Note: Descriptions are shown in the official language in which they were submitted.
CA 02365094 2002-04-25
- WO 00150580 PCT/CA00/00201
The mechanism by which loss of PHEX function elicits the bone
and renal abnormalities observed in XLH patients is coot clear. There are
no data suggesting the presence of PHEXIPhex mRNA in the kidney (Du
et al., 1996; Beck et al., 1997; Grieff et al., 1997). The increased renal
phosphate excretion in Hyp mice is due to a down-regulation of the
phosphate transporter, which is necessary for the re-absorption of the
phosphate from the nephron (Tenenhouse 1998). The serum
concentration of 1,25(OH)2D3 (calcitriol) was found to be the same in Hyp
mice as in normal littermates (Meyer 1980). However, the Hyp kidney
showed an accelerated degradation of the vitamin D metabolite to
1,24,25(OH)3D3, a metabolite with reduced activities (Tenenhouse 1988).
In the presence of a phosphate rich diet, Hyp mice experienced an
increase in serum 1,25(OH~D3 and a fall in the C-24 oxidation products,
while normal mice experienced no such changes (Tenenhouse 1990). To
summarize, the renal disorder in vitamin D metabolism in Hyp mice
appears to be secondary to the phosphate disorder.
PHEX/Phex mRNA was detected in bones by Northern blot
hybridization and in other adult and fetal tissues such as lungs, liver,
muscles, and ovaries by RT-PCR and RNase protection assays (Du et al.,
1996; Beck et ai., 1997). !n situ hybridization performed on sections of
embryos and newborn mice showed the presence of Phex mRNA in
osteoblasts and odontoblasts (Ruchon et al., 1998). Phex gene
expression was detectable on day 15 of embryonic development, which
coincides with the beginning of intracellular matrix deposition in bones.
Moreover, Northern analysis of total RNA from calvariae and teeth of 3-
day-old and adult mice showed that the abundance of the Phex transcript
is decreased in adult bones and in non growing teeth. This result was
confirmed when the presence of the Phex protein in newborn adult bones
2
CA 02365094 2002-04-25
WO 00/50580 PGTlCA00/00201
was investigated by Western blotting using a monoclonal antibody raised
against the human PHEX. Immunohistochemical studies on a 2 month-old
mouse showed exclusive labelling of mature osteoblasts and osteocytes
in bones and of odontoblasts in teeth (Ruchon et al., 2000: J Bone Miner.
Res. In press). Taken together these results suggest that PHEX/Phex
plays an important role in the development and maintenance of
mineralization in these tissues.
Further insights into the role of PHEX in bone metabolism were
provided by experimental studies on cases of oncogenic osteomalacia
(00M), a tumor-associated sporadic condition with very similar clinical
indications. There is strong evidence that a tumor-produced humoral
factor inhibits renal phosphate re-absorption and vitamin D synthesis
resulting in osteomalacia (Nelson et al., 1997). Experimental studies on
Hyp and Gy mice, the murine model of human XL, also suggest the
involvement of a humoral factor. In both mouse models, mutations have
been identified in the Phex gene, which also appear to result in loss of
function of the gene product (Strom et al., 1997; Beck et al., 1997).
Considering the similarities between PHEX protein and the other
members of the metallopeptidase family of enzymes, it has been
speculated that PHEX metabolizes a peptide hormone that modulates
renal tubular phosphate re-absorption. Such an activity could involve
either the processing of a phosphate reabsorbing hormone precursor to
its active form or the inactivation of a circulating phosphaturic factor.
There is evidence of intrinsic abnormalities in osteoblasts from Hyp mice
(Ecarot et al., 1992). A defective phosphate transport was also observed
in osteoblasts from Hyp mice (Rifas et al., 1994). PHEX might thus be
involved in the control of bone metabolism both indirectly at the level of
3
CA 02365094 2002-04-25
WO 00/50580 PCT/CAOO/OOZO1
the kidney by controlling renal phosphate re-absorption and direcdy at the
level of bones by inactivating a trophic peptide factor controlling either
osteoblast or osteoclast functions or both.
Since absence of a functioning PHEX gene leads to
hypophosphatemia, it should be possible to control human diseases
involving hyperphosphatemia through the inhibition of this enzyme. Thus,
inhibiting PHEX will cause a reduction in blood phosphate concentration,
allowing for the prevention and reduction of hyperphosphatemiarelated
disorders in humans and animals. Reduced renal excretion of phosphorus
due to impaired kidney functions is the most common cause of
hyperphosphatemia. In the specific case of secondary
hyperparathyroidism (renal osteodystrophy), proper phosphate
concentration would also benefit the patient by leading to an increase in
endogenous calcitriol production andlor a lowering of PTH level.
Therefore the early and adequate inhibition of PHEX activity could
mitigate the serious consequences of renal osteodystrophy, giving
patients an opportunity for an improved quality of life without the pain and
mobility problems of advanced renal osteodystrophy.
Hyperphosphatemia is defined in adults as an elevation of serum
phosphorus above 1.67 mmoIIL (5 mg/dL). Hyperphosphatemia is a
common finding with many causes (Harrison's 14~' Ed CD-ROM, McGraw
Hill Health Professions Division, New York NY, chapter 356).
Hyperparathyroidism or renal osteodystrophy results from the
progressive nature of chronic renal failure. The leading causes of chronic
renal failure are diabetes (43%), hypertension (35%) and
glomerulonephritis (14%) among US Medicare patients (patients over 65
4
CA 02365094 2002-04-25
- WO 00150580 PCT/CA00/00201
years of age). (Harrison's 14T" Ed CD-ROM, McGraw Hill Health
Professions Division, New York NY, chapter 271, Figure 271.1 ).
Hyperphosphatemia is potentially dangerous because of
metastatic calcification. Although only an approximate guide, a calcium-
phosphorus product [serum Ca (mg/dL) X serum P (mg/dL)] greater than
70 indicates a potential threat of calcification. Patients with this disease
suffer from bone and joint pain, osteopenia, deformities, fractures, muscle
weakness and extra-skeletal calcification.
Irrespective of the underlying cause, the disease is characterized
by a progressive loss of the kidney ability to eliminate waste, to produce
calcitriol (1,25(OH)2D3) and to excrete phosphate. Increased phosphate
excretion is achieved with elevated PTH.
The direct effect of phosphate on PTH levels is well documented.
In the presence of increasing phosphate concentration, intact fresh
parathyroid gland showed increased PTH secretion (Almaden, 1996). A
high phosphate diet causes elevated PTH while maintaining normal
serum phosphate; in contrast, parathyroidectomized rats fed the same
diet showed elevated phosphate levels (Bode, 1981 and Demeter 1991 ).
Results in patients with mild to moderate renal failure showed that
phosphate concentration correlated directly with PTH (Kates, 1997).
Although the treatment of disorders involving an inappropriate
expression of PHEX is a primary goal of the present invention, the
opposite is under the scope thereof. Compositions comprising a soluble
CA 02365094 2002-04-25
- wo ooisos:<o rcric~oorooaoi
active PHEX or a nucleic acid encoding same for the treatment of
disorders involving PHEX deficiencies is an object of-this invention.
The zinc metallopeptidase family (also known as the ~incins; see
Hooper FEES Letters 354,1-6,1994) is characterized by the presence of
a zinc atom at the active site. This large family consistsof several sub-
classes that can be distinguished by their active site structure. One such
sub-family is the gluzincins, which is characterized by the HEXXH motif
and a glutamic acid as the third zinc ligand. This sub-family includes
thermolysin, ACE (angiotensin converting enzyme), aminopeptidases and
enzymes of the Neutral Endopeptidase or Neprilysin (NEP) family. NEP
itself is now considered the prototype for the enzymes of the family (Crine
1997). These peptidases share extensive sequence and structural
similarities. In addition to NEP, there are five other NEP-like enzymes in
the public domain: the endothelin-converting enzymes ECE-1, ECE-2,
Kell, XCE and PHEX (for a review, see: Tumer and Tanzawa, 1997b).
Several family members can cleave the same peptide substrates and the
same inhibitor can inhibit more than one NEP-like enzyme. In fact, several
chemical entities are capable of inhibition of more than one enzyme of the
gluzincin sub-family (Roques B. P. Path Biol 1998 46,3,191-200).
Therefore, known gluzincins inhibitors can be assayed in a PHEX
enzymatic assay and identified as a PHEX inhibitor. Among the methods
of this invention is the administration of "PHEX inhibitors". As referred to
herein, the term "PHEX inhibitor" includes any compound that inhibits the
enzymatic action of PHEX.
SUMMARY OF THE INVENTION
Towards this objective, we have prepared various reagents and
tools designed to produce recombinant forms of PHEX and to purify both
6
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00/00201
the recombinant and native enzymes from cell fractions, spent culture
media and tissue extracts. We have cloned a cDNA encoding the full-
fength human PHEX protein into various expression vectors. These
PHEX-encoding vectors were introduced by transfection into various cell
lines including COS-1 (monkey kidney) cells, CHO (Chinese Hamster
Ovary) cells, and LLC-PK1 (porcine kidney) cells. Permanent cell lines
were established and shown to stably express the PHEX protein at the
cell surface. A procedure was established to rapidly prepare a membrane
fraction enriched in the recombinant PHEX protein.
PHEX is an intrinsic membrane protein anchored by a hydrophobic
20 amino acid sequence located near the N-terminus. The purification of
an intrinsic membrane-bound protein requires the use of detergents to
free it from the lipidic environment of the membrane. These detergents
can interfere with the catalytic activity of the enzyme. Moreover, the
detergent-purified proteins usually present stability and solubility
problems, especially if concentrated solutions and/or large amounts of the
protein are needed, such as those required for crystallization and high
throughput screening assays. To facilitate the preparation and purification
in high yields of a fully active enzyme, it is thus preferable to work with a
soluble form of PHEX. Soluble forms of NEP (Lemay et al., 1989) and
ECE (Korth et al., 1997) consisting of the entire ectodomain but lacking
the cytosolic and hydrophobic transmembrane domains have been
constructed and shown to possess enzymatic activities identical to those
of the native membrane-bound homolog. A soluble form of recombinant
PHEX was thus constructed by modification of the signal
peptide/transmembrane region of the protein. The soluble PHEX
comprises PHEX ectodomain or a catalytic part thereof; this soluble form
of PHEX is referred to as secPHEX. The expression vector encoding
7
CA 02365094 2002-04-25
- WO 00/50580 PCT/CAOO/ODZO1
secPHEX was transfected into LLC-PK1 cells and a permanent cell line
expressing the chimeric PHEX protein on a stable basis was established.
Analysis of the spent medium of this cell line by Western blot was shown
to contain high levels of a secPHEX. This secPHEXwas purified using
either immunoaf~nity or ion exchange chromatography. Ion-exchange
chromatography was found to be the most efficient method to purify
secPHEX from spent culture medium. The purified secPHEX was shown
to be active in an enzymatic assay using PTHrP107-139 as a substrate.
Moreover, the availability of this secPHEX rendered possible its use as
an antigen for the production of anti-PHEX antibodies.
Monoclonal antibodies specific for PHEX were generated by
immunizing mice with a PHEX-derived recombinant fusion protein
produced in E. coli. These monoclonal antibodies were used to purify
recombinant PHEX by various immunoafflnity procedures. PHEX-specific
monodonal antibodies also proved useful for characterizing PHEX
expression in bone by immunohistochemical techniques and Western
blotting.
