Note: Descriptions are shown in the official language in which they were submitted.
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
NOVEL PLANT GENES AND USES THEREOF
The present invention relates to broad-spectrum disease resistance in plants,
including the phenomenon of systemic acquired resistance (SAR). More
particularly, the
present invention relates to the identification, isolation and
characterization of homologues
of the Arabidopsis NIM1 gene involved in the signal transduction cascade
leading to
systemic acquired resistance in plants.
Plants are constantly challenged by a wide variety of pathogenic organisms
including
viruses, bacteria, fungi, and nematodes. Crop plants are particularly
vulnerable because
they are usually grown as genetically-uniform monocultures; when disease
strikes, losses
can be severe. However, most plants have their own innate mechanisms of
defense
against pathogenic organisms. Natural variation for resistance to plant
pathogens has been
identified by plant breeders and pathologists and bred into many crop plants.
These natural
disease resistance genes often provide high levels of resistance to or
immunity against
pathogens.
Systemic acquired resistance (SAR) is one component of the complex system
plants
use to defend themselves from pathogens (Hunt and Ryals, 1996; Ryals et al.,
1996). See
also, U.S. Patent No. 5,614,395. SAR is a particularly important aspect of
plant-pathogen
responses because it is a pathogen-inducible, systemic resistance against a
broad
spectrum of infectious agents, including viruses, bacteria, and fungi. When
the SAR signal
transduction pathway is blocked, plants become more susceptible to pathogens
that
normally cause disease, and they also become susceptible to some infectious
agents that
would not normally cause disease (Gaffney et aL, 1993; Delaney et al., 1994;
Delaney et
al., 1995; Delaney, 1997; Bi et al., 1995; Mauch-Mani and Slusarenko, 1996).
These
observations indicate that the SAR signal transduction pathway is critical for
maintaining
plant health.
Conceptually, the SAR response can be divided into two phases. In the
initiation
phase, a pathogen infection is recognized, and a signal is released that
travels through the
phloem to distant tissues. This systemic signal is perceived by target cells,
which react by
expression of both SAR genes and disease resistance. The maintenance phase of
SAR
refers to the period of time, from weeks up to the entire life of the plant,
during which the
plant is in a quasi steady state, and disease resistance is maintained (Ryals
et al., 1996).
-1 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Salicylic acid (SA) accumulation appears to be required for SAR signal
transduction.
Plants that cannot accumulate SA due to treatment with specific inhibitors,
epigenetic
repression of phenylalanine ammonia-lyase, or transgenic expression of
salicylate
hydroxylase, which specifically degrades SA, also cannot induce either SAR
gene
expression or disease resistance (Gaffney et al., 1993; Delaney et al., 1994;
Mauch-Mani
and Slusarenko, 1996; Maher et al., 1994; Pallas et al., 1996). Although it
has been
suggested that SA might serve as the systemic signal, this is currently
controversial and, to
date, all that is known for certain is that if SA cannot accumulate, then SAR
signal
transduction is blocked (Pallas et al., 1996; Shulaev et al., 1995; Vernooij
et al., 1994).
Recently, Arabidopsis has emerged as a model system to study SAR (Uknes ef
al.,
1992; Uknes et al., 1993; Cameron et al., 1994; Mauch-Mani and Slusarenko,
1994;
Dempsey and Klessig, 1995). It has been demonstrated that SAR can be activated
in
Arabidopsis by both pathogens and chemicals, such as SA, 2,6-
dichloroisonicotinic acid
(INA) and benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester (BTH)
(Uknes et al.,
1992; Vernooij et aL, 1995; Lawton et al., 1996). Following treatment with
either INA or
BTH or pathogen infection, at least three pathogenesis-related (PR) protein
genes, namely,
PR-1, PR-2, and PR-5 are coordinately induced concomitant with the onset of
resistance
(Uknes et aL, 1992, 1993). In tobacco, the best characterized species,
treatment with a
pathogen or an immunization compound induces the expression of at least nine
sets of
genes (Ward et al., 1991 ). Transgenic disease-resistant plants have been
created by
transforming plants with various SAR genes (U.S. Patent No. 5,614,395).
A number of Arabidopsis mutants have been isolated that have modified SAR
signal
transduction (Delaney, 1997) The first of these mutants are the so-called Isd
(lesions
simulating disease) mutants and acd2 Lccelerated cell death) (Dietrich et al.,
1994;
Greenberg et al., 1994). These mutants all have some degree of spontaneous
necrotic
lesion formation on their leaves, elevated levels of SA, mRNA accumulation for
the SAR
genes, and significantly enhanced disease resistance. At least seven different
Isd mutants
have been isolated and characterized (Dietrich et al., 1994; W eymann et al.,
1995).
Another interesting class of mutants are cim Lonstitutive immunity) mutants
(Lawton et aL,
1993). See also, U.S. Patent No. 5,792,904 and International PCT Application
WO
94/16077. Like Isd mutants and acd2, cim mutants have elevated SA and SAR gene
expression and resistance, but in contrast to Isd or acd2, do not display
detectable lesions
on their leaves. cprl constitutive expresser of PR genes) may be a type of cim
mutant;
-2-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
however, because the presence of microscopic lesions on the leaves of cprl has
not been
ruled out, cprl might be a type of Isd mutant (Bowling et al., 1994).
Mutants have also been isolated that are blocked in SAR signaling. ndrl (non-
race-
specific disease resistance) is a mutant that allows growth of both
Pseudomonas syringae
containing various avirulence genes and also normally avirulent isolates of
Peronospora
parasitica (Century et al., 1995). Apparently this mutant is blocked early in
SAR signaling.
nprl ~onexpresser of PR genes) is a mutant that cannot induce expression of
the SAR
signaling pathway following INA treatment (Cao et al., 1994). eds enhanced
disease
susceptibility) mutants have been isolated based on their ability to support
bacterial
infection following inoculation of a low bacterial concentration (Glazebrook
et al., 1996;
Parker et al., 1996). Certain eds mutants are phenotypically very similar to
nprl, and,
recently, eds5 and eds53 have been shown to be allelic to nprl (Glazebrook et
al., 1996).
niml Loninducible immunity) is a mutant that supports P. parasitica (i.e.,
causal agent of
downy mildew disease) growth following INA treatment (Delaney et al., 1995;
U.S. Patent
No. 5,792,904). Although nim 1 can accumulate SA following pathogen infection,
it cannot
induce SAR gene expression or disease resistance, suggesting that the mutation
blocks the
pathway downstream of SA. niml is also impaired in its ability to respond to
INA or BTH,
suggesting that the block exists downstream of the action of these chemicals
(Delaney et
al., 1995; Lawton et aL, 1996).
Allelic Arabidopsis genes have been isolated and characterized, mutants of
which
are responsible for the nim 1 and nprl phenotypes, respectively (Ryals et al.,
1997; Cao et
al., 1997). The wild-type NIM1 gene product is involved in the signal
transduction cascade
leading to both SAR and gene-for-gene disease resistance in Arabidopsis (Ryals
et al.,
1997). Ryals et al., 1997 also report the isolation of five additional alleles
of nim 1 that show
a range of phenotypes from weakly impaired in chemically induced PR-1 gene
expression
and fungal resistance to very strongly blocked. Transformation of the wild-
type NPR1 gene
into nprl mutants not only complemented the mutations, restoring the
responsiveness of
SAR induction with respect to PR-gene expression and disease resistance, but
also
rendered the transgenic plants more resistant to infection by P. syringae in
the absence of
SAR induction (Cao et al., 1997). WO 98/06748 describes the isolation of NPR1
from
Arabidopsis and a homologue from Nicotiana glutinosa. See also, WO 97/49822,
WO
98/26082, and WO 98/29537.
-3-
WO 00/$3762 CA 02365968 2001-09-06 pCT~P00/01978
Despite much research and the use of sophisticated and intensive crop
protection
measures, including genetic transformation of plants, losses due to disease
remain in the
billions of dollars annually. Therefore, there is a continuing need to develop
new crop
protection measures based on the ever-increasing understanding of the genetic
basis for
disease resistance in plants. In particular, there is a need for the
identification, isolation,
and characterization of homologues of the Arabidopsis NIM1 gene from
additional species
of plants.
In describing the present invention, the following terms will be employed, and
are
intended to be defined as indicated below.
Associated With / Operatively Linked: Refers to two DNA sequences that are
related
physically or functionally. For example, a promoter or regulatory DNA sequence
is said to
be "associated with" a DNA sequence that codes for an RNA or a protein if the
two
sequences are operatively linked, or situated such that the regulator DNA
sequence will
affect the expression level of the coding or structural DNA sequence.
Chimeric Gene: A recombinant DNA sequence in which a promoter or regulatory
DNA sequence is operatively linked to, or associated with, a DNA sequence that
codes for
an mRNA or which is expressed as a protein, such that the regulator DNA
sequence is able
to regulate transcription or expression of the associated DNA sequence. The
regulator
DNA sequence of the chimeric gene is not normally operatively linked to the
associated
DNA sequence as found in nature.
Coding Sequence: a nucleic acid sequence that is transcribed into RNA such as
mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably the RNA is
then
translated in an organism to produce a protein.
Complementary: refers to two nucleotide sequences that comprise antiparallel
nucleotide sequences capable of pairing with one another upon formation of
hydrogen
bonds between the complementary base residues in the antiparallel nucleotide
sequences.
Expression: refers to the transcription and/or translation of an endogenous
gene or a
transgene in plants. In the case of antisense constructs, for example,
expression may refer
to the transcription of the antisense DNA only.
Expression Cassette: A nucleic acid sequence capable of directing expression
of a
particular nucleotide sequence in an appropriate host cell, comprising a
promoter
operatively linked to the nucleotide sequence of interest which is operatively
linked to
termination signals. It also typically comprises sequences required for proper
translation of
-4-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
the nucleotide sequence. The expression cassette comprising the nucleotide
sequence of
interest may be chimeric, meaning that at least one of its components is
heterologous with
respect to at least one of its other components. The expression cassette may
also be one
which is naturally occurring but has been obtained in a recombinant form
useful for
heterologous expression. Typically, however, the expression cassette is
heterologous with
respect to the host, i.e., the particular nucleic acid sequence of the
expression cassette
does not occur naturally in the host cell and must have been introduced into
the host cell or
an ancestor of the host cell by a transformation event. The expression of the
nucleotide
sequence in the expression cassette may be under the control of a constitutive
promoter or
of an inducible promoter which initiates transcription only when the host cell
is exposed to
some particular external stimulus. In the case of a multicellular organism,
such as a plant,
the promoter can also be specific to a particular tissue, or organ, or stage
of development.
Gene: A defined region that is located within a genome and that, besides the
aforementioned coding nucleic acid sequence, comprises other, primarily
regulatory, nucleic
acid sequences responsible for the control of the expression, that is to say
the transcription
and translation, of the coding portion. A gene may also comprise other 5' and
3'
untranslated sequences and termination sequences. Further elements that may be
present
are, for example, introns.
Heterologous DNA Sequence: The terms "heterologous DNA sequence",
"exogenous DNA segment" or "heterologous nucleic acid," as used herein, each
refer to a
sequence that originates from a source foreign to the particular host cell or,
if from the same
source, is modified from its original form. Thus, a heterologous gene in a
host cell includes
a gene that is endogenous to the particular host cell but has been modified
through, for
example, the use of DNA shuffling. The terms also includes non-naturally
occurring multiple
copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA
segment
that is foreign or heterologous to the cell, or homologous to the cell but in
a position within
the host cell nucleic acid in which the element is not ordinarily found.
Exogenous DNA
segments are expressed to yield exogenous polypeptides.
Homologous DNA Sequence: A DNA sequence naturally associated with a host cell
into which it is introduced.
Isocoding: A nucleic acid sequence is isocoding with a reference nucleic acid
sequence when the nucleic acid sequence encodes a polypeptide having the same
amino
acid sequence as the polypeptide encoded by the reference nucleic acid
sequence.
-5-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Isolated: In the context of the present invention, an isolated nucleic acid
molecule or
an isolated enzyme is a nucleic acid molecule or enzyme that, by the hand of
man, exists
apart from its native environment and is therefore not a product of nature. An
isolated
nucleic acid molecule or enzyme may exist in a purified form or may exist in a
non-native
environment such as, for example, a recombinant host cell.
Minimal Promoter: promoter elements, particularly a TATA element, that are
inactive
or that have greatly reduced promoter activity in the absence of upstream
activation. In the
presence of a suitable transcription factor, the minimal promoter functions to
permit
transcription.
Native: refers to a gene that is present in the genome of an untransformed
cell:
Naturally occurring: the term "naturally occurring" is used to describe an
object that
can be found in nature as distinct from being artificially produced by man.
For example, a
protein or nucleotide sequence present in an organism (including a virus),
which can be
isolated from a source in nature and which has not been intentionally modified
by man in
the laboratory, is naturally occurring.
NIM1: Gene described in Ryals et al., 1997, which is involved in the SAR
signal
transduction cascade.
