to Next Marker
Position Center (cR)
on Marker Name
Chromosome
7
G5 SHGC-32510 48
G6 sWSS918 19
G7 AFMc027xb5 18
G8 SHGC-33698 23
DNA56112 -
G9 EST00439 63
G12 SHGC-30897
Table 18 indicates the ACt values for the results of epicenter mapping
relative to DNA56112, indicating
the relative amplification in the region more immediate to the actual location
of DNA56112 along Chromosome
7.
p
Epicenter
Markers
Tumor GS G6 G7 G8 DNA G9 G11 G12
56112
LTI 0.22 0.33 0.37 0.21 0.47 -2.66 0.18 0.34
LTIa -0.03 0.27 0.28 0.28 -1.38 -1.64 0.24 0.23
LT2 -0.08 0.27 0.28 0.28 -1.38 -1.64 0.24 0.23
LT3 -0.32 0.02 0.34 0.23 0.23 -0.44 0.01 0.32
LT4 -0.04 -0.08 0.68 0.04 0.65 -0.19 0.10 0.32
LT6 -0.42 -0.90 0.14 -0.19 -1.09 -1.17 -0.10 -0.43
LT7 0.08 0.03 0.21 0.27 0.59 -1.41 0.16 0.28
LT9 -0.17 -0.09 0.22 0.05 0.04 -1.23 0.13 -0.02
LT10 -0.09 0.09 0.22 0.22 0.59 -2.19 0.14 0.09
Table 18
Am lification of Epicenter Markers Relative to DNA56112 (ACt )
-140-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 18 Continued
Amplification of Epicenter Markers Relative to DNA56112 (ACt )
Epicenter
Markers
Tumor GS G6 G7 G8 DNA G9 G11 GI2
56112
LT11 0.23 0.32 0.03 0.10 0.64 -0.77 0.31 -0.04
LT12 -0.13 0.06 0.02 0.24 1.47 -0.78 0.44 0.16
LT13 -0.OS 0.06 -0.09 0.03 I.51 -0.07 0.23 -0.04
LT15 -0.18 -0.04 0.07 -0.11 2.27 -0.03 0.20 -0.16
LTl6 0.20 0.06 0.31 0.05 1.62 -0.70 0.54 0.32
LT17 0.09 -0.04 0.37 -0.04 0.24 -0.98 0.08 0.11
LT18 0.00 0.02 -0.04 -0.27 1.03 -1.61 0.29 -0.16
LT22 0.41 0.48 0.11 0.28 0.28 -2.41 0.53 0.25
CTl 0.06 0.23 -0.18 0.28 0.23 -1.14 - -0.02
CT4 0.00 0.18 0.16 0.40 0.90 -0.81 - 0.36
CTS 0.01 0.11 -0.12 0.18 1.29 -0.63 - -0.48
CT6 -0.09 -0.07 -0.37 0.03 0.31 -2.83 0.13
CT7 0.01 0.14 0.08 0.22 0.70 -0.08 0.23
CT8 0.17 0.29 0.26 -0.17 1.46 -1.22 0.16 0.43
CT9 0.79 0.91 0.38 0.67 0.28 -2.21 0.63
CT10 -0.20 -0.05 0.33 -0.02 2.28 0.60 -0.11 0.43
CTII 0.02 0.31 -0.02 -0.01 0.96 -1.09 0.02
CT12 0.06 0.27 0.06 0.18 1.84 -0.59 0.38 0.44
CT14 0.38 0.16 0.50 0.14 2.56 -0.96 0.20 0.56
CT16 0.05 0.51 0.59 0.22 1.22 0.11 0.18 0.31
CTl7 -0.02 0.42 0.28 0.10 1.52 -0.32 0.22 0.21
CT18 -0.09 0.34 0.39 0.09 0.46 2.36 0.09
The ACt values of the above described framework markers along Chromosome 7
relative to DNA56112
is indicated for selected tumors in Table 19.
-141-
CA 02353775 2001-06-04
WO 00/37640 PCTIUS99/30095
Table 19
Amplification of Framework Markers Relative to DNA56112
Tumor DNA G 1 G54 G l G 164 6205 6254 6358
56112 I 13
LT 1 0.60 0.20 0.19 0.00 -0.10 -0.29 -0.26 0.72
LTIa -1.37 0.20 0.00 0.00 -0.03 -0.67 -1.01 0.42
LT2 0.96 0.27 0.01 0.00 -0.54 -1.28 -1.44 -2.86
LT3 1.21 -0.42 -0.25 0.00 -1.17 -1.17 -1.12 -0.62
LT4 1.59 0.83 0.98 0.00 0.20 -0.78 -0.41 -0.90
LT6 -0.35 -0.21 -0.58 0.00 -2.80 -1.16 -0.53 0.33
LT7 1.40 0.52 O.IO 0.00 -0.12 -0.44 -0.36 1.45
LT9 1.07 -0.43 -0.17 0.00 -0.68 -0.10 0.33 1.71
LT10 1.98 0.24 0.01 0.00 0.41 0.22 0.32 2.47
LTI I.15 -0.56 -0.23 0.00 0.38 -0.18 0.28 -0.01
I
LT12 2.31 -0.09 0.04 0.00 -0.26 -0.32 -0.11 -0.55
LT13 1.83 -0.55 0.14 0.00 0.27 0.04 0.01 -0.09
LT15 2.79 -0.20 -0.64 0.00 -0.15 -0.59 -0.29 -0.63
LTI6 2.22 -0.19 0.18 0.00 -0.51 -0.30 0.06 -0.17
LT17 0.92 0.26 -0.02 0.00 -0.53 -0.66 -0.63 -0.45
LT18 1.06 -1.50 -0.05 0.00 -1.64 -0.86 -1.04 -0.61
LT22 1.18 0.76 0.48 0.00 0.48 0.02 -0.O8 0.12
PR0715 and PR0853:
PR0715 (DNA52722-1229) and PR0853 (DNA48227-I 350) were also reexamined with
both framework
and epicenter mapping. Figures 33A and 33B and Table 20 indicate the
chromosomal localizations of the
framework markers that were used for the procedure. The framework markers are
located approximately every 20
bases and were used to control aneuploidy. Tables 21 A and 21B indicate the
epicenter mapping markers that were
used in the procedure. The epicenter markers were located in close proximity
to DNA52722 and DNA48226,
respectively, and are used to determine the relative DNA amplification in the
immediate vicinity of DNA52722 and
DNA48226. The distance between individual markers is measured in centirays,
which is a radiation breakage unit
approximately equal to a 1 % chance of a breakage between two markers. One cR
is very roughly equivalent to
about 20 kilobases. In both Tables 21 A and 21 B, "BAC" means bacterial
artificial chromosome. The ends of a
BAC clone which contained the gene of interest were sequenced. TaqManT"'
primers and probes were made from
this sequence, which are indicated in the respective tables. BAC clones are
typically 100 to 150 Kb, so these
-142-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99I3009S
primers and probes can be used as nearby markers to probe DNA for tumors. In
Figure 33A, the marker
SHGC-31370 is the marker found to be the closest to the location on chromosome
17 where DNA52722 maps. In
Figure 33B, the marker SHGC-37126 is the marker found to be the closes to the
location on chromosome 17 where
DNA48227 maps.
Table 20
Framework Markers Used Along Chromosome 17 for DNA52722 and DNA48227
Map Position on ChromosomeStanford Human Genome Center Marker
17 Name
Q4 SHGC-31242
Q52 SHGC-35988
Q 110 AFM200zf4
Q169 SHGC-32689
Q206 SHGC-11717
Q232 SHGC-32338
Table 21 A
P
Map Position on ChromosomeStanford Human GenomeDistance to Next Marker
17 Marker (cR)
Name
Q33 SHGC-35547 18 cR to Q34
120F17FOR1 Marker from forward
end of BAC _
sequence
120F170R2 Marker from forward
end of BAC
sequence
DNA52722
120F17REV1 Marker from reverse
end of BAC
sequence
120FI7REV2 Marker from reverse
end of BAC
sequence
Q34 SHGC-31370
E icenter Markers Used on Chromosome 17 in Vicinity of DNA52722
-143-
CA 02353775 2001-06-04
WO 00137640 PCT/US99/30095
Table 21 B
Epicenter Markers Used on Chromosome 17 in Vicinity of DNA48227
Map Position on ChromosomeStanford Human GenomeDistance to Next Marker
17 Marker (cR)
Name
Q74 AFM238yb 10 3
Q73 SHGC-33634 3
203J20FOR1 Marker from forward
end of BAC
sequence
203J20FOR2 Marker from forward
end of BAC
sequence
Q72 SHGC-37126
DNA48227 ----
203J20REV 1 Marker from reverse
end of BAC
sequence
203J20REV2 Marker from reverse
end of BAC
sequence
Table 22 indicates the ACt values of the above described framework markers
along Chromosome 17
relative to DNA52722 and DNA48227 for selected tumors. While not shown, the
similar tlCt values for the
framework markers in the analysis of DNA48227 were reported.
-144-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 22
Amplification of Framework Markers Relative to DNA52722
Framework
Marker
Tumor Q4 Q52 DNA Q110 Q169 Q206 Q232
52722
LTl 0.02 -0.50 -0.04 0.05 -0.32 -0.21 -0.34
LT1 a -0.01 -0.34 0.64 0.23 -0.20 -0.25 -0.15
LT2 0.25 0.15 0.19 0.05 -0.16 -0.14 -0.09
LT3 -0.08 -0.20 0.54 0.56 -0.06 0.32 0.05
LT4 -0.32 -0.45 0.31 0.19 -0.06 -0.12 0.04
LT6 -0.21 -0.38 0.31 0.13 -0.08 -0.30 0.01
LT7 -0.66 -1.02 0.02 0.62 -0.20 0.06 0.16
LT9 -0.03 -0.29 0.46 1.20 -1.75 -0.22 -0.13
LT10 -0.16 -0.09 0.58 0.11 0.01 -0.33 -0.45
LTII -0.14 0.29 1.03 0.04 0.30 0.52 0.17
LT12 -0.25 -O.b8 0.72 0.65 0.86 0.97 0.58
LT13 0.20 0.00 1.37 -0.15 -0.04 0.25 -0.01
LT15 0.11 -0.39 1.75 0.00 -0.02 0.43 -0.19
LTl6 -0.07 -0.56 1.11 0.22 0.19 0.68 -0.55
LT17 0.41 -0.09 1.14 0.27 0.22 0.73 0.07
LT18 0.14 -0.22 1.04 0.27 0.35 0.48 -0.03
LT22 -0.07 -0.73 0.00 0.13 -0.02 0.41 0.05
CT2 0.12 -0.47 1.29 -0.19 0.32 - 0.18
CT3 0.05 0.17 1.06 -0.41 0.05 - -0.06
CT8 0.44 0.14 1.08 0.02 -0.04 -0.11
CTIO 0.35 0.26 1.60 -0.05 0.00 -0.02
CT12 -0.15 -0.46 0.52 -0.13 0.02 -0.20
CTl4 0.26 -0.59 1.05 -0.01 0.68 0.48
CT15 0.55 -0.51 1.36 -0.69 0.11 -0.16
CT16 0.09 -0.14 1.06 0.00 0.00 - -0.15
CTl7 0.40 -0.16 1.00 -0.47 0.04 -0.29
-145-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 23 indicates the ACt values for the indicated epicenter markers,
indicating the relative amplification
along Chromosome 17 in the immediate vicinity of DNA52722.
