Note: Descriptions are shown in the official language in which they were submitted.
CA 02363297 2001-08-27
WO 00/52135 1 PCTIUSOO/05313
ENGINEERING INTRACELLULAR SIALYLATION PATHWAYS
FIELD OF THE INVENTION
The invention relates to methods and compositions for expressing sialylated
glycoproteins in heterologous expression systems, particularly insect cells.
BACKGROUND OF THE INVENTION
While heterologous proteins are generally identical at the amino acid level,
their post-translationally attached carbohydrate moieties often differ from
the
carbohydrate moieties found on proteins expressed in their natural host
species. Thus,
carbohydrate processing is specific and limiting in a wide variety of
organisms
including insect, yeast, mammalian, and plant cells.
The baculovirus expression vector has promoted the use of insect cells as
hosts
for the production of heterologous proteins (Luckow et al. (1993) Curr. Opin.
Biotech. 4:564-572, Luckow et al. (1995) Protein production and processing
from
baculovirus expression vectors). Commercially available cassettes allow rapid
generation of recombinant baculovirus vectors containing foreign genes under
the
control of the strong, polyhedrin promoter. This expression system is often
used to
produce heterologous secreted and membrane-bound glycoproteins normally of
mammalian origin.
However, post-translational processing events in the secretory apparatus of
insect cells yield glycoproteins with covalently-linked oligosaccharide
attachments
that differ significantly from those produced by mammalian cells. While
mammalian
cells often generate complex oligosaccharides terminating in sialic acid (SA),
insect
cells typically produce truncated (paucimannosidic) and hybrid structures
terminating
in mannose (Man) or N-acetylglucosamine (G1cNAc) (Figure 1). The inability of
insect cell lines to generate complex carbohydrates comprising sialic acid
significantly limits the wider application of this expression system.
The carbohydrate composition of an attached oligosaccharide, especially sialic
acid, can affect a glycoprotein's solubility, structural stability, resistance
to protease
degradation, biological activity, and in vivo circulation (Goochee et al.
(1991)
CA 02363297 2001-08-27
WO 00/52135 2 PCT/US00/05313
Bio/technology 9:1347-1355, Cumming et al. (1991) Glycobiology 1:115-130,
Opdenakker et al. (1993) FASEB J. 7:1330, Rademacher et al. (1988) Ann. Rev.
Biochem., Lis et al. (1993) Eur. J. Biochem. 218:1-27). The terminal residues
of a
carbohydrate are particularly important for therapeutic proteins since the
final sugar
moiety often controls its in vivo circulatory half-life (Cumming et al. (1991)
Glycobiology 1:115-130). Glycoproteins with oligosaccharides terminating in
sialic
acid typically remain in circulation longer due to the presence of receptors
in
hepatocytes and macrophages that bind and rapidly remove structures
terminating in
mannose (Man), N-acetylglucosamine (G1cNAc), and galactose (Gal), from the
bloodstream (Ashwell et al. (1974) Giochem. Soc. Symp. 40:117-124, Goochee et
al.
(1991) Bio/technology 9:1347-1355, Opdenakker et al. (1993) FASEB J. 7:1330).
Unfortunately, Man and G1cNAc are the residues most commonly found on the
termini of glycoproteins produced by insect cells. The presence of sialic acid
can also
be important to the structure and function of a glycoprotein since sialic acid
is one of
the few sugars that is charged at physiological pH. The sialic acid residue is
often
involved in biological recognition events such as protein targeting, viral
infection, cell
adhesion, tissue targeting, and tissue organization (Brandley et al. (1986) J.
of
Leukocyte bio. 40:97-111, Varki et al. (1997) FASEB 11:248-255, Goochee et al.
(1991) Bio/technology 9:1347-1355, Lopez et al. (1997) Glycobiology 7:635-651,
Opdenakker et al. (1993) FASEB J. 7:1330).
The composition of the attached oligosaccharide for a secreted or membrane-
bound glycoprotein is dictated by the structure of the protein and by the post-
translational processing events that occur in the endoplasmic reticulum and
Golgi
apparatus of the host cell. Since the secretory processing machinery in
mammalian
cells differs from that in insect cells, glycoproteins with very different
carbohydrate
structures are produced by these two host cells (Jarvis et al. (1995) Virology
212:500-
511, Maru et al. (1996) J. Biol. Chem. 271:16294-16299, Altmann et al. (1996)
Trends in Glycoscience and Glycotechnology 8:101-114). These differences in
carbohydrate structure can have dramatic effects on the in vitro and in vivo
properties
of the resulting glycoprotein. For example, the in vitro activity of human
thyrotropin
(hTSH) expressed in insect cells was five times higher than the activity of
the same
glycoprotein produced from mammalian Chinese hamster ovary (CHO) cells
CA 02363297 2001-08-27
WO 00/52135 3 PCT/US00/05313
(Grossman et al. (1997) Endocrinology 138:92-100). However, the in vivo
activity of
the insect cell-derived product was substantially lower due to its rapid
clearance from
injected rats. The drop in in vivo hTSH activity was linked to the absence of
complex-type oligosaccharides terminating in sialic acid in the insect cell
product
(Grossman et al. (1997) Endocrinology) 138:92-100).
N-glycosylation is highly significant to glycoprotein structure and function.
In
insect and mammalian cells N-glycosylation begins in the endoplasmic reticulum
(ER) with the addition of the oligosaccharide, Glc3Man9GlcNAc2 onto the
asparagine
(Asn) residue in the consensus sequence Asn-X-Ser/Thr (Moremen, et al. (1994)
Glycobiology 4:113-125, Varki et al. (1993) Glycobiology 3(2):97-130, Altmann
et al.
(1996) Trends in Glycoscience and Glycotechnology 8:101-114). As the
glycoprotein
passes through the ER and Golgi apparatus, enzymes trim and add different
sugars to
this N-linked glycan. These carbohydrate modification steps can differ in
mammalian
and insect hosts.
In mammalian cell lines, the initial trimming steps are followed by the
enzyme-catalyzed addition of sugars including N-acetylglucosamine (G1cNAc),
galactose (Gal), and sialic acid (SA) by the steps shown in Figure 2, and as
described
in Goochee et al. (1991) Bio/technology 9:1347-1355.
In insect cells, N-linked glycans attached to heterologous and homologous
glycoproteins comprise either high-mannose (Man9_5GIcNAc2) or truncated
(paucimannosidic) (Man3_2G1cNAc2) oligosaccharides; occasionally comprising
alpha(), 6)-fucose (Figure 3; Jarvis et al. (1989) Mol. Cell. Biol. 9:214-223,
Kuroda
et al. (1990) Virology 174:418-329, Marz et al. (1995) Glycoproteins 543-563,
Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114).
These reports primarily directed to Sf-9 or Sf-21 cells from Spodoptera
frugiperda,
indicated that insect cells could trim N-linked oligosaccharides but could not
elongate
these trimmed structures to produce complex carbohydrates. Reports from other
insect cell lines, including Tricoplusia ni (T. ni; High FiveTM) and Estigmena
acrea
(Ea-4), indicated the presence of limited levels of partially elongated hybrid
(structures with one terminal Man branch and one branch with terminal Gal,
G1cNAc,
or another sugar; Figure 4a) and complex (structures with two non-Man termini;
Figure 4b) N-linked oligosaccharides (Oganah et al. (1996) Bio/Technology
14:197-
CA 02363297 2001-08-27
WO 00/52135 4 PCT/US00/05313
202, Hsu et al. (1997) J. Biol. Chem. 272:9062-9070). Low levels of G1cNAc
transferase I and II (G1cNAc TI and TII), fucosyltransferase, mannosidases I
and II,
and Gal transferase (Gal T) have been reported in these insect cells;
indicating a
limited capability for production of these hybrid and complex N-linked
oligosaccharides in these cells (Velardo et al. (1993) J. Biol. Chem.
268:17902-17907,
Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114,
van
Die et al. (1996) Glycobiology 6:157-164).
However; most insect cell derived glycoproteins lack complex N-glycans.
This absence may be attributed to the presence of the hexosaminidase N-
acetylglucosaminidase that cleaves G1cNAc attached to the alpha(1, 3) Man
branch to
generate paucimannosidic oligosaccharides (Licari et al. (1993) Biotech. Prog.
9:146-
152, Altmann et al. (1995) J. Biol. Chem. 270:17344-17349). Chemicals have
been
added in an attempt to inhibit this glycosidase activity, but significant
levels of
paucimannosidic structures remain even in the presence of these inhibitors
(Wagner et
al. (1996) J. Virology 70:4103-4109).
Manipulating carbohydrate processing in insect cells has been attempted; and
in mammalian cells, the expression of sialyltransferases,
galactosyltransferases and
other enzymes is well established in order to enhance the level of
oligosaccharide
attachment (see U.S. Patent No. 5,047,335). However, in these cases, the
presence of
the necessary donor nucleotide substrates, most significantly the sialylation
nucleotide, CMP-sialic acid, in the proper subcellular compartment has been
assumed.
Attempts to manipulate carbohydrate processing have been made by expressing
single
transferases such as N-Acetylglucosamine transferase I (G1cNAc Ti), galactose
transferase (GAL T), or sialyltransferase (Lee et al. (1989) J. Biol. Chem.
264:13848-
13855, Wagner et al. (1996) Glycobiology 6:165-175, Jarvis et al. (1996)
Nature
Biotech. 14:1288-1292, Hollister et al. (1998) Glycobiology 8:473-480, Smith
et al.
(1990) J. Biol. Chem. 265:6225-6234, Grabenhorst et al. (1995) Eur. J.
Biochem.
232:718-725). Introduction of a mammalian beta(l, 4)-GaIT using viral vectors
(Jarvis et al. (1995) Virology 212:500-511) or stably-transformed cell lines
(Hollister
et al. (1998) Glycobiology 8:473-480) indicates that both approaches can
enhance the
extent of complex glycosylation of foreign glycoproteins expressed in insect
cells.
G1cNAcTI co-expression can increase the number of recombinant glycoproteins
with
CA 02363297 2001-08-28
PCUUS 00/ 05313
IPENUS21 DEC 2000
oligosaccharides containing G1cNAc on the Man alpha(1, 3) branch (Jarvis et
al.
(1996) Nature Biotech. 14:1288-1292, Jarvis et al. (1995) Virology 212:500-
511,
Hollister et al. (1998) Glycobiology 8:473-480; Wagner et al. (1996)
Glycobiology
6:165-175).
5 However, the production of complex carbohydrates comprising sialic acid has
not been observed in these studies. Sialylation of a single recombinant
protein
(plasminogen) produced in baculovirus-infected insect cells has been reported
(Davidson et al. (1990) Biochemistry 29:5584-5590), but findings appear to be
specific to this glycoprotein. Conversely, many reports indicate the complete
absence
of any attached sialic acid on glycoproteins from all insect cell lines tested
to date
(Voss et al. (1993) Eur. J. Biochem. 217:913-919, Jarvis et al. (1995)
Virology
212:500-511, Marz et al. (1995) Glycoproteins 543-563, Altmann et al. (1996)
Trends
in Glycoscience and Glycotechnology 8:101-114, Hsu et al. (1997) J. Biol.
Chem.
272:9062-9070).
The reason for this absence of sialylated glycoproteins was initially puzzling
since polysialic acid structures were obtained in Drosophila embryos (Roth et
al.
(1992) Science 256:673-675). However, as demonstrated herein, it is now
evident
that insect cell lines generate very little sialic acid as compared to
mammalian CHO
cells (See Figures 16A-B). With very little sialic acid, the insect cells
cannot generate
the donor nucleotide CMP-sialic acid essential for sialylation. A similar lack
or
limitation in donor nucleotide substrates may be observed in other eukaryotes
as well.
Thus, the co-expression of sialyltransferase and other transferases must be
accompanied by the intracellular generation of the proper donor nucleotide
substrates
and the proper acceptor substrates in order for the production of sialylated
and other
complex glycoproteins in eukaryotes. In addition, sialic acid and CMP-sialic
acid are
not permeable to cells so these substrates can not be provided directly to the
medium
of the cultures (Bennett et al. (1981) J. Cell. Biol. 88:1-15).
The manipulation of post-translational processing is particularly relevant to
biotechnology since recombinant DNA products generated in different hosts are
usually identical at the amino acid level and differ only in the attached
carbohydrate
composition (Goochee et al. (1991) Bio/technology 9:1347-1355). Engineering
carbohydrate pathways is useful to make recombinant DNA technology more
versatile
WENDED SNP
CA 02363297 2001-08-27
WO 00/52135 6 PCT/USOO/05313
and expand the number of hosts that can generate particular glycoforms. This
flexibility could ultimately lower biotechnology production costs since host
efficiency
would be the primary factor dictating which expression system is chosen rather
than a
host's capacity to produce a specific glycoform. Furthermore, carbohydrate
engineering is useful to tailor a glycoprotein to include specific
oligosaccharides that
could alter biological activity, structural properties or circulatory targets.
Such
carbohydrate engineering efforts will provide a greater variety of recombinant
glyco-
products to the biotechnology industry.
Glycoproteins containing sialylated oligosaccharides would have improved in
vivo circulatory half-lives that could lead to their increased utilization as
vaccines and
therapeutics. In particular, complex sialylated glycoproteins from insect
cells would
be more appropriate biological mimics of native mammalian glycoproteins in
molecular recognition events in which sialic acid plays a role.
Therefore, manipulating carbohydrate processing pathways in insect and other
eukaryotic cells so that the cells produce complex sialylated glycoproteins is
useful
for enhancing the value of heterologous expression systems and increasing the
application of heterologous cell expression products as vaccines,
therapeutics, and
diagnostic tools; for increasing the variety of glycosylated products to be
generated in
heterologous hosts; and for lowering biotechnology production costs, since
particular
expression systems can be selected based on efficiency of production rather
than the
capacity to produce particular product glycoforms.
SUMMARY OF THE INVENTION
Compositions and methods for producing glycoproteins having sialylated
oligosaccharides are provided. The compositions of the invention comprise
enzymes
involved in carbohydrate processing and production of nucleotide sugars,
nucleotide
sequences encoding such enzymes, and cells transformed with these nucleotide
sequences. The compositions of the invention are useful in methods for
producing
complex sialylated glycoproteins in cells of interest including, but not
limited to,
mammalian cells and non-mammalian cells (e.g., insect cells).
The sialylation process involves the post-translational addition of a donor
substrate, cytidine monophosphate-sialic acid (CMP-SA) onto a specific
acceptor
CA 02363297 2001-08-27
WO 00/52135 7 PCTIUSOO/05313
carbohydrate (GalGlcNAcMan-R) via an enzymatic reaction catalyzed by a
sialyltransferase in the Golgi apparatus. Since one or more of these three
reaction
components (i.e., acceptor, donor substrate, and the enzyme sialyltransferase)
is
limiting or absent in certain cells of interest, methods are provided to
enhance the
production of the limiting components. Polynucleotide sequences encoding the
enzymes used according to the methods of the invention are known or novel
bacterial
invertebrate, fungal, or mammalian sequences and/or fragments or variants
thereof ,
that are optionally identified using bioinformatics searches. According to one
embodiment of the invention, completion of the sialylation reaction is
achieved by
expressing a sialyltransferase enzyme, or a fragment or variant thereof, in
the
presence of acceptor and/or donor substrates. The invention also provides an
assay
for sialylation, wherein the structures and compositions of N-linked
oligosaccharides
attached to a model secreted glycoprotein, (e.g., transferrin), is elucidated
using
multidimensional chromatography.
Cells of interest that have been recombinantly engineered to produce new
forms of sialylated glycoproteins, higher concentrations of sialylated
glycoproteins,
and/or elevated concentrations of donor substrates (.g., nucleotides sugars)
required
for sialylation, as well as kits for expression of sialylated glycoproteins
are also
provided.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the typical differences in insect and mammalian carbohydrate
structures.
Figure 2 depicts the enzymatic generation of a complex sialylated
carbohydrate in mammalian cells.
Figure 3 depicts a Paucimannosidic oligosaccharide.
Figure 4a depicts a hybrid glycan from Estigmena acrea (Ea-4) insect cells.
CA 02363297 2008-11-03
8
Figure 4b depicts a complex glycan from Estigmena acrea (Ea-4) insect cells.
Figure 5 depicts the nucleotide sugar production pathways in mammalian and
E. coli cells leading to sialylation.
Figure 6 depicts a chromatogram of labeled oligosaccharides separated by
reverse phase High Performance Liquid Chromatography (HPLC) on an ODS-silica
column. Using this technique, oligosaccharides are fractionated according to
their
carbohydrate structures. Panel "L" represents cell lysate fractions and panel
"S"
represents cell supernatant fractions.
Figure 7 depicts the structure of Oligosaccharide G.
Figure 8 depicts the glycosylation pathway in Trichoplusia ni insect cells
(High FiveTM cells; Invitrogen Corp., Carlsbad, CA, USA).
Figure 9 depicts the chromatogram of a Galactose-transferase assay following
High Performance Anion Exchange Chromatography (HPAEC), as described in the
Examples and references cited therein.
Figure 10 depicts the chromatogram of a 2;3-Sialyltransferase assay following
Reverse Phase-High Performance Liquid Chromatography (RP-HPLC), as described
in the Examples.
Figure 11 depicts 'the results of a Galactose-transferase (Gal-T) assay of
insect
cell lysates performed using a Europium.(Eu+3)-labeled Ricinus cummunis lectin
(RCA 120) probe; which specifically binds Gal or GaINAc oligosaccharide
structures
as described in the Examples. Each column represents the Gal-T activity in a
given
sample; Column (A) represents boiled T. ni cell lysates, Column (B) represents
normal T. ni cell lysates, Column (C) represents activity in 0.5 mU of enzyme
standard, Column (D) represents lysate from T ni cells infected with a
baculovirus
coding for GaIT, Column (E) represents lysates from Sf-9 cells stably
transfected with
CA 02363297 2001-08-28
PCUUS 00/ 05313
1PEANU521 DEC 2000
9
the GaIT gene. Figure 12 depicts the product of reacting UDP-Gal-6-Naph with
Dans-
AE-G1cNAc in the presence of Ga1T.
Figure 12 depicts the reaction products resulting from incubation of UDP-Gal-
6-Naph and Dans-AE-GIcNAc in the presence of Galactose-transferase, as
described
in the "Experimental" section below.
Figure 13 depicts the distinguishing emission spectra of GaIT assay reactants
and products, as described in the "Experimental" section below. Irradiation of
the
naphthyl group in UDP-Gal-6-Naph at 260-290 nm ("ex") results in an emission
peak
at 320-370 nm ("em" dotted line) while irradiation of the Galactose-
transferase
reaction products at these same low wavelengths results in energy transfer to
the
dansyl group and an emission peak at 500-560 nm ("em" solid line).
Figure 14 depicts the oxidation reaction of sialic acid.
Figure 15 schematically depicts a new GIcNAc Ti assay utilizing a synthetic
6-aminohexyl glycoside of the trimannosyl N-glycan core structure labeled with
DTPA (Diethylenetriaminepentaacetic acid) and complexed with Eu+3 (see
"Experimental" section below). This substrate is incubated with insect cell
lysates or
positive controls containing GIcNAc Ti and UDP-G1cNAc. Chemical inhibitors are
added to minimize background N-acetylglucosaminidase activity. After the
reaction,
an excess of Crocus lectin CVL (Misaki et al. (1997) J. Biol. Chem. 272:25455-
25461), which specifically binds the trimannosyl core, is added. The amount of
lectin
required to bind all the trimannosyl glycoside (and hence all the Eu '3 label)
in the
absence of any GIcNAc binding is predetermined. Following an ultrafiltration
step,
the glycoside modified with GIcNAc (not binding CVL) appears in the filtrate.
Measurement of the Eu+3 fluorescence in the filtrate reflects the level of
GIcNAc Ti
activity in the culture lysates.
Figures 16A-B depict a chromatogram of sialic acid levels in SF9 insect cells
and CHO (chinese hamster ovary) cells. In the panel labeled "Sf-9 Free Sialic
Acid
_'?"' 4CO SHEET
CA 02363297 2001-08-28
PCTJUS 00105313
IPENUS2 1 DEC 2000
Levels" the known sialic acid standard elutes just prior to 10 minutes, while
no
corresponding sialic acid peak can be detected (above background levels) in Sf-
9
cells. In the panel labeled "CHO sialic acid levels" the sialic acid standard
elutes at
approximately 9 minutes, while bound and free (released by acid hydrolysis)
sialic
5 acid peaks are observed at similar elution positions.
Figure 17 depicts how selective inhibition of N-acetylglucosaminidase allows
for production of complex oligosaccharide structures.
10 Figures 18A-B depict ethidium bromide-stained agarose gels following
electrophoresis of PCR amplification products from Sf9 genomic DNA or High
FiveT"' (Invitrogen Corp., Carlsbad, CA, USA) cell cDNA templates using
degenerate
primers corresponding to three different regions conserved within N-
acetylglucosaminidases.
Figure 19 depicts two potential specific chemical inhibitors of N-
acetylglucosaminidase.
Figure 20 schematically depicts that the overexpression of various
glycosyltransferases leads to greater production of oligosaccharide acceptor
substrates.
Figure 21 depicts three possible N-glycan acceptor structures which include
the terminal Gal (G) acceptor residue required for subsequent sialylation.
Figure 22 depicts a structure of CMP-sialic acid (CMP-SA).
Figure 23 depicts a metabolic pathway for ManNAc (N-acetylmannosamine)
from glucosamine and N-acetylglucosamine (G1cNAc).
Figure 24 depicts a ManNAc (N-acetylmannosamine) to sialic acid metabolic
pathway.
AMENDED SHEET
CA 02363297 2001-08-28
PCTIUS 00 / 05313
4P fUS21 DEC 2000
11
Figure 25 depicts the formation of CMP-sialic acid (CMP-SA) catalyzed by
CMP-SA synthetase.
Figure 26 depicts detection of purified (P) transferrin (hTf) or transferrin
from
unpurified insect cell lysates (M) following separation on an SDS-PAGE gel, as
described the Examples.
Figure 27 depicts the nucleotide sequence of human aldolase.
Figure 28 depicts the amino acid sequence of human aldolase encoded by the
sequence shown in Figure 27.
Figure 29 depicts the nucleotide sequence of human CMP-SA synthetase
(cytidine monophosphate-sialic acid synthetase)
Figure 30 depicts the amino acid sequence of human CMP-SA synthetase
encoded by the sequence shown in Figure 29.
Figure 31 depicts the nucleotide sequence of human sialic acid synthetase
(human SA-synthetase; human SAS).
Figure 32 depicts the amino acid sequence of human SA-synthetase (SAS)
encoded by the sequence shown in Figure 31.
Figures 33A-D depict the types and quantities of oligosaccharide structures
found on recombinant human transferrin in the presence and absence of Gal T
overexpression.
Figure 34 depicts bacterial and mammalian sialic acid metabolic pathways.
AMENDED SHEET
CA 02363297 2001-08-28
PSI/US00/05313
i2 IPEA/US21 DEC 2000
Figure 35 depicts human sialic acid synthetase (SAS) genetic information:
(A1-A3) depict an alignment of the polypeptide encoded by the human SAS
polynucleotide open-reading frame; (B) shows the amino acid sequence homology
between human SAS (top) and bacterial sialic acid synthetase (NeuB) (bottom).
Figure 36 (A) depicts an autoradiogram of human sialic acid synthetase gene
products following gel electrophoresis. The lanes labeled "In Vitro" represent
in vitro
transcription and translation products of SAS cDNA (amplified via polymerase
chain
reaction (PCR)). Lane 1 ("pA2") depicts a negative control reaction in which
pA2
plasmid (without the SAS cDNA) was PCR amplified, transcribed, translated, and
radiolabled. Lane 2 ("pA2-SAS ") depicts a sample reaction in which pA2-SAS
plasmid (containing the human SAS cDNA) was PCR amplified, transcribed,
translated, and radiolabeled. Lane 3 ("Marker") depicts radiolabeled protein
standards
migrating at approximately 66, 46, 30, 21.5, and 14.3 kD. The lanes labeled
"Pulse
Label" show radioactive 35S pulse labeling of polypeptides from insect cells
infected
by virions not containing or containing the human SAS cDNA. Lane 4 ("A35")
depicts a negative control reaction of radiolabled polypeptides from insect
cells
infected with virions not containing the SAS cDNA. Lane 5 ("AcSAS") depicts a
sample reaction of radiolabeled polypeptides from insect cells infected with
baculovirus containing the human SAS cDNA. Figure 36 (B) depicts an RNA
(Northern) blot of human tissues (spleen, thymus, prostate, testis, ovary,
small
intestine, peripheral blood lymphocytes (PBL), colon, heart, brain, placenta,
lung,
liver, skeletal muscle, kidney, and pancreas) probed for sialic acid
synthetase RNA
transcripts. Transcript sizes (in kilobases) are indicated by comparison to
the scale on
the left side.
Figure 37 depicts chromatograms indicating the in vivo sialic acid content of
various cells as monitored following DMB derivitization and reverse phase HPLC
separation. Figure 37 (A) depicts the sialic acid content of lysed cell lines
after
filtration through a 10,000 MWCO membrane. The cell lines analyzed were Sf-9
(insect) cells in standard media, SF-9 cells supplemented with 10% FBS (fetal
bovine
serum), or CHO (Chinese Hamster Ovary) cells. The original chromatogram values
AMENDED SHEE'
CA 02363297 2001-08-27
WO 00/52135 13 PCT/US00/05313
have been divided by protein concentration to normalize chromatograms. The
standards shown are Neu5Ac at 1000 fmol, Neu5Gc at 200 fmol, and KDN at 50
fmol. Figure 37 (B) depicts a chromatogram of the sialic acid content of
lysates from
various Sf-9 cells. "AcSAS Infected" cell lysates were from Sf-9 cells
infected with
baculovirus containing the human SAS cDNA. The Neu5Ac and KDN "Standards"
are shown at 1,000 fmol concentrations. "A35 Infected" cell lysates are from
Sf-9
infected by baculovirus not containing the SAS cDNA. "Uninfected" cell lysates
are
from normal Sf-9 cells not infected by any baculovirus. Original chromatogram
values have been divided by protein concentration to normalize chromatograms.
Figure 37 (C) depicts a chromatogram of the sialic acid content from lysates
of Sf-9
grown in media supplemented by 10 mM ManNAc; cells were infected or not
infected
with baculovirus as shown in Figure 37 (B). Original chromatogram values have
been
divided by protein concentrations to normalize chromatograms. Neu5Ac and KDN
standards represent 1,000 fmol. Figure 37(D) HPAEC (high performance anion-
exchange chromatography) analysis of lysates from Sf-9 cells infected with
AcSAS or
A35 baculovirus with and without aldolase treatment. Samples were diluted
prior to
column loading to normalize sialic acid quantities based on original sample
protein
concentration. Neu5Ac standard is shown at 250 pmol and KDN standard is shown
at
100 pmol.
Figure 38 depicts chromatograms of in vitro assays for sialic acid
phosphorylation activity. Assays were performed with and without alkaline
phosphatase (AP) treatment. Figure 38 (A) depicts chromatogram results of a
Neu5Ac-9-phosphate assay performed using lysates from Sf-9 cells infected with
the
AcSAS baculovirus (containing the human SAS cDNA). KDN and Neu5Ac
standards are shown at 5000 fmol. Figure 38 (B) depicts chromatogram results
of a
KDN-9-phosphate assay performed using lysates from Sf-9 cells infected with
the
AcSAS baculovirus (containing the human SAS cDNA). KDN and Neu5Ac
standards are shown at 5000 fmol.
Figure 39 depicts a chromatogram demonstrating production of sialylated
nucleotides in SF-9 insect cells following infection with CMP-SA synthetase
and SA
CA 02363297 2001-08-27
WO 00/52135 14 PCT/US00/05313
synthetase containing baculoviruses. Sf-9 cells were grown in six well plates
and
infected with baculovirus containing CMP-SA synthase and supplemented with 10
mM ManNAc ("CMP" line), with baculovirus containing CMP-SA synthase and SA
synthase plus 10 mM ManNAc supplementation ("CMP+SA" line), or with no
baculovirus and no ManNAc supplementation ("SF9" line).
DETAILED DESCRIPTION OF THE INVENTION
Compositions and methods for producing glycoproteins with sialylated
oligosaccharides are provided. In particular, the carbohydrate processing
pathways of
cell lines of interest are manipulated to produce complex sialylated
glycoproteins.