NIM1: Protein encoded by the NIM1 gene
Nucleic acid: the term "nucleic acid" refers to deoxyribonucleotides or
ribonucleotides
and polymers thereof in either single- or double-stranded form. Unless
specifically limited,
the term encompasses nucleic acids containing known analogues of natural
nucleotides
which have similar binding properties as the reference nucleic acid and are
metabolized in a
manner similar to naturally occurring nucleotides. Unless otherwise indicated,
a particular
nucleic acid sequence also implicitly encompasses conservatively modified
variants thereof
(e.g. degenerate codon substitutions) and complementary sequences and as well
as the
sequence explicitly indicated. Specifically, degenerate codon substitutions
may be
achieved by generating sequences in which the third position of one or more
selected (or
all) codons is substituted with mixed-base and/or deoxyinosine residues
(Batzer et al.,
Nucleic Acid Res. 19: 5081 (1991 ); Ohtsuka et aL, J. Biol. Chem. 260: 2605-
2608 (1985);
Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The terms "nucleic acid"
or "nucleic acid
sequence" may also be used interchangeably with gene, cDNA, and mRNA encoded
by a
gene. In the context of the present invention, the nucleic acid molecule is
preferably a
segment of DNA. Nucleotides are indicated by their bases by the following
standard
abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G).
-6-
WO ~~/53762 CA 02365968 2001-09-06 pCT~, P~0/01978
ORF: Open Reading Frame.
Plant: Any whole plant.
Plant Cell: Structural and physiological unit of a plant, comprising a
protoplast and a
cell wall. The plant cell may be in form of an isolated single cell or a
cultured cell, or as a
part of higher organized unit such as, for example, a plant tissue, a plant
organ, or a whole
plant.
Plant Cell Culture: Cultures of plant units such as, for example, protoplasts,
cell
culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo
sacs, zygotes and
embryos at various stages of development.
Plant Material: Refers to leaves, stems, roots, flowers or flower parts,
fruits, pollen,
egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other
part or product of a
plant.
Plant Organ: A distinct and visibly structured and differentiated part of a
plant such as
a root, stem, leaf, flower bud, or embryo.
Plant tissue: A group of plant cells organized into a structural and
functional unit. Any
tissue of a plant in planta or in culture is included. This term includes, but
is not limited to,
whole plants, plant organs, plant seeds, tissue culture and any groups of
plant cells
organized into structural and/or functional units. The use of this term in
conjunction with, or
in the absence of, any specific type of plant tissue as listed above or
otherwise embraced
by this definition is not intended to be exclusive of any other type of plant
tissue.
Promoter: An untranslated DNA sequence upstream of the coding region that
contains the binding site for RNA polymerase II and initiates transcription of
the DNA. The
promoter region may also include other elements that act as regulators of gene
expression.
Protoplast: An isolated plant cell without a cell wall or with only parts of
the cell wall.
Purified: the term "purified," when applied to a nucleic acid or protein,
denotes that the
nucleic acid or protein is essentially free of other cellular components with
which it is
associated in the natural state. It is preferably in a homogeneous state
although it can be in
either a dry or aqueous solution. Purity and homogeneity are typically
determined using
analytical chemistry techniques such as polyacrylamide gel electrophoresis or
high
performance liquid chromatography. A protein which is the predominant species
present in
a preparation is substantially purified. The term "purified" denotes that a
nucleic acid or
protein gives rise to essentially one band in an electrophoretic gel.
Particularly, it means
that the nucleic acid or protein is at least about 50% pure, more preferably
at least about
85% pure, and most preferably at least about 99% pure.
_7_
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Recombinant DNA molecule: a combination of DNA molecules that are joined
together
using recombinant DNA technology
Regulatory Elements: Sequences involved in controlling the expression of a
nucleotide sequence. Regulatory elements comprise a promoter operably linked
to the
nucleotide sequence of interest and termination signals. They also typically
encompass
sequences required for proper translation of the nucleotide sequence.
Selectable marker gene: a gene whose expression in a plant cell gives the cell
a
selective advantage. The selective advantage possessed by the cells
transformed with the
selectable marker gene may be due to their ability to grow in the presence of
a negative
selective agent, such as an antibiotic or a herbicide, compared to the growth
of non-
transformed cells. The selective advantage possessed by the transformed cells,
compared
to non-transformed cells, may also be due to their enhanced or novel capacity
to utilize an
added compound as a nutrient, growth factor or energy source. Selectable
marker gene
also refers to a gene or a combination of genes whose expression in a plant
cell gives the
cell both, a negative and a positive selective advantage.
Significant Increase: an increase in enzymatic activity that is larger than
the
margin of error inherent in the measurement technique, preferably an increase
by about
2-fold or greater of the activity of the wild-type enzyme in the presence of
the inhibitor, more
preferably an increase by about 5-fold or greater, and most preferably an
increase by about
10-fold or greater.
The terms "identical" or percent "identity" in the context of two or more
nucleic acid or
protein sequences, refer to two or more sequences or subsequences that are the
same or
have a specified percentage of amino acid residues or nucleotides that are the
same, when
compared and aligned for maximum correspondence, as measured using one of the
following sequence comparison algorithms or by visual inspection.
Substantially identical: the phrase "substantially identical," in the context
of two nucleic
acid or protein sequences, refers to two or more sequences or subsequences
that have at
least 60%, preferably 80%, more preferably 90-95%, and most preferably at
least 99%
nucleotide or amino acid residue identity, when compared and aligned for
maximum
correspondence, as measured using one of the following sequence comparison
algorithms
or by visual inspection. Preferably, the substantial identity exists over a
region of the
sequences that is at least about 50 residues in length, more preferably over a
region of at
least about 100 residues, and most preferably the sequences are substantially
identical
over at least about 150 residues. In a most preferred embodiment, the
sequences are
_g_
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
substantially identical over the entire length of the coding regions.
Furthermore,
substantially identical nucleic acid or protein sequences perform
substantially the same
function.
For sequence comparison, typically one sequence acts as a reference sequence
to
which test sequences are compared. When using a sequence comparison algorithm,
test
and reference sequences are input into a computer, subsequence coordinates are
designated if necessary, and sequence algorithm program parameters are
designated. The
sequence comparison algorithm then calculates the percent sequence identity
for the test
sequences) relative to the reference sequence, based on the designated program
parameters.
Optimal alignment of sequences for comparison can be conducted, e.g., by the
local homology algorithm of Smith & Waterman, Adv. AppL Math. 2: 482 (1981),
by the
homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443
(1970), by the
search for similarity method of Pearson & Lipman, Proc. Nat'I. Acad. Sci. USA
85: 2444
(1988), by computerized implementations of these algorithms (GAP, BESTFIT,
FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group,
575
Science Dr., Madison, WI), or by visual inspection (see generally, Ausubel et
al., infra).
One example of an algorithm that is suitable for determining percent sequence
identity
and sequence similarity is the BLAST algorithm, which is described in Altschul
et al., J. Mol.
Biol. 215: 403-410 (1990). Software for performing BLAST analyses is publicly
available
through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov~.
This algorithm involves first identifying high scoring sequence pairs (HSPs)
by identifying
short words of length W in the query sequence, which either match or satisfy
some
positive-valued threshold score T when aligned with a word of the same length
in a
database sequence. T is referred to as the neighborhood word score threshold
(Altschul ef
aL, 1990). These initial neighborhood word hits act as seeds for initiating
searches to find
longer HSPs containing them. The word hits are then extended in both
directions along
each sequence for as far as the cumulative alignment score can be increased.
Cumulative
scores are calculated using, for nucleotide sequences, the parameters M
(reward score for
a pair of matching residues; always > 0) and N (penalty score for mismatching
residues;
always < 0). For amino acid sequences, a scoring matrix is used to calculate
the cumulative
score. Extension of the word hits in each direction are halted when the
cumulative
alignment score falls off by the quantity X from its maximum achieved value,
the cumulative
score goes to zero or below due to the accumulation of one or more negative-
scoring
_g_
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
residue alignments, or the end of either sequence is reached. The BLAST
algorithm
parameters W, T, and X determine the sensitivity and speed of the alignment.
The BLASTN
program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both
strands. For
amino acid sequences, the BLASTP program uses as defaults a wordlength (V11)
of 3, an
expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff &
Henikoff, Proc.
Natl. Acad. Sci. USA 89: 10915 (1989)).
In addition to calculating percent sequence identity, the BLAST algorithm also
performs a statistical analysis of the similarity between two sequences (see,
e.g., Karlin &
Altschul, Proc. Nat'1. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of
similarity
provided by the BLAST algorithm is the smallest sum probability (P(N)), which
provides an
indication of the probability by which a match between two nucleotide or amino
acid
sequences would occur by chance. For example, a test nucleic acid sequence is
considered
similar to a reference sequence if the smallest sum probability in a
comparison of the test
nucleic acid sequence to the reference nucleic acid sequence is less than
about 0.1, more
preferably less than about 0.01, and most preferably less than about 0.001.
Another indication that two nucleic acid sequences are substantially identical
is that
the two molecules hybridize to each other under stringent conditions. The
phrase
"hybridizing specifically to" refers to the binding, duplexing, or hybridizing
of a molecule only
to a particular nucleotide sequence under stringent conditions when that
sequence is
present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s)
substantially" refers
to complementary hybridization between a probe nucleic acid and a target
nucleic acid and
embraces minor mismatches that can be accommodated by reducing the stringency
of the
hybridization media to achieve the desired detection of the target nucleic
acid sequence.
"Stringent hybridization conditions" and "stringent hybridization wash
conditions" in the
context of nucleic acid hybridization experiments such as Southern and
Northern
hybridizations are sequence dependent, and are different under different
environmental
parameters. Longer sequences hybridize specifically at higher temperatures. An
extensive
guide to the hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques
in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes
part I chapter
2 "Overview of principles of hybridization and the strategy of nucleic acid
probe assays"
Elsevier, New York. Generally, highly stringent hybridization and wash
conditions are
selected to be about 5°-C lower than the thermal melting point (Tm) for
the specific sequence
-10-
W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
at a defined ionic strength and pH. Typically, under "stringent conditions" a
probe will
hybridize to its target subsequence, but to no other sequences.
The Tm is the temperature (under defined ionic strength and pH) at which 50%
of the
target sequence hybridizes to a perfectly matched probe. Very stringent
conditions are
selected to be equal to the Tm for a particular probe. An example of stringent
hybridization
conditions for hybridization of complementary nucleic acids which have more
than 100
complementary residues on a filter in a Southern or northern blot is 50%
formamide with 1
mg of heparin at 42°-C, with the hybridization being carried out
overnight. An example of
highly stringent wash conditions is 0.1 5M NaCI at 72°-C for about 15
minutes. An example
of stringent wash conditions is a 0.2x SSC wash at 65°-C for 15 minutes
(see, Sambrook,
infra, for a description of SSC buffer). Often, a high stringency wash is
preceded by a low
stringency wash to remove background probe signal. An example medium
stringency wash
for a duplex of, e.g., more than 100 nucleotides, is 1 x SSC at 45°C
for 15 minutes. An
example low stringency wash for a duplex of, e.g., more than 100 nucleotides,
is 4-6x SSC
at 40°-C for 15 minutes. For short probes (e.g., about 10 to 50
nucleotides), stringent
conditions typically involve salt concentrations of less than about 1.OM Na
ion, typically
about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3,
and the
temperature is typically at least about 30°-C. Stringent conditions can
also be achieved with
the addition of destabilizing agents such as formamide. In general, a signal
to noise ratio of
2x (or higher) than that observed for an unrelated probe in the particular
hybridization assay
indicates detection of a specific hybridization. Nucleic acids that do not
hybridize to each
other under stringent conditions are still substantially identical if the
proteins that they
encode are substantially identical. This occurs, e.g., when a copy of a
nucleic acid is
created using the maximum codon degeneracy permitted by the genetic code.
The following are examples of sets of hybridization/wash conditions that may
be used
to clone homologous nucleotide sequences that are substantially identical to
reference
nucleotide sequences of the present invention: a reference nucleotide sequence
preferably
hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate
(SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 2X SSC, 0.1 % SDS at
50°C, more desirably in
7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with
washing in 1 X
SSC, 0.1 % SDS at 50°C, more desirably still in 7% sodium dodecyl
sulfate (SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1 % SDS at
50°C, preferably in
7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with
washing in 0.1 X
-11 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
SSC, 0.1 % SDS at 50°C, more preferably in 7% sodium dodecyl sulfate
(SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 0.1 X SSC, 0.1 % SDS at
65°C.
A further indication that two nucleic acid sequences or proteins are
substantially
identical is that the protein encoded by the first nucleic acid is
immunologically cross
reactive with, or specifically binds to, the protein encoded by the second
nucleic acid. Thus,
a protein is typically substantially identical to a second protein, for
example, where the two
proteins differ only by conservative substitutions.