The present invention also relates to compositions for treating
PHEX-related disorders in humans and animals. The present invention
particularly provides compositions for the treatment of
hyperphosphatemia, including its most frequent manifestations,
secondary hyperparathyroidism and renal osteodystrophy. The
compositions comprise an anti-PHEX molecule which, by inhibiting PHEX
activity, induce an increase in phosphate excretion as well as a reduction
in gut phosphate absorption, thus reducing andlor preferably preventing
hyperphosphatemia and the appearance of its most frequent
consequences, secondary hyperparathyroidism and renal
8
CA 02365094 2002-04-25
- WO 00150580 PCT/CAOOI00201
osteodystrophy. For example, with such a treatment, normophosphatemia
is maintained in patients with mild kidney failure at the expense of PHEX
activity as opposed to an increase in PTH serum concentration. While the
phenotype resulting from PHEX mutation suggests that PHEX inhibition
may be toxic, an attentive study of the physiology suggests otherwise.
The dominant nature of the phosphate excretion suggests that only partial
inhibition may be required to achieve the desired result. Observations in
heterozygous females indicate that an inhibition of much less than 50%
is required. At this low level of inhibition, the other features of XLH that
are gene~iosage-dependent or phosphate-dependent may not be
significant.
Accordingly, a first object of this invention is to provide
compositions comprising PHEX enzyme or mutants, or anti-PHEX
ligands. These compositions are particularly useful for treating PHEX-
related disorders in humans and animals. Further objects include the
provision of the following: (1 ) diagnostic kits for detecting the presence
or amount of PHEX in a sample; (2) a method for detecting the presence
or amount of PHEX in a sample; (3) devices for purifying PHEX ar
mutants thereof; (4) devices for screening PHEX ligands; (5) a method
for obtaining a PHEX ligand; and (6) enzymatic assays involving PHEX
and a PHEX substrate.
DESCRIPTION OF THE SPECIFIC EMBODIME_N_ TS OF THE
INVFNTI(1N
BRIEF DESCRIPTION OF THE FIGURES
9
CA 02365094 2002-04-25
- wo ooisosso rcTicAOOroo2o~
This invention will now be described with reference to the following
specific embodiments and drawings, which purpose is to illustrate the
invention and not to limit its scope.
Figure 1: Construction of a soluble form of PHEX. Figure 1A (construct
1 ) represents the schematic structure of the native membrane-bound form
of the enzyme and the construct in which the POMC signal peptide has
been fused in frame with the ectodomain of the native enzyme (construct
2). Figure 1 B represents the construct where part of the sequence for the
hydrophobic transmembrane domain in construct 1 (underlined) has
been replaced by the more hydrophilic domain in construct 2. In
construct 3, part of the hydrophobic sequence has been deleted in
addition to insertion of the hydrophilic sequence as in construct 2.
Figure 2: Amino acid sequence of human PHEX. The boxed sequence
represents the hydrophobic signal peptideltransmembrane domain. The
underlined sequence represents the segment used for making the E. coli
GST-fusion protein for monoclonal antibody production.
Figure 3: Screening of PHEX monoclonal antibodies. Monoclonal
antibodies were first selected for their capacity to bind the PHEX,2,_~4
fragment produced in E. coli as tested by using the spent medium of
hybridoma cultures in ELISA assays. Immunoglobulins from positive
cultures were next tested for their ability to bind membrane-bound PHEX
from LLC-PK1 cells transfected with the PHEX expression vector. Figure
3A is the Western blot analysis of LLC-PK1 extracts stained with the
various hybridoma supernatants. Track 12 is the staining pattern obtained
with PHEX polyclonal antibody prepared in rabbit. Figure 3B:
immunoprecipitation of a soluble form of PHEX (secPHEX). LLC-PK1
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
cells were first transfected with a vector encoding a soluble form of PHEX
as explained in the Material and Methods section. The spent medium of
transfected LLC-PK1 cells was then used as a source of secPHEX for
immunoprecipitation experiments. The immunoprecipitation was
performed by first saturating protein A-Sepharose beads (Pharmacia) with
a rabbit anti-mouse IgG fraction and then with the mouse
immunoglobulins from the hybridoma supernatants selected as shown in
Figure 3A. After washing, these beads were incubated in aliquots of the
spent medium of LLC-PK1 cells producing secPHEX (40ug of total
protein). The beads were pelleted by centrifugation, washed and the
presence of secPHEX was assessed by boiling the proteins bound to
protein A-Sepharose in the electrophoresis sample buffer followed by
Western blot analysis with a PHEX polyclonal antibody. Track 8 shows
the results of an immunoprecipitation done in the same conditions with a
rabbit PHEX polyclonal antiserum. Tracks 10 and 11 are control
experiments prepared from mock transfected cells.
Figure 4: Expression of membrane-bound and soluble forms of
recombinant PHEX in COS-1 cells. COS-1 cells were transfected with
expression vectors containing either the entire coding sequence of PHEX
(left panel) or a construct capable of promoting the secretion of the PHEX
ectodomain (see Methods) (right panel). The cells were kept in culture for
16 h after transfection and either a membrane fraction (left panel) or the
spent medium (right panel) was prepared as explained in Methods. The
expression of PHEX was monitored in Western blots with monoclonal
antibody 15D7. As seen in left panel, a band migrating with a mobility
corresponding to an apparent Mr of 105,000 was present in the
membrane fraction of cells transfected with the pCDNA31RSV-PHEX-FLB
vector (lane 2). This band was absent from the extract of control cells
11
CA 02365094 2002-04-25
WO 00/50580 PC'f/CA00/00201
(lane 1 ). The right panel shows the presence of a secreted soluble form
of PHEX in the spent medium of transfected cells, but not in control mock
transfected cells.
Figure 5: Ion-exchange chromatography purification of secPHEX.
Concentrated spent culture medium from secPHEX expressing LLC-PK1
cells was loaded on SP-Sepharose column and the proteins eluted with
a linear NaCI gradient. Fractions were analysed on a 7.5% SDS
polyacrylamide gel and detected by immunoblotting (Figure 5A) or by
silver staining (Figure 5B).
Figure 6: Enzymatic assay for secPHEX. Purified secPHEX (2 p,g) was
incubated
in the presence of 10 wg PTHrP107-139 and the reaction mixture
analyzed.by RP-HPLC. Figure 6A shows the chromatogram obtained
when PTHrP107-139 is incubated in the absence of secPHEX. Figure 6B
shows the digestion of PTHrP107-139 by secPHEX. This degradation can
be totally inhibited by the addition of 0.001 M EDTA to the reaction mixture
(Figure 6C). Cleavage of PTHrP107-139 by secPHEX is sensitive to
phosphate concentration (Figure 6D to 6H: 1, 5, 10, 25, 50 mM
phosphate, respectively).
In order to provide a clear and consistent understanding of terms
used in the present description, a number of definitions are provided
hereinbelow. Unless defined otherwise, the scientific and technological
terms and nomenclature used herein have the same meaning as
commonly understood by a person of ordinary skill to which the present
invention pertains.
12
CA 02365094 2002-04-25
- wo oo~sosso pc'ricAOOroo2oi
As used herein, the designation "variant" denotes, in the context
of a sequence whether a nucleic acid or amino acid sequence, a
molecule that retains a biological activity (either functional or structural)
that is substantially similar to that of the original sequence. This variant
or equivalent may be a natural intra-species or inter-species variant or
may be prepared synthetically. Such variants include amino acid
sequences having substitutions, deletions or additions of one or more
amino acids, provided that the biological activity of the protein is
conserved. The same applies to derivatives of nucleic acid sequences
which can have substitutions, deletions or additions of one or more
nucleotides, provided that the biological activity of the sequence is
generally maintained. When relating to a protein sequence, the
substituting amino acid generally has chemico-physical properties which
are similar to that of the substituted amino acid. The similar chemico-
physical properties include similarities in charge, bulkiness,
hydrophobicity, hydrophilicity and the like. The term "variants" is intended
to include "fragments", "segments", "functional derivatives", "analogs" or
"chemical derivatives" of the subject matter of the present invention.
The term "hydrophobic amino acid residue" is intended to mean an
amino acid chosen from the following group: alanine, valine, leucine,
isoleucine, proline, methionine, phenylalanine, tryptophan or variants
thereof (A. L. Lehninger, Principles of Biochemistry (Worth Publishers,
Inc.: 1982), at p.101 ). In the context of this invention, aliphatic amino
acids are preferred.
The expression "anti-PHEX" molecule is intended to mean a
molecule such as an "antisense nucleic acid molecule", an "antibody", an
13
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00l00201
"inhibitor" or an "antagonist" (i.e., any molecule capable of hindering
PHEX activity).
The present invention also provides antisense nucleic acid
molecules which can be used for example to decrease or abrogate the
expression of the nucleic acid sequences or proteins of the present
invention. An antisense nucleic acid molecule according to the present
invention refers to a molecule capable of forming a stable duplex or triplex
with a portion of its targeted nucleic acid sequence (DNA or RNA). The
use of antisense nucleic acid molecules and the design and modification
of such molecules is well known in the art as described for example in
WO 96132966, WO 96111266, WO 94/15646, WO 93108845 and
USP 5,593,974. Antisense nucleic acid molecules according to the
present invention can be derived from the nucleic acid sequences and
modified in accordance to well known methods. For example, some
antisense molecules can be designed to be more resistant to degradation
to increase their affinity to their targeted sequence, to affect their
transport to chosen cell types or cell compartments, andlor to enhance
their lipid solubility bu using nucleotide analogs and/or substituting
chosen chemical fragments thereof, as commonly known in the art.
In general, techniques for preparing antibodies
(including monoclonal antibodies and hybridomas) and for detecting
antigens using antibodies are well known in the art (Campbell, 1984, In
"Monoclonal Antibody Technology: Laboratory Techniques in
Biochemistry and Molecular Biology", Elsevier Science Publisher,
Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody- A
Laboratory Manual, CSH Laboratories). The present invention also
provides polyclonal, monoclonal antibodies, or humanized versions
14
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
thereof, chimeric antibodies and the like which inhibit or neutralize their
respective interaction domains andlor are specific thereto.
As commonly known, a "mutation" is a detectable change in the
genetic material which can be transmitted to a daughter cell. As well
known, a mutation can be, for example, a detectable change in one or
more deoxyribonucleotide. For example, nucleotides can be added,
deleted, substituted for, inverted, or transposed to a new position.
Spontaneous mutations and experimentally induced mutations exist. The
result of a mutations of nucleic acid molecule is a mutant nucleic acid
molecule. A mutant polypeptide can be encoded from this mutant nucleic
acid molecule. A mutation may result in an unaffected mutant, a
negatively or positively partially affected mutant, or an inactive mutant.
In the embodiment of the present invention, a mutant has been obtained
which has the particular capacity to bind to a PHEX but has an inactive
catalytic site.
As used herein, the term "purled" refers to a molecule having
been separated from a ceNular component. Thus, for example, a "purified
protein" has been purified to a level not found in nature. A "substantially
pure" molecule is a molecule that is lacking in most other cellular
components.
CA 02365094 2002-04-25
WO 00!50580 PCTICA00/00201
As used herein, the terms "molecule" or "ligand" are used interchangeably
and broadly to refer to natural, synthetic or semi-synthetic molecules or
compounds. The term "molecule" therefore denotes .for example chemicals,
macromolecules, micromolecules, cell or tissue extracts (from plants or
animals)
and the like. Non limiting examples of molecules include nucleic acid
molecules,
peptides, antibodies, carbohydrates and pharmaceutical agents. The agents can
be selected and screened by a variety of means including random screening,
rational selection and by rational design using for example protein or ligand
modelling methods such as computer modelling. The terms "rationally selected"
or "rationally designed" are meant to define compounds which have been chosen
based on the configuration of interacting domains of the present invention. As
will
be understood by the person of ordinary skill, macromolecules having non-
naturaily occurring modifications are also within the scope of the term
"molecule".
