Note: Descriptions are shown in the official language in which they were submitted.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
Hormone -Hormone Receptor Complexes and Nucleic
Acid Constructs and Their Use in Gene Therapy
Background of the Invention
1. Object of the Invention
The invention relates to the use of a nucleic acid construct
to comprising at least one hormone responsive element and a transgene
for preparing an agent for gene transfer. It further relates to
particular nucleic acid constructs comprising at least one hormone
responsive element and a transgene, wherein one of said at least one
hormone responsive elements is not functionally linked to the
is transgene, vectors comprising such nucleic acid constructs and
compositions of matter comprising such nucleic acid constructs
wherein the hormone responsive elements of the constructs are
coupled to a hormone-hormone receptor complex. The nucleic acid
constructs, plasmids, and compositions of matter of the invention
Zo have applications in gene therapy, particularly in the treatment of
human blood clotting disorders, such as hemophilia. They may also be
used to up- or down-regulate target genes and for the delivery of
vaccines.
2s 2. Summary of the Related Art
Gene therapy is a method that holds great promise for many
diseases and disorders. In general, it involves the transfer of
recombinant genes or transgenes into somatic cells to replace proteins
with a genetic defect or to interfere with the pathological process of
CONFIRMATION COPY
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
an illness. In principle, gene therapy is a simple method. In practice,
many disadvantages must still be overcome.
Research in gene therapy has concentrated on ways to most
effectively incorporate DNA into cells of a patient. Viral vectors are
s currently the widely used vehicles in clinical gene therapy approaches.
In terms of efficacy in gene expression, the viral delivery systems
have major advantages over techniques using DNA-lipid formulations
as delivery vehicles or over mechanical methods, such as the gene
gun. Although there are a variety of viral systems tested for gene
~o therapeutical strategies, retroviral vectors and adenoviral vectors are
presently the most widely used vehicles (Salmons, B. and Gunzburg,
W. H., Hum. Gene Ther., Vol. 4, 129, 1993; Kasahara, N. A., et al.,
Science, Vol. 266, 1373, 1994; Ali, M., et al., Gene Ther., Vol. 1, 367,
1994. ). Still, these systems have major disadvantages, such as
Is potential viral contamination. Other safety concerns continue- to
hamper the development of clinical application of gene therapy using
these viral systems. For example, recombinant retroviruses have the
disadvantage of random chromosomal integration, which may lead to
activation of oncogenes or inactivation of tumor-suppressor genes.
Zo Also, repetitive use of recombinant adenoviruses has caused severe
immunological problems (Elkon, K. B. et al., Proc. Natl. Acad. Sci.
USA, Vol. 94, 9814, 1997). The humoral response resulted, in the
production of antibodies to adenovirus proteins preventing subsequent
infection. Immunosuppressive drugs may ameliorate these effects, but
as they place an additional burden on the patient (Dai, Y., et al., Proc.
Nat/. Acad. Sci. USA, Vol. 92, 1401, 1995).
Yet another viral delivery system involves adenoassociated virus
(AAV). The AAV requires coinfection with an unrelated helper virus.
Although such recombinant AAV virions have proven useful for
3o introducing several small gene sequences into host cells, gene
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00101368
J
delivery systems based on those particles are limited by the relative
small size of AAV particles. This feature greatly reduces the range of
appropriate gene protocols. Moreover, the need to also use a helper
virus adds a complicating factor to this delivery system (Muzyczka, N.,
s Curr. Top. Microbiol. Immunol., Vol. 158, 97, 1992).
Though safer, non-viral gene therapy approaches are also
unsatisfactory. Problems with inefficient gene delivery or poor
sustained expression are major drawbacks. Yet the methods available
such as the direct injection of DNA into cellular compartments, or the
~o application of mixtures of DNA with cationic lipids or polylysine
allowing the transgene to cross the cell membrane more easily, have
not overcome these hurdles (Felgner, P., et al., Proc. Nat/. Acad. Sci.
USA, Vol. 84, 7413, 1987; Behr, J.-P., Bioconjugate Chemistry, Vol. 5,
382, 1994).
is Introduction of naked DNA (polynucleotide) sequences (including
antisense DNA) into vertebrates, is reported to be achieved by
injection into tissues such as muscle, brain or skin or by introduction
into the blood circulation (Wolff, J. A., et al., Science, Vol. 247, 1990;
Lin, H., et al., Circulation, Vol. 82, 2217, 1990; Schwartz, B., et al.,
Zo Gene Ther., Vol. 3, 405, 1996). Also, a direct gene transfer into
mammals has been reported for formulations of DNA encapsulated in
liposomes and DNA entrapped in proteoliposomes containing receptor
proteins. Although injected naked DNA leads to transgene expression,
the efficiency is by far not comparable to viral-based DNA delivery
2s systems. A limitation of the method of naked DNA injection is the fact
that transgene expression is dose-dependent. The gene expression is
saturable, and an increase in the amount of DNA injected leads to
decreased protein production per plasmid. Thus, protein expression
can dramatically decrease, if the amount of DNA injected is above a
3o certain threshold.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
4
Among the genetic disorders that the skilled artisan has sought
to overcome using these prior art methods are those relating to blood
clotting disorders, and in particular, hemophilia (Lozier, J. N. and
Brinkhous, K. M., JAMA, Vo1.271, 1994; Hoeben, R. C., Biologicals,
s Vol. 23, 27, 1995). For example, hemophilia A and B are X-linked,
recessive bleeding disorders caused by deficiencies of clotting factors
VIII and IX, respectively (Sadler, J. E. et al., in: The Molecular Basis
of Blood Diseases, 575, 1987). The incidence of hemophilia is about 1
in 5,000 male births. Hemophiliacs suffer from excessive bleeding due
io to the lack of clotting at the site of wounds. The inability to clot
properly causes damage to joints and internal tissues as well as
posing risks to the proper treatment of cuts.
Treatment of hemophilia A is possible by the administration of
the blood clotting factor VIII. Until recently, factor VIII preparations
is had to be prepared by concentrating blood from donors, posing -the
risk of contamination by infectious agents, such as HIV and hepatitis.
The gene for factor VIII has been cloned (e.g., Vehar et al., Nature
Vol. 312, 337 1984) allowing for the production of a recombinant
product. Although recombinant methods provide factor VIII of higher
ao purity than blood concentrates, the exogenous supply of factor VIII to
a patient still requires repeated doses throughout the lifetime of the
patient, an inconvenient and expensive solution.
Other forms of hemophilia include hemophilia B, caused by a
defect in the gene coding for Factor IX. The gene therapy systems
Zs described above have been attempted for the treatment of hemophilia
A and B with factors VIII and IX, respectively. (See e.g., WO
94/29471). However, these systems have the disadvantages already
discussed above.
On the other hand, the classical model of the action of hormones
3o is based on the concept of binding interaction of the hormone to an
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
intracellular receptor, located in the cytoplasm or the nucleus (Evans,
R., Science, Vol. 240, 889, 1988). These intracellular receptors
remain latent until exposed to their target hormone. When so
exposed, the hormone receptor changes its conformation after the
s hormone is bound and translocates in the activated form into the cell
nucleus where it binds as a dimer to hormone responsive elements in
the promoter region of hormone-regulated genes (Beato, M., Cell, Vol.
56, 335, 1989; O ~ Mallet', B., et al., Biol. Reprod., Vol. 46, 163,
1992). The hormone responsive elements are enhancer elements
io usually located in the 5 ~ flanking region of the specific hormone-
induced gene, i.e., are functionally linked to the specific hormone
induced gene. DNA constructs comprising a hormone responsive
element and a nucleic acid sequence encoding a protein of interest are
disclosed in U.S. Pat. Nos. 5,688,677 and 5,580,722 and are taught to
Is be suitable for expression of the protein of interest.
An example of such intracellular receptors is the steroid
receptor. Steroid receptors belong to a superfamily of ligand-
dependent transcription factors characterized by a unique molecular
structure. The centrally located highly conserved DNA-binding domain
Zo defines this superfamily. The second important and relatively invariant
region is the COOH-terminal ligand-binding domain. An example of
such a receptor is the progesterone receptor mediated by the steroid
progesterone. At the progesterone receptor, progesterone acts as a
natural agonist whereas it displays potent antimineralocorticoid
as properties both at the molecular and the systemic level. Besides
classical effects on the uterus, antiepileptic, anxiolytic, hypnotic and
anesthetic properties have been attributed to progesterone according
to numerous studies.
Methods have been proposed for the use of mutant hormone
3o receptors, including mutant steroid receptors for gene therapy. For
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
G
example, such methods are disclosed in WO 93/23431, WO 98/18925,
WO 96/40911. Moreover, WO 98/33903 discloses a genetic construct
comprising a steroid responsive element from a tissue specific gene, a
coding sequence, and an SV40 enhancer.
s
Brief Description of the Invention
The object of the present invention is to overcome the
disadvantages of the previous gene therapy delivery systems. It was
found that a hormone-hormone receptor complex possesses the
io ability to drag a nucleic acid construct having one or more hormone
responsive elements) through the cell membrane into a cell. It was
also found that if the construct comprises further functional sequences
besides the hormone responsive elements (hereinafter "transgenes"),
the functional sequences exert their function. The hormone responsive
~s element may also enhance the expression of the transgene. Moreover,
it was found that steroid hormones are very effective mediators for
the transfer of nucleic acid constructs through the cell membranes
into a cell. The present invention thus provides
(1) the use of a nucleic acid construct comprising at least one
2o hormone responsive element (hereinafter referred to as "HRE") and a
transgene for preparing an agent for gene transfer (said at least one
HRE being functionally linked to the transgene or not);
(2) a preferred embodiment of (1) above, wherein the agent
further comprises a hormone-hormone receptor complex;
as (3) a nucleic acid construct comprising at least one HRE and a
transgene, wherein one of said at least one HREs is not functionally
linked to the transgene;
(4) a vector comprising the nucleic acid construct of (3) above;
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
7
(5) a transformed cell or transgenic organism comprising the
nucleic acid construct as defined in (3) above or the vector as defined
in (4) above;
(6) a composition of matter comprising a nucleic acid construct
s comprising at least one HRE and a transgene as defined in (3) above
and/or a vector as defined in (4) above, said at least one HRE being
coupled to a hormone-hormone receptor complex;
(7) a preferred embodiment of (6) above, wherein the
transgene is a gene encoding a blood clotting factor;
to (8) a preferred embodiment of (7) above, wherein the blood
clotting factor is factor IX;
(9) a preferred embodiment of (7) above, wherein the blood
clotting factor is factor VIII;
(10) a pharmaceutical composition comprising the nucleic acid
~s construct as defined in (3) above and/or the composition of matter as
defined in (6) to (9) above;
(11) a method for preparing the composition of matter as
defined in (6) above, which method comprises admixing the nucleic
acid construct with the hormone receptor and the hormone;
ao (12) a method for gene transfer which comprises administering
the agent as defined in (1) and (2) or the composition of matter as
defined in (6) to (9) above to an organism or to a cellular system;
(13) a method for delivering into an organism or into a cellular
system a nucleic acid encoding a transgene to be expressed in the
2s cells of the organism or the cells of the cellular system, which method
comprises administering an agent as defined in (1) above or
composition of matter as defined in (6) to (9) above to the organism
or to the cellular system so that the hormone in the composition
interacts with the cell membrane and therewith enhances diffusion
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
8
and transport of the nucleic acid that is coupled to the hormone-
hormone receptor complex across the membrane and into the cell;
(14) a method of treating blood clotting disorders comprising
administering a therapeutically effective amount of the composition of
s matter as defined in (7) above to an organism or to a cellular system;
(15) a method of treating hemophilia B, comprising
administering a therapeutically effective amount of the composition of
matter as defined in (8) above to an organism or to a cellular system;
(16) method of treating hemophilia A, comprising administering
~o a therapeutically effective amount of the composition of matter as
defined in (9) above to an organism or to a cellular system;
(17) use of a steroid hormone for preparing an agent for gene
transfer; and
(18) a method for gene transfer which comprises administering
is a nucleic acid construct to an organism or to a cellular system;
wherein the nucleic acid construct contains a transgene and is
encapsulated in a steroid hormone.
In a preferred embodiment of (1) to (16) above the hormone
ao responsive element is a steroid responsive element (SRE), most
preferably a progesterone responsive element (PRE). In embodiments
(2) and (6) to (16) the receptor preferably is a steroid receptor, most
preferably, a progesterone receptor. Similarly, the hormone is
preferably a steroid, most preferably, progesterone.
2s The present invention thus provides a delivery system for gene
therapy that should overcome the prior art disadvantages. The
presence of the hormone responsive element on the nucleic acid
carrying a transgene encourages the binding of a hormone-hormone
receptor complex. Thus, the present invention uses the activated
3o hormone receptor as a link (or binding compound) between the
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
9
nucleic acid carrying the transgene and the hormone known to
interact with the cell membrane. The general known biological activity
mediated by the HREs is not the primary effect utilized in the present
invention, but might k-e an additional effect when regulation of the
s transgene is desired. The general principle is depicted in Figure 1. The
hormone responsive element is preferably present as a nucleic acid
dimer sequence or nucleic acid multimer sequence. Even in an inverse
orientation, the hormone responsive element will exert its proper
function. The hormone-hormone receptor complex contains a
~o hormone receptor that becomes activated after binding of its specific
hormone. The hormone receptor in the activated state is able to
recognize and bind to its specific hormone responsive element, which
in the present invention is present within the nucleic acid comprising
the desired transgene, e.g., a human blood-clotting factor.
is Vaccination is another aspect of the embodiment (12) defined
above. Introducing a nucleic acid construct or composition of matter
of the invention comprising a gene for an antigen or containing a viral
sequence into a cell (DNA vaccines) using the method mentioned
above may also provide a way to stimulate the cellular immune
Zo response.
Brief Description of the Drawings
Fi_ u~ shows the concept of gene transfer of the present invention
Zs (with HRE = hormone responsive element, HR = hormone receptor, H
= hormone, blank circles = lipophilic matrix).
Fig~~ure 2 is a diagram of the vector pTGFGl.
Figure 3 is a diagram of the vector pTGFGS.
Figure 4 is a diagram of the vector pTGFG20.
3o Figure 5 is a diagram of the vector pTGFG33.
CA 02362970 2001-08-16
~'O 00/49147 PCT/EP00/01368
Fi uq re 6 is a diagram of the vector pTGFG36.
Figure 7 is a diagram of the vector pTGFG53.
Figure 8 is a diagram of the vector pTGFG64.
Fi uq re 9 is the DNA sequence of vector pTGFG36 (SEQ ID NO: 1).
s Figure 10 shows the protein sequence of factor IX encoded by vector
pTGFG36 (SEQ ID N0: 2).
Figure 11 shows a GFP concentration curve for cell homogenates after
transfection with pTGFG5 and pTGFG20, respectively.
Figure 12 shows corresponding light (a and c) and fluorescent (b and
to d) micrographs of Hel_a cells transfected with pTGFG5 (a and b) and
pTGFG20 (c and d), respectively.
Figure 13 shows the amount of GFP expressed by utilizing the
favoured vectors of the invention in a transfection experiment.
Relative fluorescence units from mock and background can be clearly
~s separated.
Figure 14 shows the additive effect of human clotting factor IX on
clotting activity of mouse blood.
Figure 15: hPR (A-form) was expressed in insect cells and purified by
cobaltz+ affinity chromatography as described in Example 5. The final
Zo preparation (85pg protein) was separated on a denaturing 7,5% SDS
polyacrylamid gel, followed by staining with coomassie° 8250 (lane A)
or western blotting with hPR-specific staining (lane C).