The phrase "specifically (or selectively) binds to an antibody," or
"specifically (or
selectively) immunoreactive with," when referring to a protein or peptide,
refers to a binding
reaction which is determinative of the presence of the protein in the presence
of a
heterogeneous population of proteins and other biologics. Thus, under
designated
immunoassay conditions, the specified antibodies bind to a particular protein
and do not
bind in a significant amount to other proteins present in the sample. Specific
binding to an
antibody under such conditions may require an antibody that is selected for
its specificity for
a particular protein. For example, antibodies raised to the protein with the
amino acid
sequence encoded by any of the nucleic acid sequences of the invention can be
selected to
obtain antibodies specifically immunoreactive with that protein and not with
other proteins
except for polymorphic variants. A variety of immunoassay formats may be used
to select
antibodies specifically immunoreactive with a particular protein. For example,
solid-phase
ELISA immunoassays, Western blots, or immunohistochemistry are routinely used
to select
monoclonal antibodies specifically immunoreactive with a protein. See Harlow
and Lane
(1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New
York
"Harlow and Lane"), for a description of immunoassay formats and conditions
that can be
used to determine specific immunoreactivity. Typically a specific or selective
reaction will be
at least twice background signal or noise and more typically more than 10 to
100 times
background.
"Conservatively modified variations" of a particular nucleic acid sequence
refers to
those nucleic acid sequences that encode identical or essentially identical
amino acid
sequences, or where the nucleic acid sequence does not encode an amino acid
sequence,
to essentially identical sequences. Because of the degeneracy of the genetic
code; a large
number of functionally identical nucleic acids encode any given polypeptide.
For instance
the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid
arginine.
Thus, at every position where an arginine is specified by a codon, the codon
can be altered
to any of the corresponding codons described without altering the encoded
protein. Such
-12-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
nucleic acid variations are "silent variations" which are one species of
"conservatively
modified variations." Every nucleic acid sequence described herein which
encodes a protein
also describes every possible silent variation, except where otherwise noted.
One of skill will
recognize that each codon in a nucleic acid (except ATG, which is ordinarily
the only codon
for methionine) can be modified to yield a functionally identical molecule by
standard
techniques. Accordingly, each "silent variation" of a nucleic acid which
encodes a protein is
implicit in each described sequence.
Furthermore, one of skill will recognize that individual substitutions
deletions or
additions that alter, add or delete a single amino acid or a small percentage
of amino acids
(typically less than 5%, more typically less than 1 %) in an encoded sequence
are
"conservatively modified variations," where the alterations result in the
substitution of an
amino acid with a chemically similar amino acid. Conservative substitution
tables providing
functionally similar amino acids are well known in the art. The following five
groups each
contain amino acids that are conservative substitutions for one another:
Aliphatic: Glycine
(G), Alanine (A), Vaiine (V), Leucine (L), Isoleucine (I); Aromatic:
Phenylalanine (F),
Tyrosine (Y), Tryptophan (W); Sulfur-containing: Methionine (M), Cysteine (C);
Basic:
Arginine (R), Lysine (K), Histidine (H); Acidic: Aspartic acid (D), Glutamic
acid (E),
Asparagine (N), Glutamine (Q). See also, Creighton (1984) Proteins, W.H.
Freeman and
Company. In addition, individual substitutions, deletions or additions which
alter, add or
delete a single amino acid or a small percentage of amino acids in an encoded
sequence
are also "conservatively modified variations."
A "subsequence" refers to a sequence of nucleic acids or amino acids that
comprise a
part of a longer sequence of nucleic acids or amino acids (e.g., protein)
respectively.
Nucleic acids are "elongated" when additional nucleotides (or other analogous
molecules) are incorporated into the nucleic acid. Most commonly, this is
performed with a
polymerase (e.g., a DNA polymerase), e.g., a polymerase which adds sequences
at the 3'
terminus of the nucleic acid.
Two nucleic acids are "recombined" when sequences from each of the two nucleic
acids
are combined in a progeny nucleic acid. Two sequences are "directly"
recombined when both of
the nucleic acids are substrates for recombination. Two sequences are
"indirectly recombined"
when the sequences are recombined using an intermediate such as a cross-over
oligonucleotide. For indirect recombination, no more than one of the sequences
is an actual
substrate for recombination, and in some cases, neither sequence is a
substrate for
recombination.
-13-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
A "specific binding affinity" between two molecules, for example, a ligand and
a
receptor, means a preferential binding of one molecule for another in a
mixture of
molecules. The binding of the molecules can be considered specific if the
binding affinity is
about 1 x 104 M-' to about 1 x 106 M-' or greater.
Transformation: a process for introducing heterologous DNA into a host cell or
organism.
'Transformed," "transgenic," and "recombinant" refer to a host organism such
as a
bacterium or a plant into which a heterologous nucleic acid molecule has been
introduced. The
nucleic acid molecule can be stably integrated into the genome of the host or
the nucleic acid
molecule can also be present as an extrachromosomal molecule. Such an
extrachromosomal
molecule can be auto-replicating. Transformed cells, tissues, or plants are
understood to
encompass not only the end product of a transformation process, but also
transgenic progeny
thereof. A "non-transformed," "non-transgenic," or "non-recombinant" host
refers to a wild-type
organism, e.g., a bacterium or plant, which does not contain the heterologous
nucleic acid
molecule.
The present invention addresses the aforementioned needs by providing several
homologues of the Arabidopsis NIMi gene from additional species of plants. In
particular,
the present invention concerns the isolation of Nicotiana tabacum (tobacco),
Lycopersicon
esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Befa
vulgaris
(sugarbeet), Helianthus annuus (sunflower), and Solanum tuberosum (potato)
homologues
of the NIM1 gene, which encode proteins believed to be involved in the signal
transduction
cascade responsive to biological and chemical inducers that lead to systemic
acquired
resistance in plants.
Hence, the present invention is directed to an isolated nucleic acid molecule
comprising
a nucleotide sequence that encodes SEQ ID N0:2, 4, 6, 8, 16, 18, 20, 30, 32,
34, 36, 38,
40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68, 70, 72, or 74.
In another embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising SEO ID N0:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39,
41, 43, 45,
47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.
In a further embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that comprises an at least 20, 25,
30, 35, 40, 45,
or 50 (preferably 20) consecutive base pair portion identical in sequence to
an at least 20, 25,
30, 35, 40, 45, or 50 (preferably 20) consecutive base pair portion of SEQ ID
N0:1, 3, 5, 7, 15,
-14-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63,
65, 67, 69, 71, or
73.
In still another embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from a
Lycopersicon
esculentum DNA library using the polymerase chain reaction with the pair of
primers set
forth as SEQ ID N0:9 and 10, SEQ ID N0:21 and 24, SEQ ID N0:22 and 24, SEQ ID
N0:25 and 28, SEQ ID N0:26 and 28, or SEQ ID N0:59 and 60.
In yet another embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from a Beta
vulgaris DNA
library using the polymerase chain reaction with the pair of primers set forth
as SEQ ID
N0:22 and 24 or SEQ ID N0:26 and 28.
In a further embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from a
Helianthus annuus
DNA library using the polymerase chain reaction with the pair of primers set
forth as SEQ ID
N0:26 and 28.
In another embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from a Solanum
tuberosum DNA library using the polymerase chain reaction with the pair of
primers set forth
as SEQ ID N0:21 and 24, SEQ ID N0:21 and 23, SEQ ID N0:22 and 24, SEQ ID N0:25
and 28, or SEO ID N0:26 and 28.
In a further embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from a
Brassica napus
DNA library using the polymerase chain reaction with the pair of primers set
forth as SEQ ID
N0:9 and 10 or SEQ ID N0:26 and 28.
In yet another embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from an
Arabidopsis
thaliana DNA library using the polymerase chain reaction with the pair of
primers set forth
as SEQ ID N0:13 and 14, SEQ ID N0:21 and 24, or SEQ ID N0:22 and 24.
In a further embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from an
Nicotiana
tabacum DNA library using the polymerase chain reaction with the pair of
primers set forth
as SEQ ID N0:9 and 10, SEQ ID N0:11 and 12, SEQ ID N0:21 and 24, SEQ ID N0:22
and
24, SEQ ID N0:25 and 28, or SEQ ID N0:26 and 28; or
-15-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
In a further embodiment, the present invention is directed to an isolated
nucleic acid
molecule comprising a nucleotide sequence that can be amplified from an plant
DNA library
using the polymerase chain reaction with a pair of primers comprising the
first 20
nucleotides and the reverse complement of the last 20 nucleotides of the
coding sequence
(CDS) of SEQ ID N0:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45,
47, 49, 51, 53,
55, 57, 61, 63, 65, 67, 69, 71, or 73.
The present invention also encompasses a chimeric gene comprising a promoter
active in plants operatively linked to a NIM1 homologue coding sequence of the
present
invention, a recombinant vector comprising such a chimeric gene, wherein the
vector is
capable of being stably transformed into a host, as well as a host stably
transformed with
such a vector. Preferably, the host is a plant such as one of the following
agronomically
important crops: rice, wheat, barley, rye, canola, sugarcane, corn, potato,
carrot, sweet
potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower,
broccoli, turnip, radish,
spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin,
cucumber,
apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot,
strawberry, grape,
raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean,
tobacco,
tomato, sorghum, and sugarcane. The present invention also encompasses seed
from a
plant of the invention.
Further, the present invention is directed to a method of increasing SAR gene
expression in a plant by expressing in the plant a chimeric gene that itself
comprises a
promoter active in plants operatively linked to a NIMI homologue coding
sequence of the
present invention, wherein the encoded protein is expressed in the transformed
plant at
higher levels than in a wild type plant.
In addition, the present invention is directed to a method of enhancing
disease
resistance in a plant by expressing in the plant a chimeric gene that itself
comprises a
promoter active in plants operatively linked to a NIM1 homologue coding
sequence of the
present invention, wherein the encoded protein is expressed in the transformed
plant at
higher levels than in a wild type plant.
Further, the present invention is directed to a PCR primer selected from the
group
consisting of SEQ ID N0:9-14, 21-28, 59, and 60.
The present invention also encompasses a method for isolating a NIM1 homologue
involved in the signal transduction cascade leading to systemic acquired
resistance in
plants comprising amplifying a DNA molecule from a plant DNA library using the
polymerase
chain reaction with a pair of primers corresponding to the first 20
nucleotides and the
-16-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
reverse complement of the last 20 nucleotides of the coding sequence (CDS) of
SEQ ID
NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53,
55, 57, 61, 63,
65, 67, 69, 71, or 73 or with the pair of primers set forth as SEQ ID N0:9 and
10, SEQ ID
N0:11 and 12, SEQ ID N0:13 and 14, SEQ ID N0:21 and 24, SEQ ID N0:22 and 24,
SEQ
ID N0:21 and 23, SEQ ID N0:25 and 28, SEQ ID N0:26 and 28, or SEQ ID N0:59 and
60.
In a preferred embodiment, the plant DNA library is a Nicotiana tabacum
(tobacco),
Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis
thaliana,
Beta vulgaris (sugarbeet), Helianthus annuus (sunflower), or Solanum tuberosum
(potato)
DNA library.
Northern data on several of the NIMi homologues described herein indicates
constitutive expression or BTH-inducibility. The homologues of the NIM1 gene
described
herein are predicted to encode proteins involved in the signal transduction
cascade
responsive to biological and chemical inducers, which leads to systemic
acquired resistance
in plants. The present invention also concerns the transgenic expression of
such NIM1
homologues in plants to increase SAR gene expression and enhance disease
resistance.
The DNA sequences of the invention can be isolated using the techniques
described
in the examples below, or by PCR using the sequences set forth in the sequence
listing as
the basis for constructing PCR primers. For example, oligonucleotides having
the
sequence of approximately the first and last 20-25 consecutive nucleotides of
SEQ ID N0:7
(e.g., nucleotides 1-20 and 1742-1761 of SEQ ID N0:7) can be used as PCR
primers to
amplify the cDNA sequence (SEQ ID N0:7) directly from a cDNA library from the
source
plant (Arabidopsis thaliana). The other DNA sequences of the invention can
likewise be
amplified by PCR from cDNA or genomic DNA libraries of the respective plants
using the
ends of the DNA sequences set forth in the sequence listing as the basis for
PCR primers.
The transgenic expression of the NIM1 homologues of the invention in plants is
predicted to result in immunity to a wide array of plant pathogens, which
include, but are not
limited to viruses or viroids, e.g. tobacco or cucumber mosaic virus, ringspot
virus or
necrosis virus, pelargonium leaf curl virus, red clover mottle virus, tomato
bushy stunt virus,
and like viruses; fungi, e.g. oomycetes such as Phythophthora parasitica and
Peronospora
tabacina; bacteria, e.g. Pseudomonas syringae and Pseudomonas tabaci; insects
such as
aphids, e.g. Myzus persicae; and lepidoptera, e.g., Heliothus spp.; and
nematodes, e.g.,
Meloidogyne incognita. The vectors and methods of the invention are useful
against a
number of disease organisms of maize including but not limited to downy
mildews such as
Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola,
-17-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora
sacchari
and Peronosclerospora maydis; rusts such as Puccinia sorphi, Puccinia polysora
and
Physopella zeae; other fungi such as Cercospora zeae-maydis, Colletotrichum
graminicola,
Fusarium monoliforme, Gibberella zeae, Exserohilum turcicum, Kabatiellu zeae,
Erysiphe
graminis, Septoria and Bipolaris maydis; and bacteria such as Erwinia
stewartii.
