Note: Descriptions are shown in the official language in which they were submitted.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
1
PLANT LIGAND-GATED ION CHANNELS
CROSS-REFERENCE TO RELATED APPLICATIONS
s The present application claims the benefit of U.S. Provisional Patent
Application Serial Number 60/122,506, filed on March 2, 1999,which is
hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
to The amino acid ~aminobutyric acid (GABA) is the major
neurotransmitter in the mammalian central nervous system. Such
neurotransmitters generally function in regulating the conductance of ions
across neuronal membranes, typically in regulating influx of ions into a cell.
For example, GABA is considered an inhibitory neurotransmitter which acts
is to inhibit synaptic transmission in both vertebrate and invertebrate
nervous
systems. As another example, glutamate is an excitatory neurotransmitter
that depolarizes the postsynaptic membrane and acts to promote synaptic
transmission. Both GAGA and glutamate affect synaptic transmission by
binding to their respective receptors, also known as ligand-gated ion
2o channels.
These ligand-gated ion channels are present in neurons of insects
and animals. Three general classes of GABA receptors, denoted GABAA,
GABAB and GABAc, are present in animal neurons. GABA receptors have
been implicated in mediating anxiety, seizures, cognitive function, addictive
2s disorders, sleep disorders and other disorders of the central nervous
system. GABA receptors are the target of many pharmaceutical
preparations which act on the central nervous system, including
barbiturates and benzodiazepenes, and thus have therapeutic value.
Furthermore, compounds which affect the function of insect GABA
30 - receptors are commercially useful as insecticides.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
2
Although GABA receptors have been found in insects and in the
animal kingdom, they have yet to be discovered in the plant kingdom.
However, GABA has been shown to exert certain beneficial effects on
plants. For example, GABA has been shown to increase plant growth and
s productivity as shown in U.S. Patent No. 5,439,873 to Kinnersley.
Moreover, such beneficial effects have been increased when GABA is
applied to plants along with a readily metabolized source of carbon, such
as succinic acid (U.S. Patent No. 5,604,177). Moreover, GABA has been
found to increase fertilizer efficiency when administered with glutamic acid
to as described in U.S. Patent No. 5,840,656 to Kinnersley et al.
The mechanism of the above-described beneficial results of GABA
in plants has not yet been confirmed. A better understanding of the
mechanism of GABA-mediated plant growth and productivity may lead to
further methods for improving plant growth, productivity, and other
Is beneficial effects.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
3
SUMMARY OF THE INVENTION
Nucleotide sequences expected to encode ligand-gated ion channel
proteins, such as glutamate and/or GABA receptor proteins, have been
discovered in plants. Accordingly, the present invention provides these
s purified plant proteins, including recombinant proteins, nucleotide
sequences encoding the proteins and methods of using the nucleotide
sequences and proteins.
In one aspect of the invention, methods of transforming a plant are
provided. In one form of the invention, a method includes introducing into a
io plant cell a nucleic acid molecule encoding a plant protein described
herein.
In a second aspect of the invention, methods of treating a plant are
provided that include providing a plant having an introduced nucleotide
sequence encoding a plant protein described herein and treating the plant
is with an effective amount of GABA. The plant may further be treated with a
composition including GABA and a GABA agonist or may be treated only
with a GABA antagonist or GABA agonist.
In a third aspect of the invention, methods of regulating plant
metabolism include utilizing antisense DNA or RNA to reduce formation of
2o a plant protein or RNA transcript, such as a mRNA transcript. In one
embodiment, the method includes introducing into a plant cell an antisense
nucleic acid molecule having a nucleotide sequence that is complementary
to the nucleotide sequences described herein, or portions thereof, that is
expected to encode a plant GABA receptor. Alternatively, the antisense
2s nucleic acid molecule includes a nucleotide sequence complementary to an
RNA sequence, preferably a mRNA sequence, transcribed from the
sequences described herein. The antisense nucleotide sequence
hybridizes to nucleic acid, including either the template strand or the RNA
transcript, of the plant to reduce formation of a plant protein described
3o herein.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
In a fourth aspect of the invention, methods of identifying potential
plant receptors are provided that include hybridizing to plant nucleic acid a
probe having a nucleotide sequence encoding the proteins described
herein.
In a fifth aspect of the invention, methods of expressing plant
proteins described herein are provided. In one embodiment, a method
includes introducing into a host cell a nucleotide sequence expected to
encode a plant GABA receptor described herein and culturing under
conditions to achieve expression of the protein receptor.
io In further embodiments, isolated nucleic acid molecules, including
recombinant nucleic acid molecules, are provided that include nucleotide
sequences encoding plant proteins as described herein. Plant host cells
and transgenic plants are also provided that include nucleotide sequences
encoding the plant proteins described herein. The molecules, plant cells
is and transgenic plants further may include a foreign promoter sequence
operably linked to a terminal 5' end of the plant nucleotide sequences
described herein.
CA 02364596 2001-08-31
WO 00/52137 PCT/LJS00/05407
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts a graph showing the effect of baclofen, a GABA
agonist, on duckweed growth as more fully described in example 1.
s
FIG. 2 depicts a graph showing the effect of GABA antagonists
picrotoxin and bicuculline on duckweed growth as more fully described in
example 1.
io FIG. 3 depicts a graph showing the effect of GABA agonists and
antagonists on GABA-mediated growth promotion in Duckweed as more
fully described in example 1. BFN, baclofen; PIC, picrotoxin; 4-AB, y
aminobutyric acid.
is FIG. 4 depicts the phylogeny of bacterial periplasmic binding
proteins and eukaryotic receptors based on parsimony analysis of the N-
terminal (approximately one-third) amino acid sequences. Sequences
included in the phylogentic reconstruction were a bacterial periplasmic
binding protein, the animal ionotropic glutamate (iGLR), metabotropic
2o glutamate (mGLR), and 'y aminobutyric acids (GABA-BR) receptors, and
putative plant glutamate receptors (GLR). Lower case n designates N-
terminal sequences from amino acid residues 80 to 320. The abbreviations
and accession numbers for the mGLRs, GABA-BRs and the remaining
plant GLRs are as follows: human metabotropic glutamate receptor 1 alpha
2s (hummgluri alpn, ACC# U31215), human metabotropic glutamate receptor
1 beta (hummglurl betn, ACC# U31216), human glutamate receptor,
metabotropic 5 (hummglur5n, ACC# NM000842), rat metabotropic
glutamate receptor mGIuR5 (ratmglur5n, ACC# D10891 ), human glutamate
receptor, metabotropic 2 (hummglur2n, ACC# NM000839), human
3o glutamate receptor, metabotropic 3 (hummglur3n, ACC# NM000840),
human glutamate receptor, metabotropic 8 (hummglur8n, ACC# U92459),
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
6
mouse metabotropic glutamate receptor 8 (mousemglur8n, ACC# U17252),
human metabotropic glutamate receptor 7 (hummglur7n, ACC# U92458),
human metabotropic glutamate receptor 4 (hummglur4n, ACC# U92457),
rat metabotropic glutamate receptor 4 (ratmglur4n, ACC# M90518), human
s glutamate receptor, metabotropic 6 (hummglur6n, ACC# NM 000843),
human GABAB receptor subunit 1 a (humGABA-BR1 an, ACC# AJ012185),
rat GABAB receptor subunit 1 a (ratGABA-B1 an, ACC# Y10369), human
GABAB receptor subunit 1 b (humGABA-BR1 bn, ACC# AJ012186), rat
GABAB receptor subunit 1 b (ratGABA-B1 bn, ACC# Y10370), human
io GABAB receptor subunit 2 (humGABA-BR2n, ACC# AJ012188), rat GABA-
B R2 receptor (ratGABA-br2n2, ACC# AJ011318), rat GABA-B R2 receptor
(ratGABA-br2nl, ACC# AF07442), Arabidopsis putative glutamate receptor
2a (glr2an, ACC# AF079999), Arabidopsis putative glutamate receptor 2b
(glr2bn, ACC# AF038557), Arabidopsis putative glutamate receptor 5
is (glr5n, ACC# AL022604), Arabidopsis putative glutamate receptor 6 (glr6n,
ACC# AL022604), and Arabidopsis putative glutamate receptor 7 (glr7n,
ACC# AL031004). Other abbreviations are as defined in Chiu, J. et al.
( 1999) Mol. Biol. Evol. 16:826-838.
2o FIG. 5 shows a proposed evolutionary history of the bacterial
periplasmic binding proteins (BPBP), plant glutamate receptor (GLRs),
animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and
gamma-aminobutyric acide (GABA-BR) receptor genes as discussed in
example 4. 7-TMDP,a gene encoding a peptide with seven
2s transmembrane domains; GPCR-F4, family 4 of the G protein -coupled
receptors.
CA 02364596 2001-08-31
WO 00/52137 PCT/IJS00/05407
7
DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the purposes of promoting an understanding of the principles of
the invention, reference will now be made to preferred embodiments and
s specific language will be used to describe the same. It will nevertheless be
understood that no limitation of the scope of the invention is thereby
intended, such alterations and further modifications of the invention, and
such further applications of the principles of the invention as illustrated
herein, being contemplated as would normally occur to one skilled in the art
to to which the invention relates.
A nucleotide sequence has been found in Arabidopsis thaliana that
is expected to encode a plant GABA receptor protein. Accordingly, the
present invention provides purified GABA receptor proteins. The invention
further provides isolated nucleic acid molecules that include nucleotide
is sequences encoding plant GABA receptor proteins. Recombinant nucleic
acid molecules, plant host cells and transgenic plants are also provided
that include the nucleotide sequences encoding the plant GABA receptor
proteins. In other aspects of the invention, methods of expressing a
protein, such as a GABA receptor protein, and methods of using the
2o nucleotide and amino acid sequences described herein are also provided.
In a first aspect of the invention, purified plant proteins expected to
function as ligand-gated ion channel proteins in plants, such as GABA
receptor proteins, and therefore having the ability to regulate cellular ion
influx, are provided. The polypeptide receptors are substantially pure (i.e.,
2s the protein receptors are essentially free, e.g., at least about 95% free,
from other proteins with which they naturally occur). In preferred
embodiments, the amino acid sequence of a protein expected to function
as a ligand-gated ion channel protein in a plant, originally found in
Arabidopsis thaliana, is set forth in SEQ ID N0:1 or SEQ ID N0:2.