The distinction between a "macro" and a "micro" molecule is made on the basis
of
size. For example, an oligonucleotide and a peptide having no more than about
100 nucleotides or amino acids, respectively, would be considered
micromolecules, whereas a gene, a complete cDNA and a protein would generally
be classified as macromolecules because of their larger size. The molecules
identified in accordance with the teachings of the present invention have a
therapeutic value in diseases or conditions in which the physiology or
homeostasis
of the cell and/or tissue is compromised by a defect in the nature or level of
PHEX
gene product. They may also have diagnostic value in the evaluation of the
same
diseases or conditions.
METHODS
Production of monoclonal antibodies
The cDNA corresponding to amino acids 121 to 294 of the PHEX amino
acid sequence (underlined segment in Figure 2) was used to construct a GST-
fusion protein in E. colt. This fusion protein was purified from E. coli
extracts by
16
CA 02365094 2002-04-25
WO 00/50580 PCTlCA00/00201
affinity chromatography on a glutathione-Sepharose column. After thrombin
cleavage, the PHEX portion of the GST fusion protein was further purified by
electro-elution from a polyacrylamide gel. This material was used to immunize
4
mice (5 injections of ~50 ~,g of PHEX,2,_2~). Blood was collected from each
mouse
after the immunization schedule and the presence of antibodies in mice serum
was
assessed by ELISA using microtiter plates coated with PHEX,2,_~4 from E. coli
extracts. Mice sera were also tested for the presence of PHEX antibodies by
Western blotting extracts of LLC-PK1 cells transfected with the PHEX
expression
vector. Out of the 4 mice immunized, 3 showed good results both in ELISA and
Western blots. One mouse selected for its high titer of PHEX-specific
antibodies
(as measured by ELISA) was sacrificed and its spleen cells were collected and
immortalized by fusion with myeloma cells (strain). Hybridoma cells were
selected
for their ability to grow in HAT selection medium and cloned by several rounds
of
limiting dilution.
Expression of human PHEX in transfected cells
A cDNA encoding for the full-length human PHEX was obtained by
Polymerase Chain Reaction (PCR) as previously described (Beck et al., 1997).
The plasmid pCR2.1-PHEX-FLB was generated by cloning this cDNA into pCR2.1
(Invitrogen). A restriction fragment (Spel-Ec;oRV), which contained the entire
PHEX
coding sequence, was digested, blunted, and subcloned into the mammalian
expression vector (pGDNA3/RSV). The resulting plasmid (pCDNA3IRSV-PHEX-
FLB) contained the entire PHEX cDNA under the control of the Rous Sarcoma
Virus (RSV) promoter.
This recombinant vector was then expressed transiently in COS-1 cells by
transfection. COS-1 cells were grown at 37°C under a 5% CO2 atmosphere
in
Dulbecco's modified Eagle's medium (DMEM) containing 5% COSMIC (Hiclone),
100 U/ml penicillin, and 100 pglml streptomycin. COS-1 cells were transfected
using the calcium phosphate-DNA co-precipitation procedure. The day following
17
CA 02365094 2002-04-25
wo ooisosso Pc~ricAOOroo2oi
transfection, the serum-containing medium was changed for a synthetic medium
that consists of DMEM supplemented with 2.5 pg/ml insulin, 17.5 wg/ml
transferrin,
2 pg/ml ethanolamine, 100 ~glml soybean trypsin inhibitor and 10 pglml
aprotinin.
Finally, sodium butyrate was added to the synthetic medium at a concentration
of
mM to enhance the expression of the plasmids carrying the RSV promoter.
After 48 h, the cells were harvested and the membranes were prepared according
to the procedure of Korth et al. (1997).
The plasmid pCDNA3/RSV-PHEX-FLB was also transfected in LLC-PK1
cells by the CaP04 precipitation method. Transfected cells were selected by
adding 400 pg/ml of G-418 to the culture medium. G-418 resistant cells were
grown in 150 mm dishes containing 20 ml medium 199 with Earle's salts, 2mM L-
glutamine, Hepes and bicarbonate buffer supplemented with 5% fetal bovine
serum (FBS), 50 units/ml penicillin, and 50 p,glml streptomycin. Cells were
grown
up to confluence for about a week and harvested by scraping with a rubber
policeman.
Construction and expression of a soluble form of recombinant PHEX
To obtain a soluble form of recombinant human PHEX, we first attempted
to fuse in frame the cDNA encoding the signal sequence of a secreted protein
(pro-
opiomelanocortin or POMC} to the cDNA sequence of the ectodomain of human
PHEX (Figure 1, panel A). This strategy, which had successfully been used for
other members of this family of peptidases, namely NEP and ECE (Lemay et al.,
1989; Korth et al., 1997), resulted in the production of a misfolded PHEX
protein
that remained trapped in the rough endoplasmic of transfected cells.
Consequently, an alternate strategy was developed consisting in the
substitution
of selected amino acids in the N-terminal hydrophobic membrane anchor of PHEX
to transform it into a cleavable signal sequence.
18
CA 02365094 2002-04-25
- wo ooisosao Pcricnooroo2o~
Transformation of the membrane anchor into a cleavable signal sequence
was carried out on the pCDNA3IRSVIPHEX-FLB plasmid. Site-directed mutations
(9 codons) and deletions (4 codons) were introduced by Polymerase Chain
Reaction (PCR) ampl~cation using oligonucleotide #5136 as the sense primer
5'CTGACAGTGATCGCTCAACAAACAACCAGTCAAGGTCTCTTAAGTCTCCAAG
3' and oligonucleotide #5134 as the antisense primer
5'GGTTGTTTGTTGAGCGATCACTGTCAGGACAAACACGACCAGGGGAATTCG
3' (Figure 1, panel B). The resulting plasmid, designated as to
pCDNA3lRSV/PHEX-MutE, encoded for a secreted form of PHEX (secPHEX).
This recombinant vector was then expressed transiently in COS-1 cells by
transfection as described above. After 16 hours of incubation, the medium was
recovered and concentrated by ultrafiltration (MW cut-off = 30 kDa) using a
Centriprep cartridge (Amicon). To induce the stable expression of secPHEX in
LLC-PK, cells, the plasmid pCDNA31RSV-PHEX-MutE was transfected in LLC-PK,
cells by the CaPO, precipitation method. Transfected cells were selected by
adding 400 wg/ml G-418 to the medium. 6418 resistant cells were grown in 150
mm dishes containing 20 ml of medium 199 with Earle's salts, 2mM L-glutamine,
1 mM sodium pyruvate, Hepes and bicarbonate buffer supplemented with 5% fetal
bovine serum (FBS), 100 pglml G-418, 50 units/ml penicillin, and 50 ~cg/ml
streptomycin. Cells were grown up to confluence, for about a week. To produce
secPHEX, confluent cells were incubated for 4 days in synthetic medium that
consists of 199 medium supplemented with 2.5 p.g/ml insulin, 17.5 pg/ml
transferrin, 2 wg/ml ethanolamine, 100 wg/ml soybean trypsin inhibitor and 10
pg/ml
aprotinin. Finally, sodium butyrate was added to the synthetic medium, at a
concentration of 10 mM, to enhance the expression of the secPHEX gene, which
is under the control of the RSV promoter. After 4 days, the medium was
recovered,
centrifuged and concentrated by cross-flow filtration (MW cut-off = 30 kDa)
using
a Sartocon Micro Unit (Sartorius). Typically, 600 ml of crude spent medium
from
secPHEX-transfected LLC-PK1 cells are concentrated to 30 ml before loading on
ion-exchange column for purification.
19
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
Characterization of secPHEX was done by immunoblotting. Briefly, proteins
from the concentrated media were resolved on 7.5% SDS-PAGE, and transferred
onto 0.45 ~.m nitrocellulose membranes. Membranes were incubated for one hour
in TTBS (iris Buffered Saline containing 0.05% Tween-20) supplemented with 5%
(w/v) instant non-fat dry milk (Carnation). Membranes were washed rapidly with
TTBS and incubated with a 1:200 dilution of the anti-(human PHEX) monoclonal
antibody (13812) in TTBS supplemented with 1% BSA (w/v). Membranes were
washed in TTBS and incubated for one hour with a HRP-labeled second antibody
in TTBS supplemented with 1 % BSA (wlv). Membranes were washed and
processed using a chemiluminescence reagent (NEN).
Other signal peptide coding sequences may be used in so far as they
properly govern the secretion of PHEX in the extracellular space (the culture
medium or a secretion fluid, depending on the host cell, tissue or organism
used).
Immunoprecipitation assay
The immunoprecipitation assay was performed by first saturating protein A-
Sepharose beads (Pharmacia) with a rabbit anti-mouse 1gG fraction and then
with
the mouse immunoglobulins from hybridoma supernatants. After washing in PBS,
these beads were incubated in aliquots of the spent medium of LLC-PK1 cells
producing secPHEX (40 pg of total protein) diluted in immunoprecipitation
(IPP)
buffer (20 mM Tris-HCI pH7.4, 100mM NaCI, 2% sodium deoxycholate, 2% Triton
X-100, 0.2% SDS, and 0.2% BSA). The beads were pelleted by centrifugation,
washed twice in IPP buffer and once in PBS and the presence of secPHEX bound
to the immunoaffinity support was assessed by submitting the proteins bound to
proteins A Sepharose in a non-covalent fashion to boiling in the
electrophoresis
sample buffer before immunoblot analysis.
Purification of the soluble form of PHEX
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
1 ) Purification of secPHEX by ion-exchange chromatography:
The concentrated medium was loaded on a SP-Sepharose ration-exchange
column (Pharmacia) previously equilibrated with 50 mM sodium phosphate pH 6.6
containing 50 mM NaCI. The column was washed with 10 column volumes of the
same buffer and SecPHEX was eluted with a 50mM to 1 M NaCt gradient.
Fractions were analyzed by SDS-PAGE and immunoblotting, as described above,
and fractions containing secPHEX visualized by silver staining.
2) Purification of secPHEX by immunoaffinity chromatography
An immunoaffinity column was built by linking antibody 4C5 to Affigel
(BioRad). Immunoglobulins were purified from 4C5 ascite on protein G column
(Amersham-Pharmacia) and coupled to the Affigei matrix as recommended by the
supplier (BioRad). Two mg of IgG were attached to the matrix in a 4 ml column.
The column was washed as recommended by the supplier and equilibrated in 20
mM Tris-HCI pH 8Ø An aliquot of 15 ml of concentrated LLC-PK1 culture medium
was circulated overnight on the column. The column was washed with 5 volumes
of equilibration buffer. The proteins were eluted with 0.1 M triethylamine pH
11.5
and immediately neutralized by the addition of 0.2 volume of 1 M phosphate
buffer
pH 6.8. Proteins in fractions were analyzed by SDS-PAGE and immunoblotting.
Preparation of PHEX-containing brush border membranes
The LLGPK1 cell line forms polarized epithelial monolayers in culture.
Brush border (apical) membranes BBMs were purified from LLC-PK1 cell
homogenates as described previously (Bfais et al., 1987). Briefly, cell
membranes
were disrupted by sonication. Non-apical membranes were precipitated at 4
°Cby
adding CaCl2 to a final concentration of 13 mM under constant agitation. BBMs
were fractionated by sequential centrifugation at 950 x g for 10 min and then
at 35,
000 x g for 30 min. The final pellet containing BBMs was washed twice with 50
mM
21
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00/00201
Tris-HCI, pH 7.5, and resuspended in the same buffer. The presence of PHEX in
BBMs was verified by immunoblotting.