The methods of the present invention can be utilized to confer disease
resistance to
a wide variety of plants, including gymnosperms, monocots, and dicots.
Although disease
resistance can be conferred upon any plants falling within these broad
classes, it is
particularly useful in agronomically important crop plants, such as rice,
wheat, barley, rye,
rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory,
lettuce, cabbage,
cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic,
eggplant, pepper,
celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince,
melon, plum,
cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry,
pineapple,
avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and
sugarcane.
A NIM1 homologue coding sequence of the present invention may be inserted into
an expression cassette designed for plants to construct a chimeric gene
according to the
invention using standard genetic engineering techniques. The choice of
specific regulatory
sequences such as promoter, signal sequence, 5' and 3' untranslated sequences,
and
enhancer appropriate for the achieving the desired pattern and level of
expression in the
chosen plant host is within the level of skill of the routineer in the art.
The resultant
molecule, containing the individual elements linked in proper reading frame,
may be
inserted into a vector capable of being transformed into a host plant cell.
Examples of promoters capable of functioning in plants or plant cells (i.e.,
those
capable of driving expression of associated coding sequences such as those
coding for
NIM1 homologues in plant cells) include the Arabidopsis and maize ubiquitin
promoters;
cauliflower mosaic virus (CaMV) 19S or 35S promoters and CaMV double
promoters; rice
actin promoters; PR-1 promoters from tobacco, Arabidopsis, or maize; nopaline
synthase
promoters; small subunit of ribulose bisphosphate carboxylase (ssuRUBISCO)
promoters,
and the like. Especially preferred is the Arabidopsis ubiquitin promoter. The
promoters
themselves may be modified to manipulate promoter strength to increase
expression of the
associated coding sequence in accordance with art-recognized procedures.
Preferred
promoters for use with the present invention are those that confer high level
constitutive
expression.
-18-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Signal or transit peptides may be fused to the NIMI homologue coding sequence
in
the chimeric DNA constructs of the invention to direct transport of the
expressed protein to
the desired site of action. Examples of signal peptides include those natively
linked to the
plant pathogenesis-related proteins, e.g. PR-1, PR-2, and the like. See, e.g.,
Payne et al.,
1988. Examples of transit peptides include the chloroplast transit peptides
such as those
described in Von Heijne et aL (1991 ), Mazur et al. (1987), and Vorst et al.
(1988); and
mitochondria) transit peptides such as those described in Boutry et al.
(1987). Also included
are sequences that result in localization of the encoded protein to various
cellular
compartments such as the vacuole. See, for example, Neuhaus et al. (1991 ) and
Chrispeels (1991 ).
The chimeric DNA constructs) of the invention may contain multiple copies of a
promoter or multiple copies of a NIM1 homologue coding sequence of the present
invention. In addition, the constructs) may include coding sequences for
markers and
coding sequences for other peptides such as signal or transit peptides, each
in proper
reading frame with the other functional elements in the DNA molecule. The
preparation of
such constructs are within the ordinary level of skill in the art.
Useful markers include peptides providing herbicide, antibiotic or drug
resistance,
such as, for example, resistance to protoporphyrinogen oxidase inhibitors,
hygromycin,
kanamycin, 6418, gentamycin, lincomycin, methotrexate, glyphosate,
phosphinothricin, or
the like. These markers can be used to select cells transformed with the
chimeric DNA
constructs of the invention from untransformed cells. Other useful markers are
peptidic
enzymes which can be easily detected by a visible reaction, for example a
color reaction,
for example luciferase, f3-glucuronidase, or f3-galactosidase.
Chimeric genes designed for plant expression such as those described herein
can
be introduced into the plant cell in a number of art-recognized ways. Those
skilled in the art
will appreciate that the choice of method might depend on the type of plant
(i.e. monocot or
dicot) and/or organelle (i.e. nucleus, chloroplast, mitochondria) targeted for
transformation.
Suitable methods of transforming plant cells include microinjection (Crossway
et al., 1986),
electroporation (Riggs et al., 1986), Agrobacterium mediated transformation
(Hinchee et aL,
1988; Ishida et al., 1996), direct gene transfer (Paszkowski et al., 1984;
Hayashimoto et al.,
1990), and ballistic particle acceleration using devices available from
Agracetus, Inc.,
Madison, Wisconsin and Dupont, Inc., Wilmington, Delaware (see, for example,
U.S. Patent
4,945,050; and McCabe et al., 1988). See also, Weissinger et al. (1988);
Sanford et al.
(1987) (onion); Christou et al. (1988) (soybean); McCabe et al. (1988)
(soybean); Datta et
-19-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
al. (1990) (rice); Klein et al. (1988) (maize); Klein et al. (1988) (maize);
Klein ~et al. (1988)
(maize); Fromm et al. (1990); and Cordon-Kamm et al. (1990) (maize); Svab et
al. (1990)
(tobacco chloroplasts); Cordon-Kamm et al. (1993) (maize); Shimamoto et al.
(1989) (rice);
Christou et al. (1991 ) (rice); Datta et al. (1990) (rice); European Patent
Application EP 0
332 581 (orchardgrass and other Pooideae); Vasil et al. (1993) (wheat); Weeks
et al. (1993)
(wheat); Wan et al. (1994) (barley); Jahne et al. (1994) (barley); Umbeck et
al. (1987)
(cotton); Casas et al. (1993) (sorghum); Somers et al. (1992) (oats); Torbert
et al. (1995)
(oats); Weeks et a/.,(1993) (wheat); WO 94/13822 (wheat); and Nehra et al.
(1994) (wheat).
A particularly preferred set of embodiments for the introduction of
recombinant DNA
molecules into maize by microprojectile bombardment can be found in Koziel et
al. (1993);
Hill et al. (1995) and Koziel et al. (1996). An additional preferred
embodiment is the
protoplast transformation method for maize as disclosed in EP 0 292 435.
Once a chimeric gene comprising a NIM1 homologue coding sequence has been
transformed into a particular plant species, it may be propagated in that
species or moved
into other varieties of the same species, particularly including commercial
varieties, using
traditional breeding techniques. Particularly preferred plants of the
invention include the
agronomically important crops listed above. The genetic properties engineered
into the
transgenic seeds and plants described above are passed on by sexual
reproduction and
can thus be maintained and propagated in progeny plants.
-20-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
EXAMPLES
The invention is illustrated in further detail by the following detailed
procedures,
preparations, and examples. The examples are for illustration only, and are
not to be
construed as limiting the scope of the present invention. Standard recombinant
DNA and
molecular cloning techniques used here are well known in the art and are
described by
Sambrook, et aL, 1989; by T.J. Silhavy, M.L. Berman, and L.W. Enquist, 1984;
and by
Ausubel, F.M. et al., 1987.
I. Isolation of Homologues of the Arabidopsis NIM1 Gene
Example 1: Isolation of a NIM1 Homologue from Nicotiana tabacum
Plasmid DNA from a mass excision of phage from a tobacco cDNA library is used
as a
template for PCR using the following primer pairs: 5'-AGATTATTGTCAAGTCTAATG-3'
(SEQ ID N0:9) + 5'-TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10), and
5'-GCGGATCCATGGATAATAGTAGG-3' (SEQ ID N0:11 ) +
5'-GCGGATCCTATTTCCTAAAAGGG-3' (SEQ ID N0:12). Cycling conditions are
preferably 94 degrees for one minute, 40 degrees for one minute, and 72
degrees for 1.5
minutes, and the reaction is preferably carried out for 40 cycles. PCR
products are run out
on agarose gels, excised, and cloned into pCRll-TOPO (Invitrogen).
The full-length cDNA sequence of this tobacco NIM1 homologue is shown in SEQ
ID
N0:1, and the protein encoded by this cDNA sequence is shown in SEQ ID N0:2. A
tobacco NIM1 homologue comprising SEQ ID N0:1 has been deposited as pNOV1206
with
the NRRL (Agricultural Research Service, Patent Culture Collection, Northern
Regional
Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A)
on August 17,
1998, and assigned accession no. NRRL B-30051.
Example 2: Isolation of a NIM1 Homologue from Lycopersicon esculentum
Phagemids are excised from ~, ZAPII cDNA libraries of tomato using a protocol
from
Stratagene. Phagemids (plasmids) are mass-transformed into E. coli XL1-Blue in
10 pools
of about 80,000 clones each and DNA is extracted from these pools. The pools
are
screened by PCR for the presence of NIM1 homologues by PCR using the following
-21 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
primers: 5'-AGATTATTGTCAAGTCTAATG-3' (SEQ ID N0:9) and 5'-
TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10).
Sequences amplified from the pools are confirmed to contain NIMI homologues by
cloning the PCR-amplified DNA fragment and sequencing. Pools are made
successively
smaller and screened by PCR using the same primers mentioned above for the
presence of
the NIM1 homologues until a single clone containing the homologue is obtained.
In the
event that the cDNA clone contains a partial gene missing the 5' end, 5' RACE
(Rapid
Amplification of cDNA Ends) is used to obtain the full-length sequence of the
gene.
The full-length cDNA sequence of this tomato NIM1 homologue is shown in SEQ ID
N0:3, and the protein encoded by this cDNA sequence is shown in SEQ ID N0:4. A
tomato
NIM1 homologue comprising SEQ ID N0:3 has been deposited as pNOV1204 with the
NRRL (Agricultural Research Service, Patent Culture Collection, Northern
Regional
Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A)
on August 17,
1998, and assigned accession no. NRRL B-30050.
Example 3: Isolation of a NIM1 Homologue from Brassica napus
Phagemids are excised from ~, ZAPII cDNA libraries of Brassica napus using a
protocol from Stratagene. Phagemids (plasmids) are mass-transformed into E.
coli XL1-
Blue in 10 pools of about 80,000 clones each and DNA is extracted from these
pools. The
pools are screened by PCR for the presence of NIM1 homologues by PCR using the
following primers: 5'-AGATTATTGTCAAGTCTAATG-3' (SEQ ID N0:9) and 5'-
TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10).
Sequences amplified from the pools are confirmed to contain NIM1 homologues by
cloning the PCR-amplified DNA fragment and sequencing. Pools are made
successively
smaller and screened by PCR using the same primers mentioned above for the
presence of
the NIMi homologues until a single clone containing the homologue is obtained.
In the
event that the cDNA clone contains a partial gene, missing the 5' end, 5' RACE
(Rapid
Amplification of cDNA Ends) is used to obtain the full-length sequence of the
gene.
A partial cDNA sequence of this Brassica napus NIM1 homologue is shown in SEQ
ID N0:5, and the protein encoded by this cDNA sequence is shown in SEQ ID
N0:6. A
Brassica napus NIM1 homologue comprising SEQ ID N0:5 has been deposited as
pNOV1203 with the NRRL (Agricultural Research Service, Patent Culture
Collection,
-22-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Northern Regional Research Center, 1815 North University Street, Peoria,
Illinois 61604,
U.S.A) on August 17, 1998, and assigned accession no. NRRL B-30049.
Example 4: Isolation of a NIM1 Homologue from Arabidopsis thaliana
BLAST searches using the Arabidopsis or tomato NIM1 amino acid sequences as
queries detect GenBank entry B26306, which contains Arabidopsis genomic
sequence from
the Bacterial Artificial Chromosome (BAC) F18D8. Part of the BAC sequence is
predicted
to encode a protein with significant similarity (47% amino acid identity) to
NIM1. The
following primers are designed to regions of the F18D8 sequence: 5'-
TCAAGGCCTTGGATTCAGATG-3' (SEQ ID N0:13) and 5'-
ATTAACTGCGCTACGTCCGTC-3' (SEQ ID N0:14).
The primers are used in a PCR reaction with DNA from a pFL61-based Arabidopsis
cDNA library as a template. Preferable cycling conditions are 94 degrees for
30 seconds,
53 degrees for 30 seconds, 72 degrees for 30 seconds. The reaction is
preferably run for
40 cycles. A PCR product of the predicted size (290 base pairs) is detected,
and the cDNA
clone corresponding to the F18D8 primers is purified from the cDNA library by
sequential
purification by passage of increasingly smaller amounts of the library through
E. coli and re-
diagnosis of the presence of the clone by PCR. Ultimately, a single positive
clone is
obtained and sequenced. The sequence of the clone confirms the presence of an
open
reading frame with significant homology to NIM1.
A full-length cDNA sequence of this Arabidopsis thaliana NIM1 homologue is
shown
in SEQ ID N0:7, and the protein encoded by this cDNA sequence is shown in SEQ
ID
N0:8. An Arabidopsis thaliana NIM1 homologue comprising SEQ ID N0:7 has been
deposited as AtNMLcS in E. coli with the NRRL (Agricultural Research Service,
Patent
Culture Collection, Northern Regional Research Center, 1815 North University
Street,
Peoria, Illinois 61604, U.S.A) on May 25, 1999, and assigned accession no.