Lane B: Molecular mass standard. Arrows indicate the two highly
enriched protein species (94 and 74 kDa) accessible to
Zs immunodetection.
Figure 16: Domain structure of hPR-B (numbers on the top of the bar
represent amino acid positions within the polypeptide sequence).
Figure 17 shows the mean values of the difference in the clotting time
of Example 9.
3o Figure 18 shows the clotting time detected in Example 9.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
Figiure 19 shows the activity of human progesterone receptor as
determined in Example 8.
Figure z0: shows the amino acid sequence of the hPR B-Form. The
start methionine 165 of the hPR A-Form is underlined (SEQ ID N0:
s 18).
Figure z1 shows the nucleic acid sequence of the mRNA coding for
hPR. The reading frame for the hPR B-form starts at position 176, the
reading frame for the hPR A-Form at position 668. The respective
start codons ATG are underlined (SEQ ID NO: 19). The sequences of
to Figures 20 and 21 are taken from Genbank, accession number
AF016381.
Detailed Description of the Invention
is 1. Definitions
"Nucleic acid" means DNA, cDNA, mRNA, tRNA, rRNA. The
nucleic acid may be linear or circular, double-stranded or single-
stranded.
"Nucleic acid construct" refers to a composite of nucleic acid
2o elements in relation to one another. The nucleic acid elements of the
construct may be incorporated into a vector in such an orientation
that a desired gene may be transcribed, and if desired, a desired
protein may be expressed.
"Transgene" refers to a functional nucleic acid sequence which is
Zs transcriptionally active (with or without regulatory sequences).
"Gene transfer" includes "gene therapy".
"Hormone responsive element" (HRE) refers to regions of
nucleic acids, and in particular, DNA, which regulate transcription of
genes in response to hormone activation. HREs are typically about 10-
30 40 nucleotides in length, and more usually, about 13-20 nucleotides in
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
12
length. As explained above, HREs become activated when a hormone
binds to its corresponding intracellular receptor causing a
conformational change, so that the receptor has increased affinity for
the HRE and binds to it. The HRE, in turn, stimulates transcription. A
s "steroid responsive element" (SRE) is an HRE that regulates
transcription of genes in response to steroid activation. A
"progesterone responsive element" (PRE) is an HRE/SRE that
regulates transcription of genes in response to progesterone
activation.
to A "hormone receptor" refers to a receptor which binds to and is
activated by a hormone. A "steroid receptor" refers to a receptor
which binds to and is activated by a steroid hormone. A "progesterone
receptor" is a receptor which binds to or is activated by the steroid
hormone progesterone.
is "Functionally linked" refers to configurations of the nucleic acid
construct, where the HRE (or SRE/or PRE) is located within the
construct so that it can stimulate transcription of the transgene. "Not
functionally linked" refers to configurations where the HRE is so
remotely located from the transgene that it cannot stimulate its
2o transcription.
"Gene" refers to DNA sequence encoding a polypeptide,
optionally including leader and trailer sequences and introns and
exons.
"Vector" refers to any genetic construct, such as a plasmid,
2s phage, cosmid, etc., which is capable of replication when associated
with the proper control elements and which can transfer gene
sequences between cells. The term includes cloning and expression
vehicles.
"Promoter" refers to a region of regulatory DNA sequences for
3o the control of transcription of a gene to which RNA polymerise binds.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
13
The promoter forms an initiation complex with RNA polymerise to
initiate and drive transcription activity. "Enhancers" may activate the
complex or "silencers" may inhibit the complex. A "tissue-specific
promoter" is a promoter found in the DNA of tissue for transcription of
s genes expressed in this specific tissue.
"Organism" refers to a multicellular living entity including
vertebrates such as mammals (especially humans, cattle, rodents,
dogs) and invertebrates.
"Cellular system" includes cell cultures, e.g., primary cell
to cultures (especially those suitable for reimplantation), stem cells,
blood cells, tissue samples and whole organs and immortalized cell
cultures.
"Therapeutically effective dose" of the products of the invention
refers to a dose effective for treatment or prophylaxis, for example, a
Is dose that yields effective treatment or reduction of the symptoms of
hemophilia. It is also a dose that measurably activates expression of a
target gene as determined by measurements of target protein levels,
or a dose that is predictable to be effective for treatment or
prophylaxis by extrapolating from in vitro or in vivo data. The
2o determination of a therapeutically effective dose is within the purview
of one skilled in the art.
"Encodes" or "encoding" refers to a property of the nucleic acid
sequence of being transcribed (in case of DNA) or translated (in the
case of mRNA) into a polypeptide in vitro or in vivo when placed under
Zs the control of appropriate regulatory sequences.
For the purposes of this application, "express", "expressing" or
"expression" shall refer to transcription and translation of a gene
encoding a protein.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
14
2. Detailed Description and Examples
As stated above, an object of the present invention is to provide
a new and improved delivery system for gene therapy. The invention
thus provides nucleic acid constructs comprising at least one HRE and
s a transgene wherein one of said at least one HREs is not functionally
linked to the transgene, and compositions of matter comprising such
nucleic acid construct wherein said at least one HRE is coupled to a
hormone-hormone receptor complex (embodiments (3) and (6)
defined above). A preferred embodiment of the nucleic acid construct
io and of the composition of matter of the invention is one where the
hormone responsive element is a steroid responsive element (SRE),
and the receptor is a steroid receptor. Most preferably, the hormone
responsive element is a progesterone responsive element (PRE), and
the receptor is a progesterone receptor.
is Potential HREs for use in the present invention have been
previously described. For example, GREs (Scheidereit, C., et al.,
Nature, Vol. 304, 749, 1983; von der Ahe, D., et al., Proc. Natl. Acad.
Sci. USA, Vol. 83, 2817, 1986), EREs or PREs (Chambon, P., et al.,
Rec. Prog. Horm. Res., Vol., 40, 1, 1984; Klock, G., et al., Nature,
ao Vol. 329, 734, 1987). As already stated above, the most preferred
HRE for the invention is a PRE. Specifically, the preferred PRE is
described in Example 1, i.e., is the double stranded DNA sequence
comprised of SEQ ID NOs: 3 and 4. The nucleic acid for use in the
invention comprises at least one hormone responsive element.
Zs Preferred is a nucleic acid comprising more than one HRE. For
example, the nucleic acid may comprise three to ten, preferably three
to five HREs. The most preferred embodiment is a nucleic acid
comprising three to five PREs.
Potential hormone receptors for use in the present invention
3o are, for example, estrogen receptors, mineralocorticoid receptors,
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
glucocorticoid receptors, retinoic acid receptors, androgen, calcitriol,
thyroid hormone or progesterone receptors and orphan receptors.
Such receptors have been previously described. (Green, S., et al.,
Nature, Vol. 320, 134, 1986; Green, G. L.,et al., Science, Vol. 231,
s 1150, 1986; Arriza, J. L., et al., Science, Vol. 237, 268, 1987;
Hollenberg, S. M., et al., Nature, Vol. 318, 635, 1985; Petkovitch, M.,
et al., Nature, Vol. 330, 444, 1987; Giguere, V., et al., Nature , Vol.
330, 624, 1987; Tilley, W., et al., Proc. Natl. Acad. Sci. USA, Vol. 86,
327, 1989; Baker, A. R., et al., Proc. Natl. Acad. Sci. USA, Vol. 85,
~0 3294, 1988; Weinberger, C., et al., Nature, Vol. 324, 641, 1986; Sap,
J., et al., Nature, Vol. 324, 635, 1086; Misrahi, M., et al., Biochem.
Biophys. Res. Commun., Vol. 143, 740, 1987; Kastner, P., et al., Cell,
Vol. 83, 859, 1995). These receptors may be from human or other
mammalian sources, although human is preferred. Nucleotide and/or
is amino acid sequences of human steroid receptors are available in the
GenBank: mineralocorticoid receptor: M16801; glucocorticoid receptor
a: M10901; glucocorticoid receptor a2: 001351; glucocorticoid
receptor (3: M11050; retinoic acid receptor a: AF088888 (exon 1),
AF088889 (exon 2), AF088890 (exon 3), AF088891 (exon 4),
2o AF088892 (exon 5 and 6), AF088893 (exon 7), AF088894 (exon 8),
AF088895 (exon 9 and complete cDNA); retinoic acid receptor y:
M24857; androgen receptor: M27423 (exon 1), M27424 (exon 2),
M27425 (exon 3), M27436 (exon 4), M27427 (exon 5), M27428 (exon
6), M27429 (exon 7), M27430 (exon 8); thyroid hormone receptor al:
Zs M24748, thyroid hormone receptor a2: J03239; progesterone
receptor: AF016381; somatotropin receptor: J00148; vitamin D
receptor (calcitriol receptor): J03258.
The skilled person will understand that expression of the
receptor proteins can be achieved by standard methods, e.g. via PCR-
3o cloning of the known cDNAs from cDNA libraries and overexpression of
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
16
the corresponding proteins in suitable expression vectors, such as, for
example, the vectors of the present invention, in suitable host cells,
e.g., COS cells. Accordingly, subsequent purification of the cytosolic
fraction can be achieved by routine methods such as affinity
s chromatography purification. For this purpose, various suitable
antibodies against the desired receptor are commercially available.
For example, polyclonal antibodies against the mouse progesterone
receptor that have a sufficiently high cross-reactivity for the human
protein are available from Dianova (Hamburg, Germany). Likewise,
to further purification can be achieved by standard methods, e.g.,
chromatographical methods such as ion-exchange chromatography
and/or FPLC.
The most preferred receptor is the progesterone receptor.
Preferably, the receptor is a human progesterone receptor. Such a
Is human progesterone receptor (from T47D human breast cancer cells)
is disclosed in US Patent No. 4,742,000, and cells expressing this
receptor have been deposited (ATCC deposit number HTB, 133). As
already described above, it would be routine to purify such a receptor
from the cytosol using receptor specific antibodies. In addition, US
2o Patent No. 4,742,000 discloses a method for purification of the human
progesterone receptor using a specific steroid affinity resin (cf.
Grandics et al., Endocrinology, Vol. 110, 1088, 1982).
Briefly, the cytosolic fraction of the T47D cells is passed over
Sterogel, a commercial preparation of deoxycorticosterone coupled to
2s Sepharose° 2B that selectively binds the progesterone receptor.
After
washing with loading buffer, the bound receptor is eluted with a buffer
containing progesterone. The eluted steroid-receptor complex is then
chromatographed on DEAE-Biogel and eluted stepwise with a buffer
containing 0.2M NaCI. Subsequently, the bound progesterone can be
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
17
readily exchanged. As described above, further purification can be
achieved by routine methods well-known to the skilled person.
An alternative method is disclosed in Example 5.
The structure of the hPR polypeptide is depicted in Fig. 16. The hPR
s polypeptide is composed of distinct structural domains. Naturally the
human progesterone receptor (hPR) is expressed as two different
sized proteins termed hPR-B (120 kDa) and hPR-A (94 kDa). HPR-A is
a truncated but otherwise identical form of hPR-B, that is missing 165
the N-terminal amino acids (see Fig. 20, SEQ ID NO: 18). Both forms
to seems to be indistinguishable regarding their progesterone or DNA
binding properties. In human cells the A and B forms of hPR are
produced from the same gene by alternate initiation of translation at
two different AUG start sites within the same RNA transcript. As it was
reported earlier hPR-A and B can be expressed in Spodoptera
Is frugiperda (Sf9) cells as biological fully active polypeptides
(Christensen et ai., Mol. Endocrinol. 5, 1755ff (1991); Elliston et al.,
JBC 267, 5193-5198 (1992)).
The carboxyl terminus of the hPR polypeptide as shown in Fig.
16 comprises a progesterone binding domain (PBD) but also contains
Zo sequences responsible for the association with heat shock proteins
and receptor dimerization. The hinge region provides a flexible link
between the DNA-binding domain (DBD) and the PBD but is also
thought to contain elements for receptor dimerization as well as
nuclear localization. Binding of the hPR to its corresponding target
2s sites at the chromosomal DNA (PREs, Progesterone Responsive
Elements) is known to be mediated by the DBD. The remaining N-
terminal trans-activation domain (TAD) consists of regions specific for
the in vivo function of the hPR as a transcriptional gene activator.
Even though the N-terminus also seems to contribute directly to
3o the homodimerization of hPR after progesterone binding, it has been
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
I ii
demonstrated that a fragment comprising only the hinge region and
the PBD was the minimal C-terminal fragment to mediate
progesterone dependent hPR-hPR-interaction (Tetel et al., Mol.
Endocrinol. 11, 1114ff. (1997). It is believed that genetically
s engineered hPR polypeptides lacking either in part or completely the
TAD (amino acids 1 to 556) might be expressed as structurally stable
and fully soluble dimers in the presence of progesterone. Complexes
with such a truncated hPR (provided that said truncated hPR exhibits
DNA-binding activity as well as progesterone-binding activity) may
to functionally replace the complexes with the full length form of the
described recombinant hPR-A or hPR-B proteins, since still mediating
the contact between the plasmid DNA and the progesterone. Thus, the
hPR in embodiments (2) and (6) to (16) of the invention preferably is
a PR comprising nucleic acids 557 to 933 of natural hPR shown in SEQ
Is ID NO: 18.
Effective expression of such a truncated version of hPR is
possible in the baculovirus system but also in other eukaryotic
expression systems, such as cultivated mammalian cells or yeast cells.
Furthermore, also an E, coli overexpression strain is a possible
2o system for the production of those polypeptides. In this case, the
fusion of such a truncated hPR-version to a suitable polypeptide
sequence, e.g. a histidine containing sequence or the GST (glutathion
S- transferase) protein, might be helpful to overcome insolubility
problems as well as to facilitate the isolation and purification of the
Zs expressed protein.
Mutated versions of these receptors and derivatives thereof,
that still retain the function of the receptors to bind a ligand and
thereby become activated and bind DNA and regulate transcription,
may also be employed in the invention. Such derivative may be a
3o chemical derivative, variant, chimera, hybrid, analog, or fusion.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
19
The third component of the gene transfer system of the
invention is the hormone. The hormone in the agent of embodiment 2
and in the composition of matter of embodiment (6) include synthetic
and natural hormones, preferably steroid hormones, such as estrogen,
s testosterone, glucocorticoid, androgen, thyroid hormone, and
progesterone or derivatives thereof. These are widely available.
Progesterone is most preferred. For example, natural micronized
progesterone is the preferred progesterone from which has been
marketed in France since 1980 under the trademark of UTROGESTAN~
~o and is still available in Germany under the trademark UTROGEST°. Its
properties are similar to the endogenous progesterone, in particular, it
has antiestrogen, gestagen, slightly antiandrogen and
antimineralocorticoid properties. The natural micronized progesterone
in said marketed products is dispersed in a matrix as described
is hereinbelow.
The above micronized progesterone has advantages that make it
a suitable carrier for genes or nucleic acid constructs to target cells.
Specifically, the synergistic effect of the double process of
micronization and suspension in long-chain fatty acids residues of an
Zo oii results in increasing progesterone absorption. It has been
demonstrated that after oral administration of 100 mg of
UTROGESTAN~, peak plasma progesterone levels were obtained after
1-4 hours in most cases (Padwick, M. L., et al., Fertil. Steril., Vol. 46,
402, 1986). Later on, the levels declined substantially, although they
2s were still elevated at 12 hours. Even at 84 hours the levels were
slightly higher than baseline. A U.S. kinetic study confirmed earlier
work demonstrating the bioavailability of oral micronized
progesterone. They showed a peak effect at 2 hours followed by rapid
decrease in plasma progesterone level (Simon, J. A., et al., Fertil.,
3o Sterih, Vol., 60, 26, 1993).