Such sialylated glycoproteins find use as pharmaceutical compositions,
vaccines,
diagnostics, therapeutics, and the like.
Cells of interest include, but are not limited to, mammalian cells and non-
mammalian cells, such as, for example, CHO, plant, yeast, bacterial, insect,
and the
like. The methods of the invention can be practiced with any cells of
interest. By
way of example, methods for the manipulation of insect cells are described
fully
herein. However, it is recognized that the methods may be applied to other
cells of
interest to construct processing pathways in any cell of interest for
generating
sialylated glycoproteins.
Oligosaccharides on proteins are commonly attached to asparagine residues
found within Asn-X-Ser/Thr consensus sequences; such asparagine-linked
oligosaccharides are commonly referred to as "N-linked". The sialylation of N-
linked
glycans occurs in the Golgi apparatus by the following enzymatic mechanism:
CMP-
SA + Ga1G1cNAcMan-R sialyltransferase SAGa1G1cNAcMan-R + CMP. The
successful execution of this sialylation reaction depends on the presence of
three
elements: 1) the correct carbohydrate acceptor substrate (designated
GalGlcNAcMan-
R in the above reaction; where the acceptor substrate is a branched glycan,
GalGlcNAcMan is comprised by at least one branch of the glycan, the Gal is a
terminal Gal, and R is an N-linked glycan); 2) the proper donor nucleotide
sugar,
cytidine monophosphate-sialic acid (CMP-SA); and 3) a sialyltransferase
enzyme.
Each of these reaction components is limiting or missing in insect cells
(Hooker et al.
(1997) Monitoring the glycosylation pathway of recombinant human interferon-
CA 02363297 2001-08-27
WO 00/52135 15 PCT/USOO/05313
gamma produced by animal cells , Hsu et al. (1997) J. Biol. Chem. 272:9062-
9070,
Jarvis et al. (1995) Virology 212:500-511, Jenkins et al. (1998) Cell Culture
Engineering VI, Oganah et al. (1996) Bio/Technology 14:197-202).
It will be apparent to those skilled in the art that where a cell of interest
is
manipulated according to the methods of the invention such that the cell
produces a
desired level of the donor substrate CMP-SA, and expresses a desired level of
sialyltransferase; any oligosaccharide or monosaccharide, any compound
containing
an oligosaccharide or monosaccharide, any compatible aglycon (for example Gal-
sphingosine), any asparagine (N)-linked glycan, any serine- or threonine-
linked (0-
linked) glycan, and any lipid containing a monosaccharide or oligosaccharide
structure can be a proper acceptor substrate and can be sialylated within the
cell of
interest.
Accordingly, the methods of the invention may be applied to generate
sialylated glycoproteins for which the acceptor substrate is not necessarily
limited to
the structure GalGlcNAcMan-R, although this structure is particularly
recognized as
an appropriate acceptor substrate structure for production of N-linked
sialylated
glycoproteins. Thus, according to the methods of the present invention, the
acceptor
substrate can be any glycan. Preferably, the acceptor substrate according to
the
methods of the invention is a branched glycan. Even more preferably, the
acceptor
substrate according to the methods of the invention is a branched glycan
comprising a
terminal Gal in at least one branch of the glycan. Yet even more preferably,
the
acceptor substrate according to the methoids of the invention has the
structure
Ga1GIcNAcMan in at least one branch of the glycan and the Gal is a terminal
Gal.
It will also be apparent to those skilled in the art that engineering the
sialylation process into cells of interest according to the methods of the
present
invention requires the successful manipulation and integration of multiple
interacting
metabolic pathways involved in carbohydrate processing. These pathways include
participation of glycosyltransferases, glycosidases, the donor nucleotide
sugar (CMP-
SA) synthetases, and sialic acid transferases. "Carbohydrate processing
enzymes" of
the invention are enzymes involved in any of the glycosyltransfer,
glycosidase, CMP-
SA synthesis, and sialic acid transfer pathways. Known carbohydrate
engineering
efforts have generally focused on the expression of transferases (Lee et al.
(1989) J.
CA 02363297 2001-08-27
WO 00/52135 16 PCT/US00/05313
Biol. Chem. 264:13848-13855, Wagner et al. (1996) J. Virology 70:4103-4109,
Jarvis
et al. (1996) Nature Biotech. 14:1288-1292, Hollister et al. (1998)
Glycobiology
8:473-480, Smith et al. (1990) 1 Biol. Chem. 265:6225-6234, Grabenhorst et al.
(1995) Eur. I Biochem. 232:718-725; U.S. Patent No. 5,047,335; International
patent
application publication number WO 98/06835). However, it is recognized in this
invention that the mere insertion of one or more transferases into cells of
interest does
not ensure sialylation, as there are generally insufficient levels of the
donor (CMP-
SA) and the acceptor substrates, particularly Ga1G1cNAcMan-R.
The methods of the present invention permit manipulation of glycoprotein
production in cells of interest by enhancing the production of donor
nucleotide sugar
substrate (CMP-SA) and optionally, by introducing and expressing
sialyltransferase
and/or acceptor substrates. By "cells of interest" is intended any cells in
which the
endogenous CMP-SA levels are not sufficient for the production of a desired
level of
sialylated glycoprotein in that cell. The cell of interest can be any
eukaryotic or
prokaryotic cell. Cells of interest include, for example, insect cells, fungal
cells, yeast
cells, bacterial cells, plant cells, mammalian cells, and the like. Human
cells and cell
lines are also included in the cells of interest and may be utilized according
to the
methods of the present invention to, for example, manipulate sialylated
glycoproteins
in human cells and/or cell lines, such as, for example, kidney, liver, and the
like. By
"desired level" is intended that the quantity of a biochemical comprised by
the cell of
interest is altered subsequent to subjecting the cell to the methods of the
invention. In
this manner, the invention comprises manipulating levels of CMP-SA and/or
sialylated glycoprotein in the cell of interest. In a preferred embodiment of
the
invention, manipulating levels of CMP-SA and sialylated glycoprotein comprise
increasing the levels to above endogenous levels. It is recognized that the
increase
can be from a non-detectable level to any detectable level; or the increase
can be from
a detected endogenous level to a higher level.
According to the present invention, production of the acceptor substrate is
achieved by optionally screening a variety of cell lines for desirable
processing
enzymes, suppressing unfavorable cleavage reactions that generate truncated
carbohydrates, and/or by enhancing expression of desired glycosyltransferase
enzymes such as galactose transferase. Methods of enhancing expression of
certain
CA 02363297 2008-11-03
17
carbohydrate processing enzymes, including but not limited to,
glycosyltransferases,
are described in U.S. Patent No. 5,047,335 and International patent
application
publication number WO 98/06835.
According to the present invention, production of the donor substrate, CMP-
SA, may be achieved by adding key precursors such as N-acetylmannosamine
(ManNAc), N-acetylglucosamine (G1cNAc) and glucosamine to cell growth media,
by enhancing expression of limiting enzymes in CMP-SA production pathway in
the
cells, or any combination thereof.
For purposes of the present invention, by "enhancing expression" is intended
to mean that the translated product of a nucleic acid encoding a desired
protein is
higher than the endogenous level of that protein in the host cell in which the
nucleic
acid is expressed. In a preferred embodiment of the invention, the biological
activity
of a desired carbohydrate processing enzyme is increased by enhancing
expression of
the enzyme.
For the purposes of the invention, by "suppressing activity" is intended to
mean decreasing the biological activity of an enzyme. In this aspect, the
invention
encompasses reducing the endogenous expression of the enzyme. protein, for
example,
by using antisense and/or ribozyme nucleic acid sequences -corresponding to
the
amino acid sequences of the enzyme; gene knock-out mutagenesis; and/or by
inhibiting the activity of the enzyme protein, for example, by using chemical
inhibitors.
By "endogenous" is intended' to mean the type and/or quantity of a biological
function or a biochemical composition that is present in a naturally occurring
or .
25' recombinant cell prior to manipulation of that cell according to the
methods of the
invention.
By "heterologous" is intended to mean the type.and/or quantity of a biological
function or a biochemical composition that is not present in a naturally
occurring or
recombinant cell prior to manipulation of that cell by the methods of the
invention.
For purposes the present invention, by "a heterologous polypeptide or protein"
is meant as a polypeptide or protein expressed (i.e. synthesized) in a cell
species of
CA 02363297 2001-08-27
WO 00/52135 18 PCT/US00/05313
interest that is different from the cell species in which the polypeptide or
protein is
normally expressed (i.e. expressed in nature).
Methods for determining endogenous and heterologous functions and
compositions relevant to the invention are provided herein; and otherwise
encompass
those methods known in the art.
Generation of Acceptor Carbohydrate Substrate: GalGlcNAcMan-R:
According to the methods of the present invention, production of the acceptor
substrate glycan GalGlcNAcMan-R, is particularly desirable for the sialylation
reaction of N-linked glycoproteins, moreover the terminal Gal is required.
Thus, in
one embodiment of the invention the cells of interest are manipulated (using
techniques described herein or otherwise known in the art) to contain this
substrate.
For example, for insect cells which principally produce truncated
carbohydrates
terminating in Man or G1cNAc, such cells may routinely be manipulated to
produce a
significant fraction of complex oligosaccharides terminating in Gal. Three non
limiting, non-exclusive approaches that may be routinely applied to produce a
significant fraction of complex oligosaccharides terminating in Gal include:
(1)
developing screening assays to analyze a selection of insect cell lines for
the presence
of particular carbohydrate processing enzymes; (2) elevating production of Gal-
terminated oligosaccharides by expressing specific enzymes relevant to
carbohydrate
processing pathways; and (3) suppressing carbohydrate processing pathways that
produce truncated N-linked glycans which cannot serve as acceptors in
downstream
glycosyltransferase reactions.
Thus, in one embodiment, to produce GalGlcNAcMan-R acceptor substrates
according to the methods of the invention, cell lines of interest are
initially, and
optionally, screened to identify cell lines with the desired endogenous
carbohydrate
production for subsequent metabolic manipulations. More particularly, the
screening
process includes characterizing cell lines for glycosyl transferase activity
using
techniques described herein or otherwise known in the art. Furthermore, it is
recognized that any screened cell line could generate some paucimannosidic
carbohydrates. Accordingly, the screening process also includes using
techniques
CA 02363297 2001-08-27
WO 00/52135 19 PCTIUSOO/05313
described herein or otherwise known in the art to characterize cell lines for
particular
glycosidase activity leading to production of paucimannosidic structures.
Thus, in another embodiment, for the production of the acceptor substrates,
the
invention encompasses utilizing methods described herein or otherwise known in
the
art to enhance the expression of one or more transferases. Such methods
include, but
are not limited to, methods that enhance expression of Gal T, G1cNAc -TI and -
TII or
any combination thereof; for example, as described in International patent
application
publication number WO 98/06835 and U.S. Patent No. 5,047,335.
Thus, in another embodiment, concentrations of acceptor substrates are
increased by using methods described herein or otherwise known in the art to
suppress the activity of one or more endogenous glycosidases. By way of
example,
an endogenous glycosidase, the activity of which may be suppressed accoreding
to the
methods of the invention includes, but is not limited to, the hexosaminidase,
N-
acetylglucosaminidase (an enzyme that degrades the substrate required for
oligosaccharide elongation).
Thus, the invention encompasses enhancing metabolic pathways that produce
the desired acceptor carbohydrates and/or suppressing those pathways that
produce
truncated acceptors.
Characterizing cell lines using enzyme screening assay
The cell lines of interest produce different N-glycan structures. Thus, such
cells can routinely be screened using techniques described herein or otherwise
known
in the art to determine the presence of carbohydrate processing enzymes of
interest.
In insect cells, for example, different insect cell lines produce very
different N-glycan
structures (Jarvis et al. (1995) Virology 212:500-511, Hsu et al. (1997) J.
Biol. Chem.
272:9062-9070, Nishimura et al. (1996) Bioorg. Med. Chem. 4:91-96). However,
only a few cell lines have been characterized, in part due to the lack of
efficient
screening assays. The present invention provides methods implementing
fluorescence
energy transfer and Europium fluorescence assays to screen a selection of
different
cells of interest, such as, for example, insect cell lines for the presence of
critical
carbohydrate processing enzymes.
CA 02363297 2001-08-27
WO 00/52135 20 PCT/US00/05313
Analytical bioassays described herein or otherwise known in the art are also
provided according to the methods of the present invention to detect the
presence of
favorable carbohydrate processing enzymes, including, but not limited to,
galactosyl
transferase (Gal T), GIcNAc transferase I (GIcNAc T I), and sialyltransferase;
and to
detect undesirable enzymes including, but not limited to, N-
acetylglucosaminidase.
Where the cells of interest are insect cells, it will be immediately apparent
that
substantial diversity exists among established insect cell lines due to the
range of
species and tissues from which these lines were derived. Many of these lines
can
routinely be infected by the baculovirus, Autographa californica nuclear
polyhedrosis
virus (AcMNPV), and used for the production of heterologous proteins. However,
only a few cell lines are routinely used for recombinant protein production
using
techniques described herein or otherwise known in the art. These cell lines
will be
immediately apparent by one skilled in the art. It is recognized that any cell
line can
be screened for specific carbohydrate processing enzymes, and manipulated for
the
purposes of the present invention. Examples of such cell lines include, but
are not
limited to, insect cell lines, including but not limited to, Spodoptera
frugiperda (e.g.
Sf-9 or Sf-21 cells), Trichoplusia ni (T. ni), and Estigmene acrea (Ea4).
Spodoptera
frugiperda lines (Sf-9 or Sf-21) are the most widely used cell lines and a
significant
amount information is known about the oligosaccharide processing in these
cells.
Trichoplusia ni (e.g. High Five TM cells; Invitrogen Corp., Carlsbad, CA, USA)
cells
have been shown to secrete high yields of heterologous proteins with attached
hybrid
and complex N-glycans (Davis et al. (1993) In Vitro Cell. Dev. Biol. 29:842-
846).
Estigmena acrea (Ea-4) have been used to generate hybrid and complex N-linked
oligosaccharides terminating in G1cNAc and Gal residues (Oganah et al. (1996)
Bio/Technology 14:197-202).
Drosophila Schneider S2 cell lines represent another insect cell line used for
the production of heterologous proteins. Though these cells cannot be infected
by the
AcNPV expression vector, they are used for production of heterologous proteins
via
an alternative technology known in the art. These cell lines represent other
insect cell
line candidates whose glycosylation processing characteristics may be modified
to
include sialylation.
CA 02363297 2001-08-27
WO 00/52135 21 PCT/US00/05313
In insect cells, paucimannosidic structures are produced by a membrane-bound
N-acetylglucosaminidase, which removes terminal G1cNAc residues from the
alpha(1,3) arm of the trimannosyl core (Altmann et al. (1995) J. Biol. Chem.
270:17344-17349). This trimannosyl core structure lacks the proper termini
required
for conversion of side chains to sialylated complex structures; therefore,
suppression
of the N-acetylglucosaminidase activity can reduce or eliminate the formation
of these
undesired oligosaccharide structures, as illustrated in Figure 17.
To reduce the N-acetylglucosaminidase activity in the target insect cell
line(s),
the invention provides vectors encoding N-acetylglucosaminidase or other
glucosaminidase cDNAs in the antisense orientation and/or, vectors encoding
ribozymes and/or, vectors containing sequences capable of "knocking out" the N-
acetylglucosaminidase other glucosaminidase genes via homologous
recombination.
Expression plasmids described herein or otherwise known in the art are
constructed
using techniques known in the art to produce stably-transformed insect cells
that
constitutively express the antisense construct and/or ribozyme construct to
suppress
translation of N-acetylglucosaminidase other glucosaminidases or
alternatively, to use
homologous recombination techniques known in the art are to "knock-out" the N-
acetylglucosaminidase other glucosaminidase genes. Particular sequences to be
used
in the antisense and/or ribozyme construction are described herein, for
example, in
Example 4. Techniques described herein or otherwise known in the art may be
routinely applied to analyze N-linked oligosaccharide structures and to
determine if
N-glycan processing is altered and of the number of paucimannosidic structures
in
these cells is reduced.
Antisense technology can be used to control gene expression through
antisense DNA or RNA or through triple-helix formation. Antisense techniques
are
discussed, for example, in Okano, J. Neurochem. 56: 560 (1991);
"Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca Raton, FL (1988). Antisense technology can be used to control gene
expression
through antisense DNA or RNA, or through triple-helix formation. Antisense
techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca
Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et
al.,
CA 02363297 2001-08-27
WO 00/52135 22 PCT/US00/05313
Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988);
and
Dervan et al., Science 251: 1360 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA. For example, the 5' coding
portion of a polynucleotide that encodes the amino terminal portion of N-
acetylglucosaminidase and/or other glucosaminidases may be used to design
antisense RNA oligonucleotides of from about 10 to 40 base pairs in length. A
DNA
oligonucleotide is designed to be complementary to a region of the gene
involved in
transcription thereby preventing transcription and the production of N-
acetylglucosaminidase and/or other glucosaminidases. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the
mRNA
molecule into N-acetylglucosaminidase and/or other glucosaminidase
polypeptides.
The oligonucleotides described above can also be delivered to cells such that
the
antisense RNA or DNA may be expressed in vivo to inhibit production of N-
acetylglucosaminidase and/or other glucosaminidases.
In one embodiment, the N-acetylglucosaminidase and/or other
glucosaminidase antisense nucleic acids of the invention are produced
intracellularly
by transcription from an exogenous sequence. For example, a vector or a
portion
thereof, is transcribed, producing an antisense nucleic acid (RNA) of the
invention.
Such a vector would contain a sequence encoding a N-acetylglucosaminidase
and/or
other glucosaminidase antisense nucleic acids. Such a vector can remain
episomal or
become chromosomally integrated, as long as it can be transcribed to produce
the
desired antisense RNA. Such vectors can be constructed by recombinant DNA
technology methods standard in the art. Vectors can be plasmid, viral, or
others know
in the art, used for replication and expression in insect, yeast, mammalian,
and plant
cells. Expression of the sequences encoding N-acetylglucosaminidase and/or
other
glucosaminidases, or fragments thereof, can be by any promoter known in the
art to
act in insect, yeast, mammalian, and plant cells. Such promoters can be
inducible or
constitutive. Such promoters include, but are not limited to, the baculovirus
polyhedrin promoter (Luckow et al. (1993) Curr. Opin. Biotech. 4:564-572,
Luckow
et al. (1995)), the SV40 early promoter region (Bernoist and Chambon, Nature
29:304-310 (1981), the promoter contained in the 3' long terminal repeat of
Rous
sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine
CA 02363297 2001-08-27
WO 00/52135 23 PCT/US00/05313
promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981),
the
regulatory sequences of the metallothionein gene (Brinster, et al., Nature
296:39-42
(1982)), etc.
The antisense nucleic acids of the invention comprise sequences
complementary to at least a portion of an RNA transcript of N-
acetylglucosaminidase
and/or other glucosaminidase genes. However, absolute complementarity,
although
preferred, is not required. A sequence "complementary to at least a portion of
an
RNA," referred to herein, means a sequence having sufficient complementarity
to be
able to hybridize with the RNA, forming a stable duplex; in the case of double
stranded N-acetylglucosaminidase and/or other glucosaminidase antisense
nucleic
acids, a single strand of the duplex DNA may thus be tested, or triplex
formation may
be assayed. The ability to hybridize will depend on both the degree of
complementarity and the length of the antisense nucleic acid Generally, the
larger the
hybridizing nucleic acid, the more base mismatches with a N-
acetylglucosaminidase
and/or other glucosaminidase RNAs it may contain and still form a stable
duplex (or
triplex as the case may be). One skilled in the art can ascertain a tolerable
degree of
mismatch by use of standard procedures to determine the melting point of the
hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g.,
the 5' untranslated sequence up to and including the AUG initiation codon,
should
work most efficiently at inhibiting translation. However, sequences
complementary
to the 3' untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994,
Nature
372:333-335. Thus, oligonucleotides complementary to either the 5'- or 3'- non-
translated, non-coding regions of N-acetylglucosaminidase and/or other
glucosaminidases, could be used in an antisense approach to inhibit
translation of
endogenous N-acetylglucosaminidase and/or other glucosaminidase mRNAs.
Oligonucleotides complementary to the 5' untranslated region of the mRNA
should
include the complement of the AUG start codon. Antisense oligonucleotides
complementary to mRNA coding regions are less efficient inhibitors of
translation
but could be used in accordance with the invention. Whether designed to
hybridize to
the 5'-, 3'- or coding region of N-acetylglucosaminidase and/or other
glucosaminidase
CA 02363297 2001-08-27
WO 00/52135 24 PCTIUSOO/05313
mRNAs, antisense nucleic acids should be at least six nucleotides in length,
and are
preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
In
specific aspects the oligonucleotide is at least 10 nucleotides, at least 17
nucleotides,
at least 25 nucleotides or at least 50 nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double-
stranded. The oligonucleotide can be modified at the base moiety, sugar
moiety, or
phosphate backbone, for example, to improve stability of the molecule,
hybridization,
etc. The oligonucleotide may include other appended groups such as peptides
(e.g.,
for targeting host cell receptors in vivo), agents facilitating transport
across the cell
membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A.
86:6553-
6556; Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652 (1987); PCT
Publication No.
W088/09810, published December 15, 1988), or hybridization-triggered cleavage
agents (See, e.g., Krol et al., BioTechniques 6:958-976 (1988)) or
intercalating
agents. (See, e.g., Zon, Pharm. Res. 5:539-549 (1988)). To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization
triggered cross-linking agent, transport agent, hybridization-triggered
cleavage agent,
etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which is selected from the group including, but not limited to, 5-
fluorouracil, 5-
bromouracil, 5-chorouracil, 5-iodouracil, hypoxanthine, xantine, 4-
acetylcytosine, 5-
(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-
carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-
methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-
thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-
oxyacetic
acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil,
(acp3)w,
and 2,6-diaminopurine.
CA 02363297 2001-08-27
WO 00/52135 25 PCT/US00/05313
The antisense oligonucleotide may also comprise at least one modified sugar
moiety selected from the group including, but not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least
one modified phosphate backbone selected from the group including, but not
limited
to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an alpha-anomeric
oligonucleotide. An alpha -anomeric oligonucleotide forms specific double-
stranded
hybrids with complementary RNA in which, contrary to the usual beta-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-
6641
(1987)). The oligonucleotide is a 2-0-methylribonucleotide (Inoue et al.,
Nucl. Acids
Res. 15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al., FEBS
Lett. 215:327-330 (1997)).
Polynucleotides of the invention may be synthesized by standard methods
known in the art, e.g. by use of an automated DNA synthesizer (such as are
commercially available from Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate oligonucleotides may be synthesized by the method of Stein et
al.
(Nucl. Acids Res. 16:3209 (1988)), methylphosphonate oligonucleotides can be
prepared by use of controlled pore glass polymer supports (Sarin et al., Proc.
Natl.
Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc.
While antisense nucleotides complementary to the N-acetylglucosaminidase
and/or other glucosaminidase coding region sequences could be used, those
complementary to the transcribed untranslated region are most preferred.
Potential N-acetylglucosaminidase or other glucosaminidase activity
suppressors according to the invention also include catalytic RNA, or a
ribozyme
(See, e.g., PCT International Publication WO 90/11364, published October 4,
1990;
Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA
at
site specific recognition sequences can be used to destroy N-
acetylglucosaminidase
and/or other glucosaminidase mRNAs, the use of hammerhead ribozymes is
preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking
CA 02363297 2008-11-03
26
regions that form complementary base pairs with the target*mRNA. The sole
requirement is that the target mRNA have the following sequence of two bases:
5'-
UG-3'. The construction and production of hammerhead ribozymes is well known
in
the art and is described more fully in Haseloff and Gerlach, Nature 334:585-
591
(1988). Preferably, the ribozyme is engineered so that the cleavage
recognition site is
located near the 5' end of the N-acetylglucosaminidase and/or other
glucosaminidase
mRNAs; i.e., to increase efficiency and minimize the intracellular
accumulation of
non-functional mRNA transcripts.
As in the antisense approach, the ribozymes of the invention can be composed
of modified oligonucleotides (e.g. for improved stability, targeting, etc.)
and should
be delivered to cells which express N-acetylglucosaminidase and/or other
glucosaminidases in vivo. DNA constructs encoding the ribozyme may be
introduced
into the cell in the same manner as described above for the introduction of
antisense
encoding DNA. A preferred method of delivery involves using a DNA construct
"encoding" the ribozyme under the control of a. strong constitutive promoter,
such as,
for example, pol III or pol II promoter, so that transfected cells will
produce sufficient
quantities of the ribozyme to destroy endogenous N-acetylglucosaminidase
and/or
other glucosaminidase messages and inhibit translation. Since ribozymes unlike
antisense molecules, are catalytic, a lower intracellular concentration is
required for
efficiency.
Endogenous gene expression can also be reduced by inactivating or "knocking
out" the N-acetylglucosaminidase and/or other glucosaminidase gene and/or its
promoter using targeted homologous recombination. (E.g., see Smithies et al.,
Nature
317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512 (1987); Thompson et
al.,
Cell 5:313-321 (1989).
For example, a mutant, non-functional polynucleotide of the invention, or a
completely unrelated DNA sequence (such as for example, a sialic acid
synthetase)
flanked by DNA homologous to the endogenous polynucleotide sequence (either
the
coding regions or regulatory regions of the gene) can be used, with or without
a
selectable marker and/or a negative selectable marker, to transfect cells that
express
polypeptides of the invention in vivo. In another embodiment, techniques known
in
the art are used to generate knockouts in cells that contain, but do not
express the
CA 02363297 2008-11-03
27
gene of interest. Insertion of the DNA construct, via targeted homologous
recombination, results in inactivation of the targeted gene. Such approaches
are
particularly suited in research and agricultural fields where modifications to
embryonic stem cells can be used to generate animal offspring with an inactive
targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
The use of chemical inhibitors is also within the scope of the present
invention, in addition to, or as an alternative to, the antisense approach,
and/or the
ribozyme approach, and/or the gene "knock-out" approach, as means for
suppressing
glucosaminidase activity in insect cell cultures. Chemical inhibitors that may
be used
to suppress glucosaminidase activity include, but are not limited to, 2-
acetamido-
1,2,5-trideoxy-1,5 amino-D-glucitol can limit the N-acetylglucosaminidase
activity.in
insect cells (Legler et al. (1991) Biochim. Biophys. Acta 1080:80-95, Wagner
et al.
(1996) J Virology 70:4103-4109). In addition, a number of other N-
acetylglucosaminidase inhibitors may also be used according to the present
invention,
including, but not limited to, nagastatin (with a K1 value in the 10'8 range)
and
GIeNAc-oxime (K, in 0.45-22 mM) which are commercially, publicly, or otherwise
available for the purposes of the, present invention (Nishimura et al. (1996)
Bioorg.
Med. Chem. 4:91-96, Aoyagi et al. (1992) J. Antibiotics 45:1404-1408).
The chemical inhibitors mentioned above do not distinguish between
lysosomal N-acetyiglucosaminidase and the -target membrane-bound N-
acetylglucosaminidase activity in the secretory compartment. Thus, a more
specific
inhibitor, based on the substrate structure, is provided to. serve not merely
as a.
competitive inhibitor, but also as an affinity labeling reagent. The chemical
structure
for two possible chemical compounds with specificity for inhibiting-membrane-
bound
glucosaminidase one or both of which may be used according .to the present
invention,
are shown in Figure 19. Subsequent to expression and purification of the N-
acetylglucosaminidase, the effectiveness of these inhibitors may be tested and
compared in in vitro and/or in vivo trials using techniques described herein
or
otherwise known in the art. As above, these chemical inhibitors are then used
in
CA 02363297 2001-08-27
WO 00/52135 28 PCT/US00/05313
addition to, or as an alternative to, antisense suppression, ribozyme
suppression,
and/or gene knock-out mutagenesis, of glucosaminidase activity in insect
cells.
It is recognized that the suppression of glucosaminidase activity alone may
not
lead to production of the desired acceptor carbohydrate, if the enzymes
responsible
for generating structures terminating in Gal are lacking in particular cell
lines. Thus,
according to the methods of the present invention, Gal T activity in insect
cells can be
increased significantly by using techniques described described herein or
otherwise
known in the art to express a heterologous gene using a baculovirus construct
containing nucleic acid sequences encoding Gal T or a fragment or variant
thereof, or
by stably transforming the cells with a gene coding for Gal T or a fragment or
variant
thereof. If N-glycan analysis indicates that lower than a desired level of the
acceptor
substrates are present even following glucosaminidase suppression, techniques
described herein or otherwise known in the art may be applied to express
glycosyltransferase enzymes as needed in insect cells to produce a larger
fraction of
the desired acceptor structures. Figure 20 depicts that the overexpression of
various
glycosyltransferases leads to greater production of acceptor substrates.