NRRL B-
30139.
Example 5: Design of Degenerate Primers
In addition to the NIM1 gene (Ryals et al., 1997) and the NIM-like gene
described
above in Example 4 (AtNMLcS - SEQ ID N0:7), Arabidopsis thaliana contains
three other
NIM like (NML) genomic sequences: AtNMLc2 (SEQ ID N0:15), AtNMLc4-1 (SEQ ID
-23-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
N0:17), and AtNMLc4-2 (SEQ ID N0:19), where c[#J stands for the chromosome
number
on which the particular NML gene is located. Using the GCG Seqweb multiple
sequence
alignment program (Pretty, Wisconsin Genetics Computer Group), the NIM1
sequences
from Arabidopsis thaliana (Ryals et al., 1997), Nicotiana tabacum (Example 1 -
SEQ ID
N0:1 ), and Lycopersicon esculentum (Example 2 - SEO ID N0:3), as well as the
NML
sequences from Arabidopsis thaliana (SEQ ID N0:7, 15, 17, and 19) are aligned.
Based on
this alignment, three regions emerge with sufficient conservation to design
degenerate PCR
primers for PCR amplification of NIM1 homologues from other crop species,
including
sugarbeet, sunflower, potato, and canola. The primers designed from these
conserved
regions are listed below in Table 1. The NIM 1 (A-D) primers are designed
using a lineup
with only the NIMI genes from Arabidopsis thaliana (Ryals et al., 1997),
Nicotiana tabacum
(Example 1 - SEQ ID N0:1 ), and Lycopersicon esculentum (Example 2 - SEQ ID
N0:3).
The NIM 2(A-D) primers are designed using a lineup with these three sequences
in addition
to the four NML sequences from Arabidopsis thaliana (SEQ ID N0:7, 15, 17, and
19).
Primers are preferably synthesized by Genosys Biotechnologies, Inc. (The
Woodlands,
Texas). Positions of degeneracy are indicated in Table 1 by the notation of
more than one
base at a single site in the oligonucleotide. "Orientation" designates whether
the primer is
directed towards the 3' end (Downstream) or the 5' end (Upstream) of the cDNA.
Table 1: Degenerate Primers
Primer Se uence 5' to 3' SEQ ID NO: Orientation
NIM GAGATTATTGTCAAGTCTAATGTAGATA SEQ ID N0:21Downstream
1A
T T
NIM ACTGGACTCGGATGATATTGAATTA SEQ ID N0:22Downstream
1 B
T T T T G G
NIM TAACTCAACATCATCAGAATCAAATGC SEO ID N0:23Upstream
1 C
T T C G C G
NIM GTTGAGCAAGAGCAACTCTATTTTCAAG SEQ ID N0:24Upstream
1 D
T C CC
G
T
NIM TGCATAGAAATAATTGTGAAGTCTAATGTAGA SEQ ID N0:25Downstream
2A
T G TG C G T
NIM GGCACTGGACTCAGATGATGTTGAACT SEQ ID N0:26Downstream
2B
T T T GT
NIM AACTCAACATCATCAGAATCCAATGCC SEQ ID N0:27Upstream
2C
GT T G G
NIM AGTTGAGCAAGGCCAACTCGATTTTCAAAAT SEQ ID N0:28Upstream
2D
T C A T GG
T
-24-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Example 6: PCR Amplification of NIM-like DNA Fragments From Crop Species
NIM like DNA fragments are amplified from Arabidopsis, tomato, tobacco,
sugarbeet, sunflower, potato, and canola, using either genomic DNA or cDNA as
templates.
The primer combinations used, along with the expected fragment sizes, are
listed below in
Table 2.
Table 2: Primer combinations and DNA fragment sizes
Left PrimerRi ht PrimerFra ment Size
b
NIM 1 A NIM 1 D 669
NIM 1 A NIM 1 C 195
NIM 1 B NIM 1 D 499
NIM 2A NIM 2D 676
NIM 2A NIM 2C 200
NIM 2B NIM 2D 503
Degenerate primer PCR is preferably performed with Ready-To-Go PCR Beads
(Amersham, Piscataway, NJ) in a GeneAmp PCR System 9700 (PE Applied
Biosystems,
Foster City, CA). 20 to 40 ng of genomic DNA or 5 to 10 ng of cDNA is used in
each
reaction, with each primer at a final concentration of 0.8 uM. Preferable
cycling parameters
are as follows: 94°C for 1 minute; 3 cycles of [94°C for 30
seconds; 37°C for 30 seconds;
72°C for 2 minutes]; 35 cycles of [94°C for 30 seconds;
60°C for 30 seconds; 72°C for 2
minutes]; 72°C for 7 minutes; 4°C hold. Reaction products are
analyzed on 2% agarose
gels and DNA fragments of the appropriate size are excised. DNA fragments are
isolated
from agarose bands using, for example, the Geneclean III Kit (BIO 101, Inc.,
Carlsbad, CA)
and cloned using, for example, the TOPO TA Cloning Kit (Invitrogen
Corporation, Carlsbad,
CA). Plasmids are isolated using, for example, the CONCERT Rapid Plasmid
Miniprep
System (Life Technologies, Inc., Rockville, MD) and sequenced by standard
protocols.
NIM-like DNA fragments are obtained from all plant species attempted, and in
many
cases multiple, unique Nlll~like sequences are isolated. Table 3 and Figure 2
detail the
NIIV~Iike fragments that are isolated.
-25-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Table 3: Nlll~like PCR fragments
Species Successful Primer PCR TemplateUnique ClonesSE(~ ID
NO:
Pairs
Arabido 1 A/1 D; 1 B/1 D Genomic DNA One
sis
Tobacco 1 A/1 D; 1 B/1 D; cDNA Four SEQ ID
2A/2D; NO:
2B/2D 29, 31,
33,
and 35
Tomato 1 A/1 D; 1 B/1 D; Genomic DNA,One SEQ ID
2A/2D; NO:
2B/2D cDNA 37
Sugarbeet 1 B/1 D; 2B/2D Genomic DNA,One SEQ ID
NO:
cDNA 39
Sunflower 2B12D cDNA Two SEQ ID
NO:
41 and
43
Potato 1 A/1 D; 1 A/1 C; cDNA Three SEQ ID
1 B/1 D; NO:
2A/2D; 2B/2D 45, 47,
and
49
Canola 2B/2D cDNA Four SEQ ID
NO:
51, 53,
55,
and 57
Based on these results, the degenerate primer PCR described above can amplify
Nlll~like fragments from a wide variety of plant species. In particular, the
primer
combination of NIM 2B/NIM 2D is successful with cDNA as a template from all
species
attempted. The use of Ready-To-Go PCR Beads is especially preferably for
obtaining
products. In addition, using cDNA as a template is preferable for all samples
except
Arabidopsis, tomato and sugarbeet, where genomic DNA is sufficient.
Example 7: Additional Degenerate Primers
A new pair of degenerate primers is designed based on a sequence alignment of
the
four tobacco fragments (SEQ ID NO: 29, 31, 33, and 35) and the tomato sequence
(SEQ ID
NO: 37) for use in determining whether tomato also contains similar NIM like
sequences
that are not amplified with the degenerate primers listed in Table 1. The
primers designed
from these fragments are listed below in Table 3 and are preferably
synthesized by
Genosys Biotechnologies, Inc. (The Woodlands, Texas). Positions of degeneracy
are
indicated in Table 3 by the notation of more than one base at a single site in
the
-26-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
oligonucleotide. "Orientation" designates whether the primer is directed
towards the 3' end
(Downstream) or the 5' end (Upstream) of the cDNA.
Table 4: Additional degenerate primers
PrimerSe uence 5' TO 3' SEQ ID NO: Orientation
NIM TAGATGAAGCATACGCTCTCCACTATGCTGT SEQ ID N0:59Downstream
3A
T C T T T
NIM GGCTCCTTACGCATGGCAGCAACATGAAGGAC SEQ ID N0:60Upstream
3B
T C T TG C
Degenerate primer PCR is performed as described above using tomato cDNA, and
potential products are cloned and sequenced. The sequence analysis reveals two
classes
of Nlll~like fragments: the first is identical to the tomato sequence shown in
SEQ ID NO: 37,
and the second is unique in tomato and 88% identical to the tobacco sequences
shown in
SEQ ID N0:31 and 33. The sequence of this new tomato sequence is presented in
SEQ ID
N0:61.
Example 8: Full-length NIM-like cDNA's
Corresponding cDNA sequences upstream and downstream from Nlll~like PCR
fragments are preferably obtained by RACE PCR using the SMART RACE cDNA
Amplification Kit (Clontech, Palo Alto, CA). Preferably, at least three
independent RACE
products are sequenced for each 5'- or 3'-end in order to eliminate PCR
errors. Resulting
full-length cDNA sequences for Sugarbeet, Sunflower B, and Tobacco B NIM1
homologues,
which correspond to the NIIV~Iike PCR fragments shown in SEQ ID N0:39, 43, and
31 are
presented as SEQ ID N0:63, 65, and 73 respectively.
NIM like Arabidopsis thaliana cDNA's corresponding to the NIM like genomic
sequences AtNMLc2 (SEQ ID N0:15), AtNMLc4-1 (SEQ ID N0:17), and AtNMLc4-2 (SEQ
ID N0:19), are preferably cloned by RT-PCR. Total RNA from Arabidopsis
thaliana is
reverse transcribed using oligo dT primer. The resulting first strand cDNA is
amplified by
PCR using specific sense and antisense oligonucleotide primers designed based
on the 5'
and 3' ends of the coding region of each genomic sequence (SEQ ID N0:15, 17,
and 19).
PCR fragments of the predicted sizes are cloned into a vector and sequenced to
confirm
that these cDNA clones correspond to the NIM like genomic sequences. A cDNA
sequence
corresponding to the NIIV~Iike genomic sequence AtNMLc2 (SEQ ID N0:15) is
presented as
-27-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
SEQ ID N0:67; a full-length cDNA sequence corresponding to the NIIV~Iike
genomic
sequence AtNMLc4-1 (SEQ ID N0:17) is presented as SEQ ID N0:69; and a full-
length
cDNA sequence corresponding to the NIIVf-like genomic sequence AtNMLc4-2 (SEQ
ID
N0:19) is presented as SEQ ID N0:71.
Example 9: Northern Analysis
Northern data shows that expression of the sugarbeet NIM-like clone (SEQ ID
N0:39
and 63) increases three to seven fold after 100NM or 300 NM BTH
(benzo(1,2,3)thiadiazole-
7-carbothioic acid S-methyl ester) treatment. Also, Northern data shows that
expression of
the Sunflower A NIM-like clone (SEQ ID N0:41 ) is constitutive. Furthermore,
Northern data
shows that expression of the Sunflower B NIM-like clone (SEQ ID N0:43 and 65)
increases
two fold after 100NM or 300 NM BTH treatment.
II. Expression of the Gene Sequences of the Invention In Plants
A NIM1 homologue of the present invention can be incorporated into plant cells
using
conventional recombinant DNA technology. Generally, this involves inserting a
coding
sequence of the invention into an expression system to which the coding
sequence is
heterologous (i.e., not normally present) using standard cloning procedures
known in the
art. The vector contains the necessary elements for the transcription and
translation of the
inserted protein-coding sequences. A large number of vector systems known in
the art can
be used, such as plasmids, bacteriophage viruses and other modified viruses.
Suitable
vectors include, but are not limited to, viral vectors such as lambda vector
systems ~,gtl1,
~,gtl0 and Charon 4; plasmid vectors such as pB1121, pBR322, pACYC177,
pACYC184,
pAR series, pKK223-3, pUCB, pUC9, pUCl8, pUCl9, pLG339, pRK290, pKC37,
pKC101, pCDNAII; and other similar systems. The components of the expression
system
may also be modified to increase expression. For example, truncated sequences,
nucleotide substitutions or other modifications may be employed. The
expression systems
described herein can be used to transform virtually any crop plant cell under
suitable
conditions. Transformed cells can be regenerated into whole plants such that
the NIM1
homologue increases SAR gene expression and enhances disease resistance in the
transgenic plants.
-28-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Example 10: Construction of Plant Expression Cassettes
Coding sequences intended for expression in transgenic plants are first
assembled in
expression cassettes behind a suitable promoter expressible in plants. The
expression
cassettes may also comprise any further sequences required or selected for the
expression
of the transgene. Such sequences include, but are not restricted to,
transcription
terminators, extraneous sequences to enhance expression such as introns, vital
sequences,
and sequences intended for the targeting of the gene product to specific
organelles and cell
compartments. These expression cassettes can then be easily transferred to the
plant
transformation vectors described below. The following is a description of
various
components of typical expression cassettes.
1. Promoters
The selection of the promoter used in expression cassettes will determine the
spatial
and temporal expression pattern of the transgene in the transgenic plant.