Table 23
Amplification of Epicenter Markers Relative to DNA52722
Epicenter
Markers
Tumor Q33 120F17FOR120F17FOR2DNA52722120F17REV-120F17REV-Q34
1 2
LT1 -0.18 0.11 0.00 0.20 -0.08 0.07 -0.36
LTl a 0.32 -0.06 0.00 0.68 -0.09 -0.20 0.32
LT2 0.06 0.14 0.00 0.27 -0.29 0.16 -0.16
LT3 0.08 -2.06 0.00 0.16 -0.84 -0.38 -0.16
LT4 - -
LT6 -
LT7 -0.20 -0.51 0.00 0.23 -0.63 -0.37 -0.41
LT9 0.08 -0.17 0.00 0.59 0.02 -0.66 -0.01
LT10 0.09 0.05 0.00 0.59 -0.22 -0.12 0.36
LTIl 0.75 0.09 0.00 1.07 0.43 -0.Ol 0.63
LTI2 0.00 -0.45 0.00 0.63 -0.49 -0.82 0.18
LT13 0.72 -0.02 0.00 1.29 0.04 0.02 0.66
LT15 0.75 0.11 0.00 1.33 0.1 S -0.19 0.90
LT16 0.34 -0.41 0.00 1.11 -0.39 -0.89 0.15
LTI7 1.06 0.29 0.00 1.13 -0.26 -0.12 0.90
LT18 0.66 0.11 0.00 1.21 -0.28 0.11 0.47
LT19 -0.09 -0.37 0.00 0.12 -0.53 -0.48 -0.53
CTI O.SO 0.14 0.00 1.22 0.27 0.43 0.72
CT2 0.69 -0.47 0.00 0.95 -0.72 -O.I7 0.77
CT3 0.87 0.08 0.00 1.19 -0.06 0.74 0.97
CT4 0.45 -0.11 0.00 1.26 0.43 0.38 0.79
CT5 0.36 -0.39 0.00 1.79 -0.48 0.09 0.95
CT6 0.41 0.08 0.00 1.71 -0.21 0.57 0.47
CT7 0.40 0.18 0.00 1.19 0.31 0.40 O.S4
CT8 0.48 0.17 0.00 0.93 0.23 0.47 0.72
-146-
CA 02353775 2001-06-04
WO OOI37640 PCT/US99/30095
Table 23 Continued
Amplification of Epicenter Markers Relative to DNA52722
Epicenter
Markers
Tumor Q33 120F17FOR1120F17FOR2DNA52722120FI7REV-120FI7REV-Q34
2
CT10 0.72 0.15 0.00 1.86 0.81 0.67 0.97
CT11 0.80 -0.09 0.00 2.29 0.20 0.25 0.85
CT12 0.01 -0.55 0.00 0.49 -0.43 -0.09 0.11
CT14 0.22 -0.36 0.00 1.05 0.63 0.41 0.40
CT15 1.06 -0.04 0.00 1.27 0.74 0.98 1.13
CT16 0.84 0.06 0.00 1.03 0.26 0.40 0.91
CT17 0.80 0.04 0.00 0.95 0.78 1.29 0.90
CT18 0.34 0.13 0.00 1.06 0.06 0.34 0.50
Tables 24A and 24B indicate the OCt values for the indicated epicenter
markers, indicating the relative
amplification of selected lung and colon tumors, respectively, along
Chromosome 17 in the immediate vicinity of
DNA48227.
Table 24A
Amplification of Epicenter Markers in the Vicinity of DNA48227 on Chromosome
17 in Selected Lung Tumors
Epicenter
Markers
Tumor Q73 Q74 203J20-203J20-Q72 DNA 203J20-203J20-
FORI FOR2 48227 REV1 REV2
LTl -3.38 -0.07 -0.11 -0.83 -0.37 0.15 -0.55 -0.08
LTI -2.62 0.37 0.36 0.13 0.04 0.56 -0.13 0.30
a
LT2 -1.56 0.26 0.24 -0.70 0.22 0.11 -0.23 0.14
LT3 -0.01 0.05 0.31 -0.07 0.18 0.50 -0.34 0.23
LT4 -4.58 -0.15 -0.16 -0.32 -0.18 0.18 -0.26 0.29
LT6 -0.76 -0.31 0.17 -0.32 -0.16 0.07 -0.37 -0.10
LT7 -2.10 0.17 0.18 -0.16 0.56 0.23 -0.13 0.24
LT9 -2.10 0.03 0.07 -0.31 -0.32 -0.07 -0.38 -0.02
LT10 -3.17 0.22 0.40 -0.16 0.47 0.27 -0.30 -0.09
LTII 0.47 -0.01 0.34 0.29 0.96 0.18 0.47 0.15
-147-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 24A Continued
Amplification of Epicenter Markers in the Vicinity of DNA48227 on Chromosome
17 in Selected Lung Tumors
Epicenter
Markers
Tumor Q73 Q74 203J20-203J20-Q72 DNA 203J20-203J20-
FOR FOR2 48227 REV REV2
I 1
LT12 0.44 0.32 0.10 O.I3 1.24 0.20 0.36 0.17
LT13 0.18 0.03 -0.07 0.15 1.25 0.08 0.04 -0.03
LT15 0.00 0.11 0.00 0.09 1.72 0.17 0.06 -0.04
LT16 0.54 0.52 0.65 0.22 1.62 0.17 0.57 0.29
LT17 0.24 0.27 0.23 0.36 1.09 0.13 0.35 0.06
LT18 -0.22 -0.26 0.12 0.21 -0.11 -0.46 -0.26 -0.25
LT22 -0.20 -0.32 0.02 0.11 -0.12 -0.21 -0.24 -0.08
Table 24B
Amplification of Epicenter Markers In Vicinity of DNA48227 on Chromosome 17 in
Selected Colon Tumors
Epicenter
Markers
Tumor Q74 203J20-203J20-Q72 DNA 203J20-203J20-Q75
FOR1 FOR2 48227 REV1 REV2
CTl -0.18 0.38 0.19 0.07 1.09 0.31 0.04 0.36
CT2 0.49 0.20 0.64 0.39 2.10 0.38 0.20 0.26
CT3 0.18 0.22 0.51 0.43 1.09 0.38 -0.03 -0.22
CT4 0.27 0.25 0.39 -0.14 1.12 0.07 -0.13 0.23
CTS 0.31 0.11 -0.18 -0.83 2.33 0.03 0.10 0.27
CT6 0.34 0.04 0.01 0.02 1.35 0.07 0.60 0.63
CT7 0.02 -0.13 -0.16 -0.07 0.56 -0.11 -0.15 0.50
CT8 -0.08 0.08 0.17 0.15 1.34 0.11 -0.03 0.25
CT9 0.15 0.07 -0.02 0.44 1.22 -0.02 -0.06 0.52
CT10 -0.14 0.18 0.19 0.56 1.66 0.29 0.10 0.17
CTI1 0.13 -0.15 O.12 0.07 1.96 0.21 -0.07 0.57
CT12 0.00 -0.05 0.25 0.05 1.03 0.07 0.10 0.07
CT14 0.59 0.31 0.70 0.44 I.69 0.47 0.35 0.48
-148-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 24B Continued
Amplification of Epicenter Markers In Vicinity of DNA48227 on Chromosome 17 in
Selected Colon Tumors
Epicenter
Markers
Tumor Q74 203J20-203J20-Q72 DNA 203J20-203J20-Q75
FOR FOR2 48227 REV REV2
1 1
CTl 0.22 0.06 0.38 0.42 1.77 0.22 -0.05 0.27
S
CTl6 -0.69 -0.04 0.40 -0.08 0.92 0.13 -0.02 -0.04
CTl7 -0.73 -0.08 -0.36 0.28 1.25 0.08 0.06 0.20
CT18 0.18 -0.22 -0.10 0.08 0.97 -0.05 0.18 0.63
PR0357:
PR0357 (DNA44804-1248) was reexamined with selected tumors from the above
initial screen with
framework mapping. Figure 34 and Table 25 indicate the chromosomal mapping of
the framework markers that
were used in the present example. The framework markers are located
approximately every 20 megabases and were
used to control aneuploidy.
PR0357 (DNA44804-1248) was also examined with epicenter mapping. The markers
indicated in Table
26 are located in close proximity (in the genome) to DNA44804 and are used to
assess the relative amplification
in the immediate vicinity of Chromosomel6 wherein DNA44804 is located. The
distance between individual
markers is measured in centirays (cR), which is a radiation breakage unit
approximately equal to a 1 % chance of
a breakage between the two markers. One cR is very roughly equivalent to 20
kilobases. The marker SHGC-6154
is the marker found to be the closest to the location on Chromosome 16 where
DNA44804 maps.
Table 25
Framework markers for DNA44804
Map position on chromosome 16 Stanford Human Genome Center
Marker Name
p'7 SHGC-2835
P55 SHGC-9643
p99 GATA7B02
P 154 SHGC-33727
p2pg SHGC-13577
-149-
CA 02353775 2001-06-04
WO 00/37640 PC'T/US99/30095
Table 26
Epicenter Markers for DNA44804 Along Chromosome 16
Map Position on ChromosomeStanford Human GenomeDistance to Next Marker
16 Center (cR)
Marker Name
p 1 AFMA 139WG 1 6
P3 SHGC-32420 170 (GAP)
p4 SHGC-14817 40
ps SHGC-12265 4
p6 SHGC-6154 33
DNA44804
P7 SHGC-2835 10
pg SHGC-2850 9
p9 AFM297yg5 67
P 15 CHLC.GATA70B04
The ACt values of the above described framework markers along Chromosome 16
relative to DNA44804
is described in Table 27.
Table 27
Amplification of Framework Markers Relative to DNA44804 (ACt )
Framework
Markers
Tumor DNA P7 P55 P99 P154 P208
44804
LT1 0.25 0.22 -0.17 0.42 0.04 0.43
LTl a 0.90 0.09 -0.10 -0.38 0.29 0.93
LT2 -0.16 0.03 0.19 -0.18 0.18 0.54
LT3 1.15 0.68 0.57 -0.34 -0.03 0.86
LT4 0.19 0.58 0.36 -0.31 0.08 1.14
LT6 0.28 0.27 -0.11 -0.74 -0.13 0.22
LT7 0.58 0.63 0.14 0.82 0.09 -0.21
LT9 0.68 0.63 0.14 0.82 0.09 -0.21
LT10 1.21 0.52 0.40 -0.39 -0.15 0.77
LTlI 1.71 -0.79 1.31 0.73 -0.08 0.90
-150-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 27 Continued
Amplification of Framework Markers Relative to DNA44804 (ACt )
Framework
Markers
Tumor DNA P7 P55 P99 P154 P208
44804
LT12 1.96 -0.95 0.94 0.00 -0.63 0.18
LT13 2.32 -0.97 0.94 0.88 -0.04 0.70
LT15 3.01 -0.54 0.60 0.12 0.14 1.15
LT16 0.67 -0.27 0.57 -0.39 0.08 1.04
LTI7 1.64 0.25 1.10 0.28 0.10 0.23
LTl 8 0.34 0.09 0.51 0.33 -0.20 -0.09
LTI9 3.03 -0.82 0.63 0.06 0.09 0.55
LT21 1.33 -1.19 I.01 0.11 0.34 0:07
Table 28 indicates the ACt values for the results of epicenter mapping
relative to DNA44804, indicating
the relative amplification in the region more immediate to the actual location
of DNA44804 along Chromosome
16.
Table 28
Amplification of Epicenter Markers Relative to DNA44804
Epicenter
Markers
Tumor P1 P3 P4 PS P6 DNA P7 P8 P9 P15
44804
LT1 0.31 -0.300.65 0.05 -0.330.16 -0.41 0.20 0.10 0.17
LTla -0.23 -17.670.97 -0.65 -1.830.56 -0.65 -0.28 -0.27-0.07
LT2 0.18 -0.060.33 -0.11 -0.38-0.32 -1.08 -0.31 -0.53-0.05
LT3 0.00 0.25 1.07 -0.23 -0.110.70 -0.71 -0.12 -0.17-0.01
LT4 0.07 -0.250.55 -I.15 -1.78-0.09 -0.82 -0.07 -0.34-0.07
LT6 0.24 0.07 0.48 -0.55 -0.34-0.07 -1.33 -0.41 -0.70-0.27
LT7 0.07 -0.070.61 -0.19 -0.360.29 -0.96 -0.09 -0.26-0.08
LT9 0.16 -0.160.64 -0.33 -0.140.43 -1.01 -0.19 -0.36-0.21
LTIO 0.47 0.76 -0.30 0.80 -0.090.00 -0.85 -0.17 -0.28-0.07
LTlI 0.14 0.14 0.96 -0.02 0.37 1.2? -0.23 0.09 -0.33-0.07
-151-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
Table 28 Continued
Amplification of Epicenter Markers Relative to DNA44804
Epicenter
Markers
Tumor Pl P3 P4 PS P6 DNA P7 P8 P9 PIS
44804
LT12 -0.12-0.04 0.84 -1.52-0.28 1.42 -0.39-0.38 -1.21 -0.25
LTl3 0.41 -0.02 1.19 -0.340.14 1.67 -0.87-0.22 -0.72 -0.33
LT15 0.01 0.21 1.30 -0.48-0.35 2.36 -0.96-0.36 -0.54 -0.22
LT16 -0.38-0.07 0.41 -0.32-1.22 -0.08 -0.45-0.25 -0.52 -0.31
LTI7 0.36 0.23 1.39 -1.39-1.37 1.17 -0.39-0.13 0.52 0.01
LT18 0.17 -0.27 0.04 -0.040.18 -0.39 -0.59-0.25 -0.21 -0.22
LT19 0.11 -0.02 1.27 -0.121.27 2.49 -0.30-0.36 -0.82 -0.40
LT21 0.28 -0.18 0.85 0.09 0.66 0.85 -0.49-0.35 -0.27 -0.16
DISCUSSION AND CONCLUSION:
PR0201 (DNA30676-1223):
The ACt values for DNA30676-1223 in a variety of tumors are reported in Table
5. A ~Ct of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA30676-1223
encoding PR0201 occurred: (I) in
primary lung tumors: LTla, LT3, LT6, LT7, LT9, LTIO, LTl 1, LT13, LTl ~, LT16,
LT17, LT18, LT19, and LT21;
(2) in primary colon tumors: CT2, CT3, CT8, CTIO, CTI2, CT14, CT15, CT16,
CTl7, CTI, CT4, CTS, CT6, CT7,
CT9, CTI 1, and CT18; (3) lung tumor cell lines: Calu-1, Calu-6, H157, H441,
SKMES-1, H522, and H810; and
(4) colon tumor cell lines Co1o320 and Co1o205.