3o Although the invention is described with reference to Arabidopsis
thaliana amino acid sequences, it is understood that the invention is not
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
8
limited to the specific amino acid sequences set forth in SEQ ID NO:1 or
SEQ ID N0:2. Skilled artisans will recognize that, through the process of
mutation and/or evolution, polypeptides of different lengths and having
differing constituents, e.g., with amino acid insertions, substitutions,
s deletions, and the like, may arise that are related to, or sufficiently
similar
to, a sequence set forth herein by virtue of amino acid sequence homology
and advantageous functionality as described herein. The term "GABA
receptor protein" is used herein to refer generally to a protein having the
features described herein and preferred examples include polypeptides
io having the amino acid sequences set forth in SEQ ID N0:1 or SEQ ID
N0:2. Further included within this definition, and in the scope of the
invention, are variants of the polypeptide which function in regulating ion
movement into a cell, as described herein. Preferred proteins are
recombinant proteins.
is It is well known that plants of a wide variety of species commonly
express and utilize homologous proteins, which include the insertions,
substitutions and/or deletions discussed above, and yet which effectively
provide similar function. For example, an amino acid sequence isolated
from another species may differ to a certain degree from the sequences set
2o forth in SEQ ID NOS:1 and 2, and yet have similar functionality with
respect
to catalytic and regulatory function. Amino acid sequences comprising
such variations are included within the scope of the present invention and
are considered substantially or sufficiently similar to a reference amino acid
sequence. Although not being limited by theory, it is believed that the
2s identity between amino acid sequences that is necessary to maintain
proper functionality is related to maintenance of the tertiary structure of
the
polypeptide such that specific interactive sequences will be properly
located and will have the desired activity. Although it is not intended that
the present invention be limited by any theory by which it achieves its
3o advantageous result, it is contemplated that a polypeptide including these
CA 02364596 2001-08-31
WO 00/52137 PCT/iJS00/05407
9
interactive sequences in proper spatial context will have good activity, even
where alterations exist in other portions thereof.
In this regard, a variant of the proteins described herein is expected
to be functionally similar to that set forth in SEQ ID N0:1 or SEQ ID N0:2,
s for example, if it includes amino acids which are conserved among a
variety of plant species or if it includes non-conserved amino acids which
exist at a given location in another plant species that expresses the
proteins described herein.
Another manner in which similarity may exist between two amino
to acid sequences is where a given amino acid of one group (such as a non-
polar amino acid, an uncharged polar amino acid, a charged polar acidic
amino acid or a charged polar basic amino acid) is substituted with another
amino acid from the same amino acid group. For example, it is known that
the uncharged polar amino acid serine may commonly be substituted with
is the uncharged polar amino acid threonine in a polypeptide without
substantially altering the functionality of the polypeptide. Whether a given
substitution will affect the functionality of the enzyme may be determined
without undue experimentation using synthetic techniques and screening
assays known in the art.
2o The invention therefore also encompasses amino acid sequences
similar to the amino acid sequences set forth herein that have at least
about 60% identity thereto that preferably function in regulating cellular ion
influx. Preferably, inventive amino acid sequences have at least about
70% identity, further preferably at least about 80% identity, and most
2s preferably at least about 90% identity to these sequences.
Percent identity may be determined, for example, by comparing
sequence information using the MacVector computer program, version
6Ø1, available from Oxford Molecular Group, Inc. (Beaverton, OR).
Briefly, the MacVector program defines identity as the number of identical
3o aligned symbols (i.e., nucleotides or amino acids), divided by the total
number of symbols in the shorter of the two sequences. The program may
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
be used to determine percent identity over the entire length of the proteins
being compared. Preferred default parameters for the MacVector program
include: for pairwise alignment: (1 ) matrix = BLOSUM30; (2) Alignment
speed - fast; (3) Ktuple = 1; (4) Gap penalty = 1; Top diagonals = 5;
s Window size = 5; for multiple alignment: matrix = BLOSUM series, open
gap penalty = 10; extended gap penalty = 0.1, delay divergent = 40%;
protein gap parameters: Gap separation distance = 8; residue-specific
penalties = yes or on; hydrophilic residues = GPSNDQEKR.
In another aspect of the invention, isolated nucleic acid molecules,
to originally isolated from Arabidopsis thaliana, are provided that encode a
protein as described herein. The nucleotide sequences are set forth in
SEQ ID NOS:1 and 2, and sequences complementary to the specific
sequences shown therein are also encompassed in the invention. It is
preferred that the nucleotide sequence includes nucleotides spanning
is nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ
ID N0:2, or sequences having substantial similarity thereto or the selected
percent identities thereto as described below, as these regions have
homology to GABA receptor domains in animal GABA receptors. In one
form of the invention, an isolated nucleic acid molecule is provided that has
2o a nucleotide sequence encoding a protein having an amino acid sequence
having at least about 60%, preferably at least about 70%, more preferably
at least about 80% and most preferably at least about 90% identity to an
amino acid sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, or to an
amino acid sequence that includes amino acid 1 to amino acid 435, amino
2s acid 60 to amino acid 350, and amino acid 80 to amino acid 320 in SEQ ID
N0:1 or SEQ ID N0:2. It is not intended that the present invention be
limited to these exemplary nucleotide sequences, but include sequences
having substantial similarity thereto and sequences which encode variant
forms of the plant proteins described herein as discussed above and as
3o further discussed below.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
11
The term "isolated nucleic acid," as used herein, is intended to refer
to nucleic acid which is not in its native environment. For example, the
nucleic acid is separated from other contaminants that naturally accompany
it, such as proteins, lipids and other nucleic acid sequences. The term
s includes nucleic acid which has been removed or purified from its naturally-
occurring environment or clone library, and further includes recombinant or
cloned nucleic acid isolates and chemically synthesized nucleic acid.
The term "nucleotide sequence," as used herein, is intended to refer
to a natural or synthetic linear and sequential array of nucleotides and/or
to nucleosides, including deoxyribonucleic acid, ribonucleic acid, and
derivatives thereof. The terms "encoding" and "coding" refer to the process
by which a nucleotide sequence, through the mechanisms of transcription
and translation, provides the information to a cell from which a series of
amino acids can be assembled into a specific amino acid sequence to
is produce a functional polypeptide, such as, for example, an active enzyme
or other protein that has a specific function. The process of encoding a
specific amino acid sequence may involve DNA sequences having one or
more base changes (i.e., insertions, deletions, substitutions) that do not
cause a change in the encoded amino acid, or which involve base changes
2o which may alter one or more amino acids, but do not eliminate the
functional properties of the polypeptide encoded by the DNA sequence.
It is therefore understood that the invention encompasses more
than the specific exemplary nucleotide sequence encoding the proteins
described herein. For example, nucleic acid sequences encoding variant
2s amino acid sequences, as discussed above, are within the scope of the
invention. Modifications to a sequence, such as deletions, insertions, or
substitutions in the sequence, which produce "silent" changes that do not
substantially affect the functional properties of the resulting polypeptide
molecule are expressly contemplated by the present invention. For
3o example, it is understood that alterations in a nucleotide sequence which
reflect the degeneracy of the genetic code, or which result in the production
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
12
of a chemically equivalent amino acid at a given site, are contemplated.
Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may
be substituted by a codon encoding another less hydrophobic residue, such
as glycine, or a more hydrophobic residue, such as valine, leucine, or
s isoleucine. Similarly, changes which result in substitution of one
negatively
charged residue for another, such as aspartic acid for glutamic acid, or one
positively charged residue for another, such as lysine for arginine, can also
be expected to produce a biologically equivalent product.
Nucleotide changes which result in alteration of the N-terminal and
to C-terminal portions of the encoded polypeptide molecule would also not
generally be expected to alter the activity of the polypeptide. In some
cases, it may in fact be desirable to make mutations in the sequence in
order to study the effect of alteration on the biological activity of the
polypeptide. Each of the proposed modifications is well within the routine
is skill in the art.
In one preferred embodiment, the nucleotide sequence has
substantial similarity to the entire sequence set forth in SEQ ID N0:1 or
SEQ ID N0:2, and preferably the sequence spanning nucleotides 1 to 1305
in SEQ ID N0:1 or SEQ ID N0:2, and variants described herein. The term
20 "substantial similarity" is used herein with respect to a nucleotide
sequence
to designate that the nucleotide sequence has a sequence sufficiently
similar to a reference nucleotide sequence that it will hybridize therewith
under moderately stringent conditions. This method of determining
similarity is well known in the art to which the invention pertains. Briefly,
2s moderately stringent conditions are defined in Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd ed. Vol. 1, pp. 101-104, Cold Spring
Harbor Laboratory Press (1989) as including the use of a prewashing
solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5%
sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetraacetic acid
30 (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5x
SSC. A further requirement of the inventive polynucleotide is that it must
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
13
encode a polypeptide having similar functionality to the plant proteins
described herein.
In yet another embodiment, nucleotide sequences having selected
percent identities to specified regions of the nucleotide sequence set forth
s in SEQ ID N0:1 or SEQ ID N0:2 are provided. In one preferred form,
nucleotide sequences are provided that have at least about 70% identity,
more preferably at least about 80% identity, and most preferably at least
about 90% identity, to a nucleotide sequence of substantial length within
the nucleotide set forth in either SEQ ID N0:1 or SEQ ID N0:2. For
to example, such length may be no more than about 100, 200, 300, 800, 900
or 1400 nucleotides, or may be the entire sequence. In certain forms of the
invention, the nucleotide sequences have the percent identities mentioned
above to a nucleotide sequence spanning nucleotides 1 to 1305, 180 to
1050 or 240 to 960 as discussed above. A further requirement is that the
is nucleotide sequence set forth in SEQ ID N0:1 and SEQ ID N0:2 encodes
a protein that functions as described herein, i.e., one expected to regulate
ion influx into plant cells. Candidate ions whose entry may be regulated
include anions, such as chloride and cations, such as calcium, sodium, and
potassium. The percent identity may be determined, for example, by
ao comparing sequence information using the MacVector program, as
described above with reference to amino acid identity. Preferred default
parameters include: (1 ) for pairwise alignment parameters: (a) Ktuple = 1;
(b) Gap penalty = 1; (c) Window size = 4; and (2) for multiple alignment
parameters: (a) Open gap penalty = 10; (b) Extended gap penalty = 5; (c)
2s Delay divergent = 40%; and (d) transitions = weighted.