Assay for the activity of PHEX
An aliquot of purified PHEX containing 2 ~g of protein was incubated for 15
min at 37 °C in a volume of 200 p1 of 50 mM MES (2-(N-
Morpholinaethanesutfonic
acid, pH 6.5, containing 150 mM NaCI and 10 ~g of PTHrP107-139 as a substrate.
After the incubation period, the hydrolysis was stopped by the addition of
trifluoroacetic acid to a final concentration of 0.1 %. Identification of
peptide
products was performed by reverse phase high performance liquid
chromatography (RP-HPLC) on a C18 ~Bondapak analytical column (Waters) with
a UV detector set at 214 nm. Peptides were resolved with a linear gradient of
5%
B to 85% B in 45 min at the flow rate of 0.4 ml/min [mobile phase A= 0.1
trifluoroacetic acid; mobile phase B= 80% acetonitrile (CH3CN), 0.1%
trifluoroacetic
acid).
RESULTS
Production of monoclonal antibodies
Throughout the limiting dilution process, hybridoma were tested for their
ability to bind to PHEX,2,_~4 in the ELISA assay, to recognize recombinant
full
length PHEX in Western blotting assays (Figure 3A) and to immunoprecipitate
secPHEX (Figure 3B). Antibody 15D7 showed good results in
irnmunoprecipitation,
immunoblotting and also in immunofluorescence experiments (results not shown)
and was selected to monitor the expression of PHEX or secPHEX in cultured
transfected cells or PHEX in tissues. Other segments of PHEX may be used as
antigens provided that they are specific to PHEX in so far as the production
of
PHEX-specific antibodies is sought.
22
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00l00201
Expression of membrane-bound recombinant PHEX in COS-1 cells
COS-1 cells were transfected with an expression vector containing the
entire coding sequence of PHEX inserted downstream from the RSV promoter.
This vector is called pCDNA3/RSV-PHEX-FLB (see Methods). The cells were kept
in culture for 16 h after the transfection and a membrane fraction was
prepared as
explained in Methods. The expression of PHEX was monitored in Western blots
with monoclonal antibody 15D7. As seen in Figure 4 a band migrating with a
mobility corresponding to an apparent Mr of 105,000 was observed in the
membrane fraction of cells transfected with the pCDNA3/RSV-PHEX-FLB vector
(lane 2). This band was absent from the extract of control cells (lane 1 ).
Production of a soluble form of recombinant PHEX
We next wanted to determine whether it is possible to use genetic
engineering techniques to promote the secretion of a soluble and active form
of
PHEX from transfected eukaryotic cells. Obviously, this kind of enzyme, which
can
easily be purified from the incubation medium of cultured cells without the
use of
detergent, would be very useful for further structural studies and inhibitor
screening. It could also eventually be used as an injectable therapeutic agent
or
in topical applications to increase the rate of bone mineralization or bone
healing.
PHEX is a class II integral membrane protein. Class II membrane proteins
have, near their amino terminus, a unique hydrophobic peptide acting both as a
signal peptide to direct the translocation of the protein through the membrane
of
the rough endopiasmic reticulum and as a transmembrane domain for anchoring
the protein in the cell plasma membrane. Unlike class I membrane proteins
which
possess a cleavable signal peptide and are anchored in the membrane by an
additional membrane-spanning hydrophobic sequence (also called Stop Transfer
Sequence}, class II membrane proteins cannot be easily transformed into
soluble
forms by deleting the hydrophobic transmembrane domain. In class II membrane
23
CA 02365094 2002-04-25
WO 00/50580 PCTlCA00100201
proteins, deletion of the anchoring segment also removes the signal pep~de,
thereby preventing the translocation of the protein in the RER and its
transport to
the cell surface. Theoretically, there are two different approaches for
transforming
a membrane-bound class II protein into a soluble form: 1 ) the extracellular
domain
of the protein could be fused to a heterologous deavable signal peptide; and
2)
changes in the transmembrane domain could be introduced to transform the
combined signaUanchor into a cleavable signal peptide. Both strategies were
successfully used to produce a soluble from of NEP (Lemay et al., 1989; Lemire
et al., 1997).
In this work, a PHEX secretion vector was first constructed by fusing in-
framethe sequence encoding the complete ectodomain of the human enzyme with
the POMC signal peptide (Figure 1A), these sequences being under the control
of
the RSV promoter. Despite the fact that PHEX immunoreactive material could be
detected in the cell extract of transfected cells, expression levels were low
and no
enzyme could be found in the secretion medium (results not shown). When the
cell-associated PHEX immunoreactive material was digested with
endoglycosidases and analyzed by Western blot, it was found to be essentially
endo H sensitive, indicating retention of the recombinant protein in the RER
(results not shown).
Replacement of part of the transmembrane region (underlined sequence in
Figure 1 B: sequence 1 ) by the underlined sequence shown on line 2 resulted
in
the secretion of a soluble form of PHEX from transfected COS-1 cells (results
not
shown). The yield was further increased by deleting the sequence LFLV at the
junction between the transmembrane and ectodomain (panel B: sequence 3).
Figure 4 (lane 4) shows the amount of recombinant protein secreted in the
incubation medium by transfected COS-1 cells. The same vector was also
transfected in LLC-PK1 cells as described in Methods and stable transfectants
were selected for their G-418 resistance. This pool of G-418 resistant cells
was
found to secrete substantial amounts of secPHEX (up to 600 wg/L) as seen by
24
CA 02365094 2002-04-25
WO OOV50580 PCT/CA00/00201
Western blotting (results not shown). SecPHEX was resistant to endo H,
indicating
that it had acquired terminal sugars, most probably during its transit through
the
Golgi apparatus (results not shown). The enzyme secreted by cultures of LLC-
PK1
cells could then be purified either by immunoaffinity or by ion-exchange
chromatography.
Preferred purification of secPHEX by ion-exchange chromatography
Concentrated culture medium from secPHEX-transfected LLGPK1 cells
was loaded on SP-Sepharose column and proteins eluted as described in
Methods. Monitoring of the eluate at 280 nm revealed one major protein peak
(result not shown), which was shown by immunoblotting to contain secPHEX
(Figure 5). Analysis of the fractions containing secPHEX on 7.5% SDS-PAGE and
detection of proteins in the gel by silver staining showed that secPHEX
represented more than 90% of proteins present in the fractions. Typically,
1.25 mg
of pure secPHEX are obtained from 600 ml of non-concentrated culture media.
Although secPHEX has been recovered from spent culture medium, it is
feasible nowadays to have a host such as a ruminant, the organs of which are
engineered to produce PHEX as a secretion product in milk, for example. A
recombinant vector expressible in the tissue could comprise as an insert a
construct similar to the one which led to the production of secPHEX in spent
culture medium. Modifications to the construct are well known to the skilled
artisan
(promoter, signal peptide, etc). That recombinant vector is included in a
composition and in a method for producing PHEX.
On the opposite, if PHEX needs to be silenced, anti-PHEX molecules are
included in the compositions and methods of the present invention and their
administration inhibits PHEX activity.
CA 02365094 2002-04-25
- WO 00/50580 PCTlCA00/00201
Purification of secPHEX by immunoaffinity
Immunoblot analysis of the fractions abtained from~the column showed that
secPHEX was retained. However, Coomassie Blue staining showed that other
proteins were also present in the fractions (results not shown). The amount of
secPHEX obtained from 165 ml of non-concentrated LLGPK1 culture medium was
evaluated at 3 pg of protein.
Activity of secPHEX
HPLC analysis of PTHrP107-139 digested with secPHEX in conditions
described in Methods revealed that secPHEX can degrade this peptide.
PTHrP107-139 peak on the chromatogram was decreased to 15% of its original
surface after only 15 min of incubation (Figure 6). Peaks corresponding to
metabolites appeared on the chromatogram. This enzymatic activity was fully
inhibited by 0.001 M EDTA and 0.001 M O-phenantrolin, two general inhibitors
of
metallopeptidases. Activvity was also observed in Acetate, HEPES and Tris
buffers
covering a pH range from 4.0 to 8.5. Phosphate buffer inhibited the activity
of the
enzyme (Figure 6).
EXAMPLES
Example I: Use of recombinant secPHEX to identify its natural substrate in
bone
PHEX is expressed in osteoblasts, and its expression is temporally
associated with the mineralization of the extracellular matrix in cultured
osteoblasts
(Beck et al., 1997a; Du et al., 1996a; Guo and Quarles, 1997a) and during
development (Ruchon et al., 2000). These observations suggest that bone is a
relevant site of PHEX expression and that a potential relationship exists
between
mutations of PHEX and aberrant osteoblast-mediated mineralization. Thus PHEX
may function in osteoblasts to metabolize endogenous or exogenous factors that
regulate the process of osteoblast-mediated mineralization. In support of this
26
CA 02365094 2002-04-25
WO 00/50580 PCTlCA00/00201
hypothesis, a recent report suggests that loss of PHEX function in cultured
osteoblasts of Hyp mice is associated with the accumulation of a factor or
factors
that inhibit mineralization of extracellular matrix in vitro (Xiao et al.,
1998). The
availability of recombinant soluble PHEX greatly facilitates the
identification of the
physiological bone substrates) for PHEX in a series of experiments such as the
one described hereunder.
Bones of Hyp mice are dissected, freed from connective tissue, and
muscles frozen in liquid nitrogen and lyophilized. The bones are then cxushed
into
a powder and extracted with a strongly acidic solution containing
tr>fluoroacetic
acid (TFA), formic acid and 1 M NaCI. The composition of this solution is
selected
such as to inactivate all protease activities and avoid the sofubilization of
large
molecular weight proteins. The acidic extract is then lyophilized and an
aliquot
containing approximately 100 pg of total peptide resuspended in a
physiological
buffer at pH around 7.0, is submitted to digestion with 1-10 ~g of PHEX
purified by
ion-exchange or by immunoaffinity chromatography, as described above. A
control
experiment, where the enzyme preparation is inactivated by acidic or heat
treatment prior to the incubation, is conducted in parallel. The peptides
contained
in the samples are then separated by reversed-phase HPLC on a C18 pBondapak
column using buffers containing 0.1 % TFA and variable concentrations of
acetonitrile (i.e. from 0 to around 80%). The chromatograms of the peptides
digested with active or inactivated PHEX are compared. The mixture of bone
peptides taken from Hyp mouse and incubated with the inactivated PHEX
preparation should contain the PHEX substrate. Incubation of the same mixture
with active PHEX however should allow the cleavage of the PHEX substrate into
peptide metabolites. Comparison of the chromatograms should thus allow
identifying peaks corresponding to PHEX substrate and its metabolites. These
peaks are then collected and identified by mass spectrometry and/or automated
Edman sequence degradation.
27
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00/00201
The identification of PHEX substrates may also be done using a similar
strategy with conditioned medium taken from cultures of Hyp mouse osteoblasts.
Alternatively, an inactive soluble form of PHEX immobilized on a
chromatographic support may be used as an affinity reagent for purifying PHEX
substrates from crude extracts of tissues (such as bones) or serum. Cell
surface
metallopeptidases from the neprilysin family can be modified by the addition
of a
C terminal extension without interfering with their enzymatic activity (Howell
et al.,
1995; Yang et al., 1995). A soluble form of PHEX, extended by an additional
C-terminal peptide of approximately 20-25 amino acid residues (called here
secPHEX-EC) is constructed by fusing in frame a synthetic oligonucleotide, as
explained previously for NEP (Howell et al., 1995). The additional sequence is
terminated by a cysteine residue such as to allow its efficient coupling to
activated
thiol-Sepharose 4B [agarose-(glutathione-2-pyridyl disulfide)] (Pharmacia,
Fine
Chemicals AB, Uppsala, Sweden). Sec-PHEX-EC is produced in high yields using,
for example, the LLC-PK1 cell system used to produce secPHEX. The
recombinant protein is purified by ion-exchange or immunoaffinity
chromatography
using conditions similar to the ones described for the purification of
secPHEX. The
fractions are analyzed by SDS-PAGE and the purity verified by staining with
Coomassie blue.