Amplification has been confirmed by framework mapping for DNA30676-1223: (1)
in primary lung
tumors: LT3, LTIS, LTI6, LTI7, and LT18; and (2) in primary colon tumors: CT2,
CT3, CT8, CTIO, CT12, CT14,
CT15, CT16, and CT17. Epicenter mapping for DNA30676-1223 resulted in
confirmation of significant
amplification: (1 ) in primary lung tumors: LT3, LT13, LT15, LT16, and LT18;
and (2) in primary colon tumors:
CTI, CT3, CT4, CTS, CT6, CT7, CT8, CT9, CTIO, CT11, CTl2, CT14, CT15, CT16,
CT17, and CT18.
In contrast, the amplification of the closest known framework markers (with
one exception, i.e., S50)
(Table 8A) or epicenter markers (Table 9A) does not occur to a greater extent
than that of DNA30676-1223. This
strongly suggests that DNA30676-1223 is the gene responsible for the
amplification of the particular region on
Chromosome 19.
Because amplification of DNA30676-1223 occurs in various tumors, it is highly
probable to play a
-152-
CA 02353775 2001-06-04
s
_. ~., r~. -. . , '._
significant role in wmor formation or growth. As a result, antagonists (e.g.,
at~ibodies) directed against the protein
encoded by DNA30676-1223 (PR0201) wouid be exp~ to have utility in cancer
therapy.
PR0292 (DNA35617):
The ACt values for DNA35617 in a variety of tumors are reported in Table 5. A
~Ct of >1 was typically
used as the threshold value for amplification scoring, as this represents a
doubling of gene copy. Table 5 indicates
that significant amplification of nucleic acid DNA35617 encoding PR0292
occurred : ( i ) in primary lung tumors:
LTl, LTia, LTl l, LT12, LT13, LT15, LT17, LT19 and LT21; (2) in primary colon
tumors: CT2, CTB, CT10 and
CT14; in lung wmor cell lines: H441 and H810; and (4) in colon tumor cell
lines: SW620, Co1o320, HT29, and
LS 174T.
Amplification has been confmned by framework mapping for DNA35617: (1) in
primary lung tumors:
LT12, LT13, LT15, and LT16; and (2) in primary colon tumors: CT2, CT8, CT10
and CT14. Io contrast, the
amplification of the closest known framework markers (Table 11) does not occur
to a greater extent than that of
DNA35617. This strongly suggests that DNA35617 is the gene responsible for the
amplification of the particular
region on Chromosome I 1.
Because amplification of DNA35617 occurs in various tumors, it is highly
probable to play a significant
role in tumor formation or growth. As a result, antagonists (e.g., antibodies)
directed against the protein encoded
by DNA35617 (PR0292) would be expected to have utility in cancer therapy.
PR0327 (DNA38113-1230):
The ~Ct values for DNA38113-1230 in a variety of tumors are reported in Table
5. A ACt of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA38113-1230
encoding PR0327 occurred: (1) in
primary lung tumors: LTla, LT3, LT6, LT10, LTl l, LT12, LT13, LT15, LT16,
LT17, and LT19; (2) in primary
colon tumors: CTZ, CT3, CTB, CT10, CT12, CT14, CT15, CT16, C"TI7, CTl, CT4,
CTS, CT6, CT9, CTl l, and
CT18; (3) in lung tumor cell lines: H157, H441, H460, and SK1VIES-1; and (4)
in colon tumor cell lines: SW620,
Co1o320, HCC2998, and KM12.
Amplification has been confirmed by framework mapping for DNA38113-1230 (Table
8B): (1 ) in primary
lung tumor LT10; and (2) in primary colon tumors: CT2, CT3, CT8, CT10, CT12,
CT14, and CT16. Epicenter
mapping for DNA38113-1230 resulted in confirmation of significant
amplification (Table 9B): ( 1 ) in primary lung
tumors: LT12, LT13, LT15, LT16, and LTl?; and (2) in primary colon tumors:
CTl, CT2, C'T3, CT4, CTS, CT6,
CT8, CT9, CT10, CTl l, CT12, CT14, CT16, and CT18.
With the exception of S41, amplification of the closest markers w DNA38113-
1230 does not occur to a
greater extent than that of DNA38113-1230 itself. This supports the notion
that DNA38113 is the gene which is
driving the amplification of this particular region of Chromosome 19. However,
the art~lificarion of marker S41
(which does not map closely to DNA38113) could be an independent amplification
event or even an error in the
ordering of the markers.
Because amplification of DNA38113-1230 occurs in various tumors, it is highly
probable to play a
-153-
Printed:l l-04-2001 AMENDED SHEET-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
significant role in tumor formation or growth. As a result, antagonists (e.g.,
antibodies) directed against the protein
encoded by DNA38113-1230 (PR0327) would be expected to have utility in cancer
therapy.
PR01265 (DNA60764-1533):
The OCt values for DNA60764-1533 in a variety of tumors are reported in Table
5. A ~Ct of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA6076d-1533
encoding PR01265 occurred: in primary
lung tumors: LT3, LT12, LT13, LTIS, LT16, and LTI7.
Amplification has been confirmed by framework mapping for DNA60764-1533 (Table
8C) in primary lung
tumor LTI6. Epicenter mapping for DNA60764-1533 also resulted in confirmation
of significant amplification
(Table 9C): ( 1 ) in primary lung tumors: LT12, LT13, LT15, and LT16; and (2)
in primary colon tumors: CTl , CT4,
CTS, CT7, and CTl I. In contrast, the amplification of the closest known
framework markers, epicenter markers
and comparison sequences does not occur to a greater extent than that of
DNA60764-1533. This strongly suggests
that DNA60764-1533 is the gene responsible for the amplification of the
particular region on Chromosome 19.
Because amplification of DNA60764-1533 occurs in various lung and colon
tumors, it is highly probable
to play a significant role in tumor formation or growth. As a result,
antagonists (e.g., antibodies) directed against
the protein encoded by DNA60764-1533 (PR01265) would be expected to have
utility in cancer therapy.
PR0344 (DNA40592-1242):
The ACt values for DNA40592-1242 in a variety of tumors are reported in Table
5. A ~Ct of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA40592-1242
encoding PR0344 occurred: (1) in
primary lung tumors: LTl l, LTI2, LTI3, LT15, LT16, LTI7, LTI9 and LT21; and
(2) in primary colon tumors:
CT2, CT14, CT15, CTI, CT4, CTS, and CTl 1.
Because amplification of DNA40592-1242 occurs in various lung and colon
tumors, it is highly probable
to play a significant role in tumor formation or growth. As a result,
antagonists (e.g., antibodies) directed against
the protein encoded by DNA40592-1242 (PRQ344) would be expected to have
utility in cancer therapy.
PR0343 fDNA43318-1217):
The OCt values for DNA43318-1217 in a variety of tumors are reported in Table
S. A OCt of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA43318-1217
encoding PR0343 occurred: (1) in
primary lung tumors: LTl l, LT12, LT13, LT15, LTl6, LT17, LT18 and LT19; and
(2) in primary colon tumors:
CT2, CT3, CTB, CTIO, CT12, CT14, CTIS, CT16, CTl7, CT4, CTS, CT7, and CTl 1.
Amplification has been confirmed by framework mapping for DNA43318-1217 (Table
14): ( 1 ) in primary
lung tumors: LT12, LT13, LT15, LT16, and LTI 8; and (2) in primary colon
tumors: CT2, CT1, CTS, CT8, CT10,
CT14, CT15 and CT16.. Epicenter mapping for DNA43318-1217 also resulted in
conftrmation of significant
amplification (Table 15A): (1 } in primary lung tumors: LT12, LT13, LTIS, and
LTl6; and (2) in primary colon
-154-
CA 02353775 2001-06-04
Va °~~ ;
~en..xd.~ .n~';. , ., '~;. ~.,.w:.~.~. .t,.w: °- , ~ . .~a,r~r~ ,:. ,
r~ .°~'.~i ~' .o<
tum~s: CT4, CTS, GT6, CTl 1, and CTZ. In contrast, the ar~lification of tire
closest known framework markers,
and epic markers (with one exception, i.G, P107) does not occur to a greater
extent than that of DNA43318-
1217. This strongly suggests that DNA43318-1217 is the gene responsible for
the amplification of the particular
region on Chrormsome 16.
$ Because at~lification of DNA43318-1217 occurs in various lung and colon
tumors, it is highly probable
to play a significant role in tumor formation or growth. As a result,
antagonists (e.g., antibodies) directed against
the protein encoded by DNA43318-1217 (PR0343) would be expected to have
utility in cancer therapy.
PR0347 (DNA44176-12441:
The ~Ct values for DNA44175-1244 in a variety of tumors are reported in Table
5. A ~Ct of >1 was
IO typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
indicates that significant amplification of nucleic acid DNA44176-1244
encoding PR0347 occun:ed: (1) in
primary lung tumors: LTl, LTia, LT3, LT6, LT9, LT10, LTl l, LT12, LTI3, LT15,
LT17, LTI9, and LT21; and
(2) in primary colon tumors: CTl, CT2, CT3, CTS, CTB, CTl l, CT14, CT15, and
CT16. Because amplification
of DNA44176-1244 occurs in various lung and colon tumors, it is highly
probable to play a significant role in tumor
formation or growth. As a result, antagonists (e.g., antibodies) directed
against the protein encoded by DNA4417b-
1244 (PR0347) would be expected to have utility in cancer therapy.
PR035? (DNA44804-1248):
The OCt values for DNA44804-1248 in a variety of tumors are reported in Table
5. A ACt of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA44804-1248
encoding PR0357 occurred: (1) in
primary lung tumors: LTl a, LT3, LT6, LT9, LT10, LTl 1, LT12, LT13, LT15,
LT16, LT17, LT18, LT19, and LT21;
and (2) in primary colon tumors: CT2, CTB, CT10, CT14, GT15, CT16, CTl, CT4,
CTS, CT6, CT7, and CTl 1.
Amplification has been confirna;d by framework mapping for DNA44804-1248
(Table 27) in primary lung
tumors: LT3, LT10, LTl l, LTI2, LT13, LT15, LTI7, LT19 and LT21. Epicenter
mapping for DNA44804-.1248
2S also resulted in confiraration of significant amplification (Table 28) in
primary lung tumors: LTl l, LT12, LT13,
LT15, LT17 and LT19. In contrast, the amplification of the closest known
framework markers and epicenter
markers does not occur to a greater extent than that of DNA44804-1248. This
strongly suggests that DNA44804-
1248 is the gene responsible for the amplification of the particular region on
Chromosome 16.
Because amplification of DNA44804-1248 occurs in various Lung tumors, it is
highly probable to play a
significant role in tumor formation or growth. As a result, antagonists (e.g.,
antibodies) directed against the protein
encoded by DNA44804-1248 (PR0357) would be expected to have utility in cancer
therapy.