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
A further advantage of using progesterone as a carrier is the low
level of disadvantageous side effects. Orally administered
progesterone adversely affects neither plasma lipids (Jensen, J. et al.,
Am. J. Obstet. Gynecol., Vol. 156, 66, 1987) nor carbohydrate
s metabolism (Mosnier-Pudar, H. et al., Arch. Mal. Coeur, Vol 84, 1111,
1991). Further, progesterone does not affect liver enzymes (ASAT,
ALAT, AFOS), sex-hormone binding-globulin (SHBG) synthesis or HDL-
cholesterol levels at daily doses of 200 mg and 300 mg. Although the
plasma levels of deoxycorticosterone may increase substantially
Io during UTROGESTAN~ treatment, there are strong indications that the
mineralocorticoid effects of this progesterone metabolite are
completely counteracted by the anti-mineralocorticoid effects of
progesterone itself. This is apparent from a comparative study
(Corvol, P., et al., In: Progesterone and progestins. Raven Press, New
~s York, 179, 1983) in which oral UTROGESTAN~ was capable of
antagonizing the mineralocorticoid effects of 9-a-fluorohydrocortisone.
In the agent of embodiment (2) and in the composition of
matter of embodiment (6) of the invention the molar ratio of HRE (or
SRE/or PRE) within the nucleic acid construct to hormone receptor is
Zo preferably from 1:1 to 1:10, more preferably from 1:2 to 1:5. On the
other hand, the molar ratio of hormone to hormone receptor is
preferably at least 1000:1, more preferably at least 10000:1. Thus,
the hormone is present in a large excess relative to the hormone
receptor and the HRE, which is desirable in view of the ability of the
Zs hormones to transfer nucleic acid constructs through cell membranes.
The skilled artisan will appreciate that the agent of embodiments
(1) and (2) and the pharmaceutical composition of embodiment (10)
may contain other components capable of assisting in introducing the
nucleic acid into a cell for the purpose of gene therapy (matrix
3o compounds). Specifically, the agent and the composition, especially
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
21
the hormone component thereof, may contain the following matrix
compounds: glucose and related compounds (such as D-sorbitol, D-
mannitol); solubilizing adjuvants (such as alcohols, e.g., ethanol);
polyhydric compounds such as glycerine, polyethylene glycol and
s polypropylene glycol; nonionic surface active compounds, ionic surface
active compounds such as lecithin; oily compounds such as sesame
oil, peanut oil soybean oil, corn oil, etc.; starches and their derivatives
such as cyclodextrines and hydroxyalkylated starches; stabilizers such
as human serum albumin, preservatives such as benzyl alcohol and
io phenol; and the like. The preferred matrix contains f3-cyclodextrine,
glycerine, lecithin and/or corn oil. For example, the pharmaceutical
composition of hormone-hormone receptor nucleic acid complex of the
invention may be provided orally to humans or animals as a gelatin
capsule. Progesterone therein (preferably in micronized form) could
Is be present in a concentration of 50 to 1000 mg, preferably 200 -300
mg dissolved in a 35 % or 40 % f3-cyclodextrin solution or in cornoil
or gycerol with peanut oil together with lecithin.
Alternatively, when - due to the selection of appropriate matrix
components - the pharmaceutical composition is in a pasty, gel-like
zo form, it may be provided topically.
The nucleic acid construct of embodiments (1) to (15) of the
present invention may - aside from the transgene and the HREs,
SREs, or PREs already disclosed above - further contain promoter,
enhancer, and/or silencer sequences. The promoter may be ubiquitous
Zs or tissue-specific. Of the ubiquitous promoters, the CMV promoter is
most preferred. However, a tissue-specific promoter is preferred over
a ubiquitous promoter. For example, the tissue-specific promoters
envisioned for the instant invention include al-antitrypsin (further
promoters).
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
The nucleic acid construct may further comprise additional
sequences such as the ampicillin resistance gene. Other reporter
sequences known to the skilled artisan may also be included, such as,
for example, the green fluorescent protein (GFP), luciferase, f3-
s galactosidase or chloramphenicolacetyltransferase (CAT). As an
enhancer sequence, the SV40 intron and SV40 Poly A are most
preferred. The nucleic acid construct may further contain inducible
promoters such as, for example, a MMTV (Mouse Mammary Tumor
Virus) promoters inducible via glucocorticoides and Ecdyson-inducible
~o insect promoters.
A preferred nucleic acid construct contains sequentially from the
5' to the 3' end: a PRE, a CMV promoter, a gene of interest, SV40
Intron and SV40 poly A enhancer sequence, and an ampicillin
resistant gene. Further PREs are evenly distributed on the vector
Is backbone.
The nucleic acid construct may further contain origin of
replication sequences (especially eukariotic origin of replication
sequences), elements for gene targeting, integrational sequences
(e.g., AAV-ITR, transposon IS), 3'-UTR, "switch" systems (e.g., TET
Zo system, Cre/IoxP or Flp/ftr system).
The transgene may be chosen from those encoding proteins
lacking in a variety of genetic disorders or involved in conditions
related to inappropriate responses to hormones, for example,
hormone-dependent cancers such as breast, ovarian, and endometrial
Zs cancers and prostate cancer. The transgene may also be used to
replace a defective gene resulting in such genetic disorders as
hemophilia, von Willebrand disease, and cystic fibrosis. The transgene
includes mutations of such gene or a gene encoding a fusion product.
The nucleic acid construct of the present invention may comprise
~o more than one transgene.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
23
In particular, the transgene may replace genes for a blood
clotting factor, and preferably a human blood-clotting factor. The
genes encoding factor VIII and factor IX (sown in Fig. 2, SEQ ID NO:
2), involved in hemophilia A and B, respectively, are good candidates
s for the invention. Other candidates include the gene encoding von
Willebrand factor, factor IV, factor X, or protein C.
Other useful transgenes include, but are not limited to, hormone
genes such as the genes encoding for insulin, parathyroid hormone,
luteinizing hormone releasing factor (LHRH), a and f3 seminal inhibins
to and human growth hormone; hormone receptor genes such as the
glucocorticoid receptor, the estrogen receptor, the progesterone
receptor, the retinoic acid receptor; growth factors such as vascular
endothelial growth factor (VEGF); nerve growth factor, epidermal
growth factor; enzyme genes; genes encoding cytokines or
is lymphokines such as interferons, granulocytic macrophage colony
stimulating factor (GM-CSF), colony stimulating factor-1 (CSF-1),
tumor necrosis factor (TNF), and erythropoietin (EPO); genes
encoding inhibitor substances such as al-antitrypsin, and genes
encoding substances that function as drugs, e. g., genes encoding the
Zo diphteria and cholera toxins, ricin or cobra venom factor. Also,
antisense sequences may be administered as genetic material.
Another aspect of the present invention is vectors comprising
the nucleic acid constructs of embodiment (3) of the present
invention. These vectors may be used in the composition matter of
2s embodiment (6) of the present invention. Preferably, however, the
nucleic acid sequence for use in the invention is circular rather than
linear. The vectors may be capable of expressing the nucleic acid in
the nucleic acid construct transiently or permanently (including
episomally). As noted above, the nucleic acid construct therein may
3o further contain additional elements.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
24
The composition of matter of embodiment (6) of the invention
can be prepared by admixing the nucleic acid construct with the
hormone receptor and the hormone. Preferably, an aqueous solution
of nucleic acid construct was added to the oily suspension containing
s the hormone at ambient temperature under stirring.
Embodiments) of the invention relates to transfected and
transformed cells or transgenic organism comprising these vectors
and/or nucleic acid constructs. Within the scope of this invention, a
transfected cell is one in which foreign DNA has been incorporated.
~o Methods of transfection may include microinjection, CaP04
precipitation, electroporation, liposome fusion, or gene gun.
Transformation refers to introducing genetic material into a cell,
such as the vectors or nucleic acid constructs of the invention,
rendering the cell transiently or permanently altered so that the cell
is expresses a specific gene product or is otherwise altered in its
expression. Transformation may be achieved by in vivo or in vitro
techniques, although in vivo transformation is preferred.
A further embodiment of the present invention is pharmaceutical
compositions comprising a therapeutically effective dose of the nucleic
Zo acid constructs of the invention and a hormone. The hormone is
preferably a steroid, and most preferably, progesterone, as described
above. The dose is dependent on the condition to be treated, the
characteristics of the patient, and the result sought to be achieved.
Determining dosage is within the realm of the skilled artisan.
Zs The pharmaceutical composition (or, alternatively, the
composition of matter, the nucleic acid construct, or the vector) of the
present invention may be administered orally, intravenously,
intramuscularly, subcutaneously, topically, through mucosa (including
buccal, nasal spray) or by gene gun. Oral administration (of a
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
micronized hormone dispersion) is preferred. Delivery may be
systemic or directed at certain tissue.
The invention further includes a method of introducing into a cell
a nucleic acid construct encoding a gene of interest, e.g., a human
s blood-clotting factor, to express the blood-clotting factor in the cell. In
this method, the nucleic acid encoding a human blood-clotting factor
is combined with a nucleic acid construct comprising at least one
hormone responsive element (HRE), preferably a progesterone
responsive element.
~o The mixture of nucleic acid bound to the hormone-hormone
receptor complex together with an excess of hormone, preferably
progesterone, will be used to introduce the nucleic acid into a cell by
various methods known to the skilled artisan and outlined above. The
cell-uptake will be stimulated by the interaction of the hormone with
Is the cell membrane. The hormone or steroid interacts with the lipid
bilayer of the cell membrane not only through membrane perturbation
but also through activation of certain hormone- or steroid-sensitive
membrane receptors. This has been demonstrated for progesterone
and other steroids. Last but not least, it is known that hormones are
2o able to cross the cell membrane by diffusion. In the present invention,
the nucleic acid bound to the hormone-hormone receptor complex
should be transported through the membrane during the process of
diffusion or uptake.
Another aspect of the invention is a method of treating a blood
2s clotting disorder by administering a therapeutically effective amount
of the composition of matter of the invention to an organism. This
method involves the administration and dosage considerations already
discussed.
Embodiments (17) and (18) of the invention pertain to the use
of a steroid hormone for preparing an agent for gene therapy and/or
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
26
gene transfer and to method for gene therapy and/or gene transfer
which comprises administering a nucleic acid construct to an organism
or to a cellular system, wherein the nucleic acid construct contains a
transgene and is encapsulated in a steroid hormone. Suitable steroid
s hormones are enumerated hereinafter. The preferred steroid hormone
in said embodiments of the invention is a natural micronized steroid
hormone, in particular a natural micronized progesterone. In a
preferred embodiment, the micronized hormone is
solubilized/dispersed in a lipophilic matrix as described hereinafter.
to Experiments have been performed to illustrate the technical
aspects of the present invention. These experiments are described in
examples 1 to 9 below. The skilled artisan will be readily recognize
that the invention is not limited to these examples.
Is Examples
Example 1: Construction of Vectors
Production of the vector pTGFGi: The vector pUCl9 (MBI Fermentas)
Zo was digested with XbaI, treated with Klenow enzyme and religated.
This XbaI deleted vector was then digested with EcoRI, treated with
Klenow enzyme and religated in order to delete the EcoRI site. For
insertion of a XbaI site in the SacI site of this vector it was digested
with Sacl, treated with T4-polymerase, dephosphorylated with alkaline
Zs phosphatase and ligated with the XbaI-linker CTCTAGAG (Biolabs
#1032). Another XbaI-site was inserted by digesting the newly
produced vector with HindIII, treating it with Klenow,
dephosphorylating it with alkaline phosphatase and ligating it with the
XbaI-linker CTCTAGAG (Biolabs #1032). This vector was named
3o pUCl9/X.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
27
In order to destroy the XbaI-site present in the vector phGFP-
S65T (Clontech) this vector was digested with XbaI, treated with
Klenow enzyme and religated resulting in the vector pGFP/0. A 2.3 kb
fragment containing the GFP-Gene was isolated after digesting pGFP/0
s with MIuI, treating it with Klenow enzyme and digesting it with BamHI.
This fragment was inserted into the multiple cloning site of the vector
pUCl9/X which was digested with SaII, treated with Klenow enzyme
and digested with BamHI. The resulting vector was named pTGFGI
(Figure 2).
~o Starting with this vector all the vectors described in Table 1
were obtained. At the restriction sites for PstI, KpnI, Ehel, Eco0109
and/or SapI a PRE(ds) was inserted giving rise to plasmids carrying
the GFP gene and up to five PREs. By exchanging the GFP gene with a
FIX gene a set of FIX expression plasmids were obtained. By excising
is the GFP gene the cloning vectors without a transgene were obtained.
Production of the insert PRE(ds): The oligonucleotides (Metabion)
PRE-S (5'-GGG GTA CCA GCT TCG TAG CTA GAA CAT CAT GTT CTG
GGA TAT CAG CTT CGT AGC TAG AAC ATC ATG TTC TGG TAC CCC-3';
Zo SEQ ID NO: 3) and
PRE-AS (5'-GGG GTA CCA GAA CAT GAT GTT CTA GCT ACG AAG CTG
ATA TCC CAG AAC ATG ATG TTC TAG CTA CGA AGC TGG TAC CCC-3';
SEQ ID N0: 4)
were hybridized and phosphorylated by kinase reaction, resulting in
2s the insert PRE(ds).
Production of the vector pTGFGS: The vector pTGFGI was digested
with Eco0109I, treated with Klenow enzyme and dephosphorylated
with alkaline phosphatase. It was then ligated with the PRE(ds) insert,
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
28
resulting in the vector pTGFG5 (Figure 3), i.e., a vector which carries
a PRE at position C of Fig. 2.
Production of the vector pTGFG20: The vector pTGFGI was digested
s with KpnI, treated with T4-polymerise and dephosphorylated with
alkaline phosphatase. It was then ligated with the PRE(ds) insert,
resulting in the vector pTGFG7. This vector pTGFG7 was digested with
PstI, treated with T4-polymerise and dephosphorylated with alkaline
phosphatase. It was then ligated with the PRE(ds) insert, resulting in
~o the vector pTGFGI1. Subsequently, pTGFGli was digested with
Eco0109I, treated with Klenow enzyme and dephosphorylated with
alkaline phosphatase. It was then ligated with the PRE(ds) insert,
resulting in the vector pTGFG20 (Figure 4). This vector carries a PRE
at positions A, B and D of Fig. 2.
is
Production of the vector pTGFG33: In a similar manner PRE(ds) were
inserted at the restriction sites for PstI, KpnI, EheI, Eco0109 and SapI
in vector pTGFGi giving rise to the plasmid pTGFG33 (Figure 5),
which is a vector that carries the GFP gene and five PREs, one each in
Zo position A, B, C, D, E (Figure 2).
Production of the vectors hTGFG36, pTGFG53 and pTGFG64: The
vector pUCl9 (MBI Fermentas) was digested with SaII, treated with
Klenow enzyme and dephosphorylated with alkaline phosphatase. It
2s was ligated to the NotI-linker GCGGCCGC (Biolabs # 1045), resulting
in the vector pUCl9/N.