For binding the purified recombinant protein to the solid phase, the Thiol-
Sepharose resin Is rehydrated to obtain approximately 1 ml of gel volume. The
gel
is equilibrated with a buffer A (0.1 M Bis-Tris, 0.5 M NaCI, pH 7.0) and
incubated
with approximately 3 mg of secPHEX-EC in buffer A (2-4 rnl) overnight at 4
°C
under constant agitation. The slurry is then washed, first with approximately
1 ml
of buffer B (0.1 M Bis-Tris, 5 mM DTT, pH 7.0) and then extensively with
buffer A.
The quantity of proteins coupled to the support is determined by the Bradford
assay (BioRad) on a small amount of gel.
28
CA 02365094 2002-04-25
WO 00/50580 PC'1'/CAOON0201
The immobilized secPHEX-EC is used as a solid phase reagent for the
screening of PHFaC inhibitors. Enzymatically inactive variants of this
material is also
prepared by binding a form of secPHEX-EC carrying a mutation on the catalytic
glutamic acid residue in position 582 to change it into a valine. A similar
mutation
in the coding sequence of NEP was previously shown to result in a
catalytically
inactive enzyme that nevertheless retained its futl binding activity for
inhibitors and
substrates (Devault et al., 1988). Such an affinity reagent is used to bind
and purify
PHEX peptide substrates in crude tissue extracts. Receptors, if any, can be
found
using the same approach. Screening of inhibitor components can also be
performed, although an active PHEX may be preferred. Tissue extracts prepared
as described above are incubated under constant agitation in a buffer such as
0.
1 M gis-Tris pH 7.5 with 1 ml of the affinity resin at 4°C. After
washing in the same
binding buffer, the bound peptides can be eluted from the gel by either
raising or
lowering the pH and/or by increasing the ionic strength of the buffer. Many
other
mutations may be envisaged, the purpose of which remains the replacement or
elimination of the glutamic acid residue which is specific to the gluzincins.
For
example, vaiine has been tried with success as a substituting amino acid, but
other
amino acids such as hydrophobic, and preferably aliphatic, amino acids may be
equivalent.
Example II: Enzymatic assay
A peptide consisting of, for example, 10 amino acid residues spanning the
cleavage site of PTHrP107-139 is synthesized by solid-phase peptide synthesis
and used as a substrate for PHEX. The cleavage site is determined by assaying
the enzymatic reaction products with a mass spectrometer equipped with a
liquid
sample inlet port, as found with t_C-MS instruments, with the separation
achieved
in-line or off line. This decapeptide (10 pg) is incubated in the presence of
purified
secPHEX (1-10 ~.g total protein), at 37°C for 60 min in MES pH 6.5. The
reaction
is terminated by the addition of TFA to a final concentration of 0.1 %.
Metabolites
are analyzed using a C-18 ~-Bondapack column (Waters). For example,
metabolites may be resolved with a 45 min linear gradient of 0-40%
acetonitrile in
29
CA 02365094 2002-04-25
wo oorsosso PcricAOOioozo~
0.1 % trifluoroacetic acid at a rate of 1.0 ml/min. The eluted peptides are
detected
by monitoring their absorbance at 214 and 254 nm. The decapeptide should be
cleaved into iwo shorter peptides that will be eluted at different retention
times. The
peak fractions corresponding to these two peptides are collected and their
molecular mass is determined by mass spectrometry to identify the position of
the
cleavage site. Once validated as a substrate for PHEX, the synthetic peptide
described here above may be modified such as to incorporate amino acid
derivatives bearing either fluorescent groups, chromogenic groups or
radioactive
atoms. These peptides derivatives are then used to construct fast, sensitive
and
robust enzymatic assays for further quantifying and characterizing PHEX in
tissue
extracts, as described in Example III.
Example III: Screening for quenched-fluorescent substrate
The peptide ident~ed in Example II is used to design and synthesize
internally quenched fluorescent peptide substrates for PHEX. Small peptide
libraries are prepared with a fluorophore at one extremity and a quencher
group
at the other (Meldal, 1998). The substrate can be identified using a strategy
described in (Apletalina et al., 1998). For each hexapeptide library, the
identity of
one residue at one position remains constant while the rest is randomized (for
a
total of 6*20=120 individual libraries). Each library is comprised of 3.2
million
different members and is identified both by the position of the constant
residue
along the hexapeptide, and its identity. A purified preparation of PHEX enzyme
is
added to each library and the fluorescence is recorded. The data is organized
to
identify the libraries producing the most fluorescence for each position along
the
hexapeptide. This arrangement suggests the identity of important residues at
each
position along the hexapeptide. Hexapeptides representing the best suggestions
are prepared and tested in a similar fashion. From this set, the hexapeptide
with
the best fluorescence is selected. This assay can be useful for setting up a
high
throughput screening method for identifying inhibitors in combinatorial
libraries of
compounds.
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00/00201
Example IV: Uses of recombinant PHEX protein in therapeutic applications
The murine Hyp model reproduces the characteristics of human X-linked
hypophosphatemia (XLH), an inherited disease causing renal loss of phosphate
(Pi), severe rickets and osteomalacia. The presence of renal phosphate wasting
due to a mutation in the PHEX gene suggests that this endopeptidase degrades
a yet unidentified phosphaturic hormone, referred to as phosphatonin (Kumar,
1997). To test this hypothesis directly, primary mouse proximal tubule cell
cultures
(MPTC), expressing normal features of proximal tubule cells are prepared. The
presence of 10% Hyp mouse serum in HAMF12/DMEM media (1 mM Pi) for the
last 48 hours of culture of MPTC was previously found to reduce Pi uptake by
45.7
+/- 3.9%, as compared with normal mouse serum, in a dose- and time-dependent
manner (Lajeunesse et al., 1996). If defects in the PHEX gene in Hyp mouse
osteoblasts are responsible for the release andlor the modification of a
factor that
can reach the circulation and inhibit renal phosphate re-absorption, it should
be
possible to abolish the effect of the Hyp mouse senrm on Pi uptake by
pretreating
the serum with a purified preparation of PHEX. The effect of PHEX (1-10 pg of
purified recombinant secPHEX) on Hyp mouse serum is then monitored by
measuring phosphate uptake by MPTC cells. Control experiments include
incubating the serum samples under similar conditions, but with heat or acid
inactivated PHEX. If PHEX treatment is found to restore normal phosphate
uptake,
recombinant soluble PHEX might thus be used as a therapeutic agent for
restoring
normal phosphate levels, first in animal models (such as the Hyp mouse) and
then
in patients with pathological states characterized with X-linked
hypophosphatemic
rickets.
Patients suffering from oncogenic hypophosphatemic ostevmalacia, a rare
disorder, display abnormalities similar to those found with X-linked
hypophosphatemic rickets patients. Therefore, normophosphatemia in these
patients may be re-established with the administration of soluble PHEX enzyme.
31
CA 02365094 2002-04-25
- WO 00/50580 PCTICA00/00201
Example V: Production and use of PHEX antibodies
As shown in the present work, knowledge of PHEX cDNA sequences can
be used to raise specific antibodies. For example, regions of lesser homology
between the peptidases (amino acid residues 121 to 294) can be used to
synthesize peptides whose sequences are deduced from the translation of the
cDNAs. Alternatively, bacterially- expressed fragments of the cDNAs fused to
GST, for example, may be purified and injected into rabbits or mice for
polyclonal
or monoclonal antibody production. These antibodies or derived "diagnostic
reagents", which usually comprise labelled antibodies, can be used to:
- Identify by immunohistochemistry the peptidergic pathways in which
the peptidases are functioning;
- Study the physiopathology of PHEX by immunoblotting or
immunohistochemistry on samples of biological fluids or biopsies;
- Set up high through put screening assays to identify PHEX inhibitors.
This can be done, for example, by using the antibodies to attach the
PHEX to a solid support;
- Purify PHEX with said antibodies by immunoprecipitation or affinity
chromatography by identifying antibodies capable of selectively
binding to PHEX in one set of conditions and releasing it in another
set of conditions, typically involving a large pH or salt concentration
change without denaturing PHEX;
Identify antibodies that block PHEX activity and use them as
therapeutic agents. Blocking antibodies can be identified by adding
antisera or ascites fluid to an in vitro enzymatic assay as described
in Example II and looking for inhibition of PHEX activity. Blocking
antibodies may then be injected in normal and disease model
animals to test for in vivo effects.
Example VI: Alternative methods for producing recombinant soluble PHEX
enzymes
32
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
As shown above, recombinant active PHEX enzymes can be obtained by
expression of PHEX cDNAs in mammalian cells. From past experience with
another member of the family, neprilysin (Devault et al., 1988; Fossiez et
al., 1992;
Ellefsen, 1999), expression can also be performed in other expression systems
after cloning of PHEX cDNA in appropriate expression vectors. These expression
systems may include the baculovirusJinsect cells or larvae system and the
Pichia
pastoris-based yeast system. Production of recombinant PHEX enzymes inGudes
the production of naturally occurring membrane bound or soluble forms of the
protein, or genetically- engineered soluble forms of the enzyme. The latter
can be
obtained by substituting the cytosolic and trans-membrane domain by a
cleavable
signal peptide, such as that of proopiomelanocortin, as done previously (Lemay
et
al., 1989a) or by transforming by genetic manipulations the non-cleavable
signal
peptide membrane anchor domain into a cleavable signal peptide, as done
previously (Lemire et al., 1997a) or by fusion of the ectodomain of PHEX
enzyme
to the amino-terminal domain (from the initiator methionine to amino acid
residue
300) of naturally occurring soluble NEP-like enzymes such asNL-1, as done in
other work.
EXAMPLE VII Identification of inhibitors
Inhibitors can be identified from synthetic libraries, biota extracts, the
current literature and from rationally- designed inhibitors using X-ray
crystallography and substituent activity relationships. Each molecule or
extract
fraction is tested for inhibitory activity using the enzymatic test described
above.
The molecule responsible for the largest inhibition is further tested to
determine its
pharmacological and toxicological properties following known procedures.
In vitro inhibition of enzymatic PHEX degradation can be screened using any of
several art-recognized in vitro models. In these models, a peptide
("substrate") is
exposed to the PHEX enzyme. The substrate may either be a bone related
peptide, a peptide known to be cleaved by any other family member or another
peptidic substrate susceptible to degradation by the PHEX enzyme. Degradation
33
CA 02365094 2002-04-25
WO 00/50580 PCT/CAOOJOOZO1
of the peptide results in liberation of specific metabolites. The amount of
metabolite
liberated (or peptide maintained) can be monitored to determine the degree of
degradation of the substrate by the enzyme. That is, PHEX enzyme inhibitors
can
be tested to determine their propensity to reduce the amount of metabolite
liberated by degradation of a particular substrate by a particular enzyme.
These in vitro models generally consist of a test sample (containing a PHEX
enzyme inhibitor and a peptidic substrate) and a control sample (containing
the
substrate with no PHEX inhibitor). Each sample is exposed to a particular
inhibitor,
and the samples are then compared to determine whether significantly more
metabolite (or less substrate) is present in the control sample than in the
test
sample. If there is significantly more metabolite (or less substrate) in the
control
sample than the test sample, the test compound is an inhibitor of the enzymes}
present. One such method is described above.