PR0715 (DNA52722-1229):
The DCt values for DNA52722-1229 in a vmiety of tumors are reported in Table
5. A OCt of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
3S 5 indicates that significant amplification of nucleic acid DNA52722-1229
encoding PR0715 occurred: (1) in
-155-
AMENDED SHEET
Prirttecl:l 1-04-2001 ~'
CA 02353775 2001-06-04
vs s ~s
>, nv. ro>.x r's~.,.~. '~.vz;
primacy lung tumors: LTl, LTIa, LT9, LT10, LTl l, LT12, LT13, LT15, LT16,
LT17, LT18, and LT19; and (2)
in primary colon tumors: GT2, CT3, G'f8, C"f 10, CT14, CT1S, CT16; CT17, CTI,
CT4, CTS, CT6, CT7, CTl l and
C'T18.
Amplification has been confirmod by framework mapping for DNA52722-1229 (Table
22): (1 ) in primary
lung tumors: LTl l, LT13, LTl S, LT16, LT17, and LT18; and (2) in primary
coton tumors: CT2, CT 3, G'f8, CT10,
CT14, C'T15, CT16, and CT17. Epicenter mapping for DNA52722-1229 also resulted
in confirmation of significant
amplification (Table 23): ( 1 ) in primary lung tumors: LTl i, LT13, LTl S,
LT16, LT17 and LT18; and (2) in primary
colon tumors: CTI, CT3. CT4, CTS, CT6, CT7, CT10, CTl l, CT14, CT1S, G'T16,
and CT18. In merlaed contrast,
the amplification of the closest known framework markers and epicenter markers
does not occur to a greater extent
than that of DNAS2722-1229. This strongly suggests that DNAS2722-1229 is the
gene responsible for the
amplification of the particular region on Chromosome 17.
Because amplification of DNAS2722-1229 occurs in various lung and colon taws,
it is highly probable
to play a significant role in tumor formation or growth. As a result,
antagonists (eg., antibodies) directed against
the protein encoded by DNAS2722-1229 (PR071S) would be expected to have
utility in cancer therapy.
1S PR01017 (DNAS61I2-1379):
The OCt values for DNAS6112-1379 in a variety of tumors are reported in Table
S. A ACt of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNAS6112-1379
encoding PR01017 occurred: (1) in
primary lung tumors: LTla, LT3, LT6, LT7, LT9, LT10, LTl l, LT12, LT13, LT1S,
LT16, LT17, LTI8, LT19, and
LT21; and in primary colon tumors: CT2, C'I3, CTB, CT10, CT12, CTI4, CTIS,
CT16, CT17, CT4, CTS, CT6,
CT9, and CTl 1.
Amplification has been coafircned by framework mapping for DNAS6I 12-1379
(Table 19) in primacy lung
tumors: LT3, LT4, LT7, LT9. LT10, LTl l, LT12, LT13, LT1S. LT16, LT18, and
LT22. Epicenter mapping for
DNAS6112-1379 also resulted in confirmation of significant amplification
(Table 18): (1) in primary lung tumors:
LT12, LT13, LTIS, LT16, and LT18; and (2) in primary colon tumors: CTS, CT8,
CT10, CT12, CT14, CT16, and
CT17. In marked contrast, the amplification of the closest known framework
markers and epicenter markers does
not occur to a greater extent than that of DNA56112-1379. This strongly
suggests that DNAS6112-1379 is the gene
responsible for the amplification of the particular region an Chromosome 7.
Because amplification of DNA56112-1379 occurs in various tumors, it is highly
probable to play a
significant role in tumor formation or growth. As a result, antagonists (e.g.,
antibodies) directed against the protein
encoded by DNA56112-1379 (PR01017) would be expected to have utility in cancer
therapy.
PR01112 (DNAS7702-1476):
The ~Ct values for DNAS7702-1476 in a variety of tumors are reported in Table
S. A ~Ct of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
S indicates that significant amplification of nucleic acid DNAS7702-2476
encoding PRO1112 occun~ed: (1) in
primary lung tumors: LT10, LTl l, LTI2, LT13, LT15, LT17, and LT18; and (2) in
primary colon tumors: GT2,
-1S6-
Printed:l 1-04-2001 AMENDED.SN~ET ~
CA 02353775 2001-06-04
WO 00/37640 PCT/L1S99/30095
CT8, CT10, CT12, CT14, CT15, CT16, CTI , CT4, CTS, CT6, and CTI 1. Because
amplification of DNA57702-
1476 occurs in various tumors, it is highly probable to play a significant
role in tumor formation or growth. As a
result, antagonists (e.g., antibodies) directed against the protein encoded by
DNA57702-1476 (PR01112) would
be expected to have utility in cancer therapy.
PR0509 (DNA50148):
The ACt values for DNA50148 in a variety of tumors are reported in Table 5. A
~Ct of >1 was typically
used as the threshold value for amplification scoring, as this represents a
doubling of gene copy. Table 5 indicates
that significant amplification of nucleic acid DNA50148 encoding PR0509
occurred: (1 ) in primary lung tumors:
LTI, LTIa, LT3, LT4, LT9, LT12, LTI3, LTIS, LT16, LT17, and LT19; and (2) in
primary colon tumors: CT15,
CT17, CT6, CTl I, CT18. Because amplification of DNA50148 occurs in various
lung and colon tumors, it is
highly probable to play a significant role in tumor formation or growth. As a
result, antagonists (e.g., antibodies)
directed against the protein encoded by DNA50148 (PR0509) would be expected to
have utility in cancer therapy.
PR0853 (DNA48227-1350):
The OCt values for DNA48227-1350 in a variety of tumors are reported in Table
5. A ~Ct of >1 was
typically used as the threshold value for amplification scoring, as this
represents a doubling of gene copy. Table
5 indicates that significant amplification of nucleic acid DNA48227-1350
encoding PR0853 occurred: (1) in
primary lung tumors: LT11, LT12, LT13, LT15, and LT16; (2) in primary colon
tumors: CT2, CT3, CT8, CT10,
CT12, CTl4, CTIS, CTI6, CT17, CTI, CT4, CTS, CT7, and CTl l; and (3) in lung
tumor cell lines: H441; and
H522.
Confirmation of amplification was not confirmed in epicenter mapping for
DNA48227 for primary lung
tumors, but was seen in primary colon tumors (Table 24B): CTI, CT2, CT3, CT4,
CTS, CT6, CT8, CT9, CT10,
CTl l, CT12, CT14, CT15 and CT17. In contrast, the amplification of the
closest known epicenter markers does
not occur to a greater extent than that of DNA48227. This strongly suggests
that DNA48227 is the gene responsible
for the amplification of the particular region on Chromosome 17.
Because amplification of DNA48227-1350 occurs in various tumors, it is highly
probable to play a
significant role in tumor formation or growth. As a result, antagonists (e.g.,
antibodies) directed against the protein
encoded by DNA48227-1350 (PR0853) would be expected to have utility in cancer
therapy.
PR0882 (DNA58125):
The OCt values for DNA58125 in a variety of tumors are reported in Table 5. A
OCt of >1 was typically
used as the threshold value for amplification scoring, as this represents a
doubling of gene copy. Table 5 indicates
that significant amplification of nucleic acid DNA58125 encoding PR0882
occurred: ( 1 ) in primary lung tumors:
LTI a, LT3, LT6, LT9, LT10, LT11, LTl 2, LTl 3, LT15, LT16, LT17, LTl 8, LT19,
and LT21; (2) in colon tumors:
CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CTI, CT4, CTS, and CTl I; (3) in
lung tumor cell line H441;
and (4) in colon tumor cell lines: SW620, Co1o320, HT29, SKCO1, SW403, LS
174T, Co1o205, HCT15, HCC2998,
and KM 12.
-157-
CA 02353775 2001-06-04
WO 00/37640 PCTIUS99/30095
Amplification has been confirmed by framework mapping for DNA58125 (Table 14):
in primary lung
tumors: LT3, LT12, LT13, LT15, LTl7, and LTIB; and (2) in primary colon
tumors: CTI, CT2, CT3, CT4, CTS,
CT6, CTB, CTIO, CT12, CT14, CT15 and CTl 8. Epicenter mapping for DNA58125
also resulted in confirmation
of significant amplification (Table 15B): (1 ) in primary lung tumors: LTI2,
LTI3, LT15, LT16, and LT17; and (2)
in primary colon tumors: CT1, CT4, CT6, CT7, CT9, CTl l, CT2, CTB, CT10 and
CT16. In marked contrast, the
amplification of the closest known framework markers and epicenter markers
does not occur to a greater extent than
that of DNA58125. This strongly suggests that DNA58125 is the gene responsible
for the amplification of the
particular region on Chromosome 16.
Because amplification of DNA58125 occurs in various tumors, it is highly
probable to play a significant
role in tumor formation or growth. As a result, antagonists (e.g., antibodies)
directed against the protein encoded
by DNA58125 (PR0882) would be expected to have utility in cancer therapy.
EXAMPLE 18
In situ Hvbridization
In situ hybridization is a powerful and versatile technique for the detection
and localization of nucleic acid
sequences within cell or tissue preparations. It may be useful, for example,
to identify sites of gene expression,
analyze the tissue distribution of transcription, identify and localize viral
infection, fottow changes in specific
mRNA synthesis, and aid in chromosome mapping.
In situ hybridization was performed following an optimized version of the
protocol by Lu and Gillett, Cell
Vision.1:169-176(1994), usingPCR-generated"P-labeledriboprobes.
Briefly,formalin-fixed, paraffin-embedded
human tissues were sectioned, deparaffinized, deproteinated in proteinase K
(20 g/ml) for 15 minutes at 37 °C, and
further processed for in situ hybridization as described by Lu and Gillett,
supra. A (33-P)UTP-labeled antisense
riboprobe was generated from a PCR product and hybridized at 55 °C
overnight. The slides were dipped in Kodak
NTB2T'" nuclear track emulsion and exposed for 4 weeks.
3'P-Riboprobe synthesis
6.0 ~1 ( 125 mCi) of'3P-UTP (Amersham BF 1002, SA<2000 Ci/mmol) were speed-
vacuumdried. To each
tube containing dried "P-UTP, the following ingredients were added:
2.0 ~cl Sx transcription buffer
1.0 E.cl DTT (100 mM)
2.0 ~cl NTP mix (2.5 mM: 10 ~1 each of 10 mM GTP, CTP & ATP + 10 ~I HBO)
I.o ~l uTP (so ~M)
1.0 ,ul RNAsin
1.0 f,d DNA template ( 1 fig)
1.0 ~cl H20
1.0 ~l RNA polymerase (for PCR products T3 = AS, T7 = S, usually)
The tubes were incubated at 37°C for one hour. A total of I.0 ~1 RQI
DNase was added, followed by
incubation at 37 °C for 15 minutes. A total of 90 ~1 TE ( 10 mM Tris pH
7.6/1 mM EDTA pH 8.0) was added, and
the mixture was pipetted onto DE81 paper. The remaining solution was loaded in
a MICROCON-SOT"'
-158-
CA 02353775 2001-06-04
WO 00137640 PCT/US99I30095
ultrafiltration unit, and spun using program 10 (6 minutes). The filtration
unit was inverted over a second tube and
spun using program 2 (3 minutes). After the final recovery spin, a total of
100 ~cl TE was added, then 1 ~cl of the
final product was pipetted on DE81 paper and counted in 6 ml of BIOFLUOR
IIT"'.
The probe was run on a TBE/urea gel. A total of 1-3 ~1 of the probe or 5 ~cl
of RNA Mrk III was added
to 3 pl of loading buffer. After heating on a 95°C heat block for three
minutes, the gel was immediately placed on
ice. The wells of gel were flushed, and the sample was loaded and run at 180-
250 volts for 45 minutes. The gel
was wrapped in plastic wrap (SARANT"' brand) and exposed to XAR film with an
intensifying screen in a -70°C
freezer one hour to overnight.
