Note: Descriptions are shown in the official language in which they were submitted.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
DESCRIPTION
SECRETED PROTEIN ZSIG49
BACKGROUND OF THE INVENTION
Proteins secreted from cells can act as
intercellular signaling molecules which control the
ontogeny and maintenance of tissue form and function.
These secreted proteins control, among other things,
proliferation, differentiation, migration, and expression
of cells of multicellular organisms and act in concert to
form cells, tissues and organs, and to repair and
regenerate damaged tissue. Examples of secreted proteins
include hormones and polypeptide growth factors including
steroid hormones (e. g. estrogen, testosterone),
parathyroid hormone, follicle stimulating hormone, the
interleukins, platelet derived growth factor (PDGF),
epidermal growth factor (EGF), granulocyte-macrophage
colony stimulating factor (GM-CSF), erythropoietin (EPO)
and calcitonin, among others. Hormones and growth factors
influence cellular metabolism by binding to receptors.
Receptors may be integral membrane proteins that are
linked to signaling pathways within the cell, such as
second messenger systems. Other classes of receptors are
soluble molecules, such as the transcription factors.
There is a continuing need to discover new
proteins, such as the hormones and growth factors
described above. The present invention provides such
novel secreted proteins, agonists, antagonists and
receptors of such proteins, as well as related
compositions and methods as well as other uses that should
be apparent to those skilled in the art from the teachings
herein.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
2
SUMMARY OF THE INVENTION
Within one aspect the invention provides an
isolated polypeptide comprising a contiguous sequence of
50 amino acid residues of SEQ ID NO:10. Within one
embodiment the contiguous sequence is 100 amino acid
residues of SEQ ID N0:10. Within another embodiment the
contiguous sequence is 200 amino acid residues of SEQ ID
NO:10. Within another embodiment the polypeptide further
comprises an affinity tag or binding domain.
Within another aspect the invention provides an
isolated polypeptide comprising a sequence of amino acid
residues that is at least 90% identical to the amino acid
sequence of SEQ ID NO:10, from amino acid residue 34 to
amino acid residue 467, wherein the polypeptide
specifically binds to an antibody to which a polypeptide
of SEQ ID N0:10 specifically binds. Within one embodiment
the polypeptide comprises a sequence of amino acid
residues that is at least 95% identical to the amino acid
sequence of SEQ ID NO:10, from amino acid residue 34 to
amino acid residue 467, wherein the polypeptide
specifically binds to an antibody to which a polypeptide
of SEQ ID NO:10 specifically binds. Within another
embodiment the amino acid percent identity is determined
using a FASTA program with ktup=1, gap opening penalty=10,
gap extension penalty=1, and substitution matrix=blosum62,
with other parameters set as default. Within yet another
embodiment any difference between the amino acid sequence
encoded by the polynucleotide molecule and the
corresponding amino acid sequence of SEQ ID NO:10 is due
to a conservative amino acid substitution.
The invention also provides an isolated
polypeptide selected from the group consisting of: a) a
polypeptide comprising amino acid residues 34-63 of SEQ ID
N0:2; b) a polypeptide comprising amino acid residues 64-
467 of SEQ ID NO:10; c) a polypeptide comprising amino
acid residues 58-461 of SEQ ID N0:12; d) a polypeptide of
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
3
SEQ ID N0:2, from amino acid residue 34 to amino acid
residue 77; e) a polypeptide of SEQ ID NO:10, from amino
acid residue 34 to amino acid residue 467; f)a polypeptide
of SEQ ID N0:12, from amino acid residue 28 to amino acid
residue 461; g) a polypeptide of SEQ ID N0:2; h) a
polypeptide of SEQ ID NO:10; and i) a polypeptide of SEQ
ID N0:12.
The invention further provides an isolated
polypeptide comprising the amino acid sequence of SEQ ID
N0:2, from amino acid residue 1 to amino acid residue 33.
Within another aspect the invention provides an
isolated polynucleotide encoding a polypeptide comprising
a contiguous sequence of 50 amino acid residues of SEQ ID
NO:10. Within one embodiment the contiguous sequence is
100 amino acid residues of SEQ ID NO:10. Within another
embodiment the contiguous sequence is 200 amino acid
residues of SEQ ID NO:10. Within yet another embodiment
the polypeptide further comprises an affinity tag or
binding domain.
Within another aspect the invention provides an
isolated polynucleotide encoding a polypeptide comprising a
sequence of amino acid residues that is at least 90%
identical to the amino acid sequence of SEQ ID NO:10, from
amino acid residue 34 to amino acid residue 467, wherein
the polypeptide specifically binds to an antibody to which
a polypeptide of SEQ ID N0:10 specifically binds. Within
one embodiment the polypeptide comprises a sequence of
amino acid residues that is at least 95 o identical to the
amino acid sequence of SEQ ID N0:10, from amino acid
residue 34 to amino acid residue 467, wherein the
polypeptide specifically binds to an antibody to which a
polypeptide of SEQ ID NO:10 specifically binds. Within
another embodiment the amino acid percent identity is
determined using a FASTA program with ktup=1, gap opening
penalty=10, gap extension penalty=1, and substitution
matrix=blosum62, with other parameters set as default.
Within yet another embodiment any difference between the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
4
amino acid sequence encoded by the polynucleotide molecule
and the corresponding amino acid sequence of SEQ ID NO:10
is due to a conservative amino acid substitution.
Within another aspect the invention provides an
isolated polynucleotide selected from the group consisting
of: a) a polynucleotide encoding a polypeptide comprising
amino acid residues 34-63 of SEQ ID N0:2; b) a
polynucleotide encoding a polypeptide comprising amino
acid residues 64-467 of SEQ ID NO:10; c) a polynucleotide
encoding a polypeptide comprising amino acid residues 58-
461 of SEQ ID N0:12; d) a polynucleotide encoding a
polypeptide of SEQ ID N0:2, from amino acid residue 34 to
amino acid residue 77; e) a polynucleotide encoding a
polypeptide of SEQ ID N0:10, from amino acid residue 34 to
amino acid residue 467; f) a polynucleotide encoding a
polypeptide of SEQ ID N0:12, from amino acid residue 28 to
amino acid residue 461; g) a polynucleotide encoding a
polypeptide of SEQ ID NO: 2; h) a polynucleotide encoding
a polypeptide of SEQ ID NO:10; i) a polynucleotide
encoding a polypeptide of SEQ ID N0:12; j) a
polynucleotide comprising nucleotide 167 to nucleotide
1567 of SEQ ID N0:9; k) a polynucleotide comprising
nucleotide 1 to nucleotide 1383 of SEQ ID N0:12; 1) a
polynucleotide sequence complementary to a), b), c), d),
e), f), g), h), i), j) or k); and m) a degenerate
polynucleotide sequence of a), b), c), d), e), f), g), h)
or i) .
The invention also provides an isolated
polynucleotide encoding a polypeptide comprising the amino
acid sequence of SEQ ID N0:2, from amino acid residue 1 to
amino acid residue 33.
Within a further aspect the invention provides a
variant zsig49 polypeptide, wherein the amino acid
sequence of the variant polypeptide shares an identity
with the amino acid sequence of SEQ ID NO:10 selected from
the group consisting of at least 80o identity, at least
90o identity, at least 95o identity, or greater than 950
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
identity, and wherein any difference between the amino
acid sequence of the variant polypeptide and the amino
acid sequence of SEQ ID NO:10 is due to one or more
conservative amino acid substitutions.
5 Within another aspect the invention provides a
polynucleotide molecule encoding a fusion protein
consisting essentially of a first portion and a second
portion joined by a peptide bond, the first portion
comprising a polypeptide as described above; and the
second portion comprising another polypeptide.
The invention also provides a polynucleotide
encoding a fusion protein comprising a secretory signal
sequence having the amino acid sequence of amino acid
residues 1-33 of SEQ ID NO:10, wherein the secretory signal
sequence is operably linked to an additional polypeptide.
Within a further aspect the patent provides an
expression vector comprising the following operably linked
elements: a transcription promoter; a DNA segment encoding
a polypeptide as described above; and a transcription
terminator. Within one embodiment the polypeptide further
comprises a secretory signal sequence operably linked to
the polypeptide. Within a related embodiment the
secretory signal sequence comprises amino acid residues 1-
33 of SEQ ID N0:2. Within another embodiment the DNA
segment encodes a polypeptide covalently linked amino
terminally or carboxy terminally to an affinity tag.
The patent also provides a cultured cell into
which has been introduced an expression vector as described
above, wherein the cultured cell expresses the polypeptide
encoded by the polynucleotide segment.
Also provides is a method of producing a
polypeptide comprising: culturing a cell into which has
been introduced an expression vector as described above;
whereby the cell expresses the polypeptide encoded by the
polynucleotide segment; and recovering the expressed
polypeptide. Within one embodiment the expression vector
further comprises a secretory signal sequence operably
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
6
linked to the polypeptide; the cultured cell secretes the
polypeptide into a culture medium, and the polypeptide is
recovered from the culture medium.
Within another aspect the invention provides an
antibody or antibody fragment that specifically binds to a
polypeptide as described above. Within one embodiment the
antibody is selected from the group consisting of: a)
polyclonal antibody; b) murine monoclonal antibody; c)
humanized antibody derived from b); and d) human
monoclonal antibody. Within a related embodiment the
antibody fragment is selected from the group consisting of
F(ab'), F(ab), Fab', Fab, Fv, scFv, and minimal
recognition unit. Within another embodiment is provided
an anti-idiotype antibody that specifically binds to the
antibody described above.
Also provides is a polypeptide as described
above in combination with a pharmaceutically acceptable
vehicle.
Within another aspect the invention provides a
method of detecting a chromosome 1 abnormality in a
subject comprising: (a) amplifying nucleic acid molecules
that encode a polypeptide as described from RNA isolated
from a biological sample of the subject, and (b) detecting
a mutation in the amplified nucleic acid molecules,
wherein the presence of a mutation indicates a chromosome
1 abnormality. Within one embodiment the detecting step
is performed by comparing the nucleotide sequence of the
amplified nucleic acid molecules to the nucleotide
sequence of SEQ ID N0:9, wherein a difference between the
nucleotide sequence of the amplified nucleic acid
molecules and the corresponding nucleotide sequence of SEQ
ID N0:9 is indicative of chromosome 1 abnormality. Within
another embodiment amplification is performed by
polymerase chain reaction or reverse transcriptase
polymerase chain reaction.
Within another aspect is provided a method of
detecting a chromosome 1 abnormality in a subject
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
7
comprising: (a) amplifying nucleic acid molecules that
encode a polypeptide as described above from RNA isolated
from a biological sample of the subject, (b) transcribing
the amplified nucleic acid molecules to express mRNA, (c)
translating the mRNA to produce polypeptides, and (d)
detecting a mutation in the polypeptides, wherein the
presence of a mutation indicates a chromosome 1
abnormality.
The invention also provides a method for
diagnosing a metabolic disease or susceptibility to a
metabolic disease in an individual, wherein the disease is
related to the expression or activity of a polypeptide as
described above in the individual, comprising the step of
determining the presence of an alteration in the
nucleotide sequence encoding the polypeptide in the genome
of the individual, wherein the presence of an alteration
in the nucleotide sequence indicates metabolic disease or
susceptibility to a metabolic disease.
Within another aspect the invention provides a
method for diagnosing a metabolic disease or
susceptibility to a metabolic disease in an individual,
comprising:(a) amplifying nucleic acid molecules that
encode a polypeptide as described above from RNA isolated
from a biological sample of the individual, and (b)
detecting a mutation in the amplified nucleic acid
molecules, wherein the presence of a mutation indicates
metabolic disease or susceptibility to a metabolic
disease.
Also provided is a method for diagnosing a
metabolic disease or susceptibility to a metabolic disease
in an individual, comprising:(a) amplifying nucleic acid
molecules that encode a polypeptide as described above
from RNA isolated from a biological sample of the subject,
(b) transcribing the amplified nucleic acid molecules to
produce mRNA, (c) translating the mRNA to produce the
polypeptides, and (d) detecting a mutation in the
polypeptides, wherein the presence of a mutation indicates
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
8
metabolic disease or susceptibility to a metabolic
disease. Within one embodiment the metabolic disease is
diabetes. Within a related embodiment the metabolic
disease is Type II diabetes, and the individual is a Pima
Indian.
The invention further provides a method of
detecting the presence of zsig49 polypeptide RNA in a
biological sample, comprising the steps of: (a) ontacting
a nucleic acid probe under hybridizing conditions with
either (i) test RNA molecules isolated from the biological
sample, or (ii) nucleic acid molecules synthesized from
the isolated RNA molecules, wherein the nucleic acid probe
has a nucleotide sequence comprising a portion of the
nucleotide sequence of nucleotides 167-1567 of SEQ ID N0:9
or its complement, or the nucleotide sequence of
nucleotides 1-1383 of SEQ IN N0:12 or its complement, and
(b) detecting the formation of hybrids of the nucleic acid
probe and either the test RNA molecules or the synthesized
nucleic acid molecules, wherein the presence of the
hybrids indicates the presence of zsig49 polypeptide RNA
in the biological sample.
The invention also provides a method of
detecting the presence of a polypeptide as described above
in a biological sample, comprising the steps of: (a)
contacting the biological sample with an antibody or an
antibody fragment, that specifically binds with a
polypeptide consisting of the amino acid sequence of SEQ
ID NO:10, wherein the contacting is performed under
conditions that allow the binding of the antibody or
antibody fragment to the biological sample, and (b)
detecting any of the bound antibody or bound antibody
fragment. Within one embodiment the antibody or the
antibody fragment further comprises a detectable label
selected from the group consisting of radioisotope,
fluorescent label, chemiluminescent label, enzyme label,
bioluminescent label, and colloidal gold.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
9
Within another aspect the invention provides a
kit for the detection of a gene encoding a polypeptide,
comprising: a first container that comprises a
polynucleotide molecule as described above; and a second
container that comprises one or more reagents capable of
indicating the presence of the polynucleotide molecule.
The invention also provides a kit for the
detection of a gene encoding a polypeptide, comprising: a
first container that comprises an antibody as described
above; and a second container that comprises one or more
reagents capable of indicating the presence of the
antibody.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail,
it may be helpful to the understanding thereof to define
the following terms:
The term "affinity tag" is used herein to denote
a peptide segment that can be attached to a polypeptide to
provide for purification or detection of the polypeptide
or provide sites for attachment of the polypeptide to a
substrate. In principal, any peptide or protein for which
an antibody or other specific binding agent is available
can be used as an affinity tag. Affinity tags include a
poly-histidine tract, protein A (Nilsson et al., EMBO J.
4:1075, 1985; Nilsson et al., Methods Enz~mol. 198:3,
1991), glutathione S transferase (Smith and Johnson, Gene
67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et al.,
Proc. Natl. Acad. Sci. USA 82:7952-4, 1985), substance P,
FlagTM peptide (Hopp et al., Biotechnoloay 6:1204-10, 1988;
available from Eastman Kodak Co., New Haven, CT),
streptavidin binding peptide, or other antigenic epitope
or binding domain. See, in general Ford et al., Protein
Expression and Purification 2: 95-107, 1991. DNAs
encoding affinity tags are available from commercial
suppliers (e. g., Pharmacia Biotech, Piscataway, NJ).
The term "allelic variant" denotes any of two or
more alternative forms of a gene occupying the same
CA 02364330 2001-10-04
WO 00/23591 PCTNS99/24579
chromosomal locus. Allelic variation arises naturally
through mutation, and may result in phenotypic
polymorphism within populations. Gene mutations can be
silent (no change in the encoded polypeptide) or may
5 encode polypeptides having altered amino acid sequence.
The term allelic variant is also used herein to denote a
protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl
terminal" are used herein to denote positions within
10 polypeptides and proteins. Where the context allows,
these terms are used with reference to a particular
sequence or portion of a polypeptide or protein to denote
proximity or relative position. For example, a certain
sequence positioned carboxyl-terminal to a reference
sequence within a protein is located proximal to the
carboxyl terminus of the reference sequence, but is not
necessarily at the carboxyl terminus of the complete
protein.
The term "complements of polynucleotide
molecules" denotes polynucleotide molecules having a
complementary base sequence and reverse orientation as
compared to a reference sequence. For example, the
sequence 5' ATGCACGGG 3' is comp7_ementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that
has a contiguous stretch of identical or complementary
sequence to another polynucleotide. Contiguous sequences
are said to "overlap" a given stretch of polynucleotide
sequence either in their entirety or along a partial
stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-
ATGGCTTAGCTT-3' are 5'-TAGCTTgagtct-3' and 3'-
gtcgacTACCGA-5'.
The term "corresponding to", when applied to
positions of amino acid residues in sequences, means
corresponding positions in a plurality of sequences when
the sequences are optimally aligned.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
11
The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or
more degenerate codons (as compared to a reference
polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of
nucleotides, but encode the same amino acid residue (i.e.,
GAU and GAC triplets each encode Asp).
The term "expression vector" denotes a DNA
molecule, linear or circular, that comprises a segment
encoding a polypeptide of interest operably linked to
additional segments that provide for its transcription.
Such additional segments may include promoter and
terminator sequences, and may optionally include one or
more origins of replication, one or more selectable
markers, an enhancer, a polyadenylation signal, and the
like. Expression vectors are generally derived from
plasmid or viral DNA, or may contain elements of both.
The term "isolated", when applied to a
polynucleotide molecule, denotes that the polynucleotide
has been removed from its natural genetic milieu and is
thus free of other extraneous or unwanted coding
sequences, and is in a form suitable for use within
genetically engineered protein production systems. Such
isolated molecules are those that are separated from their
natural environment and include cDNA and genomic clones.
Isolated DNA molecules of the present invention are free
of other genes with which they are ordinarily associated,
but may include naturally occurring 5' and 3' untranslated
regions such as promoters and terminators. The
identification of associated regions will be evident to
one of ordinary skill in the art (see for example, Dynan
and Tijan, Nature 316:774-78, 1985). When applied to a
protein, the term "isolated" indicates that the protein is
found in a condition other than its native environment,
such as apart from blood and animal tissue. In a
preferred form, the isolated protein is substantially free
of other proteins, particularly other proteins of animal
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
12
origin. It is preferred to provide the protein in a
highly purified form, i.e., greater than 95% pure, more
preferably greater than 99o pure.
The term "operably linked", when referring to
DNA segments, denotes that the segments are arranged so
that they function in concert for their intended purposes,
e.g. transcription initiates in the promoter and proceeds
through the coding segment to the terminator.
The term "ortholog" (or "species homolog")
denotes a polypeptide or protein obtained from one species
that has homology to an analogous polypeptide or protein
from a different species. The ortholog is the functional
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
The term "polynucleotide" denotes a single- or
double-stranded polymer of deoxyribonucleotide or
ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated
from natural sources, synthesized in vitro, or prepared
from a combination of natural and synthetic molecules.
Sizes of polynucleotides are expressed as base pairs
(abbreviated "bp"), nucleotides ("nt"), or kilobases
("kb"). Where the context allows, the latter two terms
may describe polynucleotides that are single-stranded or
double-stranded. When the term is applied to double-
stranded molecules it is used to denote overall length and
will be understood to be equivalent to the term "base
pairs". It will be recognized by those skilled in the art
that the two strands of a double-stranded polynucleotide
may differ slightly in length and that the ends thereof
may be staggered as a result of enzymatic cleavage; thus
all nucleotides within a double-stranded polynucleotide
molecule may not be paired. Such unpaired ends will in
general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
13
naturally or synthetically. Polypeptides of less than
about 10 amino acid residues are commonly referred to as
"peptides".
"Probes and/or primers" as used herein can be
RNA or DNA. DNA can be either cDNA or genomic DNA.
Polynucleotide probes and primers are single or double
stranded DNA or RNA, generally synthetic oligonucleotides,
but may be generated from cloned cDNA or genomic sequences
or its complements. Analytical probes will generally be
at least 20 nucleotides in length, although somewhat
shorter probes (14-17 nucleotides) can be used. PCR
primers are at least 5 nucleotides in length, preferably
or more nt, more preferably 20-30 nt. Short
polynucleotides can be used when a small region of the
15 gene is targeted for analysis. For gross analysis of
genes, a polynucleotide probe may comprise an entire exon
or more. Probes can be labeled to provide a detectable
signal, such as with an enzyme, biotin, a radionuclide,
fluorophore, chemiluminescer, paramagnetic particle and
the like, which are commercially available from many
sources (such as Molecular Probes, Inc., Eugene, OR, and
Amersham Corp., Arlington Heights, IL), using techniques
that are well known in the art.
The term "promoter" denotes a portion of a gene
containing DNA sequences that provide for the binding of
RNA polymerise and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
A "protein" is a macromolecule comprising one or
more polypeptide chains. A protein may also comprise non-
peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be
added to a protein by the cell in which the protein is
produced, and will vary with the type of cell. Proteins
are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are
generally not specified, but may be present nonetheless.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
14
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule (i.e., a
ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-
domain structure comprising an extracellular ligand-
binding domain and an intracellular effector domain that
is typically involved in signal transduction. Binding of
ligand to receptor results in a conformational change in
the receptor that causes an interaction between the
effector domain and other molecules) in the cell. This
interaction in turn leads to an alteration in the
metabolism of the cell. Metabolic events that are linked
to receptor-ligand interactions include gene
transcription, phosphorylation, dephosphorylation,
increases in cyclic AMP production, mobilization of
cellular calcium, mobilization of membrane lipids, cell
adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In general, receptors can be membrane
bound, cytosolic or nuclear; monomeric (e. g., thyroid
stimulating hormone receptor, beta-adrenergic receptor) or
multimeric (e. g., PDGF receptor, growth hormone receptor,
IL-3 receptor, GM-CSF receptor, G-CSF receptor,
erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a
DNA sequence that encodes a polypeptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger peptide
is commonly cleaved to remove the secretory peptide during
transit through the secretory pathway.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a protein
encoded by a splice variant of an mRNA transcribed from a
gene.
5 Molecular weights and lengths of polymers
determined by imprecise analytical methods (e.g., gel
electrophoresis) will be understood to be approximate
values. When such a value is expressed as "about" X or
"approximately" X, the stated value of X will be
10 understood to be accurate to +10%.
All references cited herein are incorporated by
reference in their entirety.
The present invention is based in part upon the
discovery of a novel DNA sequence (SEQ ID N0:9) and the
15 corresponding deduced polypeptide sequence (SEQ ID NO:10)
for a secreted protein mapping to human chromosome 1. The
polypeptide of the present invention has been designated
zsig49.
The novel zsig49 polypeptide-encoding
polynucleotides of the present invention were initially
identified by querying an EST database for secretory
signal sequences characterized by an upstream methionine
start site, a hydrophobic region of approximately 13 amino
acids and a cleavage site (SEQ ID N0:3, wherein cleavage
occurs between the alanine and glycine amino acid
residues) in an effort to select for secreted proteins.
Polypeptides corresponding to ESTs meeting those search
criteria were compared to known sequences to identify
secreted proteins having homology to known ligands. One
EST sequence was discovered and determined to be novel.
The EST sequence was from an islet cell library. A clone
considered likely to contain the entire coding region was
used for sequencing and revealed the 3' end of a poly-A+
message. A putative signal sequence is intact with a stop
upstream of the predicted start methionine (residue 1 of
SEQ ID NOs:2 and 10). The alignment of the murine (SEQ ID
N0:12) and human (SEQ ID NO:1) DNA sequences indicated
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
16
that the human sequence could be extended further in the
3' direction. A series of 3'RACE PCRs were carried out
and extending the human cDNA sequence to 1704 by (SEQ ID
NO : 9 ) . The deduced amino acid sequence is shown in SEQ ID
NO:10. Analysis of the DNA encoding a zsig49 polypeptide
(SEQ ID NO:10) revealed an open reading frame encoding 467
amino acid residues comprising a putative signal sequence
(residues 1-33 of SEQ ID NO:10) and 434 amino acid
residues predicted mature sequence (residues 34 to 467 of
SEQ ID N0:10). A dibasic site (lys-lys) is found at
residues 62-63 of SEQ ID N0:10. Cysteine residues are
found at amino acid residues 42, 44, 81, 90, 95, 100, 130,
165, 207, 240, 262, 390, 393 and 396 of SEQ ID NO:10.