Alternatively, the expression of glycosyltransferases will serve to limit
generation of paucimannosidic structures by generating unacceptable
glucosaminidase
substrates terminating in Gal, or by competing against the glucosaminidase
reaction
(Wagner et al., Glycobiology 6:165-175 (1996)).
Thus, the invention comprises expression of glycosyltransferases combined
with, or as an alternative to, suppression of N-acetylglucosaminidase activity
in
selected insect cell lines to produce desired quantities of carbohydrates
containing the
correct Gal (G) acceptor substrate for sialylation. Figure 21 illustrates,
without
limitation, three examples of acceptor N-glycan structures that comprise the
terminal
Gal acceptor residue required for subsequent sialylation. Other desired
carbohydrates
structures with a branch terminating Gal are also possible and are encompassed
by the
invention.
Baculovirus expression vectors containing the coding sequence for G1cNAc -
TI and -TII, and Gal T or fragments or variants thereof, and stable
transfectants
overexpressing G1cNAc-TI and G1cNAc-TII, and Gal T, or fragments or variants
thereof are known, can be routinely generated using techniques known in the
art, and
CA 02363297 2008-11-03
29
are commercially, publicly, or otherwise available for the purposes of this
tnvennon_
(See Jarvis er al. (1996) Nature Biotech. 14:1288-1292; Hollister er al.
(1998)
Glycobiology 8: 473-480).
In addition, stable transfectants expressing GlcNAc-TI and GlcNAc-T11 can be
routinely generated using techniques known in the an, if ovcrexpression proves
desirable.
Producpon and delivery of the -Donor Substrate: CMP-Sialic Acid (CMP-SA)
For production of the donor substrate, CMP-SA, the invention provides
methods and compositions comprising expression of limiting enzymes in the CMP-
SA production pathway; in addition, or as an alternative to, the feeding of
precursor
substrates.
To produce sialylated N-linked glycoproteins, the donor substrate, CMP-sialie
acid (CMP-SA), must be synthesized. The structure of CMP-SA is shown in figure
22. CMP-SA can be enzymatically synthesized from glucose or other simple
sugars,
glutamine, and nucleotides in mammalian cells and E. coli using the metabolic
pathways shown in Figure 5, and as described in Ferwerda er al. (1983)
Biochem. I.
216:87-92; Malimoudian et at. (1997) Enzyme and Microbial Technology 20.393-
400;
Schachter et al. (1973) Metabolic Conjugation and Metabolic Hydrolysis (New
York
Academic Press) 2-135.
In some mammalian tissues and cell lines, the production and delivery of
CMP-SA limits the sialylauon capacity of these cells (Gu et al. (1997)
Improvement
of the interferon-gamma siulylarion in Chinese hamster ovary cell culture by
feeding
N-acerylrnannosamine). This problem is likely to be amplified in insect cells
since
negligible sialic acid levels are detected in Trichoplusia ni insect cells as
compared to
levels in Chinese Hamster Ovary (CHO) mammalian cells (Figures 16A-B).
Furthermore, negligible CMP-SA was observed in Sf-9 and Ea-4 insect cells when
compared to CHO cells (Hooker er al. (1997) Monitoring the Glycosylarion
Pathway
of Recombinant Human Interferon -Gamma Produced by Animal Cells, European
Workshop on Animal Cell Engineering, Costa Brava, Spain; and Jenkins (1998)
Restructuring the Carbohydrarrs of Recombinant Glycoproteins, Cell Culture
Engineering V1, Sun Diego, CA) These findings are relevant in light of the
CA 02363297 2001-08-27
WO 00/52135 30 PCT/US00/05313
previously published observation that polysialic acid can be detected in
Drosophila
embryos (Roth et al. (1992) Science 256:673-675) and the observation of
sialylated
glycoproteins produced by other insect cells (Davidson et al. (1990)
Biochemistry
29:5584-5590).
Production of sialic acid (SA), more specifically N-acetylneuraminic acid
(NeuAc), from the precursor substrate ManNAc can proceed through three
alternative
pathways shown in Figure 5. The principal pathway for the production of SA in
E.
coli and other bacteria utilizes the phosphoenylpyruvate (PEP) and ManNAc to
produce sialic acids in the presence of sialic acid synthetase (Vann et al.
(1997)
Glycobiology 7:697-701). A second pathway, observed in bacteria and mammals,
involves the reversible conversion by aldolase (also named N-acetylneuraminate
lyase) of ManNAc and pyruvate to sialic acid (Schachter et al. (1973)
Metabolic
Conjugation and metabolic Hydrolysis (New York Academic Press) 2-135, Lilley
et
al. (1992) Prot. Expr. and Pur. 3:434-440). The aldolation reaction
equilibrates
toward ManNAc but can be manipulated to favor the production of sialic acid by
the
addition of excess ManNAc or pyruvate in vitro (Mahmoudian et al. (1997)
Enzyme
and Microbial Technology 20:393-400). The third pathway, observed only in
mammalian tissue, begins with the ATP driven phosphorylation of ManNAc, and is
followed by the enzymatic conversion of phosphorylated ManNAc to a
phosphorylated form of sialic acid, from which the phosphate is removed in a
subsequent step (van Rinsum et al. (1983) Biochem. J. 210:21-28, Schachter et
al.
(1973) Metabolic Conjugation and metabolic Hydrolysis (New York Academic
Press) 2-135).
According to one embodiment of the invention, to overcome intracellular
limitations of CMP-SA in mammalian cells, feeding of alternative precursor
substrates may be applied to eliminate or reduce the need to produce CMP-SA
from
simple sugars (see Example 6). Since CMP-SA and its direct precursor, SA, are
not
permeable to cell membranes (Bennetts et al. (1981) J. Cell. Biol. 88:1-15),
these
substrates cannot be added to the culture medium for uptake by the cell.
However,
other precursors, including N-acetylmannosamine (ManNAc), glucosamine, and N-
acetylglucosamine (G1cNAc) when added to the culture medium are absorbed into
mammalian cells (see Example 6). See, for example, Gu et al. (1997)
Improvement of
CA 02363297 2008-11-03
t t 31
the interferon-gamma sialylation in Chinese hamster ovary cell culture by
feeding N-
acetylmannosamine, Zanghi et al. (1997) European Workshop on Animal Cell
Engineering, Ferwerda et al. (1983) Biochem. J. 216:87-92, Kohn et al. (1962)
J.
Biol. Chem. 237:304-308, Thomas et al. (1985) Biochim. Biophys. Acta 846:37-
43,
Bennetts et al. (1981) J. Cell. Biol. 88:1-15. The substrates are then
enzymatically
converted to CMP-SA and incorporated into homologous and heterologous
glycoproteins (Gu et al. (1997) Improvement of the interferon-gamma
sialylation in
Chinese hamster ovary cell culture by feeding N-acetylmannosamine, Ferwerda et
al.
(1983) Biochem. J. 216:87-92, Kohn et al. (1962) J. Biol. Chem. 237:304-308,
Bennetts et al. (1981) J. Cell_ Biol. 88:1-15).
To be incorporated into oligosaccharides, sialic acid and cytidine
triphosphate
(CTP) must be converted to CMP-SA by the enzyme, CMP-sialic acid (CMP-SA)
synthetase (Schachter et al. (1973) Metabolic Conjugation and metabolic
Hydrolysis
(New York Academic Press) 2-135):
Sialic Acid + CTP -RCMP-SA + PPi
This enzyme has been cloned and sequenced from E. coli and used for the in
vitro production of CMP-SA, as described in Zapata et al. (1989) J. Biol.
Chem.
264:14769-14774, Kittleman et al. (1995) Appl. Microbiol. Biotechnol. 44:59-
67,
Ichikawa et al. (1992) Anal. Biochem. 202:215-238, Shames et al. (1991)
Glycobiology 1:187-191.
In eukaryotes, the activated sugar nucleotide, CMP-SA,, must be transported
into the, Golgi lumen for sialylation to proceed (Deutscher et al. (1984) Cell
39:295-
- 299). Transport through the trans-Golgi membrane is facilitated by the CMP-
SA
transporter protein, which was identified by complementation cloning into
sialylation
deficient CHO cells (Eckhardt et al. (1996) Proc. Natl. Acad. "Sci. USA
93:7572-
7576). This mammalian gene has also been cloned and expressed in a functional
form
in the heterologous host, S. cerevisiae (Bernisone et al. (1997) J. Biol.
Chem.
272:12616-12619).
In addition to feeding of external precursor substrates such as ManNAc,
G1cNAc, or glucosamine to increase CMP-SA levels, a supplementary approach in
CA 02363297 2008-11-03
32
which CMP-SA transporter genes are introduced and expressed using routine
recombinant DNA techniques may also be employed according to the methods of
the
present invention. These techniques are optionally combined with ManNAc,
GIcNAc, or glucosamine feeding strategies described above, to maximize CMP-SA
production.
Conversion of GIcNAc or glucosamine to ManNAc
Also according to the methods of the present invention, where the utilization
of GIcNAc or glucosamine is preferred and ManNAc is not generated naturally in
insect cells, ManNAc can be produced chemically using sodium hydroxide
(Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400).
Alternatively, the enzymes that convert these substrates to ManNAc or
fragments or
variants of these enzymes, can be expressed in insect cells using techniques
described
herein or otherwise known in the art. The production of ManNAc from GIcNAc and
glucosamine proceeds through the metabolic pathway shown in Figure 23.
Two approaches are provided to accomplish this conversion: (a) direct
epimerization of GIcNAc; or (b) -conversion of GIcNAc or glucosamine to UDP-N-
acetylglucosamine (UDP-G1cNAc), and then ManNAc. According to one embodiment
of the invention, approach (a) is achieved using the gene encoding a GIcNAc-2-
epimerase isolated from pig kidney, or fragments or variants thereof, to
directly
convert GIcNAc to ManNAc (See Maru et al. (1996) J. Biol. Chem. 271:16294-
16299). Additionally, the
sequence for a homologue of this enzyme can be routinely obtained from
bioinformatics databases, and cloned into baculovirus vectors, or stably
integrated
into insect cells using techniques described herein or otherwise known in the
art.
Alternatively, approach (b) requires insertion of the gene to convert UDP-
G1cNAc to ManNAc. Engineering the production of UDP-GIcNAc from glucosamine
or GIcNAc is likely not required since most insect cells comprise metabolic
pathways
to synthesize UDP-GIcNAc; as indicated by the presence of'GlcNAc-containing
oligosaccharides. According to one embodiment of the invention, the gene
encoding
a rat bifunctional enzyme coding for conversion of UDP-GIcNAc to ManNAc and
ManNAc to ManNAc-6-P, or fragments or variants thereof is used to engineer the
CA 02363297 2008-11-03
3
production of UDP-GIcNAc using techniques described herein or otherwise known
in
the art (Stasche et at. (1997) J Biol. Chem. 272:24319-24324).
In a specific embodiment, the segment of this
enzyme responsible for conversion of UDP-GINAc to ManNAc may be expressed
independently in insect cells using techniques known in the art to produce
ManNAc
rather than ManNAc-6-P.
Conversion of ManNAc to SA
Once ManNAc is generated, it is converted to SA according to the methods of
the invention. There are three possible metabolic pathways for the conversion
of
ManNAc to SA in bacteria and mammals, as shown in Figure 24. Negligible SA
levels have previously been observed in insect cells (in the absence of
exogenous
supplementation of ManNAc to the culture media).
The conversion of ManNAc and PEP to SA using sialic acid synthetase is the
predominant pathway for SA production in E. coli (Vann et al. (1997)
Glycobiology
7:697-701). The E. coli sialic acid (SA) synthetase gene NeuB (SEQ ID NO:7 and
8)
has been cloned and sequenced and is commercially, publicly, and/or otherwise
available for the purposes-of the present invention. Additionally, as
disclosed herein,
the human sialic acid synthetase gene has also been cloned (cDNA clone
HA5AA37),
sequenced, and deposited with the American Type Culture Collection ("ATCC"),
(The
ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA.
ATCC deposits were made pursuant to the terms of the Budapest Treaty on the
international recognition of the deposit. of microorganisms for purposes of
patent
procedure.) Thus, for enhancing expression of SA synthetase according to
certain
embodiments of the invention, the nucleic acid compositions encoding a SA
synthetase such as, for example, an E.coli and/or human sialic acid synthetase
and/or
a fragment or variant thereof, may be inserted into a host expression vector
or into the
host genome using techniques described herein or otherwise known in the art.
According to the methods of the invention, the production of SA can also be
achieved
from ManNAc and pyruvate using an aldolase, such as, for example, bacterial
aldolase (Mahmoudian et at. (1997) Enzyme and Microbial Technology 20:393-
400),
CA 02363297 2008-11-03
34
or a human aldolase (as described herein) or fragment or variant thereof. The
human
aldolase gene has been cloned (cDNA clone HDPAK85), sequenced, and deposited
with the American Type Culture Collection ("ATCC"),
Thus, the aldolase enzyme is
considered as an alternative for converting ManNAc to SA. For enhancing
expression
of aldolase, the aldolase sequences can be amplified directly from E. coli and
human
DNA using primers and PCR amplification as described in Mahmoudian et al.
(Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400)
and herein, and using
techniques described herein or otherwise known in the art to enhance
expression of
aldolase, or a fragment or variant thereof. Since the aldolase reaction is
reversible,
high levels of added ManNAc and pyruvate, may be used according to the methods
of
the invention to drive this reversible reaction in the direction of the
product SA
(Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400).
In addition to the pathways which convert ManNAc to SA present in both
prokaryotes and eukaryotes, an exclusively eukaryotic pathway may also
employed
according to the methods of the invention to convert ManNAc to SA through the
phosphate intermediates ManNAc-6-phosphate and SA-9-phosphate. It is
recognized
that the mammalian enzymes (synthetase and phosphatase) responsible for
converting
ManNAc to SA through phosphate intermediates can be utilized for engineering
this
eukaryotic pathway into insect cells.
Conversion of SA to CMP-SA
The methods of the invention also encompass the use of CMP-SA synthetase
to enzymatically converts SA to CMP-SA (see, e.g., the reaction. shown in
Figure 25).
However, insect.cells, such as, for example, Sig insect cells, have negligible
endogenous CMP-SA synthetase activity. Evidence of limited CMP-SA synthetase
in
insect cells is also demonstrated by increased SA levels found following
substrate
feeding and genetic manipulation without a concomitant increase in CMP-SA.
Thus, specific embodiments of the invention provide methods for enhancing
the expression of CMP-SA synthetase, and/or fragments or variants thereof.
Bacterial
CMP-SA synthetase has been cloned and sequenced as described in Zapata et al.
CA 02363297 2008-11-03
- 35
}
(1989) J. ' Biol. Chem. 264:14769-14774.
Additionally, as described herein the gene encoding human CMP-SA
synthetase has also been cloned (cDNA clone HWLLM34), sequenced and deposited
with the American Type Culture Collection ("ATCC") .
Thus, in specific embodiments, the
methods of the present invention provide for enhancing expression of bacterial
or
human CMP-SA synthetase or fragments, or variants thereof, in cells of
interest, such
as, for example, in insect cells, using-techniques described herein, or
otherwise known
in the art.
Golgi transport of CMP-SA
CMP-SA must be delivered into the Golgi apparatus in order for sialylation to
occur, and this transport process depends on the presence of the CMP-SA
transporter
protein (Deutscher et al. (1984) Cell 39:295-299). To determine if CMP-SA
synthesized in insect cells is efficiently transported into the proper
cellular
compartment, insect cell vesicles are prepared and transport of CMP-SA is
measured
as described in (Bemisone et al. (1997) J. Biol. Chem. 272:12616-12619) and/or
using
techniques otherwise known in .the art. Where the native enzymatic transport
is lower
than desired, a transporter enzyme is cloned and expressed in insect cells
using the
known mammalian gene sequence (as described in Bemisone et al. (1997) J. Biol.
Chem. 272:12616-12619, Eckhardt et al. (1996) Proc. Natl. Acad. Sci. USA
93:7572-
7576 ); and/or sequences
otherwise known in the art. Corresponding sequences are available from
bioinformatics databases for the purposes of this invention. Localization of
the .
25* protein to the Golgi is evaluated using an antibody generated against the
heterologous
protein using techniques known in the' art in concertwith commercially
available
fluorescent probes that identify the Golgi apparatus.
Expression cloning of multiple transcripts (for example, transcripts encoding
CMP-SA pathway enzymes, glycosyl transferases, and ribozymes or anti-sense
RNAs
to suppress hexosaminidases) in a single cell line using techniques known in
the art
may be required to bring about the desired sialylation reactions and/or to
optimize
these reactions. Alternatively, co-infection of cells with multiple viruses
using
CA 02363297 2001-08-27
WO 00/52135 36 PCT/US00/05313
techniques known in the art can also be used to simultaneously produce
multiple
recombinant transcripts. In addition, plasmids that incorporate multiple
foreign genes
including some under the control of the early promoter IE1 are commercially,
publicly, or otherwise available for the purposes of the invention, and can be
used to
create baculovirus constructs. The present invention encompasses using any of
these
techniques. The invention also encompasses using the above mentioned types of
vectors to enable expression of desired carbohydrate processing enzymes in
baculovirus infected insect cells prior to production of a heterologous
glycoprotein of
interest under control of the very late polyhedrin promoter. In this manner,
once the
desired polypeptide is synthesized essential N-glycan processing enzymes can
facilitate N-glycan processing once the glycoprotein of interest.
Alternatively, genes for some of the enzymes may be incorporated directly
into the insect cell genome using vectors known in the art, such as, for
example,
vectors similar to those described in (Jarvis et al. (1990) Bio/Technology
8:950-955,
Jarvis et al. (1995) Baculovirus Expr. Protocols ed. 39:187-202). Genomic
integration eliminates the need to infect the cells with a large number of
viral
constructs. These constructs for genomic integration contain one or more early
viral
promoters, including AcMNPV IE1 and 39K, which provide constitutive expression
in transfected insect cells (Jarvis et al. (1990) Bio/Technology 8:950-955).
In
addition, a sequential transformation strategy may routinely be developed for
producing stable transformants that constitutively express up to four
different
heterologous genes simultaneously. These vectors and transformation techniques
are
provided for the purposes of this invention. In this manner, incorporation of
plasmids
containing heterologous genes into the insect cell genome combined with
baculovirus
infection integrates the metabolic pathways leading to efficient acceptor and
donor
substrate production in insect cells.
Generation of N-linked sialylated loco rop teins
The final step in the generation of sialylated glycoproteins or glycolipids in
mammalian cells is the enzymatic transfer of sialic acid from the donor
substrate,
CMP-SA, onto an acceptor substrate in the Golgi apparatus; a reaction which is
catalyzed by sialyltransferase. The sialic acid (SA) residues occurring in N-
linked
CA 02363297 2008-11-03
37
glycoproteins are alpha-linked to the 3 or 6 position of the Ga1G1cNAc sugars
(Tsuji,
S. (1996) J Biochem. 120:1-13). The SA alpha2-3GaIGIcNAc linkage is found in
heterologous glycoproteins expressed by CHO and human cells and the SA alpha2-
6GaIG 1 cNAc linkage is found in many human glycoproteins (Goochee et al.
(1991)
Bio/technology 9:1347-1355). The alpha2-3- and/or alpha2-6-sialyltransferase
genes
along with a number of other sialyltransferase genes have been cloned,
sequenced and
expressed as active heterologous proteins as described in Lee et al. (1989) J.
Biol.
Chem. 264:13848-13855, Ichikawa et al. (1992) Anal. Biochem. 202:215-238,
Tsuji,
S. (1996) J. Biochem. 120:1-13; U.S. Patent No. 5,047,335.
Any one or more of these genes, as well as
fragments, and/or variants. thereof may be introduced and expressed in cells
of interest
using techniques described herein or otherwise known in the art, and may be
used
according to the methods of the present invention to enhance the enzymatic
transfer of
sialic acid from the donor substrate.
For generating N-Linked sialylated glycoproteins in insect cells, once the
donor (CMP-SA) and acceptor (Ga1GIcNAc-R) substrates are produced as described
above, the methods of the invention further comprise expression of a
sialyltransferase
or fragment or variant thereof, in the cells. The completion of the
sialylation reaction
.can be verified by elucidating the N-glycan structures attached to a desired
glycoprotein using techniques described herein or otherwise known in the art.
It is
recognized that evaluation of N-glycans attachments may also suggest
additional
metabolic engineering strategies that can -further, enhance the level of
sialylation in
insect cells.
It is observed that unmodified T. ni insect cell lysates failed to generate
any
sialylated compounds when incubated with the substrate, LacMU, and the
nucleotide
sugar, CMP-SA. Thus, it is concluded that these cells comprise negligible
native
sialyltransferase activity. However, infection of insect cells with a
baculovirus
containing alpha2,3 sialyltransferase provided significant enzymatic
conversion of
LacMU and CMP-SA to sialylLacMU. For the purposes of the invention,
heterologous sialyltransferase can be expressed using techniques described
herein or
otherwise known in the art either by co-infection with a virus coding for
sialyltransferase, or fragment, or variant thereof, or by using stable
transfectants
CA 02363297 2008-11-03
38
expressing the enzyme. In addition to the 2,3- sialyltransferase baculovirus
constructs,
baculovirus vectors comprising sequences coding for alpha2,6 sialyltransferase
and/or
fragments or variants thereof as well as stably transformed insect cells
stably
expressing both gal T and sialyltransferase are commercially, or publicly
available,
and/or may routinely be generated using techniques described herein or
otherwise
known in the art. Evaluation of sialyltransferase activity is determined using
the
FRET or HPLC assays described herein and/or using other assays known in the
art.
Localization of the sialyltransferase to the Golgi is accomplished using anti-
sialyltransferase antibodies commercially, publicly, or otherwise available
for the
purpose of this invention in concert with Golgi specific marker proteins.
For the purposes of enhancing carbohydrate processing enzymes of the
invention, suppressing activity of endogenous N-acetylglucosaminidase,
expressing
heterologous proteins in the cells of the invention, and constructing vectors
for the
purposes of the invention; genetic engineering methods are known to those of
ordinary skill in the art. For example, see Schneider, A. et al., (1998) Mol.
Gen.
Genet. 257:308-318. Where the invention encompasses utilizing baculovirus
based
expression, such methods are known in the art, for example, as described in
O'Riley.
et al. (1992) Baculovirus Expression Vectors, W.H. Freeman and Company, New
York 1992.
For the purposes of enhancing carbohydrate processing enzymes of the
invention, suppressing activity of endogenous N-acetylglucosaminidase,
expressing
heterologous proteins in the cells of the invention, and constructing vectors
as
described herein, known sequences can be utilized in the methods of the
invention,
including but not limited to the sequences described in GenSeq accession No.
Z11234
and Z11235 for two human galactosyltransferases (see also United States Patent
Number 5,955,282);
and/or in Genbank accession No. D83766 for G1cNAc-2-epimerase, Y07744 for the
bifunctional rate liver enzyme.capable of catalyzing conversion of UDP-G1cNAc
to
ManNAc, J05023 for E. coli CMP-SA.synthetase, AJ006215 for murine CMP-SA
synthetase, Z71268 for murine CMP-SA transporter, X03345 for E. coli aldolase,
U05248 for E. coli SA synthetase, X17247 for human 2,6 sialyltransferase,
L29553
for human 2,3 sialyltransferase, M13214 for bovine' galactosyltransferase,
L77081 for
CA 02363297 2008-11-03
39
.human G1cNAc T-I, U15128 or L36537 for human G1cNAc T-II, D87969 for human
CMP-SA transporter, and S95936 for human transferrin; and fragments or
variants of
the enzymes that display one or more of the biological activities of the
enzymes (such
biological activities may routinely be assayed using techniques described
herein or
otherwise known in the art). The sequences described above are readily
accessible
using the provided accession number in the NCBI Entrez database, known to the
person of ordinary skill in the art.
Thus, one aspect of the invention provides for use of isolated nucleic acid
molecules comprising polynucleotides having nucleotide-sequences selected from
the
group consisting of : (a) nucleotide sequences encoding a biologically active
fragment or variant of the polypeptide having the amino acid sequence
described in
GenSeq accession No. Z1 1234 and Z11235 for two human galactosyltransferases;
and/or in Genbank accession No. D83766 for GlcNAc-2-epimerase, Y07744 for the
bifunctional rate.liver enzyme capable of catalyzing conversion of UDP-G1cNAc
to
ManNAc, J05023 for E. coli CMP-SA synthetase, AJO06215 for murine CMP-SA
synthetase, Z71268 for murine CMP-SA transporter, X03345 for E. coli aldolase,
U05248 for E. coli SA synthetase, X17247 for human 2,6 sialyltransferase,
L29553
for human 2,3 sialyltransferase, M 13214 for bovine galactosyltransferase,
L77081 for
human GIcNAc T-I, U15128 or L36537 for human G1cNAc T-II, D87969 for human
CMP-SA transporter, and/or S95936 for human transferrin; (b) nucleotide
sequences
encoding an antigenic fragment of the polypeptide having the amino acid
sequence
described in GenSeq accession No. Z 11234 and Z 11235 for two human
galactosyltransferases (see also United States Patent Number 5,955,282);
and/or in Genbank accession No.
D83766 for GIcNAc-2-epimerase, Y07744 for the bifunctional rate liver enzyme
capable of catalyzing conversion of UDP-GIcNAc to ManNAc, J05023 for E. coli
CMP-SA synthetase, AJO06215 for murine CMP-SA synthetase, Z71268 for murine
CMP-SA transporter, X03345 for E. coli aldolase, U05248 for E. coli SA
synthetase,
X17247 for human 2,6 sialyltransferase, L29553 for human 2,3
sialyltransferase,
M13214 for bovine galactosyltransferase, L77081 for human G1cNAc T-I, U15128
or
L36537 for human G1cNAc T-II, D87969 for human CMP-SA transporter, and/or
S95936 for human transferrin; and (c) nucleotide sequences. complementary to
any of
CA 02363297 2001-08-27
WO 00/52135 40 PCTIUSOO/05313
the nucleotide sequences in (a) or (b), above. Polypeptides encoded by such
nucleic
acids may also be used according to the methods of the present invention.
Further
embodiments of the invention include use of isolated nucleic acid molecules
that
comprise a polynucleotide having a nucleotide sequence at least 80%, 85%, or
90%
identical, and more preferably at least 95%, 97%, 98% or 99% identical, to any
of the
above nucleotide sequences, or a polynucleotide which hybridizes under
stringent
hybridization conditions to a polynucleotide that is complementary to any of
the
above nucleotide sequences. This polynucleotide which hybridizes does not
hybridize
under stringent hybridization conditions to a polynucleotide having a
nucleotide
sequence consisting of only A residues or of only T residues. Polypeptides
encoded
by such nucleic acids may also be used according to the methods of the present
invention. Preferably, the nucleic acid sequences (including fragments or
variants)
that may be used according to the methods of the present invention encode a
polypeptide having a biological activity. Such biological activity may
routinely be
assayed using techniques described herein or otherwise known in the art.
In addition to the sequences described above, the nucleotide sequences and
amino acid sequences disclosed in Figures 27-32, and fragments and variants of
these
sequences may also be used according to the methods of the invention.
In one embodiment, specific enzyme polypeptides comprise the amino acid
sequences shown in Figures 28, 30 and 32; or otherwise described herein.
However,
the invention also encompasses sequence variants of the polypeptide sequences
shown
in Figures 28, 30 and 32.
In a specific embodiment, one, two, three, four, five or more human
polynucleotide sequences, or fragments, or variants thereof, and/or the
polypeptides
encoded thereby, are used according to the methods of the present invention to
convert ManNAc to SA (see Example 6). Such polynucleotide and polypeptide
sequences include, but are not limited to, sequences corresponding to human
aldolase
(SEQ ID NO:1 and SEQ ID NO:2), human CMP-SA synthetase (SEQ ID NO:3 and
SEQ ID NO:4), and human SA synthetase (SEQ ID NO:5 and SEQ ID NO:6); see
also Figures 27 - 32. Thus, in certain embodiments the methods of present
invention
include the use of one or more novel isolated nucleic acid molecules
comprising
polynucleotides encoding polypeptides important to intracellular carbohydrate
CA 02363297 2008-11-03
41
processing in humans. Such polynucleotide sequences include those disclosed in
the
figures and/or Sequence Listing and/or encoded by the human cDNA plasmids
(Human CMP-Sialic Acid Synthetase, cDNA clone HWLLM34; Human Sialic Acid
Synthetase, cDNA clone HA5AA37; and Human Aldolase cDNA clone HDPAK85)
deposited with the American Type Culture Collection (ATCC).