Selected
promoters will express transgenes in specific cell types (such as leaf
epidermal cells,
mesophyll cells, root cortex cells) or in specific tissues or organs (roots,
leaves or flowers,
for example) and the selection will reflect the desired location of
accumulation of the gene
product. Alternatively, the selected promoter may drive expression of the gene
under
various inducing conditions. Promoters vary in their strength, i.e., ability
to promote
transcription. Depending upon the host cell system utilized, any one of a
number of suitable
promoters can be used, including the gene's native promoter. The following are
non-
limiting examples of promoters that may be used in expression cassettes.
a. Constitutive Expression, the Ubiquitin Promoter:
Ubiquitin is a gene product known to accumulate in many cell types and its
promoter
has been cloned from several species for use in transgenic plants (e.g.
sunflower - Binet et
a1.,1991; maize - Christensen et al., 1989; and Arabidopsis - Norris et al.,
1993). The
maize ubiquitin promoter has been developed in transgenic monocot systems and
its
sequence and vectors constructed for monocot transformation are disclosed in
the patent
publication EP 0 342 926 (to Lubrizol). Taylor et al. (1993) describe a vector
(pAHC25) that
comprises the maize ubiquitin promoter and first intron and its high activity
in cell
suspensions of numerous monocotyledons when introduced via microprojectile
-29-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
bombardment. The Arabidopsis ubiquitin promoter is especially preferred for
use with the
NIMi homologues of the present invention. The ubiquitin promoter is suitable
for gene
expression in transgenic plants, both monocotyledons and dicotyledons.
Suitable vectors
are derivatives of pAHC25 or any of the transformation vectors described in
this application,
modified by the introduction of the appropriate ubiquitin promoter and/or
intron sequences.
b. Constitutive Expression, the CaMV 35S Promoter:
Construction of the plasmid pCGN1761 is described in the published patent
application EP 0 392 225 (Example 23). pCGN1761 contains the "double" CaMV 35S
promoter and the tml transcriptional terminator with a unique EcoRl site
between the
promoter and the terminator and has a pUC-type backbone. A derivative of
pCGN1761 is
constructed which has a modified polylinker which includes Notl and Xhol sites
in addition
to the existing EcoRl site. This derivative is designated pCGN1761 ENX.
pCGN1761 ENX is
useful for the cloning of cDNA sequences or coding sequences (including
microbial ORF
sequences) within its polylinker for the purpose of their expression under the
control of the
35S promoter in transgenic plants. The entire 35S promoter-coding sequence-tml
terminator cassette of such a construction can be excised by Hindlll, Sphl,
Sall, and Xbal
sites 5' to the promoter and Xbal, BamHl and Bgll sites 3' to the terminator
for transfer to
transformation vectors such as those described below. Furthermore, the double
35S
promoter fragment can be removed by 5' excision with Hindlll, Sphl, Sall,
Xbal, or Pstl, and
3' excision with any of the polylinker restriction sites (EcoRl, Notl or Xhon
for replacement
with another promoter. If desired, modifications around the cloning sites can
be made by
the introduction of sequences that may enhance translation. This is
particularly useful when
overexpression is desired. For example, pCGN1761 ENX may be modified by
optimization
of the translational initiation site as described in Example 37 of U.S. Patent
No. 5,639,949.
c. Constitutive Expression, the Actin Promoter:
Several isoforms of actin are known to be expressed in most cell types and
consequently the actin promoter is a good choice for a constitutive promoter.
In particular,
the promoter from the rice Actl gene has been cloned and characterized
(McElroy et al.,
1990). A 1.3kb fragment of the promoter was found to contain all the
regulatory elements
required for expression in rice protoplasts. Furthermore, numerous expression
vectors
based on the Actl promoter have been constructed specifically for use in
monocotyledons
(McElroy et al., 1991 ). These incorporate the Actl-intron 1, Adhl 5' flanking
sequence and
-30-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Adhl intron 1 (from the maize alcohol dehydrogenase gene) and sequence from
the CaMV
35S promoter. Vectors showing highest expression were fusions of 35S and Actl
intron or
the ActlS' flanking sequence and the Actl intron. Optimization of sequences
around the
initiating ATG (of the GUS reporter gene) also enhanced expression. The
promoter
expression cassettes described by McElroy et al. (1991 ) can be easily
modified for gene
expression and are particularly suitable for use in monocotyledonous hosts.
For example,
promoter-containing fragments is removed from the McElroy constructions and
used to
replace the double 35S promoter in pCGN1761 ENX, which is then available for
the insertion
of specific gene sequences. The fusion genes thus constructed can then be
transferred to
appropriate transformation vectors. In a separate report, the rice Actl
promoter with its first
intron has also been found to direct high expression in cultured barley cells
(Chibbar et al.,
1993).
d. Inducible Expression, the PR-1 Promoter:
The double 35S promoter in pCGN1761 ENX may be replaced with any other
promoter
of choice that will result in suitably high expression levels. By way of
example, one of the
chemically regulatable promoters described in U.S. Patent No. 5,614,395 may
replace the
double 35S promoter. The promoter of choice is preferably excised from its
source by
restriction enzymes, but can alternatively be PCR-amplified using primers that
carry
appropriate terminal restriction sites. Should PCR-amplification be
undertaken, then the
promoter should be re-sequenced to check for amplification errors after the
cloning of the
amplified promoter in the target vector. The chemically/pathogen regulatable
tobacco PR-
1 a promoter is cleaved from plasmid pCIB1004 (for construction, see example
21 of
EP 0 332 104) and transferred to plasmid pCGN1761 ENX (Uknes et al., 1992).
pCIB1004
is cleaved with Ncol and the resultant 3' overhang of the linearized fragment
is rendered
blunt by treatment with T4 DNA polymerase. The fragment is then cleaved with
Hindlll and
the resultant PR-1 a promoter-containing fragment is gel purified and cloned
into
pCGN1761 ENX from which the double 35S promoter has been removed. This is done
by
cleavage with Xhol and blunting with T4 polymerase, followed by cleavage with
Hindlll and
isolation of the larger vector-terminator containing fragment into which the
pCIB1004
promoter fragment is cloned. This generates a pCGN1761 ENX derivative with the
PR-1 a
promoter and the tml terminator and an intervening polylinker with unique
EcoRl and Notl
sites. The selected coding sequence can be inserted into this vector, and the
fusion
products (i.e. promoter-gene-terminator) can subsequently be transferred to
any selected
-31 -
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
transformation vector, including those described infra. Various chemical
regulators may be
employed to induce expression of the selected coding sequence in the plants
transformed
according to the present invention, including the benzothiadiazole,
isonicotinic acid, and
salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and
5,614,395.
e. Inducible Expression, an Ethanol-Inducible Promoter:
A promoter inducible by certain alcohols or ketones, such as ethanol, may also
be
used to confer inducible expression of a coding sequence of the present
invention. Such a
promoter is for example the alcA gene promoter from Aspergillus nidulans
(Caddick et al.,
1998). In A. nidulans, the alcA gene encodes alcohol dehydrogenase I, the
expression of
which is regulated by the AIcR transcription factors in presence of the
chemical inducer.
For the purposes of the present invention, the CAT coding sequences in plasmid
paIcA:CAT
comprising a alcA gene promoter sequence fused to a minimal 35S promoter
(Caddick ef
al., 1998) are replaced by a coding sequence of the present invention to form
an expression
cassette having the coding sequence under the control of the alcA gene
promoter. This is
carried out using methods well known in the art.
f. Inducible Expression, a Glucocorticoid-Inducible Promoter:
Induction of expression of a NIM1 homologue of the present invention using
systems
based on steroid hormones is also contemplated. For example, a glucocorticoid-
mediated
induction system is used (Aoyama and Chua, 1997) and gene expression is
induced by
application of a glucocorticoid, for example a synthetic glucocorticoid,
preferably
dexamethasone, preferably at a concentration ranging from 0.1 mM to 1 mM, more
preferably from lOmM to 100mM. For the purposes of the present invention, the
luciferase
gene sequences are replaced by a gene sequence encoding a NIM1 homologue to
form an
expression cassette having the gene sequence encoding a NIM1 homologue under
the
control of six copies of the GAL4 upstream activating sequences fused to the
35S minimal
promoter. This is carried out using methods well known in the art. The trans-
acting factor
comprises the GAL4 DNA-binding domain (Keegan et al., 1986) fused to the
transactivating
domain of the herpes viral protein VP16 (Triezenberg et al., 1988) fused to
the hormone-
binding domain of the rat glucocorticoid receptor (Picard et al., 1988). The
expression of
the fusion protein is controlled by any promoter suitable for expression in
plants known in
the art or described here. This expression cassette is also comprised in the
plant comprising
the gene sequence encoding a NIM1 homologue fused to the 6xGAL4/minimal
promoter.
-32-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Thus, tissue- or organ-specificity of the fusion protein is achieved leading
to inducible
tissue- or organ-specificity of the NIM1 homologue.
g. Root Specific Expression:
Another pattern of gene expression is root expression. A suitable root
promoter is
described by de Framond (1991 ) and also in the published patent application
EP 0 452 269.
This promoter is transferred to a suitable vector such as pCGN1761 ENX for the
insertion of
a selected gene and subsequent transfer of the entire promoter-gene-terminator
cassette to
a transformation vector of interest.
h. Wound-Inducible Promoters:
Wound-inducible promoters may also be suitable for gene expression. Numerous
such promoters have been described (e.g. Xu et al., 1993); Logemann et al.,
1989;
Rohrmeier & Lehle, 1993; Firek et al., 1993; Warner et al., 1993) and all are
suitable for use
with the instant invention. Logemann et al. describe the 5' upstream sequences
of the
dicotyledonous potato wunl gene. Xu et al. show that a wound-inducible
promoter from the
dicotyledon potato (pink is active in the monocotyledon rice. Further,
Rohrmeier & Lehle
describe the cloning of the maize Vtiipl cDNA which is wound induced and which
can be
used to isolate the cognate promoter using standard techniques. Similar, Firek
et al, and
Warner et al. have described a wound-induced gene from the monocotyledon
Asparagus
officinalis, which is expressed at local wound and pathogen invasion sites.
Using cloning
techniques well known in the art, these promoters can be transferred to
suitable vectors,
fused to the genes pertaining to this invention, and used to express these
genes at the sites
of plant wounding.
i. Pith-Preferred Expression:
Patent Application WO 93/07278 describes the isolation of the maize trpA gene,
which is preferentially expressed in pith cells. The gene sequence and
promoter extending
up to -1726 by from the start of transcription are presented. Using standard
molecular
biological techniques, this promoter, or parts thereof, can be transferred to
a vector such as
pCGN1761 where it can replace the 35S promoter and be used to drive the
expression of a
foreign gene in a pith-preferred manner. In fact, fragments containing the
pith-preferred
promoter or parts thereof can be transferred to any vector and modified for
utility in
transgenic plants.
-33-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
j. Leaf-Specific Expression:
A maize gene encoding phosphoenol carboxylase (PEPC) has been described by
Hudspeth & Grula (1989). Using standard molecular biological techniques the
promoter for
this gene can be used to drive the expression of any gene in a leaf-specific
manner in
transgenic plants.
k. Pollen-Specific Expression:
WO 93/07278 describes the isolation of the maize calcium-dependent protein
kinase
(CDPK) gene which is expressed in pollen cells. The gene sequence and promoter
extend
up to 1400 by from the start of transcription. Using standard molecular
biological
techniques, this promoter or parts thereof, can be transferred to a vector
such as
pCGN1761 where it can replace the 35S promoter and be used to drive the
expression of a
NIM1 homologue of the present invention in a pollen-specific manner.
2. Transcriptional Terminators
A variety of transcriptional terminators are available for use in expression
cassettes.
These are responsible for the termination of transcription beyond the
transgene and its
correct polyadenylation. Appropriate transcriptional terminators are those
that are known to
function in plants and include the CaMV 35S terminator, the tml terminator,
the nopaline
synthase terminator and the pea rbcS E9 terminator. These can be used in both
monocotyledons and dicotyledons. In addition, a gene's native transcription
terminator may
be used.
3. Sequences for the Enhancement or Regulation of Expression
Numerous sequences have been found to enhance gene expression from within the
transcriptional unit and these sequences can be used in conjunction with the
genes of this
invention to increase their expression in transgenic plants.
Various intron sequences have been shown to enhance expression, particularly
in
monocotyledonous cells. For example, the introns of the maize Adhl gene have
been found
to significantly enhance the expression of the wild-type gene under its
cognate promoter
when introduced into maize cells. Intron 1 was found to be particularly
effective and
enhanced expression in fusion constructs with the chloramphenicol
acetyltransferase gene
(Callis etal., 1987). In the same experimental system, the intron from the
maize bronzel
-34-
WO 00/53762 cA 02365968 2001-o9-os PCT/EP00/01978
gene had a similar effect in enhancing expression. Intron sequences have been
routinely
incorporated into plant transformation vectors, typically within the non-
translated leader.
A number of non-translated leader sequences derived from viruses are also
known to
enhance expression, and these are particularly effective in dicotyledonous
cells.