There is an extensive literature available on Zn metallopeptidases (Rogues
1982a, Rogues 1982b,Ondetti 1984, Rogues 1985, Rogues 1986, Chipkin 1986,
Thorsett 1987, Rich 1990, Vallee 1990) as potent inhibitors of Neprilysin
(NEP}.
Among the many known functional groups able to coordinate the Zn" cation, the
thiol, carboxyl, hydroxamyl and phosphoryl groups have all been used with
success in the development of ACE and NEP inhibitors. All such molecules that
display inhibitory acfivity of the PHEX enzyme (PHEX inhibitors) are
encompassed
by the present invention.
As indicated above, PHEX is a member of a family of enzymes that share
similar properties, such as their sensitivity to the same inhibitor and their
ability to
process the same substrates. Numerous PHEX enzyme inhibitorsand methods for
their preparationare described in the literature and are useful in the methods
of the
present invention. Such inhibitors are described in the following references,
all of
which are incorporated herein by reference: U.S. Pat. No. 4,380,535, to
Sarantakis, issued Apr. 19, 1983; U.S. Pat. No. 4,423,242, to Wilkinson et
al.,
34
CA 02365094 2002-04-25
WO OO/SOS80 PCT/CA00/00201
issued Dec. 27, 1983; U.S. Pat. No. 4,474,795, to Greenberg et al., issued
Oct. 2,
1984; U.S. Pat. No. 4,504,492, to Wilkinson et al., issued Mar. 12, 1985; U.S.
Pat.
No. 4,513,009, to Rogues et al., issued Apr. 23, 1985; U.S. Pat. No.
4,514,391, to
Gordon et al., issued Apr. 30, 1985; U.S. Pat. No. 4,528,296, to Vecchietti et
al.,
issued Jul. 9, 1985; U.S. Pat. No. 4,552,866, to Delaney et al., issued Nov.
12,
1985; U.S. Pat. No. 4,567,198, to Delevallee et al., issued Jan. 28, 1986;
U.S. Pat.
No. 4,610,816, to Berger, issued Sep. 9, 1986; U.S. Pat. No. 4,611,002, to
Ondetti,
issued Sep. 9, 1986; U.S. Pat. No. 4,618,708, to Rogues et al., issued Oct.
21,
1986; U.S. Pat. No. 4,636,522, to Gordon, issued Jan. 13, 1987; U.S. Pat. No.
4,670,541, to Delaney et al., issued Jun. 2, 1987; U.S. Pat. No. 4,681,960, to
Kakimoto et al., issued Jul. 21, 1987; U.S. Pat. No. 4,721,726, to Berger,
issued
Jan. 26, 1988; U.S. Pat. No. 4,722,810, to Delaney et al., issued Feb. 2,
1988;
U.S. Pat. No.4,939,261, to Ksander, issued Jul. 3, 1990; U.S. Pat. No.
5,096,925,
to Ksander, issued Mar. 17, 1992; U.S. Pat. No. 5,098,934, to Vevert et al.,
issued
Mar. 24, 1992; U.S. Statutory Invention Registration No. 11642, Floyd et al.,
published Jun. 6, 1989; United Kingdom Patent Publication 8111322, Wilkinson,
published Nov. 4, 1981; United Kingdom Patent Publication, Wilkinson et al.,
published Apr. 7, 1983; European Patent Publication 161,769, Delaney et al.,
published Nov. 21, 1985; European Patent Publication 341,081, Kawamura et al.,
published Nov. 8, 1989; European Patent Publication 474,553, Shibahara et al.,
published Mar. 11, 1992; PCT Patent Publication 92/03410, Neustadt et al.,
published Mar. 5, 1992; Fournie-Zaluski et al., 'Differential Recognition of
'Enkephalinase' and Angiotensin-Converting Enzyme by New Carboxylalkyl
Inhibitors", 31 Life &L 2947-2954 (1982); Mimura et al., "A Novel Class of
Enkephalinase Inhibitors Containing a C-Terminal Sulfo Group", 35.!. Med.
Chem.
602-608 (1992).
Preferred PHEX enzyme inhibitors useful in the methods of the present
invention
have the general stnrcture of formula (I):
L-(CH2).~CH(R')~(CHZ)~ A-B-CH(R2)-CH2)p X (i)
CA 02365094 2002-04-25
prp pp/spsgp PCT/CA00100201
wherein
(1 ) L is -S-R3 or -C(=O)-R'where R3 is hydrogen or -C(=ORS, where R5 is lower
alkyl; and where RA is hydroxy or -NHOH;
(2) R' is hydrogen, lower alkyl, aryl, arylalkyl ;
(3) A is -C(=O)-, -NH-C(=O)-, or -N(Re), where R° is hydrogen or lower
alkyl;
(4) B is -NH-, -0-, -S-, or -C(=O)-
(5) R2is hydrogen, lower alkyl, aryl, arylalkyl (preferably phenylmethyl);
(6) X is -C(=O)-NH-R' or -C(=O~O-R'where R' is hydrogen, lower alkyl, phenyl,
or arylalkyl;
(7) m is from 0 to about 2;
(8) n is 0 or I (preferably 0); and
(9) p is from 0 to about 4 (preferably 0 or 1 );
and pharmaceutically-acceptable salts thereof.
Other preferred PHEX inhibitors have the general structure (II):
L-{CH2)m CH(R')-(CH2)~ A-Z-R' (II}
wherein:
(1) L, R', A, m, and n are as described in formula (I);
(2) Z is -NH-, -0-, -S-, -C(=O)-, or nil; and
(3) R' is a carbocyclic ring or a heterocyclic ring; preferably
benzenesulfonic
acid, pyridyl, or morpholinyl;
and pharmaceutically-acceptable salts thereof.
Other preferred PHEX inhibitors, as described in U.S. Pat. No. 4,721,726, to
Berger, issued Jan. 26, 1988, have the general structural fomlula (III):
R,CH(COR2~NH-CHR3 CONH(CH2)CR4R5 CORE (III)
and the racemates, enantiomers and diastereoisomers thereof, as well as the
phamaceutically acceptable salts thereof wherein:
R, is alkyl having from 1 to 6 carbon atoms, adamantylmethyl, cycloakylmethyl
having from 4 to 8 carbon atoms or A-Xm C~H2~ wherein X is oxygen or
sulfur, A is phenyl which may be substituted with the group, Y, where Y is
36
CA 02365094 2002-04-25
WO 00130580 PCT/CA00/00201
halogen, hydroxy, trifluoromethyl, alkoxy having from I to 6 carbon atoms,
alkyl having from I to 6 carbon atoms, 2- and 3-furanyl, 2- and 3-thienyl, or
phenyl (which may be substituted with halogen, hydroxy, trifluoromethyl,
alkoxy having from i to 6 carbon atoms or alkyl having from 1 to 6 carbon
atoms) benzyl (the phenyl ring of which rnay be substituted with the group,
Y, as defined herein), 1- and 2-naphthyl, 2- and 3-furanyl or 2- and 3-
thienyl; m is 0 or 1 and n is 0, 1, 2, 3, or 4;
R2 and Re may be the same or different and are hydroxy, alkoxy having from
1 to 8 carbon atoms, B-Xm C~H2~ O- wherein B is phenyl (which may be
substituted with the group, Y, as defined herein) or 1- and 2-naphthyl, X, m,
and n are as defined herein provided that when n=0, m=0, -OCH20C0-alkyl
having from 3 to 8 carbon atoms, -OCH2C0-Phenyl (the phenyl ring of
which may be substituted with the group, Y, as defined herein), 1-glyceryl,
a yz~ ~1
X
O O
1
o a. -or~ci-r.Ji - cH,
t~~~~o,-
wherein R, is hydrogen, alkyl having from 1 to 6 carbon atoms, or phenyl which
may be substituted with the group, Y, as defined herein, and R8 hydrogen or
alkyl
having from 1 to 6 carbon atoms;
RZ may also be -NR,RBwherein R, and Re are as defined herein;
R3 is alkyl having from I to 6 carbon atoms, cycloalkylmethyl having from 4 to
8 carbon atoms, 2- and 3-thienylmethyl, 2- and 3-furanylmethyl, 1- and 2-
naphthylmethyl, or benzyl the phenyl ring of which may be substituted with
the group, Y, as defined herein;
R4 is D-C~H~,Om wherein D is hydrogen, alkyl having from I to 4 carbon atoms
or phenyl which may be substituted with the group, Z, wherein Z is halogen,
hydroxy, trifluoromethyl, alkoxy having from I to 6 carbon atoms, or alkyl
having from 1 to 6 carbon atoms; m and n are as defined herein;
R4 may also be -NRSCOR, (wherein RS and R, are defined herein), and -
NRSC02R9 (wherein R5 is defined herein and Rg is alkyl having from 1 to 6
carbon atoms or phenyl which may be substituted with the group Y, as
defined herein) provided that p is 1 or 2;
R5 is hydrogen or alkyl having from 1 to 6 carbon atoms; and p is 0, 1 or 2.
Other preferred PHEX enzyme inhibitors, as described by Mimura et al., "A
Novel
Class of Enkephalinase Inhibitors Containing a C-Terminal Sulfo Group", 359.
Med. Chem. 602-608, have the general structure (IV):
37
CA 02365094 2002-04-25
- WO 00/50580 PCT/CA00/00201
R, (IV)
I
CH2 R2
I I
HS-CH2-CH-CO-N-R3 S03H
wherein:
R, is selected from phenyl, p-methylphenyl, pmethoxyphenyl, p-fluorophenyl,
p-trifluoromethylphenyl, p-nitrophenyl, p-dimethylaminophenyl, p-
phenylphenyl, phenylethyl, 1-naphthtyl, 3-pyridyl, 1,2-benzisoxazol-3-yl, or
1-methylethyl;
Ra is selected from hydrogen or cyclopropyl; and
R3 is selected from CRa, CHa-CHa, CHZ CHa-CHa, CH(CH3), CH(CH2CH(CH3)a),
o-phenyl, m-phenyl, p-phenyl, p-phenylmethyl, and 1,4-naphthylene.
Particularly preferred PHEX enzyme inhibitors useful in the methods of the
present invention include (DL-3-mercapto-2-benzylpropanoyl)-glycine; 1-(DL-3-
mercapto-2-methylpropanayl)-L-proline; 2-benzyl-3-(N-hydroxycarboxamido~
propanoyl-L-alanine; 2-benzyl-3-(N-hydroxycarboxamido~propanoyl-L-
phenylalanine; (~~N-(2-acetylthio)methyl-1-oxo-3-phenylpropyl glycine benzyl
ester; N-morpholinyl-2-phenylmethyl-3-mercaptopropanamide; alpha-(mercap-
tomethyl)-N-(4-pyridyl)benzenepropanamide; N-[2-benzyl-3-(N-hydroxy-
carboxamido)-propanoyl]-3-amino-4-phenylbutyric acid; N-[(R,S~2-benzyl-3-
((S)(2-
amino-4-methylthio)butyldithio]-1-oxopropyl]-L-Phe-benzyl ester; N-(2-benzyl-3-
mercaptopropanoyl) metanilic acid; and N-((R,S)-2-carboxy-3-phenyl-propanoyl]-
L-
Leu.
The inhibitor with the best distribution, pharmacological action combined
with low toxicity will be selected for drug manufacturing. Pharmaceutically
acceptable formulation of the inhibitor or its acceptable salt will be
prepared by
mixing with known excipients to produce tablets, capsules or injectable
solutions.