The present invention. further includes
the use of polypeptides encoded by these polynucleotides. The present
invention also
provides for use of isolated nucleic acid molecules encoding fragments and
variants of
these polypeptides, and for the polypeptides encoded by these nucleic acids.
Thus, one aspect of the invention provides for use of isolated nucleic acid
molecules comprising polynucleotides having nucleotide sequences selected from
the
group consisting of : (a) nucleotide sequences encoding human aldolase having
the
amino acid sequences as shown in SEQ ID NO:2; (b) nucleotide sequences
encoding
a biologically active fragment of the human aldolase polypeptide having the
amino
acid sequence shown in SEQ ID NO:2; (c) nucleotide sequences encoding an
antigenic fragment of the human aldolase polypeptide having the amino acid
sequence
shown in SEQ ID NO:2; (d) nucleotide sequences encoding the human aldolase
polypeptide comprising the complete amino acid sequence encoded by the plasmid
contained in the ATCC Deposit; (e) nucleotide sequences encoding a
biologically
active fragment of the human aldolase polypeptide having the amino acid
sequence
encoded by the plasmid contained in the ATCC Deposit; (f) a nucleotide
sequence
encoding an -antigenic fragment of the human akolase polypeptide having the
amino
acid sequence encoded by the plasmid contained in the ATCC Deposit; and (g)
nucleotide sequences complementary to any of the nucleotide sequences in (a)
. 25 through (f), above. Polypeptides encoded by such nucleic acids may also
be used
according to the methods of the present invention. Further embodiments of the
invention include use of isolated nucleic acid molecules that comprise. a
polynucleotide having a nucleotide sequence at least 80%,. 85%, or 90%
identical, and
more preferably at least 95%, 97%, 98% or 99% identical, to any of the
nucleotide
sequences in (a), (b), (c), (d), (e),. (f), or (g), above, or a polynucleotide
which
hybridizes under stringent hybridization conditions to a polynucleotide in
(a), (b), (c),
(d),.(e), (f), or (g), above. This.polynucleotide which hybridizes does not
hybridize
CA 02363297 2001-08-27
WO 00/52135 42 PCT/US00/05313
under stringent hybridization conditions to a polynucleotide having a
nucleotide
sequence consisting of only A residues or of only T residues. Polypeptides
encoded
by such nucleic acids may also be used according to the methods of the present
invention.
Another aspect of the invention provides for use of isolated nucleic acid
molecules comprising polynucleotides having nucleotide sequences selected from
the
group consisting of : (a) nucleotide sequences encoding human CMP-SA
synthetase
having the amino acid sequences as shown in SEQ ID NO:4; (b) nucleotide
sequences encoding a biologically active fragment of human CMP-SA synthetase
polypeptide having the amino acid sequence shown in SEQ ID NO:4; (c)
nucleotide
sequences encoding an antigenic fragment of the human CMP-SA synthetase
polypeptide having the amino acid sequence shown in SEQ ID NO:4; (d)
nucleotide
sequences encoding the human CMP-SA synthetase polypeptide comprising the
complete amino acid sequence encoded by the plasmid contained in the ATCC
Deposit; (e) nucleotide sequences encoding a biologically active fragment of
the
human CMP-SA synthetase polypeptide having the amino acid sequence encoded by
the plasmid contained in the ATCC Deposit; (f) a nucleotide sequence encoding
an
antigenic fragment of the human CMP-SA synthetase polypeptide having the amino
acid sequence encoded by the plasmid contained in the ATCC Deposit; and (g)
nucleotide sequences complementary to any of the nucleotide sequences in (a)
through (f), above. Polypeptides encoded by such nucleic acids may also be
used
according to the methods of the present invention. Further embodiments of the
invention include use of isolated nucleic acid molecules that comprise a
polynucleotide having a nucleotide sequence at least 80%, 85%, or 90%
identical, and
more preferably at least 95%, 97%, 98% or 99% identical, to any of the
nucleotide
sequences in (a), (b), (c), (d), (e), (f), or (g) above, or a polynucleotide
which
hybridizes under stringent hybridization conditions to a polynucleotide in
(a), (b), (c),
(d), (e), (f), or (g), above. This polynucleotide which hybridizes does not
hybridize
under stringent hybridization conditions to a polynucleotide having a
nucleotide
sequence consisting of only A residues or of only T residues. Polypeptides
encoded
by such nucleic acids may also be used according to the methods of the present
invention.
CA 02363297 2001-08-27
WO 00/52135 43 PCTIUSOO/05313
Another aspect of the invention provides for use of isolated nucleic acid
molecules comprising polynucleotides having nucleotide sequences selected from
the
group consisting of. (a) nucleotide sequences encoding human SA synthetase
having
the amino acid sequences as shown in SEQ ID NO:6; (b) nucleotide sequences
encoding a biologically active fragment of the human SA synthetase polypeptide
having the amino acid sequence shown in SEQ ID NO:6; (c) nucleotide sequences
encoding an antigenic fragment of the human SA synthetase polypeptide having
the
amino acid sequence shown in SEQ ID NO:6; (d) nucleotide sequences encoding
the
human SA synthetase polypeptide comprising the complete amino acid sequence
encoded by the plasmid contained in the ATCC Deposit; (e) nucleotide sequences
encoding a biologically active fragment of the human SA synthetase polypeptide
having the amino acid sequence encoded by the plasmid contained in the ATCC
Deposit; (f) a nucleotide sequence encoding an antigenic fragment of the human
SA
synthetase polypeptide having the amino acid sequence encoded by the plasmid
contained in the ATCC Deposit; and (g) nucleotide sequences complementary to
any
of the nucleotide sequences in (a) through (f), above. Polypeptides encoded by
such
nucleic acids may also be used according to the methods of the present
invention.
Further embodiments of the invention include use of isolated nucleic acid
molecules
that comprise a polynucleotide having a nucleotide sequence at least 80%, 85%,
or
90% identical, and more preferably at least 95%, 97%, 98% or 99% identical, to
any
of the nucleotide sequences in (a), (b), (c), (d), (e), (f), or (g) above, or
a
polynucleotide which hybridizes under stringent hybridization conditions to a
polynucleotide in (a), (b), (c), (d), (e), (f), or (g), above. This
polynucleotide which
hybridizes does not hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A residues or
of only
T residues. Polypeptides encoded by such nucleic acids may also be used
according to
the methods of the present invention.
By a nucleic acid having a nucleotide sequence at least, for example, 95%
"identical" to a reference nucleotide sequence of the present invention, it is
intended
that the nucleotide sequence of the nucleic acid is identical to the reference
sequence
except that the nucleotide sequence may include up to five point mutations per
each
100 nucleotides of the reference nucleotide sequence encoding the described
CA 02363297 2001-08-27
WO 00/52135 44 PCT/US00/05313
polypeptide. In other words, to obtain a nucleic acid having a nucleotide
sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in
the reference sequence may be deleted or substituted with another nucleotide,
or a
number of nucleotides up to 5% of the total nucleotides in the reference
sequence may
be inserted into the reference sequence. The query sequence may be an entire
sequence, such as, for example, that shown of SEQ ID NO:1, the ORF (open
reading
frame), or any fragment as described herein.
As a practical matter, whether any particular nucleic acid molecule or
polypeptide is at least, for example, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%
identical to a nucleotide sequence of the presence invention can be determined
conventionally using known computer programs. A preferred method for
determining
the best overall match between a query sequence (a sequence of the present
invention)
and a subject sequence, also referred to as a global sequence alignment, can
be
determined using the FASTDB computer program based on the algorithm of Brutlag
et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the
query and
subject sequences are both DNA sequences. An RNA sequence can be compared by
converting U's to T's. The result of said global sequence alignment is in
percent
identity. Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l,
Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap
Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject
nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3'
deletions, not because of internal deletions, a manual correction must be made
to the
results. This is because the FASTDB program does not account for 5' and 3'
truncations of the subject sequence when calculating percent identity. For
subject
sequences truncated at the 5' or 3' ends, relative to the query sequence, the
percent
identity is corrected by calculating the number of bases of the query sequence
that are
5' and 3' of the subject sequence, which are not matched/aligned, as a percent
of the
total bases of the query sequence. Whether a nucleotide is matched/aligned is
determined by results of the FASTDB sequence alignment. This percentage is
then
subtracted from the percent identity, calculated by the above FASTDB program
using
CA 02363297 2001-08-27
WO 00/52135 45 PCT/IJS00/05313
the specified parameters, to arrive at a final percent identity score. This
corrected
score is what is used for the purposes of the present invention. Only bases
outside the
5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment,
which are not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine percent identity. The deletions occur at the 5' end of
the
subject sequence and therefore, the FASTDB alignment does not show a
matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases
represent
10% of the sequence (number of bases at the 5' and 3' ends not matched/total
number
of bases in the query sequence) so 10% is subtracted from the percent identity
score
calculated by the FASTDB program. If the remaining 90 bases were perfectly
matched the final percent identity would be 90%. In another example, a 90 base
subject sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the 5' or 3' of
the subject
sequence which are not matched/aligned with the query. In this case the
percent
identity calculated by FASTDB is not manually corrected. Once again, only
bases 5'
and 3' of the subject sequence which are not matched/aligned with the query
sequence
are manually corrected for. No other manual corrections are to made for the
purposes
of the present invention.
By a polypeptide having an amino acid sequence at least, for example, 95%
"identical" to a query amino acid sequence of the present invention, it is
intended that
the amino acid sequence of the subject polypeptide is identical to the query
sequence
except that the subject polypeptide sequence may include up to five amino acid
alterations per each 100 amino acids of the query amino acid sequence. In
other
words, to obtain a polypeptide having an amino acid sequence at least 95%
identical
to a query amino acid sequence, up to 5% of the amino acid residues in the
subject
sequence may be inserted, deleted (indels) or substituted with another amino
acid.
These alterations of the reference sequence may occur at the amino or carboxy
terminal positions of the reference amino acid sequence or anywhere between
those
terminal positions, interspersed either individually among residues in the
reference
sequence or in one or more contiguous groups within the reference sequence.
CA 02363297 2001-08-27
WO 00/52135 46 PCT/US00/05313
As a practical matter, whether any particular polypeptide is at least, for
example, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example,
the amino acid sequences of SEQ ID NO:2 or to the amino acid sequence encoded
by
the cDNA contained in a deposited clone can be determined conventionally using
known computer programs. A preferred method for determining the best overall
match between a query sequence (a sequence of the present invention) and a
subject
sequence, also referred to as a global sequence alignment, can be determined
using
the FASTDB computer program based on the algorithm of Brutlag et al. (Comp.
App.
Biosci. 6:237-245(1990)). In a sequence alignment the query and subject
sequences
are either both nucleotide sequences or both amino acid sequences. The result
of said
global sequence alignment is in percent identity. Preferred parameters used in
a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch
Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l,
Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window
Size=500 or the length of the subject amino acid sequence, whichever is
shorter.
If the subject sequence is shorter than the query sequence due to N- or C-
terminal deletions, not because of internal deletions, a manual correction
must be
made to the results. This is because the FASTDB program does not account for N-
and C-terminal truncations of the subject sequence when calculating global
percent
identity. For subject sequences truncated at the N- and C-termini, relative to
the
query sequence, the percent identity is corrected by calculating the number of
residues
of the query sequence that are N- and C-terminal of the subject sequence,
which are
not matched/aligned with a corresponding subject residue, as a percent of the
total
bases of the query sequence. Whether a residue is matched/aligned is
determined by
results of the FASTDB sequence alignment. This percentage is then subtracted
from
the percent identity, calculated by the above FASTDB program using the
specified
parameters, to arrive at a final percent identity score. This final percent
identity score
is what is used for the purposes of the present invention. Only residues to
the N- and
C-termini of the subject sequence, which are not matched/aligned with the
query
sequence, are considered for the purposes of manually adjusting the percent
identity
score. That is, only query residue positions outside the farthest N- and C-
terminal
residues of the subject sequence.
CA 02363297 2001-08-27
WO 00/52135 47 PCT/US00/05313
For example, a 90 amino acid residue subject sequence is aligned with a 100
residue query sequence to determine percent identity. The deletion occurs at
the N-
terminus of the subject sequence and therefore, the FASTDB alignment does not
show a matching/alignment of the first 10 residues at the N-terminus. The 10
unpaired residues represent 10% of the sequence (number of residues at the N-
and C-
termini not matched/total number of residues in the query sequence) so 10% is
subtracted from the percent identity score calculated by the FASTDB program.
If the
remaining 90 residues were perfectly matched the final percent identity would
be
90%. In another example, a 90 residue subject sequence is compared with a 100
residue query sequence. This time the deletions are internal deletions so
there are no
residues at the N- or C-termini of the subject sequence which are not
matched/aligned
with the query. In this case the percent identity calculated by FASTDB is not
manually corrected. Once again, only residue positions outside the N- and C-
terminal
ends of the subject sequence, as displayed in the FASTDB alignment, which are
not
matched/aligned with the query sequence are manually corrected for. No other
manual corrections are to made for the purposes of the present invention.
In another embodiment of the invention, to determine the percent homology of
two amino acid sequences, or of two nucleic acids, the sequences are aligned
for
optimal comparison purposes (e.g., gaps can be introduced in the sequence of
one
protein or nucleic acid for optimal alignment with the other protein or
nucleic acid).
The amino acid residues or nucleotides at corresponding amino acid positions
or
nucleotide positions are then compared. When a position in one sequence is
occupied
by the same amino acid residue or nucleotide as the corresponding position in
the
other sequence, then the molecules are homologous at that position. As used
herein,
amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic
acid
"identity". The percent homology between the two sequences is a function of
the
number of identical positions shared by the sequences (i.e., per cent homology
equals
the number of identical positions/total number of positions times 100).
Variants of above described sequences include a substantially homologous
protein encoded by the same genetic locus in an organism, i.e., an allelic
variant.
Variants also encompass proteins derived from other genetic loci in an
organism, but
having substantial homology to the proteins of Figures 27-32, or otherwise
described
CA 02363297 2001-08-27
WO 00/52135 48 PCTIUSOO/05313
herein. Variants also include proteins substantially homologous to the protein
but
derived from another organism, i.e., an ortholog. Variants also include
proteins that
are substantially homologous to the proteins that are produced by chemical
synthesis.
Variants also include proteins that are substantially homologous to the
proteins that
are produced by recombinant methods. As used herein, two proteins (or a region
of
the proteins) are substantially homologous when the amino acid sequences are
at least
about 55-60%, typically at least about 70-75%, more typically at least about
80-85%,
and most typically at least about 90-95% or more homologous. A substantially
homologous amino acid sequence, according to the present invention, will be
encoded
by a nucleic acid sequence hybridizing to the nucleic acid sequence, or
portion
thereof, of the sequence shown in Figures 27, 28, 31 or otherwise described
herein
under stringent conditions as more fully described below.
Orthologs, homologs, and allelic variants that are encompassed by the
invention and that may be used according to the methods of the invention can
be
identified using methods well known in the art. These variants comprise a
nucleotide
sequence encoding a protein that is at least about 55%, typically at least
about 70-
75%, more typically at least about 80-85%, and most typically at least about
90-95%
or more homologous to the nucleotide sequence shown in Figures 27, 29, 31, or
otherwise described herein, or a fragment of this sequence. Such nucleic acid
molecules can readily be identified as being able to hybridize under stringent
conditions, to the nucleotide sequence shown in Figures 27, 29, 31, or
complementary
sequence thereto, or otherwise described herein, or a fragment of the
sequence. It is
understood that stringent hybridization does not indicate substantial homology
where
it is due to general homology, such as poly A sequences, or sequences common
to all
or most proteins in an organism or class of proteins.
The invention also encompasses polypeptides having a lower degree of
identity but having sufficient similarity so as to perform one or more of the
same
functions performed by the enzyme polypeptides described herein. Similarity is
determined by conserved amino acid substitution. Such substitutions are those
that
substitute a given amino acid in a polypeptide by another amino acid of like
characteristics (see Table 1). Conservative substitutions are likely to be
phenotypically silent. Typically seen as conservative substitutions are the
CA 02363297 2001-08-27
WO 00/52135 49 PCT/US00/05313
replacements, one for another, among the aliphatic amino acids Ala, Val, Leu,
and Ile;
interchange of the hydroxyl residues Ser and Thr, exchange of the acidic
residues Asp
and Glu, substitution between the amide residues Asn and Gln, exchange of the
basic
residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
Guidance concerning which amino acid changes are likely to be phenotypically
silent
are found in Bowie et al., Science 247:1306-1310 (1990).
TABLE 1. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine
Polar Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
Both identity and similarity can be readily calculated (Computational
Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic
Press,
New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and
Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in
Molecular
CA 02363297 2001-08-27
WO 00/52135 50 PCT/USOO/05313
Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer,
Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991).
Preferred
computer program methods to determine identify and similarity between two
sequences include, but are not limited to, GCG program package (Devereux, J.
(1984)
Nuc. Acids Res. 12(1):387), BLASTP, BLASTN, FASTA (Atschul, S.F. (1990) J.
Molec. Biol. 215:403).
A variant polypeptide can differ in amino acid sequence by one or more
substitutions, deletions, insertions, inversions, fusions, and truncations or
a
combination of any of these.
Variant polypeptides can be fully functional or can lack function in one or
more activities. Thus, in the present case, variations can affect the
function, for
example, of one or more of the modules, domains, or functional subregions of
the
enzyme polypeptides of the invention. Preferably, polypeptide variants and
fragments
have the described activities routinely assayed via bioassays described herein
or
otherwise known in the art.
Fully functional variants typically contain only conservative variation or
variation in non-critical residues or in non-critical regions. Functional
variants can
also contain substitution of similar amino acids, which result in no change or
an
insignificant change in function. Alternatively, such substitutions may
positively or
negatively affect function to some degree.
Non-functional variants typically contain one or more non-conservative amino
acid substitutions, deletions, insertions, inversions, or truncation or a
substitution,
insertion, inversion, or deletion in a critical residue or critical region. As
indicated,
variants can be naturally-occurring or can be made by recombinant means or
chemical
synthesis to provide useful and novel characteristics for the polypeptide.
Amino acids that are essential for function can be identified by methods
known in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis
(Cunningham et al., Science 244:1081-1085 (1989)). The latter procedure
introduces
single alanine mutations at every residue in the molecule. The resulting
mutant
molecules are then tested for biological activity. Sites that are critical can
also be
determined by structural analysis such as crystallization, nuclear magnetic
resonance
CA 02363297 2001-08-27
WO 00/52135 51 PCT/US00/05313
or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992); de
Vos et al.
Science 255:306-312 (1992)).
The invention further encompasses variant polynucleotides, and fragments
thereof, that differ from the nucleotide sequence, such as, for example, those
shown in
Figures 27, 29, 31 or otherwise described herein, due to degeneracy of the
genetic
code and thus encode the same protein as that encoded by the nucleotide
sequence
shown in Figures 27, 29, 31 or otherwise described herein.
The invention also provides nucleic acid molecules encoding the variant
polypeptides described herein. Such polynucleotides may be naturally
occurring,
such as allelic variants (same locus), homologs (different locus), and
orthologs
(different organism), or may be constructed by recombinant DNA methods or by
chemical synthesis. Such non-naturally occurring variants may be made by
mutagenesis techniques, including those applied to polynucleotides, cells, or
organisms. Accordingly, as discussed above, the variants can contain
nucleotide
substitutions, deletions, inversions and insertions.
Variation can occur in either or both the coding and non-coding regions. The
variations can produce both conservative and non-conservative amino acid
substitutions.
"Polynucleotides" or "nucleic acids" that may be used according to the
methods of the invention also include those polynucleotides capable of
hybridizing,
under stringent hybridization conditions, to sequences contained in SEQ ID NO:
1, the
complement thereof, or a cDNA within the deposited plasmids. As used herein,
the
term "hybridizes under stringent conditions" is intended to describe
conditions for
hybridization and washing under which nucleotide sequences encoding a receptor
at
least 55% homologous to each other typically remain hybridized to each other.
The
conditions can be such that sequences at least about 65%, at least about 70%,
or at
least about 75% or more homologous to each other typically remain hybridized
to
each other. Such stringent conditions are known to those skilled in the art
and can be
found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.
(1989),
6.3.1-6.3.6. One example of stringent hybridization conditions are
hybridization in
6X sodium chloride/sodium citrate (SSC) at about 45degrees C, followed by one
or
more washes in 0.2 X SSC, 0.1% SDS at 50-65 degrees C.
CA 02363297 2001-08-27
WO 00/52135 52 PCT/US00/05313
Also contemplated for use according to the methods of the invention are
nucleic acid molecules that hybridize to a polynucleotide disclosed herein
under lower
stringency hybridization conditions. Changes in the stringency of
hybridization and
signal detection are primarily accomplished through the manipulation of
formamide
concentration (lower percentages of formamide result in lowered stringency);
salt
conditions, or temperature. For example, lower stringency conditions include
an
overnight incubation at 37 degree C in a solution comprising 6X SSPE (20X SSPE
=
3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100
ug/ml salmon sperm blocking DNA; followed by washes at 50 degree C with
IXSSPE, 0.1% SDS. In addition, to achieve even lower stringency, washes
performed following stringent hybridization can be done at higher salt
concentrations
(e.g. 5X SSC).
Note that variations in the above conditions may be accomplished through the
inclusion and/or substitution of alternate blocking reagents used to suppress
background in hybridization experiments. Typical blocking reagents include
Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and
commercially available proprietary formulations. The inclusion of specific
blocking
reagents may require modification of the hybridization conditions described
above,
due to problems with compatibility.
Of course, a polynucleotide which hybridizes only to polyA+ sequences (such
as any 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or
to a
complementary stretch of T (or U) residues, would not be included in the
definition of
"polynucleotide," since such a polynucleotide would hybridize to any nucleic
acid
molecule containing a poly (A) stretch or the complement thereof (e.g.,
practically
any double-stranded cDNA clone generated using oligo-dT as a primer).
In one embodiment, an isolated nucleic acid molecule that hybridizes under
stringent conditions to a sequence disclosed herein, or the complement
thereof, such
as, for example, the sequence of Figures 27, 29, 31, corresponds to a
naturally-
occurring nucleic acid molecule. As used herein, a "naturally-occurring"
nucleic acid
molecule refers to an RNA or DNA molecule having a nucleotide sequence that
occurs in nature (e.g., encodes a natural protein).
CA 02363297 2001-08-27
WO 00/52135 53 PCT/USOO/05313
The present invention also encompasses recombinant vectors, which include
the isolated nucleic acid molecules and polynucleotides that may be used
according to
the methods of the present invention, and to host cells containing the
recombinant
vectors and/or nucleic acid molecules, as well as to methods of making such
vectors
and host cells and for using them for production of glycosylation enzyme by
recombinant techniques. Polypeptides produced by such methods are also
provided.
The invention encompasses utilizing vectors for the maintenance (cloning
vectors) or vectors for expression (expression vectors) of the desired
polynucleotides
encoding the carbohydrate processing of the invention, or those encoding
proteins to
be sialylated by the methods of the invention and/or by expression of the
proteins the
cells of the invention. The vectors can function in prokaryotic or eukaryotic
cells or
in both (shuttle vectors).
In one embodiment, one or more of the polynucleotide sequences used
according to the methods of the invention are inserted into commercially,
publicly, or
otherwise available baculovirus expression vectors for enhanced expression of
the
corresponding enzyme. In another non-exclusive embodiment, one ore more of the
polynucleotides used according to the methods of the invention are inserted
into other
viral vectors or for generation of stable insect cell lines. Techniques known
in the art,
such as, for example, HPAEC and HPLC techniques, may be routinely used to
evaluate the enzymatic activity of these enzymes from both eukaryotic and
bacterial
sources to determine which source is best for generating SA in insect cells.
Generally, expression vectors contain cis-acting regulatory regions that are
operably linked in the vector to the polynucleotide to be expressed, or other
relevant
polynucleotides such that transcription of the polynucleotides is allowed in a
host cell.
The polynucleotides can be introduced into the host cell with a separate
polynucleotide capable of affecting transcription. Thus, the second
polynucleotide
may provide a trans-acting factor interacting with the cis-regulatory control
region to
allow transcription of the polynucleotides from the vector. Alternatively, a
trans-
acting factor may be supplied by the host cell. Finally, a trans-acting factor
can be
produced from the vector itself.
It is understood, however, that in some embodiments, transcription of the
polynucleotides can occur in a cell-free system.
CA 02363297 2001-08-27
WO 00/52135 54 PCT/US00/05313
The regulatory sequence to which the polynucleotides described herein can be
operably linked include, for example, promoters for directing mRNA
transcription.
These promoters include, but are not limited to, baculovirus promoters
including, but
not limited to, 1EO, 1E1, 1E2, 39k, 35k, egt, ME53, ORF 142, PE38, p6.9,
capsid,
gp64 polyhedrin, p10, basic and core; and insect cell promoters including, but
not
limited to, Drosophila actin, metallothionine, and the like. Where the host
cell is not
an insect cell, such promoters include, but are not limited to, the left
promoter from
bacteriophage lambda, the lac, TRP, and TAC promoters from E. coli, promoters
from
Actinomycetes, including Nocardia, and Streptomyces.
Promoters may be isolated, if they have not already been isolated, by standard
promoter identification and trapping methods known in the art, see, for
example, in
Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, (1989).
It would be understood by a person of ordinary skill in the art that the
choice
of promoter would depend upon the choice of host cell. Similarly, the choice
of host
cell will depend upon the use of the host cell. Accordingly, host cells can be
used for
simply amplifying, but not expressing, the nucleic acid. However, host cells
can also
be used to produce desirable amounts of the desired polypeptide. In this
embodiment,
the host cell is simply used to express the protein per se. For example,
amounts of the
protein could be produced that enable its purification and subsequent use, for
example, in a cell free system. In this case, the promoter is compatible with
the host
cell. Host cells can be chosen from virtually any of the known host cells that
are
manipulated by the methods of the invention to produce the desired
glycosylation
patterns. These could include mammalian, bacterial, yeast, filamentous fungi,
or plant
cells.
In addition to control regions that promote transcription, expression vectors
may also include regions that modulate transcription, such as repressor
binding sites
and enhancers.
In addition to containing sites for transcription initiation and control,
expression vectors can also contain sequences necessary for transcription
termination
and, in the transcribed region a ribosome binding site for translation. Other
regulatory
control elements for expression include initiation and termination codons as
well as
CA 02363297 2001-08-27
WO 00/52135 55 PCT/US00/05313
polyadenylation signals. The person of ordinary skill in the art would be
aware of the
numerous regulatory sequences that are useful in expression vectors. Such
regulatory
sequences are described, for example, in Sambrook et al., cited above.
Depending on the choice of a host cell, a variety of expression vectors can be
used to express the polynucleotide. Such vectors include chromosomal,
episomal, and
particularly virus-derived vectors, for example, AcMNPV, OpMNPV, BmNPV,
HzMNPV, and RoMNPV. Vectors may also be derived from combinations of these
sources such as those derived from plasmid and bacteriophage genetic elements,
e.g.
cosmids and phagemids. Appropriate cloning and expression vectors for
prokaryotic
and eukaryotic hosts are described in Sambrook et al., Molecular Cloning: A
Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, (1989).
The regulatory sequence may provide constitutive expression in one or more
host cells or may provide for inducible expression in one or more cell types
such as by
temperature, nutrient additive, or exogenous factor such as a hormone or other
ligand.
A variety of vectors providing for constitutive and inducible expression in
prokaryotic
and eukaryotic hosts are well known to those of ordinary skill in the art.
The polynucleotides can be inserted into the vector nucleic acid using
techniques known in the art. Generally, the DNA sequence that will ultimately
be
expressed is joined to an expression vector by cleaving the DNA sequence and
the
expression vector with one or more restriction enzymes and then ligating the
fragments together. Procedures for restriction enzyme digestion and ligation
are well
known to those of ordinary skill in the art.