Specifically, leader sequences from Tobacco Mosaic Virus (TMV, the "W-
sequence"), Maize
Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown
to be
effective in enhancing expression (e.g. Gallie et al., 1987; Skuzeski et al.,
1990).
4. Targeting of the Gene Product Within the Cell
Various mechanisms for targeting gene products are known to exist in plants
and the
sequences controlling the functioning of these mechanisms have been
characterized in
some detail. For example, the targeting of gene products to the chloroplast is
controlled by
a signal sequence found at the amino terminal end of various proteins which is
cleaved
during chloroplast import to yield the mature protein (e.g. Comai et al.,
1988). These signal
sequences can be fused to heterologous gene products to effect the import of
heterologous
products into the chloroplast (van den Broeck, et aL, 1985). DNA encoding for
appropriate
signal sequences can be isolated from the 5' end of the cDNAs encoding the
RUBISCO
protein, the CAB protein, the EPSP synthase enzyme, the GS2 protein and many
other
proteins which are known to be chloroplast localized. See also, the section
entitled
"Expression With Chloroplast Targeting" in Example 37 of U.S. Patent No.
5,639,949.
Other gene products are localized to other organelles such as the
mitochondrion and
the peroxisome (e.g. Unger et al., 1989). The cDNAs encoding these products
can also be
manipulated to effect the targeting of heterologous gene products to these
organelles.
Examples of such sequences are the nuclear-encoded ATPases and specific
aspartate
amino transferase isoforms for mitochondria. Targeting cellular protein bodies
has been
described by Rogers et al. (1985).
In addition, sequences have been characterized which cause the targeting of
gene
products to other cell compartments. Amino terminal sequences are responsible
for
targeting to the ER, the apoplast, and extracellular secretion from aleurone
cells (Koehler &
Ho, 1990). Additionally, amino terminal sequences in conjunction with carboxy
terminal
sequences are responsible for vacuolar targeting of gene products (Shinshi et
al., 1990).
By the fusion of the appropriate targeting sequences described above to
transgene
sequences of interest it is possible to direct the transgene product to any
organelle or cell
compartment. For chloroplast targeting, for example, the chloroplast signal
sequence from
-35-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
the RUBISCO gene, the CAB gene, the EPSP synthase gene, or the GS2 gene is
fused in
frame to the amino terminal ATG of the transgene. The signal sequence selected
should
include the known cleavage site, and the fusion constructed should take into
account any
amino acids after the cleavage site which are required for cleavage. In some
cases this
requirement may be fulfilled by the addition of a small number of amino acids
between the
cleavage site and the transgene ATG or, alternatively, replacement of some
amino acids
within the transgene sequence. Fusions constructed for chloroplast import can
be tested
for efficacy of chloroplast uptake by in vitro translation of in vitro
transcribed constructions
followed by in vitro chloroplast uptake using techniques described by Bartlett
et al. (1982)
and Wasmann et al. (1986). These construction techniques are well known in the
art and
are equally applicable to mitochondria and peroxisomes.
The above-described mechanisms for cellular targeting can be utilized not only
in
conjunction with their cognate promoters, but also in conjunction with
heterologous
promoters so as to effect a specific cell-targeting goal under the
transcriptional regulation of
a promoter that has an expression pattern different to that of the promoter
from which the
targeting signal derives.
Example 11: Construction of Plant Transformation Vectors
Numerous transformation vectors available for plant transformation are known
to
those of ordinary skill in the plant transformation arts, and the genes
pertinent to this
invention can be used in conjunction with any such vectors. The selection of
vector will
depend upon the preferred transformation technique and the target species for
transformation. For certain target species, different antibiotic or herbicide
selection markers
may be preferred. Selection markers used routinely in transformation include
the nptll
gene, which confers resistance to kanamycin and related antibiotics (Messing &
Vierra,
1982; Bevan et al., 1983), the bar gene, which confers resistance to the
herbicide
phosphinothricin (White et al., 1990; Spencer ef al., 1990), the hph gene,
which confers
resistance to the antibiotic hygromycin (Blochinger & Diggelmann), and the
dhfrgene, which
confers resistance to methatrexate (Bourouis ef al., 1983), and the EPSPS
gene, which
confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5,188,642).
1. Vectors Suitable for Agrobacterium Transformation
-36-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Many vectors are available for transformation using Agrobacterium tumefaciens.
These typically carry at least one T-DNA border sequence and include vectors
such as
pBINl9 (Bevan, Nucl. Acids Res. (1984)) and pXYZ. Below, the construction of
two typical
vectors suitable for Agrobacterium transformation is described.
a. pCIB200 and pCIB2001:
The binary vectors pcIB200 and pCIB2001 are used for the construction of
recombinant vectors for use with Agrobacterium and are constructed in the
following
manner. pTJS75kan is created by Narl digestion of pTJS75 (Schmidhauser &
Helinski,
1985) allowing excision of the tetracycline-resistance gene, followed by
insertion of an Accl
fragment from pUC4K carrying an NPTII (Messing & Vierra, 1982; Bevan et al.,
1983;
McBride et al., 1990). Xhol linkers are ligated to the EcoRV fragment of PCIB7
which
contains the left and right T-DNA borders, a plant selectable noslnptll
chimeric gene and
the pUC polylinker (Rothstein et al., 1987), and the Xhol digested fragment
are cloned into
Sall-digested pTJS75kan to create pCIB200 (see also EP 0 332 104, example 19).
pCIB200 contains the following unique polylinker restriction sites: EcoRI,
Sstl, Kpnl, Bglll,
Xbal, and Sall. pCIB2001 is a derivative of pCIB200 created by the insertion
into the
polylinker of additional restriction sites. Unique restriction sites in the
polylinker of
pCIB2001 are EcoRl, Sstl, Kpnl, Bglll, Xbal, Sall, Mlul, Bcll, Avrll, Apal,
Hpal, and Stul.
pCIB2001, in addition to containing these unique restriction sites also has
plant and
bacterial kanamycin selection, left and right T-DNA borders for Agrobacterium-
mediated
transformation, the RK2-derived trfA function for mobilization between E. coli
and other
hosts, and the OriT and OriV functions also from RK2. The pCIB2001 polylinker
is suitable
for the cloning of plant expression cassettes containing their own regulatory
signals.
b. pCIBlO and Hygromycin Selection Derivatives thereof:
The binary vector pCIBlO contains a gene encoding kanamycin resistance for
selection in plants and T-DNA right and left border sequences and incorporates
sequences
from the wide host-range plasmid pRK252 allowing it to replicate in both E.
coli and
Agrobacterium. Its construction is described by Rothstein et al. (1987).
Various derivatives
of pCIBlO are constructed which incorporate the gene for hygromycin B
phosphotransferase described by Gritz et al., 1983). These derivatives enable
selection of
transgenic plant cells on hygromycin only (pCIB743), or hygromycin and
kanamycin
(pCIB715, pCIB717).
-37-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
2. Vectors Suitable for non-Agrobacterium Transformation
Transformation without the use of Agrobacterium tumefaciens circumvents the
requirement for T-DNA sequences in the chosen transformation vector and
consequently
vectors lacking these sequences can be utilized in addition to vectors such as
the ones
described above which contain T-DNA sequences. Transformation techniques that
do not
rely on Agrobacterium include transformation via particle bombardment,
protoplast uptake
(e.g. PEG and electroporation) and microinjection. The choice of vector
depends largely on
the preferred selection for the species being transformed. Below, the
construction of typical
vectors suitable for non-Agrobacterium transformation is described.
a. pCIB3064:
pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques
in
combination with selection by the herbicide basta (or phosphinothricin). The
plasmid
pCIB246 comprises the CaMV 35S promoter in operational fusion to the E, coli
GUS gene
and the CaMV 35S transcriptional terminator and is described in the PCT
published
application WO 93/07278. The 35S promoter of this vector contains two ATG
sequences 5'
of the start site. These sites are mutated using standard PCR techniques in
such a way as
to remove the ATGs and generate the restriction sites Sspl and Pvull. The new
restriction
sites are 96 and 37 by away from the unique Sall site and 101 and 42 by away
from the
actual start site. The resultant derivative of pCIB246 is designated pCIB3025.
The GUS
gene is then excised from pCIB3025 by digestion with Sall and Sacl, the
termini rendered
blunt and religated to generate plasmid pCIB3060. The plasmid pJIT82 is
obtained from the
John Innes Centre, Norwich and the a 400 by Smal fragment containing the bar
gene from
Streptomyces viridochromogenes is excised and inserted into the Hpal site of
pCIB3060
(Thompson etal., 1987). This generated pCIB3064, which comprises the bar gene
under
the control of the CaMV 35S promoter and terminator for herbicide selection, a
gene for
ampicillin resistance (for selection in E, coh) and a polylinker with the
unique sites Sphl,
Pstl, Hindlll, and BamHl. This vector is suitable for the cloning of plant
expression
cassettes containing their own regulatory signals.
b. pSOGl9 and pSOG35:
pSOG35 is a transformation vector that utilizes the E, coli gene dihydrofolate
reductase (DFR) as a selectable marker conferring resistance to methotrexate.
PCR is
-38-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adh1 gene
(-550 bp)
and 18 by of the GUS untranslated leader sequence from pSOGlO. A 250-by
fragment
encoding the E. coli dihydrofolate reductase type II gene is also amplified by
PCR and
these two PCR fragments are assembled with a Sacl-Pstl fragment from pB1221
(Clontech)
which comprises the pUCl9 vector backbone and the nopaline synthase
terminator.
Assembly of these fragments generates pSOGl9 which contains the 35S promoter
in fusion
with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline
synthase
terminator. Replacement of the GUS leader in pSOGl9 with the leader sequence
from
Maize Chlorotic Mottle Virus (MCMV) generates the vector pSOG35. pSOGl9 and
pSOG35
carry the pUC gene for ampicillin resistance and have Hindlll, Sphl, Pstl and
EcoRl sites
available for the cloning of foreign substances.
Example 12: Transformation
Once the gene sequence of interest has been cloned into an expression system,
it is
transformed into a plant cell. Methods for transformation and regeneration of
plants are
well known in the art. For example, Ti plasmid vectors have been utilized for
the delivery of
foreign DNA, as well as direct DNA uptake, liposomes, electroporation, micro-
injection, and
microprojectiles. In addition, bacteria from the genus Agrobacterium can be
utilized to
transform plant cells. Below are descriptions of representative techniques for
transforming
both dicotyledonous and monocotyledonous plants.
1. Transformation of Dicotyledons
Transformation techniques for dicotyledons are well known in the art and
include
Agrobacterium-based techniques and techniques that do not require
Agrobacterium. Non-
Agrobacterium techniques involve the uptake of exogenous genetic material
directly by
protoplasts or cells. This can be accomplished by PEG or electroporation
mediated uptake,
particle bombardment-mediated delivery, or microinjection. Examples of these
techniques
are described by Paszkowski et al., 1984; Potrykus et al., 1985; Reich et al.,
1986; and
Klein et al., 1987. In each case the transformed cells are regenerated to
whole plants using
standard techniques known in the art.
Agrobacterium-mediated transformation is a preferred technique for
transformation of
dicotyledons because of its high efficiency of transformation and its broad
utility with many
different species. Agrobacterium transformation typically involves the
transfer of the binary
-39-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
vector carrying the foreign DNA of interest (e,g. pCIB200 or pCIB2001 ) to an
appropriate
Agrobacterium strain which may depend of the complement of vir genes carried
by the host
Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g,
strain
CIB542 for pCIB200 and pCIB2001 (Uknes et al., 1993). The transfer of the
recombinant
binary vector to Agrobacterium is accomplished by a triparental mating
procedure using E.
coli carrying the recombinant binary vector, a helper E. coil strain which
carries a plasmid
such as pRK2013 and which is able to mobilize the recombinant binary vector to
the target
Agrobacterium strain. Alternatively, the recombinant binary vector can be
transferred to
Agrobacterium by DNA transformation (Hofgen & Willmitzer, 1988).
Transformation of the target plant species by recombinant Agrobacterium
usually
involves co-cultivation of the Agrobacterium with explants from the plant and
follows
protocols well known in the art. Transformed tissue is regenerated on
selectable medium
carrying the antibiotic or herbicide resistance marker present between the
binary plasmid T-
DNA borders.
Another approach to transforming plant cells with a gene involves propelling
inert or
biologically active particles at plant tissues and cells. This technique is
disclosed in U.S.
Patent Nos. 4,945,050, 5,036,006, and 5,100,792. Generally, this procedure
involves
propelling inert or biologically active particles at the cells under
conditions effective to
penetrate the outer surface of the cell and afford incorporation within the
interior thereof.
When inert particles are utilized, the vector can be introduced into the cell
by coating the
particles with the vector containing the desired gene. Alternatively, the
target cell can be
surrounded by the vector so that the vector is carried into the cell by the
wake of the
particle. Biologically active particles (e.g., dried yeast cells, dried
bacterium or a
bacteriophage, each containing DNA sought to be introduced) can also be
propelled into
plant cell tissue.
2. Transformation of Monocotyledons
Transformation of most monocotyledon species has now also become routine.