Between 1 and 500 mg of the drug is administered to the patients.
38
CA 02365094 2002-04-25
- WO UO/50580 PCT/CA00/00201
EXAMPLE VII( Therapeutic uses
The present invention also provides methods of treatment for
hyperphosphatemia, including its most frequent manifestations, secondary
hyperparathyroidism and renal osteodystrophy. The method comprises the
administration of a PHEX inhibitor that induces a reduction in circulating
phosphate, thus reducing, or preferably preventing, hyperphosphatemia and the
appearance of its most frequent consequences.
As indicated above, PHEX is member of a family of metalloproteases that
shares similar properties including, as indicated above, their sensitivity to
the same
inhibitor and their capability of processing the same substrates. Numerous NEP-
like enryme inhibitors, and methods for their preparation, are described in
the
literature and are useful in the methods of the present invention.
The PHEX inhibitors that show inhibitory activity are administered to rats
weighing about 2508 at a dose of 1 mg/kg. The control group consists of
another
group of rats where the same vehicle is administered without the PHEX
inhibitor.
Serum and urine are obtained from the test animals using standard methods.
Phosphate concentration in serum and in urine is then measured by standard
methods. PHEX inhibitors capable of inducing a change in phosphate
concentration are said to be hypophosphatemic. Such compounds are the
preferred "hypophosphatemic PHEX inhibitors" for the purpose of treating
hyperphosphatemic patients.
The "least effective dose" is the minimum dose that is required to induce a
sign~cant reduction in serum phosphate or PTH concentration. Preferably, the
therapy will be initiated with such a dose. The treatment preferably involves
the
administration of a "hypophosphatemic PHEX inhibitor" for a period of time
sufficient to achieve a reduction in phosphate or PTH blood concentration or
both
(here and after the blood parameters). Preferably, the net reduction is about
25%
of the difference between the patient value and that of the normal population
or,
39
CA 02365094 2002-04-25
wo ooisosso rcTicAOOioozoi
more preferably, at least about 50% of the difference between the patient's
value
and that of the normal population. The specific period of time sufficient to
achieve
this reduction in the subject blood parameters may depend on a variety of
factors.
Such factors include, for example, the specific hypophosphatemic inhibitor
employed, the amount administered, the age and gender of the subject, the
specific disorder to be treated, concomitant therapies employed (if any), the
general physical health of the subject (including the presence of other
disorders),
the severity of the disease in the individual, and the nutritional habits of
the
individual.
According to the methods of this invention, "administering" refers to any
method which, in sound medical practice, delivers the hypophosphatemic
inhibitor
used in this invention to the subject to be treated in such a manner so as to
be
effective in achieving a reduction in the blood parameters. The
hypophosphatemic
PHEX enzyme inhibitor may be administered by any of a variety of known methods
of administration, e.g., orally, dermatomucosally (for example, dermally,
sublingually, intranasally, and rectally), parenterally (for example, by
subcutaneous
injection, intramuscular injection, intra-articular injection, intravenous
injection), and
by inhalation. Thus, specific modes of administration include, for example,
oral,
transdermal, mucosal, sublingual, intramuscular, intravenous, intraperitoneal,
subcutaneous administration, and topical application. A preferred mode for
delivering the hypophosphatemic PHEX enzyme inhibitors is orally, for as long
and
as frequently as medically required. The period and frequency is adjusted
after
regular measurement of serum phosphate, PTH and vitamin D metabolites.
Thus, a preferred method of this invention comprises the steps of
performing a diagnostic on a human subject for the detection of
hyperphosphatemia, including its most frequent manifestations, secondary
hyperparathyroidism and renal osteodystrophy and, upon obtaining a positive
result from said diagnostic, administering the hypophosphatemic PHEX enzyme
inhibitor according to the methods of this invention. Suitable diagnostics for
the
CA 02365094 2002-04-25
- WO 00/50580 PCZ'/CA00100201
detection of hyperphosphatemia, including its most frequent manifestations,
secondary hyperparathyroidism and renal osteodystrophy, are well known in the
art. Such methods include the measurement of the blood, serum, plasma or
urinary
phosphate or the measurement of the blood, serum or plasma PTH.
EXAMPLE IX Dosage forms
The hypophosphatemic PHEX enzyme inhibitors described herein may be
administered in any of a variety of pharmaceutically acceptable compositions.
Such compositions may comprise an active and a pharmaceutically acceptable
carrier. Accordingly, for example, compositions for administering the
hypophosphatemic PHEX enzyme inhibitor comprise:
(a) From about 1.0 mg to about 1 000.0 mg of a hypophosphatemic PHEX
enzyme inhibitor; and
(b) A pharmaceutically acceptable carrier.
Pharmaceutically-acceptable carriers include solid or liquid filler diluents
or
encapsulating substances, and mixtures thereof, that are suitable for
administration to a human or lower animal. The term "compatible", as used
herein,
means that the components of the pharmaceutical composition are capable of
being co-mingled with the hypophosphatemic PHEX enzyme inhibitor, and with
each other, in a manner such that there is no interaction, which would
substantially
reduce the pharmaceutical efficacy of the pharmaceutical composition under
ordinary use situations. Pharmaceutically acceptable carriers must, of course,
be
of sufficiently high purity and sufficiently low toxicity to render them
suitable for
administration to the humans or lower animals being treated.
Some examples of the substances which can serve as pharmaceutical
carriers are: sugars, such as lactose, glucose and sucrose; starches, such as
corn
starch and potato starch; cellulose and its derivatives, such-as sodium
41
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
carboxymethylcellulose, ethylcellulose, cerllulose acetate; powdered
tragacanth;
malt; gelatin; talc; stearic acid; magnesium stearate; vegetable oils, such as
peanut
oil, cottonseed oil, sesame oil, olive oil, corn oil and oil of theobroma;
polyols such
as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol;
agar;
alginic acid; pyrogen free water, isotonic saline; phosphate buffer solutions;
wetting
agents and lubricants such as sodium lauryl sulfate; coloring agents;
flavoring
agents; and preservatives. Other compatible pharmaceutical additives and
hypophosphatemic PHEX enzyme inhibitor may be included in the
pharmaceutically acceptable carrier for use in the compositions of the present
invention.
The choice of a pharmaceutically-acceptable carrier to be used in
conjunction with the active substance is determined by the way the active
substance is to be administered. If the active is to be injected, the
preferred
pharmaceutical carrier is sterile water, physiological saline, or mixtures
thereof.
The pH of such parenteral composition is preferably adjusted to about 7.4.
Suitable
pharmaceutically acceptable carriers for topical application include those
known
in the art for use in creams, gels, tapes, patches, and similar topical
delivery
means.
The pharmaceutically- acceptable carrier employed in conjunction with the
hypophosphatemic PHEX enzyme inhibitor is used at a concentration sufficient
to
provide a practical size to dosage relationship. The pharmaceutically-
acceptable
carriers, in total, may comprise from about 0.1 % to about 99.9% by weight of
the
pharmaceutical compositions of the present invention, preferably from about 5%
to about 80%, and most preferably from about 10% to about 50%.
As indicated, the preferred method of administering hypophosphatemic
PHEX enzyme inhibitor is dependent upon the class of active being
administered.
For the hypophosphatemic PHEX inhibitors, the preferred method of
administration
is orally, in a unit-dosage form (i.e., a dosage form containing an amount of
active
42
CA 02365094 2002-04-25
WO 00/50580 PCT1CA00/00201
suitable for administration in one single dose, according to sound medical
practice).
Preferred unit dosage forms include tablets, capsules, suspensions, and
solutions, comprising a safe and effective amount of active. Pharmaceutically-
acceptable carriers suitable for the preparation of unit dosage forms for oral
administration are well known in the art. Their selection will depend on
secondary
considerations like taste, cost, shelf stability, which are not critical for
the purposes
of the present invention, and can be made without difficulty by a person
skilled in
the art. Preferably, oral unit dosage forms of the hypophosphatemic PHEX
enzyme
inhibitor comprise from about 1.0 mg to about 1000 mg of the inhibitor.
The present invention is intended to further encompass the following: (1 )
diagnostic kits for detecting the presence or amount of PHEX in a sample; (2)
a
method for detecting the presence or amount of PHEX in a sample; (3) devices
for
purifying PHEX or mutants thereof; (4) devices for screening PHEX ligands; and
(5) a method for obtaining a PHEX ligand. More particularly, the diagnostic
kits
comprise antibodies andlor a soluble PHEX enzyme. Antibodies againts PHEX
may be used in devices for purifying PHEX, and PHEX or mutants thereof may be
used in devices for screening PHEX ligands. Though not described herein, the
more general aspects concerning the operability of the diagnostic kits and
devices
included in the present invention are known in the art and readily available.
The method for detecting the presence or amount of PHEX comprises the
following steps:
- contacting a sample containing PHEX with an antibody in conditions
such that immune complexes can form; and
- detecting the immune complexes as an indication of the presence or
amount of PHEX in the sample.
The method for obtaining a PHEX ligand comprises the following steps:
43
CA 02365094 2002-04-25
WO 00150580 PCT/CAOOIOOZO1
contacting a sample containing one or more molecules with a PHEX
mutant enzyme in conditions such that binding of the molecules with
PHEX can occur;
- detecting the binding of the molecules with PHEX as an indication of
the presence of a PHEX ligand in the sample; and
- selecting the PHEX ligand.
Although not described in detail, the particulars relating to experimental
conditions for carrying out the methods described above are within the purview
of
those skilled in the art and readily appreciable by them.
While the invention has been described in connection with specific
embodiments thereof, it will be understood that it is capable of further
mod~cations
and this application is intended to cover any variations, uses, or adaptations
of the
invention following, in general, the principles of the invention and including
such
departures from the present disclosure as come within known or customary
practice within the art to which the invention pertains and as may be applied
to the
essential features hereinbefore set forth, and as follows in the scope of the
appended claims.
44
CA 02365094 2002-04-25
WO 00/50580 PCT/CA00/00201
REFERENCE LIST
Almaden Y, Canalejo A, Hernandez A, Ballesteros E, Garcia-Navarro S, Torres A
and Rodriguez M (1996) Direct effect of phosphorus on PTH secretion from
the whole rat parathyroid glands in vitro. J Bone Miner Res Jul 11:7 970-6
Apletalina, E" Appel, J., Lamango, N.S., Houghten, R.A:, and Lindberg, I.
(1998).
identification of inhibitors of prohormone convertases 1 and 2 using a
peptide combinatorial library. J.BioLChem. 273, 26589-26595.
Beck, L., Soumounou, Y., Mantel, J., Krishnamurthy, G., Gauthier, C., Goodyer,
C.G., and Tenenhouse, H.S. (1997). PexIPEX tissue distribution and
evidence for a deletion in the 3' region of the Pex gene in X-linked
hypophosphatemic mice. J.Clin.lnvest. 99, 1200-1209.
Blais, A., Bissonnette, P., and Berteloot, A. (1987). Common characteristics
for
Na+dependent sugar transport in Caco- 2 cells and human fetal colon.
J.Membr.Biol. 99, 113-125.
Borle AB and Clark I (1981) Effects of phosphate-induced hyperparathyroidism
and
parathyroidectomy on rat kidney calcium in vivo. Am J Physiol Aug 241:2
E136-41
Chipkin, R.E. : Inhibitors of enkephalinase : the next generation of
analgesics.
Drugs Future 11 : 593-606, 1986.
Crine, P., Dion, N., and Boileau, G. (1997). Endopeptidase-24.11. In Cell-
Surface
Peptidases in Health and Disease. A.J. Kenny and C.M. Boustead, eds.