The patent also provides a murine ortholog of
human zsig49. Analysis of the polynucleotide sequence
(SEQ ID N0:12) encoding the murine ortholog (SEQ ID N0:13)
revealed a putative signal sequence (amino acid residues
1-27 of SEQ ID N0:13), and a 434 amino acid residues
mature sequence (amino acid residues 28-461 of SEQ ID
N0:13). As in the human, there is a dibasic site (lys-
lys) found at residues 56-57 of SEQ ID N0:13 and cysteine
residues corresponding to amino acid residues 35, 75, 84,
89, 94, 124, 159, 201, 234, 256, 384, 387 and 390 of SEQ
ID N0:13.
Multimeric complexes can be formed through
intermolecular disulfide bonds between zsig49 and a second
polypeptide. The dimeric proteins within the present
invention are formed by intermolecular disulfide bonds
formed between the cysteine residues. These proteins
include homodimers and heterodimers. In the latter case,
the second polypeptide can be a zsig49 ortholog or homolog
or other similar protein. The protein could also be one
having a cysteine residue available for disulfide bond
formation.
Precursor proteins are cleaved or processed into
active form through the action of prohormone convertases
(endoproteases). The most prevalent cleavage or processing
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
17
site is a dibasic amino acid prohormone convertase site.
There are only a few dibasic amino acid combinations,
including lys-lys, arg-arg, arg-lys and lys-arg. Non-
dibasic cleavage and processing sites have also been
observed, for example, Asn-Arg is a non-dibasic site found
in gastrin. Zsig49 polypeptides may be processed at the
lys-lys di-basic site (amino acid residues 62-62 of SEQ ID
NOs:2 and 10 or amino acid residues 56-57 of SEQ ID N0:13)
by prohormone convertases into an active from. Known
prohormone convertases include, but are not limited to,
prohormone convertase 3 (PC3), prohormone convertase 2
(PC2), furin, or similar convertases of the furin family
such as prohormone convertase 4 (PC4) and PACE4.
The present invention therefore provides post
translationally modified polypeptides or polypeptide
fragments having the amino acid sequence from amino acid
residue 34 to amino acid residue 63 of SEQ ID NOs:2 or
110; the amino acid sequence from amino acid residue 64 to
amino acid residue 77 of SEQ ID N0:2; the amino acid
sequence from amino acid residues 64 to 467 of SEQ ID
NO:10; the amino acid sequence 28 to amino acid residue 57
of SEQ ID N0:13; or the amino acid sequence from amino
acid residue 58 to amino acid residue 461 of SEQ ID N0:13.
Examples of post translational modifications include
proteolytic cleavage, glycosylation, disulfide bonding and
hydroxylation.
Analysis of the tissue distribution of the mRNA
corresponding to the partial zsig 49 DNA sequence of SEQ
ID N0:1, by Northern blot and Dot blot analysis showed
strong expression in pancreas, slightly decreased
expression in testis, obvious expression in stomach,
liver, pituitary, thyroid and salivary gland. A weaker
transcript was detected in prostate, spinal cord, adrenal
gland, small intestine, trachea, spleen, thymus,
peripheral blood leukocytes and lymph node. There are two
major transcripts at about 2 kb and 5 kb. While the 2 kb
transcript is the major transcript in testis, the 5 kb
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
18
transcript is the major transcript in the other tissues.
These results suggest that SEQ ID N0:1 may be the result
of an incompletely spliced mRNA.
The present invention further provides
polynucleotide molecules, including DNA and RNA molecules,
encoding zsig49 proteins. The polynucleotides of the
present invention include the sense strand; the anti-sense
strand; and the DNA as double-stranded, having both the
sense and anti-sense strand annealed together by their
respective hydrogen bonds. A representative DNA sequence
encoding a zsig49 protein is set forth in SEQ ID NO:10.
DNA sequences encoding other zsig49 proteins can be
readily generated by those of ordinary skill in the art
based on the genetic code. Counterpart RNA sequences can
be generated by substitution of U for T.
Those skilled in the art will readily recognize
that, in view of the degeneracy of the genetic code,
considerable sequence variation is possible among these
polynucleotide molecules. SEQ ID N0:4 is a degenerate DNA
sequence that encompasses all DNAs that encode the partial
zsig49 polypeptide of SEQ ID N0:2, SEQ ID N0:11 is a
degenerate DNA sequence that encompasses all DNAs that
encode the zsig49 polypeptide of SEQ ID N0:10, and SEQ ID
N0:14 is a degenerate DNA sequence that encompasses all
DNAs that encode the murine ortholog zsig49 sequence of
SEQ ID N0:13. Those skilled in the art will recognize
that the degenerate sequences of SEQ ID NOs:4, 11 and 14
also provides all RNA sequences encoding SEQ ID NOs:2, 10
and 13 by substituting U for T. Thus, zsig49 polypeptide-
encoding polynucleotides comprising nucleotide 1 to
nucleotide 231 of SEQ ID N0:4, nucleotide 1 to nucleotide
1401 of SEQ ID N0:11 and nucleotide 1 to nucleotide 1383
of SEQ ID N0:14 and their RNA equivalents are contemplated
by the present invention. Table 1 sets forth the one-
letter codes used within SEQ ID NOs:4, 11 and 14 to denote
degenerate nucleotide positions. "Resolutions" are the
nucleotides denoted by a code letter. "Complement"
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
19
indicates the code for the complementary nucleotide(s).
For example, the code Y denotes either C or T, and its
complement R denotes A or G, A being complementary to T,
and G being complementary to C.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
TABLE 1
Nucleotide Resolution Nucleotide Complement
A A T T
C C G G
G G C C
T T A A
R A~G Y CST
Y CST R A~G
M ABC K GET
K GET M ABC
S CMG S CMG
W ACT W ACT
H A~C~T D A~G~T
B C~G~T V A~C~G
V A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ ID NOs:4, 11
5 and 14, encompassing all possible codons for a given amino
acid, are set forth in Table 2.
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
21
TABLE 2
One
Amino Letter Degenerate
Acid Code Colons Colon
Cys C TGC TGT TGY
Ser S AGC AGTTCA TCC TCG TCT WSN
Thr T ACA ACCACG ACT ACN
Pro P CCA CCCCCG CCT CCN
Ala A GCA GCCGCG GCT GCN
Gly G GGA GGCGGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGGCGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATCATT ATH
Leu L CTA CTCCTG CTT TTA TTG YTN
Ual U GTA GTCGTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAGTGA TRR
Asn~AspB RAY
Glu~GlnZ SAR
Any X NNN
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
22
One of ordinary skill in the art will appreciate
that some ambiguity is introduced in determining a
degenerate codon, representative of all possible codons
encoding each amino acid. For example, the degenerate
codon for serine (WSN) can, in some circumstances, encode
arginine (AGR), and the degenerate codon for arginine
(MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding
phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant
amino acid sequences, but one of ordinary skill in the art
can easily identify such variant sequences by reference to
the amino acid sequences of SEQ ID NOs:2, 10 and 14.
Variant sequences can be readily tested for functionality
as described herein.
One of ordinary skill in the art will also
appreciate that different species can exhibit
"preferential codon usage." In general, see, Grantham, et
al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene 13:355-64,
1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm,
Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential
codon usage" or "preferential codons" is a term of art
referring to protein translation codons that are most
frequently used in cells of a certain species, thus
favoring one or a few representatives of the possible
codons encoding each amino acid (See Table 2). For
example, the amino acid threonine (Thr) may be encoded by
ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the
most commonly used codon; in other species, for example,
insect cells, yeast, viruses or bacteria, different Thr
codons may be preferential. Preferential codons for a
particular species can be introduced into the
polynucleotides of the present invention by a variety of
methods known in the art. Introduction of preferential
codon sequences into recombinant DNA can, for example,
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
23
enhance production of the protein by making protein
translation more efficient within a particular cell type
or species. Therefore, the degenerate codon sequence
disclosed in SEQ ID NOs:4, 11 and 14 serve as a template
for optimizing expression of polynucleotides in various
cell types and species commonly used in the art and
disclosed herein. Sequences containing preferential
codons can be tested and optimized for expression in
various species, and tested for functionality as disclosed
herein.
Radiation hybrid mapping is a somatic cell
genetic technique developed for constructing high-
resolution, contiguous maps of mammalian chromosomes (Cox
et al., Science 250:245-50, 1990). Partial or full
knowledge of a gene's sequence allows the designing of PCR
primers suitable for use with chromosomal radiation hybrid
mapping panels. Radiation hybrid mapping panels are
commercially available which cover the entire human
genome, such as the Stanford G3 RH Panel and the
GeneBridge 4 RH Panel (Research Genetics, Inc.,
Huntsville, AL). These panels enable rapid, PCR based,
chromosomal localizations and ordering of genes, sequence-
tagged sites (STSs), and other nonpolymorphic- and
polymorphic markers within a region of interest. This
includes establishing directly proportional physical
distances between newly discovered genes of interest and
previously mapped markers. The precise knowledge of a
gene's position can be useful in a number of ways
including: 1) determining if a sequence is part of an
existing contig and obtaining additional surrounding
genetic sequences in various forms such as YAC-, BAC- or
cDNA clones, 2) providing a possible candidate gene for an
inheritable disease which shows linkage to the same
chromosomal region, and 3) for cross-referencing model
organisms such as mouse which may be beneficial in helping
to determine what function a particular gene might have.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
24
Radiation hybrid mapping showed that zsig49 maps
9.76 cR 3000 distal of the marker D1S2635 on the
GeneBridge 4 RH mapping panel and 62 cR_10,000 distal of
the marker SHGC-6236 on the Stanford G3 RH panel. The use
of surrounding markers positions zsig49 in the 1q24
chromosomal region. A susceptibility locus for prostate
cancer (HPCl) has been localized to chromosome 1q24 and a
susceptibility locus for type II diabetes mellitus has
also been localized to the q arm of chromosome 1.
Type II diabetes mellitus has a substantial
genetic component (Barnett et al., Diabetoloqia 20:87,
1981; Knowler et al., Am. J. Epidemiol. 113:144-56, 1981;
Hanson et al., Am. J. Hum. Genet. 57:160-70, 1995). Genes
that predispose to certain forms of diabetes have been
identified, including several loci for Type I diabetes and
for maturity-onset diabetes of the young (Froguel et al.,
Nature 356:162, 1992; Davies et al., Nature 371:130, 1994;
Yamagata et al., Nature 384:455, 1996; Stoffers et al.,
Nat. Genet. 17:138, 1997 and Elbein et al., Diabetes
48:1175-82, 1999). Although specific genetic defects have
been identified in rare syndromes of Type II diabetes
mellitus, no specific defect has yet been defined as
pathogenic in common forms of this disease. Mathematical
modeling has suggested that Type II diabetes mellitus is a
polygenic disease (DeFronzo, Diabetes Reviews 5:177, 1997;
Lowe, "Diabetes Mellitus," Principles of Molecular
Medicine, (Jameson, ed.), pages 433-442 (Humana Press Inc.
1998 ) ) .
A linkage analyses indicates that a diabetes-
susceptibility locus resides on chromosome lq (Hanson et
al., Am. J. Hum. Genet. 63:1130-8, 1998). On the Stanford
G3 RH panel, the zig49 gene was found to map 5 cR 10,000
(1 cR-10,000 - ~25 kb) distal from a potential diabetes-
susceptibility loci marker, D1S1677, identified by Hanson
et al., ibid. The Hanson study was a genome-wide search
for loci linked to diabetes and body-mass index in Pima
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
Indians, a Native American population with a high
prevalence of Type II diabetes and obesity (Bennett et
al., Lancet 2:125 1971); Knowler et al., Am. J. Clin.
Nutr. 53 (Suppl):15435 1991). Accordingly, nucleotide
5 sequences that encode the zsig49 gene can be used in the
diagnosis or prognosis of metabolic disease, such as
diabetes. These methods are also suitable for diagnosis
or prognosis of diabetes in Pima Indians.
The present invention provides reagents for use
10 in diagnostic applications. For example, the zsig49 gene,
a probe comprising zsig49 DNA or RNA, or a subsequence
thereof can be used to determine if the zsig49 gene is
present on chromosome 1 or if a mutation has occurred.
Detectable chromosomal aberrations at the zsig49 gene
15 locus include, but are not limited to, aneuploidy, gene
copy number changes, insertions, deletions, restriction
site changes and rearrangements. These aberrations can
occur within the coding sequence, within introns, or
within flanking sequences, including upstream promoter and
20 regulatory regions, and may be manifested as physical
alterations within a coding sequence or changes in gene
expression level.
In general, these diagnostic methods comprise
the steps of (a) obtaining a genetic sample from a
25 patient; (b) incubating the genetic sample with a
polynucleotide probe or primer as disclosed above, under
conditions wherein the polynucleotide will hybridize to
complementary polynucleotide sequence, to produce a first
reaction product; and (iii) comparing the first reaction
product to a control reaction product. A difference
between the first reaction product and the control
reaction product is indicative of a genetic abnormality in
the patient. Genetic samples for use within the present
invention include genomic DNA, cDNA, and RNA. The
polynucleotide probe or primer can be RNA or DNA, and will
comprise a portion of SEQ ID NOs:l, 9 or 12, the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
26
complements of SEQ ID NOs:l, 9 or 12, or an RNA equivalent
thereof. Suitable assay methods in this regard include
molecular genetic techniques known to those in the art,
such as restriction fragment length polymorphism (RFLP)
analysis, short tandem repeat (STR) analysis employing PCR
techniques, ligation chain reaction (Barany, PCR Methods
and Applications 1:5-16, 1991), ribonuclease protection
assays, use of single-nucleotide polymorphisms (SNPs)
(Zhao et al., Am. J. Hum. Genet. 63:225-40, 1998) and
other genetic linkage analysis techniques known in the art
(Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian,
Chest 108:255-65, 1995). Ribonuclease protection assays
(see, e.g., Ausubel et al., ibid., ch. 4) comprise the
hybridization of an RNA probe to a patient RNA sample,
after which the reaction product (RNA-RNA hybrid) is
exposed to RNase. Hybridized regions of the RNA are
protected from digestion. Within PCR assays, a patient's
genetic sample is incubated with a pair of polynucleotide
primers, and the region between the primers is amplified
and recovered. Changes in size or amount of recovered
product are indicative of mutations in the patient.
Another PCR-based technique that can be employed is single
strand conformational polymorphism (SSCP) analysis
(Hayashi, PCR Methods and Applications 1:34-8, 1991).
Zsig49 is expressed in organs of the endocrine
system, pancreas, testis, thymus, adrenal gland, thyroid
gland and pituitary gland, suggesting a metabolic-
associated activity. Hormones released by endocrine
tissues regulate reproduction, growth and development,
provide defense against stress, and maintain and regulate
a metabolic balance within the body. Zsig49 is also
expressed in other tissues, such as stomach and small
intestine, which secrete hormones in response to food
intake and digestion.
Zsig49 expression is strongest in pancreas.
Acinar cells of the pancreas are involved in production of
secretory fluids ducted to the small intestine for use
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
27
during digestion. The islets of Langerhans (islets) are
the site of synthesis of hormones that affect metabolism
and neurological functions. For example, within islets,
mature a-cells produce glucagon, mature (3-cells produce
insulin, and mature 8-cells produce somatostatin.
Glucagon and insulin coordinate the flow of
endogenous glucose, free fatty acids, amino acids, and
other substrate molecules to ensure that energy needs are
met in the basal state and during exercise. Furthermore,
they coordinate the efficient disposition of the nutrient
input from meals. Other hormone-like products of islet
cells (including amylin, pancreastatin, somatostatin, and
pancreatic polypeptide) may play subsidiary roles in the
regulation of metabolism.
The ability of zsig49 to modulate mammalian
energy balance may be evaluated by monitoring one or more
of the following metabolic functions: adipogenesis,
gluconeogenesis, glycogenolysis, lipogenesis, glucose
uptake, protein synthesis, thermogenesis, oxygen
utilization or the like. These metabolic functions are
monitored by techniques (assays or animal models) known to
one of ordinary skill in the art. Such methods of the
present invention comprise incubating cells to be studied
~zsig49 polypeptide, monoclonal antibody, agonist or
antagonist thereof and observing changes in adipogenesis,
gluconeogenesis, glycogenolysis, lipogenesis, glucose
uptake, or the like. For example, the glucoregulatory
effects of insulin are predominantly exerted in the liver,
skeletal muscle and adipose tissue. Insulin binds to its
cellular receptor in these three tissues and initiates
tissue-specific actions that result in, for example, the
inhibition of glucose production and the stimulation of
glucose utilization. In the liver, insulin stimulates
glucose uptake and inhibits gluconeogenesis and
glycogenolysis. In skeletal muscle and adipose tissue,
insulin acts to stimulate the uptake, storage and
utilization of glucose.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
28
Use may also be made of zsig49 polypeptides,
agonists and/or antagonists in prevention or treatment of
pancreatic conditions characterized by dysfunction
associated with pathological regulation of blood glucose
levels, insulin resistance or digestive function. As used
herein, the terms "treat" and "treatment" will be
understood to include the reduction of symptoms as well as
effects on the underlying disease process. In particular,
diabetes mellitus is a disorder of metabolism caused by a
complete or partial lack of insulin. The most prominent
forms are Type I or insulin dependent diabetes, and Type
II, non-insulin dependent diabetes. Diabetes can also
result from secondary causes which disrupt or limit
insulin production, such as pancreatectomy or pancreatic
insufficiency due to pancreatic disease, hypersecretion of
hormones antagonistic to insulin or administration of
drugs which interfere with carbohydrate metabolism. Onset
may also be due to impaired glucose tolerance. Use of
zsig49 polypeptides, agonists and/or antagonists may be
made to treat diabetes or alleviate or eliminate
associated symptoms related to elevated glucose levels.
Zsig49 polypeptides may find application, for example, in
maintaining and/or regulating blood sugar levels. Animal
models, such as the NOD mice, a spontaneous model system
for insulin-dependent diabetes mellitus (IDDM) and a viral
induction transgenic mouse model (Herrath et al., J. Clin
Invest. 98:1324, 1996) are available to study induction of
non-responsiveness. Administration of zsig49 polypeptides
prior to or after onset of disease can be monitored by
assay of urine glucose levels.
Stimulation of proliferation or differentiation
of pancreatic cells can be measured in vitro by
administration of zsig49 polypeptides to cultured
pancreatic cells or in vivo by administering molecules of
the present invention to the appropriate animal model.
Such reagents would be useful for i~ vitro culturing of
islets, and hence their component cells which include a-
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
29
cell, (3-cells and 8-cells. Cultured islets would provide
a source for islet cells for transplantation, an
alternative to whole pancreas transplantation. Assays
measuring cell proliferation or differentiation are well
known in the art. For example, assays measuring
proliferation include such assays as chemosensitivity to
neutral red dye (Cavanaugh et al., Investigational New
Druas 8:347-54, 1990), incorporation of radiolabelled
nucleotides (Cook et al., Analytical Biochem. 179:1-7,
1989), incorporation of 5-bromo-2'-deoxyuridine (BrdU) in
the DNA of proliferating cells (Porstmann et al., J.
Immunol. Methods 82:169-79, 1985), and use of tetrazolium
salts (Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley
et al., Cancer Res. 48:589-601, 1988; Marshall et al.,
Growth Rea. 5:69-84, 1995; and Scudiero et al., Cancer
Res. 48:4827-33, 1988). Assays measuring differentiation
include, for example, measuring cell-surface markers
associated with stage-specific expression of a tissue,
enzymatic activity, functional activity or morphological
FASEB, 5:281-4, 1991; Francis,
changes (Watt,
Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell
Biol. Technol. Bioprocesses, 161-71, 1989).
Within the testis, germ cells undergo
spermatogenesis and mature into terminally differentiated
cells (spermatozoa or sperm). Additionally, Leydig cells
within the testis secrete androgens that are involved in
development of male sex characteristics and activity.
Factors involved in the regulation of sperm cell
maturation and egg-sperm interaction are of therapeutic
value for treating conditions associated with fertility
and for male contraceptive use. Factors that influence
the germ cell maturation process may come directly from
the Sertoli cells that are in contact with spermatogenic
cells. Others are paracrine or endocrine factors produced
outside the seminiferous tubules, such as in the
interstitial Leydig cells, and are transported into the
sperm cell microenvironment by transport and binding
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
proteins that are expressed by the Sertoli cells within
the seminiferous tubules. Factors believed to play an
important role in spermatogenic cell maturation process,
include testosterone, Leydig factor, IGF-1, inhibin,
5 insulin homologs and activin.
Proliferation or differentiation of testicular
cells can be measured in vitro by administering zsig49
polypeptides to cultured testicular cells or in vivo by
administering molecules of the present invention to the
10 appropriate animal model. Cultured testicular cells
include dolphin DBl.Tes cells (CRL-6258); mouse GC-1 spg
cells (CRL-2053); TM3 cells (CRL-1714); TM4 cells (CRL-
1715); and pig ST cells (CRL-1746), available from
American Type Culture Collection, 12301 Parklawn Drive,
15 Rockville, MD. Assays measuring cell proliferation or
differentiation are well known in the art and discussed
herein.
In vivo assays for evaluating the effect of
zsig49 polypeptides on testes are well known in the art.
20 For example, compounds can be injected intraperitoneally
for a specific time duration. After the treatment period,
animals are sacrificed and testes removed and weighed.
Testicles are homogenized and sperm head counts are made
(Meistrich et al., Ex~. Cell Res. 99:72-8, 1976). Other
25 activities, for example, chemotaxic activity that may be
associated with proteins of the present invention can be
analyzed. For example, late stage factors in
spermatogenesis may be involved in egg-sperm interactions
and sperm motility. Activities, such as enhancing
30 viability of cryopreserved sperm, stimulating the acrosome
reaction, enhancing sperm motility and enhancing egg-sperm
interactions may be associated with the proteins of the
present invention. Assays evaluating such activities are
known (Rosenberger, J. Androl. 11:89-96, 1990; Fuchs,
Zentralbl Gynakol 11:117-120, 1993; Neurwinger et al.,
Androlo is 22:335-9, 1990; Harris et al., Human Reprod.
3:856-60, 1988; and Jockenhovel, Androloaia 22:171-178,
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
31
1990; Lessing et al., Fertil. Steril. 44:406-9 (1985);
Zaneveld, In Male Infertility Chapter 11, Comhaire Ed.,
Chapman & Hall, London 1996). These activities are
expected to result in enhanced fertility and successful
reproduction.
The polypeptides of the present invention may
exert regulatory effects on male gametes, reproductive
development and testicular functions through feedback
inhibition of the hypothalamus and anterior pituitary.
Testis proteins, such as activins and inhibins, have been
shown to regulate secretion of active molecules including
follicle stimulating hormone (FSH) by the pituitary (Ying,
Endodcr. Rev. 9:267-93, 1988; Plant et al., Hum. Reprod.
8:41-44,1993). Testosterone reduces the amount of
gonadotropin released from the hypothalamus. The
polypeptides of the present invention may be evaluated for
hormone dependent transcription and expression, using
methods known in the art. For example, zsig49
polypeptides can be tested for androgen regulated
expression using transgenic mice as described in Allison
et al., Mol. Cell. Biol. 9:2254-7, 1989, castration and
steroid therapy (Heyns et al., ibid. and Page and Parker,
Mol. Cell. Biol. 27:343-55, 1982) and hormone suppression
(Pasapera et al., ibid. and Castro et al., ibid.). If
desired, zsig49 polypeptide performance in this regard can
be compared to other androgen proteins, such as
testosterone. Therapeutic use can be made of zsig49
polypeptides, agonists and antagonists by inducing or
releasing suppression of the feedback mechanism in
treating reproductive dysfunctions.
Zsig49 polypeptide, agonists and/or antagonists
of the present invention may have applications in
enhancing fertilization during assisted reproduction in
humans and in animals. Such assisted reproduction methods
are known in the art and include artificial insemination,
in vitro fertilization, embryo transfer and gamete
intrafallopian transfer. Such methods are useful for
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
32
assisting patients who may have physiological or metabolic
disorders that prevent natural conception. Such methods
are also useful in animal breeding programs, such as for
livestock, zoological or racehorse breeding, and could be
used within methods for the creation of transgenic
animals.