Specific expression vectors are described herein for the purposes of the
invention; for example, AcMNPV. Other expression vectors listed herein are not
intended to be limiting, and are merely provided by way of example. The person
of
ordinary skill in the art would be aware of other vectors suitable for
maintenance,
propagation, or expression of the polynucleotides described herein. These are
found
for example in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular
Cloning: A
Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989. Any cell type or expression
system
can be used for the purposes of the invention including but not limited to,
for
CA 02363297 2001-08-27
WO 00/52135 56 PCT/US00/05313
example, baculovirus systems (O'Riley et al. (1992) Baculovirus Expression
Vectors,
W.H. Freeman and Company, New York 1992) and Drosophila-derived systems
(Johansen et al. (1989) Genes Dev 3(6):882-889).
The invention also encompasses vectors in which the nucleic acid sequences
described herein are cloned into the vector in reverse orientation, but
operably linked
to a regulatory sequence that permits transcription of antisense RNA. Thus, an
antisense transcript can be produced to all, or to a portion, of the
polynucleotide
sequences described herein, including both coding and non-coding regions.
Expression of this antisense RNA is subject to each of the parameters
described above
in relation to expression of the sense RNA (regulatory sequences, constitutive
or
inducible expression, tissue-specific expression).
The recombinant host cells are prepared by introducing the vector constructs
described herein into the cells by techniques readily available to the person
of
ordinary skill in the art. These include, but are not limited to, calcium
phosphate
transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated
transfection, electroporation, transduction, infection, lipofection, and other
techniques
such as those found in Sambrook, et al. (Molecular Cloning: A Laboratory
Manual.
2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press,
Cold
Spring Harbor, NY, 1989).
Where secretion of the polypeptide is desired, appropriate secretion signals
known in the art are incorporated into the vector using techniques known in
the art.
The signal sequence can be endogenous to the polypeptides or heterologous to
these
polypeptides.
Where the polypeptide is not secreted into the medium, the desired protein can
be isolated from the host cell by techniques known in the art, such as, for
example,
standard disruption procedures, including freeze thaw, sonication, mechanical
disruption, use of lysing agents and the like. The polypeptide can then be
recovered
and purified by well-known purification methods including, but not limited to,
ammonium sulfate precipitation, acid extraction, anion or cationic exchange
chromatography, phosphocellulose chromatography, hydrophobic-interaction
chromatography, affinity chromatography, hydroxylapatite chromatography,
lectin
chromatography, and high performance liquid chromatography.
CA 02363297 2001-08-28
PCT/US00/05313
IPENUS21 DEC 2000
57
Furthermore, for suppressing activity of endogenous N-acetylglucosaminidase,
the invention encompasses utilizing the sequences deduced from the fragment
identified in Figures 18A-B, and described in Example 4. More particularly, in
this
aspect, the invention comprises utilization of the glucosaminidase nucleotide
sequences which are produced by using primers, such as, for example, those
primer
combinations described in Example 4. These nucleotide sequences may be used in
the construction and expression of anti-sense RNA, ribozymes, or homologous
recombination (gene "knock-out") constructs, using methods readily available
to those
skilled in the art, to reduce or eliminate in vivo glucosaminidase activity.
Cell lines produced by the methods of the invention can be tested by
expressing a model recombinant glycoprotein in such cell lines and assessing
the N-
glycans attached therein using techniques described herein or otherwise known
in the
art. The assessment can be done, for example, by 3-dimensional HPLC
techniques. In
the Examples of the invention, human transferrin is used as a model target
glycoprotein, since this glycoprotein is sialylated in humans and extensive
oligosaccharide structural information for the protein is available (Montreuil
et at.
(1997) Glycoproteins II Ed. 203-242). In this manner, cell lines with superior
processing characteristics are identified. Such a cell line can then be
evaluated for its
growth rate, product yields, and capacity to grow in suspension culture
(Lindsay et al.
(1992) Biotech. and Bioeng. 39:614-618, Reuveny et al. (1992) Ann. NY Acad.
Sci.
665:320, Reuveny et al. (1993) Appl. Microbiol. Biotechnol. 38:619-623,
Reuveny et
al. (1993) Biotechnol. Bioeng. 42:235-239).
The invention encompasses expressing heterologous proteins in the cells of the
invention and/or according to the methods of the invention for any purpose
benefiting
from such expression. Such a purpose includes, but is not limited to,
increasing the in
vivo circulatory half life of a protein; producing a desired quantity of the
protein;
increasing the biological function of the protein including, but not limited
to, enzyme
activity, receptor activity, binding capacity, antigenicity, therapeutic
property,
capacity as a vaccine or a diagnostic tool, and the like. Such proteins may be
naturally occurring chemically synthesized or recombinant proteins. Examples
of
proteins that benefit from the heterologous expression of the invention
include, but
are not limited to, transferrin, plasminogen, Na', K+-ATPase , thyrotropin,
tissue
AMENDED SHEET
CA 02363297 2008-11-03
58
plasminogen activator, erythropoietin, interleukins, and interferons. Other
examples
of such proteins include, but are not limited to, those described in
International patent
application publication number WO 98/06835.
In one embodiment, proteins that benefit from the heterologous expression of
the invention are mammalian proteins. In this aspect, mammals include but are
not
limited to, cats, dogs, rats, mice, cows, pigs, non-human primates, and
humans.
It is recognized that the heterologous expression of the invention not only
encompasses proteins that are sialylated in their native source; but also
those that are
not sialylated as such, and benefit from the expression in the cells of and/or
according
to the methods of the invention.
It is recognized that proteins that are not sialylated in their native source,
can
be altered by known genetic engineering methods so that the heterologous
expression
of the protein according to the invention will result in sialylation of the
protein. Such
methods include, but are not limited' to, the genetic engineering methods
described
herein. In this aspect, it is further recognized that altering the proteins
could
encompass engineering into the protein targeting signals to ensure targeting
of the
proteins to the ER and Golgi apparatus for sialylation; where such signals are
needed.
It is also recognized that the cells of the invention contain proteins, which
are_
not sialylated prior to manipulation of the cells according to the methods of
the .
invention, but are sialylated subsequent to the manipulation. In this manner,
the
invention also encompasses proteins that have amino acid sequences that are
endogenous to the cells of the. invention, but are sialylated as a result
manipulation of
the cells according to the methods of the invention.
It is recognized that the analysis ofthe N-glycans produced. according to the
methods of the invention may suggest. additional strategies to further enhance
the
sialylation of glycoproteins in insect cells. If the production of Gal
containing
carbohydrate acceptor structures is low relative to those containing G1cNAc,
then the
levels of Gal transferase expression are increased by integrating multiple
copies of
this gene into the insect cell genome or by expressing Gal T under a stronger
promoter using techniques described herein or otherwise known in the art.
Additionally, or alternatively, substrate feeding strategies are used to
enhance the
CA 02363297 2001-08-27
WO 00/52135 59 PCT/USOO/05313
levels of UDP-Gal for this carbohydrate processing reaction. In contrast, if
the
fraction of carbohydrate structures terminating in Gal is high and the
fraction with
terminal SA is low, then sialyltransferase or CMP-SA production is enhanced.
Examination of sialyltransferase activity using techniques described herein or
otherwise known in the art, such as, for example, FRET or HPLC and CMP-SA
levels
using HPAEC, is used to determine which step is the metabolic limiting step to
sialylation. These metabolic limitations are overcome by increasing expression
of
specific enzymes or by altering substrate feeding strategies or a combination
thereof.
ASSAYS
Having generally described the invention, the same will be more readily
understood by reference to the following assays and examples, which are
provided by
way of illustration and are not intended as limiting.
Analytical bioassays are implemented to evaluate enzymatic activities in the
N-glycosylation pathway of insect cells. In order to screen a larger selection
of insect
cells for particular oligosaccharide processing enzymes, bioassays in which
multiple
samples can be analyzed simultaneously are advantageous. Consequently,
bioassays
based on fluorescence energy transfer (FRET) and time-resolved fluorometry of
europium (Eu) are designed to screen native and recombinant insect cell lines
for
carbohydrate processing enzymes in a format that can handle multiple samples.
Fluorescence assays are especially useful in detecting limiting steps in
carbohydrate processing due to their sensitivity and specificity. FRET and Eu
assays
detect enzymatic activities at levels as low as 10-14 M, which is greater than
the
sensitivity obtained with 125I. In addition, the use of substrates modified
with
fluorophores enables the measurement of one specific enzyme activity in an
insect
cell lysate, and multiple samples can be analyzed simultaneously in a
microtiter plate
configuration used in an appropriate fluorometer. With these assays, insect
cell lines
are rapidly screened for the presence of processing enzymes including Gal,
G1cNAc,
and sialic acid transferases to identify limiting enzymes in N-glycosylation
in native
and recombinant cells.
CA 02363297 2001-08-27
WO 00/52135 60 PCTIUSOO/05313
Fluorescence energy transfer (FRET) assays
Glycosyl transferase activity assays are based on the principle of
fluorescence
energy transfer (FRET), which has been used to study glycopeptide conformation
(Rice et al. (1991) Biochemistry 30:6646-6655) and to develop endo-type
glycosidase
assays (Lee et al. (1995) Anal. Biochem. 230:31-36).
Gal T assay
The fluorescent compound, UDP-Gal-6-Naph, synthesized by consecutive
reactions of galactose oxidase (generating 6-oxo compound) and reductive
amination
with naphthylamine, is found to be effective as a substrate for Gal
transferase. When
UDP-Gal-6-Naph is reacted with an acceptor carrying a dansyl group (Dans-AE-
G1cNAc) in the presence of Gal-T, a product is created that can transfer
energy
(Figure 12). While irradiation of the naphthyl group in UDP-Gal-6-Naph at 260-
290
nm ("ex" in Figure 13) results in the usual emission at 320-370 nm ("em"
dotted line
in Figure 13), irradiation of the product at these same low wavelengths
results in
energy transfer to the dansyl group and emission at 500-560 run ("em" solid
line in
Figure 13). Assay sensitivity is as great as the fluorometer allows (pico- to
femtomol
range) and exceeds that of radioisotopes. In addition, multiple samples can be
monitored simultaneously in the fluorometer, allowing a number of cell lines
to be
evaluated rapidly for Gal T activity.
Sialyltransferase assay
A sialyltransferase assay is designed using similar FRET technology described
in the above example for Gal T. The 3-carbon tail (exocyclic chain) of sialic
acid (in
particular, its glycoside) can be readily oxidized with mild periodate to
yield an
aldehyde (Figure 14). This intermediate is reductively aminated to generate a
fluorescently tagged sialic acid (after removal of its aglycon), which is then
modified
to form a fluorescently modified CMP-sialic acid (See also Lee et al. (1994)
Anal.
Biochem. 216:358-364, Brossamer et al. (1994) Methods Enzymol. 247:153-177).
The
acceptor substrate is modified as described above to include the dansyl group.
Then
the FRET approach is used to measure either alpha(2, 3) or alpha(2, 6)
CA 02363297 2001-08-27
WO 00/52135 61 PCTIUSOO/05313
sialyltransferase activity since these enzymes should utilize the modified CMP-
SA as
donor substrate to generate a product with altered fluorescent emission
characteristics.
The choice of the fluorescent donor and acceptor pair can be flexible. The
above examples are given using naphthyl-dansyl pairs, but other fluorescent
combinations may be even more sensitive (Wu et al. (1994) Anal. Biochem.
250:260-
262).
Europium (Eu+)) fluorescence assays.
An example of the use of Eu+3 fluorescence for the evaluation of Gal T
activity is provided herein in the N-linked oligosaccharides from insect
cells. The
same techniques are used to develop enzymatic assay for transferases such as
G1cNAc
Ti and glycosidases such as N-acetylglucosaminidase. Further enhancements in
sensitivity are obtained with the advent of the super-sensitive Eu-chelator,
BHHT (4,
4'- bis (1",1", I", 2", 2", 3", 3'-heptatluro-4", 6"-hexanedione-6'-yl)-
chlorosulfo-o--
terphenyl) (Yuan et al. (1998) Anal. Chem. 70:596-601), which allows detection
down to the lower fmol range.
GlcNac-TI Assay
A new G1cNAc-TI assay, illustrated in Figure 15, utilizes a synthetic 6-
aminohexyl glycoside of the trimannosyl N-glycan core structure labeled with
DTPA
(Diethylenetriaminepentaacetic acid) and complexed with Eu+3. This substrate
is then
incubated with insect cell lysates or positive controls containing GlcNAc Ti
and
UDP-G1cNAc. Addition of chemical inhibitors are used to minimize background N-
acetylglucosaminidase activity. After the reaction, an excess of Crocus lectin
CVL
(Misaki et al. (1997) J. Biol. Chem. 272:25455-25461), which specifically
binds the
trimannosyl core, is added. The amount of the lectin required to bind all the
trimannosyl glycoside (and hence all the Eu+3 label) in the absence of any
G1cNAc
binding is predetermined. The reacted mixture is then filtered through a
10,000
molecular weight cut off (MWCO) microfuge ultrafiltration cup. The glycoside
modified with G1cNAc does not bind CVL and appears in the filtrate.
Measurement of
the Eu +3 fluorescence in the filtrate reflects the level of G1cNAc TI
activity in the
culture lysates.
CA 02363297 2001-08-27
WO 00/52135 62 PCTIUSOO/05313
N-acetylglucosaminidase assay
An assay for N-acetylglucosaminidase activity is developed using a different
lectin, GS-II, which is specific for G1cNAc. The substrate is prepared by
modification
of the same trimannosyl core glycoside described above using in vitro purified
G1cNAc Ti, which results in addition of a GIcNAc_beta(1-2) residue to the
Man_alpha(1-3) residue. Following incubation with insect cell lysates,
enzymatic
hydrolysis by N-acetylglucosaminidase removes G1cNAc from the substrate
resulting
in the tri-mannosyl core product. The product is not susceptible to lectin
binding and
thus escapes into the filtrate. Evaluation of Eu +3 fluorescence in the
filtrate provides
a measure of the N-acetylglucosaminidase activity. Alternatively, enhanced
binding
of the Eu-bound trimannosyl core to the Crocus lectin described above can be
used as
another assay for N-acetylglucosaminidase activity.
Characterization off-linked Oligosaccharides from Insect Cells
Carbohydrate structure elucidation of the N-glycans of a recombinant
glycoprotein, IgG, purified from Trichoplusia ni (High FiveTM cells;
Invitrogen Corp.,
Carlsbad, CA, USA) has been undertaken (Davis et al. (1993) In Vitro Cell.
Dev. Biol.
29:842-846; Hsu et al. (1997) J. Biol. Chem. 272:9062-9070). The recombinant
glycoprotein, immunoglobulin G (IgG), was purified from both intracellular and
extracellular (secreted) sources and all the attached N-glycans determined
using three
dimensional HPLC techniques. The composition of these structures provided
insights
into the carbohydrate processing pathways present in insect cells and allowed
a
comparison of intracellular and secreted N-glycan structures.
The Trichoplusia ni cells grown in serum free medium in suspension culture
were infected with a baculovirus vector encoding a murine IgG (Summers et al.
(1987) A manual of methods for baculovirus vectors and insect cells culture
procedures). IgG includes an N-linked oligosaccharide attachment on each of
the two
heavy chains.
Heterologous IgG was purified from the culture supernatant and soluble cell
lysates using a Protein A-Sepharose column. N-linked oligosaccharides were
isolated
following protease digestion of IgG and treatment with glycoamidase A to
release the
CA 02363297 2001-08-27
WO 00/52135 63 PCT/US00/05313
N-glycans. Oligosaccharides were then derivatized with 2-aminopyridine (PA) at
the
reducing ends to provide fluorogenic properties for detection.
Three-dimensional HPLC analysis, was performed to elucidate the N-linked
oligosaccharide structures attached to the heavy chain of IgG (Tomiya et al.
(1988)
Anal. Biochem. 171:73-90, Takahashi et al. (1992) Handbook of Endoglycosidases
and Glycoamidases Ed. 199-332). This technique separates oligosaccharides by
three
successive HPLC steps and enables the identification of structures by
comparison of
elution conditions with those of known standards.
A DEAE column was used to separate oligosaccharides on the basis of
carbohydrate acidity (first dimension). None of the oligosaccharides retained
on this
column were found to include sialic acid. Treatment of the acidic fractions
with
neuraminidase from Arthrobacter ureafaciens (known to cleave all known sialic
acid
linkages) failed to release any sialic acid, and ODS-chromatography of the
fractions
revealed several minor components different from all known sialylated
oligosaccharides.
The second dimension used reverse phase HPLC with an ODS-silica column
to fractionate the labeled oligosaccharides according to carbohydrate
structure.
Supernatant (S) and lysate (L) IgGs oligosaccharides were separated into 6 and
10
fractions, respectively, labeled A-L in Figure 6.
Separation in the third and final dimension was accomplished using an amide
column to isolate oligosaccharides on the basis of molecular size. Peak B from
the
ODS column was separated into two separate oligosaccharide fractions, and peak
H
was separated into three separate oligosaccharide fractions on the amide-
column.
After oligosaccharide purification, structures of unknown oligosaccharides
were determined by comparing their positions on the 3-dimensional map with the
positions of over 450 known oligosaccharides. Co-elution of an unknown sample
with a known PA-oligosaccharide on the ODS and amide-silica columns was used
to
confirm the identity of an oligosaccharide. Digestion by glycosidases with
specific
cleavage sites (alpha-L-fucosidase, beta-galactosidase, beta-N-
acetylglucosaminidase, and alpha-mannosidase) followed by reseparation
provided
further confirmation.
CA 02363297 2001-08-27
WO 00/52135 64 PCT/US00/05313
All the oligosaccharides in the culture medium and cell lysates matched
known carbohydrates except for oligosaccharide G. The structure of
oligosaccharide
G was elucidated by treatment of the N-glycan with alpha-L-fucosidase, known
to
digest Fuc_alphal-6GIcNAc, followed by treatment with 13.5 M trifluoroacetic
acid
to remove the alphal, 3 linked fucose. The de-alphal, 6- and de-alphal, 3-
fucosylated
oligosaccharide G co-eluted with a known oligosaccharide, allowing the
identification
of G. The structure of oligosaccharide G is shown in Figure 7.
The structure of oligosaccharide G was further confirmed by 'H-NMR and
electrospray ionization (ESI) mass spectrometry (Hsu et al. (1997) J. Biol.
Chem.
272:9062-9070). Thus, the combination of these techniques can be used to
elucidate
both known and unknown oligosaccharides.
The carbohydrates attached to IgG from the culture medium and intracellular
lysate were identified and the levels present in each source were quantified.
These
structures were then used in conjunction with previous studies of
oligosaccharide
processing in insect cells (Altmann et al. (1996) Trends in Glycoscience and
Glycotechnology 8:101-114) to generate a detailed map of N-linked
oligosaccharide
processing in Trichoplitsia ni insect cells. The pathway and the levels of the
oligosaccharides from secreted and intracellular sources are detailed in
Figure 8.
The initial processing in the T. ni cells appears to be similar to the
mammalian
pathway, including trimming of the terminal glucose and mannose residues. The
trimming process follows a linear pathway with the exception of two different
forms
of the Man7GlcNAc2 (M7GN, in Figure 8 also observed in native insect
glycoproteins
(Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114)
and
IgG4, from NS/0 cells (Ip et al. (1994) Arch. Biochem. Biophys. 308:387-399).
The
presence of these two Man7 forms suggests the possible existence of an
alternative
processing pathway that yields Man7GlcNAc2 through the action of endo-alpha-
mannosidase. Following cleavage of the mannose residues, GlcNAc (GN) is added
to
the alpha 1,3 branch of Man5G1cNAC2 by GlcNAc TI (N-
acetylglusosaminyltransferase I) (Altmann et al. (1996) Trends in Glycoscience
and
Glycotechnology 8:101-114). However, GIcNAc1 Man5G1cNAC2 must be a short-
lived intermediate quickly processed by alpha-Man II, since this structure was
not
detected in the T. ni cell lysate. At the G1cNAc1, Mani GIcNAc2
oligosaccharide,
CA 02363297 2001-08-27
WO 00/52135 65 PCT/US00/05313
several branching steps in the N-glycan processing pathway are possible in
insect
cells. Complex glycoforms can be generated by the action of G1cNAc TII (N-
acetylglucosaminyltransferase II) and Gal T (galactosyltransferase T) to
provide
oligosaccharides which include terminal G1cNAc (GN) and Gal (G) residues. None
of the complex oligosaccharide structures included sialic acid indicating that
sialylation is negligible or non-existent in these cells.
The production of these complex glycoforms must compete with an alternative
processing pathway that is catalyzed by N-acetylglucosaminidase (Altmann et
al.
(1995) J. Biol. Chem. 270:17344-17349) (see Branch Points in Figure 8),
leading to
the production of hybrid and paucimannosidic structures. While the complex-
type N-
glycans represent 35% of the total secreted glycoforms (supernatant % in
Figure 8),
the majority of secreted N-glycans are either paucimannosidic (35%) or hybrid
structures (30%). Furthermore, those complex structures with a branch
terminating in
Gal represent less than 20% of the total secreted glycoforms and no structures
were
observed with terminal Gal on both branches of the N-glycan.
In contrast to the secreted glycoforms, the intracellular N-glycans (lysate %
in
Figure 8) obtained from insect cells include more than 50% high-mannose type
structures. The fraction of intracellular complex oligosaccharides is less
than 15% and
only 8% include a terminal Gal residue. The high level of high-mannose
structures
from intracellular sources indicates significantly less oligosaccharide
processing for
most of the intracellular immunoglobulins. Many of these intracellular
immunoglobulins may not reach the compartments in which carbohydrate trimming
takes place (Jarvis et al. (1989) Mol. Cell. Biol. 9:214-223). High mannose
glycoforms are also observed intracellularly for mammalian cells (Jenkins et
al.
(1998) Cell Culture Engineering VI).
Examples
Example 1: Evaluation of N-glycosylation Pathway Enzymes
The levels of N-linked oligosaccharide processing enzymes are measured
using analytical assays to characterize carbohydrate processing in native and
CA 02363297 2001-08-27
WO 00/52135 66 PCT/US00/05313
recombinant insect cells. These assays are used to compare the N-glycan
processing
capacity of different cell lines and to evaluate changes in processing and
metabolite
levels following metabolic engineering modifications.
High Performance Anion Exchange Chromatography (HPAEC) assay for galactose
transferase
HPAEC is used in combination with pulsed amperometric detection (HPAEC-
PAD) or conductivity to detect metabolite levels in the CMP-SA pathway and to
evaluate N-linked oligosaccharide processing enzymes essentially as described
by
(Lee et al. (1990) Anal. Biochem. 34:953-957, Lee et al. (1996) J.
Chromatography A
720:137-149). Shown in Figure 9 is an example of the use of HPAEC-PAD for
measuring Gal T activity by following the lactose formation reaction:
UDP - Gal + Glc Ga1T Lac + UDP
The peak labeled "Lac" indicates the formation of the product lactose (Lac).
Many of the enzymes involved in N-glycosylation (e.g., aldolase, CMP-NeuAc
synthetase, sialyltransferase) and metabolic intermediates (e.g., sialic acid,
CMP-
sialic acid, ManNAc, ManNAc-6-phosphate) in the CMP-SA production pathway are
measured using this form of chromatography, essentially as described by Lee et
al.
(1990) Anal. Biochem. 34:953-957, Lee et al. (1996) J. Chromatography A
720:137-
149, Hardy et al. (1988) Anal. Biochem. 170:54-62, Townsend et al. (1988)
Anal.
Biochem. 174:459-470, Kiang et al. (1997) Anal. Biochem. 245:97-101.
Reverse phase High Performance Liquid Chromatography (HPLC) for
sialyltransferase
To detect native sialyltransferase enzyme activity, Trichoplusia ni lysates
were
incubated in the presence of exogenously added CMP-SA and the fluorescent
substrate, 4-methylumbelliferyl lactoside (Lac-MU). Negligible conversion of
the
substrate was observed, indicating the absence of endogenous sialyltransferase
activity. However, following infection of the insect cells with a baculovirus
encoding
human alpha2-3-sialyltransferase, conversion of Lac-MU to the product sialyl
LacMU was observed in cell lysates using Reverse Phase HPLC and a fluorescence
CA 02363297 2001-08-27
WO 00/52135 67 PCT/USOO/05313
detector (Figure 10). For higher sensitivity, Lac-PA (PA=2-aminopyridine) or
Lac-
ABA (ABA=o-aminobenzamide) are used as substrates. HPLC and HPAEC is used
in conjunction with other fluorometric methods detailed in the procedures to
analyze
the metabolites and enzymatic activities in insect cells.
Dissociation Enhanced Lanthananide FluorommunoAssay (DELFIA) for GaiT
The previous chromatography techniques have one limitation in that only one
sample can be handled at a time. When samples from several cell lines must be
assayed, a method such as DELFIA is advantageous since a multiwell fluorometer
can
simultaneously examine activities in many samples on a microtiter plate
(Hemmila et
al. (1984) Anal. Biochem. 137:335-343). The application of such a technique
for the
measurement of Gal T activity in several different insect cell lysates and
controls is
shown in Figure 11. First, the wells of the microtiter plate are coated with
the
substrate G1cNAc-BSA (Stowell et al. (1993) Meth. in Carb. Chem. 9:178-181).
After incubation with Gal T and UDP-Gal, the well is washed and the Gal
residue
newly attached to GlcNAc-BSA is measured with europium (Eu+3)-labeled Ricinus
cummunis lectin, which specifically binds Gal or Ga1NAc structures. The
sensitivity
of Eu fluorescence under appropriate conditions can reach the fmol range and
match
or eclipse that of radioiodides (Kawasaki et al. (1997) Anal. Biochem. 250:260-
262).
Figure 11 depicts G1cNAc-BSA in (A) Boiled lysate; (B) T. ni; (C) Standard
enzyme, 0.5 mU; (D) T. ni insect cells infected with a baculovirus coding for
Ga1T
(E) Sf-9 cells stably transfected with GaIT gene. The increase in Gal T
activity in
untreated cell lysates (B in Figure 11) relative to boiled lysates (A)
indicates that T. ni
cells have low but measurable endogenous Gal T activity. The Gal T activity
level is
increased significantly following infection with a baculovirus vector
including a
mammalian Gal T gene under the IE 1 promoter or by using Sf-9 cells stably-
transformed with the Gal T gene (cell lines are described in Jarvis et al.
(1996) Nature
Biotech. 14:1288-1292; and Hollister et al. (1998) Glycobiology 8:473-480).
The DELFIA method is not limited to Gal T measurement. This technique is
used to evaluate the activity of any processing enzyme which generates
carbohydrate
structures containing binding sites for a specific lectin or carbohydrate-
specific
CA 02363297 2001-08-27
WO 00/52135 68 PCTIUSOO/05313
antibodies (Taki et al. (1994) Anal. Biochem. 219:104-108, Rabina et al.
(1997) Anal.
Biochem. 246:459-470).
Example 2: Enhancing SA levels by Substrate Addition
Because the conventional substrates in insect cell media are not efficiently
converted to CMP-SA in insect cells as demonstrated by the low levels of CMP-
SA,
alternative substrates are added to the culture medium. Because sialic acid
and CMP-
SA are not permeable to cell membranes (Bennetts et al. (1981) J. Cell. Biol.
88:1-
15), they are not considered as appropriate substrates. However, other
precursors in
the CMP-SA pathway are incorporated into cells and considered as substrates
for the
generation of CMP-SA in insect cells.
Incorporation and conversion of N-acetylmannosamine (ManNAc)
ManNAc has been added to mammalian tissue and cell cultures and
enzymatically converted to SA and CMP-SA (Ferwerda et al. (1983) Biochem. J.
216:87-92, Gu et al. (1997) Improvement of the interferon-gamma sialylation in
Chinese hamster ovary cell culture by feeding N-acetylmannosamine, Thomas et
al.
(1985) Biochim. Biophys. Acta 846:37-43). Consequently, external feeding of
ManNAc is examined as one strategy to enhance CMP-SA levels in insect cells.
ManNAc is available commercially (Sigma Chemical Co.) or can be prepared
chemically from the less expensive feedstock G1cNAc in vitro using sodium
hydroxide (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-
400). Initially, the levels of native cellular ManNAc, if any, is determined
using
HPAEC-PAD techniques (Lee et al. (1990) Anal. Biochem. 34:953-957, Lee et al.
(1996) J. Chromatography A 720:137-149, Hardy et al. (1988) Anal. Biochem.
170:54-62, Townsend et al. (1988) Anal. Biochem. 174:459-470, Kiang et al.