A 1.4 kb fragment containing the open reading frame of the
human clotting factor IX, isolated from a human cDNA library (see
example 2), was inserted into the PstI-site of the vector pUCl9/N
3o which was digested with PstI, treated with T4-polymerise and
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
?9
dephosphorylated with alkaline phosphatase. From the resulting
vector pUCl9/N-FIX a 1.4 kb fragment containing the open reading
frame of the human clotting factor IX was cut out by double-digestion
with Hind III and NotI. This fragment was ligated to the 4.3 kb
s fragment of the HindIII and NotI double-digested vector pTGFG5
resulting in the vector pTGFG36 shown in Figure 6. This vector is a
preferred one for delivery of Factor IX into the cell, and its DNA
sequence is provided in Figure 9 (SEQ ID NO: 1).
In a similar manner plasmids pTGFG53 and pTGFG64 (shown in
to Figures 7 and 8) were obtained by exchanging the GFP gene in
plasmids pTGFG20 and pTGFG33 by the FIX gene.
Production of the insert ALLG(ds): The oligonucleotides (Metabion)
ALLG1/1 (5'-AGC TTG ACC TCG AGC AAG C-3') (SEQ. ID NO: 5) and
ALLG2 (5'-GGC CGC TTG CTC GAG GTC A-3') (SEQ. ID N0: 6) were
is hybridized and phosphorylated by kinase reaction, resulting in the
inserts ALLG(ds). The insert ALLG (ds) was constructed to introduce
into the vector of choice a sequence with a multiple cloning site for
the possible introduction of other transgenes.
Table 1 gives an overview of the available vectors with different
ao transgenes and a different number of PREs in various positions. The
positions of the PREs are given according to Figure 2. For the
underlined vectors a map is provided (Figures 3 to 8).
Table 1: Vectors of the invention
PlasmidTrans-PRE Plasmid Trans-PRE Plasmid Trans- PRE
gene gene
gene
pTGFGO -_ -- pTGFG GFP BDE pTGFG34 FIX E
I 8
~TGFGI GFP -- pTGFGI9 GFP BCD pTGFG3s FIX A
pTGFG2 FIX -- 1~TGFG20GFP ABD pTGFG36 FIX D
pTGFG3 GFP E pTGFG21 GFP CDE pTGFG37 FIX C
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
pTGFG4 GFP A pTGFG22 GFP ACD pTGFG38 FIX B
pTGFGS GFP D pTGFG23 GFP ABC pTGFG53 FIX ABD
pTGFGG GFP C pTGFG24 GFP ABE pTGFGG4 F1X ABCDE
pTGFG7 GFP B pTGFG25 GFP ACE pTGFGGG -- A
pTGFG8 GFP BC pTGFG2G GFP ADE pTGFG67 -- D
pTGFG9 GFP BE pTGFG27 GFP BCE pTGFGG8 -- C
pTGFGIO GFP BD pTGFG28 GFP BCDE pTGFGG9 -- B
pTGFGII GFP AB pTGFG29 GFP ACDE pTGFG82 -- ABD
pTGFGI3 GFP CD pTGFG30 GFP ABCE pTGFG95 -- ABCDE
pTGFGl4 GFP AC pTGFG31 GFP ABDE
pTGFG GFP DE pTGFG32 GFP ABCD
15
pTGFG GFP AD pTGFG33 GFP ABCDE
1 G
For the DNA sequence of pTGFG 36, pTGFG 53, pTGFG 64, pTGFG 67,
pTGFG 82 and pTGFG 95, see SEQ ID NOs: i and 13 to 17,
respectively.
5
Example 2: Isolation of Human Factor IX cDNA
Factor IX cDNA was amplified from human liver cDNA (Clontech)
using two primers overlapping the start and termination codon of the
to factor IX open reading frame resulting in a 1387 by fragment
containing the entire open reading frame. Restriction sites for EcoRI
(upstream) and BamHI (downstream) were included at the end of
each primer to facilitate cloning. Amplification was performed with
Pwo polymerise (Boehringer Mannheim) in 50 ml reaction volume [10
Is mM Tris HCI pH 8.85, 25 mM KCI, 5 mM (NH4)2504, 2 mM MgS04]
with 30 incubation cycles at 96°C for 1 min, 60°C for i min,
72°C for
2 min, followed by a final extension step at 72°C for 10 min.
Reaction products were ligated into the EcoRI- and BamHI-sites
of pUCi9 and transformed into E, coli DH5-a. Positive clones were
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
31
selected. Sequences were confirmed by cycle sequencing (Amersham)
from both ends with labeled primers (IR-700) and automated analysis
on the LiCor sequencing system (MWG, Biotech).
The following primers were used
s GGAATTCCGCAAAGGTTATGCAGCGCGTGAACATGATCATGGC
(upstream; SEQ. ID N0: 7)
CGCGGATCCATTAAGTGAGCTTTGTTTTTTCCTTAATCC (downstream;
SEQ. ID NO: 8)
~o Example 3: Expression and Quantification of the Marker
Protein GFP
Method 1: HeLa cells were transfected by electroporation with
plasmids pTGFGS or pTGFG20. Transfected cells were harvested and
Is the cell pellets were homogenized and lysed in a buffer containing
phosphate buffered saline (pH 7.5) and 10 mM PMSF. The
concentration of green fluorescent protein (GFP) in the cell
homogenate was determined by competitive ELISA.
For this purpose, GFP was coated in a defined concentration on
Zo microtiter plates. Then, GFP samples were added in the presence of
anti-GFP antibody. After several washing steps a labeled secondary
antibody was added in order to trace the first antibody. The
colorimetric reaction was measured photometrically (extinction).
Generally, the more GFP was added the less antibody was left to bind
Zs the coated GFP. Thus, reduction of extinction corresponded to higher
GFP concentration in the sample.
A concentration curve of GFP was determined by linear
regression (Figure 11) using bovine serum albumin (BSA) as a
reference. A mean value of 2.4 mg GFP/ml for pTGFG5 (1 PRE) and
30 5.2 mg GFP/ml for pTGFG20 (3PREs) was found.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
32
Figures 12 a-d show micrographs of HeLa cell cultures
transfected with pTGFG5 (Fig. 12 a and b) and pTGFG20 (Fig. 12 c
and d), respectively. Figures 12 a and c represent light microscopic
views as controls, and Fig. 12 b and d show the corresponding cell
s patches in the fluorescent mode. Routinely, more than 50% of the
cells expressed GFP, indicating very efficient transfection, the
presence of only one PRE showing more efficient expression.
Method 2: 293 T cells were transfected with pTGFG 5, 20 and 33
~o using calcium phosphate method and fluorescence was detected with
a fluorimeter (Labsystems, Extinction: 485 nm Emission: 520 nm). In
the case of the mock transfection, non GFP-expressing DNA was used.
Background indicates the fluorescence of the empty plate (96-well
plate, Dynex, Immulon-4). The results are summarized in Fig. 13.
is Again the vector with just one PRE (pTGFGS) shows the highest
expression.
Example 4: Human Factor IX Quantification by ELISA Assay
Zo HeLa cells were transfected either by electroporation or using
liposome reagent DOTAP (Boehringer Mannheim) with plasmids
pTGFG36, pTGFG53 and pTGFG64. These plasmids contain the cDNA
of human clotting factor IX. Recombinant human factor IX was
secreted into the supernatant of the cell culture and quantified using a
as sandwich ELISA method.
0.11 M sodium citrate and 10 mM PMSF were added in order to
prevent degradation of human factor IX. The enzyme-immunological
in vitro assay "Asserachrom IX:AG" from Boehringer-Mannheim was
used in order to determine the concentration of expressed human
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
~J
clotting factor IX. The factor IX-standard from Octapharma AG was
used as a standard in aqueous solutions of 28 IU/ml.
In six different transfection experiments, in which HeLa cells
with plasmids containing human factor IX-cDNA (pTGFG36, 53 and
s 64) were transfected using either electroporation or lipid-transfection
reagent (DOTAP, Boehringer Mannheim), a concentration range of 3-
25 ng/ml human clotting factor IX was reached.
Example 5: Production and Purification of hPR (A Form)
~o
1. Cloning of the human ~rogesterone receptor' The cloning was
performed as follows: Total human RNA was isolated from human
white blood cells or liver cells using cell lysis in guanidinium
hydrochloride buffer and CsCI-density centrifugation.
is For cloning of the hPR coding sequence, hPR specific cDNA was-
prepared and used for amplification of the hPR coding sequence in two
fragments by PCR.
The following oligonucleotide primers were selected based on the
published mRNA sequence (Genbank: NM_000926 and X51730).
ao Oligonucleotides used were obtained from MWG, Ebersberg or
Metabion, Munchen. All primers used are listed 5' to 3', bases added
to introduce restriction sites are in capital letters and restriction sites
used for cloning are underlined.
hPGR-5'-primer: CGA GGA tcc agt cgt cat gac tga gc (SEQ ID NO: 9);
2s hPGR-3'-primer: GCA GAA TT cat tat aaa aac tca aga cct cat aat cct
gac (SEQ ID N0: 10);
hPGR-internal primer (Sal I) 1: ctc ctc ggg tc ac cct gg (SEQ ID NO:
11);
hPGR-internal primer (Sal I) 2: cca ggcLtc_g acc ccg agg ag (SEQ ID
3o NO: 12).
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
34
Synthesis of cDNA was perfomed using 3 pg of total RNA and 200
pmol of the 3'-primer with Superscript II reverse transcriptase (Gibco
BRL). Reaction volume was 50 pl and buffer was used as
s recommended, supplemented with RNase Inhibitor and 10 mM DTT
and 1 mM dNTPs. Before adding the enzyme, samples were heated to
80°C for 10 min, followed by. 10 min at 72°C and 10 min at
42°C.
Superscript II RT was added at 42°C and reaction was continued for
15 min at 42°C, 15 min at 50°C and 1 h at 58°C.
~o
The cDNA obtained from this synthesis reaction was used to amplify
the hPGR coding sequence in two fragments by PCR. One fragment
(5') with 5'-primer and internal primer 2 and one fragment (3') with 3'
primer and internal primer 1. Reaction setup in 50 pl was . Pwo
is polymerase (Roche Diagnostics), buffer as supplied by Roche
Diagnostics, supplemented with DMSO, 50 pmol of each primer and
0.2 mM dNTPs. Reaction conditions were: 10 min 96°C followed by 35
cycles of 1 min 96°C, 2 min at 59°C, 2 min 72°C and a
final extension
step at 72°C for 10 min.
PCR-products were purified by gel electrophoresis and digested with
Sal I. The BamHI and Hind III sites introduced in the primer were not
used to avoid cutting at two internal restriction sites of the hPR coding
sequence. Both fragments were ligated into pBluescript SK+ vector
2s cut with EcoRV through blunt end ligation into the vector and sticky
end ligation through the internal Sal I site. Vectors containing the
appropriate insert were identified by mini-prep, restriction digest and
sequencing. The obtained vector was designated pTGhPRI.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
2. Production of hPR (A-form: Initially, the gene for hPR-B inclusive
its 3 ~-UTR was cut out from pTGh PR1 and cloned in frame in the
multiple cloning site of the expression plasmid pFASTBAC HTc (BAC-
to-BAC Baculovirus Expression System, Life Technologies). This
s resulted in an expression casette of a N-terminally histidine-tagged
version of hPR-B under expression control of the viral polyhedrin
promotor as shown below. A rTEV protease cleavage site is located
between the six histidine residues and the initial methionine of the
hPR-B reading frame, which allows removal of the histidine residues
to from the expressed protein. The N-terminal region of the expression
cassettes is shown below.
MSYYHHHHHHDYDIPTTENLYFQ**GAMGIRNST-hPR-gen
6xHis
is spacer
rTEV cleavage site
Amino acids are presented in the single letter code. The cleavage site
of the rTEV protease is represented by **
In order to generate the expression cassette for the truncated hPR-A
form, the DNA sequence encoding for the amino acids between Met 1
and Met 165 of the hPR-B form was removed using a PCR-based
strategy. Two primer pairs were designed which allowed amplification
2s of either a DNA fragment just downstream of the start AUG of the
hPR-B gene and a DNA-fragment just upstream of the AUG coding for
Met 165, respectively. In a subsequent PCR reaction these two DNA
fragments were annealed to each other at their homologous 3'-ends,
and amplified using the outermost amplification primers. The resulting
3o DNA-fragment was digested by EcoRI and Mlu I and the cleavage
product was exchanged against the corresponding fragment of the
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
3G
hPR-B expression cassette in the pFASTBAC HTc vector. Thereby the
reading frame coding for an N-terminal histidine tagged version of the
hPR-A polypeptide (94kDA) was restored.
This 6xHis-tag was utilised for affinity purification of the protein
s by immobilized cobalt2+ affinity chromatography on a TALON° resin
(Clontech). The procedure, following the method of
Boonyaratanakornkit et al. Mol. Cell. Biol.l8, 4471 (1998), was as
follows (all steps were carried out at 0 to 8°C):
Sf9 cells were cultivated in monolayer culture in serum free SF900
io medium. Viral infection of the cells was done at a multiplicity of
infection (MOI) of 5-8.
The harvesting was done 48 hours after infection with baculovirus
containing the hPR expression cassette and lysed mechanically by
homogenising in buffer A containing 20 m~1 Tris-CI pH 8.0, 350 mM
is NaCI, 10 mM imidazol, 5% glycerol and a cocktail of proteinase
inhibitors (CompIeteTM EDTA-free, Roche Diagnostics, Penzberg,
Germany). After a 10 min centrifugation at 10000 x g, supernatant
originating from 10$ cells was incubated for 1 h with 0,5 ml settled
TALON° resin equilibrated in buffer A. TALON° was washed
with 20
2o volumes of buffer A. hPR-A was eluted with 10 Vol buffer B, containing
all ingredients of buffer A, but 100 mM imidazol. The eluate was
concentrated 50-fold and dialysed against 100 volumes buffer C (PBS
+ 100 nM progesteron) by centrifugal ultrafltration at a molecular
exclusion size of 10 kDa (Centricon Plus-20 PL-10, Millipore, Eschborn,
2s Germany).
3. Determination of identity, purity and yield of hPR-A' Purity and
yield of the product were determined by application on denaturing
reducing polyacrylamid- gelelectrophoresis according to Laemmli, U.
3o et al., Nature 227, 680-685 (1970) and subsequent staining with
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
37
coomassie° blue 8250. By this one-step procedure hPR-A was
enriched to a final specific hPR content of 0.2 - 0.5 mg hPR/mg
protein. As depicted in Figure 15, lane A, the final preparation
consisted predominantly of two distinct protein species displaying
s apparent molecular masses of 94 and 74 kDa (Fig. 15, arrows).
Yield was estimated by parallel separation of standardised
protein preparations. Data taken from a set of three separate
experiments hint at a typical yield of 30 pg enriched hPR A-receptor
per 10$ cells.
~o Identity of hPR was determined by immunodetection of the
product transferred to nitrocellulose by western blotting with mouse
monoclonal antibodies directed against recombinant hPR (PR Ab-1,
Oncogene, Cambridge, MA, USA).
The final product was transferred to nitrocellulose BA-83 and
Is immunostained as described above. As presented in Figure 15, lane C,
three major protein bands were detected, including the two dominant
protein species described above. The smaller sized bands may display
copurified proteolytic fragments of hPR.
Intracellular GFP from adherent cells was detected by a
2o fluorimeter after media was taken off and PBS (colourless) was added.
The results are summarized in Fig. 13.
Example 6: Clotting Activity of Human Clotting Factor IX from
Transfected 293 T Cells
A concentration range of 55 - 95 ng/ml human clotting factor IX has
been reached by transfection of 293 T-cells with plasmids containing
human factor IX-cDNA (pTGFG 36, 53, 64 and 2) in 11 different
experiments using ELISA (Example 4).