3'P-Hybridization
A. Pretreatment of frozen sections
The slides were removed from the freezer, placed on aluminum trays, and thawed
at room temperature for
5 minutes. The trays were placed in a 55°C incubator for five minutes
to reduce condensation. The slides were
fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and
washed in 0.5 x SSC for 5 minutes, at
room temperature (25 ml 20 x SSC + 975 ml SQ H~O). After deproteination in 0.5
pg/ml proteinase K for 10
minutes at 37°C (12.5 pl of 10 mglml stock in 250 ml prewarmed RNAse-
free RNAse buffer), the sections were
washed in 0.5 x SSC for 10 minutes at room temperature. The sections were
dehydrated in 70%, 95%, and 100%
ethanol, 2 minutes each.
B. Pretreatment of paraffen-embedded sections
The slides were deparaffinized, placed in SQ H,O, and rinsed twice in 2 x SSC
at room temperature, for
5 minutes each time. The sections were deproteinated in 20 pg/ml proteinase K
(500 ~I of 10 mg/ml in 250 ml
RNase-free RNase buffer; 37 °C, 15 minutes) for human embryo tissue, or
8 x proteinase K ( 100 pl in 250 ml Rnase
buffer, 37°C, 30 minutes) for formalin tissues. Subsequent rinsing in
0.5 x SSC and dehydration were performed
as described above.
C. Prehybridization
The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50%
formamide) - saturated filter
paper. The tissue was covered with SO,uI of hybridization buffer (3.75 g
dextran sulfate + 6 ml SQ HZO), vortexed,
and heated in the microwave for 2 minutes with the cap loosened. After cooling
on ice, 18.75 ml formamide, 3.75
ml 20 x SSC, and 9 ml SQ HZO were added, and the tissue was vortexed well and
incubated at 42°C for 1-4 hours.
D. Hybridization
1.0 x 1 O6 cpm probe and I .0 ,ul tRNA (50 mg/ml stock) per slide were heated
at 95 °C for 3 minutes. The
slides were cooled on ice, and 48 ~cl hybridization buffer was added per
slide. After vortexing, 50 ul "P mix was
added to 50 ~cl prehybridization on the slide. The slides were incubated
overnight at 55°C.
E. Washes
Washing was done for 2x 10 minutes with 2xSSC, EDTA at room temperature (400
ml 20 x SSC + 16 m1
0.25 M EDTA, V,=4L), followed by RNAseA treatment at 37°C for 30
minutes (500 ~1 of 10 mg/ml in 250 ml
Rnase buffer = 20 ~cg/ml), The slides were washed 2 x 10 minutes with 2 x SSC,
EDTA at room temperature. The
stringency wash conditions were as follows: 2 hours at 55 °C, 0.1 x
SSC, EDTA (20 ml 20 x SSC + 16 mi EDTA,
V~=4L).
-159-
CA 02353775 2001-06-04
F. Oligonucleotides
"~~"",z~'s'" '
~Et~f~~l~ll~~, a
a~,.~~A
In situ analysis was performed on two of the DNA sequences disclosed herein.
The oiigonucleotides
employed for these analyses are as follows:
(1) PR0292 tDNA35616) (Catheosin D)
DNA35616-pl:
5'-GGA T'hC TAA TAC GAC TCA CTA TAG GGC TCT TCG ACA CGG GCT CCT CCA A-3' (SEQ
1D N0:96)
DNA35616-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAG CTC GCG CAC CTC ATC CAC-3' (SEQ ID
N0:9?)
DNA35616 (Cathepsin D), an estrogen inducible lysosomal aspartyI protease,
showed widespread tissue
expression. Expression has been reported to correlate with outcome in breast
and lung cancer. In normal tissues:
widespread expression was seen in macrophages and cells of macrophage lineage,
especially osteoclasts.
Expression was observed in epithelial cells of lung, liver, gall bladder,
stomach (basal glands), kidney, bladder and
prostate. Expression was also seen in adult cardiac myocytes, cartilage and
cerebral neurones. In the fetus,
expression was strongest in osteoclasts, but was also seen in thymus, splenic
red pulp, fetal liver (hepatocytes and
Kupffer cells), bronchial epithelium, choroid plexus, neurones and spinal
ganglia.
Additional notable expression was observed in diseased tissues: DNA35616 was
widely expressed in
macrophages at sites of injury; in tumor tissues, expression was seen at
varying levels in malignant epithelium in
all of the lung cancers. In nine out of fifteen tumors, expression was higher
in the malignant epithelium than it was
in the benign epithelium - a finding that is consistent with amplification.
Expression was always higher in tumor
associated macrophages, than it was in the malignant epithelium and in one
case expression was striking in
multinucleated giant cells.
(2) PR0327 t'DNA38113-1230) lProlactio RceJ~tor Iiomlo~)
DNA38113-pl:
S'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC CCT GAG CTC TCC CGT GTA 3' (SEQ iD
N0:98)
DNA381I3-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG CTC GCC ACT GGT CGT AGA-3' (SEQ ID
N0:99)
High expression was observed in developing mouse and human fetal lung, while
normal adult lung,
including bronchial epithelium was negative. Expression was also seen in human
fetal trachea, including with high
probability, smooth muscle cells. Expression was also observed in non-
trophoblastic cells io the human placenta.
These data are consistent with a potential role in bronchial development.
In addition, DNA38113 was identified as being amplified in a panel of lung
cancers. Accordingly,
expression was examined in a series of lung cancers: eight squamous carcinomas
and eight adenocarcinomas were
examined. Based on observing strong expression on the radiographic film, three
tumors were examined after a two
week exposure, all other sections were examined after a 4 week exposure.
DNA38113 was highly expressod in
three out of the eight adenocarcinotnas. Moderate, more focal expression, was
seen in four other adenocarcinomas.
None of the squamous carcinomas showed significant expression over the
malignant epithelium, although low level
-160-
Prirlted:'I 1-04-200 - AMENDED-SHEET
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
expression was detected .
Expression was not restricted to malignant epithelium, additional sites of
expression included: benign
bronchiolar epithelium; expression in stromal spindle shaped cells; expression
in smooth muscle of arteries (in one
specimen the expression was in the outer third of the wall); and in bronchial
and in small nerves.
Expression of DNA38113 was consistent with the amplification data (shown
above). Expression was
especially prominent in three tumors studied. Based on the expression data,
this may be a therapeutic target for
lung adenocarcinomas.
The expression pattern in fetal lung suggests a possible role in lung growth
and repair.
(3) PR01265 lDNA60764-1533) (Fis-1 Homoloe)
DNA60764-pl:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGC GCT GTC CTG CTG TCA CCA-3' (SEQ ID
NO:100}
DNA60764-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTT CCC CTC CCC GAG AAG ATA-3' (SEQ ID
NO:1 Ol )
Fifteen of the sixteen lung tumors examined were suitable for analysis (eight
adeno and seven squamous
carcinomas). Most of the tumors showed some expression of DNA60764. Expression
was largely confined to
monnuclear cells adjacent to the infiltrating tumor. In one squamous
carcinoma, expression was seen by the
malignant epithelium.
Expression was also seen over cells in fetal thymic medul la of uncertain
histogenesis. Expression was seen
over mononuclear cells in damaged renal interstitium and in interstitial cells
in a renal cell carcinoma. Expression
was also seen over cells in a germinal center, consistent with the fact that
most Fig-1 positive cells are probably
inflammatory in origin.
(4) PR0343 (DNA43318-1217) (Human Prostasin Homoloe)
DNA43318-01:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCG GCG AGG ACA GCA CTG ACA G-3' (SEQ
ID
N0:102)
DNA43318-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG GGC CCC CAG AGG TAG AGG-3' (SEQ ID
N0:103)
Expression was observed in lung carcinomas as well as in benign normal fetal
and adult tissues.
Expression was observed in five out of eight adenocarcinomas, and three out of
seven squamous
carcinomas. Expression was seen over malignant epithelium. Expression was
accentuated in cells adjacent to areas
of necrosis suggesting that this gene may be upregulated by hypoxia and/or
that it may be associated with cell death
or cell shedding. Expression was also seen in two sarcomas and in a renal cell
carcinoma.
In benign tissues, expression was seen over developing esophageal and gastric
epithelium, with expression
higher in superficial cells. No specific expression was seen in adult human
gastric epithelium, but expression was
seen in the basal glands of chimp stomach. Low level expression was observed
in fetal and adult bronchial
-161-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
epithelium as well as in bronchial cartilage. Fetal limb showed expression
adjacent to sites of bone formation.
Expression was also seen in placenta. Stromal cells in the wall of rhesus
monkey penis showed expression and
regional expression was seen over neurones in monkey cerebrum.
(5) PR0357 (DNA44804-1248) (ALS Hornolos):
DNA44804-pl:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TGC CCG CAA CCC CTT CAA CTG-3' (SEQ ID
N0:104)
DNA44804-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG CAG CTG GGT GAC CGT GTA-3'(SEQ ID
NO:1 OS)
Low to moderate expression was seen at sites of bone formation in fetal
tissues and in the malignant cells
of an osteosarcoma. Expression was also observed at low level in the placenta
and umbilical cord.
(6) PR0715 (DNA52722-1229) (TNF Homolos)
DNA52722-p 1:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGC CCC GCC ACC TCC T-3' (SEQ ID
N0:106)
DNA52722-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CTC GAG ACA CCA CCT GAC CCA-3' (SEQ ID
N0:107)
DNA52722-p3:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCA AGG AAG GCA GGA GAC TCT-3' (SEQ ID
NO:108)
DNA52722-p4:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CTA GGG GGT GGG AAT GAA AAG-3'(SEQ ID
N0:109)
Generalized high expression level was observed in many tissues: the highest
signals were seen over
placenta, osteoblasts, injured renal tubules, injured liver, colorectal liver
metastasis and gall bladder. Tested
samples had acetominophen induced liver injury and hepatic cirrhosis.
Tissues also examined included eight adenocarcinomas and eight squamous
carcinomas of the lung. Strong
expression was seen over macrophages in all tumors examined. In one case,
there was weak to moderate expression
over benign bronchial epithelium. Expression was also observed in a non-tumor
containing lung sample with
moderate inflammatory changes.
(7) PR01017 (DNA56112-1379) (Sulfotransferase Homology)
DNA56112-pl
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCA GCA GGC GGA GCG GAG GAG-3'(SEQ ID
NO:110)
DNA56112-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAC GGC GAA CTT GCG GTA GAA-3' (SEQ ID
NO:111 )
A positive signal was seen in a multi-tumor block: expression was seen in
squamous carcinoma, sarcoma,
and hepatocellular carcinoma. In lung cancers: two out of eight
adenocarcinomas and two out of seven squamous
carcinomas showed a positive signal over the malignant epithelium. A positive
signal was also seen over cortical
-162-
CA 02353775 2001-06-04
WO 00137640 PCT/US99/30095
and hippocampal neurones in adult rhesus monkey brain. A possible signal was
seen in fetal small intestinal
epithelium.
(8) PR0853 (DNA48227-1350) (Reductase Homology):
DNA48227-p 1:
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCA ACA GCG GCA TCG GAA AGA-3'(SEQ ID
N0:112)
DNA48227-p2:
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GGA GCA CCA GCC AAG CCA ATG-3'(SEQ ID
NO:113)
Elevated expression was observed in the mucosa of the chimp stomach.
EXAMPLE 19
Use of PR0201 PR0292 PR0327 PR01265 PR0344 PR0343. PR0347 PR0357, PR0715.
PR01017,
PROI 112 PR0509 PR0853 or PR0882 as a hybridization yrobe
The following method describes use of a nucleotide sequence encoding a PR0201,
PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509,
PR0853 or PR0882
polypeptide as a hybridization probe.
DNA comprising the coding sequence of a full-length or mature "PR0201 ",
"PR0292", "PR0327",
"PR01265", "PR0344", "PR0343", "PR0347", "PR0357", "PR0715", "PR01017",
"PR01112", "PR0509",
"PR0853" or "PR0882" polypeptide as disclosed herein andlor fragments thereof
may be employed as a probe to
screen for homologous DNAs (such as those encoding naturally-occurring
variants of PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO 1112, PR0509,
PR0853 or PR0882)
in human tissue cDNA libraries or human tissue genomic libraries.