(1997)
Anal. Biochem. 245:97-101). The ability to increase intracellular ManNAc
levels is
evaluated by adding ManNAc to cell culture media. Incorporation of exogenous
ManNAc is quantified using unlabeled ManNAc if levels of native ManNAc are
negligible, or 14C- or 3H-labeled ManNAc if significant levels of native
ManNAc are
present) (Bennetts et al. (1981) J. Cell. Biol. 88:1-15, Kriesel et al. (1988)
J. Biol.
Chem. 263:11736-11742). The levels of radioactive ManNAc and other metabolites
CA 02363297 2001-08-27
WO 00/52135 69 PCT/US00/05313
are determined by collecting ManNAc peaks following HPAEC and measuring the
radioactivity using scintillation countering.
To be effective as a substrate for sialylation, the ManNAc must be converted
to SA and CMP-SA through intracellular pathways. This conversion is detected
directly from externally added ManNAc by following an increase in internal SA
and
CMP-SA levels using HPAEC or thin layer chromatography (TLC) combined with
liquid scintillation counting to detect the radiolabeled metabolites. HPAEC
techniques have been used to quantify cellular pools of CMP-SA in as few as 6
x 106
mammalian cells (Fritsch et al. (1996) Journal of Chromatography A 727:223-
230),
and TLC has been used to evaluate conversion of 14C labeled ManNAc to sialic
acid
in bacteria (Vann et al. (1997) Glycobiology 7:697-701). If the addition of
ManNAc
leads to a significant increase in the CMP-SA levels, a limiting step exists
in the
production of ManNAc from conventional insect cell media substrates. Different
ManNAc feeding concentrations are tested and the effect on CMP-SA levels and
insect cell viability evaluated to determine if there are any deleterious
effects from
feeding the ManNAc as substrate. Conversion of ManNAc to SA through the
aldolase pathway requires pyruvate, and the addition of cytidine can enhance
CMP-
SA production from SA (Thomas et al. (1985) Biochim. Biophys. Acta 846:37-43).
Thus, pyruvate and cytidine are optionally added to the medium to enhance
conversion of ManNAc to CMP-SA (Tomita et al. (1995) Biochim. Biophys. Acta
1243:329-335, Thomas et al. (1985) Biochim. Biophys. Acta 846:37-43).
Alternative Substrates
Other precursors substrates such as N-acetylglucosamine (G1cNAc) and
glucosamine are converted to SA and CMP-SA through the ManNAc pathway in
eukaryotic cells (Pederson et al. (1992) Cancer Res. 52:3782-3786, Kohn et al.
(1962)
J. Biol. Chem. 237:304-308). The disposition of these alternative precursor
substrates
are monitored using HPAEC analysis using techniques known in the art and
compared
with ManNAc feeding strategies to determine which substrate provides for the
most
efficient production of CMP-SA, in particular insect cells.
CA 02363297 2001-08-27
WO 00/52135 70 PCT/US00/05313
Example 3: Purification and cloning of CMP-SA synthetase
A bioinformatics search of the cDNA libraries of HGS revealed a novel
human CMP-SA synthetase gene based on its homology with the E. coli DNA
sequence. The bacterial enzyme includes a nucleotide binding site for CTP.
This
binding site contains a number of amino acids that are conserved among all
known
bacterial CMP-SA synthetase enzymes (See Stoughton et al., Biochem J. 15:397-
402
(1999). The identity of the human cDNA as a CMP-SA synthetase gene was
confirmed by the presence of significant homology within this binding motif:
bacterial sequence: IIAIIPARSGSKGL
identity/homology + A+I AR GSKG+
human cDNA: LAALILARGGSKGI
This human homologue commercially, publicly, or otherwise available for the
purposes of this invention is cloned and expressed in insect cells. The
nucleotide and
amino acid sequences of human CMP SA synthetase are shown in Figures 29 and 30
respectively.
Example 4: Isolation and Inhibition of glucosaminidase
It is recognized that insect cells could possess additional N-
acetylgiucosaminidase enzymes other than the enzyme responsible for generating
low-mannose structures, so both recombinant DNA and biochemical approaches are
implemented to isolate the target N=acetylglucosaminidase gene. PCR techniques
are
used to isolate fragments of N-acetylglucosaminidase genes by the same
strategies
used in isolating alpha-mannosidase cDNAs from Sf-9 cells (Jarvis et al.
(1997)
Glycobiology 7:113-127, Kawar et al. (1997) Glycobiology 7:433-443).
Degenerate
oligonucleotide primers are designed corresponding to regions of conserved
amino
acid sequence identified in all N-acetylglucosaminidases described thus far,
from
human to bacteria, including two lepidopteran insect enzymes (Zen et al.
(1996)
Insect Biochem. Mol. Biol. 26:435-444). These primers are used to amplify a
fragment
of the N-acetylglucosaminidase gene(s) from genomic DNA or cDNA of
lepidopteran
insect cell lines commercially, publicly, or otherwise available for the
purposes of this
invention. A putative N-acetylglucosaminidase gene fragment from Sf9 genomic
CA 02363297 2001-08-28
PCT/US 00/ 05313
IPEAIUS21 DEC 2000
71
DNA and from High FiveTM cell (Invitrogen Corp., Carlsbad, CA, USA) cDNA has
been
identified (Figures 18A-B). Similar techniques are used to isolate cDNAs from
other insect
cell lines of interest. The identification of cDNAs for the Sf9 or High FiveTM
N-
acetylglucosaminidase facilitates the isolation of the gene in other insect
cell lines.
Figures 18A-B depicts PCR amplification of Sf9 genomic DNA (A) or High
FiveTMcell cDNA (B) with degenerate primers corresponding to three different
regions
conserved within N-acetylglucosaminidases. These regions were designated 1, 2,
and 3, from
5 to 3'. Lane 1 (sense primer 1 and antisense primer 2); Lanes 2 (sense primer
f and
antisense primer 3); Lanes 3 (sense primer 2 and antisense primer 3). M (size
standards with
sizes indicated in Kbp). The results show that specific fragments of N-
acetylglucosaminidase
genes were amplified from both DNAs (lanes A2 and B3). The specificity of the
reactions is
indicated by the fact that different primer pairs produced different
amplification products
from different templates. The primer sequences utilized in amplifying the
putative N-
acetylglucosaminidase gene were as follows:
Sense primer #1: 5'-T/C,T,I,C,A,C/ T,T,G,G,C,A,CTF,A/T/C,T,I,G,T,I,G,A-3' (SEQ
ID
NO:9)
Sense primer #2: 5'-G,A,G/A,A/T,T,A/C/T,G,A,C/T,I,I,I,C,C,I,G,G/C,I,C,A-3'
(SEQ ID
NO:10)
Antisense primer #2: 5'-T,G,I,C/G,C,I,G,G,I,I,I,G/A,T,C,T/G/A,A,T/A,C/T,T,C-3'
(SEQ ID
NO:11)
Antisense primer #3: 5'-A,C/A/G,C/T,T,C,G/A,T,C,I,C,C,I,C,C,I,I,I,G/A,T,G-3'
(SEQ ID NO: 12)
The PCR amplified fragments are cloned and sequenced using the chain
termination method
(Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463-5467). The results
are used to
design exact-match oligonucleotide primers to isolate an N-
acetylglucosaminidase clone(s)
from existing Sf9 and/or High FiveTM lambda ZAPII
AMENDED SHEET
CA 02363297 2008-11-03
72
cDNA libraries by sibling selection and PCR (Jarvis et al. (1997) Glycobiology
7:113-
127, Kawar et al. (1997).Glycobiology 7:433-443). The library is consecutively
split
into sub-pools that score positive in PCR screens until a positive sub-pool of
approximately 2,000 clones is obtained. These clones are then screened by
plaque
hybridization (Benton et al. (1977) Science 196:180-182) using the cloned PCR
fragment, and positive clones are identified and plaque purified. The cDNA(s)
are
then excised in vivo as a pBluescript-based subclone in E. coll.
Isolation ofN-acetylglucosaminidases using biochemical techniques
Since insect cells may have multiple N-acetylglucosaminidases, a biochemical
purification approach is also used to broaden the search for the cDNA encoding
the
target enzyme. A polyclonal antiserum against a .Manduca sexta N-
acetylglucosaminidase (Koga.et al. (1983) Manduca sexta Comparative
Biochemistry
and Physiology 74:515-520) is used to examine Sf9 and High FiveTM cells for
cross-
reactivity. This antiserum is used to probe for the N-acetylglucosaminidase
during
biochemical isolation techniques. In addition, specific assays for N-
acetylglucosaminidase described earlier are used to monitor enzyme activity in
isolated biochemical fractions.
The target N-acetylglucosaminidase is membrane bound, so it must be
solubilized using a. detergent such as Triton X 1.00 prior-to purification.
Once
solubilized, the enzyme is purified by a combination. of gel filtration, ion
exchange,
and affinity chromatography. For affinity chromatography, the affinants 6-
aminohexyl thio-N-acetylglucosaminide (Chipowsky et al. (1973) Carbohydr. Res.
.31:339-346) or BSA modified with thio-N-acetylglucosaminide (Lee et al.
(1976)
Biochemistry 15:3956-3963) is tried first. If necessary, 6-aminohexyl a-D-[2-
(thio-2-
amino-2-deoxy-b-D-glucosaminyl)-mannopyranodside or other thio-
oligosaccharides
are synthesized and used as affinants. Affinity -matrices are prepared using
commercially available products. .
Alternatively, the target enzyme is "anchored" to the membrane by a
glycophosphoinositide. In such a case, a specific p'hospholipase C is used to
release
the active enzyme from the membrane, and the use of detergent for
solubilization-is
avoided.
CA 02363297 2001-08-27
WO 00/52135 73 PCT/US00/05313
The purity of the enzyme is examined with SDS-PAGE and mass
spectroscopy, and the activity of the enzyme characterized. Once the enzyme is
sufficiently purified, its amino-terminal region is sequenced by conventional
Edman
degradation techniques, available commercially. If N-terminal blockage is
encountered, the purified protein are digested, peptides purified, and these
peptides
are used to obtain internal amino acid sequences. The resulting sequence
information
is used to design degenerate oligonucleotide primers that are used, in turn,
to isolate
cDNAs as described above.
Expression of glucosaminidase
Isolated full-length cDNAs are sequenced, compared to other N-
acetylglucosaminidase cDNAs, and expressed using known polyhedrin-based
baculovirus vectors. The overexpressed proteins are purified, their
biochemical
activities and substrate specificities characterized, and new polyclonal
antisera is
produced to establish the subcellular locations of the enzymes in insect
cells. The
locations are optionally identified by using the antisera in conjunction with
secretory
pathway markers, including Golgi and endoplasmic reticulum specific dyes and
GFP-
tagged N-glycan processing enzymes commercially, publicly, or otherwise
available
for the purposes of this invention. Evaluation of the N-glycan structures on
secreted
glycoproteins from insect cells overexpressing the glucosaminidase gene
demonstrates the involvement of this enzyme in N-glycan processing as opposed
to
lysosomal degradation, a common activity for other glucosaminidases.
Example 5: Expression of the model glycoprotein transferrin
The gene encoding human transferrin as described in Genbank accession No.
S95936 is cloned into the baculovirus vector, expressed in multiple insect
cell lines,
and purified to homogeneity. Figure 26 shows SDS-PAGE of transferrin from
insect
cells (M=unpurified lysates, P=purified protein). Similar techniques are used
to
express and purify this glycoprotein in the target cell line(s) of interest
following
manipulation of the glycosyltransferase and CMP-SA production pathways.
Once the transferrin is purified to homogeneity, the structures of the
oligosaccharides which are N-linked at two sites of the transferrin are
analyzed using
CA 02363297 2001-08-27
WO 00/52135 74 PCTIUSOO/05313
3-dimensional HPLC mapping techniques. Over 450 N-glycans have been mapped
with this technique. For example, characterization of the N-linked
oligosaccharides
attached to the heavy chain of secreted and intracellular IgG is described.
Confirmation of particular carbohydrate structures is provided by treating the
oligosaccharides with glycosidases and re-eluting through the HPLC columns.
Additional structural information on unknown oligosaccharides are obtained
using
mass spectrometry and NMR techniques previously used for analysis of IgG
glycoforms (Hsu et al. (1997) J. Biol. Chem. 272:9062-9070).
These analytical techniques allow the identification and quantification of N-
glycans to determine if a fraction of these structures are sialylated
oligosaccharides.
Sialylation is confirmed by treating the purified N-glycan with sialidase from
A.
ureafaciens and measuring the release of sialic acid using HPAEC-PAD.
The present invention now will be described more fully hereinafter with
reference to the accompanying drawings, in which preferred embodiments of the
invention are shown. This invention may, however, be embodied in many
different
forms and should not be construed as limited to the embodiments set forth
herein;
rather, these embodiments are provided so that this disclosure will be
thorough and
complete, and will fully convey the scope of the invention to those skilled in
the art.
Like numbers refer to like elements throughout.
Many modifications and other embodiments of the invention will come to
mind to one skilled in the art to which this invention pertains having the
benefit of the
teachings presented in the foregoing descriptions and the associated drawings.
Therefore, it is to be understood that the invention is not to be limited to
the specific
embodiments disclosed and that modifications and other embodiments are
intended to
be included within the scope of the appended claims. Although specific terms
are
employed herein, they are used in a generic and descriptive sense only and not
for
purposes of limitation.
Example 6: Cloning, expression, and characterization of the human sialic acid
synthetase (SAS) gene and gene product.
This example reports the cloning and characterization of a novel human gene
having homology to the Escherichia coli sialic acid synthetase gene (neuB).
This
CA 02363297 2001-08-28
PCTiUS00/05313
IPEA/US21 DEC 2000
human gene is ubiquitously expressed and encodes a 40 kD enzyme which results
in N-
acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic
acid
(KDN) production in insect cells upon recombinant baculovirus infection. In
vitro the human
enzyme uses N-acetylmannosamine-6-phosphate and mannose-6-phosphate as
substrates to
5 generate phosphorylated forms. of Neu5Ac and KDN, respectively, but exhibits
much higher
activity toward the Neu5Ac phosphate product.
In order to identify genes involved in sialic acid biosynthesis in eukaryotes,
homology
searches of a human expressed sequence tag (EST) database were performed using
the E. coli
sialic acid synthetase gene. A cDNA of approximately 1 kb with a predicted
open reading
1o frame (ORF) of 359 amino acids was identified. Northern blot analysis
indicated that the
mRNA is ubiquitously expressed, and in vitro transcription and translation
along with
recombinant expression in insect cells demonstrated that the human sialic acid
synthetase
(SAS) gene encodes a 40 kD protein. SAS rescued an E. coli neuB mutant
although less
efficiently than neuB. Neu5Ac production in insect culture supplemented with
ManNAc
15 further supported the role of SAS in sialic acid biosynthesis. In addition
to Neu5Ac, a second
sialic acid, KDN, was generated suggesting that the human enzyme has broad
substrate
specificity. The human enzyme (SAS), unlike its E. coli homologue, uses
phosphorylated
substrates to generate phosphorylated sialic acids and thus likely represents
the previously
described sialic acid-9-phosphate synthetase of mammalian cells (Watson et
al., J. Biol.
20 Chem. 241, 5627-5636 (1966)).
Identification of a Human Sialic Acid Synthetase Gene
The E. coli sialic acid synthetase gene (Annunziato et al., J. Bacteriol. 177,
312-319
(1995)) was used to search the human EST database of Human Genome Sciences,
Inc.
25 (Rockville, MD). One EST with significant homology to the neuB gene was
found in a
human liver cDNA library and used to identify a full length cDNA (Figures 35A1-
A3) with
an ORF homologous to the bacterial synthetase over most of its length. The
putative
synthetase consisted of 359 amino acids (SEQ ID NO:6) while the neuB gene
product
contained 346 amino acids (SEQ ID NO:8). Alignment of the human against the
bacterial
30 enzyme demonstrated that significant differences
AMENDED SHEET
..............
CA 02363297 2008-11-03
76
were found primarily in the N-terminus (Figure 35B). Overall, the two
synthetases
were found to be 36.1% identical and 56.1 % similar at the amino acid level.
The product of a cDNA amplification with a T7 promoter was expressed by in
vitro transcription and translation using rabbit reticulocyte lysates. The
generation of
an -40 kD protein, consistent with a predicted molecular weight of 40.3 kD,
confirmed the existence of an ORF (Figure 36A, lane 2). The negative control,
namely the vector without an insert, did not produce a protein product (Figure
36A,
lane 1). Northern blot analysis was performed on poly-A+ RNA blots
representing a
selection of human tissues (Figure 36B). The full-length cDNA was radio-
labeled
and used as probe. A band of expected size, -1.3 kb, was observed in all
tissues tested
suggesting that the putative synthetase is ubiquitously expressed.
Expression and Purification of Human Sialic Acid Synthetase
SAS was inserted into baculovirus under the polh promoter using IacZ as a
positive selection marker. After transfection and viral titering, the
resulting virus
(AcSAS) was used to infect Spodoptera frugiperda (Sf-9) cells followed by
pulse
labeling. An -40 kD band was observed in the Sf-9 lysates from cells infected
by
AcSAS (Figure 36A, lane 5) and not in the mock infected control (Figure 36A,
lane
4). Furthermore, this band co-migrated with the protein produced in vitro. To
verify
SAS expression, the band was visualized in the non-nuclear fraction (Miyamoto
et al.,
Mol. Cell.. Biol. 5, 2860-2865 (1985)) after electrophoretic transfer to a
ProBlottTM
membrane and Ponceau S staining and excised for amino acid
sequencing. The five N-terminal amino acids were identical to the second
through
sixth amino acids of the predicted protein.. Interestingly, the initiator
methionine was also removed from the purified recombinant E. coli sialic acid.
synthetase (Vann et al., 1997).
In Vivo Activity of Human Sialic Acid Synthetase
Covalent labeling of sialic acids with the fluorescent reagent 1,2-diamino-4,5-
methylene dioxybenzene dihydrochloride (DMB) allows very specific and
sensitive
sialic acid detection (Hara et al., Anal. Biochem: 179, 162-166 (1989); Manzi
et al.,
Anal. Biochem. 188, 20-32 (1990)). The DMB reaction products are identified
after
CA 02363297 2008-11-03
.77
separation by reverse phase HPLC chromatography. Using this technique, sialic
acid
standards were measured in quantities as low as 50 fmol. Sialic acid
levels of an insect cell line (Sf-9) and a mammalian cell line (Chinese
hamster ovary,
CHO) were compared (Table 2). The sialic acid content in cell lysates before
and
after filtration through a 10,000 MWCO membrane was determined by DMB labeling
and HPLC separation. The native sialic acid levels in Sf-9 cells grown without
fetal
bovine serum (FBS) supplementation are substantially lower than the levels
found in
CHO cells (Table 2; Figure 37A). To ensure that the low sialic acid content
was not
due to the absence of serum, the sialic acid content of insect cells cultured
in 10%
FBS was determined. Even with FBS addition, the Neu5Ac content of Sf-9 cells
is
nearly an order of magnitude -lower. than the content of CHO cells (Table 2).
The
origin of the sialic acid detected in insect cells, whether natively produced
or the
result of contamination from the media, is not clear since even serum free
insect cell
media contains significant levels of sialic acid.
Table 2. Sialic Acid Content of CHO and Sf-9 Cell Lines
KDN (fmol/ g protein) Neu5Ac (fmol/ g protein)
+ Filtration - Filtration + Filtration - Filtration
Sf-9 - - 20- 30
Sf-9 + FBS - - 80 600
CHO 70 100 900 4,200
CHO and Sf-9 cells were grown to confluency in T-75 flasks. Cell lysates with
and
without 10,000 MWCO filtration were analyzed for sialic acid content following
DMB
derivatization and HPLC separation. Sialic acid levels have been normalized
based on
lysate protein content. Dashes indicate sialic acid was not detectable.
The lack of large sialic acid pools in Sf-9 cells grown in serum-free media
facilitated the detection of sialic acids produced by recombinant enzymes. In
order to
examine the production of sialic acids from cells infected with recombinant
virus, Sf-
9 cells were infected with AcSAS and a negative control virus, A35.. The A35
virus
was generated by recombining a transfer vector without a gene inserted
downstream
of the polh promoter. Low levels of Neu5Ac were observed in lysates from-
insect
cells infected by either virus (Figure 37B) indicating additional Neu5Ac was
not
CA 02363297 2008-11-03
78
produced following the expression of SAS. However, a significant new peak was
seen in AcSAS lysates at 12.5 min. that was not observed in A35 negative
control
lysates (Figure 37B). Published chromatograms suggested the unknown early
eluting
peak could be N-glycolylneuraminic acid (Neu5Gc) or KDN (Inoue et al., 1998).
The
elution time of the unknown peak was the same as DMB-derivatized KDN standard
(Figure 37B) and co-chromatographed with authentic DMB-KDN
confirming KDN generation in AcSAS infected Sf-9 cells. KDN was not detected
in
uninfected Sf-9 cells either with or without FBS supplementation (Table 2).
In a further attempt to demonstrate Neu5Ac synthetic functionality, the
culture
media was supplemented with ManNAc, the metabolic precursor of Neu5Ac. In
addition to a DMB-KDN peak, 'a prominent peak eluting at 17.5 min.
corresponding
with that of the Neu5Ac standard was observed from the lysates of ManNAc
supplemented Sf-9 cells infected with AcSAS (Figure 37C). Neu5Ac quantities
were
more than 100 times lower in the uninfected lysates and even less in A35
infected
lysates (Table 2).
Sialic acid levels were quantified in lysates of uninfected, A35 infected, and
AcSAS infected Sf-9 cells grown in media with and without Man, mannosamine
(ManN), or ManNAc supplementation (Table 3). In uninfected cells, Man feeding
resulted in detection of KDN slightly above background, and ManNAc feeding
marginally increased Neu5Ac levels in uninfected and A35 infected cells (Table
3).
ManN supplementation had no effect on KDN levels-but increased Neu5Ac levels
(Table 3)_ The most, significant changes in sialic acid levels occurred with
AcSAS
infection. AcSAS infection of Sf-9' cells led to large increases in KDN levels
with
slight enhancements upon Man or ManNAc supplementation. Both AcSAS infection
and ManNAc feeding were required to obtain substantial Neu5Ac levels.
Table 3. Sialic Acid Content of Sf-9 with Media Supplementation .
KDN (finollue protein) Neu5Ac (fmol/ g protein)
Feeding: None Man ManN ManNAc None Man ManN ManNAc
No Infection 20 - - ' 30 20 60 140
A35 - - - - 80 80 100 120
AcSAS 5,300 7,600 5,200 6,300 50 40 200 27,000
CA 02363297 2008-11-03
79
Uninfected, A35 infected, and AcSAS infected Sf-9 cells were grown in
unsupplemented media
and media that was supplemented with 10 mM Man, ManN, or ManNAc. Cell lysates
were
analyzed for KDN and Neu5Ac content using DMB derivatization and HPLC
separation. Sialic
acid levels have been normalized based on lysate protein content. Dashes
indicate sialic acid was
not detectable.
The presence of KDN and Neu5Ac in AcSAS lysates has been confirmed by
high-performance anion-exchange chromatography (HPAEC) with a pulsed
amperometric detector (Figure 37D). When culture media is supplemented with
ManNAc, peaks with elution times corresponding to authentic KDN and Neu5Ac
standards are seen in AcSAS infected lysates that are absent in A35 infected
lysates.
Neu5Ac aldolase has been demonstrated previously to break Neu5Ac into ManNAc
and pyruvic acid (Comb and Roseman, J. Biol. Chem. 235, 2529-2537 (1960)) and
KDN into Man and pyruvic acid (Nadano et al., J. Biol. Chem. 261, 11550-11557
(1986)). KDN and Neu5Ac disappear from the AcSAS lysates after aldolase
treatment (Figure 37D). A similar disappearance of the sialic acid peaks
following
aldolase treatment was observed using DMB-labeling and HPLC analysis.:
In Vitro Activity of Human Sialic Acid Synthetase
The mammalian pathway for Neu5Ac synthesis uses a phosphate
intermediate (Jourdian et al., J Biol. Chem. 239, PC2714-PC2716 (1964); Kundig
et
al., J. Biol. Chem. 241,' 5619-5626 (.1966); Watson et al., J. Biol. Chem.
241, 5627-
5636 (1966)) while the E. coli pathway directly converts ManNAc and PEP to
Neu5Ac (Vann et al., Glycobiology 7, 697-701 (1997)). In order to determine
which
substrates are used by the human enzyme, in vitro, assays were performed using
lysates of infected Sf-9 cells and protein purified from the prokaryotic
expression
system. Lysates or purified protein plus PEP and MinC12 (Angata.et al., J.
Biol. Chem.
274, 22949-22956 (1999)) were incubated with Man, mannose-6-phosphate (Man-6-
P), ManNAc, or ManNAc-6-P followed by DMB labeling and HPLC analysis.
AcSAS infected cell lysates incubated with ManNAc-6-P and PEP produced a
peak eluting at 5.5 min (Figure 38A) consistent with phosphorylated sugars.-
In
previous studies, phosphorylated KDN was detected as DMB-KDN after alkaline
CA 02363297 2008-11-03
phosphatase (AP) treatment and DMB derivatization (Angata et al., J. Biol.
Chem.
274, 22949-22956 (1999)). Similarly, the peak eluting at 5.5 min. was
exchanged for
one that eluted at the same time as authentic Neu5Ac following AP treatment
(Figure
38A). Likewise, an early eluting peak from the incubation mixture containing
Man-6-
5 P yielded a KDN peak after AP treatment (Figure 38B). No sialic acid
products were
detected when A35 infected cell lysates were used in the equivalent assays or
when
Man or ManNAc were used as substrates.
Assays were performed by incubating lysates with different substrate solution
concentrations of Man-6-P and ManNAc-6-P in order to evaluate substrate
10 preference. After incubation for a fixed time period, the samples were
treated with
AP, and DMB derivatives of Neu5Ac and KDN were quantified and compared (Table
4). When equimolar amounts of substrates are used, Neu5Ac production is
significantly favored over KDN especially at higher equimolar concentrations
(10 and
20 mM) of the two substrates. Only when the substrate concentration of ManNAc-
6-
15 P is substantially lower than the Man-6-P levels are production levels of
the two sialic
acids comparable. When the ManNAc-6-P concentration is 1 mM and the Man-6-P
level is 20 mM, the Neu5Ac:KDN production ratio approaches unity. Therefore,
the
enzyme prefers ManNAc-6-P over Man-6-P in the production of phosphorylated
forms of Neu5Ac and KDN, respectively.
Table 4. Competitive Formation of Neu5Ac and KDN
Concentration in Substrate Solution (mM) Final Concentration (pmol/ l)
Neu5Ac/KDN
Man-6-P ManNAc-6-P KDN Neu5Ac Ratio
1 1 8 33 4.2
5 1 19 . 47 2.5
10 1 33 53 1.6
20 1 56 60 1.1
5 5 14 190 14
10 10 18 440 24
20 .20 16 820 51
20 5 40 300 7.6
20 10 .18 470 - 25
CA 02363297 2001-08-27
WO 00/52135 81 PCT/USOO/05313
Lysates from AcSAS infected Sf-9 cells were incubated with substrate solutions
containing the indicated concentrations of Man-6-P and ManNAc-6-P. After
incubation
and AP treatment, samples were analyzed for KDN and Neu5Ac content using DMB
derivatization and HPLC separation. Neu5Ac and KDN concentrations of the final
solution (50 l) and the Neu5Ac/KDN ratio are reported.
Discussion of Human Sialic Acid Synthetase Characterization
We have identified the sequence of a human sialic acid phosphate synthetase
gene, SAS, whose protein product condenses ManNAc-6-P or Man-6-P with PEP to
form Neu5Ac and KDN phosphates, respectively. To our knowledge, this is the
first
report of the cloning of a eukaryotic sialic acid phosphate synthetase gene.
Despite
the importance of sialic acids in many biological recognition phenomena,
sialic acid
phosphate synthetase genes have not been cloned because the enzymes they
encode
are unstable and difficult to purify (Watson et al., J. Biol. Chem. 241, 5627-
5636
(1966); Angata et al., J. Biol. Chem. 274, 22949-22956 (1999)). Even the E.
coli
sialic acid synthetase enzyme, whose sequence is known, has low specific
activity and
is unstable (Vann et al., Glycobiology 7, 697-701 (1997)).
Consequently, a bioinformatics approach based on the E. coli synthetase
sequence was used to identify a putative human gene 36% identical and 56%
similar
to neuB. In vitro transcription and translation verified an open reading frame
which
encoded a 359 amino acid protein. In addition, Northern blots revealed
ubiquitous
transcription of the human synthetase gene in a selection of human tissues.