3o Clotting activity was deterined with a partial thromboplastin time
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
38
assay using Cephalin (phosphatidyl ethanolamine) activation with a
manual coagulation instrument (ML-2, Instrumentation Laboratories).
For the study, 100 pl undiluted supernatant from transfected 293 T-
cells, 100 pl deficiency plasma (Progeny and 100 pl Cephalin
s (Instrumentation Laboratories) were incubated for 5 minutes at 37°C.
Coagulation was started by adding 100 NI CaCl2. Sample coagulation
time was compared to normal plasma.
Number of cells Factor IX-concentrationClotting time
/ml n /ml s
2,1 x 105 36 45
8,7 x 105 20 79
~o Normal plasma: 37 - 39 s
Factor IX deficient plasma: 137 - 140 s
Example 7: Analysis of an Additive Effect of Human Clotting
Factor IX on the Clotting Time of Mice Blood
IS
1. Clotting time: Clotting activity was determined with a partial
thromboplastin time assay using Cephalin (phosphatidyl
ethanolamine) activation with a manual coagulation instrument (KC 4
A, Amelung).
2o For the study, 5 NI mouse blood, 20 pl deficiency plasma (Progeny ad
100 III physiological NaCI and 100 pl DaPPTin (Progeny were incubated
for 2 minutes at 37°C. Coagulation was started by adding 100 pl
CaCl2.
To analyse the additive effect, human clotting factor IX
Zs (housestandard, Octapharma) was added to the mouse blood and
diluted 1:10 within the system. As it is shown in Figure 15, the
additive effect of human clotting factor IX on clotting activity can be
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
39
detected up to a limit concentration of 0,07 mIU hFIX/ml (= 31,5
ng/ml).
2. ELISA: The addition of human clotting factor IX to the mouse blood
~s was monitored by ELISA as described in Example 4. Citrate plasma
was made out of mouse blood and human clotting factor IX was added
in different concentrations.
NO. Description Concentration Extinction at 405
[mIU/ml] hFIX addednm [-]
1. Mouse Citrate Plasma 7 0,204
2. Mouse Citrate Plasma 2 0,130
3. Mouse Citrate Plasma - 0,099
4. Control: 1.+2. Antibody - 0,096
without antigen
5. Control: 1. Antibody - 0,072
without antigen
6. Control: 2. Antibody - 0,085
without antigen
7. Substrate (ABTS) - 0,072
Io Mouse plasma without the addition of human clotting factor IX showed
an extinction of 0,099 at 405 nm background. When added human
factor IX in a concentration of 2 mIU/ml (= 9 ng/ml human factor IX)
the detection limit is reached. It can be deduced that the antihuman
factor IX antibodies used in the ELISA are not cross-reactive with
is mouse coagulation factor IX.
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
Example 8: Cloning and Activity Testing of the Human
Progesterone Receptor (hPR)
2. Activity Testing: The human progesterone receptor encoded in
s plasmid pTGhPRi (s. Example 8.1 above) was tested for its
phyiological activity. In a functional form and after activation with a
progestin like 85020 the receptor should be able to induce the
expression of luciferase from a Mouse Mammary Tumor Virus (MTV)
promoter.
~o To test this 293T cells were grown in phenol red-free DMEM
supplemented with 10% charcoal-filtrated fetal calf serum and with or
without 10 nM of 85020 (NEN) in 6 well plates. Transfections were
performed by the calcium phosphate method using 2 pg of a pSG-
hPRi constructt and pMTV-luc (Hollenberg et al., 1985, Cell 55, p899-
~s 906) per well. One day after transfection the cells were washed in PBS
and the luciferase expression assayed with the Berthold luciferase kit
according to the manufacturer's directions in a fluorimeter
(Labsystems). The controls were as follows: 85020 was omitted
(PR+MTV) and both plasmids alone were transfected with (PR+85020,
2o MTV+85020) and without 85020 (PR, MTV). As positive control a
plasmid with a CMV-driven luciferase gene was transfected (pCMV-
luc).
As can be seen in Figure 19, there is a clear induction of
luciferase expression when all the necessary elements are present,
2s that is human progesterone receptor, progestin 85020 and the MTV-
driven luciferase gene (PR+MTV+85020). The error bars give the
standard deviation of a threefold experiment, the readout is relative
light units (RLU).
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
41
Example 9: Oral Gene Transfer in in vivo Animal Experiment
Purpose of experiment: The object of this pilot study is to prove oral
gene transfer in an in vivo animal experiment. Successful gene transfer
is established by coagulation measurement: an additive effect of
s expressed human factor IX on the coagulation time of healthy murine
whole blood is expected. The presence of expression of human factor IX
in mouse blood is quantitated by ELISA.
Animals: The animals employed are 35 male C57BL/6J mice from Iffa
~o Credo, France, with an initial age of 9 weeks and a weight of 23-33 g.
The mice are kept in groups of 7 animals each in conventional test
animal cages with wooden chips in the Institut fur Experimentelle
Onkologie and Therapieforschung der Technischen Universitat
Munchen.
~s The animals are fed ad libitum with "Altrum Ratten and Mause
Haltung" and are given tap water, also ad libitum.
The test animal cages are kept at an ambient temperature of 19-
24°C and a humidity of 55 5%. The room is additionally provided with
an automatic light supply which maintains a 12 hours rhythm.
Zo The test animals are supervised by specialized staff.
Mixture of substances:
Group Hormone Hormone Plasmid Aqua dest.Route of
receptor administration
1.-
2. - 100 NI 10 pg oral
3. - 10 pg 100 NI oral
4. - 10 Ng 50 pl i.m.
5. - 100 pl 4.35 Ng 10 pg oral
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
43
Plasmid and hPR: Theragene GmbH
Hormone: Utrogest° by Dr. Kade/Besins Pharma GmbH,
Rigistr. 2, D-12277 Berlin
Aqua dest.: Aqua ad injectabilia Delta-Pharma GmbH, 72793
s Pfullingen
Esophageal sound: Vein catheter, diam. 0.5 x 0.9 mm,
Lot 7077 62221, B. Braun Melsungen AG, Western
Germany
i.m. injection: Micro-Fine 12.7 mm, Becton Dickinson GmbH,
~o Tullastr. 8-12, D-69126 Heidelberg
Course of experiment: The 35 mice were divided into 5 groups of 7
mice each. One group serves as a control, the second group was daily
administered a total of 100 pl of hormone and plasmid via the gastro-
intestinal tract orally with an esophageal sound, the third group was
~s daily administered a total of 100 pl of plasmid with aqua dest. orally
with an esophageal sound, the fourth group was administered a total of
50 NI of plasmid with aqua dest. i.m. into the musculus quadriceps
femoris, the fifth group was daily administered a total of 100 pl of
hormone, hormone receptor and plasmid orally with an esophageal
ao sound.
About 2-3 hours before the manipulation, the mice were
prewarmed under a red light. Immediately before, during and after the
manipulation, the mice were examined and supervised by a
veterinarian.
2s Blood sampling from the mice was performed daily from the
caudal artery of animals slightly sedated by inhalation anesthesia. For
this purpuse the artery was punctured with a disposable injection
cannula (0.90 x 40 mm). Whole blood welling out of the puncture site
(5 pl of blood) was immediately collected with an Eppendorf pipette.
3o Without further delay, the blood coagulation time in seconds was
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
43
determined using an Amelung-Koagulometer KC 4A by means of an
aPTT assay (activated partial thromboplastin time). The blood
coagulation analysis was always performed by the same person.
Immediately after the blood sampling, the bleeding was stopped by
s compression.
Sedation of the mice was achieved by inhalation anesthesia
(active substance: isoflurane: Forene , Abbott GmbH, 65205
Wiesbaden, Western Germany) in a whole body chamber.
The daily manipulation was performed through an overall period of 7
to days. This was followed by a day (day 8 of experiment) without any
manipulation, and at day 9 of experiment, again 5 pl of whole blood
was withdrawn from the ventral caudal artery under anesthesia, and
the coagulation time established as described above. Further, 0.5
0.75 ml of whole blood was collected intracardially using U-40 insulin
is syringes (Mikro-Fine 12.4.mm) filled with 50-75 pl of sodium citrate-
(3.1%), transferred into Eppendorf cuvettes, and about 100 pl of whole
blood with citrate was reserved for PCR examination and stored in a
cool environment. The remaining citrate blood was centrifuged for
min using a centrifuge 6000 rpm, 4°C, at 5000 rpm, and the plasma
was recovered for the ELISA determination of the factor IX
concentration.
Then, the animals were sacrificed using 0.5 ml Narkoren i.p.
Immediately after the sacrificing, the animal bodies were dissected.
The following organs were removed from the mice for an
2s immunohistochemical examination: brain, spleen, liver, kidneys, testes,
lungs, m. quadriceps femoris, heart, appendix; and frozen at -80°C.
Deviation from the scheduled experimental course' Due to the poor
general condition of the mice in the course of the long-term
3o administration series, the administration had to be interrupted at days
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
44
3 (except one mouse) and 5 for test group 2 (hormone and plasmid), at
days 3 and 5 for group 5 (hormone, hormone receptor and plasmid),
and two mice were additionally spared the administration of the
reagents at days 2 and 7 of the experiment.
s The poor general condition is accounted for by the hypnotic effect
of the hormone progesterone. It causes the mice to sleep for about 24
hours without eating and drinking. This again has an adverse effect on
the water balance of the mice, resulting in exsiccotic phenomena and
apathic behavior. Therefore, the mice were prophylactically treated with
~o a subcutaneous administration of 1 ml of 5% glucose solution (Delta
Pharma GmbH, 72793 Pfullingen) and 1 ml of Ringer solution (Delta
Pharma GmbH, 72793 Pfullingen) when the hormone was administered
orally. Among the group which was orally administered hormone,
hormone receptor and plasmid, two mice died at days 3 and 6,
is respectively; they were dissected.
Among the group which was orally administered hormone with
plasmid, one mouse was found dead in its cage on day 8 of the
experiment; it was also dissected.
The results are summarized in Figures 17 and 18. The statistical
Zo evaluations were performed according to the generalized linear model
with repeated measurements (MANOVA with repeated measurements).
In none of the test groups a non-linear course was observed.
Therefore, the course was calculated by a simple representation of the
linear increase or decrease, namely initial value minus final value per
Zs mouse. The particularly interesting difference between the control and
the group "plasmid in the hormone with hormone receptor" (group 5)
was examined using a T test for independent random samples.
Figure 17 shows the mean values of the calculated differences: In
the control, for example, this difference was about 50 seconds. The
3o vertical lines show plus and minus one standard deviation from these
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
4>
values. The T test is based both on the differences between the mean
values and on the degree of overlapping which can be seen from these
lines: The larger the overlapping, the less is the significance of the
mean value differences. Thus, the groups "control" and "plasmid and
water i.m." (groups 1 and 5, respectively) are distinguished in a purely
numerical way in the mean value, but the degree of overlapping is so
high that these groups are not significantly different.
The only significant difference was between group 1 and 5: The
decrease of the tatter is significantly higher than that of the control (T =
~o -2.357; d.f. = 12; p < 0.05).
The following Tables contain the concluding statistics and the
results of the statistical tests (T test) performed on the differences
between the mean values obtained in the course of the test:
is Group statistics
ADMIN N mean valuestandard standard error
of
deviationthe mean value
DIF control 7 47.3857 58.9946 22.2978
Hormone, hormone receptor 7 114.7571 47.3300 17.8891
and plasmid orally
CA 02362970 2001-08-16
~'~'O 00/49147 PCT/EP00/01368
46
Test for independent random samples
Levene T
test test
for for
equal
mean
values
equal
variance
F SignifiT df sig. mean standard95%
(2-sided) error confidence
interval
cance differenceof differenceof difference
lower upper
DIF variances0.0260.874-2.35712 0.036 -67.371428.5869 -129.6570-5.0858
are
equal
Variances -2.35711.4610.037 -67.371428.5869 -129.9833-4.7596
are not equal
The human F IX was also detectable in the treated mice of the
"hormone-hormone reception and plasmid orally group using an Elisa
s as described in Example 4.
CA 02362970 2001-08-16
FOR THE PURPOSES OF INFORMATION ONLY
Codes used to identify States party to the PCT on the front pages of pamphlets
publishing international applications under the PCT.