Dot blot analysis indicated expression of zsig49
in salivary gland. The salivary glands synthesize and
secrete a number of proteins having diverse biological
functions. Such proteins facilitate lubrication of the
oral cavity (e-a., mucins and proline-rich proteins), re-
mineralization (e. a., statherin and ionic proline-rich
proteins), digestion (ela., amylase, lipase and
proteases), provide anti-microbial (e-a., proline-rich
proteins, lysozyme, histatins and lactoperoxidase) and
mucosal integrity maintenance (e-a., mucins) capabilities.
In addition, saliva is a rich source of growth factors
synthesized by the salivary glands. For example, saliva
is known to contain epidermal growth factor (EGF), nerve
growth factor (NGF), transforming growth factor-alpha
(TGF-a), transforming growth factor-beta (TGF-(3), insulin,
insulin-like growth factors I and II (IGF-I and IGF-II)
and fibroblast growth factor (FGF). See, for example,
Zelles et al., J. Dental. Res. 74: 1826-32, 1995.
Synthesis of growth factors by the salivary gland is
believed to be androgen-dependent and to be necessary for
the health of the oral cavity and gastrointestinal tract.
In addition to expression is salivary gland,
zsig49 is also expressed in stomach and small intestine.
This suggests that zsig49 polypeptides, agonists or
antagonists thereof may be therapeutically useful for
aiding digestion. To verify the presence of this
capability in zsig49 polypeptides, agonists or antagonists
of the present invention, such zsig49 polypeptides,
agonists or antagonists are evaluated with respect to
their ability to break down starch according to procedures
known in the art. If desired, zsig49 polypeptide
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
33
performance in this regard can be compared to digestive
enzymes, such as amylase, lipase, proteases and the like.
In addition, zsig49 polypeptides or agonists or
antagonists thereof may be evaluated in combination with
one or more digestive enzymes to identify synergistic
effects.
Also, zsig49 polypeptides, agonists or
antagonists thereof may be therapeutically useful for
promoting wound healing. To verify the presence of this
capability in zsig49 polypeptides, agonists or antagonists
of the present invention, such zsig49 polypeptides,
agonists or antagonists are evaluated with respect to
their ability to facilitate wound healing according to
procedures known in the art. If desired, zsig49
polypeptide performance in this regard can be compared to
growth factors, such as EGF, NGF, TGF-cc, TGF-~3, insulin,
IGF-I, IGF-II, fibroblast growth factor (FGF) and the
like. In addition, zsig49 polypeptides or agonists or
antagonists thereof may be evaluated in combination with
one or more growth factors to identify synergistic
effects.
In addition, zsig49 polypeptides, agonists or
antagonists thereof may be therapeutically useful for
anti-microbial applications. To verify the presence of
this capability in zsig49 polypeptides, agonists or
antagonists of the present invention, such zsig49
polypeptides, agonists or antagonists are evaluated with
respect to their anti-microbial properties according to
procedures known in the art. See, for example, Barsum et
al., Eur. Respir. J. 8: 709-14, 1995; Sandovsky-Losica et
al., J. Med. Vet. Mycol. (England) 28: 279-87, 1990;
Mehentee et al., J. Gen. Microbiol (England) 135 (Pt. 8):
2181-8, 1989; Segal and Savage, J. Med. Vet. Mycol. 24:
477-9, 1986 and the like. If desired, zsig49 polypeptide
performance in this regard can be compared to proteins
known to be functional in this regard, such as proline-
rich proteins, lysozyme, histatins, lactoperoxidase or the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
34
like. In addition, zsig49 polypeptides or agonists or
antagonists thereof may be evaluated in combination with
one or more anti-microbial agents to identify synergistic
effects.
Anti-microbial protective agents may be directly
. acting or indirectly acting. Such agents operating via
membrane association or pore forming mechanisms of action
directly attach to the offending microbe. Anti-microbial
agents can also act via an enzymatic mechanism, breaking
down microbial protective substances or the cell
wall/membrane thereof. Anti-microbial agents, capable of
inhibiting microorganism proliferation or action or of
disrupting microorganism integrity by either mechanism set
forth herein, are useful in methods for preventing
contamination in cell culture by microbes susceptible to
that anti-microbial activity. Such techniques involve
culturing cells in the presence of an effective amount of
said zsig49 polypeptide or an agonist or antagonist
thereof.
Also, zsig49 polypeptides or agonists thereof
may be used as cell culture reagents in in vitro studies
of exogenous microorganism infection, such as bacterial,
viral or fungal infection. Such moieties may also be used
in in vivo animal models of infection. Also, the
microorganism-adherence properties of zsig49 polypeptides
or agonists thereof can be studied under a variety of
conditions in binding assays and the like.
Moreover, zsig49 polypeptides, agonists or
antagonists thereof may be therapeutically useful for
mucosal integrity maintenance. To verify the presence of
this capability in zsig49 polypeptides, agonists or
antagonists of the present invention, such zsig49
polypeptides, agonists or antagonists are evaluated with
respect to their mucosal integrity maintenance according
to procedures known in the art. See, for example, Zahm et
al., Eur. Respir. J. 8: 381-6, 1995, which describes
methods for measuring viscoelastic properties and surface
_ CA 02364330 2001-10-04
WO 00/23591 PCTNS99/24579
properties of mucous as well as for evaluating mucous
transport by cough and by ciliary activity. If desired,
zsig49 polypeptide performance in this regard can be
compared to mucins or the like. In addition, zsig49
5 polypeptides or agonists or antagonists thereof may be
evaluated in combination with mucins to identify
synergistic effects.
In addition, zsig49 polypeptides are expressed
in the prostate. The prostate gland is androgen regulated
10 and shares other properties with salivary glands. For
example, the salivary glands and prostate gland are
classified as slow replicators with respect to their
proliferative capacity. See, for example, Zajicek, Med.
Hypotheses 7 10 1241-51, 1981. Such slow replicators
15 exhibit similar onotgenies and proceed during regeneration
and neoplasia through similar stages. The prostate gland
also appears to produce growth factors, such as EGF and
NGF, and other biologically important proteins, such as
kallikreins. See, for example, Hiramatsu et al., Biochem.
20 Int. 17 2 311-7, 1988, Harper et al., J. Biol. Chem.
257(14): 8541-8, 1982 and Brady et al., Biochemistry
28 12 5203-10, 1988. Prostate gland function also
appears to be androgen-dependent.
The zsig49 gene was localized to human
25 chromosome 1q24 which is also the location of a
susceptibility locus for prostate cancer (HPC1). Prostate
dysfunction, such as prostate adenocarcinoma or the like,
may also be detected using zsig49 polypeptides.
The present invention also provides methods for
30 studying known or identifying new prohormone convertases,
or endoproteases, enzymes which process prohormones and
protein precursors. Prohormone convertases sometimes
exhibit tissue specificity. As a result, zsig49
polypeptides, which are expressed at high levels in
35 pancreatic tissue, are likely tc be processed by
prohormone convertases exhibiting pancreas specificity,
such as PC2 and PC3. In such methods of the present
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
36
invention, zsig49 polypeptides or fragments (substrate)
may be incubated with known or suspected prohormone
convertases (enzyme) to produce a 30 amino acid residue
fragment from amino acid residue 34 to amino acid residue
63 (product). The enzyme and substrate are incubated
together or co-expressed in a test cell for a time
sufficient to achieve cleavage/processing of the zsig49
polypeptide or fragment or fusion thereof. Detection
and/or quantification of cleavage products follows, using
procedures that are known in the art. For example, enzyme
kinetics techniaues, measuring the rate of cleavacre, can
be used to study or identify prohormone convertases
capable of cleaving zsig49 polypeptides, fragments or
fusion proteins of the present invention.
Agonists or antagonists of the zsig49
polypeptides disclosed above are included within the scope
of the present invention. Agonists may be identified
using a method that comprises providing cells responsive
to a zsig49 polypeptide, fragment or fusion; culturing the
cells in the presence of a test compound and comparing the
cellular response with the cell cultured in the presence
of the zsig49 polypeptide, and selecting the test
compounds for which the cellular response is of the same
type. As described herein, the disclosed polypeptides can
be used to construct zsig49 variants and functional
fragments of zsig49. Such variants and fragments are
considered to be zsig49 agonists. Another type of zsig49
agonist is provided by anti-idiotype antibodies, and
fragments thereof, which mimic the RNA-binding domain of
zsig49, for example. Zsig49 agonists can also be
constructed using combinatorial libraries. Methods for
constructing and screening phage display and other
combinatorial libraries are provided, for example, by Kay
et al., Phage Display of Peptides and Proteins (Academic
Press 1996), Verdine, U.S. Patent No. 5,783,384, Kay, et.
al., U.S. Patent No. 5,747,334, and Kauffman et al., U.S.
Patent No. 5,723,323.
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
37
Zsig49 can also be used to identify inhibitors
(antagonists) of its activity. One such method comprises
providing cells responsive to a zsig49 polypeptide,
culturing a first portion of the cells in the presence of
zsig49 polypeptide, culturing a second portion of the
cells in the presence of the zsig49 polypeptide and a test
compound, and detecting a decrease in a cellular response
of the second portion of the cells as compared to the
first portion of the cells. In addition to those assays
disclosed herein, samples can be tested for inhibition of
zsig49 activity within a variety of assays designed to
measure receptor binding or the stimulation/inhibition of
zsig49-dependent cellular responses. For example, zsig49-
responsive cell lines can be transfected with a reporter
gene construct that is responsive to a zsig49-stimulated
cellular pathway. Reporter gene constructs of this type
are known in the art, and will generally comprise a
zsig49-DNA response element operably linked to a gene
encoding an assayable protein, such as luciferase. DNA
response elements can include, but are not limited to,
cyclic AMP response elements (CRE), hormone response
elements (HRE) insulin response element (IRE) (Nasrin et
al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum
response elements (SRE) (Shaw et al. Cell 56: 563-72,
1989). Cyclic AMP response elements are reviewed in
Roestler et al., J. Biol. Chem. 263 (19):9063-6; 1988 and
Habener, Molec. Endocrinol. 4 (8):1087-94; 1990. Hormone
response elements are reviewed in Beato, Cell 56:335-44;
1989. Candidate compounds, solutions, mixtures or
extracts are tested for the ability to inhibit the
activity of zsig49 on the target cells as evidenced by a
decrease in zsig49 stimulation of reporter gene
expression. Assays of this type will detect compounds
that directly block zsig49 binding to cell-surface
receptors, as well as compounds that block processes in
the cellular pathway subsequent to receptor-ligand
binding. In the alternative, compounds or other samples
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
38
can be tested for direct blocking of zsig49 binding to
receptor using zsig49-tagged with a detectable label
(e. lzSl, biotin, horseradish peroxidase, FITC, and the
g.,
like) . Within assays of this type, the ability of a test
sample to inhibit the binding of labeled zsig49 to the
receptor is indicative of inhibitory activity, which can
be confirmed through secondary assays. Receptors used
within binding assays may be cellular receptors or
isolated, immobilized receptors.
Useful antagonists of zsig49 polypeptides can
also include antibodies directed against a zsig49
polypeptide epitope.
Within preferred embodiments of the invention
the isolated polynucleotides will hybridize to similar
sized regions of SEQ ID NOs:l, 9 or 12, other
polynucleotide probes, primers, fragments and sequences
recited herein or sequences complementary thereto.
Polynucleotide hybridization is well known in the art and
widely used for many applications, see for example,
Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second Edition, Cold Spring Harbor, NY, 1989; Ausubel et
al., eds., Current Protocols in Molecular Bioloay, John
Wiley and Sons, Inc., NY, 1987; Berger and Kimmel, eds.,
Guide to Molecular Cloning Techniques, Methods in
Enzvmoloay, volume 152, 1987 and Wetmur, Crit. Rev.
Biochem. Mol. Biol. 26:227-59, 1990. Polynucleotide
hybridization exploits the ability of single stranded
complementary sequences to form a double helix hybrid.
Such hybrids include DNA-DNA, RNA-RNA and DNA-RNA.
Hybridization will occur between sequences which
contain some degree of complementarity. Hybrids can
tolerate mismatched base pairs in the double helix, but
the stability of the hybrid is influenced by the degree of
mismatch. The Tm of the mismatched hybrid decreases by loC
for every 1-1.5o base pair mismatch. Varying the
stringency of the hybridization conditions allows control
over the degree of mismatch that will be present in the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
39
hybrid. The degree of stringency increases as the
hybridization temperature increases and the ionic strength
of the hybridization buffer decreases. Stringent
hybridization conditions encompass temperatures of about
5-25oC below the thermal melting point (Tm) of the hybrid
and a hybridization buffer having up to 1 M Na+. Higher
degrees of stringency at lower temperatures can be
achieved with the addition of formamide which reduces the
Tm of the hybrid about 1oC for each 1% formamide in the
buffer solution. Generally, such stringent conditions
encompass temperatures of 20-70oC and a hybridization
buffer containing up to 6X SSC and 0-50% formamide. A
higher degree of stringency can be achieved at
temperatures of from 40-70°C with a hybridization buffer
having up to 4X SSC and from 0-50% formamide. Highly
stringent conditions typically encompass temperatures of
42-70°C with a hybridization buffer having up to 1X SSC
and 0-50o formamide. Different degrees of stringency can
be used during hybridization and washing to achieve
maximum specific binding to the target sequence.
Typically, the washes following hybridization are
performed at increasing degrees of stringency to remove
non-hybridized polynucleotide probes from hybridized
complexes.
The above conditions are meant to serve as a
guide and it is well within the abilities of one skilled
in the art to adapt these conditions for use with a
particular polypeptide hybrid. The Tm for a specific
target sequence is the temperature (under defined
conditions) at which 50% of the target sequence will
hybridize to a perfectly matched probe sequence. Those
conditions which influence the Tm include, the size and
base pair content of the polynucleotide probe, the ionic
strength of the hybridization solution, and the presence
of destabilizing agents in the hybridization solution.
Numerous equations for calculating Tm are known in the
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
art, see for example (Sambrook et al., ibid.; Ausubel et
al., ibid.; Berger and Kimmel, ibid. and Wetmur, ibid.)
and are specific for DNA, RNA and DNA-RNA hybrids and
polynucleotide probe sequences of varying length.
5 Sequence analysis software such as Oligo 4.0 (publicly
available shareware) and Primer Premier (PREMIER Biosoft
International, Palo Alto, CA) as well as sites on the
Internet, are available tools for analyzing a given
sequence and calculating Tm based on user defined criteria.
10 Such programs can also analyze a given sequence under
defined conditions and suggest suitable probe sequences.
Typically, hybridization of longer polynucleotide
sequences, >50 bp, is done at temperatures of about 20-
25oC below the calculated Tm. For smaller probes, <50 bp,
15 hybridization is typically carried out at the Tm or 5-lOoC
below. This allows for the maximum rate of hybridization
for DNA-DNA and DNA-RNA hybrids.
The length of the polynucleotide sequence
influences the rate and stability of hybrid formation.
20 Smaller probe sequences, <50 bp, come to equilibrium with
complementary sequences rapidly, but may form less stable
hybrids. Incubation times of anywhere from minutes to
hours can be used to achieve hybrid formation. Longer
probe sequences come to. equilibrium more slowly, but form
25 more stable complexes even at lower temperatures.
Incubations are allowed to proceed overnight or longer.
Generally, incubations are carried out for a period equal
to three times the calculated Cot time. Cot time, the
time it takes for the polynucleotide sequences to
30 reassociate, can be calculated for a particular sequence
by methods known in the art.
The base pair composition of polynucleotide
sequence will effect the thermal stability of the hybrid
complex, thereby influencing the choice of hybridization
35 temperature and the ionic strength of the hybridization
buffer. A-T pairs are less stable than G-C pairs in
aqueous solutions containing NaCl. Therefore, the higher
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
41
the G-C content, the more stable the hybrid. Even
distribution of G and C residues within the sequence also
contribute positively to hybrid stability. Base pair
composition can be manipulated to alter the Tm of a given
sequence, for example, 5-methyldeoxycytidine can be
substituted for deoxycytidine and 5-bromodeoxuridine can
be substituted for thymidine to increase the Tm. 7-deazo-
2'-deoxyguanosine can be substituted for guanosine to
reduce dependence on Tm.
Ionic concentration of the hybridization buffer
also effects the stability of the hybrid. Hybridization
buffers generally contain blocking agents such as
Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.),
denatured salmon sperm DNA, tRNA, milk powders (BLOTTO),
heparin or SDS, and a Na' source, such as SSC (1X SSC: 0.15
M NaCl, 15 mM sodium citrate) or SSPE (1X SSPE: 1.8 M
NaCl, 10 mM NaH2P04, 1 mM EDTA, pH 7.7). By decreasing the
ionic concentration of the buffer, the stability of the
hybrid is increased. Typically, hybridization buffers
contain from between 10 mM-1 M Na+. Premixed hybridization
solutions are also available from commercial sources such
as Clontech Laboratories (Palo Alto, CA) and Promega
Corporation (Madison, WI) for use according to
manufacturer's instruction. Addition of destabilizing or
denaturing agents such as formamide, tetralkylammonium
salts, guanidinium cations or thiocyanate cations to the
hybridization solution will alter the Tm of a hybrid.
Typically, formamide is used at a concentration of up to
50% to allow incubations to be carried out at more
convenient and lower temperatures. Formamide also acts to
reduce non-specific background when using RNA probes.
As previously noted, the isolated zsig49
polynucleotides of the present invention include DNA and
RNA. Methods for isolating DNA and RNA are well known in
the art. It is generally preferred to isolate RNA from
lymph node, although DNA can also be prepared using RNA
from other tissues or isolated as genomic DNA. Total RNA
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
42
can be prepared using guanidine HCl extraction followed by
isolation by centrifugation in a CsCl gradient (Chirgwin
et al., Biochemistry 18:52-94, 1979). Poly(A)+ RNA is
prepared from total RNA using the method of Aviv and Leder
(Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
Complementary DNA (cDNA) is prepared from poly(A)+ RNA
using known methods. Polynucleotides encoding zsig49
polypeptides are then identified and isolated by, for
example, hybridization or PCR.
The polynucleotides of the present invention can
also be synthesized using automated equipment. The
current method of choice is the phosphoramidite method.
If chemically synthesized double stranded DNA is required
for an application such as the synthesis of a gene or a
gene fragment, then each complementary strand is made
separately. The production of short genes (60 to 80 bp)
is technically straightforward and can be accomplished by
synthesizing the complementary strands and then annealing
them. For the production of longer genes (>300 bp),
however, special strategies must be invoked, because the
coupling efficiency of each cycle during chemical DNA
synthesis is seldom 1000. To overcome this problem,
synthetic genes (double-stranded) are assembled in modular
form from single-stranded fragments that are from 20 to
100 nucleotides in length. Gene synthesis methods are
well known in the art. See, for example, Glick and
Pasternak, Molecular Biotechnology, Principles &
Applications of Recombinant DNA, ASM Press, Washington,
D.C., 1994; Itakura et al., Annu. Rev. Biochem. 53: 323-
56, 1984; and Climie et al., Proc. Natl. Acad. Sci. USA
87:633-7, 1990.
The present invention further provides
counterpart polypeptides and polynucleotides from other
species (orthologs). These orthologous polynucleotides
can be used, inter alia, to prepare the respective
orthologous proteins. These species include, but are not
limited to mammalian, avian, amphibian, reptile, fish,
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
43
insect and other vertebrate and invertebrate species. Of
particular interest are zsig49 orthologs from other
mammalian species, including murine, porcine, ovine,
bovine, canine, feline, equine and other primate proteins.
Orthologs of the human proteins can be cloned using
information and compositions provided by the present
invention in combination with conventional cloning
techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses the
protein. Suitable sources of mRNA can be identified by
probing Northern blots with probes designed from the
sequences disclosed herein. A library is then prepared
from mRNA of a positive tissue or cell line. A zsig49
polypeptide-encoding cDNA can then be isolated by a
variety of methods, such as by probing with a complete or
partial human cDNA or with one or more sets of degenerate
probes based on the disclosed sequences. A cDNA can also
be cloned using the polymerase chain reaction, or PCR
(Mullis, U.S. Patent 4,683,202), using primers designed
from the sequences disclosed herein. Within an additional
method, the cDNA library can be used to transform or
transfect host cells, and expression of the cDNA of
interest can be detected with an antibody to zsig49.
Similar techniques can also be applied to the isolation of
genomic clones.
Those skilled in the art will recognize that the
sequences disclosed in SEQ ID NOs:l, 9 and 12 and SEQ ID
NOs:2, 10 and 13 represent a single allele of the human
zsig49 gene and polypeptide and a single allele of the
murine zsig49 gene and polypeptide, and that allelic
variation and alternative splicing are expected to occur.
In addition, allelic variants can be cloned by probing
cDNA or genomic libraries from different individuals
according to standard procedures. Allelic variants of the
DNA sequences shown in SEQ ID NOs:l, 9 and 12, including
those containing silent mutations and those in which
mutations result in amino acid sequence changes, are
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
44
within the scope of the present invention, as are proteins
which are allelic variants of SEQ ID NOs:2, 10 and 13.
cDNAs generated from alternatively spliced mRNAs, which
retain the properties of the zsig49 polypeptide are
included within the scope of the present invention, as are
polypeptides encoded by such cDNAs and mRNAs. Allelic
variants and splice variants of these sequences can be
cloned by probing cDNA or genomic libraries from different
individuals or tissues according to standard procedures
known in the art.
The present invention also provides isolated
zsig49 polypeptides that are substantially homologous to
the polypeptides of SEQ ID NOs:2, 10 and 13 and their
species homologs/orthologs. The term "substantially
homologous" is used herein to denote polypeptides having
500, preferably 60%, more preferably at least 800,
sequence identity to the sequences shown in SEQ ID NOs:2,
10 and 13 or their orthologs. Such polypeptides will more
preferably be at least 90o identical, and most preferably
950 or more identical to SEQ ID NOs:2, 10 and 13 or their
orthologs. Percent sequence identity is determined by
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
Briefly, two amino acid sequences are aligned to optimize
the alignment scores using a gap opening penalty of 10, a
gap extension penalty of 1, and the "blosum 62" scoring
matrix of Henikoff and Henikoff (ibid.) as shown in Table
3 (amino acids are indicated by the standard one-letter
codes). The percent identity is then calculated as:
Total number of identical matches
x 100
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences]
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
rl N M
r~ I
[-i tIlN N O
I I
Uj d~ rlM N N
I I
p.l C~rl v--Id' M N
I I I I I
[t., l0 ~ N N H M rl
I I I I
LflO N rl rlrl rl~-i
I I I I I
,.'l, LIlriM rlO r~M N N
I I I I I I I
r.~ d~N N O M N rlN v-1H
M I I I I I t
H '~ N M rlO M N rlM rlM
I I I I I I
,T, 00M M ri N rl N rl N N N M
E'I I I I I I I I I I I
l0 N d' d'N M M N O N N M M
I I I I 1 I I i I I I
W L(1N O M M rl N M t-IO rlM N N
I I I I I I I I I I
Qf LI1N N O M N rl O M rlO rlN rlN
I I I I I I I I i
U O1 M ~ M M r-~rlM rlN M rl rlN N rl
I I I I I I I I I i I I I I I
l0 M O N rW -IM dif-IM M rlO rld~ M M
I I I 1 I 1 I i I I I I I
"Z, l0H M O O O rlM M O N M N r--IO ~ N M
i I I I I I I I I
(Y, LIlO N M rlO N O M N N rlM N rl rlM N M
I I I I I I I I I I I I I
FC, dirl N N O H rlO N r-IrlH rlN rlr-IO M N O
I I I I I I I I I I I I I I
rx z a v a w ~ x H a x ~ C~.~w cn H 3
In o m o
rl c-I N
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
46
Sequence identity of polynucleotide molecules is
determined by similar methods using a ratio as disclosed
above.
Those skilled in the art appreciate that there
are many established algorithms available to align two
amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein
alignment method for examining the level of identity
shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative variant zsig49. The
FASTA algorithm is described by Pearson and Lipman, Proc.
Nat. Acad. Sci. USA 85:2444, 1988, and by Pearson, Meth.
Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence
similarity by identifying regions shared by the query
sequence (e. g., SEQ ID NOs:2, 10 or 13) and a test
sequence that have either the highest density of
identities (if the ktup variable is 1) or pairs of
identities (if ktup=2), without considering conservative
amino acid substitutions, insertions, or deletions. The
ten regions with the highest density of identities are
then rescored by comparing the similarity of all paired
amino acids using an amino acid substitution matrix, and
the ends of the regions are "trimmed" to include only
those residues that contribute to the highest score. If
there are several regions with scores greater than the
"cutoff" value (calculated by a predetermined formula
based upon the length of the sequence and the ktup value),
then the trimmed initial regions are examined to determine
whether the regions can be joined to form an approximate
alignment with gaps. Finally, the highest scoring regions
of the two amino acid sequences are aligned using a
modification of the Needleman-Wunsch-Sellers algorithm
(Needleman and Wunsch, J. Mol. Biol. 48:444, 1970);
Sellers, SIAM J. Appl. Math. 26:787, 1974), which allows
for amino acid insertions and deletions. Preferred
parameters for FASTA analysis are: ktup=l, gap opening
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
47
penalty=10, gap extension penalty=1, and substitution
matrix=BLOSUM62. These parameters can be introduced into
a FASTA program by modifying the scoring matrix file
(~~SMATRIX") , as explained in Appendix 2 of Pearson, Meth.
Enzymol. 183:63, 1990.
FASTA can also be used to determine the sequence
identity of nucleic acid molecules using a ratio as
disclosed above. For nucleotide sequence comparisons, the
ktup value can range between one to six, preferably from
three to six, most preferably three, with other parameters
set as default.
The present invention includes nucleic acid
molecules that encode a polypeptide having one or more
conservative amino acid changes, compared with the amino
acid sequences of SEQ ID NOs:2, 10 or 13. The BLOSUM62
table is an amino acid substitution matrix derived from
about 2,000 local multiple alignments of protein sequence
segments, representing highly conserved regions of more
than 500 groups of related proteins (Henikoff and
Henikoff, Proc. Nat. Acad. Sci. USA 89:10915, 1992).
Accordingly, the BLOSUM62 substitution frequencies can be
used to define conservative amino acid substitutions that
may be introduced into the amino acid sequences of the
present invention. As used herein, the language
"conservative amino acid substitution" refers to a
substitution represented by a BLOSUM62 value of greater
than -1. For example, an amino acid substitution is
conservative if the substitution is characterized by a
BLOSUM62 value of 0, 1, 2, or 3. Preferred conservative
amino acid substitutions are characterized by a BLOSUM62
value of at least 1 (e. g., l, 2 or 3), while more
preferred conservative amino acid substitutions are
characterized by a BLOSUM62 value of at least 2 (e.g., 2
or 3 ) .
Substantially homologous proteins and
polypeptides are characterized as having one or more amino
acid substitutions, deletions or additions. These changes
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
48
are preferably of a minor nature, that is conservative
amino acid substitutions (see Table 4) and other
substitutions that do not significantly affect the folding
or activity of the protein or polypeptide; small
deletions, typically of one to about 30 amino acids; and
small amino- or carboxyl-terminal extensions, such as an
amino-terminal methionine residue, a small linker peptide
of up to about 20-25 residues or an affinity tag.
Polypeptides comprising affinity tags can further comprise
a proteolytic cleavage site between the zsig49 polypeptide
and the affinity tag. Preferred such sites include
thrombin cleavage sites and factor Xa cleavage sites.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
49
Table 4
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
The proteins of the present invention can also
comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without
limitation, trans-3-methylproline, 2,4-methanoproline,
cis-4-hydroxyproline, trans-4-hydroxyproline, N-methyl-
glycine, alto-threonine, methylthreonine, hydroxyethyl-
cysteine, hydroxyethylhomocysteine, nitroglutamine, homo-
glutamine, pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, 3,3-dimethyl-
proline, tert-leucine, norvaline, 2-azaphenyl-alanine, 3-
azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenyl-
alanine. Several methods are known in the art for
incorporating non-naturally occurring amino acid residues
into proteins. For example, an in vitro system can be
employed wherein nonsense mutations are suppressed using
chemically aminoacylated suppressor tRNAs. Methods for
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
synthesizing amino acids and aminoacylating tRNA are known
in the art. Transcription and translation of plasmids
containing nonsense mutations is carried out in a cell-
free system comprising an E. coli S30 extract and
5 commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for
example, Robertson et al., J. Am. Chem. Soc. 113:2722,
1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung
et al., Science 259:806-9, 1993; and Chung et al., Proc.
10 Natl. Acad. Sci. USA 90:10145-9, 1993). In a second
method, translation is carried out in Xenopus oocytes by
microinjection of mutated mRNA and chemically
aminoacylated suppressor tRNAs (Turcatti et al., J. Biol.
Chem. 271:19991-8, 1996). Within a third method, E. coli
15 cells are cultured in the absence of a natural amino acid
that is to be replaced (e.g., phenylalanine) and in the
presence of the desired non-naturally occurring amino
acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-
azaphenylalanine, or 4-fluorophenylalanine). The non-
20 naturally occurring amino acid is incorporated into the
protein in place of its natural counterpart. See, Koide
et al., Biochem. 33:7470-6, 1994. Naturally occurring
amino acid residues can be converted to non-naturally
occurring species by in vitro chemical modification.
25 Chemical modification can be combined with site-directed
mutagenesis to further expand the range of substitutions
(Wynn and Richards, Protein Sci. 2:395-403, 1993).
A limited number of non-conservative amino
acids, amino acids that are not encoded by the genetic
30 code, non-naturally occurring amino acids, and unnatural
amino acids may be substituted for zsig49 amino acid
residues.
Essential amino acids in the zsig49 polypeptides
of the present invention can be identified according to
35 procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham
and Wells, Science 244: 1081-5, 1989). In the latter
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
51
technique, single alanine mutations are introduced at
every residue in the molecule, and the resultant mutant
molecules are tested for biological activity (e. g.,
adhesion-modulation, differentiation-modulation or the
like) to identify amino acid residues that are critical to
the activity of the molecule. See also, Hilton et al., J.
Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor
or other biological interaction can also be determined by
physical analysis of structure, as determined by such
techniques as nuclear magnetic resonance, crystallography,
electron diffraction or photoaffinity labeling, in
conjunction with mutation of putative contact site amino
acids. See, for example, de Vos et al., Science 255:306-
12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992;
Wlodaver et al., FEBS Lett. 309:59-64, 1992.
Multiple amino acid substitutions can be made
and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc.
Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these
authors disclose methods for simultaneously randomizing
two or more positions in a polypeptide, selecting for
functional polypeptide, and then sequencing the
mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Patent
No. 5,223,409; Huse, WIPO Publication WO 92/06204) and
region-directed mutagenesis (Derbyshire et al., Gene
46:145, 1986; Ner et al., DNA 7:127, 1988).
Variants of the disclosed zsig49 DNA and
polypeptide sequences can be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389-91,
1994, Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51,
1994 and WIPO Publication WO 97/20078. Briefly, variant
DNAs are generated by in vitro homologous recombination by
random fragmentation of a parent DNA followed by
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
52
reassembly using PCR, resulting in randomly introduced
point mutations. This technique can be modified by using
a family of parent DNAs, such as allelic variants or DNAs
from different species, to introduce additional
variability into the process. Selection or screening for
the desired activity, followed by additional iterations of
mutagenesis and assay provides for rapid "evolution" of
sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed above can be
combined with high-throughput, automated screening methods
to detect activity of cloned, mutagenized polypeptides in
host cells. Mutagenized DNA molecules that encode active
polypeptides (e. g., receptor binding) can be recovered
from the host cells and rapidly sequenced using modern
equipment. These methods allow the rapid determination of
the importance of individual amino acid residues in a
polypeptide of interest, and can be applied to
polypeptides of unknown structure.
Polypeptides of the present invention comprise
at least 15 contiguous amino acid residues of SEQ ID
NOs:2, 10 or 13. Within certain embodiments of the
invention, the polypeptides comprise 20, 30, 40, 50 or
more contiguous residues of SEQ ID NOs:2, 10 or 13, up to
the entire predicted mature polypeptides (residues 34-467
of SEQ ID NO:10 or residues 28-461 of SEQ ID N0:13) or
residues 34-77 of SEQ ID N0:2, or the primary translation
products (residues 1 to 461 of SEQ ID N0:10 or residues 1
to 461 of SEQ ID NO : 13 ) or residues 1-77 of SEQ ID N0: 2 .
As disclosed in more detail below, these polypeptides can
further comprise additional, non-zsig49, polypeptide
sequence(s). Such fragments or peptides may comprise an
"immunogenic epitope," which is a part of a protein that
elicits an antibody response when the entire protein is
used as an immunogen. Immunogenic epitope-bearing
peptides can be identified using standard methods (see,
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
53
for example, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998, 1983).
In contrast, polypeptide fragments or peptides
may comprise an "antigenic epitope," which is a region of
a protein molecule to which an antibody can specifically
bind. Certain epitopes consist of a linear or contiguous
stretch of amino acids, and the antigenicity of such an
epitope is not disrupted by denaturing agents. It is known
in the art that relatively short synthetic peptides that
can mimic epitopes of a protein can be used to stimulate
the production of antibodies against the protein (see, for
example, Sutcliffe et al., Science 219:660, 1983).
Accordingly, antigenic epitope-bearing peptides and
polypeptides of the present invention are useful to raise
antibodies that bind with the polypeptides described
herein.
Such epitope-bearing peptides and polypeptides
can be produced by fragmenting a zsig49 polypeptide, or by
chemical peptide synthesis, as described herein.
Moreover, epitopes can be selected by phage display of
random peptide libraries (see, for example, Lane and
Stephen, Curr. Opin. Immunol. 5:268, 1993), and Cortese et
al., Curr. Opin. Biotechnol. 7:616, 1996). Standard
methods for identifying epitopes and producing antibodies
from small peptides that comprise an epitope are
described, for example, by Mole, "Epitope Mapping," in
Methods in Molecular Bioloay, Vol. 10, Manson (ed.), pages
105-116 (The Humana Press, Inc. 1992), Price, "Production
and Characterization of Synthetic Peptide-Derived
Antibodies," in Monoclonal Antibodies: Production,
Enaineerina, and Clinical Application, Ritter and Ladyman
(eds.), pages 60-84 (Cambridge University Press 1995), and
Coligan et al. (eds.), Current Protocols in Immunoloay,
pages 9.3.1 - 9.3.5 and pages 9.4.1 - 9.4.11 (John Wiley &
Sons 1997).
Antibodies that recognize short, linear epitopes
are particularly useful in analytic and diagnostic
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
54
applications that employ denatured protein, such as
Western blotting (Tobin, Proc. Natl. Acad. Sci. USA
76:4350-6, 1979), or in the analysis of fixed cells or
tissue samples. Antibodies to linear epitopes are also
useful for detecting fragments of zsig49, such as might
occur in body fluids or cell culture media.
For any zsig49 polypeptide, including variants
and fusion proteins, one of ordinary skill in the art can
readily generate a fully degenerate polynucleotide
sequence encoding that variant using the information set
forth in Tables 1 and 2 above. Moreover, those of skill
in the art can use standard software to devise zsig49
variants based upon the nucleotide and amino acid
sequences described herein. Accordingly, the present
invention includes a computer-readable medium encoded with
a data structure that provides at least one of the
following sequences: SEQ ID NO:1, SEQ ID N0:2, SEQ ID
N0:4, SEQ ID N0:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
N0:12, SEQ ID N0:13 or SEQ ID N0:14. Suitable forms of
computer-readable media include magnetic media and
optically-readable media. Examples of magnetic media
include a hard or fixed drive, a random access memory
(RAM) chip, a floppy disk, digital linear tape (DLT), a
disk cache, and a ZIP disk. Optically readable media are
exemplified by compact discs (e. g., CD-read only memory
(ROM), CD-rewritable (RW), and CD-recordable), and digital
versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and
DVD+RW ) .
Using the methods discussed above, one of
ordinary skill in the art can identify and/or prepare a
variety of polypeptides that are substantially homologous
to residues 34 to 77 of SEQ ID N0:2, residues 34 to 467 of
SEQ ID NO:10, residues 28 to 461 of SEQ ID N0:13 or
allelic variants thereof and retain the properties of
wild-type protein. Such polypeptides may include
additional amino acids, such as affinity tags and the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
like. Such polypeptides may also include additional
polypeptide segments as generally disclosed herein.
The polypeptides of the present invention,
including full-length proteins, fragments thereof and
5 fusion proteins, can be produced in genetically engineered
host cells according to conventional techniques. Suitable
host cells are those cell types that can be transformed or
transfected with exogenous DNA and grown in culture, and
include bacteria, fungal cells, and cultured higher
10 eukaryotic cells. Eukaryotic cells, particularly cultured
cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are
disclosed by Sambrook et al., Molecular Cloning: A
15 Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY, 1989, and Ausubel et al.
(eds.), Current Protocols in Molecular Bioloay, John Wiley
and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zsig49
20 polypeptide of the present invention is operably linked to
other genetic elements required for its expression,
generally including a transcription promoter and
terminator within an expression vector. The vector will
also commonly contain one or more selectable markers and
25 one or more origins of replication, although those skilled
in the art will recognize that within certain systems
selectable markers may be provided on separate vectors,
and replication of the exogenous DNA may be provided by
integration into the host cell genome. Selection of
30 promoters, terminators, selectable markers, vectors and
other elements is a matter of routine design within the
level of ordinary skill in the art. Many such elements
are described in the literature and are available through
commercial suppliers.
35 To direct a zsig49 polypeptide into the
secretory pathway of a host cell, a secretory signal
sequence (also known as a leader sequence, prepro sequence
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
56
or pre sequence) is provided in the expression vector.
The secretory signal sequence may be that of the zsig49
polypeptide, or may be derived from another secreted
protein (e.g., t-PA) or synthesized de novo. The
secretory signal sequence is joined to the zsig49 DNA
sequence in the correct reading frame and positioned to
direct newly synthesized polypeptide into secretory
pathways to host cell. Secretory signal sequences are
commonly positioned 5' to the DNA sequence encoding the
polypeptide of interest, although certain secretory signal
sequences may be positioned elsewhere in the DNA sequence
of interest (see, e.g., Welch et al., U.S. Patent No.
5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence
contained in the polypeptides of the present invention is
used to direct other polypeptides into the secretory
pathway. The present invention provides for such fusion
polypeptides. A signal fusion polypeptide can be made
wherein a secretory signal sequence derived from amino
acid residues 1-33 of SEQ ID N0:2 or residues 1-33 of SEQ
ID N0:10 is be operably linked to another polypeptide
using methods known in the art and disclosed herein. The
secretory signal sequence contained in the fusion
polypeptides of the present invention is preferably fused
amino-terminally to an additional peptide to direct the
additional peptide into the secretory pathway. Such
constructs have numerous applications known in the art.
For example, these novel secretory signal sequence fusion
constructs can direct the secretion of an active component
of a normally non-secreted protein. Such fusions may be
used in vivo or in vitro to direct peptides through the
secretory pathway.
Cultured mammalian cells are suitable hosts
within the present invention. Methods for introducing
exogenous DNA into mammalian host cells include calcium
phosphate-mediated transfection (Wigler et al., Cell
14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
57
7:603, 1981: Graham and Van der Eb, Viroloay 52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-845,
1982), DEAF-dextran mediated transfection (Ausubel et al.,
eds., Current Protocols in Molecular Bioloay, John Wiley
and Sons, Inc., NY, 1987), liposome-mediated transfection
(Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et
al., Focus 15:80, 1993), and viral vectors (Miller and
Rosman, BioTechniques 7:980-90, 1989; Wang and Finer,
Nature Med. 2:714-16, 1996). The production of
recombinant polypeptides in cultured mammalian cells is
disclosed, for example, by Levinson et al., U.S. Patent
No. 4,713,339; Hagen et al., U.S. Patent No. 4,784,950;
Palmiter et al., U.S. Patent No. 4,579,821; and Ringold,
U.S. Patent No. 4,656,134. Suitable cultured mammalian
cells include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC
No. CRL 1651), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No.
CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977)
and Chinese hamster ovary (e.g. CHO-K1; ATCC No. CCL 61)
cell lines. Additional suitable cell lines are known in
the art and available from public depositories such as the
American Type Culture Collection, Rockville, Maryland. In
general, strong transcription promoters are preferred,
such as promoters from SV-40 or cytomegalovirus. See,
e.g., U.S. Patent No. 4,956,288. Other suitable promoters
include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late
promoter.
If the zsig49 polypeptide is expressed in a non-
endocrine or non-neuroendocrine cell, the expression host
cell generally will not express the prohormone convertases
PC2 and PC3, which are believed to be involved in the
regulated secretory pathway. Another member of this
endoprotease family, furin, is present in most cells and
is believed to be involved in the constitutive secretory
pathway. Vollenweider et al. (Diabetes 44:1075-80, 1995)
have described the role of these prohormone conversion
endoproteases in general, and specifically describe
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
58
studies involving co-transfection of COS cells with
proinsulin and one of the endoproteases. Their results
showed that PC3 and furin were able to cleave proinsulin
at both its junctions; PC2 did not exhibit prohormone
cleavage to any significant extent. Without co-
transfection of an endoprotease, the prohormone was not
converted to any great extent by COS cells. However, the
co-transfection system described is still not an exact
model of the natural ~3 cell environment, since (3 cells
make both PC2 and PC3. Also, a non-endocrine cell does
not represent a native environment for PC2 and PC3
expression. In addition, co-transfection may result in
general or local overexpression of PC2 and/or PC3,
relative to the native (3 cell environment. In a preferred
embodiment, the host cells will be co-transfected with a
second DNA expression construct comprising the following
operably linked elements: a transcription promoter; a DNA
segment encoding an endoprotease; and a transcription
terminator, wherein the host cell expresses the DNA
segment encoding the endoprotease.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the
gene of interest to their progeny are referred to as
"stable transfectants." A preferred selectable marker is
a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-
type drug, such as G-418 or the like. Selection systems
may also be used to increase the expression level of the
gene of interest, a process referred to as
"amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of
selective agent to select for cells that produce high
levels of the products of the introduced genes. A
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
59
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g., hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can
also be used. Alternative markers that introduce an
altered phenotype, such as green fluorescent protein, or
cell surface proteins such as CD4, CD8, Class I MHC,
placental alkaline phosphatase may be used to sort
transfected cells from untransfected cells by such means
as FACS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used
as hosts, including plant cells, insect cells and avian
cells. The use of Agrobacterium rhizogenes as a vector
for expressing genes in plant cells has been reviewed by
Sinkar et al., J. Biosci. (Banaalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign
polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and V~IIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus,
commonly derived from Autographa californica nuclear
polyhedrosis virus (AcNPV). However, pFastBaclTM can be
modified to a considerable degree. The polyhedrin
promoter can be removed and substituted with the
baculovirus basic protein promoter (also known as Pcor,
p6.9 or MP promoter) which is expressed earlier in the
baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins. See, Hill-
Perkins and Possee, J. Gen. Virol. 71:971-6, 1990; Bonning
et al., J. Gen. Virol. 75:1551-6, 1994; and, Chazenbalk
and Rapoport, J. Biol. Chem. 270:1543-9, 1995. In such
transfer vector constructs, a short or long version of the
basic protein promoter can be used. Moreover, transfer
vectors can be constructed which replace the native zsig49
secretory signal sequences with secretory signal sequences
derived from insect proteins. For example, a secretory
signal sequence from Ecdysteroid Glucosyltransferase
(EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
baculovirus gp67 (PharMingen, San Diego, CA) can be used
in constructs to replace the native zsig49 secretory
signal sequence. DNA encoding the zsig49 polypeptide is
inserted into the baculoviral genome in place of the AcNPV
5 polyhedrin gene coding sequence by one of two methods.
The first is the traditional method of homologous DNA
recombination between wild-type AcNPV and a transfer
vector containing the zsig49 flanked by AcNPV sequences.
Suitable insect cells, e.g. 5F9 cells, are infected with
10 wild-type AcNPV and transfected with a transfer vector
comprising a zsig49 polynucleotide operably linked to an
AcNPV polyhedrin gene promoter, terminator, and flanking
sequences. See, King and Possee, The Baculovirus
Expression System: A Laboratory Guide, London, Chapman &
15 Hall; O'Reilly et al., Baculovirus Expression Vectors: A
Laboratorv Manual, New York, Oxford University Press.,
1994; and, Richardson, Ed., Baculovirus Expression
Protocols. Methods in Molecular Bioloay, Totowa, NJ,
Humana Press, 1995. Natural recombination within an
20 insect cell will result in a recombinant baculovirus which
contains zsig49 driven by the polyhedrin promoter.
Recombinant viral stocks are made by methods commonly used
in the art.
The second method of making recombinant
25 baculovirus utilizes a transposon-based system described
by Luckow (Luckow et al., J. Virol. 67:4566-79, 1993).
This system is sold in the Bac-to-Bac kit (Life
Technologies, Rockville, MD). This system utilizes a
transfer vector, pFastBaclT"" (Life Technologies) containing
30 a Tn7 transposon to move the DNA encoding the zsig49
polypeptide into a baculovirus genome maintained in E.
coli as a large plasmid called a "bacmid." The pFastBaclT""
transfer vector utilizes the AcNPV polyhedrin promoter to
drive the expression of the gene of interest, in this case
35 zsig49. However, pFastBaclT"" can be modified to a
considerable degree. The polyhedrin promoter can be
removed and substituted with the baculovirus basic protein
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
61
promoter (also known as Pcor, p6.9 or MP promoter) which
is expressed earlier in the baculovirus infection, and has
been shown to be advantageous for expressing secreted
proteins. See, Hill-Perkins and Possee, J. Gen. Virol.
71:971-6, 1990; Bonning et al., J. Gen. Virol. 75:1551-6,
1994; and, Chazenbalk, G.D., and Rapoport, J. Biol. Chem.
270:1543-9, 1995. In such transfer vector constructs, a
short or long version of the basic protein promoter can be
used. Moreover, transfer vectors can be constructed which
replace the native zsig49 secretory signal sequences with
secretory signal sequences derived from insect proteins.
For example, a secretory signal sequence from Ecdysteroid
Glucosyltransferase (EGT), honey bee Melittin (Invitrogen,
Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego,
CA) can be used in constructs to replace the native
secretory signal sequence. In addition, transfer vectors
can include an in-frame fusion with DNA encoding an
epitope tag at the C- or N-terminus of the expressed
zsig49 polypeptide, for example, a Glu-Glu epitope tag
(Grussenmeyer et al., ibid.). Using a technique known in
the art, a transfer vector containing zsig49 is
transformed into E. coli, and screened for bacmids which
contain an interrupted lacZ gene indicative of recombinant
baculovirus. The bacmid DNA containing the recombinant
baculovirus genome is isolated, using common techniques,
and used to transfect Spodoptera frugiperda cells, e.g.
Sf9 cells. Recombinant virus that expresses zsig49 is
subsequently produced. Recombinant viral stocks are made
by methods commonly used the art.
The recombinant virus is used to infect host
cells, typically a cell line derived from the fall
armyworm, Spodoptera frugiperda. See, in general, Glick
and Pasternak, Molecular Biotechnoloay: Principles and
Applications of Recombinant DNA, ASM Press, Washington,
D.C., 1994. Another suitable cell line is the High FiveOT"'
cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent $#5,300,435). Commercially available serum-free
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
62
media are used to grow and maintain the cells. Suitable
media are Sf900 IIT"" (Life Technologies) or ESF 921T""
(Expression Systems) for the Sf9 cells; and Ex-ce110405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life
Technologies) for the T. ni cells. The cells are grown up
from an inoculation density of approximately 2-5 x 105
cells to a density of 1-2 x 106 cells at which time a
recombinant viral stock is added at a multiplicity of
infection (MOI) of 0.1 to 10, more typically near 3. The
recombinant virus-infected cells typically produce the
recombinant zsig49 polypeptide at 12-72 hours post-
infection and secrete it with varying efficiency into the
medium. The culture is usually harvested 48 hours post-
infection. Centrifugation is used to separate the cells
from the medium (supernatant). The supernatant containing
the zsig49 polypeptide is filtered through micropore
filters, usually 0.45 ~,m pore size. Procedures used are
generally described in available laboratory manuals (King
and Possee, ibid.; O'Reilly et al., ibid.; Richardson, C.
D., ibid.). Subsequent purification of the zsig49
polypeptide from the supernatant can be achieved using
methods described herein.
Fungal cells, including yeast cells, can also be
used within the present invention. Yeast species of
particular interest in this regard include Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica.
Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al.,
U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent
No. 4,845,075. Transformed cells are selected by
phenotype determined by the selectable marker, commonly
drug resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POTI
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
63
vector system disclosed by Kawasaki et al. (U. S. Patent
No. 4,931,373), which allows transformed cells to be
selected by growth in glucose-containing media. Suitable
promoters and terminators for use in yeast include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
4,615,974; and Bitter, U.S. Patent No. 4,977,092) and
alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe,
Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells may be utilized according to the methods
of McKnight et al., U.S. Patent No. 4,935,349. Methods
for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
For example, the use of Pichia methanolica as
host for the production of recombinant proteins is
disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond,
U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23,
1998, and in international publication Nos. WO 97/17450,
WO 97/17451, WO 98/02536, and WO 98/02565. DNA molecules
for use in transforming P. methanolica will commonly be
prepared as double-stranded, circular plasmids, which are
preferably linearized prior to transformation. For
polypeptide production in P. methanolica, it is preferred
that the promoter and terminator in the plasmid be that of
a P. methanolica gene, such as a P. methanolica alcohol
utilization gene (AUG1 or AUG2). Other useful promoters
include those of the dihydroxyacetone synthase (DHAS),
formate dehydrogenase (FMD), and catalase (CAT) genes. To
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
64
facilitate integration of the DNA into the host
chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which
encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21) , which allows ade2 host cells to grow in the
absence of adenine. For large-scale, industrial processes
where it is desirable to minimize the use of methanol, it
is preferred to use host cells in which both methanol
utilization genes (AUG1 and AUG2) are deleted. For
production of secreted proteins, host cells deficient in
vacuolar protease genes (PEP4 and PRB1) are preferred.
Electroporation is used to facilitate the introduction of
a plasmid containing DNA encoding a polypeptide of
interest into P. methanolica cells. It is preferred to
transform P. methanolica cells by electroporation using
an exponentially decaying, pulsed electric field having a
field strength of from 2.5 to 4.5 kV/cm, preferably about
3.75 kV/cm, and a time constant (i) of from 1 to 40
milliseconds, most preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the
bacteria Escherichia coli, Bacillus and other genera are
also useful host cells within the present invention.
Techniques for transforming these hosts and expressing
foreign DNA sequences cloned therein are well known in the
art (see, e.g., Sambrook et al., ibid.). When expressing
a zsig49 polypeptide in bacteria such as E. coli, the
polypeptide may be retained in the cytoplasm, typically as
insoluble granules, or may be directed to the periplasmic
space by a bacterial secretion sequence. In the former
case, the cells are lysed, and the granules are recovered
and denatured using, for example, guanidine isothiocyanate
or urea. The denatured polypeptide can then be refolded
and dimerized by diluting the denaturant, such as by
dialysis against a solution of urea and a combination of
reduced and oxidized glutathione, followed by dialysis
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
against a buffered saline solution. In the latter case,
the polypeptide can be recovered from the periplasmic
space in a soluble and functional form by disrupting the
cells (by, for example, sonication or osmotic shock) to
5 release the contents of the periplasmic space and
recovering the protein, thereby obviating the need for
denaturation and refolding.
The adenovirus system can also be used for
protein production in vitro. By culturing adenovirus
10 infected non-293 cells under conditions where the cells
are not rapidly dividing, the cells can produce proteins
for extended periods of time. For instance, BHK cells are
grown to confluence in cell factories, then exposed to the
adenoviral vector encoding the secreted protein of
15 interest. The cells are then grown under serum-free
conditions, which allows infected cells to survive for
several weeks without significant cell division.
Alternatively, adenovirus vector infected 293 cells can be
grown as adherent cells or in suspension culture at
20 relatively high cell density to produce significant
amounts of protein (see Gamier et al., Cytotechnol.
15:145-55, 1994). With either protocol, an expressed,
secreted heterologous protein can be repeatedly isolated
from the cell culture supernatant. Within the infected
25 293 cell production protocol, non-secreted proteins may
also be effectively obtained.
Transformed or transfected host cells are
cultured according to conventional procedures in a culture
medium containing nutrients and other components required
30 for the growth of the chosen host cells. A variety of
suitable media, including defined media and complex media,
are known in the art and generally include a carbon
source, a nitrogen source, essential amino acids, vitamins
and minerals. Media may also contain such components as
35 growth factors or serum, as required. The growth medium
will generally select for cells containing the exogenously
added DNA by, for example, drug selection or deficiency in
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
66
an essential nutrient which is complemented by the
selectable marker carried on the expression vector or co-
transfected into the host cell. P. methanolica cells are
cultured in a medium comprising adequate sources of
carbon, nitrogen and trace nutrients at a temperature of
about 25°C to 35°C. Liquid cultures are provided with
sufficient aeration by conventional means, such as shaking
of small flasks or sparging of fermentors. A preferred
culture medium for P. methanalica is YEPD (2% D-glucose,
2o BactoTM Peptone (Difco Laboratories, Detroit, MI), 1%
BactoTM yeast extract (Difco Laboratories), 0.004% adenine
and 0.006% L-leucine).
An in vivo approach for assaying proteins of the
present invention involves viral delivery systems.
Exemplary viruses for this purpose include adenovirus,
herpesvirus, vaccinia virus and adeno-associated virus
(AAV). Adenovirus, a double-stranded DNA virus, is
currently the best studied gene transfer vector for
delivery of heterologous nucleic acid (for a review, see
Becker et al., Meth. Cell Biol. 43:161-89, 1994; and
Douglas and Curiel, Science & Medicine 4:44-53, 1997).
The adenovirus system offers several advantages:
adenovirus can (i) accommodate relatively large DNA
inserts; (ii) be grown to high-titer; (iii) infect a broad
range of mammalian cell types; and (iv) be used with a
large number of available vectors containing different
promoters. Also, because adenoviruses are stable in the
bloodstream, they can be administered by intravenous
injection. Some disadvantages (especially for gene
therapy) associated with adenovirus gene delivery include:
(i) very low efficiency integration into the host genome;
(ii) existence in primarily episomal form; and (iii) the
host immune response to the administered virus, precluding
readministration of the adenoviral vector.
By deleting portions of the adenovirus genome,
larger inserts (up to 7 kb) of heterologous DNA can be
accommodated. These inserts can be incorporated into the
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
67
viral DNA by direct ligation or by homologous
recombination with a co-transfected plasmid. In an
exemplary system, the essential E1 gene has been deleted
from the viral vector, and the virus will not replicate
unless the E1 gene is provided by the host cell (the human
293 cell line is exemplary). When intravenously
administered to intact animals, adenovirus primarily
targets the liver. If the adenoviral delivery system has
an E1 gene deletion, the virus cannot replicate in the
host cells. However, the host's tissue (e. g., liver) will
express and process (and, if a secretory signal sequence
is present, secrete) the heterologous protein. Secreted
proteins will enter the circulation in the highly
vascularized liver, and effects on the infected animal can
be determined.
The adenovirus system can also be used for
protein production in vitro. By culturing adenovirus-
infected non-293 cells under conditions where the cells
are not rapidly dividing, the cells can produce proteins
for extended periods of time. For instance, BHK cells are
grown to confluence in cell factories, then exposed to the
adenoviral vector encoding the secreted protein of
interest. The cells are then grown under serum-free
conditions, which allows infected cells to survive for
several weeks without significant cell division.
Alternatively, adenovirus vector infected 2935 cells can
be grown in suspension culture at relatively high cell
density to produce significant amounts of protein (see
Gamier et al., Cytotechnol. 15:145-55, 1994). With
either protocol, an expressed, secreted heterologous
protein can be repeatedly isolated from the cell culture
supernatant. Within the infected 2935 cell production
protocol, non-secreted proteins may also be effectively
obtained.
Zsig49 polypeptides or fragments thereof may
also be prepared through chemical synthesis. Zsig49
polypeptides may be monomers or multimers; glycosylated or
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
68
non-glycosylated; pegylated or non-pegylated; and may or
may not include an initial methionine amino acid residue.
The present invention further provides a variety
of other polypeptide fusions and related multimeric
proteins comprising one or more polypeptide fusions. For
example, a zsig49 polypeptide can be prepared as a fusion
to a dimerizing protein as disclosed in U.S. Patents Nos.
5,155,027 and 5,567,584. Preferred dimerizing proteins in
this regard include immunoglobulin constant region
domains. Immunoglobulin-zsig49 polypeptide fusions can be
expressed in genetically engineered cells to produce a
variety of multimeric zsig49 analogs. Auxiliary domains
can be fused to zsig49 polypeptides to target them to
specific cells, tissues, or macromolecules. For example,
a zsig49 polypeptide or protein could be targeted to a
predetermined cell type by fusing a zsig49 polypeptide to
a ligand that specifically binds to a receptor on the
surface of the target cell. In this way, polypeptides and
proteins can be targeted for therapeutic or diagnostic
purposes. A zsig49 polypeptide can be fused to two or
more moieties, such as an affinity tag for purification
and a targeting domain. Polypeptide fusions can also
comprise one or more cleavage sites, particularly between
domains. See, Tuan et al., Connective Tissue Research
34:1-9, 1996.
Expressed recombinant zsig49 polypeptides (or
chimeric zsig49 polypeptides) can be purified using
fractionation and/or conventional purification methods and
media. Ammonium sulfate precipitation and acid or
chaotrope extraction may be used for fractionation of
samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase
high performance liquid chromatography. Suitable anion
exchange media include derivatized dextrans, agarose,
cellulose, polyacrylamide, specialty silicas, and the
like. DEAE Fast-Flow Sepharose (Pharmacia, Piscataway,
NJ), PEI, DEAE, QAE and Q derivatives are preferred.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
69
Exemplary chromatographic media include those media
derivatized with phenyl, butyl, or octyl groups, such as
Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso
Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia)
and the like; or polyacrylic resins, such as Amberchrom CG
71 (Toro Haas) and the like. Suitable solid supports
include glass beads, silica-based resins, cellulosic
resins, agarose beads, cross-linked agarose beads,
polystyrene beads, cross-linked polyacrylamide resins and
the like that are insoluble under the conditions in which
they are to be used. These supports may be modified with
reactive groups that allow attachment of proteins by amino
groups, carboxyl groups, sulfhydryl groups, hydroxyl
groups and/or carbohydrate moieties. Examples of coupling
chemistries include cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, hydrazide activation, and carboxyl
and amino derivatives for carbodiimide coupling
chemistries. These and other solid media are well known
and widely used in the art, and are available from
commercial suppliers. Methods for binding receptor
polypeptides to support media are well known in the art.
Selection of a particular method is a matter of routine
design and is determined in part by the properties of the
chosen support. See, for example, Affinity
Chromatography: Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The zsig49 polypeptides of the present invention
can be isolated by exploitation of their structural
features. Within one embodiment of the invention are
included a fusion of the polypeptide of interest and an
affinity tag (e. g., polyhistidine, Glu-Glu, FLAG, maltose-
binding protein, an immunoglobulin domain) that may be
constructed to facilitate purification. An exemplary
purification method of protein constructs having an N-
terminal or C-terminal affinity tag produced from
mammalian cells, such as BHK cells, involves using an
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
antibody to the affinity tag epitope to purify the
protein. SDS-PAGE, Western analysis, amino acid analysis
and N-terminal sequencing can be done to the purified
protein to confirm its identity.
5 Protein refolding (and optionally reoxidation)
procedures may be advantageously used. It is preferred to
purify the protein to >80% purity, more preferably to >90%
purity, even more preferably >95%, and particularly
preferred is a pharmaceutically pure state, that is
10 greater than 99.90 pure with respect to contaminating
macromolecules, particularly other proteins and nucleic
acids, and free of infectious and pyrogenic agents.
Preferably, a purified protein is substantially free of
other proteins, particularly other proteins of animal
15 origin.
Proteins/polypeptides which bind zsig49 (such as
a zsig49 binding receptor) can also be used for
purification of zsig49. The zsig49-binding
protein/polypeptide is immobilized on a solid support,
20 such as beads of agarose, cross-linked agarose, glass,
cellulosic resins, silica-based resins, polystyrene,
cross-linked polyacrylamide, or like materials that are
stable under the conditions of use. Methods for linking
polypeptides to solid supports are known in the art, and
25 include amine chemistry, cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, and hydrazide activation. The
resulting medium will generally be configured in the form
of a column, and fluids containing zsig49 polypeptide are
30 passed through the column one or more times to allow
zsig49 polypeptide to bind to the ligand-binding or
receptor polypeptide. The bound zsig49 polypeptide is
then eluted using changes in salt concentration, chaotropic
agents (guanidine HCl), or pH to disrupt ligand-receptor
35 binding.
An assay system that uses a ligand-binding
receptor (or an antibody, one member of a complement/anti-
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
71
complement pair) or a binding fragment thereof, and a
commercially available biosensor instrument (BIAcoreTM,
Pharmacia Biosensor, Piscataway, NJ) may be advantageously
employed. Such receptor, antibody, member of a
complement/anti-complement pair or fragment is immobilized
onto the surface of a receptor chip. Use of this
instrument is disclosed by Karlsson, J. Immunol. Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or
fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold
film within the flow cell. A test sample is passed
through the cell. If a ligand, epitope, or opposite
member of the complement/anti-complement pair is present
in the sample, it will bind to the immobilized receptor,
antibody or member, respectively, causing a change in the
refractive index of the medium, which is detected as a
change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates,
from which binding affinity can be calculated, and
assessment of stoichiometry of binding. As used herein,
the term complement/anti-complement pair denotes non-
identical moieties that form a non-covalently associated,
stable pair under appropriate conditions. For instance,
biotin and avidin (or streptavidin) are prototypical
members of a complement/anti-complement pair. Other
exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
complement/anti-complement pair preferably has a binding
affinity of <109 M 1.
Zsig49 polypeptide and other ligand homologs can
also be used within other assay systems known in the art.
Such systems include Scatchard analysis for determination
of binding affinity (see Scatchard, Ann. NY Acad. Sci. 51:
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
72
660-72, 1949) and calorimetric assays (Cunningham et al.,
Science 253:545-48, 1991; Cunningham et al., Science
245:821-25, 1991).
The activity of zsig49 polypeptides can be
measured by a silicon-based biosensor microphysiometer
which measures the extracellular acidification rate or
proton excretion associated with receptor binding and
subsequent physiologic cellular responses. An exemplary
device is the CytosensorT"" Microphysiometer manufactured by
Molecular Devices, Sunnyvale, CA. A variety of cellular
responses, such as cell proliferation, ion transport,
energy production, inflammatory response, regulatory and
receptor activation, and the like, can be measured by this
method. See, for example, McConnell et al., Science
257:1906-12, 1992; Pitchford et al., Meth. Enzymol.
228:84-108, 1997; Arimilli et al., J. Immunol. Meth.
212:49-59, 1998; Van Liefde et al., Eur. J. Pharmacol.
346:87-95, 1998. The microphysiometer can be used for
assaying adherent or non-adherent eukaryotic or
prokaryotic cells. By measuring extracellular
acidification changes in cell media over time, the
microphysiometer directly measures cellular responses to
various stimuli, including zsig49 polypeptide, its
agonists, or antagonists.
Preferably, the microphysiometer is used to
measure responses of a zsig49-responsive eukaryotic cell,
compared to a control eukaryotic cell that does not
respond to zsig49 polypeptide. Zsig49-responsive
eukaryotic cells comprise cells into which a receptor for
zsig49 has been transfected; or cells naturally responsive
to zsig49 such as cells derived from pancreatic tissue.
Differences, measured by a change, for example, an
increase or diminution in extracellular acidification, in
the response of cells exposed to zsig49 polypeptide,
relative to a control, are a direct measurement of zsig49-
modulated cellular responses. Moreover, such zsig49-
modulated responses can be assayed under a variety of
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
73
stimuli. Using the microphysiometer, there is provided a
method of identifying agonists of zsig49 polypeptide,
comprising providing cells responsive to a zsig49
polypeptide, culturing a first portion of the cells in the
absence of a test compound, culturing a second portion of
the cells in the presence of a test compound, and
detecting a change, for example, an increase or
diminution, in a cellular response of the second portion
of the cells as compared to the first portion of the
cells. The change in cellular response is shown as a
measurable change extracellular acidification rate.
Moreover, culturing a third portion of the cells in the
presence of zsig49 polypeptide and the absence of a test
compound can be used as a positive control for the zsig49-
responsive cells, and as a control to compare the agonist
activity of a test compound with that of the zsig49
polypeptide. Moreover, using the microphysiometer, there
is provided a method of identifying antagonists of zsig49
polypeptide, comprising providing cells responsive to a
zsig49 polypeptide, culturing a first portion of the cells
in the presence of zsig49 and the absence of a test
compound, culturing a second portion of the cells in the
presence of zsig49 and the presence of a test compound,
and detecting a change, for example, an increase or a
diminution in a cellular response of the second portion of
the cells as compared to the first portion of the cells.
The change in cellular response is shown as a measurable
change extracellular acidification rate. Antagonists and
agonists, for zsig49 polypeptide, can be rapidly
identified using this method.
Moreover, zsig49 can be used to identify cells,
tissues, or cell lines which respond to a zsig49-
stimulated pathway. The microphysiometer, described
above, can be used to rapidly identify ligand-responsive
cells, such as cells responsive to zsig49 of the present
invention. Cells can be cultured in the presence or
absence of zsig49 polypeptide. Those cells which elicit a
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
74
measurable change in extracellular acidification in the
presence of zsig49 are responsive to zsig49. Such cell
lines, can be used to identify antagonists and agonists of
zsig49 polypeptide as described herein.
Nucleic acid molecules disclosed herein can be
used to detect the expression of a zsig49 gene in a
biological sample. Such probe molecules include double-
stranded nucleic acid molecules comprising the nucleotide
sequences of SEQ ID NOs:l, 4, 9, 11, 12, 14, or fragments
thereof, as well as single-stranded nucleic acid molecules
having the complement of the nucleotide sequences of SEQ
ID NOs: 1, 4, 9, 11, 12, 14, or a fragment thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the
like.
In a basic assay, a single-stranded probe
molecule is incubated with RNA, isolated from a biological
sample, under conditions of temperature and ionic strength
that promote base pairing between the probe and target
zsig49 RNA species. After separating unbound probe from
hybridized molecules, the amount of hybrids is detected.
Well-established hybridization methods of RNA
detection include northern analysis and dot/slot blot
hybridization (see, for example, Ausubel ibid. and Wu et
al. (eds.), "Analysis of Gene Expression at the RNA
Level," in Methods in Gene Biotechnology, pages 225-239
(CRC Press, Inc. 1997)). Nucleic acid probes can be
detectably labeled with radioisotopes such as 32P or 355.
Alternatively, zsig49 RNA can be detected with a
nonradioactive hybridization method (see, for example,
Isaac (ed.), Protocols for Nucleic Acid Analysis by
Nonradioactive Probes, Humana Press, Inc., 1993).
Typically, nonradioactive detection is achieved by
enzymatic conversion of chromogenic or chemiluminescent
substrates. Illustrative nonradioactive moieties include
biotin, fluorescein, and digoxigenin.
Zsig49 oligonucleotide probes are also useful
for in vivo diagnosis. As an illustration, l8F-labeled
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
oligonucleotides can be administered to a subject and
visualized by positron emission tomography (Tavitian et
al., Nature Medicine 4:467, 1998).
Numerous diagnostic procedures take advantage of
5 the polymerase chain reaction (PCR) to increase
sensitivity of detection methods. Standard techniques for
performing PCR are well-known (see, generally, Mathew
(ed.), Protocols in Human Molecular Genetics (Humana
Press, Inc. 1991), White (ed.), PCR Protocols: Current
10 Methods and Applications (Humana Press, Inc. 1993), Cotter
(ed.), Molecular Diagnosis of Cancer (Humana Press, Inc.
1996), Hanausek and Walaszek (eds.), Tumor Marker
Protocols (Humana Press, Inc. 1998), Lo (ed.), Clinical
Applications of PCR (Humana Press, Inc. 1998), and Meltzer
15 (ed.), PCR in Bioanalysis (Humana Press, Inc. 1998)).
PCR primers can be designed to amplify a sequence encoding
a particular zsig49 domain or motif.
One variation of PCR for diagnostic assays is
reverse transcriptase-PCR (RT-PCR). In the RT-PCR
20 technique, RNA is isolated from a biological sample,
reverse transcribed to cDNA, and the cDNA is incubated
with zsig49 primers (see, for example, Wu et al. (eds.),
"Rapid Isolation of Specific cDNAs or Genes by PCR," in
Methods in Gene Biotechnoloay, CRC Press, Inc., pages 15-
25 28, 1997). PCR is then performed and the products are
analyzed using standard techniques.
As an illustration, RNA is isolated from
biological sample using, for example, the guanidinium-
thiocyanate cell lysis procedure described above.
30 Alternatively, a solid-phase technique can be used to
isolate mRNA from a cell lysate. A reverse transcription
reaction can be primed with the isolated RNA using random
oligonucleotides, short homopolymers of dT, or zsig49
anti-sense oligomers. Oligo-dT primers offer the
35 advantage that various mRNA nucleotide sequences are
amplified that can provide control target sequences.
_CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
76
Zrnpl sequences are amplified by the polymerase chain
reaction using two flanking oligonucleotide primers that
are typically at least 5 bases in length.
PCR amplification products can be detected using
a variety of approaches. For example, PCR products can be
fractionated by gel electrophoresis, and visualized by
ethidium bromide staining. Alternatively, fractionated
PCR products can be transferred to a membrane, hybridized
with a detestably-labeled zsig49 probe, and examined by
autoradiography. Additional alternative approaches
include the use of digoxigenin-labeled deoxyribonucleic
acid triphosphates to provide chemiluminescence detection,
and the C-TRAK colorimetric assay. Another approach is
real time quantitative PCR (Perkin-Elmer Cetus, Norwalk,
Ct.). A fluorogenic probe, consisting of an
oligonucleotide with both a reporter and a quencher dye
attached, anneals specifically between the forward and
reverse primers. Using the 5' endonuclease activity of
Taq DNA polymerase, the reporter dye is separated from the
quencher dye and a sequence-specific signal is generated
and increases as amplification increases. The
fluorescence intensity can be continuously monitored and
quantified during the PCR reaction.
Another approach for detection of zsig49
expression is cycling probe technology (CPT), in which a
single-stranded DNA target binds with an excess of DNA
RNA-DNA chimeric probe to form a complex, the RNA portion
is cleaved with RNase H, and the presence of cleaved
chimeric probe is detected (see, for example, Beggs et
al., J. Clin. Microbiol. 34:2985, 1996 and Bekkaoui et
al., Biotechniaues 20:240, 1996). Alternative methods for
detection of zsig49 sequences can utilize approaches such
as nucleic acid sequence-based amplification (NASBA),
cooperative amplification of templates by cross-
hybridization (CATCH), and the ligase chain reaction (LCR)
(see, for example, Marshall et al., U.S. Patent No.
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
77
5,686,272 (1997), Dyer et al., J. Virol. Methods 60:161,
1996; Ehricht et al., Eur. J. Biochem. 243:358, 1997 and
Chadwick et al., J. Virol. Methods 70:59, 1998). Other
standard methods are known to those of skill in the art.
Zsig49 probes and primers can also be used to
detect and to localize zsig49 gene expression in tissue
samples. Methods for such in situ hybridization are well-
known to those of skill in the art (see, for example, Choo
(ed.), In Situ Hybridization Protocols, Humana Press, Inc.,
1994; Wu et al. (eds.), "Analysis of Cellular DNA or
Abundance of mRNA by Radioactive In Situ Hybridization
IRISH)," in Methods in Gene Biotechnoloay, CRC Press, Inc.,
pages 259-278, 1997 and Wu et al. (eds.), "Localization of
DNA or Abundance of mRNA by Fluorescence In Situ
Hybridization IRISH)," in Methods in Gene Biotechnoloay,
CRC Press, Inc., pages 279-289, 1997).
In another embodiment, the present invention
provides methods for detecting in a sample from an
individual, a chromosome 1 abnormality associated with a
disease, comprising the steps of: (a) contacting nucleic
acid molecules of the sample with a nucleic acid probe
that hybridizes with a nucleic acid molecule having the
nucleotide sequence of SEQ ID NO:1, 9 or 12, their
complements or fragments, under stringent conditions, and
(b) detecting the presence or absence of hybridization of
the probe with nucleic acid molecules in the sample,
wherein the absence of hybridization is indicative of a
chromosome 1 abnormality, such as an abnormality that
causes a defective glucose metabolism.