The wide
distribution of SAS mRNA is consistent with the detection of sialic acids in
many
different mammalian tissues (Inoue and Inoue, Sialobiology and Other Novel
Forms
of Glycosylation (Osaka, Japan: Gakushin Publishing) pp.57-67 (1999)).
Using the baculovirus expression system, the 40 kD sialic acid phosphate
synthetase enzyme, SAS, was expressed in cells. The use of Sf-9 cells which
have
little if any native sialic acid greatly facilitated the detection of sialic
acids and the
characterization of SAS. However, Neu5Ac was observed only when insect cells
were infected with AcSAS and the cell culture media was supplemented with
CA 02363297 2001-08-27
WO 00/52135 82 PCT/US00/05313
ManNAc, a sialic acid precursor. This ManNAc feeding requirement indicates
that
Sf-9 cells may lack sizeable ManNAc pools and synthetic pathways.
SAS was identified based on homology with neuB whose enzyme product
directly forms Neu5Ac from ManNAc and PEP (Vann et al., Glycobiology 7, 697-
701
(1997)). Furthermore, insect cells produce Neu5Ac following recombinant SAS
expression and ManNAc supplementation. However, mammalian cells are known
only to produce Neu5Ac from ManNAc through a three-step pathway with
phosphorylated intermediates. Therefore, in vitro assays were performed to
determine
the substrate specificity of SAS. Both AcSAS infected insect cell lysates and
protein
purified from the prokaryotic expression system were assayed using ManNAc and
ManNAc-6-P as possible substrates. A rapidly eluting DMB derivatized product,
typical of a phosphorylated sialic acid, was observed only when ManNAc-6-P was
used as the substrate. Furthermore, this peak disappears with the appearance
of an
unsubstituted DMB-Neu5Ac peak following AP treatment. SAS therefore condenses
PEP and ManNAc-6-P to form a Neu5Ac phosphate product. Although the exact
position of the phosphorylated carbon on the product has not yet been
specified, SAS
is likely the sialic acid phosphate synthetase enzyme of the previously
described
three-step mammalian pathway (Kundig et al., J. Biol. Chem. 241, 5619-5626
(1966);
Watson et al., J. Biol. Chem. 241, 5627-5636 (1966); Jourdian et al., J. Biol.
Chem.
239, PC2714-PC2716 (1964)). Despite little if any native pools of sialic
acids, Sf-9
cells natively possess the ability to complete the three-step mammalian
pathway when
only the sialic acid phosphate synthetase gene is provided. Sf-9 cells have
been
shown to have substantial ManNAc kinase ability (Effertz et al., J. Biol.
Chem. 274,
28771-28778 (1999)), and phosphatase activity has also been detected in insect
cells
(Sukhanova et al., Genetika 34, 1239-1242 (1998)).
The capacity to produce sialic acids in Sf-9 cells following AcSAS infection
and ManNAc supplementation at levels even higher than those seen in a
mammalian
cell lines such as CHO may help overcome a major limitation of the baculovirus
expression system. N-glycans of recombinant glycoproteins produced in insect
cells
lack significant levels of terminal sialic acid residues (Jarvis and Finn,
Virology 212,
500-511 (1995); Ogonah et al., Bio/Technology 14, 197-202 (1996)). The lack of
sialylation on human thyrotropin produced by the baculovirus expression system
CA 02363297 2001-08-27
WO 00/52135 83 PCTIUSOO/05313
resulted in rapid in vivo thyrotropin clearance as compared to thyrotropin
produced by
a mammalian system (Grossmann et al., Endocrinology 138, 92-100 (1997)).
Generation of significant sialic acid pools along with expression of other
genes such
as sialyltransferases may lead to production of significant levels of
sialylated
glycoproteins in insect cells.
Another interesting observation was the occurrence of a second DMB reactive
peak in AcSAS infected Sf-9 lysates. This peak has been identified as KDN, a
deaminated Neu5Ac. We subsequently demonstrated that the SAS enzyme generates
KDN phosphate from Man-6-P and PEP in vitro. While Neu5Ac production in insect
cells requires both AcSAS infection and ManNAc supplementation, only AcSAS
infection is necessary for KDN synthesis. Therefore, significant substrate
pools for
the generation of KDN already exist in insect cells or are present in the
media. In
addition, mannose feeding increased KDN production even further.
Interestingly,
Man feeding of the uninfected insect cells increased KDN levels above
background,
and ManNAc feeding also led to higher Neu5Ac levels in uninfected cells.
Therefore,
insect cells may possess limited native sialic acid synthetic ability. Similar
substrate
supplementation results have been reported in mammalian cells, as cultivation
in
Man-rich or ManNAc-rich media enhanced the synthesis of native intracellular
KDN
and Neu5Ac, respectively (Angata et al., Biochem. Biophys. Res. Commun. 261,
326-
331 (1999)).
This study is the first report of a eukaryotic gene encoding any enzyme with
KDN synthetic ability. Recently, KDN enzymatic activity has been characterized
in
trout testis, a tissue high in KDN content. KDN is synthesized from Man in
trout
through a three-step pathway involving a synthetase with a Man-6-P substrate
(Angata et al., J. Biol. Chem. 274, 22949-22956 (1999)). However, the fish
synthetase enzyme, partially purified from trout testis, was approximately 80
kD as
compared to the human enzyme of 40 kD. Furthermore, KDN and Neu5Ac phosphate
synthesis in trout were likely catalyzed by two separate synthetase activities
(Angata
et al., J. Biol. Chem. 274, 22949-22956 (1999)) while the current study
indicates that
both products were generated from a single human enzyme with broad substrate
specificity.
CA 02363297 2008-11-03
84
Neu5Ac, usually bound to glycoconjugates, is the predominant sialic acid
found in mammalian tissue, but KDN, primarily found free in the ethanol
soluble
fractions, has also been detected all human tissues examined so far (Inoue and
Inoue,
Sialobiology and Other Novel Forms of Glycosylation (Osaka, Japan: Gakushin
Publishing, pp.57-67 (1999)). The ratio of Neu5Ac to KDN is on the order of
100:1
in blood cells and ovaries (Inoue et al., 1998), although this ratio may
change during
development and cancer. The levels of free KDN in newborn fetal cord red blood
cells are higher than those of maternal red blood cells (Inoue et al., J.
Biol. Chem.
273, 27199-27204 (1998)). Furthermore, a 4.2 fold increase in the ratio of
free KDN
to free Neu5Ac was observed in ovarian tumor cells as compared to normal
cells, and
the ratio appears to increase with the extent of invasion or malignancy for
ovarian
adenocarcinomas (Inoue et al., J. Biol. Chem. 273, 27199-27204 (1998)).
Because the KDN/Neu5Ac ratio has biological significance, we performed
competitive in vitro assays with insect cell lysates using both ManNAc-6-P and
Man-
6-P as substrates. SAS demonstrated a preference for phosphorylated Neu5Ac
over
phosphorylated KDN synthesis in vitro, although the concentrations of the
particular
substrates relative to the enzyme level altered this production ratio. Thus
changes in
the ratios of free KDN to Neu5Ac observed in different developmental states
and
cancer tissue may reflect variability either in the levels of specific
substrates or the
amount of active enzyme present in vivo. The identification of the SAS genetic
sequence and characterization of the-enzyme it encodes should help further our
understanding of sialic acid biosynthesis as well as the roles sialic' acids
play in
development and disease states,
In Figure 39- the production of sialylated nucleotides in SF-9 insect cells
following infection with human CMP-SA synthetase and SA synthetase containing
baculoviruses is demonstrated. Sf-9 cells were grown in six well plates and
infected
with baculovirus containing CMP-SA synthase and supplemented with 10 mM
ManNAc ("CMP" line), baculovirus containing CMP-SA synthase and SA synthase
plus 10 mM ManNAc supplementation ("CMP+SA" line), or no baculovirus and no
ManNAc supplementation (" SF9" line). The nucleotide sugars from lysed cells
were
extracted with 75% ethanol, dried, resuspended in water, and filtered through
a 10,000
molecular weight cut-off membrane. Samples were then separated on a Dionea
CA 02363297 2008-11-03
Carbopac PA- I column using a Shimadzu VP series HPLC: Nucleotide sugars were
detected- based upon their absorbance at 280 nm, and CMP sialic acid standards
were
shown to elute at approximately 7 minutes. These results demonstrate the
ability to
produce the desired oligosaccharide products in insect cells via introduction
and
5 expression of sialyltransferase enzymes.
Materials and Method o Example 6
Gene Characterization
The E. coli neuB coding sequence was used to query the Human Genome
10 Sciences (Rockville, MD) cDNA database with BLAST software. One EST clone,
HMKAK61, from a human (liver) cDNA library demonstrated significant homology
to neuB and was chosen for further characterization. The tissue distribution
profile
was determined by Northern blot hybridization. Briefly; the cDNA was radio-
labeled
with [32P]-dCTP using a RediPrimeTMII kit (Amersham/PharmaciaMBiotech,
15 Piscataway, NJ) following the manufacturer's directions. Multiple tissue
Northern
blots containing poly-A+ RNA (Clontech, Palo Alto, CA). were pre-hybridized at
42 C for 4 hours and then hybridized overnight with radio-labeled probe at
lx106
CPM/ml. The blots were sequentially washed twice for 15 min. at 42'C and once
for
20 min. at 65 C in 0. IX SSC, 0.1% SDS'and subsequently autoradiographed.
- 20
Baculovirus Cloning and Protein Expression
The full length ORF was amplified by PCR using the following primers. The
forward primer, 5'-
TGTAATACGACTCACTATAGGGCGGATCCGCCATCATGCCGCTGGAGCTG
25 GAGC (SEQ-ID NO: 13) contained a synthetic T7 promoter sequence
(underlined), -a
BamHI site (italics), a KOZAK sequence (bold), and sequence corresponding to
the
first six codons. of SAS. The minus strand primer, 5'-
GTACGGTACCTTATTAAGACTTGATTTTTTTGCC (SEQ.ID NO:14), contained
an Asp 718 site (italics), two in-frame stop codons (underlined), and
sequences
30 representing the last six codons of SAS.
After amplification, the PCR product was digested with BamHI and Asp 718
(Roche, Indianapolis, IN) and the resulting fragment cloned into the
corresponding
CA 02363297 2008-11-03
86
sites of the baculovirus transfer vector, pA2. Following DNA sequence
confirmation,
the plasmid (pA2-SAS) was transfected into Sf-9 cells to generate the
recombinant
baculovirus AcSAS as previously described (Coleman et al., Gene 190, 163-171
(1997)). Amplified virus was used to infect cells, and the gene product was
radio-
labeled with [3S S]-Met and [35 S]-Cys. Bands corresponding to the gene
product were
visualized by SDS-PAGE and autoradiography. Alternatively, the PCR product was
used as a template for in vitro transcription-and translation using rabbit
reticulocyte
lysate (Pro'mega'Madison, WI) in the presence of [35S]-Met. Translation
products
were resolved by SDS-PAGE and visualized by autoradiography.
For protein production, Sf-9 cells were seeded in serum-free media at a
density of 1 x 106 cells/ml in spinner flasks and infected at a multiplicity
of infection of
1-2 with the recombinant virus. A detergent fractionation procedure was
employed
(Miyamoto et al., Mol. Cell: Biol. 5,2860-2865 (1985)) to separate nuclear
from non-
nuclear fractions. Protein was resolved by SDS-PAGE, transferred to a
ProBlottTM
TM
membrane (ABI, Foster City, CA), and visualized by Ponceau S staining. A
prominent band at the expected MW of -40 kD was visible and excised for
protein
microsequencing using an ABI-494 sequencer (PE Biosystems,, Foster City, CA).
Neu5Ac/KDN Detection
Sialic acid was measured by the procedure of Hara et al. (Anal. Biochem. 179,
162-166 (1989). Ten microliters of sample were treated with 200 l DMB (Sigma
Chemicals, St. Louis, MO) solution (7.0 mM DMB in 1.4 M. acetic acid, 0.75 M
~3-
mercaptoethanol, and 18 mM 'sodium hydrosulfite) at 50 C for 2.5 hrs, from
which 10
gl was used for HPLC analysis on a Shimadzuu (Columbia, MD) VP series HPLC
using a-Waters (Milford, MA) Spherisorb 5 gm ODS2 column. Peaks were detected
using a Shimadzu RF-IOAXL fluorescence detector with 448 nm emission and 373
nm excitation wavelengths. The mobile phase was-an acetonitrile, methanol, and
water mixture (9:7:84, v/v) with a flow rate of 0.7 ml/min. Response factors
of
Neu5Ac and KDN were established with authentic standards based on peak areas
for
quantifying sample sialic acid levels. Sialic acid content was normalized
based on
protein content measured with the Pierce (Rockford, IL) BCA assay kit and. a
Molecular Devices (Sunnyvale, CA) microplate reader.
CA 02363297 2008-11-03
87
Cell Culture and Sialic Acid Quantification
Sf-9 (ATCC, Manassas, VA) cells were grown in Ex-CeIlTM 405 media (JRH
BioScience, Lenexa, KS) with and without 10% FBS at 27 C. CHO-KI cells (ATCC,
Manassas, VA) were cultured at 37 C in a humidified atmosphere with 5% CO2 in
Dulbecco's Modified Eagle Medium (Life Technologies, Rockville, MD)
supplemented with 10% FBS, 100 U/ml penicillin, 100 p.g/ml streptomycin, 100
M
MEM essential amino acids, and 4 mM L-glutamine (Life Technologies, Rockville,
MD). Cells were grown to confluency in T-75 flasks, washed twice with PBS, and
lysed in 0.05 M bicine, pH 8.5, with 1 mM DTT (Vann et al., Glycobiology 7,
697-
701 (1997)) using a Tekmar Sonic Disruptor (Cincinnati, OH). For determination
of
sialic acid content, 10 l of lysates with and without 10,000 MWCO
microfiltration
(Millipore, Bedford, MA) were analyzed by DMB derivatization as described
above.
Sugar substrate feeding was studied by plating approximately 106 Sf-9 cells on
each well of a six well plate. Media was replaced with 2 ml fresh media
supplemented with 10 mM sterile-filtered Man, ManN, or ManNAc. Cells were left
uninfected or infected with 20 l of the appropriate (A35 or AcSAS) amplified
baculovirus stock. Cells were harvested at 80 hours post-infection by
separating the.
pellet from the media by centrifugation and washing twice with PBS. Cells were
lysed and analyzed for sialic acid content as described above.
In vitro Activity
In vitro activity assays were based on the procedure of Angata et al. (J.
Biol.
Chem. 274, 22949-22956 (1999)). Lysates were prepared from A35 and-AcSAS
infected and uninfected Sf-9 cells cultured in T-75 flasks with and without 10
mM
ManNAc supplementation. After washing twice with PBS, cells were lysed on ice
with 25 strokes of a tight-fitting Dounce homogenizer (Wheaton, Miliville, NJ)
in 2.5
ml lysis, buffer [50mM HEPES pH = 7.0 with 1 mM DTT, leupeptin. (1 glml),,
antipain (0.5 ghni), benzarnidine-HC1(15.6 gg/ml), aprotinin (0.5 p.g/ml),
chymostatin (0.5 gg/ml), and 1 mM phenylmethylsulfonylfluoride]. 5 l of
substrate
solution was incubated with either 20 gl insect cell lysate (30 min.) or
purified E. coli
protein (60 min.) at 37 C. The substrate solution contained 10 mM MnC12, 20 mm
CA 02363297 2001-08-27
WO 00/52135 88 PCTIUSOO/05313
PEP, and either 5 mM ManNAc-6-P or 25 mM Man-6-P (Sigma, St. Louis, MO).
ManNAc-6-P was prepared by acid hydrolysis of meningococcal Group A
polysaccharide. The polysaccharide (15.5 mg) in 5.8 ml water was mixed with
770
mg of Dowex 50 H+ and heated for 1 hr. at 100 C. The filtered hydrolysate was
dried
in vacuo and the residue dissolved to give a solution of 50 mM ManNAc-6-P and
stored frozen. Substrate solutions containing 25 mM Man and ManNAc were also
used. Boiled samples were used as negative controls. Following incubation, all
samples were boiled 3 min., centrifuged for 10 min. at 12,000g, and split into
two 10
l aliquots. One aliquot was treated with 9 units of calf intestine alkaline
phosphatase
(Roche, Indianapolis, IN) along with 3 1of accompanying buffer while the
other
aliquot was diluted with water and buffer. AP treated aliquots were incubated
4 hrs.
at 37 C, and 10 .il of both AP treated and untreated samples were reacted with
DMB
as described above. 2 l of the samples incubated with insect lysates and 10
l of the
samples incubated with bacterial protein were injected onto the HPLC for
sialic acid
analysis as described above.
For substrate competition experiments, Man-6-P and ManNAc-6-P
concentrations in the substrate solution were varied from 1 to 20 mM. In vitro
assays
were run with Sf-9 lysates as described above. Samples were treated with 7 l
buffer
and 18 units of AP, incubated for 4 hrs. at 37 C, and analyzed for sialic acid
content.
Samples containing more than 1 mM ManNAc-6-P in the substrate solution
produced
high levels of sialic acid and were diluted 1:5 before injection to avoid
fluorescence
detector signal saturation.
Analysis with Aldolase Using HPAEC
Sf-9 cells were grown in T-75 flasks and then infected with A35 or AcSAS or
left uninfected in the presence or absence of 10 mM ManNAc. After 80 hrs.,
cells
were washed twice in PBS and sonicated. Aliquots (200 l ) were filtered
through
10,000 MWCO membranes, and 50 l samples were treated with 12.5 l aldolase
solution [0.0055 U aldolase (ICN, Costa Mesa, CA), 1.4 mM NADH (Sigma, St.
Louis, MO), 0.5 M HEPES pH 7.5, 0.7 U lactate dehydrogenase (Roche,
Indianapolis,
IN)] or left untreated and incubated at 37 C for one hour (Lilley et al.,
1992).
Samples were analyzed by HPAEC with a Dionex (Sunnyvale, CA) BioLC system
CA 02363297 2001-08-27
WO 00/52135 89 PCT/US00/05313
using a pulsed amperometric detector (PAD-II) on a Carbopac PA-1 column. The
initial elution composition was 50% A (200 mM NaOH), 45% B (water), and 5% C
(1M NaOAc, 200 mM NaOH) with a linear gradient to 50% A, 25% B, and 25% C at
20 min. A 6 min. 50% A and 50 % C washing followed. Samples were normalized
based on protein content by dilution with water, and 20 l of each sample were
analyzed. Ten l of each sample were also derivatized with DMB and analyzed by
HPLC as described above to confirm the elimination of sialic acids by aldolase
treatment.
CA 02363297 2001-08-27
WO 00/52135 90 PCT/US00/05313
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis)
A. The indications made below relate to the microorganism referred to in the
description
onpage 33 , line 21
B. IDENTIFICATIONOFDEPOSIT Further deposits are identified on an additional
sheet 0
Name ofdepositary institution American Type Culture Collection
Address of depositary institution (including postal code and country)
10801 University Boulevard
Manassas, Virginia 20110-2209
United States of America
Date of deposit Accession Number
24 February 2000 unknown
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is
continued on an additional sheet
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are
not for all designated States)
Europe
In respect to those designations in which a European Patent is sought a sample
of the deposited
microorganism will be made available until the publication of the mention of
the grant of the European patent
or until the date on which application has been refused or withdrawn or is
deemed to be withdrawn, only by
the issue of such a sample to an expert nominated by the person requesting the
sample (Rule 28 (4) EPC).
E. SEPARATE FURNISHING OF INDICATIONS (leaveblankifnotapplicable)
The indications listed below will be submitted to the International Bureau
later (specify the general nature of the indications e.g., 'Accession
Number of Deposit')
For receiving Office use only For International Bureau use only
This sheet was received with the international application El This sheet was
received by the International Bureau on:
Authorized officer / Authorized officer
PP, Team V ipNp IF-
Form PCT/RO/134 (July 1992)
CA 02363297 2001-08-27
WO 00/52135 PCT/USOO/05313
91
ATCC Deposit No.: unassigned
CANADA
The applicant requests that, until either a Canadian patent has been issued on
the basis of an
application or the application has been refused, or is abandoned and no longer
subject to
reinstatement, or is withdrawn, the Commissioner of Patents only authorizes
the furnishing of
a sample of the deposited biological material referred to in the application
to an independent
expert nominated by the Commissioner, the applicant must, by a written
statement, inform
the International Bureau accordingly before completion of technical
preparations for
publication of the international application.
NORWAY
The applicant hereby requests that the application has been laid open to
public inspection (by
the Norwegian Patent Office), or has been finally decided upon by the
Norwegian Patent
Office without having been laid open inspection, the furnishing of a sample
shall only be
effected to an expert in the art. The request to this effect shall be filed by
the applicant with
the Norwegian Patent Office not later than at the time when the application is
made available
to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If
such a request has
been filed by the applicant, any request made by a third party for the
furnishing of a sample
shall indicate the expert to be used. That expert may be any person entered on
the list of
recognized experts drawn up by the Norwegian Patent Office or any person
approved by the
applicant in the individual case.
AUSTRALIA
The applicant hereby gives notice that the furnishing of a sample of a
microorganism shall
only be effected prior to the grant of a patent, or prior to the lapsing,
refusal or withdrawal of
the application, to a person who is a skilled addressee without an interest in
the invention
(Regulation 3.25(3) of the Australian Patents Regulations).
FINLAND
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the National Board of Patents and Regulations), or has been
finally decided
upon by the National Board of Patents and Registration without having been
laid open to
public inspection, the furnishing of a sample shall only be effected to an
expert in the art.
UNITED KINGDOM
The applicant hereby requests that the furnishing of a sample of a
microorganism shall only
be made available to an expert. The request to this effect must be filed by
the applicant with
the International Bureau before the completion of the technical preparations
for the
international publication of the application.
CA 02363297 2001-08-27
WO 00/52135 PCT/US00/05313
92
ATCC Deposit No.:unassigned
DENMARK
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Danish Patent Office), or has been finally decided upon by
the Danish
Patent office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the Danish Patent Office not later that at the time when the
application is made
available to the public under Sections 22 and 33(3) of the Danish Patents Act.
If such a
request has been filed by the applicant, any request made by a third party for
the furnishing of
a sample shall indicate the expert to be used. That expert may be any person
entered on a list
of recognized experts drawn up by the Danish Patent Office or any person by
the applicant in
the individual case.
SWEDEN
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Swedish Patent Office), or has been finally decided upon by
the Swedish
Patent Office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the International Bureau before the expiration of 16 months
from the priority
date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of
the PCT
Applicant's Guide). If such a request has been filed by the applicant any
request made by a
third party for the furnishing of a sample shall indicate the expert to be
used. That expert may
be any person entered on a list of recognized experts drawn up by the Swedish
Patent Office
or any person approved by a applicant in the individual case.
NETHERLANDS
The applicant hereby requests that until the date of a grant of a Netherlands
patent or until the
date on which the application is refused or withdrawn or lapsed, the
microorganism shall be
made available as provided in the 31F(1) of the Patent Rules only by the issue
of a sample to
an expert. The request to this effect must be furnished by the applicant with
the Netherlands
Industrial Property Office before the date on which the application is made
available to the
public under Section 22C or Section 25 of the Patents Act of the Kingdom of
the
Netherlands, whichever of the two dates occurs earlier.
CA 02363297 2010-10-14
93
SEQUENCE LISTING
<110> Human Genome Sciences, Inc.