A suitable DNA sequence may be obtained by cloning techniques
using cDNA or genomic libraries of Arabidospis thaliana which are
available commercially or which may be constructed using standard
methods known in the art. Suitable nucleotide sequences may be isolated
3o from DNA libraries obtained from a wide variety of species by means of
nucleic acid hybridization or polymerase chain reaction (PCR) procedures,
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
14
using as probes or primers nucleotide sequences selected in accordance
with the invention, such as those set forth in SEQ ID N0:1 and SEQ ID
N0:2, nucleotide sequences having substantial similarity thereto, or
portions thereof. In preferred forms of the invention, the nucleotide
s sequences provided herein are cDNA sequences.
Alternately, a suitable sequence may be made by techniques which
are well known in the art. For example, nucleic acid sequences encoding a
plant protein described herein may be constructed by recombinant DNA
technology, for example, by cutting or splicing nucleic acids using
to restriction enzymes and DNA ligase. Furthermore, nucleic acid sequences
may be constructed using chemical synthesis, such as solid-phase
phosphoramidate technology, or PCR. PCR may also be used to increase
the quantity of nucleic acid produced. Moreover, if the particular nucleic
acid sequence is of a length which makes chemical synthesis of the entire
is length impractical, the sequence may be broken up into smaller segments
which may be synthesized and ligated together to form the entire desired
sequence by methods known in the art.
In a further aspect of the invention, recombinant nucleic acid
molecules, or recombinant vectors, are provided. In one embodiment, the
2o nucleic acid molecules include a nucleotide sequence encoding a protein
described herein. The nucleotide sequence has selected percent identities
described herein, or substantial similarity, both as defined above, to the
nucleotide sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, preferably
the sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in
2s SEQ ID N0:1 or SEQ ID N0:2. The protein produced has the amino acid
sequence set forth in SEQ ID N0:1, SEQ ID N0:2, or variants thereof as
described above.
A wide variety of vectors are known that have use in the invention.
For example, various plasmid and phage vectors are known that are ideally
3o suited for use in the invention, including AZap and pBluescript. In
preferred
embodiments, the vector may be a T-DNA vector. Representative T-DNA
CA 02364596 2001-08-31
WO 00/52137 PCT/US00105407
vector systems are discussed in the following publications: An et al.,
(1986) EMBO J. 4:277; Herrera-Estrella et al., (1983) EMBO J. 2:987;
Herrera-Estrella et al., (1985) in Plant Genetic Engineering, New York:
Cambridge University Press, p. 63.
s In one embodiment, the desired recombinant vector may be
constructed by ligating DNA linker sequences to the 5' and 3' ends of the
desired nucleotide insert, cleaving the insert with a restriction enzyme that
specifically recognizes sequences present in the linker sequences and the
desired vector, cleaving the vector with the same restriction enzyme,
to mixing the cleaved vector with the cleaved insert and using DNA ligase to
incorporate the insert into the vector as known in the art.
The vectors may include other nucleotide sequences, such as those
encoding selectable markers, including those for antibiotic resistance or
color selection. The vectors also preferably include a promoter nucleotide
is sequence. The desired nucleic acid insert is preferably operably linked to
the promoter. A nucleic acid is "operably linked" to a another nucleic acid
sequence, such as a promoter sequence, when it is placed in a specific
functional relationship with the other nucleic acid sequence. The functional
relationship between a promoter and a desired nucleic acid insert typically
zo involves the nucleic acid and the promoter sequences being contiguous
such that transcription of the nucleic acid sequence will be facilitated. Two
nucleic acid sequences are further said to be operably linked if the nature
of the linkage between the two sequences does not (1 ) result in the
introduction of a frame-shift-mutation; (2) interfere with the ability of the
2s promoter region sequence to direct the transcription of the desired
nucleotide sequence, or (3) interfere with the ability of the desired
nucleotide sequence to be transcribed by the promoter sequence region.
Typically, the promoter element is generally upstream (i.e., at the 5' end) of
the nucleic acid insert coding sequence.
so A wide variety of promoters are known in the art, including cell-
specific promoters, inducible promoters, and constitutive promoters. Any
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
16
promoter that directs transcription in plants cells may be used. The
promoters may be of viral, bacterial or eukaryotic origin, including those
from plants and plant viruses. For example, in certain preferred
embodiments, the promoter may be of viral origin, including a cauliflower
s mosaic virus promoter (CaMV), such as CaMV 35S or 19S, a figwort
mosaic virus promoter (FMV 35S), or the coat protein promoter of tobacco
mosaic virus (TMV). The promoter may further be, for example, a
promoter for the small subunit of ribulose-1,3-diphosphate carboxylase.
Promoters of bacterial origin include the octopine synthase promoter, the
to nopaline synthase promoter and other promoters derived from native Ti
plasmids as discussed in Herrera-Estrella et al., Nature, 303:209-213
(1983).
The promoter may further be one that responds to various forms of
environmental stresses, or other stimuli. For example, the promoter may
is be one induced by abiotic stresses such as wounding, cold, dessication,
ultraviolet-B [van Der Krol et al. (1999) Plant Physiol. 121:1153-1162], heat
shock (Shinmyo et al., (1998) Biotechnol. Bioeng. 58:329-332] or other heat
stress, drought stress or water stress. The promoter may further be one
induced by biotic stresses including pathogen stress, such as stress
2o induced by a virus (Sohal et al. (1999) Plant Mol. Biol. 41:75-87] or fungi
[Eulgem (1999) EMBO. J. 18:4689-4699], stresses induced as part of the
plant defense pathway [Lebel (1998) Plant J. 16:223-233] or by other
environmental signals, such as light [Ngai et al. (1997) Plant J. 12:1021-
1034; Sohal et al. (1999) Plant Mol. Biol. 41:75-87], carbon dioxide [Kucho
2s et al. (1999) Plant Physiol 121:1329-1338], hormones or other signaling
molecules such as auxin, hydrogen peroxide and salicylic acid [Chen and
Singh (1999) Plant J. 19:667-677], sugars and gibberellin [Lu et al. (1998)
J. Biol. Chem. 273:10120-10131 ] or abscissic acid and ethylene [Leubner-
Metzger et al. (1998) Plant Mol. Biol. 38:785-795].
3o The promoters may further be selected such that they require
activation by other elements known in the art, so that production of the
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
17
protein encoded by the nucleic acid sequence insert may be regulated as
desired. Preferred promoters are foreign promoters. A "foreign promoter"
is defined herein to mean a promoter other than the native, or natural,
promoter which promotes transcription of a length of DNA.
s The vectors may further include other regulatory elements, such as
enhancer sequences, which cooperate with the promoter to achieve
transcription of the nucleic acid insert coding sequence. By "enhancer" is
meant nucleotide sequence elements which can stimulate promoter activity
in a cell, such as a plant host cell. The vectors may further include 3'
to regulatory sequence elements known in the art, such as those, for
example, that increase the stability of the RNA transcribed.
Moreover, the vectors may include another nucleotide sequence
insert that encodes a peptide or polypeptide used as a tag to aid in
purification of the desired protein encoded by the desired nucleotide
is sequence. The additional nucleotide sequence is positioned in the vector
such that a fusion, or chimeric, protein is obtained. For example, a protein
described herein may be produced having at its C-terminal end linker
amino acids, as known in the art, joined to the other protein that acts as a
tag. After purification procedures known to the skilled artisan, the
Zo additional amino acid sequence is cleaved with an appropriate enzyme.
The protein may then be isolated from the other proteins, or fragments
thereof, by methods known in the art.
The inventive recombinant vectors may be used to transform a host
cell. Accordingly, methods of transforming a plant are provided that include
2s introducing into a plant cell a nucleic acid molecule having a nucleotide
sequence as described herein, such as one, for example, that encodes a
protein having at least about 60% identity to the amino acid sequence set
forth in SEQ ID N0:1 or SEQ ID N0:2. Methods of transforming a plant are
well known in the art, and may be found in references including, for
3o example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold
Springs Laboratory, Cold Springs Harbor, New York (1982) and Current
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
18
Protocols in Molecular Biology, John Wiley and Sons, edited by Ausubel et
al. (1988). Plant gene transfer techniques may also be found in references
including Fromm et al., (1985) Proc. Natl. Acad. Sci. USA , 82:5824-5828
(lipofection); Crossway et al., (1986) Mol. Gen. Genet. 202:179
s (microinjection); Hooykaas-Van Slogtern et al., (1984) Nature 311:763-
764)(T-DNA mediated transformation of monocots); Rogers et al., (1986)
Methods EnzymoL 118:627-641 (T-DNA mediated transformation of
dicots); Bevan et al., (1982) Ann. Rev. Genet. 16:357-384) (T-DNA
mediated transformation of dicots); Klein et al., (1988) Proc. Natl. Acad. Sci
to USA 85:4305-4309 (microprojectile bombardment); and Fromm et al.,
Nature (1986) 319:791-793 (electroporation). Once the desired nucleic
acid has been introduced into the host cell, the host cell may produce the
protein, or variants thereof, as described above. Accordingly, in yet
another aspect of the invention, a host cell is provided that includes the
is inventive recombinant vectors described above.
A wide variety of host cells may be used in the invention, including
prokaryotic and eukaryotic host cells. Preferred host cells are eukaryotic
and are further preferably plant cells, such as, for example, those derived
from monocotyledons, such as duckweed, corn, turf (including rye grass,
2o Bermuda grass, Blue grass, Fescue), dicotyledons, including lettuce,
cereals such as wheat, crucifers (such as rapeseed, radishes and
cabbage), solanaceae (including green peppers, potatoes and tomatoes),
and legumes such as soybeans and bush beans. In a further aspect of the
invention, the host cells may be cultured as known in the art to produce a
2s transgenic plant.