The present invention also provides methods of
detecting in a sample from an individual, an zsig49 gene
abnormality associated with a disease, comprising: (a)
isolating nucleic acid molecules that encode zsig49 from
the sample, and (b) comparing the nucleotide sequence of
the isolated zsig49-encoding sequence with the nucleotide
sequence of SEQ ID NOs:l, 9 or 12, wherein the difference
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
78
between the sequence of the isolated zsig49-encoding
sequence or a polynucleotide encoding the zsig49
polypeptide generated from the isolated zsig49-encoding
sequence and the nucleotide sequences of SEQ ID NOs:l, 9
or 12 is indicative of an zsig49 gene abnormality
associated with disease or susceptibility to a disease in
an individual, such as a defective glucose metabolism or
diabetes.
The present invention also provides methods of
detecting in a sample from a individual, an abnormality in
expression of the zsig49 gene associated with disease or
susceptibility to disease, comprising: (a) obtaining
zsig49 RNA from the sample, (b) generating zsig49 cDNA by
polymerase chain reaction from the zsig49 RNA, and (c)
comparing the nucleotide sequence of the zsig49 cDNA to
the nucleotide sequence of SEQ ID NOs :1, 9 or 12 , wherein
a difference between the sequence of the zsig49 cDNA and
the nucleotide sequence of SEQ ID NOs:l, 9 or 12 is
indicative of an abnormality in expression of the zsig49
gene associated with disease or susceptibility to disease.
In further embodiments, the disease is defective glucose
metabolism or diabetes.
In other aspects, the present invention provides
methods for detecting in a sample from an individual, an
zsig49 gene abnormality associated with a disease,
comprising: (a) contacting sample nucleic acid molecules
with a nucleic acid probe, wherein the probe hybridizes to
a nucleic acid molecule having the nucleotide sequence of
SEQ ID NOs:l, 9 or 12, its complements or fragments, under
stringent conditions, and (b) detecting the presence or
absence of hybridization is indicative of an zsig49
abnormality. The absence of hybridization of the probe is
associated with defective glucose metabolism.
In situ hybridization provides another approach
for identifying zsig49 gene abnormalities. According to
this approach, an zsig49 probe is labeled with a
detectable marker by any method known in the art. For
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
79
example, the probe can be directly labeled by random
priming, end labeling, PCR, or nick translation. Suitable
direct labels include radioactive labels such as 32P, 3H,
and 35S and non-radioactive labels such as fluorescent
markers (e. g., fluorescein, Texas Red, AMCA blue (7-amino-
4-methyl-coumanine-3-acetate), lucifer yellow, rhodamine,
etc.), cyanin dyes which are detectable with visible
light, enzymes, and the like. Probes labeled with an
enzyme can be detected through a colorimetric reaction by
providing a substrate for the enzyme. In the presence of
various substrates, different colors are produced by the
reaction, and these colors can be visualized to separately
detect multiple probes if desired. Suitable substrates
for alkaline phosphatase include 5-bromo-4-chloro-3-
indolylphosphate and nitro blue tetrazolium. One
preferred substrate for horseradish peroxidase is
diaminobenzoate.
An illustrative method for detecting chromosomal
abnormalities with in situ hybridization is described by
Wang et al., U.S. patent No. 5,856,089. Following this
approach, for example, a method of performing in situ
hybridization with an zsig49 probe to detect a chromosome
structural abnormality in a cell from a fixed tissue
sample obtained from a patient suspected of having a
metabolic disease can comprise the steps of: (1) obtaining
a fixed tissue sample from the patient, (2) pretreating
the fixed tissue sample obtained in step (1) with a
bisulfate ion composition, (3) digesting the fixed tissue
sample with proteinase, (4) performing in situ
hybridization on cells obtained from the digested fixed
tissue sample of step (3) with a probe which specifically
hybridizes to the zsig49 gene, wherein a signal pattern of
hybridized probes is obtained, (5) comparing the signal
pattern of the hybridized probe in step (4) to a
predetermined signal pattern of the hybridized probe
obtained when performing in situ hybridization on cells
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
having a normal critical chromosome region of interest,
and (6) detecting a chromosome structural abnormality in
the patient's cells, by detecting a difference between the
signal pattern obtained in step (4) and the predetermined
5 signal pattern. Examples of zsig49 gene abnormalities
include deletions, amplifications, translocations,
inversions, and the like.
The present invention also contemplates kits for
performing a diagnostic assay for zsig49 gene expression or
10 to detect mutations in the zsig49 gene. Such kits comprise
nucleic acid probes, such as double-stranded nucleic acid
molecules comprising the nucleotide sequence of SEQ ID
NOs:l, 9 or 12, or a portion thereof, as well as single-
stranded nucleic acid molecules having the complement of
15 the nucleotide sequence of SEQ ID NOs:l, 9 or 12, or a
portion thereof. Probe molecules may be DNA, RNA,
oligonucleotides, and the like. Kits can comprise nucleic
acid primers for performing PCR or oligonucleotides for
performing the ligase chain reaction.
20 Preferably, such a kit contains all the
necessary elements to perform a nucleic acid diagnostic
assay described above. A kit will comprise at least one
container comprising an zsig49 probe or primer. The kit
may also comprise a second container comprising one or
25 more reagents capable of indicating the presence of zsig49
sequences. Examples of such indicator reagents include
detectable labels such as radioactive labels,
fluorochromes, chemiluminescent agents, and the like. A
kit may also comprise a means for conveying to the user
30 that the zsig49 probes and primers are used to detect
zsig49 gene expression. For example, written instructions
may state that the enclosed nucleic acid molecules can be
used to detect either a nucleic acid molecule that encodes
zsig49, or a nucleic acid molecule having a nucleotide
35 sequence that is complementary to an zsig49-encoding
nucleotide sequence. The written material can be applied
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
81
directly to a container, or the written material can be
provided in the form of a packaging insert.
Various additional diagnostic approaches are
well-known to those of skill in the art (see, for example,
Mathew (ed.), Protocols in Human Molecular Genetics Humana
Press, Inc., 1991; Coleman and Tsongalis, Molecular
Dia~~nostics, Humana Press, Inc., 1996 and Elles, Molecular
Diagnosis of Genetic Diseases, Humana Press, Inc., 1996).
The invention also provides anti-zsig49
antibodies. Antibodies to zsig49 can be obtained, for
example, using as an antigen the product of a zsig49
expression vector, or zsig49 isolated from a natural
source. Particularly useful anti-zsig49 antibodies "bind
specifically" with zsig49. Antibodies are considered to
be specifically binding if the antibodies bind to a zsig49
polypeptide, peptide or epitope with a binding affinity
(Ka) of 106 M 1 or greater, preferably 10~ M 1 or greater,
more preferably 108 M 1 or greater, and most preferably
109 M 1 or greater. The binding affinity of an antibody
can be readily determined by one of ordinary skill in the
art, for example, by Scatchard analysis (Scatchard, Ann.
NY Acad. Sci. 51:660, 1949). Suitable antibodies include
antibodies that bind with zsig49 in particular domains.
Anti-zsig49 antibodies can be produced using
antigenic zsig49 epitope-bearing peptides and
polypeptides. Antigenic epitope-bearing peptides and
polypeptides of the present invention contain a sequence
of at least nine, preferably between 15 to about 30 amino
acids contained within SEQ ID NOs:2, 10 or 13. However,
peptides or polypeptides comprising a larger portion of an
amino acid sequence of the invention, containing from 30
to 50 amino acids, or any length up to and including the
entire amino acid sequence of a polypeptide of the
invention, also are useful for inducing antibodies that
bind with zsig49. It is desirable that the amino acid
sequence of the epitope-bearing peptide is selected to
provide substantial solubility in aqueous solvents (i.e.,
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
82
the sequence includes relatively hydrophilic residues,
while hydrophobic residues are preferably avoided).
Moreover, amino acid sequences containing proline residues
may be also be desirable for antibody production.
Polyclonal antibodies to recombinant zsig49
protein or to zsig49 isolated from natural sources can be
prepared using methods well-known to those of skill in the
art. See, for example, Green et al., "Production of
Polyclonal Antisera," in Immunochemical Protocols (Manson,
ed.), pages 1-5 (Humana Press 1992), and Williams et al.,
"Expression of foreign proteins in E. coli using plasmid
vectors and purification of specific polyclonal
antibodies," in DNA Cloning 2: Expression Systems, 2nd
Edition, Glover et al. (eds.), page 15 (Oxford University
Press 1995). The immunogenicity of a zsig49 polypeptide
can be increased through the use of an adjuvant, such as
alum (aluminum hydroxide) or Freund's complete or
incomplete adjuvant. Polypeptides useful for immunization
also include fusion polypeptides, such as fusions of
zsig49 or a portion thereof with an immunoglobulin
polypeptide or with maltose binding protein. The
polypeptide immunogen may be a full-length molecule or a
portion thereof. If the polypeptide portion is "hapten-
like," such portion may be advantageously joined or linked
to a macromolecular carrier (such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus
toxoid) for immunization.
Although polyclonal antibodies are typically
raised in animals such as horses, cows, dogs, chicken,
rats, mice, rabbits, guinea pigs, hamsters, goats, or
sheep, an anti-zsig49 antibody of the present invention
may also be derived from a subhuman primate antibody.
General techniques for raising diagnostically and
therapeutically useful antibodies in baboons may be found,
for example, in Goldenberg et al., international patent
publication No. WO 91/11465, and in Losman et al., Int. J.
Cancer 46:310, 1990. Antibodies can also be raised in
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
83
transgenic animals such as transgenic sheep, cows, goats
or pigs. Antibodies can also be expressed in yeast and
fungi in modified forms as will as in mammalian and insect
cells.
Alternatively, monoclonal anti-zsig49 antibodies
can be generated. Rodent monoclonal antibodies to
specific antigens may be obtained by methods known to
those skilled in the art (see, for example, Kohler et al.,
Nature 256:495, 1975, Coligan et al. (eds.), Current
Protocols in Immunoloay, Vol. 1, pages 2.5.1-2.6.7 (John
Wiley & Sons 1991), Picksley et al., "Production of
monoclonal antibodies against proteins expressed in E.
coli, " in DNA Clonina 2 : E~ression Systems, 2nd Edition,
Glover et al. (eds.), page 93 (Oxford University Press
1995) ) .
Briefly, monoclonal antibodies can be obtained
by injecting mice with a composition comprising a zsig49
gene product, verifying the presence of antibody
production by removing a serum sample, removing the spleen
to obtain B-lymphocytes, fusing the B-lymphocytes with
myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce
antibodies to the antigen, culturing the clones that
produce antibodies to the antigen, and isolating the
antibodies from the hybridoma cultures.
In addition, an anti-zsig49 antibody of the
present invention may be derived from a human monoclonal
antibody. Human monoclonal antibodies are obtained from
transgenic mice that have been engineered to produce
specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy
and light chain locus are introduced into strains of mice
derived from embryonic stem cell lines that contain
targeted disruptions of the endogenous heavy chain and
light chain loci. The transgenic mice can synthesize human
antibodies specific for human antigens, and the mice can be
used to produce human antibody-secreting hybridomas.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
84
Methods for obtaining human antibodies from transgenic mice
are described, for example, by Green et al . , Nature Genet .
7:13, 1994, Lonberg et al., Nature 368:856, 1994, and
Taylor et al., Int. Immun. 6:579, 1994.
Monoclonal antibodies can be isolated and
purified from hybridoma cultures by a variety of well-
established techniques. Such isolation techniques include
affinity chromatography with Protein-A Sepharose, size-
exclusion chromatography, and ion-exchange chromatography
(see, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3; Baines et al., "Purification of
Immunoglobulin G (IgG)," in Methods in Molecular Biology,
Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to
prepare fragments of anti-zsig49 antibodies. Such
antibody fragments can be obtained, for example, by
proteolytic hydrolysis of the antibody. Antibody
fragments can be obtained by pepsin or papain digestion of
whole antibodies by conventional methods. As an
illustration, antibody fragments can be produced by
enzymatic cleavage of antibodies with pepsin to provide a
5S fragment denoted F(ab')z. This fragment can be further
cleaved using a thiol reducing agent to produce 3.55 Fab'
monovalent fragments. Optionally, the cleavage reaction
can be performed using a blocking group for the sulfhydryl
groups that result from cleavage of disulfide linkages.
As an alternative, an enzymatic cleavage using pepsin
produces two monovalent Fab fragments and an Fc fragment
directly. These methods are described, for example, by
Goldenberg, U.S. patent No. 4,331,647, Nisonoff et al.,
Arch Biochem. Bio~hys. 89:230, 1960, Porter, Biochem. J.
73:119, 1959, Edelman et al., in Methods in Enzymology
Vol. 1, page 422 (Academic Press 1967), and by Coligan,
ibid.
Other methods of cleaving antibodies, such as
separation of heavy chains to form monovalent light-heavy
chain fragments, further cleavage of fragments, or other
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
enzymatic, chemical or genetic techniques may also be
used, so long as the fragments bind to the antigen that is
recognized by the intact antibody.
For example, Fv fragments comprise an
5 association of Vx and VL chains. This association can be
noncovalent, as described by mbar et al., Proc. Nat.
Acad. Sci. USA 69:2659, 1972. Alternatively, the variable
chains can be linked by an intermolecular disulfide bond
or cross-linked by chemicals such as gluteraldehyde (see,
10 for example, Sandhu, Crit. Rev. Biotech. 12:437, 1992).
The Fv fragments may comprise VH and VL chains
which are connected by a peptide linker. These single-
chain antigen binding proteins (scFv) are prepared by
constructing a structural gene comprising DNA sequences
15 encoding the VH and VL domains which are connected by an
oligonucleotide. The structural gene is inserted into an
expression vector which is subsequently introduced into a
host cell, such as E. coli. The recombinant host cells
synthesize a single polypeptide chain with a linker
20 peptide bridging the two V domains. Methods for producing
scFvs are described, for example, by Whitlow et al.,
Methods: A Companion to Methods in Enzymoloay 2:97, 1991,
also see, Bird et al., Science 242:423, 1988, Ladner et
al., U.S. Patent No. 4,946,778, Pack et al.,
25 Bio/Technoloay 11:1271, 1993, and Sandhu, supra.
As an illustration, a scFV can be obtained by
exposing lymphocytes to zsig49 polypeptide in vitro, and
selecting antibody display libraries in phage or similar
vectors (for instance, through use of immobilized or
30 labeled zsig49 protein or peptide). Genes encoding
polypeptides having potential zsig49 polypeptide binding
domains can be obtained by screening random peptide
libraries displayed on phage (phage display) or on
bacteria, such as E. coli. Nucleotide sequences encoding
35 the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. These random peptide display libraries can be
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
86
used to screen for peptides which interact with a known
target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al.,
U.S. Patent No. 5,223,409, Ladner et al., U.S. Patent No.
4,946,778, Ladner et al., U.S. Patent No. 5,403,484,
Ladner et al., U.S. Patent No. 5,571,698, and Kay et al.,
Phaae Display of Peptides and Proteins (Academic Press,
Inc. 1996)) and random peptide display libraries and kits
for screening such libraries are available commercially,
for instance from Clontech (Palo Alto, CA), Invitrogen
Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly,
MA), and Pharmacia LKB Biotechnology Inc. (Piscataway,
NJ). Random peptide display libraries can be screened
using the zsig49 sequences disclosed herein to identify
proteins which bind to zsig49.
Another form of an antibody fragment is a
peptide coding for a single complementarity-determining
region (CDR). CDR peptides ("minimal recognition units")
can be obtained by constructing genes encoding the CDR of
an antibody of interest. Such genes are prepared, for
example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-
producing cells (see, for example, Larrick et al.,
Methods: A Companion to Methods in Enzymology 2:106,
1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal
Antibodies," in Monoclonal Antibodies: Production,
Engineering and Clinical Application, Ritter et al.
(eds.), page 166 (Cambridge University Press 1995), and
Ward et al., "Genetic Manipulation and Expression of
Antibodies," in Monoclonal Antibodies: Principles and
Applications, Birch et al., (eds.), page 137 (Wiley-Liss,
Inc. 1995) ) .
Alternatively, an anti-zsig49 antibody may be
derived from a "humanized" monoclonal antibody. Humanized
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
87
monoclonal antibodies are produced by transferring mouse
complementary determining regions from heavy and light
variable chains of the mouse immunoglobulin into a human
variable domain. Typical residues of human antibodies are
then substituted in the framework regions of the murine
counterparts. The use of antibody components derived from
humanized monoclonal antibodies obviates potential
problems associated with the immunogenicity of murine
constant regions. General techniques for cloning murine
immunoglobulin variable domains are described, for
example, by Orlandi et al., Proc. Nat. Acad. Sci. USA
86:3833, 1989. Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones
et al., Nature 321:522, 1986, Carter et al., Proc. Nat.
Acad. Sci. USA 89:4285, 1992, Sandhu, Crit. Rev. Biotech.
12:437, 1992, Singer et al., J. Immun. 150:2844, 1993,
Sudhir (ed.), Antibody Enctineerinct Protocols (Humana
Press, Inc. 1995), Kelley, "Engineering Therapeutic
Antibodies," in Protein En~ineerinct: Principles and
Practice, Cleland et al. (eds.), pages 399-434 (John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No.
5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be
prepared by immunizing animals with anti-zsig49 antibodies
or antibody fragments, using standard techniques. See,
for example, Green et al., "Production of Polyclonal
Antisera," in Methods In Molecular Biology: Immunochemical
Protocols, Manson (ed.), pages 1-12 (Humana Press 1992).
Also, see Coligan, ibid. at pages 2.4.1-2.4.7.
Alternatively, monoclonal anti-idiotype antibodies can be
prepared using anti-zsig49 antibodies or antibody
fragments as immunogens with the techniques, described
above. As another alternative, humanized anti-idiotype
antibodies or subhuman primate anti-idiotype antibodies
can be prepared using the above-described techniques.
Methods for producing anti-idiotype antibodies are
described, for example, by Irie, U.S. Patent No.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
88
5,208,146, Greene, et. al., U.S. Patent No. 5,637,677, and
Varthakavi and Minocha, J. Gen. Virol. 77:1875, 1996.
A variety of assays known to those skilled in
the art can be utilized to detect antibodies and binding
proteins which specifically bind to zsig49 proteins or
peptides. Exemplary assays are described in detail in
Antibodies: A Laboratory Manual, Harlow and Lane (Eds.),
Cold Spring Harbor Laboratory Press, 1988. Representative
examples of such assays include: concurrent
immunoelectrophoresis, radioimmunoassay, radioimmuno
precipitation, enzyme-linked immunosorbent assay (ELISA),
dot blot or Western blot assay, inhibition or competition
assay, and sandwich assay. In addition, antibodies can be
screened for binding to wild-type versus mutant zsig49
protein or peptide.
Antibodies to zsig49 may be used for tagging
cells that express zsig49 polypeptide; for isolating
zsig49 polypeptide by affinity purification; for diagnostic
assays for determining circulating levels of zsig49
polypeptides; for detecting or quantitating soluble zsig49
polypeptide as marker of underlying pathology or disease;
in analytical methods employing FACS; for screening
expression libraries; for generating anti-idiotypic
antibodies; and as neutralizing antibodies or as
antagonists to zsig49-associated activity in vitro and in
vivo. Suitable direct tags or labels include
radionuclides, enzymes, substrates, cofactors, inhibitors,
fluorescent markers, chemiluminescent markers, magnetic
particles and the like; indirect tags or labels may
feature use of biotin-avidin or other complement/anti-
complement pairs as intermediates. Antibodies herein may
also be directly or indirectly conjugated to drugs,
toxins, radionuclides and the like, and these conjugates
used for in vivo diagnostic or therapeutic applications.
The present invention contemplates the use of
anti-zsig49 antibodies to screen biological samples in
vitro for the presence of zsig49. In one type of in vitro
CA 02364330 2001-10-04
WO 00/23591 PCTNS99/24579
89
assay, anti-zsig49 antibodies are used in liquid phase.
For example, the presence of zsig49 in a biological sample
can be tested by mixing the biological sample with a trace
amount of labeled zsig49 and an anti-zsig49 antibody under
conditions that promote binding between zsig49 and its
antibody. Complexes of zsig49 and anti-zsig49 in the
sample can be separated from the reaction mixture by
contacting the complex with an immobilized protein which
binds with the antibody, such as an Fc antibody or
Staphylococcus protein A. The concentration of zsig49 in
the biological sample will be inversely proportional to the
amount of labeled zsig49 bound to the antibody and directly
related to the amount of free labeled zsig49. Although rat
or human anti-zsig49 antibodies can be used to detect
zsig49, human anti-zsig49 antibodies are preferred for
human diagnostic assays.
In vitro assays can also be performed in which
anti-zsig49 antibody is bound to a solid-phase carrier.
For example, antibody can be attached to a polymer, such as
aminodextran, in order to link the antibody to an insoluble
support such as a polymer-coated bead, a plate or a tube.
Other suitable in vi tro assays will be readily apparent to
those of skill in the art.
In another approach, anti-zsig49 antibodies can
be used to detect zsig49 in tissue sections prepared from
a biopsy specimen. Such immunochemical detection can be
used to determine the relative abundance of zsig49 and to
determine the distribution of zsig49 in the examined
tissue. General immunochemistry techniques are well
established (see, for example, Ponder, "Cell Marking
Techniques and Their Application," in Mammalian
Development: A Practical Approach, Monk (ed.), pages 115-
38 (IRL Press 1987), Coligan at pages 5.8.1-5.8.8,
Ausubel (1995) at pages 14.6.1 to 14.6.13 (Wiley
Interscience 1990), and Manson (ed.), Methods In Molecular
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
Biology, Vol. 10: Immunochemical Protocols (The Humana
Press, Ins. 1992)).
Immunochemical detection can be performed by
contacting a biological sample with an anti-zsig49
5 antibody, and then contacting the biological sample with a
detestably labeled molecule which binds to the antibody.
For example, the detestably labeled molecule can comprise
an antibody moiety that binds to anti-zsig49 antibody.
Alternatively, the anti-zsig49 antibody can be conjugated
10 with avidin/streptavidin (or biotin) and the detestably
labeled molecule can comprise biotin (or
avidin/streptavidin). Numerous variations of this basic
technique are well-known to those of skill in the art.
Alternatively, an anti-zsig49 antibody can be
15 conjugated with a detectable label to form an anti-zsig49
immunoconjugate. Suitable detectable labels include, for
example, a radioisotope, a fluorescent label, a
chemiluminescent label, an enzyme label, a bioluminescent
label or colloidal gold. Methods of making and detecting
20 such detestably-labeled immunoconjugates are well-known to
those of ordinary skill in the art, and are described in
more detail below.
The detectable label can be a radioisotope that
is detected by autoradiography. Isotopes that are
25 particularly useful for the purpose of the present
invention are 3H, 1251, 1311, 355, 14C, and the like.
Anti-zsig49 immunoconjugates can also be labeled
with a fluorescent compound. The presence of a
fluorescently-labeled antibody is determined by exposing
30 the immunoconjugate to light of the proper wavelength and
detecting the resultant fluorescence. Fluorescent
labeling compounds include fluorescein isothiosyanate,
rhodamine, phycoerytherin, phycocyanin, allophycocyanin,
o-phthaldehyde and fluorescamine.
35 Alternatively, anti-zsig49 immunoconjugates can
be detestably labeled by coupling an antibody component to
a chemiluminescent compound. The presence of the
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
91
chemiluminescent-tagged immunoconjugate is determined by
detecting the presence of luminescence that arises during
the course of a chemical reaction. Examples of chemi-
luminescent labeling compounds include luminol,
isoluminol, an aromatic acridinium ester, an imidazole, an
acridinium salt and an oxalate ester.
Similarly, a bioluminescent compound can be used
to label anti-zsig49 immunoconjugates of the present
invention. Bioluminescence is a type of chemiluminescence
found in biological systems in which a catalytic protein
increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by
detecting the presence of luminescence. Bioluminescent
compounds that are useful for labeling include luciferin,
luciferase and aequorin.