Hybridization and washingof filters containing either library DNAs is
performed under the following high
stringency conditions. Hybridization of radiolabeled PR0201-, PR0292-, PR0327-
, PR01265-, PR0344-,
PR0343-, PR0347-, PR0357-, PR0715-, PR01017-, PR01112-, PR0509-, PR0853- or
PR0882-derived probe
to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1 % SDS,
0.1 % sodium pyrophosphate, 50
mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate
at 42°C for 20 hours. Washing
of the filters is performed in an aqueous solution of 0.1 x SSC and 0.1 % SDS
at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length
native sequence PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 can then be identified using standard techniques known in the
art.
EXAMPLE 20
Exvression of PR0201 PR0292 PR0327 PR01265 PR0344, PR0343 PR0347. PR0357.
PR0715,
PR01017 PROI 112 PR0509 PR0853 or PR0882 Palvvevtides in E. coli.
This example illustrates preparation of an unglycosylated form of PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO11I2, PR0509, PR0853 or
PR0882 by
recombinant expression in E. cofi.
-163-
CA 02353775 2001-06-04
WO 00/37640
PCT/US99/30095
The DNA sequence encodin= the PRO polypeptide of interest is initially
amplified using selected PCR
primers. The primers should contain restriction enzyme sites which correspond
to the restriction enzyme sites on
the selected expression vector. A variety of expression vectors may be
employed. An example of a suitable vector
is pBR322 -(derived from E. coli; see Bolivar et al., Gene, 2:95 (i977)) which
contains genes for ampicillin and
tetracycline resistance. The vector is digested with restriction enzyme and
dephosphorylated. The PCR amplified
sequences are then ligated into the vector. The vector will preferably include
sequences which encode for an
antibiotic resistance gene, a trp promoter, a poly-His leader (including the
first six STII codons, poly-His sequence,
and enterokinase cleavage site), the PR0201, PR0292, PR0327, PRO 1265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 coding region, lambda
transcriptional terminator,
and an argU gene.
The ligation mixture is then used to transform a selected E. coli strain using
the methods described in
Sambrook et al., supra. Transforrnants are identified by their ability to grow
on LB plates and antibiotic resistant
colonies are then selected. Plasmid DNA can be isolated and confirmed by
restriction analysis and DNA
sequencing.
Selected clones can be grown overnight in liquid culture medium such as LB
broth supplemented with
antibiotics. The overnight culture may subsequently be used to inoculate a
larger scale culture. The cells are then
grown to a desired optical density, during which the expression promoter is
turned on.
After culturing the cells for several more hours, the cells can be harvested
by centrifugation. The cell pellet
obtained by the centrifugation can be solubilized using various agents known
in the art, and the solubilized PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882 protein can then be purified using a metal chelating column
under conditions that allow tight
binding of the protein.
PR0327 was successfully expressed in E. coli in a poly-His tagged form using
the following procedure.
The DNA encoding PR0327 was initially amplified using selected PCR primers.
The primers contained restriction
enzyme sites which correspond to the resuiction enzyme sites on the selected
expression vector, and other useful
sequences providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column,
and proteolytic removal with enterokinase. The PCR-amplified, poly-His tagged
sequences were then ligated into
an expression vector, which was used to transform an E. coli host based on
strain 52 (W3110 fuhA(tonA) lon galE
rpoHts(htpRts) clpP(laclq). Transfotmants were first grown in LB containing 50
mg/ml carbenicillin at 30°C with
shaking until an O.D. of 3-5 at 600 nm was reached. Cultures were then diluted
50-100 fold into CRAP media
(prepared by mixing 3.57 g (NH.,)zSO,, 0.71 g sodium citrate~2Hz0, 1.07 g KCI,
5.36 g Difco yeast extract, 5.36g
Sheffield hycase SF in 500 ml water, as well as 110 mM MPOS, pH 7.3, 0.55%
(w/v) glucose and 7 mM MgS04)
and grown for approximately 20-30 hours at 30°C with shaking. Samples
were removed to verify expression by
SDS-PAGE analysis, and the bulk culture was centrifuged to pellet the cells.
Cell pellets were frozen until
purification and refolding.
E. toll paste from 0.5 to 1 L fermentations (6-10 g pellets) was resuspended
in 10 volumes (w/v) in 7 M
guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfue and sodium
tetrathionate were added to make final
concentrations of O.1M and 0.02 M, respectively, and the solution was stirred
overnight at 4°C. This step results
-164-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
in a denatured protein with all cysteine residues blocked by sulfitolization.
The solution was centrifuged at 40,000
rpm in a Beckman Ultracentifuge for 30 min. The supernatant was diluted with 3-
5 volumes of metal chelate
column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22
micron filters to clarify. The clarified
extract was loaded onto a 5 ml Qiagen Ni 2;-NTA metal chelate column
equilibrated in the metal chelate column
buffer. The column was washed with additional buffer containing 50 mM
imidazole (Calbiochem, Utrol grade),
pH 7.4. The proteins were eluted with buffer containing 250 mM imidazole.
Fractions containing the desired
protein were pooled and stored at 4°C. Protein concentration was
estimated by its absorbance at 280 nm using the
calculated extinction coefficient based on its amino acid sequence.
The protein was refolded by diluting sample slowly into freshly prepared
refolding buffer consisting of:
20 n~lvi Tris, pH 8.6, 0.3 M NaCI, 2.5 M urea, 5 mM cysteine, 20 mM glycine
and 1 mM EDTA. Refolding
volumes were chosen so that the final protein concentration was between 50 to
100 micrograms/ml. The refolding
solution was stirred gently at 4°C for 12-36 hours. The refolding
reaction was quenched by the addition of TFA
to a final concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution
was filtered through a 0.22 micron filter and acetonitrile was added to 2-10%
final concentration. The refolded
protein was chromatographed on a Poros RI/H reversed phase column using a
mobile buffer of 0.1 % TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions
with A2,~, absorbance were analyzed
on SDS polyacrylamide gels and fractions containing homogeneous refolded
protein were pooled. Generally, the
properly refolded species of most proteins are eluted at the lowest
concentrations of acetonitrile since those species
are the most compact with their hydrophobic interiors shielded from
interaction with the reversed phase resin.
Aggregated species are usually eluted at higher acetonitrile concentrations.
In addition to resolving misfolded forms
of proteins from the desired form, the reversed phase step also removes
endotoxin from the samples.
Fractions containing the desired folded PR0327 protein were pooled and the
acetonitrile removed using
a gentle stream of nitrogen directed at the solution. Proteins were formulated
into 20 mM Hepes, pH 6.8 with 0.14
M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25
Superfine (Phamnacia) resins
equilibrated in the formulation buffer and sterile filtered.
EXAMPLE 21
Ex ression of PR0201 PR0292 PR0327 PROI 265 PR0344 PR0343 PR0347 PR0357 PR0715
PR01017 PROI 112 PR0509 PR0853 or PR0882 in mammalian cells
This example illustrates preparation of a potentially glycosylated form of
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509,
PR0853 or PR0882
by recombinant expression in mammalian cells.
The vector, pRKS (see EP 307,247, published March 15, 1989), is employed as
the expression vector.
Optionally, the PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347,
PR0357, PR0715, PRO I O 17,
PRO1112, PR0509, PR0853 or PR0882 DNA is ligated into pRKS with selected
restriction enzymes to allow
insertion of the PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 DNA using ligation methods such as
described in Sambrook
et al., supra. The resulting vector is called pRKS-PR0201, pRKS-PR0292, pRKS-
PR0327, ARKS-PR01265,
-165-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
pRKS-PR0344, pRKS-PR0343, pRKS-PR0347, pRKS-PR0357, pRKS-PR0715, pRKS-PR01017,
pRKS-
PROI 112, ARKS-PR0509, pRKS-PR0853 or pRKS-PR0882.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells
(ATCC CCL 1573) are
grown to confluence in tissue culture plates in medium such as DMEM
supplemented with fetal calf serum and
optionally, nutrient components and/or antibiotics. About 10 ~cg pRKS-PR0201,
pRKS-PR0292, pRKS-PR0327,
pRKS-PR01265, pRKS-PR0344, pRKS-PR0343, pRKS-PR0347, ARKS-PR0357, pRKS-PR0715,
pRKS-
PR01017, pRKS-PRO1 I 12, pRKS-PR0509, pRKS-PR0853 or pRKS-PR0882 DNA is mixed
with about 1 ~g
DNA encoding the VA RNA gene [Thimmappaya etal., Cell, 31:543 (1982)] and
dissolved in 500 ~.1 of 1 mM Tris-
HCI, 0.1 mM EDTA, 0.227 M CaClz. To this mixture is added, dropwise, 500 ~1 of
50 mM HEPES (pH 7.35), 280
mM NaCI, 1.5 mM NaPO~, and a precipitate is allowed to form for 10 minutes at
25"C. The precipitate is
suspended and added to the 293 cells and allowed to settle for about four
hours at 37"C. The culture medium is
aspirated off and 2 m1 of 20% glycerol in PBS is added for 30 seconds. The 293
cells ace then washed with serum
free medium, fresh medium is added and the cells are incubated for about 5
days.
Approximately 24 hours after the transfections, the culture medium is removed
and replaced with culture
medium (alone) or culture medium containing 200 ~.Ci/ml 35S-cysteine and 200
~Ci/ml'SS-methionine. After a 12
hour incubation, the conditioned medium is collected, concentrated on a spin
filter, and loaded onto a 15% SDS
gel. The processed gel may be dried and exposed to film for a selected period
of time to reveal the presence of the
PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 polypeptide. The cultures containing transfected
cells may undergo further
incubation (in serum free medium) and the medium is tested in selected
bioassays.
In an alternative technique, PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347,
PR0357, PR0715, PR01017, PROI I 12, PR0509, PR0853 or PR0882 DNA may be
introduced into 293 cells
transiently using the dextraWsulfate method described by Somparyrac et al.,
Proc. Natl. Acad. Sci., 12:7575 (1981 ).
293 cells are grown to maximal density in a spinner flask and 700 ~g pRKS-
PR0201, pRKS-PR0292, pRKS-
PR0327, pRKS-PR01265, pRKS-PR0344, pRKS-PR0343, pRKS-PR0347, pRKS-PR0357, pRKS-
PR0715,
pRKS-PR01017, pRKS-PR01112, ARKS-PR0509, pRKS-PR0853 or pRKS-PR0882 DNA is
added. The cells
are first concentrated from the spinner flask by centrifugation and washed
with PBS. The DNA-dextran precipitate
is incubated on the cell pellet for four hours. The cells are treated with 20%
glycerol for 90 seconds, washed with
tissue culture medium, and re-introduced into the spinner flask containing
tissue culture medium, 5 ~glml bovine
insulin and 0.1 ~g/ml bovine transferrin. After about four days, the
conditioned media is centrifuged and filtered
to remove cells and debris. The sample containing expressed PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 can
then be
concentrated and purified by any selected method, such as dialysis and/or
column chromatography.
In another embodiment PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357,
PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or PR0882 can be expressed in CHO
cells. The ARKS-PR0201,
pRKS-PR0292, pRKS-PR0327, pRKS-PR01265, pRKS-PR0344, pRKS-PR0343, pRKS-PR0347,
pRKS
PR0357, pRKS-PR0715, pRKS-PR01017, pRKS-PRO 1112, pRKS-PR0509, pRKS-PR0853 or
pRKS-PR0882
vector can be transfected into CHO cells using known reagents such as CaP04 or
DEAE-dextran. As described
-166-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
above, the cell cultures can be incubated, and the medium replaced with
culture medium (alone) or medium
containing a radiolabel such as 'SS-methionine. After determining the presence
of the PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509,
PR0853 or PR0882
polypeptide, the culture medium may be replaced with serum free medium.
Preferably, the cultures are incubated
for about 6 days, and then the conditioned medium is harvested. The medium
containing the expressed PR0201,
PR0292, PR0327, PROI265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI
112, PR0509,
PR0853 or PR0882 can then be concentrated and purified by any selected method.
Epitope-tagged PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 may also be expressed in host CHO
cells. The PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROl
l 12, PR0509,
PR0853 or PR0882 may be subcloned out of the pRKS vector. The subclone insert
can undergo PCR to fuse in
frame with a selected epitope tag such as a poly-His tag into a Baculovirus
expression vector. The poly-His tagged
PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882 insert can then be subcloned into a S V40 driven
vector containing a selection marker
such as DHFR for selection of stable clones. Finally, the CHO cells can be
transfected (as described above) with
the SV40 driven vector. Labeling may be performed, as described above, to
verify expression. The culture medium
containing the expressed poly-His tagged PR0201, PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 can then be
concentrated and purified by
any selected method, such as by Niz'-chelate affinity chromatography.