AL Albania ES Spain LS Lesotho SI Slovenia
AM Armenia FI Finland LT Lithuania SK Slovakia
AT Austria FR France LU Luxembourg SN Senegal
AU Australia GA Gabon LV Latvia SZ Swaziland
AZ Azerbaijan GB United KingdomMC Monaco TD Chad
BA Bosnia and GE Georgia MD Republic of TG Togo
Herzegovina Moldova
BB Barbados GH Ghana MG Madagascar TJ Tajikistan
BE Belgium GN Guinea MK The former TM Turkmenistan
Yugoslav
BF Burkina Faso GR Greece Republic of TR Turkey
Macedonia
BG Bulgaria HU Hungary ML Mali TT Trinidad
and Tobago
BJ Benin IE Ireland MN Mongolia UA Ukraine
BR Brazil IL Israel MR Mauritania UG Uganda
BY Belarus IS Iceland MW Malawi US United States
of America
CA Canada IT Ttaly MX Mexico UZ Uzbekistan
CF Central AfricanJP Japan NE Niger VN Viet Nam
Republic
CG Congo KE Kenya NL Netherlands YU Yugoslavia
CH Switzerland KG Kyrgyzstan NO Norway ZW Zimbabwe
CI Cdte d'IvoireKP Democratic NZ New Zealand
People's
CM Cameroon Republic of PL Poland
Korea
CN China KR Republic of PT Portugal
Korea
CU Cuba KZ Kazakstan RO Romania
CZ Czech RepublicLC Saint Lucia RU Russian Federation
DE Germany LI LiechtensteinSD Sudan
DK Denmark LK Sri Lanka SE Sweden
EE Estonia LR Liberia SG Singapore
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
1
SEQUENCE LISTING
<110> Theragene dical Laboratories
Biome GmbH
<120> Hormone-HormoneReceptor cid
Complexes
and Nucleic
A
Constructs and Their Use n Gene
i Therapy
<130> 000065wo/JH/ml
10<140>
<141>
<160> 19
15<170> PatentIn Ver..1
2
<210> 1
<211> 5753
20<212> DNA
<213> Artificial ence
Sequ
<220>
<223> Description ArtificialSequence:ector
of v pTGFG36
25
<220>
<221> CDS
<222> (689)..(2071)
30<400> 1
cgcgttgaca ttgattattgactagttattaatagtaatcaattacggggtcattagttc60
atagcccata tatggagttccgcgttacataacttacggtaaatggcccgcctggctgac120
35cgcccaacga cccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa180
tagggacttt ccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcag240
tacatcaagt gtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc300
40
ccgcctggca ttatgcccagtacatgaccttatgggactttcctacttggcagtacatct360
acgtattagt catcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtg420
45gatagcggtt tgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt480
tgttttggca ccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattga540
cgcaaatggg cggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaa600
SO
ctagagaacc cactgcttactggcttatcgaaattaatacgactcactatagggagaccc660
aagcttgcat gccaattccgcaaaggtt tg cag gtg aac atc atg 712
a cgc atg
M et Gln Val Asn Ile Met
Arg Met
55 1 5
gca gaa tca cca ggc ctc atc acc atc tgc ctt tta gga tat cta ctc 760
Ala Glu Ser Pro Gly Leu Ile Thr Ile Cys Leu Leu Gly Tyr Leu Leu
15 20
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
2
agt get gaa tgt aca gtt ttt ctt gat cat gaa aac gcc aac aaa att 808
Ser Ala Glu Cys Thr Val Phe Leu Asp His Glu Asn Ala Asn Lys Ile
25 30 35 40
ctg aat cgg cca aag agg tat aat tca ggt aaa ttg gaa gag ttt gtt 856
Leu Asn Arg Pro Lys Arg Tyr Asn Ser Gly Lys Leu Glu Glu Phe Va1
45 50 55
caa ggg aac ctt gag aga gaa tgt atg gaa gaa aag tgt agt ttt gaa 904
Gln Gly Asn Leu Glu Arg Glu Cys Met Glu Glu Lys Cys Ser Phe Glu
60 65 70
gaa gca cga gaa gtt ttt gaa aac act gaa aga aca act gaa ttt tgg 952
Glu Ala Arg Glu Val Phe Glu Asn Thr Glu Arg Thr Thr Glu Phe Trp
75 80 85
aag cag tat gtt gat gga gat cag tgt gag tcc aat cca tgt tta aat 1000
Lys Gln Tyr Val Asp Gly Asp Gln Cys Glu Ser Asn Pro Cys Leu Asn
90 95 100
ggc ggc agt tgc aag gat gac att aat tcc tat gaa tgt tgg tgt ccc 1048
Gly Gly Ser Cys Lys Asp Asp Ile Asn Ser Tyr Glu Cys Trp Cys Pro
105 110 115 120
ttt gga ttt gaa gga aag aac tgt gaa tta gat gta aca tgt aac att 1096
Phe Gly Phe Glu Gly Lys Asn Cys Glu Leu Asp Val Thr Cys Asn Ile
125 130 135
aag aat ggc aga tgc gag cag ttt tgt aaa aat agt get gat aac aag 1144
Lys Asn Gly Arg Cys Glu Gln Phe Cys Lys Asn Ser Ala Asp Asn Lys
140 145 150
gtg gtt tgc tcc tgt act gag gga tat cga ctt gca gaa aac cag aag 1192
Val Val Cys Ser Cys Thr Glu Gly Tyr Arg Leu Ala Glu Asn Gln Lys
155 160 165
tcc tgt gaa cca gca gtg cca ttt cca tgt gga aga gtt tct gtt tca 1240
Ser Cys Glu Pro Ala Val Pro Phe Pro Cys Gly Arg Val Ser Val Ser
170 175 180
caa act tct aag ctc acc cgt get gag act gtt ttt cct gat gtg gac 1288
Gln Thr Ser Lys Leu Thr Arg Ala Glu Thr Val Phe Pro Asp Val Asp
185 190 195 200
tat gta aat tct act gaa get gaa acc att ttg gat aac atc act caa 1336
Tyr Val Asn Ser Thr Glu Ala Glu Thr Ile Leu Asp Asn Ile Thr Gln
205 210 215
agc acc caa tca ttt aat gac ttc act cgg gtt gtt ggt gga gaa gat 1384
Ser Thr Gln Ser Phe Asn Asp Phe Thr Arg Val Val Gly Gly Glu Asp
220 225 230
gcc aaa cca ggt caa ttc cct tgg cag gtt gtt ttg aat ggt aaa gtt 1432
Ala Lys Pro Gly Gln Phe Pro Trp Gln Val Val Leu Asn Gly Lys Val
235 240 245
gat gca ttc tgt gga. ggc tct atc gtt aat gaa aaa tgg att gta act 1480
Asp Ala Phe Cys Gly Gly Ser Ile Val Asn Glu Lys Trp Ile Val Thr
250 255 260
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
3
get gcc cac tgt gtt gaa act ggt gtt aaa att aca gtt gtc gca ggt 1528
Ala Ala His Cys Val Glu Thr Gly Val Lys Ile Thr Val Val Ala Gly
265 270 275 280
gaa cat aat att gag gag aca gaa cat aca gag caa aag cga aat gtg 1576
Glu His Asn Ile Glu Glu Thr Glu His Thr Glu Gln Lys Arg Asn Val
285 290 295
att cga att att cct cac cac aac tac aat gca get att aat aag tac 1624
Ile Arg Ile Ile Pro His His Asn Tyr Asn Ala Ala Ile Asn Lys Tyr
300 305 310
aac cat gac att gcc ctt ctg ga.a ctg gac gaa ccc tta gtg cta aac 1672
Asn His Asp Ile Ala Leu Leu Glu Leu Asp Glu Pro Leu Val Leu Asn
315 320 325
agc tac gtt aca cct att tgc att get gac aag gaa tac acg aac atc 1720
Ser Tyr Val Thr Pro Ile Cys Ile Ala Asp Lys Glu Tyr Thr Asn Ile
330 335 340
ttc ctc aaa ttt gga tct ggc tat gta agt ggc tgg gga aga gtc ttc 1768
Phe Leu Lys Phe Gly Ser Gly Tyr Val Ser Gly Trp Gly Arg Val Phe
345 350 355 360
cac aaa ggg aga tca get tta gtt ctt cag tac ctt aga gtt cca ctt 1816
His Lys Gly Arg Ser Ala Leu Val Leu Gln Tyr Leu Arg Val Pro Leu
365 370 375
gtt gac cga gcc aca tgt ctt cga tct aca aag ttc acc atc tat aac 1864
Val Asp Arg Ala Thr Cys Leu Arg Ser Thr Lys Phe Thr Ile Tyr Asn
380 385 390
aac atg ttc tgt get ggc ttc cat gaa gga ggt aga gat tca tgt caa 1912
Asn Met Phe Cys Ala Gly Phe His Glu Gly Gly Arg Asp Ser Cys Gln
395 400 405
gga gat agt ggg gga ccc cat gtt act gaa gtg gaa ggg acc agt ttc 1960
Gly Asp Ser Gly Gly Pro His Val Thr Glu Val Glu Gly Thr Ser Phe
410 415 420
tta act gga att att agc tgg ggt gaa gag tgt gca atg aaa ggc aaa 2008
Leu Thr Gly Ile Ile Ser Trp Gly Glu Glu Cys Ala Met Lys Gly Lys
425 430 435 440
tat gga ata tat acc aag gta tcc cgg tat gtc aac tgg att aag gaa 2056
Tyr Gly Ile Tyr Thr Lys Val Ser Arg Tyr Val Asn Trp Ile Lys Glu
445 450 455
aaa aca aag ctc act taatgggatc ggtcgagcgg ccgcgactct actagaggat 2111
Lys Thr Lys Leu Thr
460
ctttgtgaag gaaccttact tctgtggtgt gacataattg gacaaactac ctacagagat 2171
ttaaagctct aaggtaaata taaaattttt aagtgtataa tgtgttaaac tactgattct 2231
aattgtttgt gtattttaga ttccaaccta tggaactgat gaatgggagc agtggtggaa 2291
tgcctttaat gaggaaaacc tgttttgctc agaagaaatg ccatctagtg atgatgaggc 2351
tactgctgac tctcaacatt ctactcctcc aaaaaagaag agaaaggtag aagaccccaa 2411
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
4
ggactttcct tcagaattgc taagtttttt gagtcatgct gtgtttagta atagaactct 2471
tgcttgcttt gctatttaca ccacaaagga aaaagctgca ctgctataca agaaaattat 2531
S ggaaaaatat tctgtaacct ttataagtag gcataacagt tataatcata acatactgtt 2591
ttttcttact ccacacaggc atagagtgtc tgctattaat aactatgctc aaaaattgtg 2651
tacctttagc tttttaattt gtaaaggggt taataaggaa tatttgatgt atagtgcctt 2711
gactagagat cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc 2771
tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt 2831
1S ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 2891
catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg 2951
tctggatccc cgggtaccct ctagagcgaa ttaattcact ggccgtcgtt ttacaacgtc 3011
gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat ccccctttcg 3071
ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc 3131
2S tgaatggcga atggcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac 3191
accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagcccc 3251
gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt 3311
acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac 3371
cgaaacgcgc gagacgaaag ggggggtacc agcttcgtag ctagaacatc atgttctggg 3431
3S atatcagctt cgtagctaga acatcatgtt ctggtacccc cctcgtgata cgcctatttt 3491
tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa 3551
atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 3611
tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc 3671
aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc 3731
acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt 3791
acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt 3851
ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg 3911
SO
ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact 3971
caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg 4031
SS ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga 4091
aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg 4151
aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa 4211
tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac 4271
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc 4331
cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca 4391
5 ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga 4451
gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta 4511
agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc 4571
atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc 4631
cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt 4691
cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 4751
cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct 4811
tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact 9871
tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg 4931
ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata 4991
aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga 5051
cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag 5111
ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 5171
agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac 5231
ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca 5291
acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg 5351
cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc 5411
gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa 5471
tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt 5531
ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag ctcactcatt 5591
aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg 5651
gataacaatt tcacacagga aacagctatg accatgatta cgccaagctc tctagagctc 5711
tagagctcta gagctctaga gagcttgcat gcctgcaggt cg 5753
<210> 2
<211> 461
<212> PRT
<213> Artificial Sequence
<223> Description of Artificial Sequence: vector pTGFG36
<400> 2
Met Gln Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr
1 5 10 15
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
6
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys Thr Val Phe Leu
20 25 30
Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro Lys Arg Tyr Asn
35 40 45
Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg Glu Cys
50 55 60
Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe Glu Asn
65 70 75 80
Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly Asp Gln
85 90 95
Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp Asp Ile
100 105 110
Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys Asn Cys
115 120 125
Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu Gln Phe
130 135 140
Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr Glu Gly
145 150 155 160
Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val Pro Phe
165 170 175
Pro Cys GlyArgVal SerValSer GlnThrSer LysLeuThr ArgAla
180 185 190
Glu Thr ValPhePro AspValAsp TyrValAsn SerThrGlu AlaGlu
195 200 205
Thr Ile LeuAspAsn IleThrGln SerThrGln SerPheAsn AspPhe
210 215 220
Thr Arg ValValGly GlyGluAsp AlaLysPro GlyGlnPhe ProTrp
225 230 235 240
Gln Val ValLeuAsn GlyLysVal AspAlaPhe CysGlyGly SerIle
245 250 255
Val Asn GluLysTrp IleValThr AlaAlaHis CysValGlu ThrGly
260 265 270
Val Lys IleThrVal ValAlaGly GluHisAsn IleGluGlu ThrGlu
275 280 285
His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His His Asn
290 295 300
SS Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu Leu Glu
305 310 315 - 320
Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile Cys Ile
325 330 335
Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser Gly Tyr
340 345 350
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
7
Val Ser Trp Gly ValPheHisLys GlyArgSer AlaLeuVal
Gly Arg
355 360 365
Leu Gln Leu Arg ProLeuValAsp ArgAlaThr CysLeuArg
Tyr Val
370 375 380
Ser Thr Phe Thr TyrAsnAsnMet PheCysAla GlyPheHis
Lys Ile
38.5 390 395 400
Glu Gly Arg Asp CysGlnGlyAsp SerGlyGly ProHisVal
Gly Ser
405 410 415
Thr Glu Glu Gly SerPheLeuThr GlyIleIle SerTrpGly
Val Thr
420 425 43C
Glu Glu Ala Met GlyLysTyrGly IleTyrThr LysValSer
Cys Lys
435 440 445
20Arg Tyr Asn Trp LysGluLysThr LysLeuThr
Val Ile
450 455 460
<210> 3
25<211> 78
<212> DNA
<213> Homo Sapiens
<400> 3
30ggggtaccag cttcgtagct gttctgggat atcagcttcg tagctagaac
60
agaacatcat
atcatgttct ggtacccc 7g
<210> 4
35<211> 78
<212> DNA
<213> Homo Sapiens
<400> 4
40ggggtaccag aacatgatgt aagctgatat cccagaacat gatgttctag
60
tctagctacg
ctacgaagct ggtacccc 7g
<210> 5
45<211> 19
<212> DNA
<213> Homo Sapiens
<400> 5
50agcttgacct cgagcaagc 19
<210> 6
<211> 19
55<212> DNA
<213> Homo sapiens
<400> 6
ggccgcttgc tcgaggtca lg
60
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
8
<210> 7
<211> 43
<212> DNA
<213> Homo sapiens
<400> 7
ggaattccgc aaaggttatg cagcgcgtga acatgatcat ggc 43
<210> 8
<211> 39
<212> DNA
<213> Homo Sapiens
<400> 8
cgcggatcca ttaagtgagc tttgtttttt ccttaatcc 39
<210> 9
<211> 26
<212> DNA
<213> Homo Sapiens
<400> 9
cgaggatcca gtcgtcatga ctgagc 26
<210> 10
<211> 41
<212> DNA
<213> Homo sapiens
<400> 10
gcagaattca ttataaaaac tcaagacctc ataatcctga c 41
<210> 11
<211> 20
<212> DNA
<213> Homo Sapiens
<400> 11
ctcctcgggg tcgaccctgg 20
<210> 12
<211> 20
<212> DNA
<213> Homo sapiens
<400> 12
ccagggtcga ccccgaggag 20
<210> 13
<211> 5905
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector pTGFG53
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
9
<400> 13
cgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttc60
atagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgac120
cgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa180
tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcag240
tacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc300
ccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatct360
acgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtg420
gatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt480
tgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattga540
cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaa600
ctagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagaccc660
aagcttgcatgccaattccgcaaaggt.tatgcagcgcgtgaacatgatcatggcagaatc720
accaggcctcatcaccatctgccttttaggatatctactcagtgctgaatgtacagtttt780
tcttgatcatgaaaacgccaacaaaattctgaatcggccaaagaggtataattcaggtaa840
attggaagagtttgttcaagggaaccttgagagagaatgtatggaagaaaagtgtagttt900
tgaagaagcacgagaagtttttgaaaacactgaaagaacaactgaattttggaagcagta960
tgttgatggagatcagtgtgagtccaatccatgtttaaatggcggcagttgcaaggatga1020
cattaattcctatgaatgttggtgtccctttggatttgaaggaaagaactgtgaattaga1080
tgtaacatgtaacattaagaatggcagatgcgagcagttttgtaaaaatagtgctgataa1140
caaggtggtttgctcctgtactgagggatatcgacttgcagaaaaccagaagtcctgtga1200
accagcagtgccatttccatgtggaagagtttctgtttcacaaacttctaagctcacccg1260
tgctgagactgtttttcctgatgtggactatgtaaattctactgaagctgaaaccatttt1320
ggataacatcactcaaagcacccaatcatttaatgacttcactcgggttgttggtggaga1380
agatgccaaaccaggtcaattcccttggcaggttgttttgaatggtaaagttgatgcatt1440
ctgtggaggctctatcgttaatgaaaaatggattgtaactgctgcccactgtgttgaaac1500
tggtgttaaaattacagttgtcgcaggtgaacataatattgaggagacagaacatacaga1560
gcaaaagcgaaatgtgattcgaattattcctcaccacaactacaatgcagctattaataa1620
gtacaaccatgacattgcccttctggaactggacgaacccttagtgctaaacagctacgt1680
tacacctatttgcattgctgacaaggaatac-acgaacatcttcctcaaatttggatctgg1-7-40
ctatgtaagtggctggggaagagtcttccacaaagggagatcagctttagttcttcagta1800
ccttagagttccacttgttgaccgagccacatgtcttcgatctacaaagttcaccatcta1860
taacaacatgttctgtgctggcttccatgaaggaggtagagattcatgtcaaggagatag1920
tgggggaccccatgttactgaagtggaagggaccagtttcttaactggaattattagctg1980
gggtgaagagtgtgcaatgaaaggcaaatatggaatatataccaaggtatcccggtatgt2040
caactggattaaggaaaaaacaaagctcacttaatgggatcggtcgagcggccgcgactc2100
tactagaggatctttgtgaaggaaccttacttctgtggtgtgacataattggacaaacta2160
cctacagagatttaaagctctaaggtaaatataaaatttttaagtgtataatgtgttaaa2220
ctactgattctaattgtttgtgtattttagattccaacctatggaactgatgaatgggag2280