In another aspect of the invention, methods of identifying plant
proteins, such as those expected to be GABA receptors, are provided. In
these methods, nucleotide sequences described above, and preferably
portions thereof, may be used as probes to locate other, similar nucleotide
3o sequences that may encode other GABA receptors. General methods for
screening for selected nucleotide sequences in a DNA or RNA sample are
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
19
known to the art. For example, DNA may be isolated from selected plants,
treated with various restrictions enzymes and analyzed by Southern
blotting techniques utilizing a radioactively or fluorescently-labeled probe
of
interest. RNA fragments may be similarly analyzed by Northern blotting
s techniques. Alternatively, commercially available cDNA or genomic
libraries may be screened.
In a preferred embodiment, a probe nucleic acid molecule having a
nucleotide sequence having at least about 70% identity to a nucleotide
sequence having a length of about 25 to about 100 nucleotides, preferably
l0 25 to about 400, and further preferably about 25 to about 800, and about
25 to about 1000 nucleotides within the nucleotide sequence set forth in
SEQ ID N0:1 or SEQ ID N0:2, preferably from nucleotide 1 to nucleotide
1305, may be used as a probe. In more preferred embodiments, the probe
encompasses the length of nucleotides from nucleotide 1 to nucleotide
is 1305 in SEQ ID N0:1 or SEQ ID N0:2, but may also encompass the entire
length of nucleotides set forth in SEQ ID N0:1 or SEQ ID N0:2. In other
embodiments, the probe has a nucleotide sequence having at least about
80% identity, most preferably at least about 90% identity, to the length of
nucleotides indicated directly above. The probe may be radioactively
20 labeled at its 5'end, for example, with polynucleotide kinase and 32P and
hybridized to the isolated nucleic acid fragments.
In another aspect of the invention, methods of treating a plant are
provided. In one embodiment, a method includes providing a plant having
an introduced nucleic acid molecule described herein, such as one having
2s at least about 70% identity to the sequence set forth in SEQ ID N0:1 or
SEQ ID N0:2 that encodes a protein described herein, and treating the
plant with an effective amount of GABA. The introduced nucleic acid
molecule may include a promoter, preferably a foreign promoter, operably
linked to a terminal 5' end of the nucleotide sequence so that the sequence
3o is expressed, typically prior to treating the plant with GABA. Such
treating
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
of the plant may stimulate growth of the plant, as well as provide other
beneficial results, including reducing the effects of plant stress.
Transgenic plants may be prepared as described above and treated
with an effective amount of GABA. The effective amount of GABA is
s typically an amount of GABA that will provide some advantages to the
plant, including stimulation of plant growth and reduction of plant stress.
This amount may vary depending on the particular advantage provided to
the plant, the number of introduced nucleotide sequences expressed, the
type of plant, and the number of plants treated. However, plants are
to typically treated with about 1 ppm to about 24,000 ppm [about 0.013
oz/acre (oz/A) to about 20 Ibs/A] [about 0.93 g/hectare (g/ha) to about 22
kg/ha], about 1 ppm to about 12,000 ppm (about 0.013 oz/A to about 10
Ibs/A) (about 0.93 g/ha to about 11 kg/ha), about 1 ppm to about 7,500
ppm (about 0.013 oz/A to about 6.3 Ibs/A) (about 0.93 g/ha to about 7.1
is kg/ha) and about 1 ppm to about 5,000 ppm (about 0.013 oz/A to about 4.2
Ibs/A) (about 0.93 g/ha to about 4.8 kg/ha). However, with respect to plant
growth stimulation, concentrations of about 1 ppm to about 5,000 ppm, and
as described in U.S. Patent No. 5,439,873 to Kinnersley are frequently
employed. When reduction of plant stress is desired, concentrations of
2o GABA of from about 1 ppm to about 2,500 ppm (about 0.013 oz/A to about
2.1 Ibs/A) (about 0.93 g/ha to about 2.4 kg/ha) are typically employed, with
about 150-600 ppm (about 1/8 Ib/A to about 1/2 Ib/A) (about 0.14 kg/ha to
about 0.56 kg/ha) most frequently being employed. All amounts in ppm are
on a weight/volume (g/ml) basis. Moreover, the application rates in
2s brackets or parentheses above are derived for a treatment utilizing a
standard volume of 100 gallons of the specified solutions dispersed over 1
acre.
In yet other embodiments, the plant, in addition to being treated with
GABA, may also be treated with a composition that includes GABA and a GABA
3o agonist. For example, plants may be treated with baclofen as well as other
GABA agonists known to the art, including, for example, cis-4-aminopent-2-
enoic
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
21
acid (CACA), imidazole-4-acetic acid (IAA) and 4,5,6,7-tetrahydroisoxazolo[5,4-
c]pyridin-3-of (THIP). Plants may also be treated with only a GABA antagonist,
such as picrotoxin or bicuculline, or only a GABA agonist to regulate plant
metabolism as desired.
s GABA, the GABA agonists or antagonists described are typically
applied to the foliage of the plant but may also be administered as a soil
drench. Furthermore, when plants are grown hydroponically, the
compounds and compositions may be applied to the aqueous solution in
which the plants are grown. The compositions are further preferably
to applied by spraying. Moreover, the compounds and compositions may
also be applied as a seed treatment.
GABA, the GABA agonists or GABA antagonists described above are
preferably combined with a carrier medium as known in the art. The compounds
and compositions may, for example, be combined with water, such as tap water
is or with distilled water to which has been added selected minerals.
Alternatively,
the compositions of the present invention may be applied as a solid. In such a
form, the solid is preferably applied to the soil.
The compositions may further include agricultural additives or
formulation aids known to those skilled in the art. Such additives or aids
2o may be used to ensure that the compositions disperse well in a spray tank,
stick to or penetrate plant surfaces (particularly leaf or other foliage
surfaces) as well as provide other benefits to the plant. For example,
surfactants, dispersants, humectants, and binders may be used to disperse
the compounds or compositions described herein in a spray tank as well as
2s to allow the compound or compositions to adhere to and/or penetrate the
plant surfaces.
Methods of regulating plant metabolism are also provided.
Regulation of plant metabolism may include affecting nutrient utilization,
such as nitrogen-assimilation, plant growth, plant productivity and
3o increasing the plant's resistance to the effects of plant stress. For
example,
in one form, an inventive method includes introducing into a plant cell an
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
22
antisense nucleotide sequence having a nucleotide sequence
complementary to the nucleotide sequences provided herein, such as one
that is complementary to a nucleotide sequence having at least about 70%
identity, more preferably at least about 80% identity, most preferably at
s least about 90% identity to a length of nucleotides within the nucleotide
sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, preferably from
nucleotide 1 to nucleotide 1305. The antisense nucleotide may have a
length of about 30 to about 400 nucleotides, about 30 to about 800
nucleotides, about 30 to about 1400 nucleotides and about 30 to about
l0 1800 nucleotides. In more preferred embodiments, the antisense
nucleotide sequence is as long as the entire length of the nucleotide
sequence set forth in SEQ ID N0:1 or SEQ ID N0:2. The antisense
nucleotide sequence may hybridize to the template strand, which serves as
the strand from which RNA is produced, so that transcription will be
is reduced. Alternatively, the antisense nucleotide sequence may be
complementary to, and therefore hybridize to, the RNA sequence, such as
the mRNA sequence, transcribed from the nucleotide sequences described
herein, so that translation of the mRNA sequence to express the encoded
protein, such as a GABA receptor, will be reduced. The antisense
2o nucleotide sequence may be either DNA or RNA. Such antisense
sequences may be produced as described above for the nucleotide
sequences and by further methods known in the art. Nucleotide sequences
having substantial similarity to the above-described antisense nucleotide
sequences are also encompassed in the invention.
2s In another form of a method of regulating plant metabolism, a
method may include in vivo mutagenesis of the gene present in the plant
genome encoding the plant GABA receptor protein described herein in
order to alter its activity to provide the desired results. A plant may be
mutated by methods known to the skilled artisan, including chemical
3o methods and DNA-insertion mutagenesis.
CA 02364596 2001-08-31
WO 00/52137 PCT/tJS00/05407
23
In another aspect of the invention, methods of modifying receptor
activity in a plant are provided. In one form of the invention, a method
includes introducing into a plant cell a nucleic acid molecule having a
nucleotide sequence encoding a plant protein as described herein, such as
s a plant protein having an amino acid sequence having at least about 60%
identity to the amino acid sequence set forth in SEQ ID N0:1 or SEQ ID
N0:2.
In yet another aspect of the invention, methods of expressing plant
proteins expected to function as GABA receptors as described above are
io provided. In one embodiment, the method includes providing a nucleotide
sequence described above, or variants thereof, that encodes a protein
described herein, and introducing the nucleotide sequence into a host cell,
as described above. The desired nucleotide sequence may be
advantageously incorporated into a vector to form a recombinant vector.
is The recombinant vector may then be introduced into a host cell according
to known procedures in the art. Such host cells are then cultured under
conditions, well known to the skilled artisan, effective to achieve expression
of the plant protein. The protein may then be purified using conventional
techniques.
2o Reference will now be made to specific examples illustrating the
invention described above. It is to be understood that the examples are
provided to illustrate preferred embodiments and that no limitation to the
scope of the invention is intended thereby.
25 EXAMPLE 1
Effect of GABA Agonists and Antagonists on Duckweed
GABA receptors in animals have been defined on the basis of their
response to antagonists as described in Johnston, GAR (1997), Molecular
Biology, Pharmacology and Physiology of the GABA~ Receptors, SJ Emna
3o and NG Bowery Eds., The GABA Receptors, Humana Press. GABAA
receptors are sensitive to the antagonist bicuculline and insensitive to the
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
24
agonist baclofen and GABAB receptors are insensitive to bicuculline and
sensitive to baclofen. GABAc receptors are insensitive to both bicuculline
and baclofen. GABAc receptors are sensitive to the antagonist picrotoxin.
Bicuculline is specific for GABAA and picrotoxin is specific for both GABAA
s and GABA~ receptors.