Expression in CHO and/or COS cells may
also be accomplished by a transient expression procedure.
PRO 1265, PR01017 and PR0509 were expressed in CHO cells by a stable
expression procedure, whereas
PR0292, PR0715 and PR0509 were expressed in CHO cells by a transient
procedure. Stable expression in CHO
cells was performed using the following procedure. The proteins were expressed
as an IgG construct
(immunoadhesin), in which the coding sequences for the soluble forms (e.g.,
extracellular domains) of the
respective proteins were fused to an IgGI constant region sequence containing
the hinge, CH2 and CH2 domains
and/or in a poly-His tagged form.
Following PCR amplification, the respective DNAs were subcloned in a CHO
expression vector using
standard techniques as described in Ausubel et al., Current Protocols of
Molecular Bioloey, Unit 3.16, John Wiley
and Sons ( 1997). CHO expression vectors are constructed to have compatible
restriction sites 5' and 3' of the DNA
of interest to allow the convenient shuttling of cDNA's. The vector used for
expression in CHO cells is as
described in Lucas et al., Nucl. Acids Res., 24:9 (1774-1779 (1996), and uses
the SV40 early promoter/enhancer
to drive expression of the cDNA of interest and dihydrofolate reductase
(DHFR). DHFR expression permits
selection for stable maintenance of the plasmid following transfection.
Twelve micrograms of the desired plasmid DNA were introduced into
approximately 10 million CHO cells
using commercially available transfection reagents Superfect~ (Quiagen),
Dosper~ or Fugene~ (Boehringer
Mannheim). The cells were grown as described in Lucas et al., supra.
Approximately 3 x 10-' cells are frozen in
an ampule for further growth and production as described below.
The ampules containing the plasmid DNA were thawed by placement into a water
bath and mixed by
-167-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
vortexing. The contents were pipetted into a centrifuge tube containing 10 mls
of media and centrifuged at 1000
rpm for 5 minutes. The supernatant was aspirated and the cells were
resuspended in 10 mi of selective media (0.2
~m filtered PS20 with 5% 0.2 ~cm diafiltered fetal bovine serum). The cells
were then aiiquoted into a 100 ml
spinner containing 90 ml of selective media. After 1-2 days, the cells were
transferred into a 250 ml spinner filled
with 150 ml selective growth medium and incubated at 37"C. After another 2-3
days, 250 ml, 500 ml and 2000 ml
spinners were seeded with 3 x 105 cellslml. The cell media was exchanged with
fresh media by centrifugation and
resuspension in production medium. Although any suitable CHO media may be
employed, a production medium
described in US Patent No. 5,122,469, issued June 16, 1992 was actually used.
3L production spinner was seeded
at 1.2 x 10~ cells/ml. On day 0, the cell number and pH were determined. On
day 1, the spinner was sampled and
sparging with filtered air was commenced. On day 2, the spinner was sampled,
the temperature shifted to 33°C, and
30 ml of 500 g/L, glucose and 0.6 ml of 10% antifoam (e.g., 35%
polydimethylsiloxane emulsion, Dow Corning 365
Medical Grade Emulsion) added. Throughout the production, the pH was adjusted
as necessary to keep at around
7.2. After 10 days, or until viability dropped below 70%, the cell culture was
harvested by centrifugation and
filtered through a 0.22 ~cm filter. The filtrate was either stored at
4°C or immediately loaded onto columns for
I S purification.
For the poly-His tagged constructs, the proteins were purified using a Ni Z'-
NTA column (Qiagen). Before
purification, imidazole was added to the conditioned media to a concentration
of 5 mM. The conditioned media
was pumped onto a 6 ml Ni 2'-NTA column equilibrated in 20 mM Hepes, pH 7.4,
buffer containing 0.3 M NaCI
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4°C. After loading,
the column was washed with additional
equilibration buffer and the protein eluted with equilibration buffer
containing 0.25 M imidazole. The highly
purified protein was subsequently desalted into a storage buffer containing 10
mM Hepes, 0.14 M NaCI and 4%
mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -
80°C.
Immunoadhesin (Fc containing) constructs were purified from the conditioned
media as follows. The
conditioned medium was pumped onto a 5 ml Protein A column (Pharmacia) which
had been equilibrated in 20 mM
Na phosphate buffer, pH 6.8. After loading, the column was washed extensively
with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately
neutralized by collecting 1 ml
fractions into tubes containing 275 ~cl of 1 M Tris buffer, pH 9. The highly
purified protein was subsequently
desalted into storage buffer as described above for the poly-His tagged
proteins. The homogeneity was assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman
degradation.
PR0292, PR0327, PR0344, PR0347, PR0357, and PR0853 were also produced by
transient expression
in COS cells.
EXAMPLE 22
Ex ression of PR0201 PR0292 PR0327 PR01265 PR0344 PR0343 PR0347 PR0357 PR0715
PR01017 PROI 1 l2 PR0509 PR0853 or PR0882 in Yeast
The following method describes recombinant expression of PR0201, PR0292,
PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or
PR0882 in yeast.
First, yeast expression vectors are constructed for intracellular production
or secretion of PR0201,
-168-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0292, PR0327, PROI 265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PROI 112, PR0509,
PR0853 or PR0882 from the ADH2/GAPDH promoter. DNA encoding PR0201, PR0292,
PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR071 S, PRO 1017, PR01112, PR0509, PR0853 or
PR0882 and the
promoter is inserted into suitable restriction enzyme sites in the selected
plasmid to direct intracellular expression
of PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343, PR0347, PR0357, PR0715,
PR01017, PR01112,
PR0509, PR0853 or PR0882. For secretion, DNA encoding PR0201, PR0292, PR0327,
PR01265, PR0344,
PR0343, PR0347, PR0357, PR071 S, PRO 1017, PRO 1112, PR0509, PR0853 or PR0882
can be cloned into the
selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native
PR0201, PR0292, PR0327,
PRO 1265, PR0344, PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509,
PR0853 or PR0882
signal peptide or other mammalian signal peptide, or, for example, a yeast
alpha-factor or invertase secretory
signal/leader sequence, and linker sequences (if needed) for expression of
PR0201, PR0292, PR0327, PROI 265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I 12, PR0509, PR0853 or
PR0882.
Yeast cells, such as yeast strain AB110, can then be transformed with the
expression plasmids described
above and cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by
precipitation with 10% trichloroacetic acid and separation by SDS-PAGE,
followed by staining of the gels with
Coomassie Blue stain.
Recombinant PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357,
PR0715,
PR01017, PROI 112, PR0509, PR0853 or PR0882 can subsequently be isolated and
purified by removing the
yeast cells from the fermentation medium by centrifugation and then
concentrating the medium using selected
cartridge filters. The concentrate containing PRO201, PR0292, PR0327, PR0126S,
PR0344, PR0343, PR0347,
PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 may further be
purified using selected
column chromatography resins.
EXAMPLE 23
Expression of PR0201. PR0292. PR0327. PR01265. PR0344. PR0343. PR0347. PR0357,
PR0715,
PR01017. PR01112. PR0509. PR0853 or PR0882 in Baculovirus-infected Insect
Cells
The following method describes recombinant expression in Baculovirus-infected
insect cells.
The sequence coding for PR0201, PR0292, PR0327, PR01265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882 is fused upstream of an
epitope tag contained within
a baculovirus expression vector. Such epitope tags include poly-His tags and
immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids derived
from commercially available plasmids
such as pVL1393 (Novagen). Briefly, the sequence encoding PR0201, PR0292,
PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357, PR0715, PRO 1017, PRO 1112, PR0509, PR0853 or PR0882
or the desired portion
of the coding sequence of PR0201, PR0292, PR0327, PRO I 265, PR0344, PR0343,
PR0347, PR0357, PR0715,
PR01017, PR01112, PR0509, PR0853 or PR0882 [such as the sequence encoding the
extracellular domain of
a transmembrane protein or the sequence encoding the mature protein if the
protein is extracellular] is amplified
by PCR with primers complementary to the S' and 3' regions. The S' primer may
incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those selected
restriction enzymes and subcloned into
-169-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
the expression vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and
BaculoGoldT"'virus DNA
(Pharmingen) into Spodoptera frugiper da ("Sf9") cells (ATCC CRL I 71 1 ) usi
ng lipofectin (commercially available
from GIBCO-BRL). After 4 - 5 days of incubation at 2$°C, the released
viruses are harvested and used for further
amplifications. Viral infection and protein expression are performed as
described by O'Reilley et al., Baculovirus
expression vectors: A Laboratory Manual, Oxford: Oxford University Press (
1994).
Expressed poly-His tagged PR0201, PR0292, PR0327, PRO 1265, PR0344, PR0343,
PR0347, PR0357,
PR0715, PR01017, PRO 1112, PR0509, PR0853 or PR0882 can then be purified, for
example, by Niz+-chelate
affinity chromatography as follows. Extracts are prepared from recombinant
virus-infected Sf9 cells as described
by Rupert et al., Nature, 362:175-179 ( 1993). Briefly, Sf9 cells are washed,
resuspended in sonication buffer (25
ml Hepes, pH 7.9; 12.5 mM MgCl2; 0.1 mM EDTA; 10% glycerol; 0.1 % NP-40; 0.4 M
KCl), and sonicated twice
for 20 seconds on ice. The sonicates are cleared by centrifugation, and the
supernatant is diluted 50-fold in loading
buffer (50 mM phosphate, 300 mM NaCI, 10% glycerol, pH 7.8) and filtered
through a 0.45 ~cm filter. A Nip'-NTA
agarose column (commercially available from Qiagen) is prepared with a bed
volume of 5 ml, washed with 25 ml
of water and equilibrated with 25 ml of loading buffer. The filtered cell
extract is loaded onto the column at 0.5
ml per minute. The column is washed to baseline A2R" with loading buffer, at
which point fraction collection is
started. Next, the column is washed with a secondary wash buffer (50 mM
phosphate; 300 mM NaCI, 10%
glycerol, pH 6.0), which elutes nonspecifically bound protein. After reaching
A2~" baseline again, the column is
developed with a 0 to 500 mM imidazole gradient in the secondary wash buffer.
One ml fractions are collected and
analyzed by SDS-PAGE and silver staining or Western blot with Ni2*-NTA-
conjugated to alkaline phosphatase
(Qiagen). Fractions containing the eluted His "; tagged PR0201, PR0292,
PR0327, PRO 1265, PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PRO11 I 2, PR0509, PR0853 or PR0882,
respectively, are pooled and
dialyzed against loading buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) PR0201, PR0292,
PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO i 112, PR0509, PR0853 or
PR0882 can be
performed using known chromatography techniques, including for instance,
Protein A or protein G column
chromatography.
While expression is actually performed in a 0.5-2 L scale, it can be readily
scaled up for larger (e.g., 8 L)
preparations. The proteins are expressed as an IgG construct (immunoadhesin),
in which the protein extracellular
region is fused to an IgGI constant region sequence containing the hinge, CH2
and CH3 domains and/or in poly-
His tagged forms.
Following PCR amplification, the respective coding sequences are subcloned
into a baculovirus expression
vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly-His tagged
proteins), and the vector and BaculogoldO
baculovirus DNA (Pharmingen) are co-transfected into 105 Spodoptera frugiperda
("Sf9") cells (ATCC CRL
1711 ), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are
modifications of the commercially available
baculovirus expression vector pVLI 393 (Pharmingen), with modified polylinker
regions to include the His or Fc
tag sequences. The cells are grown in Hink's TNM-FH medium supplemented with
10% FBS (Hyclone). Cells are
incubated for S days at 28°C. The supernatant is harvested and
subsequently used for the first viral amplification
-170-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
by infecting Sf9 cells in Hink's TNM-FH medium supplemented with 10% FBS at an
approximate multiplicity of
infection (MOI) of 10. Cells are incubated for 3 days at 28°C. The
supernatant is harvested and the expression
of the constructs in the baculovirus expression vector is determined by batch
binding of I ml of supernatant to 25
ml of Ni'-*-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A
Sepharose CL-4B beads (Pharmacia)
for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known
concentration of protein standard
by Coomassie blue staining.