(Oxford: BIOS Scientific Publishers), pp. 79-98.
Demeter JG, De Jong SA, Oslapas R, Ernst K, Hessel P, Jarosz H, Smith M,
Nayyar R, Lawrence AM and Paloyan E (1991 ) High phosphate diet-
induced primary hyperparathyroidism:an animal model. Surgery Dec 110:6
1053-60.
Devault, A., Lazure, C., Nault, C., Le Moual, H., Seidah, N.G., Chr~tien, M.,
Kahn,
P., Powell, J., Mallet, J., Beaumont, A., Rogues, B.P., Crine, P., and
Boileau, G. (1987). Amino acid sequence of rabbit kidney neutral
endopeptidase 24.11 (enkephalinase) deduced from a complementary
DNA. EMBO J. 6, 1317-1322.
Devault, A., Nault, C., Zollinger, M., Fourni~-Zaluski, M.-C., Rogues, B.P.,
Crine,
P., and Boileau, G. (1988). Expression of neutral endopeptidase
(enkephalinase) in heterologous COS- I cells. Characterization of the
recombinant enzyme and evidence for a glutamic acid naidue at the active
site. J.BioLChem. 263, 4033-4040.
CA 02365094 2002-04-25
- wo ooisosso rcTicAOOroo2oi
Du, L., Desbarats, M., Viel, J., Glorieux, F.H., Cawthom, C., and Ecarot, B.
(1996).
cDNA cloning of the murine Pex gene implicated in X-linked
hypophosphatemia and evidence for expression in bone. Genomics 36,
22-28.
Ecarot, B., Glorieux, F.H., Desbarats, M., Travers, R., and Labelle, L.
(1992).
Effect of dietary phosphate deprivation and supplemetation of recipient mice
on bone formation by transplanted cells from normal and X-linked
hypophosphatemic mice. J.Bone Miner.Res. 7, 523-530.
Ellefsen (1999). Immobilization dune forme chim~rique soluble de
fendopeptidase
neutre - 24.11 sur un support chromatogaphique et mise au point d'un test
de liaison. M~moire de maitrise Universite de Montreal.
Fossiez, F., Lemay, G., Labont~, N., Parmentier-Lesage, F., Boileau, G., and
Crine, P. (1992). Secretion of a functional soluble form of neutral
endopeptidase- 24.11 from a baculovirus-infected insect cell line.
Biochem.J. 284, 53-59.
Francis, F., Hennig, S., Kom, B., Reinhardt, R., De Jong, P., Poustka, A.,
Lehrach,
H., Rowe, P.S.N., Goulding, J.N., Summefield, T., Mountford, R., Read,
A.P., Popowska, E., Pronicka, E., Davies, K.E., O'Riordan, J.L.H., Econs,
M.J., Nesbitt, T., Drezner, M.K., Oudet, C., Pannetier, S., Hanauer, A.,
Strom, T.M., and Meindl, A. (1995). A gene (PEX) with homologies to
endopeptidases is mutated in patients with X-linked hypophosphatemic
rickets. Nature Genet. 11, 130-136.
Grieff, M., Mumm, S., Waeltz, P., Mazzarella, R., Whyte, M.P., Thakker, R.V.,
and
Schlessinger, D. (1997). Expression and cloning of the human X-linkod
hypophosphatemia gene cDNA. Biochemical & Biophysical Research
Communications 231, 635-639.
Guo, R. and Quarles, L.D. (1997). Cloning and sequencing of human PEX from a
bone cDNA library: Evidence for its developmental stage-specific regulation
in osteoblasts. J.Bone Miner.Res. 12, 1009-1017.
Howell, S., LanctBt, C., Cailler, F., and Crine, P. (1995). Addition of a
glycosylphosphatidylinosital anchor to a soluble form of neutral
endopeptidase reestablishes its apical targeting in LLC-PKI cells. The
Biochemical Society Meeting 657, 41-41.(Abstract)
Kates DM, Sherrard DJ and Andress DL (1997) Am J Kidney Dis Dec 30:6 809-13
Korth, P., Egidy, G., Pamot, C., LeMoullec, J.M., Corvol, P., and Pinet, F.
(1997).
Construction, expression and characterization of a soluble form of human
endothelin-converting-enzyme-1. FEBS Lett. 417, 365-370.
46
CA 02365094 2002-04-25
- WO 00/50580 PCTlCA0010020I
Kumar, R. (1997). Phosphatonin-a new phosphaturetic hormone? (lessons from
tumourinduced osteomalacia and X-linked hypophosphataemia) [editorial).
NephroLDiaLTransplant. 12, 11-13.
Lajeunesse, D., Meyer, R.A.J., and Hamel, L. (1996). Direct demonstration of a
humorally-mediated inhibition of renal phosphate transport in the Hyp
mouse. Kidney Int. 50, 1531 -1538.
Lemay, G., Waksman, G., Roques, B.P., Crine, P., and Boileau, G. (1989).
Fusion
of a cleavable signal peptide to the ectodomain of neutral endopeptidase
(EC 3.4.24.11 ) results in the secretion of an active enzyme in COS-1 cells.
J.BioLChem. 264, 15620- 15623.
Lemire, L, Lazure, C., Crine, P., and Boileau, G. (1997). Secretion of a type
II
integral membrane protein induced by mutation of the transmembrane
segment. Biochem.J. 322, 335-342.
Lipman, M.L., Panda, D., Bennett, H.P., Henderson, J.E., Shane, E., Shen,
Y.N.,
Goltzman, D., and Karaplis, A.C. (1998}. Cloning of human PEX cDNA
Expression, subcellular localization, and endopeptidase activity. J.BioLChem.
273,
13729-13737.
Meldal, M. (1998). Intramolecular fluorescence-quenched substrate libraries.
Methods MoLBiol. 87:65-74, 65-74.
Nelson, A.E., Mason, R.S., and Robinson, B.G. (1997). The PEX gene: not a
simple answer for X-linked hypophosphataemic rickets and oncogenic
osteomalaaa. MoLCeILEndocrinol. 132, 1-5.
Meyer, RA Jr, Gray RW and Meyer MH. 1980. Abnormal vitamin D metabolism in
the X-linked hypophosphatemic mouse. Endocrinology, 107:1577-1581.
Ondetti, M.A., and Cushman, D.W. : Angiotensin-converting enzyme inhibitors
biochemical properties and biological action. Crit. Rev. Biochem. 16 : 381-
411, 1984.
Rasmussen, H. and Tenenhouse, H.S. (1995). Mendelian hypophosphatemias. In
The metabolic and Molecular Basis of Inherited disease. C.L. Scriver, A.L.
Beaudet, W.S. Sly, and D. Valle, eds. (New York: McGraw Hill), pp.
3717-3745.
Rich, D.H. : Peptidase inhibitors. In comprehensive Medicinal Chemistry. The
Rational Design, Mechanistic Study and Therapeutic Application of
Chemical Compounds, ed. by P.G. Sammes and J.B. Taylor, Vol. 2, p. 391,
Pergamon Press, New York, 1990.
Rifas, L., Dawson, L.L., Halstead, L.R., Roberts, M., and Avioli, L.V. (1994).
Phosphate transport in osteoblasts from normal and X-linked
hypophosphatemic mice. Calcif.Tissue Int. 54, 505-510.
47
_._._..
_.~ ...._
CA 02365094 2002-04-25
wo oo~osso pcricwooioozoi
Rogues, B.P., Foumi~-Zaluski, M.C., Fiorentin, D., Waksman, G., Sassi, A.,
Chaillet, P., Collado, H., and Constantin, J. : New enkephalinase inhibitors
as probes to differentiate "enkephalinase" and angiotensin-converting-
enzyme active sites. Life Sci. 31 : 1749-1752, 1982a.
Rogues, B.P., Fournie-Zaluski, M.C., Gacel, G., Lucas-Soroca, E., David, M.,
Schwartz, J.C., Maifroy, B., Llorens, C., Swerts, J.P., Lecomte, J.M.,
Meunier, J.C., .Moisand, C., Morgat, J.L., and Maigret, B. : Synth~se et
etudes physicochimiques et biologiques de ligands sp~cifiques des
recepteurs enkephalinergiques mu et delta et d'inhiblteurs du systeme de
degradation des enk~phalines endog~nes. Acta Chim. Ther. 9 : 211-240,
1982b.
Rogues, B.P., and Fourr~i~-Zaluski, M.C.: A new way to antinociceptive
compounds through rational design of enkephalin degrading enzymes
inhibitors. In Proceedings of the International Symposium on Medicinal
Chemistry ed. by R. Dalhbom and J.L.G. Nilsson, pp. 134-146, Swedish
Pharmaceutical Press, Stockholm, Sweden, 1985.
Rogues, B.P., and Foumie-Zaluski, M.C.: Enkephalin degrading enzyme
inhibitors : a physiological way to new analgesics and psychoactive agents.
Natl. Inst. Drug Abuse Res. Monogr. Ser. 70 : 128-154, 1986.
Ruchon, A.F., Marcinkiewicz, M., Siegfried, G., Tenenhouse, H.S.,
DesGroseillers,
L., Crine, P., and Boileau, G. (1998). Pex mRNA is localized in developing
mouse osteoblasts and odontoblasts. J.Histochem.Cytochem. 46, 459-468.
Strom, T.M., Francis, F., Lorenz, B., Boddrich, A., Econs, M.J., Lehrach, H.,
and
Meitinger, T. (1997). Pex gene deletions in Gy and Hyp mice provide mouse
models for X-linked hypophosphatemia. Hum.Moi.Genet. 6, 165- 171.
Tenenhouse HS, Yip A and Jones G.,1988,Increased renal catabolism of 1,25-
dihydroxyvitamin D3 in murine X-linked hypophosphatemic rickets. J. Clin.
Invest. 81:461-465.
Tenenhouse HS and Jones 6.1990, Abnormal regulation of renal vitamin D
catabolism by dietary phosphate in murine X-linked hypophosphatemic
rickets. J. Clin. invest. 85,1450-1455.
Tenenhouse HS at al, Am J. Physiol 1998, Oct 275:4 Pt 2 F527-34
Thorsett, E.D. and Wyvratt, M.J. : Inhibition of zinc peptidases that
hydrolyse
neuropeptides. In Neuropeptides and their Peptidases, ed. by A.J. Tumer,
pp. 229-292, Harwood, Chichester, UK, 1987.
Tumer, A.J. (1997). Endothelin-converting enzymes. In Cell-surface peptidases
in
health and disease. A.J. Kenny and C.M. Boustead, eds. (Oxford, UK: BIOS
Scientific Publishers Ltd.), pp. 137-153.
48
CA 02365094 2002-04-25
WO 00/50580 FCT/CA00100201
Turner, A.J. and Tanzawa, K. (1997b). Mammalian membrane metallopeptidases:
NEP, ECE, KELL, and PEX. FASEB J. I I, 355-364.
Vallee, B.L., and Auld, D.S. : Zinc coordinating function and structure of
zinc
enzymes and other proteins. Biochemistry 29 : 5647-5659, 1990.
Xiao, Z.S., Crenshaw, M., Guo, R., Nesbitt, T., Drezner, M.K., and Quarles,
L.D.
(1998). Intrinsic mineralization defect in Hyp mouse osteoblasts.
Am.J.PhysioLEndocrinoLMetab. 275, E700-E708
Yang, X.F., Crine, P., and Boileau, G. (1995). The nature of topogenic
sequences
determines the transport competence of topological mutants of neutral
endopeptidase-24.11. Biochem.J. 312, 99-105.
49