Alternatively, anti-zsig49 immunoconjugates can
be detestably labeled by linking an anti-zsig49 antibody
component to an enzyme. When the anti-zsig49-enzyme
conjugate is incubated in the presence of the appropriate
substrate, the enzyme moiety reacts with the substrate to
produce a chemical moiety which can be detected, for
example, by spectrophotometric, fluorometric or visual
means. Examples of enzymes that can be used to detestably
label polyspecific immunoconjugates include (3
galactosidase, glucose oxidase, peroxidase and alkaline
phosphatase.
Those of skill in the art will know of other
suitable labels which can be employed in accordance with
the present invention. The binding of marker moieties to
anti-ZSIG49 antibodies can be accomplished using standard
techniques known to the art. Typical methodology in this
regard is described by Kennedy et al., Clin. Chim. Acta
70:1, 1976), Schurs et al., Clin. Chim. Acta 81:1, 1977,
Shih et al., Int. J. Cancer 46:1101, 1990, Stein et al.,
Cancer Res. 50:1330, 1990, and Coligan, su ra.
Moreover, the convenience and versatility of
immunochemical detection can be enhanced by using anti-
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
92
zsig49 antibodies that have been conjugated with avidin,
streptavidin, and biotin (see, for example, Wilchek et al.
(eds.), "Avidin-Biotin Technology," Methods In Enzymoloay,
Vol. 184 (Academic Press 1990), and Bayer et al.,
"Immunochemical Applications of Avidin-Biotin Technology,"
in Methods In Molecular Biology, Vol. 10, Manson (ed.),
pages 149-162 (The Humana Press, Inc. 1992).
Methods for performing immunoassays are well
established. See, for example, Cook and Self, "Monoclonal
Antibodies in Diagnostic Immunoassays," in Monoclonal
Antibodies: Production, Enaineerina, and Clinical
Application, Ritter and Ladyman (eds.), pages 180-208,
(Cambridge University Press, 1995), Perry, "The Role of
Monoclonal Antibodies in the Advancement of Immunoassay
Technology," in Monoclonal Antibodies: Principles and
Applications, Birch and Lennox (eds.), pages 107-120
(Wiley-Liss, Inc. 1995), and Diamandis, Immunoassay
(Academic Press, Inc. 1996). Suitable biological samples
for detection of zsig49 protein include cells, tissues or
bodily fluids, such as urine, saliva or blood.
In a related approach, biotin- or FITC-labeled
anti-zsig49 antibodies can be used to identify cells that
bind zsig49. Such can binding can be detected, for
example, using flow cytometry.
The present invention also contemplates kits for
performing an immunological diagnostic assay for zsig49
gene expression. Such kits comprise at least one
container comprising an anti-zsig49 antibody, or antibody
fragment. A kit may also comprise a second container
comprising one or more reagents capable of indicating the
presence of zsig49 antibody or antibody fragments.
Examples of such indicator reagents include detectable
labels such as a radioactive label, a fluorescent label, a
chemiluminescent label, an enzyme label, a bioluminescent
label, colloidal gold, and the like. A kit may also
comprise a means for conveying to the user that zsig49
antibodies or antibody fragments are used to detect zsig49
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
93
protein. For example, written instructions may state that
the enclosed antibody or antibody fragment can be used to
detect zsig49. The written material can be applied
directly to a container, or the written material can be
provided in the form of a packaging insert.
Molecules of the present invention can be used
to identify and isolate receptors which bind zsig49. For
example, proteins and peptides of the present invention
can be immobilized on a column and membrane preparations
run over the column (Immobilized Affinity Ligand
Techniques, Hermanson et al., eds., Academic Press, San
Diego, CA, 1992, pp.195-202). Proteins and peptides can
also be radiolabeled (Methods in Enz~mol., vol. 182,
"Guide to Protein Purification", Deutscher, ed., Acad.
Press, San Diego, 1990, 721-37) or photoaffinity labeled
(Brunner et al., Ann. Rev. Biochem. 62:483-514, 1993 and
Fedan et al., Biochem. Pharmacol. 33:1167-80, 1984) and
specific cell-surface proteins can be identified.
For pharmaceutical use, pharmaceutically
effective amounts of zsig49 therapeutic antibodies, small
molecule antagonists or agonists of zsig49 polypeptides,
or zsig49 polypeptide fragments can be formulated with
pharmaceutically acceptable carriers for parenteral, oral,
nasal, rectal, topical, transdermal administration or the
like, according to conventional methods. Formulations may
further include one or more diluents, fillers,
emulsifiers, preservatives, buffers, excipients, and the
like, and may be provided in such forms as liquids,
powders, emulsions, suppositories, liposomes, transdermal
patches and tablets, for example. Slow or extended-
release delivery systems, including any of a number of
biopolymers (biological-based systems), systems employing
liposomes, and polymeric delivery systems, can also be
utilized with the compositions described herein to provide
a continuous or long-term source of the zsig49
polypeptide, agonist or antagonist. Such slow release
systems are applicable to formulations, for example, for
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
94
oral, topical and parenteral use. The term
"pharmaceutically acceptable carrier or vehicle" refers to
a carrier medium which does not interfere with the
effectiveness of the biological activity of the active
ingredients and which is not toxic to the host or patient.
One skilled in the art may formulate the compounds of the
present invention in an appropriate manner, and in
accordance with accepted practices, such as those
disclosed in Remington: The Science and Practice of
Pharmacv, Gennaro, ed., Mack Publishing Co., Easton, PA,
19th ed., 1995.
As used herein, a pharmaceutically effective
amount of a zsig49 polypeptide, agonist or antagonist, is
an amount sufficient to induce a desired biological
result. The result can be alleviation of the signs,
symptoms, or causes of a disease, or any other desired
alteration of a biological system. For example, an
effective amount of a polypeptide of the present invention
is that which provides either subjective relief of
symptoms or an objectively identifiable improvement as
noted by the clinician or other qualified observer. In
particular, such an effective amount if administered to a
patient suffering with diabetes, results in a decrease in
glucose levels, prevention or significant delay of onset
of disease or loss of islet infiltration in NOD mice or
other beneficial effect. Doses of zsig49 polypeptide
will generally be determined by the clinician according to
accepted standards, taking into account the nature and
severity of the condition to be treated, patient traits,
etc. Determination of dose is within the level of
ordinary skill in the art. The proteins may be
administered for acute treatment, over one week or less,
often over a period of one to three days or may be used in
chronic treatment, over several months or years.
Polynucleotides encoding zsig49 polypeptides are
useful within gene therapy applications where it is
desired to increase or inhibit zsig49 activity. If a
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
mammal has a mutated or absent zsig49 gene, the zsig49
gene can be introduced into the cells of the mammal. In
one embodiment, a gene encoding a zsig49 polypeptide is
introduced in vivo in a viral vector. Such vectors
5 include an attenuated or defective DNA virus, such as, but
not limited to, herpes simplex virus (HSV),
papillomavirus, Epstein Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), and the like. Defective
viruses, which entirely or almost entirely lack viral
10 genes, are preferred. A defective virus is not infective
after introduction into a cell. Use of defective viral
vectors allows for administration to cells in a specific,
localized area, without concern that the vector can infect
other cells. Examples of particular vectors include, but
15 are not limited to, a defective herpes simplex virus 1
(HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as
the vector described by Stratford-Perricaudet et al., J.
Clin. Invest. 90:626-30, 1992; and a defective adeno-
20 associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8,
1989) .
In another embodiment, a zsig49 gene can be
introduced in a retroviral vector, e.g., as described in
25 Anderson et al., U.S. Patent No. 5,399,346; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol. 62:1120, 1988; Temin et al.,
U.S. Patent No. 5,124,263; International Patent
30 Publication No. WO 95/07358, published March 16, 1995 by
Dougherty et al.; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection
in vivo using liposomes. Synthetic cationic lipids can be
used to prepare liposomes for in vivo transfection of a
35 gene encoding a marker (Felgner et al., Proc. Natl. Acad.
Sci. USA 84:7413-7, 1987; Mackey et al., Proc. Natl. Acad.
Sci. USA 85:8027-31, 1988). The use of lipofection to
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
96
introduce exogenous genes into specific organs in vivo has
certain practical advantages. Molecular targeting of
liposomes to specific cells represents one area of
benefit. More particularly, directing transfection to
particular cells represents one area of benefit. For
instance, directing transfection to particular cell types
would be particularly advantageous in a tissue with
cellular heterogeneity, such as the pancreas, liver,
kidney, and brain. Lipids may be chemically coupled to
other molecules for the purpose of targeting. Targeted
peptides (e. g., hormones or neurotransmitters), proteins
such as antibodies, or non-peptide molecules can be
coupled to liposomes chemically.
It is possible to remove the target cells from
the body; to introduce the vector as a naked DNA plasmid;
and then to re-implant the transformed cells into the
body. Naked DNA vectors for gene therapy can be
introduced into the desired host cells by methods known in
the art, e.g., transfection, electroporation,
microinjection, transduction, cell fusion, DEAE dextran,
calcium phosphate precipitation, use of a gene gun or use
of a DNA vector transporter. See, e.g., Wu et al., J.
Biol. Chem. 267:963-7, 1992; Wu et al., J. Biol. Chem.
263:14621-4, 1988.
Antisense methodology can be used to inhibit
zsig49 gene translation, such as to inhibit cell
proliferation in vivo. Polynucleotides that are
complementary to a segment of a zsig49-encoding
polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID NOs:l, 9 or 12) are designed to bind to zsig49-encoding
mRNA and to inhibit translation of such mRNA. Such
antisense polynucleotides are used to inhibit expression
of zsig49 polypeptide-encoding genes in cell culture or in
a subject.
Transgenic mice, engineered to express the
zsig49 gene, and mice that exhibit a complete absence of
zsig49 gene function, referred to as "knockout mice"
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
97
(Snouwaert et al., Science 257:1083, 1992), may also be
generated (Lowell et al., Nature 366:740-42, 1993). These
mice may be employed to study the zsig49 gene and the
protein encoded thereby in an in vivo system.
The invention is further illustrated by the
following non-limiting examples.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
98
EXAMPLES
Example 1
Identification of zsig~49 cDNA Sequence
The novel zsig49 polypeptide-encoding
polynucleotides of the present invention were initially
identified by querying an EST database for secretory
signal sequences characterized by an upstream methionine
start site, a hydrophobic region of approximately 13 amino
acids and a cleavage site (SEQ ID N0:3, wherein cleavage
occurs between the alanine and glycine amino acid
residues) in an effort to select for secreted proteins.
Polypeptides corresponding to ESTs meeting those search
criteria were compared to known sequences to identify
secreted proteins having homology to known ligands. One
EST sequence was discovered and determined to be novel.
The EST sequence was from an islet cell library. To
identify the corresponding cDNA, a clone considered likely
to contain the entire coding sequence was used for
sequencing. Using an Invitrogen S.N.A.P.TM Miniprep kit
(Invitrogen, Corp., San Diego, CA) according to
manufacturer's instructions a 5 ml overnight culture in LB
+ 50 ~g/ml ampicillin was prepared. The template was
sequenced on an ABIPRISM TM model 377 DNA sequencer
(Perkin-Elmer Cetus, Norwalk, Ct.) using the ABI PRISMTM
Dye Terminator Cycle Sequencing Ready Reaction Kit
(Perkin-Elmer Corp.) according to manufacturer's
instructions. Sequencing reactions were carried out in a
Hybaid OmniGene Temperature Cycling System (National
Labnet Co., Woodbridge, NY). SEQUENCHERTM 3.1 sequence
analysis software (Gene Codes Corporation, Ann Arbor, MI)
was used for data analysis. The resulting 952 by sequence
is disclosed in SEQ ID NO: 1.
Example 2
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
99
Tissue Distribution
Northerns were performed using Human Multiple
Tissue Blots from Clontech (Palo Alto, CA). An
approximately 120 by probe (SEQ ID N0:5) was amplified
from the clone described above in Example 1.
Oligonucleotide primers ZC14887 (SEQ ID N0:5) and ZC16136
(SEQ ID N0:6) were used to amplify the probe sequence in a
polymerase chain reaction as follows: 1 cycle at 95°C for 1
minute; 35 cycles of 95°C for 30 seconds, 50oC for 30
seconds and 72°C for 30 seconds, followed by a 2 minute
extension at 72°C. The resulting DNA fragment was
electrophoresed on a to agarose gel (SEA PLAQUE GTG low
melt agarose, FMC Corp., Rockland, ME), the fragment was
purified using the QIAquickT"' method (Qiagen, Chatsworth,
CA). The DNA probe was radioactively labeled with3zP using
REDIPRIME~ DNA labeling system (Amersham, Arlington
Heights, Illinois) according to the manufacturer's
specifications. The probe was purified using a NUCTRAP
push column (Stratagene Cloning Systems, La Jolla, CA).
EXPRESSHYB (Clontech, Palo Alto, CA) solution was used for
prehybridization and as a hybridizing solution for the
Northern blots. Hybridization took place overnight at
65°C, and the blots were then washed in 2X SSC and 0.1% SDS
at room temperature, followed by two washes in O.1X SSC
and 0.1o SDS at 55°C and exposed to film for 48 hours.
There are two major transcripts at about 2 kb and 5 kb.
While the 2 kb transcript is the major transcript in
testis, the 5 kb transcript is the major transcript in the
other tissues including pancreas, liver, stomach and
thyroid. Signal intensity was highest for testis, with
relatively less intense signals in liver, thyroid and
stomach, and weak signals in small intestine, spleen,
prostate, thymus, spinal cord, trachea and lymph node.
A RNA Master Dot Blot (Clontech) that contained
RNAs from various tissues that were normalized to 8
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
100
housekeeping genes was also probed with the 120 by probe
(SEQ ID N0:5) described above. The blot was
prehybridized, hybridized and washed as described above.
After a 48 hour exposure, highest expression was seen in
the pancreas, with strong expression in testis and
stomach. A lower level of expression was seen in liver,
pituitary gland, thyroid gland and salivary gland. A
weaker signal was detected in adrenal gland, small
intestine, trachea, spleen, thymus, peripheral leukocyte,
lymph node and in fetal tissues.
Example 3
Chromosomal Assignment and Placement of Zsig49
Zsig49 was mapped to chromosome 1 using the both
the commercially available GeneBridge 4 Radiation Hybrid
Panel and Stanford G3 Radiation Hybrid (RH) panel
(Research Genetics, Inc., Huntsville, AL). The GeneBridge
4 Radiation Hybrid Panel contains PCRable DNAs from each
of 93 radiation hybrid clones, plus two control DNAs (the
HFL donor and the A23 recipient), while the Stanford G3 RH
panel contained PCRable DNAs from each of 83 radiation
hybrid clones, plus two control DNAs (the RM donor and the
A3 recipient). Publicly available WWW servers
(http://carbon.wi.mit.edu:8000/cgi-bin/contig/rhmapper.pl)
and (http://shgc-www.stanford.edu/RH/rhserverformnew.html)
allowed chromosomal localization in relationship to the
respective chromosomal frame work markers.
For the mapping of zsig49 with the GeneBridge 4
RH Panel and Stanford G3 RH panels, 20 ~l reactions were
set up in a 96-well microtiter plate (Stratagene, La
Jolla, CA) and used in a "RoboCycler Gradient 96" thermal
cycler (Stratagene). Each of the 95 PCR reactions
consisted of 2 ~,1 10X KlenTaq PCR reaction buffer
(Clontech), 1.6 ~.l dNTPs mix (2.5 mM each, PERKIN-ELMER,
Foster City, CA), 1 ~C1 sense primer, ZC 16,080 (SEQ ID
N0:7) , 1 ~,l antisense primer, ZC 16, 079 (SEQ ID N0:8) , 2
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
101
~,1 RediLoad (Research Genetics, Inc.), 0.4 ~1 50X
Advantage KlenTaq Polymerase Mix (Clontech), 25 ng of DNA
from an individual hybrid clone or control and ddH20 for a
total volume of 20 ~1. The reactions were overlaid with an
equal amount of mineral oil and sealed. The PCR cycler
conditions were as follows: an initial 1 cycle 5 minute
denaturation at 95°C, 35 cycles of a 1 minute denaturation
at 95°C, 1 minute annealing at 66°C and 1.5 minute
extension at 72°C, followed by a final 1 cycle extension of
7 minutes at 72°C. The reactions were separated by
electrophoresis on a 2% agarose gel (Life Technologies,
Gaithersburg, MD).
The results of the radiation hybrid mapping
showed that zsig49 maps 9.76 cR_3000 distal of the marker
D1S2635 on the GeneBridge 4 RH mapping panel and 62
cR 10,000 distal of the marker SHGC-6232 on the Stanford
G3 RH panel. Proximal and distal framework markers were
D1S2635 and CHLC.GATA70D01, respectively. The use of
surrounding markers positions zsig49 in the 1q24.1 region
on the integrated LDB chromosome 1 map (The Genetic
Location Database, University of Southhampton, WWW server:
http://cedar.genetics. soton.ac.uk/public html/).
In an autosomal genomic scan for loci linked to
type II diabetes mellitus and body-mass index in Pima
Indians (Hanson et al., Am. J. Hum. Genet. 63:1130-8,
1998) a potential diabetes-susceptibility locus was
identified on chromosome lq near the marker D1S1677. We
mapped D1S1677 on the Stanford G3 RH panel using similar
conditions as described above for zsig49 and found it to
map only 5 cR 10,000 (1 cR 10,000 - "'25 kb) proximal to
zsig49, making zsig49 a positional gene candidate for type
II diabetes mellitus locus.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
102
Example 4
Murine Zsig49 Ortholoa
The DNA sequence of human zsig49 (SEQ ID NO: l)
described above was used to search for murine orthologs.
A clone considered likely to contain a murine ortholog was
sequenced and an alignment with human zsig49 (SEQ ID NO: l)
indicated that the murine sequence was missing about 42 by
at 5'end. Two 5'RACE primers ZC24781 (SEQ ID N0:23) and
ZC24785 (SEQ ID N0:24) were designed according to murine
sequence. To a final volume of 25 ~l was added 3 ~.1 of
1/100 diluted marathon stomach or small intestine cDNA as
a template, 20 pmoles each of oligonucleotide primers
ZC9739 and ZC24785, and 1 U of ExTaq/Taq antibody(1:1).
The 5' RACE reactions were run as follows: 94°C for 2
minutes, followed by 5 cycles (94°C for 20 seconds, 65°C
for 30 seconds, 72°C for 30 seconds) followed by 30 cycles
(94°C for 20 seconds, 64°C for 30 seconds; 72°C for 30
seconds) followed by a 2 minute extension at 72°C. A second
round, nested PCR was then performed. To a final volume
of 25 ~1 was added 1 ~.1 of 1/50 diluted first PCR product
as template, 20 pmoles each of oligonucleotide primers
ZC9719 (SEQ ID N0:18) and ZC24781 (SEQ ID N0:23) and 1 U
of ExTaq/Taq antibody (1:1). The reactions were run as
follows: 94°C for 2 minutes, followed by 5 cycles (94°C for
20 seconds, 65°C for 30 seconds, 72°C for 30 seconds)
followed by 35 cycles (94°C for 20 seconds, 64°C for 30
seconds, 72°C and 30 seconds) followed by a 2 minutes
extension at 72°C. The second round nested PCR products
were purified and sequenced as described above. Comparison
of the murine DNA sequence (SEQ ID N0:12) with the human
zsig49 DNA sequence (SEQ ID N0:1) indicated that the human
sequence differed from the murine sequence by about 17 by
from the 5' end encoding the start Met.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
103
Example 5
Extension of Human Zsia49 cDNA Sequence
The alignment of the murine and human DNA
sequences indicated that the human sequence could be
extended further in the 3' direction. A series of 3'RACE
PCRs were carried out and extending the human cDNA
sequence to 1704 by (SEQ ID N0:9).
3' RACE primers ZC24645 (SEQ ID N0:15) and
ZC24646 (SEQ ID N0:16) were designed according to the
human zsig49 sequence described by SEQ ID NO:1. To a
final volume of 25 ~1 was added 3 ~l of a 1/100 dilution
of one of the following marathon cDNAs (human adrenal
gland, fetal liver, islet, pancreas, stomach, small
intestine and testis) as a template, 20 pmoles each of
oligonucleotide primers ZC9739 (SEQ ID N0:17) and ZC24645
(SEQ ID N0:15), and 1 U of ExTaq/Taq antibody(l:l). The
reactions were run as follows: 94°C for 2 minutes, followed
by 5 cycles (94°C for 20 seconds, 67°C for 1 minute)
followed by 35 cycles (94°C for 20 seconds, 64°C for 30
seconds; 72°C for 1 minute) followed by a 5 minutes
extension at 72°C. To 25 ~,l of a second round, nested PCR
reaction was added 1 ~l each of a 1/50 diluted first round
PCR product as template, 20 pmoles each of oligonucleotide
primers ZC9719 (SEQ ID N0:18) and ZC24646 (SEQ ID N0:16)
and 1 U of ExTaq/Taq antibody(1:1). The reactions were run
as follows: 94°C for 2 minutes, followed by 5 cycles (94°C
for 20 seconds; 69°C for 1 minute) ; followed by 35 cycles
(94°C for 20 seconds, 64°C for 30 seconds; 69°C for 1
minute) followed by a 5 minutes extension at 69°C. The
second round, nested PCR products were separated on an
agarose gel and purified with Qiaquick (Qiagen) gel
purification kit. Purified PCR products generated from the
small intestine and stomach templates were sequenced as
described above. Sequence indicating the PCR product
extended and diverged from original zsig49 clone at
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
104
nucleotide 389 of SEQ ID N0:1 and continued for about 400
by before hitting an intron.
Three additional rounds of 3' RACE were
performed as described above using primers ZC24780 (SEQ ID
N0:19), ZC24779 (SEQ ID N0:20), ZC24965 (SEQ ID N0:21),
and ZC25142 (SEQ ID N0:22) designed from newly extended
sequence. Marathon cDNA from stomach and small intestine
was used as a template. Sequencing of the resulting PCR
products was done as described above. The resulting 1,704
by sequence is disclosed in SEQ ID N0:9 which contains a
polynucleotide sequence that encodes the polypeptide of
SEQ ID N0:2.
From the foregoing, it will be appreciated that,
although specific embodiments of the invention have been
described herein for purposes of illustration, various
modifications may be made without deviating from the
spirit and scope of the invention. Accordingly, the
invention is not limited except as by the appended claims.
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
1
SEQUENCE LISTING
<110> ZymoGenetics. Inc.
<120> SECRETED PROTEIN ZSIG49
<130> 98-30PC
<150> 09/176,545
<151> 1998-10-21
<160> 24
<170> FastSEQ for Windows Version 3.0
<210>1
<211>952
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (158)...(388)
<400> 1
ttggggaaag agtcgcctgc ctccggaccg gagtgcagac ctctgaccct ggagtcgctc 60
ggccgctggg aaccgtcccc ttgggtcgtc gcctgggccg cccgtcgttc cccggccccg 120
aggggtccgg ctggccgcgg tgtgggtaga ggtcagc atg agc caa ggg gtc cgc 175
Met Ser Gln Gly Val Arg
1 5
cgg gca ggc get ggg cag ggg gta gcg gcc gcg gtg cag ctg ctg gtc 223
Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln Leu Leu Val
15 20
acc ctg agc ttc ctg cgg agc gtc gtc gag gcg cag gtc act gga gtt 271
Thr Leu Ser Phe Leu Arg Ser Val Val Glu Ala Gln Val Thr Gly Val
25 30 35
ctg gat gat tgc ttg tgt gat att gac age atc gat aac ttc aat acc 319
Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn Phe Asn Thr
40 45 50
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
2
tac aaa atc ttc ccc aaa ata aaa aaa ttg caa gag aga gac tat ttt 367
Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe
55 60 65 70
cgt tat tac aag gta agg ttg taatttttta ttctgttgat atcaaaggtt 418
Arg Tyr Tyr Lys Ual Arg Leu
tatatgtgacctttatgatccttttgaaagcccatttcagttcctctcagcaccttgtgt 478
atatctttcatcactgaatttattatgtattgcagtggaaacctattgatctttttaaac 538
agtacaaatcttagcccccttcctttgtatggggagttcctcatttttcagttttggttt 598
ttaggcagagactactgtctctatagaagctgaaaatgccacagacttactttgtcagcc 658
tctcttataacatagttctgccatctggacacacctactcagcctttgagttgtgctgat 718
gtcagtgtgctagcattgttagtggaaaggaccacagcagcatctttgttggacctcttt 778
ctgagagggctggcaaaacaggctgaggctccaagtagaccactaccgacagtgatgctc 838
cagaattggttcttaaatctagtaatagtctactctagacctttacaaaataaccggtga 898
tactttaaaggcagcgagtccctgcaacagcaataaacttccttctcctcggga 952
<210>2
<211>77
<212>PRT
<213>Homo sapiens
<400> 2
Met Ser Gln Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala
1 5 10 15
Ala Val Gln Leu Leu Val Thr Leu Ser Phe Leu Arg Ser Val Val Glu
20 25 30
Ala Gln Val Thr Gly Val Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser
35 40 45
Ile Asp Asn Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu
50 55 60
Gln Glu Arg Asp Tyr Phe Arg Tyr Tyr Lys Val Arg Leu
65 70 75
<210> 3
<211> 15
<212> PRT
<213> Artificial Sequence
<220>
<223> Cleavage site
<400> 3
Leu Leu Thr Leu Ala Leu Leu Gly Gly Pro Thr Trp Ala Gly Lys
_. CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
3
1 5 10 15
<210> 4
<211> 231
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide sequence encoding the zsig49
polypeptide of SEQ ID N0:2.