Duckweed (Lemna Minor L) was grown following the general
procedure described by Kinnersley (U.S. Patent No. 4,813,997) except that
the culture media was Solu-Spray 20-20-20 fertilizer dissolved in tap water
at 1 g/I and the pH was adjusted to 5.5 as discussed in U.S. Patent No.
l0 5,439,873 to Kinnersley. Duckweed was treated with, independently, the
indicated concentrations of baclofen [(3-(aminomethyl)-4-
chlorobenzenepropanoic acid] (FIG. 1 ), picrotoxin (cocculin) (FIG. 2),
bicuculline ([R-(R*,S*)]-6-(5,6,7,8-tetrahydro-6-methyl-1,3-dioxolo[4,5-
g]isoquinolin-5-yl)furo[3,4-a]-1,3-benzodioxol-8(6H)-one) (FIG. 2) or a
is mixture of GABA and baclofen (FIG. 3).
As seen in FIG. 1, baclofen is active at promoting duckweed growth
up to concentrations of about 1 mM. Moreover, as seen in FIG. 3, baclofen
increases the growth-promoting effects of GABA when duckweed is treated
with both GABA and baclofen. In contrast, the growth-promoting effects of
2o GABA are completely inhibited when bicuculline or picrotoxin was added to
the culture media. This shows that compounds which affect GABA that act
through GABA receptors in animals behave the same way in plants.
As seen in FIG. 2, when duckweed, grown as above, was treated
independently with bicuculline and picrotoxin, an inhibitory effect on growth
2s was seen in the absence of GABA in the medium. This suggests that
bicuculline and picrotoxin are having an effect on GABA that is being made
by the plant.
The above results, taken together, provide evidence that GABA
receptors exist in plants, as experiments with chemicals that promote or
so inhibit the activity of GABA receptors in animals have the same response in
plants. As there is no published understanding of the role of GABA in
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
plants, it is surprising that chemicals that effect the action of GABA
receptors in animals have the same response in plants.
Additionally, the above results, taken together with the discovery of
nucleotide sequences encoding a protein whose N-terminal region has
s homology to animal GABA receptors, provide even further evidence of the
existence of GABA receptors in plants.
EXAMPLE 2
Isolation of a Full-length cDNA and Genomic DNA
to Protocol
Arabidopsis thaiiana (L.) Heynh. Ecotype Columbia (Col-0) seeds
were obtained from the Arabidopsis Biological Resource Center (Ohio
State University, Columbus, OH). Arabidopsis seedlings were grown under
aseptic conditions in flasks containing MS media (Murashige and Skook,
is Physiol. Plant 15:485 (1962)] on a rotary shaker (150 rpm). Two-day-old
seedlings were collected for total RNA isolation. Total RNA was isolated as
described in Turano, F.J. et al.(1992) Plant Physiol. 100:374. Primers,
5'K/OGLR4Not1(5'GCCCGCGGCCGCATGGCGAAAGCAATCAGAGAGTT
GTG-3') and 3'IUOGLR4Notl
20 (5'GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') to GLR4,
corresponding to GenBank ACC# AC000098, were commercially
synthesized (Biosynthesis, Inc., Lewisville, TX) and used for RT-PCR
reactions. For the RT-PCR, a 5' RACE system (Life Technologies,
Rockville, MD) was used to identify a full-length cDNA clone. The primer,
2s 3'IUOGLR4Notl was used to synthesize a first strand cDNA from 1 p.g of
poly (A+)RNA isolated from two-day-old plants following the manufacturers
instructions. One-fifth of the first strand cDNA synthesis was used as a
template in a gene amplification reaction with both primers, 5'K/OGLR4Noti
and 3'K/OGLR4Notl. Prior to the amplification, the components were
3o incubated at 95°C for 4 minutes. The gene amplification reaction was
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
26
conducted at 94°C for 1 minute, 68°C for 1 minute and
72°C for 2 minutes,
for 30 cycles followed by a 5 minute, 72°C extension.
Genomic DNA was isolated from leaves of 24 day old Arabidopsis
as described in Turano, F.J. et al. (1992) Plant Physiol 100:374. For the
s PCR reaction, 250 ng of each primer (5"K/OGLR4Notl and 3'K/OGLR4Notl)
was used with approximately 500 ng of genomic DNA. Prior to the
amplification reaction, the components were incubated at 95°C for 10
minutes. The gene amplification reaction was conducted at 94°C for 1
minutes, 70°C for 1 minute and 72°C for 3 minutes, for 30 cycles
followed
to by a 5 minute, 72°C extension.
Both the genomic DNA and cDNA fragments were cloned separately
into PCR2.1 (Invitrogen Corp. Carlsbad, CA, USA) and sequenced using
the Taq Dideoxy terminator cycle sequence (Applied Biosystems) method
at the Center for Agricultural Biotechnology, University of Maryland,
is College Park, MD. The data were analyzed with MacVector software on a
Power Macintosh 6500/250.
Results
A full-length cDNA clone encoding a ligand-gated ion channel
was identified from total RNA isolated from 2 day old Arabidopsis. The
2o deduced amino acid sequence has high homology with 11 amino acid
sequences derived from genomic sequences and three amino acid
sequences deduced from full-length cDNA clones in Genbank. More
specifically, the gene had homology to animal GABA receptors from
nucleotides 1 to 1305 and had homology to animal glutamate receptors
2s from nucleotide 1306 to the end of the sequence. The large family of
putative ligand-gated ion channels from Arabidopsis have homology with
genes encoding glutamate ionotropic receptor proteins (Glu R) and, in
some cases GABA receptor proteins, in invertebrates and vertebrates.
The gene encoded in the cDNA described herein was designated GLR4.
3o Northern blot and RT-PCR analyses demonstrated that the GLR4 transcript
is approximately 2.8 kb and is readily detected in 2 and 4 day-old
CA 02364596 2001-08-31
WO 00/52137 PCT/IJS00/05407
27
Arabidopsis and in meristems of 21 day-old plants. The data suggest that
the genes are expressed in tissues undergoing rapid cell division.
Although not being limited by theory, it is believed the GABA, GABA
antagonists and GABA agonists will interact with the GABA-like domains at
s the N-terminal region of the plant ligand-gated ion channel described
herein. This theory is supported by recent experimental findings that
demonstrate the N-terminal domain of the animal GABA-BRs is sufficient to
specify agonist and antagonist binding in GABA-BRs [Malitschek (1999)
Mol. Pharmacol. 56(2):448-454].
to Although the functions of all of the GLR genes are unknown, the
presence of GLR genes, and genes having GABA receptor characteristics
and glutamate receptor characteristics, in Arabidopsis provides molecular
evidence for the biochemical machinery necessary for the transmission of
electrical signals in higher plants.
EXAMPLE 3
Construction of an Antisense GLR4 Plant
The entire open reading frame for GLR4, or portions thereof as small
as about 25 base pairs, can be cloned into a plant transformation vector,
2o such as pB1121 (Clonetech, Palo Alto, CA) using PCR, RT-PCR or
conventional cloning methods to make antisense constructs. Gene specific
primers, 5'K/OGLR4Notl (5'-
GCCCGCGGCCGCATGGCGAAAGCAATCAGAGTTGTG-3') and
3'K/OGLR4Notl (5'-
2s GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3')
(corresponding to GenBank GLR4, ACC # AC000098) can be
commercially synthesized (Biosynthesis Inc., Lewisville, TX, USA) and
used for PCR or RT-PCR reactions. For example the PCR reactions can
use, 250 ng of each primer with approximately 500 ng of genomic DNA.
3o Prior to the amplification reaction, the components can be incubated at
95°C for 2 min. The gene amplification reaction can be conducted at
94°C
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
28
for 1 min, 65°C for 1 min and 72°C for 2 min, for 30 cycles
followed by a 4
min 72°C extension. For the RT-PCR, a 5' RACE system (Life
Technologies, Rockville, MD, USA) or a simpler reverse transcriptase (RT)
based system, can be used to identify a full-length cDNA clone. The
s primer, 3'K/OGLR4Notl, can be used to synthesize first strand cDNA from 1
pg from poly (A+) RNA isolated from 2 d-old plants following the
manufacturer's instructions. One fifth of the first strand cDNA synthesis can
be used as a template in a gene amplification reaction with both primers,
5'K/OGLR4Notl and 3'K/OGLR4Notl. Prior to the amplification, the
to components can be incubation at 95°C for 2 min. The gene
amplification
reaction can be conducted at 94°C for 1 min, 58°C for 1 min and
72°C for 2
min, for 30 cycles followed by a 5 min 72°C extension.
The genomic DNA or cDNA fragments can be cloned into plant
transformation vectors in an antisense (backwards) direction. The vectors
is may contain constitutive promoters such as CaMV 35S promoter and the
nopaline synthase terminator. The vectors can be modified to include
promoters that can be induced by biotic [Sohal et al.,(1999) Plant Mol. Biol.
41:75-87] or abiotic stresss [Ngai et al., (1997) Plant J. 12:1021-1034;
van Der Krol et al., (1999) Plant Physiol. 121:1153-1162; Kucho et al.,
20 (1999) Plant Physiol 121:1329-1338] and/or by hormones and other
signaling molecules (Chen and Singh, (1999) Plant J. 19:667-677; Lu et al.,
(1998) J. BioL Chem. 273:10120-10131; Leubner-Metzger et al., (1998)
Plant Mol. Biol. 38:785-795. The orientation of the cloned constructs can be
confirmed by restriction endonuclease and PCR analyses.
2s Upon completion of cloning, the binary vector construct can be
transferred into a disarmed strain of Agrobacterium tumefaciens, such as
EHA105, and subsequently into Arabidopsis (Ws ecotype) using the
vacuum infiltration method [Bechtold and Bouchez (1995) In planta
Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants
3o by vacuum infiltration, in Gene Transfer to Plants, I. Potrykus and G.
Spangenberg, Eds. (Springer-Verlag, Heidelberg) pp. 19-23] with one
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
29
modification [i.e., the addition of 0.02% (v/v) Silwet to the infiltration
media].