The first viral amplification supernatant is used to infect a spinner culture
(500 ml) of Sf9 cells grown in
ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells
are incubated for 3 days at 28 °C.
The supernatant is harvested and filtered. Batch binding and SDS-PAGE analysis
are repeated, as necessary, until
expression of the spinner culture is confirmed.
The conditioned medium from the transfected cells (0.5 to 3 L) is harvested by
centrifugation to remove
the cells and filtered through 0.22 micron filters. For the poly-His tagged
constructs, the protein construct is
purified using a Ni 2+-NTA column (Qiagen). Before purification, imidazole is
added to the conditioned media to
a concentration of 5 mM. The conditioned media is pumped onto a 6 ml Ni Z*-NTA
column equilibrated in 20 mM
Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a flow rate
of 4-5 ml/min. at 4°C. After
loading, the column is washed with additional equilibration buffer and the
protein eluted with equilibration buffer
containing 0.25 M imidazole. The highly purified protein is subsequently
desalted into a storage buffer containing
10 mM Hepes, 0.14 M NaCI and 4% mannitol, pH 6.8, with a 25 ml G25 Supe~ne
(Pharmacia) column and stored
at -80°C.
Immunoadhesin (Fc containing) constructs of proteins are purified from the
conditioned media as follows.
The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which
has been equilibrated in 20 mM
Na phosphate buffer, pH 6.8. After loading, the column is washed extensively
with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately
neutralized by collecting 1 ml fractions
into tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins. The
homogeneity of the proteins is verified by
SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid
sequencing by Edman degradation.
PR0327, PR0344 and PR0509 were expressed in Baculovirus -infected Sf9 insect
cells by the above
procedure.
Alternatively, a modified baculovirus procedure may be used incorporating high
5 cells. In this procedure,
the DNA encoding the desired sequence is amplified with suitable systems, such
as Pfu (Stratagene), or fused
upstream (5'-of) of an epitope tag contained with a baculovirus expression
vector. Such epitope tags include poly-
His tags and immunoglobulin tags (like Fc regions of IgG). A variety of
plasmids may be employed, including
plasmids derived from commercially available plasmids such as pIEI -1
(Novagen). The pIE l -1 and pIEI -2 vectors
are designed for constitutive expression of recombinant proteins from the
baculovirus iel promoter in stably-
transformed insect cells. The plasmids differ only in the orientation of the
multiple cloning sites and contain all
promoter sequences known to be important for iel-mediated gene expression in
uninfected insect cells as well as
the hr5 enhancer element. pIEI-1 and pIEl-2 include the translation initiation
site and can be used to produce
fusion proteins. Briefly, the desired sequence or the desired portion of the
sequence (such as the sequence encoding
-171-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
the extracellular domain of a transmembrane protein) is amplified by PCR with
primers complementary to the 5'
and 3' regions. The 5' primer may incorporate flanking (selected) restriction
enzyme sites. The product is then
digested with those selected restriction enzymes and subcloned into the
expression vector. For example, derivatives
of pIEI -1 can include the Fc region of human IgG (pb.PH.IgG) or an 8
histidine (pb.PH.His) tag downstream (3'-of)
the desired sequence. Preferably, the vector construct is sequenced for
confirmation.
High 5 cells are grown to a confluency of 50% under the conditions of
27°C, no C02, NO pen/strep. For
each 150 mm plate, 30 ~g of pIE based vector containing the sequence is mixed
with 1 ml Ex-Cell medium (Media:
Ex-Cell 401 + 1/100 L-Glu JRH Biosciences #14401-78P (note: this media is
light sensitive)), and in a separate
tube,100 ~1 of CellFectin (CeIIFECTIN (GibcoBRL #10362-010) (vortexed to mix))
is mixed with 1 ml of Ex-Cell
1~ medium. The two solutions are combined and allowed to incubate at room
temperature for 15 minutes. 8 ml of Ex-
Cell media is added to the 2 ml of DNA/CelIFECTIN mix and this is layered on
high 5 cells that have been washed
once with Ex-Cell media. The plate is then incubated in darkness for 1 hour at
room temperature. The
DNA/CeIIFECTIN mix is then aspirated, and the cells are washed once with Ex-
Cell to remove excess
CeIIFECTIN, 30 ml of fresh Ex-Cell media is added and the cells are incubated
for 3 days at 28°C. The supernatant
is harvested and the expression of the sequence in the baculovirus expression
vector is determined by batch binding
of 1 ml of supernatant to 25 ml of Ni '-'-NTA beads (QIAGEN) for histidine
tagged proteins or Protein-A Sepharose
CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis
comparing to a known
concentration of protein standard by Coomassie blue staining.
The conditioned media from the transfected cells (0.5 to 3 L) is harvested by
centrifugation to remove the
cells and filtered through 0.22 micron filters. For the poly-His tagged
constructs, the protein comprising the
sequence is purified using a Ni 2+-NTA column (Qiagen). Before purification,
imidazole is added to the conditioned
media to a concentration of 5 mM. The conditioned media is pumped onto a 6 ml
Ni 2+-NTA column equilibrated
in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a
flow rate of 4-5 ml/min. at 48°C.
After loading, the column is washed with additional equilibration buffer and
the protein eluted with equilibration
buffer containing 0.25 M imidazole. The highly purified protein is then
subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCI and 4% mannitol, pH 6.8, with a 25 ml G25
Superfine (Pharmacia) column
and stored at -80°C.
Immunoadhesin (Fc containi ng) constructs of proteins are purified from the
conditioned media as follows.
The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which
has been equilibrated in 20 mM
Na phosphate buffer, pH 6.8. After loading, the column is washed extensively
with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately
neutralized by collecting 1 ml fractions
into tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins. The
homogeneity of the sequence is assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman
degradation and other analytical
procedures as desired or necessary.
PR0327, PRO 1265, PR0344 and PR0882 were successfully expressed by the above
modified baculovirus
procedure incorporating high 5 cells.
-172-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
EXAMPLE 24
Preparation of Antibodies that Bind PR0201. PR0292, PR0327, PR01265. PR0344.
PR0343. PR0347,
PR0357. PR0715. PR01017. PR01112, PR0509. PR0853 or PR0882
This example illustrates preparation of monoclonal antibodies which can
specifically bind PR0201,
PR0292, PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017,
PR01112, PR0509,
PR0853 or PR0882.
Techniques for producing the monoclonal antibodies are known in the art and
are described, for instance,
in Goding, supra. Immunogens that may be employed .include purified PR0201,
PR0292, PR0327, PR01265,
PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PROI 112, PR0509, PR0853 or
PR0882 fusion
proteins containing PR0201, PR0292, PR0327, PR01265, PR0344, PR0343, PR0347,
PR0357, PR0715,
PR01017, PROI 112, PR0509, PR0853 or PR0882 and cells expressing recombinant
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I 12, PR0509,
PR0853 or PR0882
on the cell surface. Selection of the immunogen can be made by the skilled
artisan without undue experimentation.
Mice, such as Balb/c, are immunized with the PR0201, PR0292, PR0327, PRO 1265,
PR0344, PR0343,
PR0347, PR0357, PR0715, PR01017, PR01112, PR0509, PR0853 or PR0882 immunogen
emulsified in
complete Freund's adjuvant and injected subcutaneously or intraperitoneally in
an amount from I -100 micrograms.
Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi
Immunochemical Research, Hamilton,
MT) and injected into the animal's hind foot pads. The immunized mice are then
boosted 10 to 12 days later with
additional immunogen emulsified in the selected adjuvant. Thereafter, for
several weeks, the mice may also be
boosted with additional immunization injections. Serum samples may be
periodically obtained from the mice by
retro-orbital bleeding for testing in ELISA assays to detect anti-PR0201, anti-
PR0292, anti-PR0327, anti-
PR01265, anti-PR0344, anti-PR0343, anti-PR0347, anti-PR0357, anti-PR0715, anti-
PRO 1017, anti-PRO 1112,
anti-PR0509, anti-PR0853 or anti-PR0882 antibodies.
After a suitable antibody titer has been detected, the animals "positive" for
antibodies can be injected with
a final intravenous injection of PR0201, PR0292, PR0327, PR01265, PR0344,
PR0343, PR0347, PR0357,
PR0715, PROI017, PRO11 I2, PR0509, PR0853 or PR0882. Three to four days later,
the mice are sacrificed
and the spleen cells are harvested. The spleen cells are then fused (using 35%
polyethylene glycol) to a selected
murine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL
1597. The fusions generate
hybridoma cells which can then be plated in 96 well tissue culture plates
containing HAT (hypoxanthine,
aminopterin, and thymidine) medium to inhibit proliferation of non-fused
cells, myeloma hybrids, and spleen cell
hybrids.
The hybridoma cells will be screened in an ELISA for reactivity against
PR0201, PR0292, PR0327,
PR01265, PR0344, PR0343, PR0347, PR0357, PR07 i 5, PR01017, PRO 1 l 12,
PR0509, PR0853 or PR0882.
Determination of "positive" hybridoma cells secreting the desired monoclonal
antibodies against PR0201, PR0292,
PR0327, PR01265, PR0344, PR0343, PR0347, PR0357, PR0715, PR01017, PRO1 I 12,
PR0509, PR0853 or
PR0882 is within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic
Balb/c mice to produce
ascites containing the anti-PR0201, anti-PR0292, anti-PR0327, anti-PR01265,
anti-PR0344, anti-PR0343, anti-
-173-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
PR0347, anti-PR0357, anti-PR0715, anti-PRO 1017, anti-PRO 1112, anti-PR0509,
anti-PR0853 or anti-PR0882
monoclonal antibodies. Alternatively, the hybridoma cells can be grown in
tissue culture flasks or roller bottles.
Purification of the monoclonal antibodies produced in the ascites can be
accomplished using ammonium sulfate
precipitation, followed by gel exclusion chromatography. Alternatively,
affinity chromatography based upon
binding of antibody to protein A or protein G can be employed.
De~~osit of Material:
The following materials have been deposited with the American Type Culture
Collection,10801 University
Blvd., Mantissas, VA 20110-2209, USA (ATCC):
Material ATCC Deposit No.: Deposit Date
DNA30676-1223 209567 12/23/97
DNA38113-1230 209530 12/10/97
DNA60?64-1533 203452 11/10/98
DNA40592-1242 209492 11/21/97
DNA43318-1217 209481 11 /21 /97
DNA44176-1244 209532 12/10/97
DNA44804-1248 209527 12/10/97
DNA52722-1229 209570 1/7/98
DNA56112-1379 209883 5/20/98
DNA57702-1476 209951 6/9/98
DNA48227-1350 209812 4/28/98
These deposits were made under the provisions of the Budapest Treaty on the
International Recognition
of the Deposit of Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest
Treaty). This assures the maintenance of a viable culture of the deposit for
30 years from the date of deposit. The
deposit will be made available by the ATCC under the terms of the Budapest
Treaty, and subject to an agreement
between Genentech, Inc., and the ATCC, which assures permanent and
unrestricted availability of the progeny of
the culture of the deposit to the public upon issuance of the pertinent U.S.
patent or upon laying open to the public
of any U.S. or foreign patent application, whichever comes first, and assures
availability of the progeny to one
determined by the U.S. Commissioner of Patents and Trademarks to be entitled
thereto according to 35 U.S.C. ~
122 and the Commissioner's rules pursuant thereto (including 37 C.F.R. ~ 1.14
with particular reference to 886 OG
638).
The assignee of the present application has agreed that if a culture of the
materials on deposit should die
or be lost or destroyed when cultivated under suitable conditions, the
materials will be promptly replaced on
notification with another of the same. Availability of the deposited material
is not to be construed as a license to
practice the invention in contravention of the rights granted under the
authority of any government in accordance
with its patent laws.
- I 74-
CA 02353775 2001-06-04
WO 00/37640 PCT/US99/30095
The foregoing written specification is considered to be sufficient to enable
one skilled in the art to practice
the invention. The present invention is not to be limited in scope by the
construct deposited, since the deposited
embodiment is intended as a single illustration of certain aspects of the
invention and any constructs that are
functionally equivalent are within the scope of this invention. The deposit of
material herein does not constitute
an admission that the written description herein contained is inadequate to
enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be construed as
limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of the
invention in addition to those shown and
described herein will become apparent to those skilled in the art from the
foregoing description and fall within the
scope of the appended claims.
-175-