cagtggtggaatgcctttaatgaggaaaacctgttttgctcagaagaaatgccatctagt2340
gatgatgaggctactgctgactctcaacattctactcctccaaaaaagaagagaaaggta2400
gaagaccccaaggactttccttcagaattgctaagttttttgagtcatgctgtgtttagt2460
'
aatagaactcttgcttgctttgctatttacaccacaaaggaaaaagctgcactgctatac2520
aagaaaattatggaaaaatattctgtaacctttataagtaggcataacagttataatcat2580
aacatactgttttttcttactccacacaggcatagagtgtctgctattaataactatgct2640
caaaaattgtgtacctttagctttttaatttgtaaaggggttaataaggaatatttgatg2700
tatagtgccttgactagagatcataatcagccataccacatttgtagaggttttacttgc2760
tttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgt2820
tgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaattt2880
cacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgt2940
atcttatcatgtctggatccccggggggtaccagcttcgtagctagaacatcatgttctg3000
ggatatcagcttcgtagctagaacatcatgttctggtacccccgctctagagcgaattaa3060
ttcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaa3120
tcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccga3180
tcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcctgatgcggtattttct3240
ccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctc3300
tgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacg3360
ggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcat3420
gtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcggggtaccaga3480
acatgatgttctagctacgaagctgatatcccagaacatgatgttctagctacgaagctg3540
gtaccccggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttc3600
ttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttattttt3660
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
ctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaata3720
atattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttt3780
tgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgc3840
tgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagat3900
S ccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgct3960
atgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcataca4020
ctattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatgg4080
catgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaa4140
cttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatggg4200
10 ggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacga4260
cgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactgg4320
cgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagt4380
tgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctgg4440
agccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctc4500
IS ccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagaca4560
gatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactc4620
atatatactttagattgatttaaaacttcatttttaatttaaaagg.atctaggtgaagat4680
cctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc4740
agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctg4800
ctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagct4860
accaactctttttccgaa.ggtaactggcttcagcagagcgcagataccaaatactgtcct4920
tctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacct4980
cgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgg5040
gttggactcaagacgatagttacggataaggcgcagcggtcgggctgaacggggggttcg5100
tgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgag5160
ctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc5220
agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttat5280
agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg5340
gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgc5400
tggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatt54-60
accgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca5520
gtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccg5580
attcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaac5640
gcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccg5700
3S gctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgac5760
catgattacgccaagctctctagagctctagagctctagagctctagagagcttgcatgc5820
cggggtaccagcttcgtagctagaacatcatgttctgggatatcagcttcgtagctagaa5880
catcatgttctggtaccccggtcga 5905
4S
<210> 14
<211> 6052
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector pTGFG64
<400> 14
cgcgttgaca ttgattattg actagttatt aatagtaatc aattacgggg tcattagttc 60
atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 120
cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 180
tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag 240
tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc 300
SS ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct 360
acgtattagt catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg 420
gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt 480
tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga 540
cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct ctctggctaa 600
ctagagaacc cactgcttac tggcttatcg aaattaatac gactcactat agggagaccc 660
aagcttgcat gccaattccg caaaggttat gcagcgcgtg aacatgatca tggcagaatc 720
accaggcctc atcaccatct gccttttagg atatctactc agtgctgaat gtacagtttt 780
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
11
tcttgatcat gaaaacgccaacaaaattctgaatcggccaaagaggtataattcaggtaa840
attggaagag tttgttcaagggaaccttgagagagaatgtatggaagaaaagtgtagttt900
tgaagaagca cgagaagtttttgaaaacactgaaagaacaactgaattttggaagcagta960
tgttgatgga gatcagtgtgagtccaatccatgtttaaatggcggcagttgcaaggatga1020
cattaattcc tatgaatgttggtgtccctttggatttgaaggaaagaactgtgaattaga1080
tgtaacatgt aacattaagaatggcagatgcgagcagttttgtaaaaatagtgctgataa1140
caaggtggtt tgctcctgtactgagggatatcgacttgcagaaaaccagaagtcctgtga1200
accagcagtg ccatttccatgtggaagagtttctgtttcacaaacttctaagctcacccg1260
tgctgagact gtttttcctgatgtggactatgtaaattctactgaagctgaaaccatttt1320
10ggataacatc actcaaagcacccaatcatttaatgacttcactcgggttgttggtggaga1380
agatgccaaa ccaggtcaattcccttggcaggttgttttgaatggtaaagttgatgcatt1440
ctgtggaggc tctatcgttaatgaaaaatggattgtaactgctgcccactgtgttgaaac1500
tggtgttaaa attacagttgtcgcaggtgaacataatattgaggagacagaacatacaga1560
gcaaaagcga aatgtgattcgaattattcctcaccacaactacaatgcagctattaataa1620
15gtacaaccat gacattgcccttctggaactggacgaacccttagtgctaaacagctacgt1680
tacacctatt tgcattgctgacaaggaatacacgaacatcttcctcaaatttggatctgg1740
ctatgtaagt ggctggggaagagtcttccacaaagggagatcagctttagttcttcagta1800
ccttagagtt ccacttgttgaccgagccacatgtcttcgatctacaaagttcaccatcta1860
taacaacatg ttctgtgctggcttccatgaaggaggtagagattcatgtcaaggagatag1920
20tgggggaccc catgttactgaagtggaagggaccagtttcttaactggaattattagctg1980
gggtgaagag tgtgcaatgaaaggcaaatatggaatatataccaaggtatcccggtatgt2040
caactggatt aaggaaaaaacaaagctcacttaatgggatcggtcgagcggccgcgactc2100
tactagagga tctttgtgaaggaaccttacttctgtggtgtgacataattggacaaacta2160
cctacagaga tttaaagctctaaggtaaatataaaatttttaagtgtataatgtgttaaa2220
25ctactgattc taattgtttgtgtattttagattccaacctatggaactgatgaatgggag2280
cagtggtgga atgcctttaatgaggaaaacctgttttgctcagaagaaatgccatctagt2340
gatgatgagg ctactgctgactctcaacattctactcctccaaaaaagaagagaaaggta2400
gaagacccca aggactttccttcagaattgctaagttttttgagtcatgctgtgtttagt2460
aatagaactc ttgcttgctttgctatttacaccacaaaggaaaaagctgcactgctatac2520
30aagaaaatta tggaaaaatattctgtaacctttataagtaggcataacagttataatcat2580
aacatactg t tttttcttactccacacaggcatagagtgtctgctattaataactatgct2640
caaaaattgt gtacctttagctttttaatttgtaaaggggttaataaggaatatttgatg2700
tatagtgcct tgactagagatcataatcagccataccacatttgtagaggttttacttgc2760
tttaaaaaac ctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgt2820
35tgttaacttg tttattgcagcttataatggttacaaataaagcaatagcatcacaaattt2880
cacaaataaa gcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgt2940
atcttatcat gtctggatccccggggggtaccagcttcgtagctagaacatcatgttctg3000
ggatatcagc ttcgtagctagaacatcatgttctggtacccccctctagagcgaattaat3060
tcactggccg tcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaat3120
40cgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgat3180
cgcccttccc aacagttgcgcagcctgaatggcgaatggcggggtaccagcttcgtagct3240
agaacatcat gttctgggatatcagcttcgtagctagaacatcatgttctggtaccccgc3300
ctgatgcggt attttctcct-tacgcatctgtgcggtatttcacaccgcatatggtgcact3360
ctcagtacaa tctgctctgatgccgcatagttaagccagccccgacacccgccaacaccc3420
45gctgacgcgc cctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgacc3480
gtctccggga gctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacga3540
aagggcacca gaacatgatgttctagctacgaagctgatatcccagaacatgatgttcta3600
gctacgaagc tggtaccccgcctcgtgatacgcctatttttataggttaatgtcatgata3660
ataatggttt cttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatt3720
SOtgtttatttt tctaaatacattcaaatatgtatccgctcatgagacaataaccctgataa3780
atgcttcaat aatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgccctt3840
attccctttt ttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaa3900
gtaaaagatg ctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaac3960
agcggtaaga tccttgagagttttcgccccgaagaacgttttccaatgatgagcactttt4020
55aaagttctgc tatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggt9080
cgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcat4140
cttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataac4200
actgcggcca acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttg4260
cacaacatgg gggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagcc4320
60ataccaaacg acgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaa4380
ctattaactg gcgaactacttactctagcttcccggcaacaattaatagactggatggag4440
gcggataaag ttgcaggaccacttctgcgctcggcccttccggctggctggtttattgct4500
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
12
gataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagat4560
ggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaa4620
cgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagac4680
caagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatc4740
taggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttc4800
cactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctg4860
cgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg4920
gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacca4980
aatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccg5040
cctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcg5100
tgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga5160
acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatac5220
ctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtat5280
ccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcc5340
tggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtga5400
tgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttc5460
ctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtg5520
gataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgag5580
cgcagcgagtcagtgagcgaggggtaccagaacatgatgttctagctacgaagctgatat5640
cccagaacatgatgttctagctacgaagctggtaccccagcggaagagcgcccaatacgc5700
aaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttccc5760
gactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggca5820
ccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataa5880
caatttcacacaggaaacagctatgaccatgattacgccaagctctctagagctctagag5940
ctctagagctctagagagcttgcatgccggggtaccagcttcgtagctagaacatcatgt6000
tctgggatatcagcttcgtagctagaacatcatgttctggtaccccggtcga 6052
<210> 15
<211> 4344
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector pTGFG67
<400> 15
cgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttc60
atagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgac120
cgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa180
tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcag240
tacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc300
ccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatct360
acgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtg420
gatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt480
tgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattga540
cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaa600
ctagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagaccc660
aagcttgacctcgagcaagcggccgcgactctactagaggatctttgtgaaggaacctta720
cttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaa780
tataaaatttttaagtgtataatgtgttaaactactgattctaattgtttgtgtatttta840
gattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaa900
cctgttttgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaaca960
ttctactcctccaaaaaagaagagaaaggtagaagaccccaaggactttccttcagaatt1020
gctaagttttttgagtcatgctgtgtttagtaatagaactcttgcttgctttgctattta1080
caccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattctgtaac1140
ctttataagtaggcataacagttataatcataacatactgttttttcttactccacacag1200
gcatagagtgtctgctattaataactatgctcaaaaattgtgtacctttagctttttaat1260
ttgtaaaggggttaataaggaatatttgatgtatagtgccttgactagagatcataatca1320
gccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctga1380
acctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatg1440
gttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt1500
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
13
ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccccgggtacc1560
ctctagagcgaattaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctg1620
gcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcg1680
aagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcc1740
tgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactc1800
tcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccg1860
ctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccg1920
tctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaa1980
agggggggtaccagcttcgtagctagaacatcatgttctgggatatcagcttcgtagcta2040
gaacatcatgttctggtacccccctcgtgatacgcctatttttataggttaatgtcatga2100
taataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaaccccta2160
tttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgat2220
aaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgccc2280
ttattccct t ttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtga2340
aagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca2400
acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcactt2460
ttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcg2520
gtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagc2580
atcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgata2640
acactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttt2700
tgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaag2760
ccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca2820
aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatgg2880
aggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattg2940
ctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccag3000
atggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg3060
aacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcag3120
accaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaagga3180
tctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgt3240
tccactgagcgtcagaccccgtagaaaagat~aaaggatcttcttgagatcctttttttc33D0
tgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgc3360
cggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatac3420
caaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcac3480
cgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagt3540
cgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct3600
gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagat3660
acctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggt3720
atccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacg3780
cctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt3840
gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggt3900
tcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctg3960
tggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccg4020
agcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctcc4080
ccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgg4140
gcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttac4200
actttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacag4260
gaaacagctatgaccatgattacgccaagctctctagagctctagagctctagagctcta4320
gagagcttgcatgcctgcaggtcg 4344
55
<210> 16
<211> 4496
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector pTGFG82
<400> 16
cgcgttgaca ttgattattg actagttatt aatagtaatc aattacgggg tcattagttc 60
atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 120
cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 180
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
14
tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcag240
tacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc300
ccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatct360
acgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtg420
gatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt480
tgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattga540
cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaa600
ctagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagaccc660
aagcttgacctcgagcaagcggccgcgactctactagaggatctttgtgaaggaacctta720
cttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaa780
tataaaatttttaagtgtataatgtgttaaactactgattctaattgtttgtgtatttta840
gattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaa900
cctgttttgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaaca960
ttctactcctccaaaaaagaagagaaaggtagaagaccccaaggactttccttcagaatt1020
gctaagttttttgagtcatgctgtgtttagtaatagaactcttgcttgctttgctattta1080
caccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattctgtaac1140
ctttataagtaggcataacagttataatcataacatactgttttttcttactccacacag1200
gcatagagtgtctgctattaataactatgctcaaaaattgtgtacctttagctttttaat1260
ttgtaaaggggttaataaggaatatttgatgtatagtgccttgactagagatcataatca1320
gccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctga1380
acctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatg1440
gttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt1500
ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccccggggggt1560
accagcttcgtagctagaacatcatgttctgggatatcagcttcgtagctagaacatcat1620
gttctggtacccccctctagagcgaattaattcactggccgtcgttttacaacgtcgtga1680
ctgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag1740
ctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaa1800
tggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccg1860
catatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgaca1920
cccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacag1980
acaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaa2040
acgcgcgagacgaaagggcggggtaccagaacatgatgttctagctacgaagctgatatc2100
ccagaacatgatgttctagctacgaagctggtaccccggcctcgtgatacgcctattttt2160
ataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaa2220
tgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcat2280
gagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattca2340
acatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctca2400
cccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtta2460
catcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttt2520
tccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgc2580
cgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactc2640
accagtcacagaaaagcatc,ttacggatggcatgacagtaagagaattatgcagtgctgc2700
cataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaa2760
ggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttggga2820
accggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaat2880
ggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaaca2940
attaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttcc3000
ggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcat3060
tgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggag3120
tcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaa3180
gcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca3240
tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccc3300
ttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttc3360
ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc3420
agcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctt3480
cagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccactt3540
caagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgc3600
tgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataa3660
ggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgac3720
ctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg3780
gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggga3840
gcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgact3900
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa 3960
cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc 4020
gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg 4080
ccgcagccga acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat 4140
5 acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt 4200
tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta 4260
ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg 4320
ataacaattt cacacaggaa acagctatga ccatgattac gccaagctct ctagagctct 4380
agagctctag agctctagag agcttgcatg ccggggtacc agcttcgtag ctagaacatc 4440
10 atgttctggg atatcagctt cgtagctaga acatcatgtt ctggtacccc ggtcga 4496
<210> 17
<211> 4644
15 <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector pTGFG95
<400> 17
cgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttc60
atagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgac120
cgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa180
tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcag240
tacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc300
ccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatct360
acgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtg420
gatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt480
tgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattga54.0
cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaa600
ctagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagaccc660
aagcttgacctcgagcaagcggccgcgactctactagaggatctttgtgaaggaacctta720
cttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaa780
tataaaatttttaagtgtataatgtgttaaactactgattctaattgtttgtgtatttta840
gattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaa900
cctgttttgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaaca960
ttctactcctccaaaaaagaagagaaaggtagaagaccccaaggactttccttcagaatt1020
gctaagttttttgagtcatgctgtgtttagtaatagaactcttgcttgctttgctattta1080
caccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattctgtaac1140
ctttataagtaggcataacagttataatcataacatactgttttttcttactccacacag1200
gcatagagtgtctgctattaataactatgctcaaaaattgtgtacctttagctttttaat1260
ttgtaaaggggttaataagg-aatatttgatgtatagtgccttgactagagatcataatca1320
gccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctga1380
acctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatg1440
gttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt1500
ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccccggggggt1560
accagcttcgtagctagaacatcatgttctgggatatcagcttcgtagctagaacatcat1620
gttctggtacccccctctagagcgaattaattcactggccgtcgttttacaacgtcgtga1680
ctgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag1740
ctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaa1800
tggcgaatggcggggtaccagcttcgtagctagaacatcatgttctgggatatcagcttc1860
gtagctagaacatcatgttctggtaccccgcctgatgcggtattttctccttacgcatct1920
gtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcata1980
gttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgct2040
cccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggtt2100
ttcaccgtcatcaccgaaacgcgcgagacgaaagggctaccagaacatgatgttctagct2160
acgaagctgatatcccagaacatgatgttctagctacgaagctggtaccccgcctcgtga2220
tacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggca2280
cttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata2340
tgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaaga2400
gtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttc2460
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
16
ctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtg2520
cacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgcc2580
ccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattat2640
cccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgact2700
tggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaat2760
tatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacga2820
tcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcc2880
ttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacga2940
tgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctag3000
cttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgc3060
gctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggt3120
ctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatct3180
acacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtg3240
cctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattg3300
atttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctca3360
tgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaaga3420
tcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaa3480
aaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccga3540
aggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagt3600
taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgt3660
taccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat3720
agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagct3780
tggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgcca3840
cgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggag3900
agcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttc3960
gccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga4020
aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcaca4080
tgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgag4140
ctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggggtacc4200
agaacatgatgttctagctacgaagctgatatcccagaacatgatgttctagctacgaag42-60
ctggtaccccagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccga4320
ttcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacg4380
caattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccgg4440
ctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgacc4500
atgattacgccaagctctctagagctctagagctctagagctctagagagcttgcatgcc4560
ggggtaccagcttcgtagctagaacatcatgttctgggatatcagcttcgtagctagaac4620
atcatgttctggtaccccggtcga 4694
<210> 18
<211> 933
<212> PRT
<213> Homo Sapiens
<400> 18
Met Thr Glu Leu Lys Ala Lys Gly Pro Arg Ala Pro His Val Ala Gly
1 5 10 15
Gly Pro Pro Ser Pro Glu Val Gly Ser Pro Leu Leu Cys Arg Pro Ala
SO 20 25 30
Ala Gly Pro Phe Pro Gly Ser Gln Thr Ser Asp Thr Leu Pro Glu Val
35 40 45
Ser Ala Ile Pro Ile Ser Leu Asp Gly Leu Leu Phe Pro Arg Pro Cys
50 55 60 -
Gln Gly Gln Asp Pro Ser Asp Glu Lys Thr Gln Asp Gln Gln Ser Leu
70 75 80
Ser Asp Val Glu Gly Ala Tyr Ser Arg Ala Glu Ala Thr Arg Gly Ala
85 90 95
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
17
Gly Gly Ser Ser Ser Ser Pro Pro Glu Lys Asp Ser Gly Leu Leu Asp
100 105 110
Ser ValLeuAsp ThrLeuLeu AlaProSer GlyProGly GlnSerGln
115 120 125
Pro SerProPro AlaCysGlu ValThrSer SerTrpCys LeuPheGly
130 135 140
Pro GluLeuPro GluAspPro ProAlaAla ProAlaThr GlnArgVal
145 150 155 160
Leu SerProLeu MetSerArg SerGlyCys LysValGly AspSerSer
165 170 175
Gly ThrAlaAla AlaHisLys ValLeuPro ArgGlyLeu SerProAla
180 185 190
20Arg GlnLeuLeu LeuProAla SerGluSer ProHisTrp SerGlyAla
195 200 205
Pro ValLysPro SerProGln AlaAlaAla ValGluVal GluGluGlu
210 215 220
Asp GlySerGlu SerGluGlu SerAlaGly ProLeuLeu LysGlyLys
225 230 235 240
Pro ArgAlaLeu GlyGlyAla AlaAlaGly GlyGlyAla AlaAlaVal
245 250 255
Pro ProGlyAla AlaAlaGly GlyValAla LeuValPro LysGluAsp
260 265 270
35Ser ArgPheSer AlaProArg ValAlaLeu ValGluGln AspAlaPro
275 280 285
Met AlaProGly ArgSerPro LeuAlaThr ThrValMet AspPheIle
290 295 300
His ValProIle LeuProLeu AsnHisAla LeuLeuAla AlaArgThr
305 310 315 320
Arg GlnLeuLeu GluAspGlu SerTyrAsp GlyGlyAla GlyAlaAla
325 330 335
Ser AlaPheAla ProProArg SerSerPro CysAlaSer SerThrPro
340 345 350
50Val AlaValGly AspPhePro AspCysAla TyrProPro AspAlaGlu
355 360 365
Pro LysAspAsp AlaTyrPro LeuTyrSer AspPheGln ProProAla
370 375 380
Leu LysIleLys GluGluGlu GluGlyAla GluAlaSer AlaArgSer
385 390 395 400
Pro ArgSerTyr LeuValAla GlyAlaAsn ProAlaAla PheProAsp
4 410 415
0
5
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
18
Phe Pro Leu Gly Pro Pro Pro Pro Leu Pro Pro Arg Ala Thr Pro Ser
420 425 430
Arg ProGly GluAlaAla ValThrAla AlaProAla SerAlaSer Val
435 440 445
Ser SerAla SerSerSer GlySerThr LeuGluCys IleLeuTyr Lys
450 455 460
Ala GluGly AlaProPro GlnGlnGly ProPheAla ProProPro Cys
465 470 475 480
Lys AlaPro GlyAlaSer GlyCysLeu LeuProArg AspGlyLeu Pro
485 490 495
Ser ThrSer AlaSerAla AlaAlaA1a GlyAlaAla ProAlaLeu Tyr
500 505 510
Pro AlaLeu GlyLeuAsn GlyLeuPro GlnLeuGly TyrGlnAla Ala
515 520 525
Val LeuLys GluGlyLeu ProGlnVal TyrProPro TyrLeuAsn Tyr
530 535 540
Leu ArgPro AspSerGlu AlaSerGln SerProGln TyrSerPhe Glu
545 550 555 560
Ser LeuPro GlnLysIle CysLeuIle CysGlyAsp GluAlaSer Gly
565 570 575
Cys HisTyr GlyValLeu ThrCysGly SerCysLys ValPhePhe Lys
580 585 590
Arg AlaMet GluGlyGln HisAsnTyr LeuCysAla GlyArgAsn Asp
595 600 605
Cys IleVal AspLysIle ArgArgLys AsnCysPro AlaCysArg Leu
610 615 620
Arg LysCys CysGlnAla GlyMetVal LeuGlyGly ArgLysPhe Lys
625 630 635 640
Lys PheAsn LysValArg ValValArg AlaLeuAsp AlaValAla Leu
r15 645 650 655
Pro Gln Pro Leu Gly Val Pro Asn Glu Ser Gln Ala Leu Ser Gln Arg
660 665 670
Phe Thr Phe Ser Pro Gly Gln Asp Ile Gln Leu Ile Pro Pro Leu Ile
675 680 685
Asn Leu Leu Met Ser Ile Glu Pro Asp Val Ile Tyr Ala Gly His Asp
690 695 700
Asn Thr Lys Pro Asp Thr Ser Ser Ser Leu Leu Thr Ser Leu Asn Gln
705 710 715 720
Leu Gly Glu Arg Gln Leu Leu Ser Val Val Lys Trp Ser Lys Ser Leu
725 730 735
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
19
Pro Gly Phe Arg Asn Leu His Ile Asp Asp Gln Ile Thr Leu Ile Gln
740 745 750
Tyr Ser Trp Met Ser Leu Met Val Phe Gly Leu Gly Trp Arg Ser Tyr
755 760 765
Lys His Val Ser Gly Gln Met Leu Tyr Phe Ala Pro asp Leu Ile Leu
770 775 780
Asn Glu Gln Arg Met Lys Glu Ser Ser Phe Tyr Ser ~eu Cys Leu Thr
785 790 795 800
Met Trp Gln Ile Pro Gln Glu Phe Val Lys Leu Gln '.'al Ser Gln Glu
805 810 815
Glu Phe Leu Cys Met Lys Val Leu Leu Leu Leu Asn ~hr Ile Pro Leu
820 825 830
Glu Gly Leu Arg Ser Gln Thr Gln Phe Glu Glu Met Arg Ser Ser Tyr
835 840 845
Ile Arg Glu Leu Ile Lys Ala Ile Gly Leu Arg Gln _ys Gly Val Val
850 855 860
Ser Ser Ser Gln Arg Phe Tyr Gln Leu Thr Lys Leu ~eu Asp Asn Leu
865 870 875 880
His Asp Leu Val Lys Gln Leu His Leu Tyr Cys Leu Asn Thr Phe Ile
885 890 895
Gln Ser Arg Ala Leu Ser Val Glu Phe Pro Glu Met Met Ser Glu Val
900 905 910
Ile Ala Ala Gln Leu Pro Lys Ile Leu Ala Gly Met Val Lys Pro Leu
915 920 925
Leu Phe His Lys Lys
930
45
<210> 19
<211> 2970
<212> DNA
<213> Homo sapiens
<400> 19
ctgaccagcg ccgccctccc ccgcccccga cccaggaggt ggagatccct ccggtccagc 60
cacattcaac acccactttc tcctccctct gcccctatat tcccgaaacc ccctcctcct 120
tcccttttcc ctcctccctg gagacggggg aggagaaaag gggagtccag tcgtcatgac 180
tgagctgaag gcaaagggtc cccgggctcc ccacgtggcg ggcggcccgc cctcccccga 240
ggtcggatcc ccactgctgt gtcgcccagc cgcaggtccg ttcccgggga gccagacctc 300
ggacaccttg cctgaagttt cggccatacc tatctccctg gacgggctac tcttccctcg 360
gccctgccag ggacaggacc cctccgacga aaagacgcag gaccagcagt cgctgtcgga 420
cgtggagggc gcatattcca gagctgaagc tacaaggggt gctggaggca gcagttctag 480
tcccccagaa aaggacagcg gactgctgga cagtgtcttg gacactctgt tggcgccctc 540
aggtcccggg cagagccaac ccagccctcc cgcctgcgag gtcaccagct cttggtgcct 600
gtttggcccc gaacttcccg aagatccacc ggctgccccc gccacccagc gggtgttgtc 660
cccgctcatg agccggtccg ggtgcaaggt tggagacagc tccgggacgg cagctgccca 720
taaagtgctg ccccggggcc tgtcaccagc ccggcagctg ctgctcccgg cctctgagag 780
ccctcactgg tccggggccc cagtgaagcc gtctccgcag gccgctgcgg tggaggttga 840
ggaggaggat ggctctgagt ccgaggagtc tgcgggtccg cttctgaagg gcaaacctcg 900
ggctctgggt ggcgcggcgg ctggaggagg agccgcggct gtcccgccgg gggcggcagc 960
CA 02362970 2001-08-16
WO 00/49147 PCT/EP00/01368
aggaggcgtcgccctggtccccaaggaagattcccgcttctcagcgcccagggtcgccct1020
ggtggagcaggacgcgccgatggcgcccgggcgctccccgctggccaccacggtgatgga1080
tttcatccacgtgcctatcctgcctctcaatcacgccttattggcagcccgcactcggca1140
getgctggaagacgaaagttacgacggcggggccggggctgccagcgcctttgccccgcc1200
5 gcggagttcaccctgtgcctcgtccaccccggtcgctgtaggcgacttccccgactgcgc1260
gtacccgcccgacgccgagcccaaggacgacgcgtaccctctctatagcgacttccagcc1320
gcccgctctaaagataaaggaggaggaggaaggcgcggaggcctccgcgcgctccccgcg1380
ttcctaccttgtggccggtgccaac.cccgcagccttcccggatttcccgttggggccacc1440
gcccccgctgccgccgcgagcgaccccatccagacccggggaagcggcggtgacggccgc1500
10 acccgccagtgcctcagtctcgtctgcgtcctcctcggggtcgaccctggagtgcatcct1560
gtacaaagcggagggcgcgccgccccagcagggcccgttcgcgccgccgccctgcaaggc1620
gccgggcgcgagcggctgcctgctcccgcgggacggcctgccctccacctccgcctctgc1680
cgccgccgccggggcggcccccgcgctctaccctgcactcggcctcaacgggctcccgca1740
gctcggctaccaggccgccgtgctcaaggagggcctgccgcaggtctacccgccctatct1800
IS caactacctgaggccggattcagaagccagccagagcccacaatacagcttcgagtcatt1860
acctcagaagatttgtttaatctgtggggatgaagcatcaggctgtcattatggtgtcct1920
tacctgtgggagctgtaaggtcttctttaagagggcaatggaagggcagcacaactactt1980
atgtgctggaagaaatgactgcatcgttgataaaatccgcagaaaaaactgcccagcatg2040
tcgccttagaaagtgctgtcaggctggcatggtccttggaggtcgaaaatttaaaaagtt2100
20 caataaagtcagagttgtgagagcactggatgctgttgctctcccacagccattgggcgt2160
tccaaatgaaagccaagccctaagccagagattcactttttcaccaggtcaagacataca2220
gttgattccaccactgatcaacctgttaatgagcattgaaccagatgtgatctatgcagg2280
acatgacaacacaaaacctgacacctccagttctttgctgacaagtcttaatcaactagg2340
cgagaggcaacttctttcagtagtcaagtggtctaaatcattgccaggttttcgaaactt2400
acatattgatgaccagataactctcattcagtattcttggatgagcttaatggtgtttgg2460
tctaggatggagatcctacaaacatgtcagtgggcagatgctgtattttgcacctgatct2520
aatactaaatgaacagcggatgaaagaatcatcattctattcattatgccttaccatgtg2580
gcagatcccacaggagtttgtcaagcttcaagttagccaagaagagttcctctgtatgaa2640
agtattgttacttcttaatacaattcctttggaagggctacgaagtcaaacccagtttga2700
ggagatgaggtcaagctacattagagagctcatcaaggcaattggtttgaggcaaaaagg27-60
agttgtgtcgagctcacagcgtttctatcaacttacaaaacttcttgataacttgcatga2820
tcttgtcaaacaacttcatctgtactgcttgaatacatttatccagtcccgggcactgag2880
tgttgaatttccagaaatgatgtctgaagttattgctgcacaattacccaagatattggc2940
agggatggtgaaaccccttctctttcataa 2970