Seeds collected from the transformed plants can be germinated and
selected for kanamycin resistance.
s EXAMPLE 4
Evolutionary Origin of Glutamate and GABA Receptors
Parsimony and nearest neighbor analyses were used to examine
evolutionary relationships between eight putative plant GLR sequences,
the iGLRs and members of family 4 of the GPCRs, specifically the mGLRs
to and GABA-BRs (FIG. 4). The possibility of a recombination event during
the evolutionary history of the loci was considered and, therefore, the
analyses of the peptides were separated into two; comparing the
approximate first one-third (N-terminal regions), and the last two-thirds (C-
terminal regions) of the peptides separately.
is Experimental
The tree is one of four equally parsimonious trees generated from
heuristic analysis (length = 6186 steps, consistency index = 0.649,
retention index = 0.753, and rescaled consistency index = 0.488). A strict
consensus tree generated from the four equally parsimonious trees was
2o identical to the tree shown with the exception that hummglur7n was placed
between hummglur6n and ratmglur4n. Support of the more important
Glades is indicated by bootstrap values using 500 permutations of the
aligned data set. Ecoliginh was used as an outgroup. Similar results were
obtained with nearest neighbor analyses (not shown). The abbreviations
2s and accession numbers for the bacterial periplasmic binding proteins,
animal iGLRs and plant GLRs (1, 3, and 4) sequences are identical to
those used by Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838.
Results
It was concluded that the amino acid sequences in the N-terminal
3o regions of the plant GLRs are related to members of GPCRs (family 4 of
the G-protein-coupled receptors) superfamily and not to members of the
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
iGLRs. However, the C-terminal regions of the plant GLRs are related to
members of the iGLRs superfamily and not to members of the GPCRs.
Similar inferences were made from results comparing the entire peptide
sequences (data not shown). The results from the present analysis of the
s C-terminal regions are in agreement with those of a recently published
phylogenetic analysis [Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838]. It
can be concluded from the results of both the present study, along with the
published study, that the C-terminal regions of the Arabidopsis GLRs and
iGLRs evolved from a common ancestral locus that predated the
io divergence of animal kainate/AMPA and NMDA receptors. However, the
analyses of the N-terminal regions herein support a different scenario. The
N-terminal regions of the Arabidopsis GLRs are homologous to GABA-BRs
and mGLRs, which are members of family 4 of the GPCRs. These loci
share a common ancestry that predates the divergence of plants and
is animals.
Collectively, it was concluded that the iGLRs and the two members
of family 4 of the GPCRs evolved from distinct regions of the GLRs prior to
the divergence of the plant and animal kingdoms. Therefore, the ancestors
to extant GLRs are the evolutionary progenitors to both the iGLRs and
2o members of family 4 of the GPCRs, and thus represent a previously
unidentified evolutionary link between the two superfamilies of receptors.
As seen in FIG. 5, an ancestral plant GLR evolves from a BPBP.
The ancestral GLR evolves into plant GLRs, iGLRs and members of family
4 of the G-protein coupled receptors (GPCR-F4), via distinct evolutionary
2s routes. The GLRs and iGLRs evolve by a series of point mutations and
selection. An ancestral GPCR-F4 arose from a gene conversion or
recombination event between the 5'-end of an ancestral plant GLR and a
gene encoding for a peptide with seven-transmembrane domains (7-
TMDP), perhaps a gene encoding for a GPCR-like protein. [Josefsson, L.G.
3o et al., (1997) Eur. J. Biochem. 249:415-420; Plakidou-Dymock, S. et al.
(1998) Curr. Biol. 8:315-324; Josefsson, LG. (1999) Gene 239:333-340].
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
31
The ancestral GPCR-F4 evolves into mGLRS and GABA-BRs by a series
of point mutations and selection.
While the invention has been illustrated and described in detail in the
drawings and foregoing description, the same is to be considered as
illustrative and not restrictive in character, it being understood that only
the
preferred embodiment has been shown and described and that all changes
and modifications that come within the spirit of the invention are desired to
be protected. In addition, all references cited herein are indicative of the
to level of skill in the art and are hereby incorporated by reference in their
entirety.
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
SEQUENCE LISTING
<110> Kinnersely, Alan _M_
Turano, Frank J
<120> Plant Ligand-Gated Ion Channels
<130> 7224-38
<140> Unknown
<141> 2000-03-02
<150> US 60/122,506
<151> 1999-03-02
<160> 2
<170> PatentIn Ver. 2.1
<210> 1
<211> 2784
<212> DNA
<213> Arabidopsis thaliana
<220>
<400> 1
atg gcg aaa gca atc aga gtt gtg ttg tta tgt ctt tct gtc ttg tgg 48
Met Ala Lys Ala Ile Arg Val Val Leu Leu Cys Leu Ser Val Leu Trp
1 5 10 15
gtc gtt cca aag gaa tgt get tgt aga agt aat tac tca aga aac tcc 96
Val Val Pro Lys Glu Cys Ala Cys Arg Ser Asn Tyr Ser Arg Asn Ser
20 25 30
tct tct tct tct tct tct tct ttg ccg cca tta aca cag agg cca agc 144
Ser Ser Ser Ser Ser Ser Ser Leu Pro Pro Leu Thr Gln Arg Pro Ser
35 40 45
tct_gtg aat gtt gga get ctg ttt act tac gat tct ttc atc gga aga 192
Ser Val Asn Val Gly Ala Leu Phe Thr Tyr Asp Ser Phe Ile G1y Arg
50 55 60
gcg get aaa ccc gcg gtt aaa gcg get atg gat gat gtt aat get gac 240
Ala Ala Lys Pro Ala Val Lys Ala Ala Met Asp Asp Val Asn Ala Asp
65 70 75 80
1
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
caa act gta ct= aag ggc atc aag cta aat atc atc ttt caa gac tca 288
Gln Thr Val Leu Lys Gly Ile Lys Leu Asn Ile Ile Phe Gln Asp Ser
85 90 95
aat tgc agt gga ttt ata gge acc atg gga get ttg cag ctg atg gaa 336
Asn Cys Ser Gly Phe Ile Gly Thr Met Gly Ala Leu Gln Leu Met Glu
100 105 110
aac aaa gtg gtt gca gcc att gat cca caa tct tca ggg att get cac 384
Asn Lys Val Val Ala Ala Ile Asp Pro Gln Ser Ser Gly Ile Ala His
115 120 125
atg atc tcc tat gta get aat gag ctt cat gta cct ctc ttg tca ttt 432
Met Ile Ser Tyr Val Ala Asn Glu Leu His Val Pro Leu Leu Ser Phe
130 135 140
gga gca acg gat ccg act ctc tcc tct ttg caa ttt cct tat ttc ctc 480
Gly Ala Thr Asp Pro Thr Leu Ser Ser Leu Gln Phe Pro Tyr Phe Leu
145 150 155 160
cgc acc acg cag aat gat tac ttc caa atg cat gcg atc gca gat ttt 528
Arg Thr Thr Gln Asn Asp Tyr Phe Gln Met His Ala Ile Ala Asp Phe
165 170 175
cta tca tat tcc gga tgg aga caa gtc att acg ata ttc gtt gat gat 576
Leu Ser Tyr Ser Gly Trp Arg Gln Val Ile Thr Ile Phe Val Asp Asp
180 185 190
gag tgt ggc agg aac ggg ata tct gtc cta ggt gat gta tta gcc aag 624
G1u Cys Gly Arg ~.sn Gly Ile Ser Val Leu Gly Asp Val Leu Ala Lys
195 200 205
aaa cgc tcg agg atc tct tac aaa get gca att act cct ggt gca gat 672
Lys Arg Ser Arg Ile Ser Tyr Lys Ala Ala Ile Thr Pro Gly Ala Asp
210 215 220
tct agc tcc atc aga gac ttg ttg gtt tct gtt aat ctg atg gaa tct 720