<221> variation
<222> (1)...(231)
<223> Each N is independently any nucleotide.
<400> 4
atgwsncarg gngtnmgnmg ngcnggngcn ggncarggng tngcngcngc ngtncarytn 60
ytngtnacny tnwsnttyyt nmgnwsngtn gtngargcnc argtnacngg ngtnytngay 120
gaytgyytnt gygayathga ywsnathgay aayttyaaya cntayaarat httyccnaar 180
athaaraary tncargarmg ngaytaytty mgntaytaya argtnmgnyt n 231
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC14887
<400> 5
tcgatgctgt caatatcaca ca 22
<210> 6
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC16136
<400> 6
tgtgggtata agtcagcatg agccaagggg tccgccgggc aggcgctg 48
<210> 7
<211> 18
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
4
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC16080
<400> 7
aggggtgcag gtggtaga 18
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC16079
<400> 8
tcccgaacag ccatcatt 18
<210>9
<211>1704
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (167)...(1567)
<400> 9
ggcacgaggt tggggaaaga gtcgcctgcc tccggaccgg agtgcagacc tctgaccctg 60
gagtcgctcg gccgctggga accgtcccct tgggtcgtcg cctgggccgc ccgtcgttcc 120
ccggccccga ggggtccggc tggccgcggt gtgggtagag gtcagc atg agc caa 175
Met Ser Gln
1
ggg gtc cgc cgg gca ggc get ggg cag ggg gta gcg gcc gcg gtg cag 223
Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln
10 15
ctg ctg gtc acc ctg agc ttc ctg cgg agc gtc gtc gag gcg cag gtc 271
Leu Leu Ual Thr Leu Ser Phe Leu Arg Ser Val Val Glu Ala Gln Val
20 25 30 35
act gga gtt ctg gat gat tgc ttg tgt gat att gac agc atc gat aac 319
_. CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
Thr Gly Val Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn
40 45 50
ttc aat acc tac aaa atc ttc ccc aaa ata aaa aaa ttg caa gag aga 367
Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg
55 60 65
gac tat ttt cgt tat tac aag gtt aat ctg aag cga cct tgt cct ttc 415
Asp Tyr Phe Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe
70 75 80
tgg gca gaa gat ggc cac tgt tca ata aaa gac tgt cat gtg gag ccc 463
Trp Ala Glu Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro
85 90 95
tgt cca gag agt aaa att ccg gtt gga ata aaa get ggg cat tct aat 511
Cys Pro Glu Ser Lys Ile Pro Val Gly Ile Lys Ala Gly His Ser Asn
100 105 110 115
aag tac ttg aaa atg gca aac aat acc aaa gaa tta gaa gat tgt gag 559
Lys Tyr Leu Lys Met Ala Asn Asn Thr Lys Glu Leu Glu Asp Cys Glu
120 125 130
caa get aat aaa ctg gga gca att aac agc aca tta agt aat caa agc 607
Gln Ala Asn Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Gln Ser
135 140 145
aaa gaa get ttc att gac tgg gca aga tat gat gat tca cgg gat cac 655
Lys Glu Ala Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Arg Asp His
150 155 160
ttt tgt gaa ctt gat gat gag aga tct cca get get cag tat gta gac 703
Phe Cys Glu Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Val Asp
165 170 175
cta ttg ctg aac cca gag cgt tac act ggc tat aaa ggg acc tct gca 751
Leu Leu Leu Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Thr Ser Ala
180 185 190 195
tgg aga gtg tgg aac agc atc tat gaa gag aac tgt ttc aag cct cga 799
Trp Arg Val Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg
200 205 210
tct gtt tat cgt cct tta aat cct ctg gcg cct agc cga ggc gaa gat 847
Ser Val Tyr Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
6
215 220 225
gat gga gaa tca ttc tac aca tgg cta gaa ggt ttg tgt ctg gag aaa 895
Asp Gly Glu Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys
230 235 240
aga gtc ttc tat aag ctt ata tcg gga ctt cat get agc atc aat tta 943
Arg Val Phe Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu
245 250 255
cat cta tgc gca aat tat ctt ttg gaa gaa acc tgg ggt aag ccc agt 991
His Leu Cys Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser
260 265 270 275
tgg gga cct aat att aaa gaa ttc aaa cac cgc ttt gac cct gtg gaa 1039
Trp Gly Pro Asn Ile Lys Glu Phe Lys His Arg Phe Asp Pro Val Glu
280 285 290
acc aag gga gaa ggt cca aga agg ctc aag aat ctt tac ttt tta tac 1087
Thr Lys Gly Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr
295 300 305
ttg att gag ctt cga get ttg tca aag gtg get cca tat ttt gag cgc 1135
Leu Ile Glu Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr Phe Glu Arg
310 315 320
tca att gtc gat ctt tac act gga aat gca gaa gaa gat get gac aca 1183
Ser Ile Val Asp Leu Tyr Thr Gly Asn Ala Glu Glu Asp Ala Asp Thr
325 330 335
aaa act ctt cta ctg aat atc ttt caa gat aca aag tcc ttt ccc atg 1231
Lys Thr Leu Leu Leu Asn Ile Phe Gln Asp Thr Lys Ser Phe Pro Met
340 345 350 355
cac ttt gat gag aaa tcc atg ttt gca ggt gac aaa aaa ggg gcc aag 1279
His Phe Asp Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys
360 365 370
tca cta aag gag gaa ttc cga tta cat ttc aag aat atc tcc cgt ata 1327
Ser Leu Lys Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile
375 380 385
atg gac tgt gtt gga tgt gac aaa tgc aga tta tgg gga aaa tta cag 1375
Met Asp Cys Ual Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln
390 395 400
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
7
act cag ggt tta gga act gcc ctg aag ata tta ttc tct gaa aaa gaa 1423
Thr Gln Gly Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu
405 410 415
atc caa aag ctt cca gag aat agt cca tct aaa ggc ttc caa ctc acc 1471
Ile Gln Lys Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr
420 425 430 435
cga cag gaa ata gtt get ctt tta aat get ttt gga agg ctt tct aca 1519
Arg Gln Glu Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr
440 445 450
agt ata aga gac tta cag aat ttt aaa gtc tta tta caa cac agt agg 1567
Ser Ile Arg Asp Leu Gln Asn Phe Lys Val Leu Leu Gln His Ser Arg
455 460 465
taataaaggc ttttatgtgt ctaactagag acataaagtg actgtggaaa gccttttaat 1627
tatggacatt catcagaaag acactaatct gacttcaaga attctgaact attaaataga 1687
aaatttaaat gctcaac 1704
<210>10
<211>467
<212>PRT
<213>Homo sapiens
<400> 10
Met Ser Gln Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala
1 5 10 15
Ala Val Gln Leu Leu Val Thr Leu Ser Phe Leu Arg Ser Ual Val Glu
20 25 30
Ala Gln Val Thr Gly Ual Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser
35 40 45
Ile Asp Asn Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu
50 55 60
Gln Glu Arg Asp Tyr Phe Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro
65 70 75 80
Cys Pro Phe Trp Ala Glu Asp Gly His Cys Ser Ile Lys Asp Cys His
85 90 95
Ual Glu Pro Cys Pro Glu Ser Lys Ile Pro Val Gly Ile Lys Ala Gly
100 105 110
His Ser Asn Lys Tyr Leu Lys Met Ala Asn Asn Thr Lys Glu Leu Glu
115 120 125
Asp Cys Glu Gln Ala Asn Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser
130 135 140
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
8
Asn Gln Ser Lys Glu Ala Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser
145 150 155 160
Arg Asp His Phe Cys Glu Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln
165 170 175
Tyr Val Asp Leu Leu Leu Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly
180 185 190
Thr Ser Ala Trp Arg Val Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe
195 200 205
Lys Pro Arg Ser Val Tyr Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg
210 215 220
Gly Glu Asp Asp Gly Glu Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys
225 230 235 240
Leu Glu Lys Arg Val Phe Tyr Lys Leu Ile Ser Gly Leu His Ala Ser
245 250 255
Ile Asn Leu His Leu Cys Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly
260 265 270
Lys Pro Ser Trp Gly Pro Asn Ile Lys Glu Phe Lys His Arg Phe Asp
275 280 285
Pro Val Glu Thr Lys Gly Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr
290 295 300
Phe Leu Tyr Leu Ile Glu Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr
305 310 315 320
Phe Glu Arg Ser Ile Val Asp Leu Tyr Thr Gly Asn Ala Glu Glu Asp
325 330 335
Ala Asp Thr Lys Thr Leu Leu Leu Asn Ile Phe Gln Asp Thr Lys Ser
340 345 350
Phe Pro Met His Phe Asp Glu Lys Ser Met Phe Ala Gly Asp Lys Lys
355 360 365
Gly Ala Lys Ser Leu Lys Glu Glu Phe Arg Leu His Phe Lys Asn Ile
370 375 380
Ser Arg Ile Met Asp Cys Val Gly Cys Asp Lys Cys Arg Leu Trp Gly
385 390 395 400
Lys Leu Gln Thr Gln Gly Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser
405 410 415
Glu Lys Glu Ile Gln Lys Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe
420 425 430
Gln Leu Thr Arg Gln Glu Ile Val Ala Leu Leu Asn Ala Phe Gly Arg
435 440 445
Leu Ser Thr Ser Ile Arg Asp Leu Gln Asn Phe Lys Val Leu Leu Gln
450 455 460
His Ser Arg
465
<210> 11
<211> 1401
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
9
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate polynucleotide encoding the polypeptide
of SEQ ID N0:10
<221> variation
<222> (1)...(1401)
<223> Each N is independently T, A, G, or C.
<400> 11
atgwsncarggngtnmgnmgngcnggngcnggncarggngtngcngcngcngtncarytn60
ytngtnacnytnwsnttyytnmgnwsngtngtngargcncargtnacnggngtnytngay120
gaytgyytntgygayathgaywsnathgayaayttyaayacntayaarathttyccnaar180
athaaraarytncargarmgngaytayttymgntaytayaargtnaayytnaarmgnccn240
tgyccnttytgggcngargayggncaytgywsnathaargaytgycaygtngarccntgy300
ccngarwsnaarathccngtnggnathaargcnggncaywsnaayaartayytnaaratg360
gcnaayaayacnaargarytngargaytgygarcargcnaayaarytnggngcnathaay420
wsnacnytnwsnaaycarwsnaargargcnttyathgaytgggcnmgntaygaygaywsn480
mgngaycayttytgygarytngaygaygarmgnwsnccngcngcncartaygtngayytn540
ytnytnaayccngarmgntayacnggntayaarggnacnwsngcntggmgngtntggaay600
wsnathtaygargaraaytgyttyaarccnmgnwsngtntaymgnccnytnaayccnytn660
gcnccnwsnmgnggngargaygayggngarwsnttytayacntggytngarggnytntgy720
ytngaraarmgngtnttytayaarytnathwsnggnytncaygcnwsnathaayytncay780
ytntgygcnaaytayytnytngargaracntggggnaarccnwsntggggnccnaayath840
aargarttyaarcaymgnttygayccngtngaracnaarggngarggnccnmgnmgnytn900
aaraayytntayttyytntayytnathgarytnmgngcnytnwsnaargtngcnccntay960
ttygarmgnwsnathgtngayytntayacnggnaaygcngargargaygcngayacnaar1020
acnytnytnytnaayathttycargayacnaarwsnttyccnatgcayttygaygaraar1080
wsnatgttygcnggngayaaraarggngcnaarwsnytnaargargarttymgnytncay1140
ttyaaraayathwsnmgnathatggaytgygtnggntgygayaartgymgnytntggggn1200
aarytncaracncarggnytnggnacngcnytnaarathytnttywsngaraargarath1260
caraarytnccngaraaywsnccnwsnaarggnttycarytnacnmgncargarathgtn1320
gcnytnytnaaygcnttyggnmgnytnwsnacnwsnathmgngayytncaraayttyaar1380
gtnytnytncarcaywsnmgn 1401
<210>12
<211>1584
<212>DNA
<213>Mus musculus
<220>
<221> CDS
<222> (1)...(1383)
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
<400> 12
cgg gcc gtt act ggg cag ggg gcg gcg gcc gcg gtg caa ctg ctt gtc 48
Arg Ala Ual Thr Gly Gln Gly Ala Ala Ala Ala Val Gln Leu Leu Val
1 5 10 15
acc ctg agc ttc ctc tca agt ctg gtc aag act cag gtg act gga gtt 96
Thr Leu Ser Phe Leu Ser Ser Leu Val Lys Thr Gln Val Thr Gly Val
25 30
ctg gat gat tgc tta tgt gac att gac agc att gat aaa ttc aac acc 144
Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Lys Phe Asn Thr
35 40 45
tac aaa atc ttt ccc aaa ata aag aag tta caa gaa cga gac tat ttt 192
Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe
50 55 60
cgt tat tac aag gtt aat ctg aaa cga cca tgt cct ttc tgg gca gaa 240
Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe Trp Ala Glu
65 70 75 80
gat ggc cac tgc tca ata aaa gac tgt cat gtg gag ccc tgt cca gaa 288
Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro Cys Pro Glu
85 90 95
agt aaa att cca gtt gga att aaa gcc ggg cgt tca aat aag tac tcg 336
Ser Lys Ile Pro Val Gly Ile Lys Ala Gly Arg Ser Asn Lys Tyr Ser
100 105 110
caa gca gca aac agc acc aaa gaa ctg gat gac tgt gag cag get aac 384
Gln Ala Ala Asn Ser Thr Lys Glu Leu Asp Asp Cys Glu Gln Ala Asn
115 120 125
aaa ctg ggc gcc atc aac agc acg cta agt aac gaa agc aaa gaa gcg 432
Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Glu Ser Lys Glu Ala
130 135 140
ttc att gac tgg gcg aga tat gat gat tcg cag gac cac ttt tgt gaa 480
Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Gln Asp His Phe Cys Glu
145 150 155 160
ctt gat gat gag cgg tct cct get gca cag tat gtg gac ctg ctg ctg 528
Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Val Asp Leu Leu Leu
165 170 175
CA 02364330 2001-10-04
WO 00/23591 PCTNS99/24579
11
aac ccg gaa cgg tac act ggc tac aag ggc tcc tca gca tgg agg gtg 576
Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Ser Ser Ala Trp Arg Val
180 185 190
tgg aac agc atc tat gaa gaa aac tgc ttc aag cct cga tct gtt tat 624
Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg Ser Val Tyr
195 200 205
cgt cct tta aat cct ttg gcg ccc agc aga ggg gaa gat gat gga gaa 672
Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp Asp Gly Glu
210 215 220
tca ttc tat acg tgg cta gaa ggt ttg tgt ctt gag aaa aga gtc ttc 720
Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys Arg Val Phe
225 230 235 240
tat aag ctt ata tca gga ctc cat gcc agc atc aat tta cat ctg tgt 768
Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu His Leu Cys
245 250 255
gca aac tac ctt ctg gaa gaa acc tgg ggg aaa cct agt tgg gga cca 816
Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser Trp Gly Pro
260 265 270
aac atc aag gag ttt aga cgc cgc ttt gac cct gtg gaa aca aag ggg 864
Asn Ile Lys Glu Phe Arg Arg Arg Phe Asp Pro Val Glu Thr Lys Gly
275 280 285
gaa ggt cca agg agg cta aag aac ctg tac ttt tta tac ttg ata gag 912
Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr Leu Ile Glu
290 295 300
ctc cgt get ttg tca aag gtg gcc cct tac ttt gag cgc tcg att gtt 960
Leu Arg Ala Leu Ser Lys Ual Ala Pro Tyr Phe Glu Arg Ser Ile Val
305 310 315 320
gat ctc tat act ggc aat gtg gaa gat gat gcc gac acc aag acc ctt 1008
Asp Leu Tyr Thr Gly Asn Val Glu Asp Asp Ala Asp Thr Lys Thr Leu
325 330 335
ctg ctc agc atc ttt cag gat aca aag tcc ttt cct atg cac ttc gat 1056
Leu Leu Ser Ile Phe Gln Asp Thr Lys Ser Phe Pro Met His Phe Asp
340 345 350
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
12
gag aaa tcc atg ttt gca ggt gac aaa aag ggg gcc aag tca tta aag 1104
Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys Ser Leu Lys
355 360 365
gaa gaa ttc cgg tta cat ttc aag aac atc tcc cgg atc atg gac tgt 1152
Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile Met Asp Cys
370 375 380
gtt ggg tgc gat aaa tgc aga ctg tgg ggg aaa ctg cag act cag ggt 1200
Val Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln Thr Gln Gly
385 390 395 400
tta gga act gcc ttg aag atc ctc ttc tct gaa aag gaa atc caa aac 1248
Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu Ile Gln Asn
405 410 415
ctt ccg gag aac agc cca tcc aaa ggc ttc cag ctc act cgg cag gaa 1296
Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr Arg Gln Glu
420 425 430
atc gtt get ctt tta aat get ttt gga aga ctt tct aca agc ata aga 1344
Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr Ser Ile Arg
435 440 445
gaa tta cag aac ttt aaa gcg ttg ttg cag cac agg agg taatgaagac 1393
Glu Leu Gln Asn Phe Lys Ala Leu Leu Gln His Arg Arg
450 455 460
ttttctatgt cttcatagac atagcagact gtatgaagcc ttttagcctt ggacactggg 1453
caaagagact acatgtctaa gacttcaaga attctgaact ctttaagaga aaattcaaat 1513
gtccacttga atatttatga tctttaatag aataccaatt agagatattt ataaatcctc 1573
1584
gtgccgaatt c
<210>13
<211>461
<212>PRT
<213>Mus musculus
<400> 13
Arg.Ala Val Thr Gly Gln Gly Ala Ala Ala Ala Ual Gln Leu Leu Val
1 5 10 15
Thr Leu Ser Phe Leu Ser Ser Leu Val Lys Thr Gln Val Thr Gly Val
20 25 30
Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Lys Phe Asn Thr
35 40 45
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
13
Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe
50 55 60
Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe Trp Ala Glu
65 70 75 80
Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro Cys Pro Glu
85 90 95
Ser Lys Ile Pro Val Gly Ile Lys Ala Gly Arg Ser Asn Lys Tyr Ser
100 105 110
Gln Ala Ala Asn Ser Thr Lys Glu Leu Asp Asp Cys Glu Gln Ala Asn
115 120 125
Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Glu Ser Lys Glu Ala
130 135 140
Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Gln Asp His Phe Cys Glu
145 150 155 160
Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Ual Asp Leu Leu Leu
165 170 175
Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Ser Ser Ala Trp Arg Val
180 185 190
Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg Ser Val Tyr
195 200 205
Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp Asp Gly Glu
210 215 220
Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys Arg Val Phe
225 230 235 240
Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu His Leu Cys
245 250 255
Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser Trp Gly Pro
260 265 270
Asn Ile Lys Glu Phe Arg Arg Arg Phe Asp Pro Val Glu Thr Lys Gly
275 280 285
Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr Leu Ile Glu
290 295 300
Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr Phe Glu Arg Ser Ile Val
305 310 315 320
Asp Leu Tyr Thr Gly Asn Val Glu Asp Asp Ala Asp Thr Lys Thr Leu
325 330 335
Leu Leu Ser Ile Phe Gln Asp Thr Lys Ser Phe Pro Met His Phe Asp
340 345 350
Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys Ser Leu Lys
355 360 365
Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile Met Asp Cys
370 375 380
Val Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln Thr Gln Gly
385 390 395 400
Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu Ile Gln Asn
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
14
405 410 415
Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr Arg Gln Glu
420 425 430
Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr Ser Ile Arg
435 440 445
Glu Leu Gln Asn Phe Lys Ala Leu Leu Gln His Arg Arg
450 455 460
<210> 14
<211> 1383
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate polynucleotide encoding the polypeptide
of SEQ ID N0:13
<221> variation
<222> (1)...(1383)
<223> Each N is independently A, T. G, or C.
<400>
14
mgngcngtnacnggncarggngcngcngcngcngtncarytnytngtnacnytnwsntty60
ytnwsnwsnytngtnaaracncargtnacnggngtnytngaygaytgyytntgygayath120
gaywsnathgayaarttyaayacntayaarathttyccnaarathaaraarytncargar180
mgngaytayttymgntaytayaargtnaayytnaarmgnccntgyccnttytgggcngar240
gayggncaytgywsnathaargaytgycaygtngarccntgyccngarwsnaarathccn300
gtnggnathaargcnggnmgnwsnaayaartaywsncargcngcnaaywsnacnaargar360
ytngaygaytgygarcargcnaayaarytnggngcnathaaywsnacnytnwsnaaygar420
wsnaargargcnttyathgaytgggcnmgntaygaygaywsncargaycayttytgygar480
ytngaygaygarmgnwsnccngcngcncartaygtngayytnytnytnaayccngarmgn540
tayacnggntayaarggnwsnwsngcntggmgngtntggaaywsnathtaygargaraay600
tgyttyaarccnmgnwsngtntaymgnccnytnaayccnytngcnccnwsnmgnggngar660
gaygayggngarwsnttytayacntggytngarggnytntgyytngaraarmgngtntty720
tayaarytnathwsnggnytncaygcnwsnathaayytncayytntgygcnaaytayytn780
ytngargaracntggggnaarccnwsntggggnccnaayathaargarttymgnmgnmgn840
ttygayccngtngaracnaarggngarggnccnmgnmgnytnaaraayytntayttyytn900
tayytnathgarytnmgngcnytnwsnaargtngcnccntayttygarmgnwsnathgtn960
gayytntayacnggnaaygtngargaygaygcngayacnaaracnytnytnytnwsnath1020
ttycargayacnaarwsnttyccnatgcayttygaygaraarwsnatgttygcnggngay1080
aaraarggngcnaarwsnytnaargargarttymgnytncayttyaaraayathwsnmgn1140
athatggaytgygtnggntgygayaartgymgnytntggggnaarytncaracncarggn1200
ytnggnacngcnytnaarathytnttywsngaraargarathcaraayytnccngaraay1260
wsnccnwsnaarggnttycarytnacnmgncargarathgtngcnytnytnaaygcntty1320
ggnmgnytnwsnacnwsnathmgngarytncaraayttyaargcnytnytncarcaymgn1380
_ CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
mgn 1383
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24645
<400> 15
tgctggtcac cctgagcttc ctg 23
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24646
<400> 16
tcgaggcgca ggtcactgga gtt 23
<210> 17
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC9739
<400> 17
ccatcctaat acgactcact atagggc 27
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC9719
<400> 18
actcactata gggctcgagc ggc 23
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
16
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24780
<400> 19
tagacctatt gctgaaccca gagcg 25
<210> 20
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24779
<400> 20
cactggctat aaagggacct ctgca 25
<210> 21
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24965
<400> 21
gccgaggcga agatgatgga gaatc 25
<210> 22
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC25142
<400> 22
agaatatctc ccgtataatg gactgtgttg g 31
CA 02364330 2001-10-04
WO 00/23591 PCT/US99/24579
17
<210> 23
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24781
<400> 23
gaggaagctc agggtgacaa gcagt 25
<210> 24
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC24785
<400> 24
gcaatcatcc agaactccag tcacc 25