<120> Engineering Intracellular Sialylation Pathways
<130> PF509.PCT
<140> Unassigned
<141> 2000-03-01
<150> 60/122,582
<151> 1999-12-07
<150> 60/169,624
<151> 1999-12-08
<160> 8
<170> Patentln Ver. 2.1
<210> 1
<211> 1429
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(693)
<400> 1
atg gcc ttc cca aag aag aaa ctt cag ggt ctt gtg get gca acc atc 48
Met Ala Phe Pro Lys Lys Lys Leu Gln Gly Leu Val Ala Ala Thr Ile
1 5 10 15
acg cca atg act gag aat gga gaa atc aac ttt tca gta att ggt cag 96
Thr Pro Met Thr Glu Asn Gly Glu Ile Asn Phe Ser Val Ile Gly Gln
20 25 30
tat gtg gat tat ctt gtg aaa gaa cag gga gtg aag aac att ttt gtg 144
Tyr Val Asp Tyr Leu Val Lys Glu Gin Gly Val Lys Asn Ile Phe Val
35 40 45
aat ggc aca aca gga gaa ggc ctg tcc ctg agc gtc tca gag cgt cgc 192
Asn Gly Thr Thr Gly Glu Gly Leu Ser Leu Ser Val Ser Glu Arg Arg
50 55 60
cag gtt gca gag gag tgg gtg aca aaa ggg aag gac aag ctg gat cag 240
Gln Val Ala Glu Glu Trp Val Thr Lys Gly Lys Asp Lys Leu Asp Gln
65 70 75 80
gtg ata att cac gta gga gca ctg agc ttg aag gag tca cag gaa ctg 288
Val Ile Ile His Val Gly Ala Leu Ser Leu Lys Glu Ser Gln Glu Leu
85 90 95
gcc caa cat gca gca gaa ata gga get gat ggc atc get gtc att gca 336
Ala Gln His Ala Ala Glu Ile Gly Ala Asp Gly Ile Ala Val Ile Ala
100 105 110
CA 02363297 2010-10-14
94
ccg ttc ttc ctc aag cca tgg acc aaa gat atc Ctg att aat ttc cta 384
Pro Phe Phe Leu Lys Pro Trp Thr Lys Asp Ile Leu Ile Asn Phe Leu
115 120 125
aag gaa gtg get get gcc gcc cct gcc ctg cca ttt tat tac tat cac 432
Lys Glu Val Ala Ala Ala Ala Pro Ala Leu Pro Phe Tyr Tyr Tyr His
130 135 140
att cct gcc ttg aca ggg gta aag att cgt get gag gag ttg ttg gat 480
Ile Pro Ala Leu Thr Gly Val Lys Ile Arg Ala Glu Glu Leu Leu Asp
145 150 155 160
ggg att ctg gat aag atc ccc acc ttc caa ggg ctg aaa ttc agt gat 528
Gly Ile Leu Asp Lys Ile Pro Thr Phe Gln Gly Leu Lys Phe Ser Asp
165 170 175
aca gat ctc tta gac ttc ggg caa tgt gtt gat cag aat cgc cag caa 576
Thr Asp Leu Leu Asp Phe Gly Gln Cys Val Asp Gln Asn Arg Gln Gln
180 185 190
cag ttt get ttc ctt ttt ggg gtg gat gag caa ctg ttg agt get ctg 624
Gin Phe Ala Phe Leu Phe Gly Val Asp Glu Gln Leu Leu Ser Ala Leu
195 200 205
gtg atg gga gca act gga gca gtg ggc agt ttt gta tcc aga gat tta 672
Val Met Gly Ala Thr Gly Ala Val Gly Ser Phe Val Ser Arg Asp Leu
210 215 220
tca act ttg ttg tca aac tag gttttggagt gtcacagacc aaagccatca 723
Ser Thr Leu Leu Ser Asn
225 230
tgactctggt ctctgggatt ccaatgggcc caccccggct tccactgcag aaagcctcca 783
gggagtttac tgatagtgct gaagctaaac tgaagagcct ggatttcctt tctttcactg 843
atttaaagga tggaaacttg gaagctggta gctagtgcct ctctatcaaa tcagggtttg 903
caccttgaga cataatctac cttaaatagt gcattttttt ctcagggaat tttagatgaa 963
cttgaataaa ctctcctagc aaatgaaatc tcacaataag cattgaggta ccttttgtga 1023
gccttaaaaa gtcttatttt gtgaaggggc aaaaactcta ggagtcacaa ctctcagtca 1083
ttcatttcac agattttttt gtggagaaat ttctgtttat atggatgaaa tggaatcaag 1143
aggaaaattg taattgatta attccatctg tctttaggag ctctcattat ctcggtctct 1203
ggttcctaat cctattttaa agttgtctaa ttttaaacca ctataatatg tcttcatttt 1263
aataaatatt catttggaat ctaggaaaac tctgagctac tgcatttagg caggcacttt 1323
aataccaaac tgtaacatgt ctcaactgta tacaactcaa aatacaccag ctcatttggc 1383
tgctcagtct aactctagaa tggatgcttt tgaattcatt tcgatg 1429
<210> 2
<211> 230
CA 02363297 2010-10-14
<212> PRT
<213> Homo sapiens
<400> 2
Met Ala Phe Pro Lys Lys Lys Leu Gln Gly Leu Val Ala Ala Thr Ile
1 5 10 15
Thr Pro Met Thr Glu Asn Gly Glu Ile Asn Phe Ser Val Ile Gly Gln
20 25 30
Tyr Val Asp Tyr Leu Val Lys Glu Gln Gly Val Lys Asn Ile Phe Val
35 40 45
Asn Gly Thr Thr Gly Glu Gly Leu Ser Leu Ser Val Ser Glu Arg Arg
50 55 60
Gln Val Ala Glu Glu Trp Val Thr Lys Gly Lys Asp Lys Leu Asp Gln
65 70 75 80
Val Ile Ile His Val Gly Ala Leu Ser Leu Lys Glu Ser Gin Glu Leu
85 90 95
Ala Gln His Ala Ala Glu Ile Gly Ala Asp Gly Ile Ala Val Ile Ala
100 105 110
Pro Phe Phe Leu Lys Pro Trp Thr Lys Asp Ile Leu Ile Asn Phe Leu
115 120 125
Lys Glu Val Ala Ala Ala Ala Pro Ala Leu Pro Phe Tyr Tyr Tyr His
130 135 140
Ile Pro Ala Leu Thr Gly Val Lys Ile Arg Ala Glu Glu Leu Leu Asp
145 150 155 160
Gly Ile Leu Asp Lys Ile Pro Thr Phe Gln Gly Leu Lys Phe Ser Asp
165 170 175
Thr Asp Leu Leu Asp Phe Gly Gln Cys Val Asp Gln Asn Arg Gln Gin
180 185 190
Gin Phe Ala Phe Leu Phe Gly Val Asp Glu Gln Leu Leu Ser Ala Leu
195 200 205
Val Met Gly Ala Thr Gly Ala Val Gly Ser Phe Val Ser Arg Asp Leu
210 215 220
Ser Thr Leu Leu Ser Asn
225 230
<210> 3
<211> 1305
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(1305)
<400> 3
atg gac tcg gtg gag aag ggg gcc gcc acc tcc gtc tcc aac ccg cgg 48
Met Asp Ser Val Glu Lys Gly Ala Ala Thr Ser Val Ser Asn Pro Arg
1 5 10 15
ggg cga ccg tcc cgg ggc cgg ccg ccg aag ctg cag cgc aac tct cgc 96
Gly Arg Pro Ser.Arg Gly Arg Pro Pro Lys Leu Gln Arg Asn Ser Arg
20 25 30
ggc ggc cag ggc cga ggt gtg gag aag ccc ccg cac ctg gca gcc cta 144
Gly Gly Gln Giy Arg Gly Val Glu Lys Pro Pro His Leu Ala Ala Leu
35 40 45
CA 02363297 2010-10-14
96
att ctg gcc cgg gga ggc agc aaa ggc atc CCC ctg aag aac att aag 192
Ile Leu Ala Arg Gly Gly Ser Lys Gly Ile Pro Leu Lys Asn Ile Lys
50 55 60
cac ctg gcg ggg gtc ccg ctc att ggc tgg gtc ctg cgt gcg gcc ctg 240
His Leu Ala Gly Val Pro Leu Ile Gly Trp Val Leu Arg Ala Ala Leu
65 70 75 80
gat tca ggg gcc ttc cag agt gta tgg gtt tcg aca gac cat gat gaa 288
Asp Ser Gly Ala Phe Gln Ser Val Trp Val Ser Thr Asp His Asp Glu
85 90 95
att gag aat gtg gcc aaa caa ttt ggt gca caa gtt cat cga aga agt 336
Ile Glu Asn Val Ala Lys Gln Phe Gly Ala Gln Val His Arg Arg Ser
100 105 110
tct gaa gtt tca aaa gac agc tct acc tca cta gat gcc atc ata gaa 384
Ser Glu Val Ser Lys Asp Ser Ser Thr Ser Leu Asp Ala Ile Ile Glu
115 120 125
ttt ctt aat tat yat aat gag gkt gac att gta gga aat att caa get 432
Phe Leu Asn Tyr Xaa Asn Glu Xaa Asp Ile Val Gly Asn Ile Gln Ala
130 135 140
act tct yca tgt tta cat cct act gat ctt caa aaa gtt gca gaa atg 480
Thr Ser Xaa Cys Leu His Pro Thr Asp Leu Gln Lys Val Ala Glu Met
145 150 155 160
att cga gaa gaa gga tat gat tct gkt ttc tct gtt gtg aga cgc cat 528
Ile Arg Glu Glu Gly Tyr Asp Ser Xaa Phe Ser Val Val Arg Arg His
165 170 175
cag ttt cga tgg agt gaa att cag aaa gga gtt cgt gaa gtg acc gaa 576
Gln Phe Arg Trp Ser Glu Ile Gln Lys Gly Val Arg Glu Val Thr Glu
180 185 190
cct ctg aat tta aat cca get aaa cgg cct cgt cga caa gac tgg gat 624
Pro Leu Asn Leu Asn Pro Ala Lys Arg Pro Arg Arg Gln Asp Trp Asp
195 200 205
gga gaa tta tat gaa aat ggc tca ttt tat ttt get aaa aga cat ttg 672
Gly Glu Leu Tyr Glu Asn Gly Ser Phe Tyr Phe Ala Lys Arg His Leu
210 215 220
ata gag atg ggt tac ttg cag ggt gga aaa tgg cat act acg aaa tgc 720
Ile Glu Met Gly Tyr Leu Gln Gly Gly Lys Trp His Thr Thr Lys Cys
225 230 235 240
gag ctg gaa cat agt gtg gat ata gat gtg gat att gat tgg cct att 768
Glu Leu Glu His Ser Val Asp Ile Asp Val Asp Ile Asp Trp Pro Ile
245 250 255
gca gag caa aga gta tta aga tat ggc tat ttt ggc aaa gag aag ctt 816
Ala Glu Gln Arg Val Leu Arg Tyr Gly Tyr Phe Gly Lys Glu Lys Leu
260 265 270
aag gaa ata aaa ctt ttg gtt tgc aat att gat gga tgt ctc acc aat 864
Lys Glu Ile Lys Leu Leu Val Cys Asn Ile Asp Gly Cys Leu Thr Asn
275 280 285
CA 02363297 2010-10-14
97
ggc cac att tat gta tca gga gac caa aaa gaa ata ata tct tat gat 912
Gly His Ile Tyr Val Ser Gly Asp Gln Lys Glu Ile Ile Ser Tyr Asp
290 295 300
gta aaa gat get att ggg ata agt tta tta aag aaa agt ggt att gag 960
Val Lys Asp Ala Ile Gly Ile Ser Leu Leu Lys Lys Ser Gly Ile Glu
305 310 315 320
gtg agg cta atc tca gaa agg gcc tgt tca aag cag acg ctg tct tct 1008
Val Arg Leu Ile Ser Glu Arg Ala Cys Ser Lys Gln Thr Leu Ser Ser
325 330 335
tta aaa ctg gat tgc aaa atg gaa gtc agt gta tca gac aag cta gca 1056
Leu Lys Leu Asp Cys Lys Met Glu Val Ser Val Ser Asp Lys Leu Ala
340 345 350
gtt gta gat gaa tgg aga aaa gaa atg ggc ctg tgc tgg aaa gaa gtg 1104
Val Val Asp Glu Trp Arg Lys Glu Met Gly Leu Cys Trp Lys Glu Val
355 360 365
gca tat ctt gga aat gaa gtg tct gat gaa gag tgc ttg aag aga gtg 1152
Ala Tyr Leu Gly Asn Glu Val Ser Asp Glu Glu Cys Leu Lys Arg Val
370 375 380
ggc cta agt ggc get cct get gat gcc tgt tcc tac gcc cag aag get 1200
Gly Leu Ser Gly Ala Pro Ala Asp Ala Cys Ser Tyr Ala Gln Lys Ala
385 390 395 400
gtt gga tac att tgc aaa tgt aat ggt ggc cgt ggt gcc atc cga gaa 1248
Val Gly Tyr Ile Cys Lys Cys Asn Gly Gly Arg Gly Ala Ile Arg Glu
405 410 415
ttt gca gag cac att tgc cta cta atg gaa aaa gtt aat aat tca tgc 1296
Phe Ala Glu His Ile Cys Leu Leu Met Glu Lys Val Asn Asn Ser Cys
420 425 430
caa aaa tag 1305
Gln Lys
435
<210> 4
<211> 434
<212> PRT
<213> Homo sapiens
<400> 4
Met Asp Ser Val Glu Lys Gly Ala Ala Thr Ser Val Ser Asn Pro Arg
1 5 10 15
Gly Arg Pro Ser Arg Gly Arg Pro Pro Lys Leu Gln Arg Asn Ser Arg
20 25 30
Gly Gly Gln Gly Arg Gly Val Glu Lys Pro Pro His Leu Ala Ala Leu
35 40 45
Ile Leu Ala Arg Gly Gly Ser Lys Gly Ile Pro Leu Lys Asn Ile Lys
50 55 60
His Leu Ala Gly Val Pro Leu Ile Gly Trp Val Leu Arg Ala Ala Leu
65 70 75 80
Asp Ser Gly Ala Phe Gln Ser Val Trp Val Ser Thr Asp His Asp Glu
CA 02363297 2010-10-14
98
85 90 95
Ile Glu Asn Val Ala Lys Gin Phe Gly Ala Gln Val His Arg Arg Ser
100 105 110
Ser Glu Val Ser Lys Asp Ser Ser Thr Ser Leu Asp Ala Ile Ile Glu
115 120 125
Phe Leu Asn Tyr Xaa Asn Glu Xaa Asp Ile Val Gly Asn Ile Gln Ala
130 135 140
Thr Ser Xaa Cys Leu His Pro Thr Asp Leu Gin Lys Val Ala Glu Met
145 150 155 160
Ile Arg Glu Glu Gly Tyr Asp Ser Xaa Phe Ser Val Val Arg Arg His
165 170 175
Gln Phe Arg Trp Ser Glu Ile Gln Lys Gly Val Arg Glu Val Thr Glu
180 185 190
Pro Leu Asn Leu Asn Pro Ala Lys Arg Pro Arg Arg Gln Asp Trp Asp
195 200 205
Gly Glu Leu Tyr Glu Asn Gly Ser Phe Tyr Phe Ala Lys Arg His Leu
210 215 220
Ile Glu Met Gly Tyr Leu Gln Gly Gly Lys Trp His Thr Thr Lys Cys
225 230 235 240
Glu Leu Glu His Ser Val Asp Ile Asp Val Asp Ile Asp Trp Pro Ile
245 250 255
Ala Glu Gln Arg Val Leu Arg Tyr Gly Tyr Phe Gly Lys Glu Lys Leu
260 265 270
Lys Glu Ile Lys Leu Leu Val Cys Asn Ile Asp Gly Cys Leu Thr Asn
275 280 285
Gly His Ile Tyr Val Ser Gly Asp Gln Lys Glu Ile Ile Ser Tyr Asp
290 295 300
Val Lys Asp Ala Ile Gly Ile Ser Leu Leu Lys Lys Ser Gly Ile Glu
305 310 315 320
Val Arg Leu Ile Ser Glu Arg Ala Cys Ser Lys Gln Thr Leu Ser Ser
325 330 335
Leu Lys Leu Asp Cys Lys Met Glu Val Ser Val Ser Asp Lys Leu Ala
340 345 350
Val Val Asp Glu Trp Arg Lys Glu Met Gly Leu Cys Trp Lys Glu Val
355 360 365
Ala Tyr Leu Gly Asn Glu Val Ser Asp Glu Glu Cys Leu Lys Arg Val
370 375 380
Gly Leu Ser Gly Ala Pro Ala Asp Ala Cys Ser Tyr Ala Gln Lys Ala
385 390 395 400
Val Gly Tyr Ile Cys Lys Cys Asn Gly Gly Arg Gly Ala Ile Arg Glu
405 410 415
Phe Ala Glu His Ile Cys Leu Leu Met Glu Lys Val Asn Asn Ser Cys
420 425 430
Gln Lys
<210> 5
<211> 1080
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(1080)
<400> 5
atg ccg ctg gag ctg gag ctg tgt ccc ggg cgc tgg gtg ggc ggg caa 48
Met Pro Leu Glu Leu Glu Leu Cys Pro Gly Arg Trp Val Gly Gly Gln
CA 02363297 2010-10-14
99
1 5 10 15
cac ccg tgc ttc atc att gcc gag atc ggc cag aac cac cag ggc gac 96
His Pro Cys Phe Ile Ile Ala Glu Ile Gly Gln Asn His Gln Gly Asp
20 25 30
ctg gac gta gcc aag cgc atg atc cgc atg gcc aag gag tgt ggg get 144
Leu Asp Val Ala Lys Arg Met Ile Arg Met Ala Lys Glu Cys Gly Ala
35 40 45
gat tgt gcc aag ttc cag aag agt gag cta gaa ttc aag ttt aat cgg 192
Asp Cys Ala Lys Phe Gln Lys Ser Glu Leu Glu Phe Lys Phe Asn Arg
50 55 60
aaa gcc ttg gag agg cca tac acc tcg aag cat tcc tgg ggg aag acg 240
Lys Ala Leu Glu Arg Pro Tyr Thr Ser Lys His Ser Trp Gly Lys Thr
65 70 75 80
tac ggg gag cac aaa cga cat ctg gag ttc agc cat gac cag tac agg 288
Tyr Gly Glu His Lys Arg His Leu Glu Phe Ser His Asp Gln Tyr Arg
85 90 95
gag ctg cag agg tac gcc gag gag gtt ggg atc ttc ttc act gcc tct 336
Glu Leu Gln Arg Tyr Ala Glu Glu Val Gly Ile Phe Phe Thr Ala Ser
100 105 110
ggc atg gat gag atg gca gtt gaa ttc ctg cat gaa ctg aat gtt cca 384
Gly Met Asp Glu Met Ala Val Glu Phe Leu His Glu Leu Asn Val Pro
115 120 125
ttt ttc aaa gtt gga tct gga gac act aat aat ttt cct tat ctg gaa 432
Phe Phe Lys Val Gly Ser Gly Asp Thr Asn Asn Phe Pro Tyr Leu Glu
130 135 140
aag aca gcc aaa aaa ggt cgc cca atg gtg atc tcc agt ggg atg cag 480
Lys Thr Ala Lys Lys Gly Arg Pro Met Val Ile Ser Ser Gly Met Gln
145 150 155 160
tca atg gac acc atg aag caa gtt tat cag atc gtg aag ccc ctc aac 528
Ser Met Asp Thr Met Lys Gln Val Tyr Gln Ile Val Lys Pro Leu Asn
165 170 175
ccc aac ttc tgc ttc ttg cag tgt acc agc gca tac ccg ctc cag cct 576
Pro Asn Phe Cys Phe Leu Gln Cys Thr Ser Ala Tyr Pro Leu Gln Pro
180 185 190
gag gac gtc aac ctg cgg gtc atc tcg gaa tat cag aag ctc ttt cct 624
Glu Asp Val Asn Leu Arg Val Ile Ser Glu Tyr Gln Lys Leu Phe Pro
195 200 205
gac att ccc ata ggg tat tct ggg cat gaa aca ggc ata gcg ata tct 672
Asp Ile Pro Ile Gly Tyr Ser Gly His Glu Thr Gly Ile Ala Ile Ser
210 215 220
gtg gcc gca gtg get ctg ggg gcc aag gtg ttg gaa cgt cac ata act 720
Val Ala Ala Val Ala Leu Gly Ala Lys Val Leu Glu Arg His Ile Thr
225 230 235 240
ttg gac aag acc tgg aag ggg agt gac cac tcg gcc tcg ctg gag cct 768
CA 02363297 2010-10-14
100
Leu Asp Lys Thr Trp Lys Gly Ser Asp His Ser Ala Ser Leu Glu Pro
245 250 255
gga gaa ctg gcc gag ctg gtg cgg tca gtg cgt ctt gtg gag cgt gcc 816
Gly Glu Leu Ala Glu Leu Val Arg Ser Val Arg Leu Val Glu Arg Ala
260 265 270
ctg ggc tcc cca acc aag cag ctg ctg ccc tgt gag atg gcc tgc aat 864
Leu Gly Ser Pro Thr Lys Gln Leu Leu Pro Cys Glu Met Ala Cys Asn
275 280 285
gag aag ctg ggc aag tct gtg gtg gcc aaa gtg aaa att ccg gaa ggc 912
Glu Lys Leu Gly Lys Ser Val Val Ala Lys Val Lys Ile Pro Glu Gly
290 295 300
acc att cta aca atg gac atg ctc acc gtg aag gtg ggt gag ccc aaa 960
Thr Ile Leu Thr Met Asp Met Leu Thr Val Lys Val Gly Glu Pro Lys
305 310 315 320
gcc tat cct cct gaa gac atc ttt aat cta gtg ggc aag aag gtc ctg 1008
Ala Tyr Pro Pro Glu Asp Ile Phe Asn Leu Val Gly Lys Lys Val Leu
325 330 335
gtc act gtt gaa gag gat gac acc atc atg gaa gaa ttg gta gat aat 1056
Val Thr Val Glu Glu Asp Asp Thr Ile Met Glu Glu Leu Val Asp Asn
340 345 350
cat ggc aaa aaa atc aag tct taa 1080
His Gly Lys Lys Ile Lys Ser
355 360
<210> 6
<211> 359
<212> PRT
<213> Homo sapiens
<400> 6
Met Pro Leu Glu Leu Glu Leu Cys Pro Gly Arg Trp Val Gly Gly Gln
1 5 10 15
His Pro Cys Phe Ile Ile Ala Glu Ile Gly Gln Asn His Gln Gly Asp
20 25 30
Leu Asp Val Ala Lys Arg Met Ile Arg Met Ala Lys Glu Cys Gly Ala
35 40 45
Asp Cys Ala Lys Phe Gln Lys Ser Glu Leu Glu Phe Lys Phe Asn Arg
50 55 60
Lys Ala Leu Glu Arg Pro Tyr Thr Ser Lys His Ser Trp Gly Lys Thr
65 70 75 80
Tyr Gly Glu His Lys Arg His Leu Glu Phe Ser His Asp Gin Tyr Arg
85 90 95
Glu Leu Gln Arg Tyr Ala Glu Glu Val Gly Ile Phe Phe Thr Ala Ser
100 105 110
Gly Met Asp Glu Met Ala Val Glu Phe Leu His Glu Leu Asn Val Pro
115 120 125
Phe Phe Lys Val Gly Ser Gly Asp Thr Asn Asn Phe Pro Tyr Leu Glu
130 135 140
Lys Thr Ala Lys Lys Gly Arg Pro Met Val Ile Ser Ser Gly Met Gln
145 150 155 160
Ser Met Asp Thr Met Lys Gln Val Tyr Gln Ile Val Lys Pro Leu Asn
CA 02363297 2010-10-14
101
165 170 175
Pro Asn Phe Cys Phe Leu Gln Cys Thr Ser Ala Tyr Pro Leu Gln Pro
180 185 190
Glu Asp Val Asn Leu Arg Val Ile Ser Glu Tyr Gln Lys Leu Phe Pro
195 200 205
Asp Ile Pro Ile Gly Tyr Ser Gly His Glu Thr Gly Ile Ala Ile Ser
210 215 220
Val Ala Ala Val Ala Leu Gly Ala Lys Val Leu Glu Arg His Ile Thr
225 230 235 240
Leu Asp Lys Thr Trp Lys Gly Ser Asp His Ser Ala Ser Leu Glu Pro
245 250 255
Gly Glu Leu Ala Glu Leu Val Arg Ser Val Arg Leu Val Glu Arg Ala
260 265 270
Leu Gly Ser Pro Thr Lys Gln Leu Leu Pro Cys Glu Met Ala Cys Asn
275 280 285
Glu Lys Leu Gly Lys Ser Val Val Ala Lys Val Lys Ile Pro Giu Gly
290 295 300
Thr Ile Leu Thr Met Asp Met Leu Thr Val Lys Val Gly Glu Pro Lys
305 310 315 320
Ala Tyr Pro Pro Glu Asp Ile Phe Asn Leu Val Gly Lys Lys Val Leu
325 330 335
Val Thr Val Glu Glu Asp Asp Thr Ile Met Glu Glu Leu Val Asp Asn
340 345 350
His Gly Lys Lys Ile Lys Ser
355
<210> 7
<211> 1059
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(1041)
<400> 7
atg agt aat ata tat atc gtt get gaa att ggt tgc aac cat aat ggt 48
Met Ser Asn Ile Tyr Ile Val Ala Glu Ile Giy Cys Asn His Asn Gly
1 5 10 15
agt gtt gat att gca aga gaa atg ata tta aaa gcc aaa gag gcc ggt 96
Ser Val Asp Ile Ala Arg Glu Met Ile Leu Lys Ala Lys Glu Ala Gly
20 25 30
gtt aat gca gta aaa ttc caa aca ttt aaa get gat aaa tta att tca 144
Val Asn Ala Val Lys Phe Gln Thr Phe Lys Ala Asp Lys Leu Ile Ser
35 40 45
get att gca cct aag gca gag tat caa ata aaa aac aca gga gaa tta 192
Ala Ile Ala Pro Lys Ala Glu Tyr Gln Ile Lys Asn Thr Gly Glu Leu
50 55 60
gaa tct cag tta gaa atg aca aaa aag ctt gaa atg aag tat gac gat 240
Glu Ser Gln Leu Glu Met Thr Lys Lys Leu Glu Met Lys Tyr Asp Asp
65 70 75 80
tat ctc cat cta atg gaa tat gca gtc agt tta aat tta gat gtt ttt 288
CA 02363297 2010-10-14
102
Tyr Leu His Leu Met Glu Tyr Ala Val Ser Leu Asn Leu Asp Val Phe
85 90 95
tct acc cct ttt gac gaa gac tct att gat ttt tta gca tct ttg aaa 336
Ser Thr Pro Phe Asp Glu Asp Ser Ile Asp Phe Leu Ala Ser Leu Lys
100 105 110
caa aaa ata tgg aaa atc cct tca ggt gag tta ttg aat tta ccg tat 384
Gln Lys Ile Trp Lys Ile Pro Ser Gly Glu Leu Leu Asn Leu Pro Tyr
115 120 125
ctt gaa aaa ata gcc aag ctt ccg atc cct gat aag aaa ata atc ata 432
Leu Glu Lys Ile Ala Lys Leu Pro Ile Pro Asp Lys Lys Ile Ile Ile
130 135 140
tca aca gga atg get act att gat gag ata aaa cag tct gtt tct att 480
Ser Thr Gly Met Ala Thr Ile Asp Glu Ile Lys Gln Ser Val Ser Ile
145 150 155 160
ttt ata aat aat aaa gtt ccg gtt ggt aat att aca ata tta cat tgc 528
Phe Ile Asn Asn Lys Val Pro Val Gly Asn Ile Thr Ile Leu His Cys
165 170 175
aat act gaa tat cca acg ccc ttt gag gat gta aac ctt aat get att 576
Asn Thr Glu Tyr Pro Thr Pro Phe Glu Asp Val Asn Leu Asn Ala Ile
180 185 190
aat gat ttg aaa aaa cac ttc cct aag aat aac ata ggc ttc tct gat 624
Asn Asp Leu Lys Lys His Phe Pro Lys Asn Asn Ile Gly Phe Ser Asp
195 200 205
cat tct agc ggg ttt tat gca get att gcg gcg gtg cct tat gga ata 672
His Ser Ser Gly Phe Tyr Ala Ala Ile Ala Ala Val Pro Tyr Gly Ile
210 215 220
act ttt att gaa aaa cat ttc act tta gat aaa tct atg tct ggc cca 720
Thr Phe Ile Glu Lys His Phe Thr Leu Asp Lys Ser Met Ser Gly Pro
225 230 235 240
gat cat ttg gcc tca ata gaa cct gat gaa ctg aaa cat ctt tgt att 768
Asp His Leu Ala Ser Ile Glu Pro Asp Glu Leu Lys His Leu Cys Ile
245 250 255
ggg gtc agg tgt gtt gaa aaa tct tta ggt tca aat agt aaa gtg gtt 816
Gly Val Arg Cys Val Glu Lys Ser Leu Gly Ser Asn Ser Lys Val Val
260 265 270
aca get tca gaa agg aag aat aaa atc gta gca aga aag tct att ata 864
Thr Ala Ser Glu Arg Lys Asn Lys Ile Val Ala Arg Lys Ser Ile Ile
275 280 285
get aaa aca gag ata aaa aaa ggt gag gtt ttt tca gaa aaa aat ata 912
Ala Lys Thr Glu Ile Lys Lys Gly Glu Val Phe Ser Glu Lys Asn Ile
290 295 300
aca aca aaa aga cct ggt aat ggt atc agt ccg atg gag tgg tat aat 960
Thr Thr Lys Arg Pro Gly Asn Gly Ile Ser Pro Met Glu Trp Tyr Asn
305 310 315 320
CA 02363297 2010-10-14
103
tta ttg ggt aaa att gca gag caa gac ttt att cca gat gaa tta ata. 1008
Leu Leu Gly Lys Ile Ala Glu Gln Asp Phe Ile Pro Asp Glu Leu Ile
325 330 335
att cat agc gaa ttc aaa aat cag ggg gaa taa tgagaacaaa aattattg 1059
Ile His Ser Glu Phe Lys Asn Gln Gly Glu
340 345
<210> 8
<211> 346
<212> PRT
<213> Homo sapiens
<400> 8
Met Ser Asn Ile Tyr Ile Val Ala Glu Ile Gly Cys Asn His Asn Gly
1 5 10 15
Ser Val Asp Ile Ala Arg Glu Met Ile Leu Lys Ala Lys Glu Ala Gly
20 25 30
Val Asn Ala Val Lys Phe Gln Thr Phe Lys Ala Asp Lys Leu Ile Ser
35 40 45
Ala Ile Ala Pro Lys Ala Glu Tyr Gln Ile Lys Asn Thr Gly Glu Leu
50 55 60
Glu Ser Gln Leu Glu Met Thr Lys Lys Leu Glu Met Lys Tyr Asp Asp
65 70 75 80
Tyr Leu His Leu Met Glu Tyr Ala Val Ser Leu Asn Leu Asp Val Phe
85 90 95
Ser Thr Pro Phe Asp Glu Asp Ser Ile Asp Phe Leu Ala Ser Leu Lys
100 105 110
Gln Lys Ile Trp Lys Ile Pro Ser Gly Glu Leu Leu Asn Leu Pro Tyr
115 120 125
Leu Glu Lys Ile Ala Lys Leu Pro Ile Pro Asp Lys Lys Ile Ile Ile
130 135 140
Ser Thr Gly Met Ala Thr Ile Asp Glu Ile Lys Gln Ser Val Ser Ile
145 150 155 160
Phe Ile Asn Asn Lys Val Pro Val Gly Asn Ile Thr Ile Leu His Cys
165 170 175
.Asn Thr Glu Tyr Pro Thr Pro Phe Glu Asp Val Asn Leu Asn Ala Ile
180 185 190
Asn Asp Leu Lys Lys His Phe Pro Lys Asn Asn Ile Gly Phe Ser Asp
195 200 205
His Ser Ser Gly Phe Tyr Ala Ala Ile Ala Ala Val Pro Tyr Gly Ile
210 215 220
Thr Phe Ile Glu Lys His Phe Thr Leu Asp Lys Ser Met Ser Gly Pro
225 230 235 240
Asp His Leu Ala Ser Ile Glu Pro Asp Glu Leu Lys His Leu Cys Ile
245 250 255
Gly Val Arg Cys Val Glu Lys Ser Leu Gly Ser Asn Ser Lys Val Val
260 265 270
Thr Ala Ser Giu Arg Lys Asn Lys Ile Val Ala Arg Lys Ser Ile Ile
275 280 285
Ala Lys Thr Glu Ile Lys Lys Gly Glu Val Phe Ser Glu Lys Asn Ile
290 295 300
Thr Thr Lys Arg Pro Gly Asn Gly Ile Ser Pro Met Glu Trp Tyr Asn
305 310 315 320
Leu Leu Gly Lys Ile Ala Glu Gln Asp Phe Ile Pro Asp Glu Leu Ile
325 330 335
Ile His Ser Glu Phe Lys Asn Gln Gly Glu
340 345