Ser Ser Ser Ile Arg Asp Leu Leu Val Ser Val Asn Leu Met Glu Ser
225 230 235 240
cgg_gtt ttt gtt gtc cat gtg aat cct gac tct ggt tta aac gtt ttc 768
Arg Val Phe Val Val His Val Asn Pro Asp Ser Gly Leu Asn Val Phe
245 250 255
tct gtg get aaa tct ctt gga atg atg gca agt ggt tat gtt tgg atc 816
Ser Val Ala Lys Ser Leu Gly Met Met Ala Ser Gly Tyr Val Trp Ile
260 265 270
2
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
gca aca gac tgg ctt cct aca get atg gat tcc atg gag cac gtg gat 80'4
Ala Thr Asp Trp Leu Pro Thr Ala rtet Asp Ser Met Glu His Val Aso
275 280 285 _
tca gac acg atg gat ctc ttg caa gga gtg gtt get ttt cgc cac tac 912
Ser Asp Thr Met Asp Leu Leu Gln Gly Val Val Ala Phe Arg His Tyr
290 295 300
aca atc gag agt agt gtc aaa aga cag ttt atg gcg aga tgg aag aat 960
Thr Ile Glu Ser Ser Val Lys Arg Gln Phe Met Ala Arg Trp Lys Asn
305 310 315 320
ctt aga cca aat gat ggc ttc aac tct tat gcg atg tac get tac gat 1008
Leu Arg Pro Asn Asp Gly Phe Asn Ser Tyr Ala Met Tyr Ala Tyr Asp
325 330 335
tct gtt tgg tta gtt get cgt gcc ctc gat gtt ttc ttc aga gaa aac 1056
Ser Val Trp Leu Val Ala Arg Ala Leu Asp Val Phe Phe Arg Glu Asn
340 345 350
aat aac ata act ttc tcc aac gat cca aat ctg cac aaa aca aat ggt 1104
Asn Asn Ile Thr Phe Ser Asn Asp Pro Asn Leu His Lys Thr Asn Gly
355 360 365
agc act att cag cta tca get cta agt gtt ttc aat gaa gga gag aaa 1152
Ser Thr Ile Gln Leu Ser Ala Leu Ser Val Phe Asn Glu Gly Glu Lys
370 375 380
ttt atg aag atc att ctt ggg atg aat caa act ggt gtg acg ggc cca 1200
Phe Met Lys Ile Ile Leu Gly Met Asn Gln Thr Gly Val Thr Gly Pro
385 390 395 400
atc cag ttt gat tca gat aga aac cgg gtt aat ccg get tat gaa gtt 1248
Ile Gln Phe Asp Ser Asp Arg Asn Arg Val Asn Pro Ala Tyr Glu Val
405 410 415
cta aac tta gaa ggt aca get cca cgc aca gtc ggg tac tgg tca aat 1296
Leu Asn Leu Glu Gly Thr Ala Pro Arg Thr Val Gly Tyr Trp Ser Asn
420 425 430
cat_tcg ggt ctc tct gtg gtc cat cca gag acc ttg tac tct agg cct 1344
His Ser Gly Leu Ser Val Val His Pro Glu Thr Leu Tyr Ser Arg Pro
435 440 445
cca aac aca tct aca gca aac cag cgt ctt aaa gga atc ata tat cca 1392
Pro Asn Thr Ser Thr Ala Asn Gln Arg Leu Lys Gly I1e Ile Tyr Pro
450 455 460
3
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
gga gaa gta act aag cct cct cgt ggt tgg gtg ttt cct aat aat gga 1440
Gly Glu Val Thr Lys Pro Pro Arg Gly Trp Val Phe Pro Asn Asn Gly
465 470 475 480
aaa ccg ctc aga atc ggg gtg cct aac cgt gtg agc tat aca gat tac 1488
Lys Pro Leu Arg Ile G1y Val Pro Asn Arg Val Ser Tyr Thr Asp Tyr
485 490 495
gtt tct aag gat aaa aac ccg cct ggc gtt aga ggc tac tgc att gat 1536
Val Ser Lys Asp Lys Asn Pro Pro Gly Va1 Arg Gly Tyr Cys Ile Asp
500 505 510
gtc ttt gaa gcc get att gaa ttg ctt cca tat cct gtt cca cgt act 1584
Val Phe Glu Ala Ala Ile Glu Leu Leu Pro Tyr Pro Val Pro Arg Thr
515 520 525
tat ata cta tat gga gac ggg aag aga aat cct tct tat gat agc ctc 1632
Tyr Ile Leu Tyr Gly Asp Gly Lys Arg Asn Pro Ser Tyr Asp Ser Leu
530 535 540
gtc aat gaa gtt gtt gcg gat aat ttt gat gta get gta gga gat atc 1680
Val Asn Glu Val Val Ala Asp Asn Phe Asp Val Ala Val Gly Asp Ile
545 550 555 560
aca atc gtc aca aac aga aca aga tat gta gat ttc aca caa ccg ttt 1728
Thr Ile Val Thr Asn Arg Thr Arg Tyr Val Asp Phe Thr Gln Pro Phe
565 570 575
ata gaa tca ggg ctt gtg gtg gtg get ccg gtt aag gag gcc aag tct 1776
Ile Glu Ser G1y Leu Val Val Va1 Ala Pro Val Lys Glu Ala Lys Ser
580 585 590
agt cct tgg tca ttc ctg aaa cca ttc act ata gag atg tgg get gtc 1824
Ser Pro Trp Ser Phe Leu Lys Pro Phe Thr Ile Glu Met Tr~_ Ala Val
595 600 605
act gga ggc ttc ttt ctc ttt gtg gga gcc acg gtc tgg att ctc gaa 1872
Thr Gly Gly Phe Phe Leu Phe Val Gly Ala Thr Val Trp Ile Leu Glu
610 615 620
cac_cgc ttc aac caa gaa ttc cgt ggc cct cct agg cgt caa ctc att 1920
His Arg Phe Asn Gln Glu Phe Arg Gly Pro Pro Arg Arg Gln Leu I1e
625 630 635 640
acc atc ttc tgg ttt agc ttc tca aca atg ttc ttc tct cat agg gag 1968
Thr Ile Phe Trp Phe Ser Phe Ser Thr Met Phe Phe Ser His Arg Glu
645 650 655
4
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
aac acg gtg agt tca ctg ggg agg ttt gtg ctg atc att tgg tta ttc 2016
Asn Thr Val Ser Ser Leu Gly Arg Phe Val Leu Ile Ile T-o Leu Phe
660 6'05 670
gtg gtt ctg atc atc aac tcg agc tac acg gcc agt ctc act tcg atc 2064
Val Val Leu Ile Ile Asn Ser Ser Tyr Thr Ala Ser Leu Thr Ser Ile
675 680 685
cta acc att cga cag ctg aca tct cgg att gaa gga ata gat agc ttg 2112
Leu Thr Ile Arg Gln Leu Thr Ser Arg Ile Glu Gly Ile Asp Ser Leu
690 695 700
gta acg agc aat gaa cca att gga gtt caa gac ggt acc ttt get cgg 2160
VaI Thr Ser Asn Glu Pro Ile Gly Val Gln Asp Gly Thr Phe Ala Arg
705 710 715 720
aac tat cta atc aac gag ctt aac ata cta cct tca agg att gtt cct 2208
Asn Tyr Leu Ile Asn Glu Leu Asn Ile Leu Pro Ser Arg Ile Val Pro
725 730 735
ctg aaa gac gaa gaa cag tac ctt tct get ctg caa cgc ggt ccc aac 2256
Leu Lys Asp Glu Glu Gln Tyr Leu Ser Ala Leu Gln Arg Gly Pro Asn
740 745 750
get ggc ggt gtg gca gcc att gta gat gag ctt cet tac atc gaa gtt 2304
Ala Gly Gly Val Ala Ala Ile Val Asp Glu Leu Pro Tyr Ile Glu Val
755 760 765
ctt ttg aca aat agc aac tgc aaa ttc cgt aca gta ggg caa gag ttc 2352
Leu Leu Thr Asn Ser Asn Cys Lys Phe Arg Thr Val Gly Gln Glu Phe
770 775 780
aca cge aca ggc tgg ggt ttc gca ttc cag aga gat tcc cct tta get 2400
Thr Arg Thr Gly Trp G1y Phe Ala Phe Gln Arg Asp Ser Pro Leu Ala
785 790 795 800
gta gac atg tca acg get atc ttg caa cta tct gaa gaa ggc gag ctc 2448
Val Asp Met Ser Thr Ala Ile Leu Gln Leu Ser Glu Glu Gly Glu Leu
805 810 815
gag aaa atc cat agg aaa tgg ctt aac tac aag cat gaa tgc tcg atg 2496
Glu Lys Ile His Arg Lys Trp Leu Asn Tyr Lys His Glu Cys Ser Met
820 825 830
cag atc tca aac agt gag gac tct cag ctt tca cta aag agt ttc tgg 2544
Gln Ile Ser Asn Ser G1u Asp Ser Gln Leu Ser Leu Lys Ser Phe Trp
835 840 845
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
gga ctc ttc ctt atc tgt ggc atc act tgc ttc atg gca ctc act gtc 2592
Gly Leu Phe Leu Ile Cys Gly Ile Thr Cys Phe Met Ala Leu Thr Val
850 355 80'0
ttc ttc tgg agg gtt ttc tgg caa tac cag agg ttg cta cca gaa agt 2640
Phe Phe Trp Arg Val Phe Trp Gln Tyr Gln Arg Leu Leu Pro Glu Ser
865 870 875 880
gcg gac gag gaa agg gca ggc gaa gtg tct gag cca tct cga tca ggg 2688
Ala Asp Glu Glu Arg Ala Gly Glu Val Ser Glu Pro Ser Arg Ser Gly
885 890 895
aga ggt tca cga gca ccg agt ttc aag gaa ttg ata aaa gtt gtg gat 2736
Arg Gly Ser Arg Ala Pro Ser Phe Lys Glu Leu Ile Lys Val Val Asp
900 905 910
aag agg gaa gca gag atc aag gag ata ctt aag cag aag agt agc tag 2784
Lys Arg Glu Ala Glu Ile Lys Glu Ile Leu Lys Gln Lys Ser Ser
915 920 925
<210> 2
<211> 2439
<212> DNA
<213> Arabidopsis thaliana
<220>
<400> 2
atg gcg aaa gca atc aga gtt gtg ttg tta tgt ctt tct gtc ttg tgg 48
Met Ala Lys Ala Ile Arg Val Val Leu Leu Cys Leu Ser Val Leu Trp
1 5 10 15
gtc gtt cca aag gaa tgt get tgt aga agt aat tac tca aga aac tcc 96
Val Val Pro Lys Glu Cys Ala Cys Arg Ser Asn Tyr Ser Arg Asn Ser
20 25 30
tct tct tct tct tct tct tct ttg ccg cca tta aca cag agg cca agc 144
Ser_Ser Ser Ser Ser Ser Ser Leu Pro Pro Leu Thr Gln Arg Pro Ser
35 40 45
tct gtg aat gtt gga get ctg ttt act tac gat tct ttc atc gga aga 192
Ser Val Asn Val Gly Ala Leu Phe Thr Tyr Asp Ser Phe Ile Gly Arg
50 55 60
6
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
gcg get aaa ccc gcg gtt aaa gcg get atg gat gat gtt aat get gac 240
Ala Ala Lys Pro Ala Val Lys Ala Ala Met Asp Asp Val Asn Ala Asp
55 70 75 80
caa act gta ctt aag ggc atc aag cta aat atc atc ttt caa gac tca 288
Gln Thr Val Leu Lys Gly Ile Lys Leu Asn Ile Ile Phe Gln Aso Ser
85 90 95
aat tgc agt gga ttt ata ggc acc atg gga get ttg cag ctg atg gaa 336
Asn Cys Ser Gly Phe Ile Gly Thr Met Gly Ala Leu Gln Leu Met Glu
100 105 110
aac aaa gtg gtt gca gcc att gat cca caa tct tca ggg att get cac 384
Asn Lys Val Val Ala Ala Ile Asp Pro Gln Ser Ser Gly Ile Ala His
115 120 125
atg atc tcc tat gta get aat gag ctt cat gta cct ctc ttg tca ttt 432
Met Ile Ser Tyr Val Ala Asn Glu Leu His Val Pro Leu Leu Ser Phe
130 135 140
gga gca acg gat ccg act ctc tcc tct ttg caa ttt cct tat ttc ctc 480
Gly Ala Thr Asp Pro Thr Leu Ser Ser Leu Gln Phe Pro Tyr Phe Leu
145 150 155 160
cgc acc acg cag aat gat tac ttc caa atg cat gcg atc gca gat ttt 528
Arg Thr Thr Gln Asn Asp Tyr Phe Gln Met His Ala Ile Ala Aso Phe
165 170 175
cta tca tat tcc gga tgg aga caa gtc att acg ata ttc gtt gat gat 576
Leu Ser Tyr Ser Gly Trp Arg Gln Val Ile Thr Ile Phe Val AsD_ Aso_
180 185 190
gag tgt ggc agg aac ggg ata tct gtc cta ggt gat gta tta gcc aag 624
Glu Cys Gly Arg Asn Gly Ile Ser Val Leu Gly Asp Val Leu Ala Lys
195 200 205
aaa cgc tcg agg atc tct tac aaa get gca att act cct ggt gca gat 672
Lys Arg Ser Arg Ile Ser Tyr Lys Ala Ala Ile Thr Pro Gly Ala Asp
210 215 220
tct agc tcc atc aga gac ttg ttg gtt tct gtt aat ctg atg gaa tct 720
Ser Ser Ser Ile Arg Asp Leu Leu Val Ser Val Asn Leu Met Glu Ser
225 230 235 240
cgg gtt ttt gtt gtc cat gtg aat cct gac tct ggt tta aac gtt ttc 768
Arg Val Phe Val Val His Val Asn Pro Asp Ser G1y Leu Asn Val Phe
245 250 255
7
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
tet gtg get aaa tct ctt gga atg atg gca agt ggt tat gtt tgg atc 316
Ser Va1 Ala Lys Ser Leu Gly Met Met Ala Ser Gly Tyr Val Trp Ile
20'0 265 270
gca aca gac tgg ctt cct aca get atg gat tec atg gag eac gtg gat 864
Ala Thr Asp Trp Leu Pro T:zr Ala Met Asp Ser Met Glu His Val Asp
275 280 2g5
tca gac acg atg gat ctc ttg caa gga gtg gtt get ttt cgc cac tac 912
Ser Asp Thr Met Asp Leu Leu Gln Gly Val Val Ala Phe Arg His Tyr
290 295 300
aca atc gag agt agt gtc aaa aga cag ttt atg gcg aga tgg aag aat 960
Thr Ile Glu Ser Ser Val Lys Arg Gln Phe Met Ala Arg Trp Lys Asn
305 310 315 320
ctt aga cca aat gat ggc ttc aac tct tat gcg atg tac get tac gat 1008
Leu Arg Pro Asn Asp Gly Phe Asn Ser Tyr Ala Met Tyr Ala Tyr Asp
325 330 335
tct gtt tgg tta gtt get cgt gcc ctc gat gtt ttc ttc aga gaa aac 1056
Ser Val Trp Leu Val Ala Arg Ala Leu Asp Val Phe Phe Arg Glu Asn
340 345 350
aat aac ata act ttc tcc aac gat cca aat ctg cac aaa aca aat ggt 1104
Asn Asn Ile Thr Phe Ser Asn Asp Pro Asn Leu His Lys Thr Asn Gly
355 360 365
age act att cag eta tca get cta agt gtt ttc aat gaa gga gag aaa 1152
Ser Thr Ile Gln Leu Ser Ala Leu Ser Val Phe Asn Glu Gly Glu Lys
370 375 380
ttt atg aag atc att ctt ggg atg aat caa act ggt gtg acg ggc cca 1200
Phe Met Lys Ile I1e Leu Gly Met Asn Gln Thr Gly Val Thr Gly Pro
385 390 395 400
atc cag ttt gat tca gat aga aac cgg gtt aat ccg get tat gaa gtt 1248
Ile Gln Phe Asp Ser Asp Arg Asn Arg Val Asn Pro Ala Tyr Glu Val
405 410 415
cta aac tta gaa ggt aca get cca cgc aca gtc ggg tae tgg tca aat 1296
Leu.Asn Leu Glu Gly Thr Ala Pro Arg Thr Val Gly Tyr Trp Ser Asn
420 425 430
cat tcg ggt ctc tct gtg gtc cat cca gag acc ttg tac tct agg cct 1344
His Ser Gly Leu Ser Val Val His Pro Glu Thr Leu Tyr Ser Arg Pro
435 440 445
8
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
cca aac aca tct aca gca aac cag cgt ctt aaa gga atc ata cat cca 1392 -
Pro Asn Thr Ser Thr Aia Asn G1n Arg Leu Lys Gly Ile Its Tyr Pro
450 455 460
gga gaa gta act aag cct cct cgt ggt tgg gtg ttt cct aat aat gga 1440
Gly Glu Val Thr Lys Pro Pro Arg Gly Trp Val Phe Pro Asn Asn Gly
465 470 475 480
aaa ccg ctc aga atc ggg gtg cct aac cgt gtg agc tat aca gat tac 1488
Lys Pro Leu Arg Ile Gly Val Pro Asn Arg Val Ser Tyr Thr Asp Tyr
485 490 495
gtt tct aag gat aaa aac ccg cct ggc gtt aga ggc tac tgc att gat 1536
Val Ser Lys Asp Lys Asn Pro Pro Gly Val Arg Gly Tyr Cys Ile Asp
500 505 510
gtc ttt gaa gcc get att gaa ttg ctt cca tat cct gtt cca cgt act 1584
Val Phe Glu Ala Ala Ile Glu Leu Leu Pro Tyr Pro Val Pro Arg Thr
515 520 525
tat ata cta tat gga gac ggg aag aga aat cct tct tat gat agc ctc 1632
Tyr Ile Leu Tyr Gly Asp Gly Lys Arg Asn Pro Ser Tyr Asp Ser Leu
530 535 540
gtc aat gaa gtt gtt gcg gat aat ttt gat gta get gta gga gat atc 1680
Val Asn Glu Val Val Ala Asp Asn Phe Asp Val Ala Val Gly Asp Ile
545 550 555 560
aca atc gtc aca aac aga aca aga tat gta gat ttc aca caa ccg ttt 1728
Thr Ile Val Thr Asn Arg Thr Arg Tyr Val Asp Phe Thr Gln Pro Phe
565 570 575
ata gaa tca ggg ctt gtg gtg gtg get ccg gtt aag gag gcc aag tct 177'0
I1e Glu Ser Gly Leu Val Val Val Ala Pro Val Lys Glu Ala Lys Ser
580 585 590
agt cct tgg tca ttc ctg aaa cca ttc act ata gag atg tgg get gtc 1824
Ser Pro Trp Ser Phe Leu Lys Pro Phe Thr Ile Glu Met Trp Ala Val
595 600 605
act gga ggc ttc ttt ctc ttt gtg gga gcc acg gtc tgg att ctc gaa 1872
Thr_G1y Gly Phe Phe Leu Phe Val Gly Ala Thr Va1 Trp Ile Leu Glu
610 615 620
cac cgc ttc aac caa gaa ttc cgt ggc cct cct agg cgt caa ctc att 1920
His Arg Phe Asn Gln Glu Phe Arg Gly Pro Pro Arg Arg Gln Leu Ile
625 630 635 640
9
CA 02364596 2001-08-31
WO 00/52137 PCT/US00/05407
_ ;'.. _ __ ___ »~. -
__ .. ..__ _~~ ~__ _ __c ___ a~a a-_ _ .. _
_~ ___ ___ ___ ___ __~ c=
____ _1 > ? =~ ==~ ?°_ ~ 7~_ - - _.
. _ ._ .__ ___ .
7~~
aac acg gtg agt tca c
g ggg =gg ttt ' cc a_c a_.
g-g g __ tgg tt_ ._tc 20?5
~:: TP_r Val Jer Ser _,_tl G1 V .r ~ ?~:? Val Le'1 _ 1 a .1 . 'lr~ Lell
?_1°_
X00 'J~~~
070
gtg gtt ctg atc atc aac tcg agc tac acg gcc agt ctc act tcg atc 2061
Val Val Leu Ile I12 ~sz S=_r Ser Tsrr Tar Vila Ser Leu Thr Se. T_le
675 530
635
cta'acc att cga cag ctg aca tct cgg att gaa gga ata gat agc ttg 2112
Leu T'~r _Tle P~ g Gln Leu Thr S=r Arg Ile Glu Gly Ile ~s~ Ser Leu
690 0'95
700
gta aeg age aat gaa cca att gga gtt caa gac ggt acc ttt get cgg 2160
Va1 T':r Ser ~sn Glu ?r o I l a Gl y Val Gl n 3s? G l y Tr ?re ~ l a ~=g
705 710
71' 720
aac tat cta atc aac gag ctt aac ata cta cct tca agg att gtt cct 2203
Asz !yr L2u Ile 3sn Glu Leu mss:. Ile Leu Pro S=r arg _Tle Val ?=o
725 730
735
ctg aaa gac gaa gaa cag tac ctt tct get ctg caa cgc ggt cce aac 2255
Leu Lys asp Glu Glu Gln Tyr L=a Ser ~1a Leu Glz ~.rg Gly Pro ~sn
740 745
750
get ggc ggt 9tg gca gec att gta gat gag ett ect tac atc gaa gtt 2304
~l a Gl :r Gly 'vat Vila .'-.l a =l a Val ~s~ Gl a Leu ?.o ~yr _Tle Gl a Val
755 76v
755
ctt ttg aca aat agc aac tgc aaa t..c cgt eca gta ggg caa gag ttc 2352
~ ~°-a '?'.~-r AS:1 Ser .'~.S.'1 CVS LyS ?~e J=g '='.._ Va~ G~ V G1:1
G1 i: ?~c=
770 775
780
aca cgc aca ggc tgg ggt ttc gta tgc att cca gag aga ttc ccc ttt 2400
Tzr Ar g Thr Gl y T-p Gly ?he Val Cys I l a ?r o Glu :~=g ?i:e ?r o ?ze
735 790
795 300
agc tgt aga cat gtc aac ggc tat ctt gca act atc tgs 2439
~r
S__.Cys Arg. ::is Val as:z Gly Ty= Leu Vila T~_ Ile
305 8i0