Preferred techniques include direct gene transfer into protoplasts using PEG
or
electroporation techniques, and particle bombardment into callus tissue.
Transformations
can be undertaken with a single DNA species or multiple DNA species (i,e, co-
transformation) and both these techniques are suitable for use with this
invention. Co-
transformation may have the advantage of avoiding complete vector construction
and of
generating transgenic plants with unlinked loci for the gene of interest and
the selectable
-40-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
marker, enabling the removal of the selectable marker in subsequent
generations, should
this be regarded desirable. However, a disadvantage of the use of co-
transformation is the
less than 100% frequency with which separate DNA species are integrated into
the genome
(Schocher et al., 1986).
Patent Applications EP 0 292 435, EP 0 392 225, and WO 93/07278 describe
techniques for the preparation of callus and protoplasts from an elite inbred
line of maize,
transformation of protoplasts using PEG or electroporation, and the
regeneration of maize
plants from transformed protoplasts. Gordon-Kamm et aL (1990) and Fromm et al.
(1990)
have published techniques for transformation of A188-derived maize line using
particle
bombardment. Furthermore, WO 93/07278 and Koziel et al. (1993) describe
techniques for
the transformation of elite inbred lines of maize by particle bombardment.
This technique
utilizes immature maize embryos of 1.5-2.5 mm length excised from a maize ear
14-15 days
after pollination and a PDS-1000He Biolistics device for bombardment.
Transformation of rice can also be undertaken by direct gene transfer
techniques
utilizing protoplasts or particle bombardment. Protoplast-mediated
transformation has been
described for Japonica-types and lndica-types (Zhang et al., 1988; Shimamoto
et al., 1989;
Datta et al., 1990). Both types are also routinely transformable using
particle bombardment
(Christou et al., 1991 ). Furthermore, WO 93/21335 describes techniques for
the
transformation of rice via electroporation.
Patent Application EP 0 332 581 describes techniques for the generation,
transformation and regeneration of Pooideae protoplasts. These techniques
allow the
transformation of Dactylis and wheat. Furthermore, wheat transformation has
been
described by Vasil et al. (1992) using particle bombardment into cells of type
C long-term
regenerable callus, and also by Vasil et al. (1993) and Weeks et al. (1993)
using particle
bombardment of immature embryos and immature embryo-derived callus. A
preferred
technique for wheat transformation, however, involves the transformation of
wheat by
particle bombardment of immature embryos and includes either a high sucrose or
a high
maltose step prior to gene delivery. Prior to bombardment, any number of
embryos (0.75-1
mm in length) are plated onto MS medium with 3% sucrose (Murashiga & Skoog,
1962) and
3 mg/I 2,4-D for induction of somatic embryos, which is allowed to proceed in
the dark. On
the chosen day of bombardment, embryos are removed from the induction medium
and
placed onto the osmoticum (i.e. induction medium with sucrose or maltose added
at the
desired concentration, typically 15%). The embryos are allowed to plasmolyze
for 2-3 h and
are then bombarded. Twenty embryos per target plate is typical, although not
critical. An
-41 -
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated
onto
micrometer size gold particles using standard procedures. Each plate of
embryos is shot
with the DuPont Biolistics0 helium device using a burst pressure of 1000 psi
using a
standard 80 mesh screen. After bombardment, the embryos are placed back into
the dark
to recover for about 24 h (still on osmoticum). After 24 hrs, the embryos are
removed from
the osmoticum and placed back onto induction medium where they stay for about
a month
before regeneration. Approximately one month later the embryo explants with
developing
embryogenic callus are transferred to regeneration medium (MS + 1 mg/liter
NAA, 5 mg/liter
GA), further containing the appropriate selection agent (10 mg/I basta in the
case of
pCIB3064 and 2 mg/I methotrexate in the case of pSOG35). After approximately
one
month, developed shoots are transferred to larger sterile containers known as
"GA7s" which
contain half-strength MS, 2% sucrose, and the same concentration of selection
agent.
Tranformation of monocotyledons using Agrobacterium has also been described.
See, WO 94/00977 and U.S. Patent No. 5,591,616.
III. Breeding and Seed Production
Example 13: Breeding
The plants obtained via tranformation with a gene of the present invention can
be any
of a wide variety of plant species, including those of monocots and dicots;
however, the
plants used in the method of the invention are preferably selected from the
list of
agronomically important target crops set forth supra. The expression of a gene
of the
present invention in combination with other characteristics important for
production and
quality can be incorporated into plant lines through breeding. Breeding
approaches and
techniques are known in the art. See, for example, Welsh J. R. (1981 ); Wood
D. R. (Ed.)
(1983); Mayo O. (1987); Singh, D.P. (1986); and Wricke and Weber (1986).
The genetic properties engineered into the transgenic seeds and plants
described
above are passed on by sexual reproduction or vegetative growth and can thus
be
maintained and propagated in progeny plants. Generally said maintenance and
propagation
make use of known agricultural methods developed to fit specific purposes such
as tilling,
sowing or harvesting. Specialized processes such as hydroponics or greenhouse
technologies can also be applied. As the growing crop is vulnerable to attack
and damages
caused by insects or infections as well as to competition by weed plants,
measures are
- 42 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
undertaken to control weeds, plant diseases, insects, nematodes, and other
adverse
conditions to improve yield. These include mechanical measures such a tillage
of the soil or
removal of weeds and infected plants, as well as the application of
agrochemicals such as
herbicides, fungicides, gametocides, nematicides, growth regulants, ripening
agents and
insecticides.
Use of the advantageous genetic properties of the transgenic plants and seeds
according to the invention can further be made in plant breeding, which aims
at the
development of plants with improved properties such as tolerance of pests,
herbicides, or
stress, improved nutritional value, increased yield, or improved structure
causing less loss
from lodging or shattering. The various breeding steps are characterized by
well-defined
human intervention such as selecting the lines to be crossed, directing
pollination of the
parental lines, or selecting appropriate progeny plants. Depending on the
desired
properties, different breeding measures are taken. The relevant techniques are
well known
in the art and include but are not limited to hybridization, inbreeding,
backcross breeding,
multiline breeding, variety blend, interspecific hybridization, aneuploid
techniques, etc.
Hybridization techniques also include the sterilization of plants to yield
male or female
sterile plants by mechanical, chemical, or biochemical means. Cross
pollination of a male
sterile plant with pollen of a different line assures that the genome of the
male sterile but
female fertile plant will uniformly obtain properties of both parental lines.
Thus, the
transgenic seeds and plants according to the invention can be used for the
breeding of
improved plant lines, that for example, increase the effectiveness of
conventional methods
such as herbicide or pestidice treatment or allow one to dispense with said
methods due to
their modified genetic properties. Alternatively new crops with improved
stress tolerance can
be obtained, which, due to their optimized genetic "equipment', yield
harvested product of
better quality than products that were not able to tolerate comparable adverse
developmental conditions.
Example 14: Seed Production
In seeds production, germination quality and uniformity of seeds are essential
product characteristics, whereas germination quality and uniformity of seeds
harvested and
sold by the farmer is not important. As it is difficult to keep a crop free
from other crop and
weed seeds, to control seedborne diseases, and to produce seed with good
germination,
fairly extensive and well-defined seed production practices have been
developed by seed
- 43 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
producers, who are experienced in the art of growing, conditioning and
marketing of pure
seed. Thus, it is common practice for the farmer to buy certified seed meeting
specific
quality standards instead of using seed harvested from his own crop.
Propagation material
to be used as seeds is customarily treated with a protectant coating
comprising herbicides,
insecticides, fungicides, bactericides, nematicides, molluscicides, or
mixtures thereof.
Customarily used protectant coatings comprise compounds such as captan,
carboxin,
thiram (TMTD~), methalaxyl (Apron~), and pirimiphos-methyl (Actellic~). If
desired, these
compounds are formulated together with further carriers, surfactants or
application-
promoting adjuvants customarily employed in the art of formulation to provide
protection
against damage caused by bacterial, fungal or animal pests. The protectant
coatings may
be applied by impregnating propagation material with a liquid formulation or
by coating with
a combined wet or dry formulation. Other methods of application are also
possible such as
treatment directed at the buds or the fruit.
It is a further aspect of the present invention to provide new agricultural
methods,
such as the methods examplified above, which are characterized by the use of
transgenic
plants, transgenic plant material, or transgenic seed according to the present
invention.
The seeds may be provided in a bag, container or vessel comprised of a
suitable
packaging material, the bag or container capable of being closed to contain
seeds. The
bag, container or vessel may be designed for either short term or long term
storage, or both,
of the seed. Examples of a suitable packaging material include paper, such as
kraft paper,
rigid or pliable plastic or other polymeric material, glass or metal.
Desirably the bag,
container, or vessel is comprised of a plurality of layers of packaging
materials, of the same
or differing type. In one embodiment the bag, container or vessel is provided
so as to
exclude or limit water and moisture from contacting the seed. In one example,
the bag,
container or vessel is sealed, for example heat sealed, to prevent water or
moisture from
entering. In another embodiment water absorbent materials are placed between
or
adjacent to packaging material layers. In yet another embodiment the bag,
container or
vessel, or packaging material of which it is comprised is treated to limit,
suppress or
prevent disease, contamination or other adverse affects of storage or
transport of the seed.
An example of such treatment is sterilization, for example by chemical means
or by
exposure to radiation. Comprised by the present invention is a commercial bag
comprising
seed of a transgenic plant comprising a gene of the present invention that is
expressed in
said transformed plant at higher levels than in a wild type plant, together
with a suitable
-44-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
carrier, together with label instructions for the use thereof for conferring
broad spectrum
disease resistance to plants.
IV. Disease Resistance Evaluation
Disease resistance evaluation is performed by methods known in the art. See,
Uknes
et al. (1993); Gorlach et al. (1996); Alexander et al. (1993). For example,
several
representative disease resistance assays are described below.
Example 15: Phytophthora parasitica (Black Shank) Resistance Assay
Assays for resistance to Phytophthora parasitica, the causative organism of
black
shank, are performed on six-week-old plants grown as described in Alexander et
al. (1993).
Plants are watered, allowed to drain well, and then inoculated by applying 10
ml of a
sporangium suspension (300 sporangia/ml) to the soil. Inoculated plants are
kept in a
greenhouse maintained at 23-25°C day temperature, and 20-22°C
night temperature. The
wilt index used for the assay is as follows: 0=no symptoms; 1=no symptoms;
1=some sign
of wilting, with reduced turgidity; 2=clear wilting symptoms, but no rotting
or stunting;
3=clear wilting symptoms with stunting, but no apparent stem rot; 4=severe
wilting, with
visible stem rot and some damage to root system; 5=as for 4, but plants near
death or
dead, and with severe reduction of root system. All assays are scored blind on
plants
arrayed in a random design.
Example 16: Pseudomonas syringae Resistance Assay
Pseudomonas syringae pv. tabaci strain #551 is injected into the two lower
leaves of
several 6-7-week-old plants at a concentration of 106 or 3 x 106 per ml in
H20. Six individual
plants are evaluated at each time point. Pseudomonas tabaci infected plants
are rated on a
point disease severity scale, 5=100% dead tissue, 0=no symptoms. A T-test
(LSD) is
conducted on the evaluations for each day and the groupings are indicated
after the Mean
disease rating value. Values followed by the same letter on that day of
evaluation are not
statistically significantly different.
-45-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Example 17: Cercospora nicotianae Resistance Assay
A spore suspension of Cercospora nicotianae (ATCC #18366) (100,000-150,000
spores per ml) is sprayed to imminent run-off onto the surface of the leaves.
The plants are
maintained in 100% humidity for five days. Thereafter the plants are misted
with water 5-10
times per day. Six individual plants are evaluated at each time point.
Cercospora
nicotianae is rated on a % leaf area showing disease symptoms basis. A T-test
(LSD) is
conducted on the evaluations for each day and the groupings are indicated
after the Mean
disease rating value. Values followed by the same letter on that day of
evaluation are not
statistically significantly different.
Example 18: Peronospora parasitica Resistance Assay
Assays for resistance to Peronospora parasitica are performed on plants as
described in Uknes et al, (1993). Plants are inoculated with a compatible
isolate of P.
parasitica by spraying with a conidial suspension (approximately 5 x 104
spores per
milliliter). Inoculated plants are incubated under humid conditions at
17° C in a growth
chamber with a 14-hr day/10-hr night cycle. Plants are examined at 3-14 days,
preferably
7-12 days, after inoculation for the presence of conidiophores. In addition,
several plants
from each treatment are randomly selected and stained with lactophenol-trypan
blue
(Keogh et al., 1980) for microscopic examination.
The above disclosed embodiments are illustrative. This disclosure of the
invention will
place one skilled in the art in possession of many variations of the
invention. All such
obvious and foreseeable variations are intended to be encompassed by the
claims.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
SEQ ID N0:1 - Full length cDNA sequence of a NIM1 homologue from Nicotiana
tabacum.
SEQ ID N0:2 - Protein sequence of the Nicotiana tabacum NIM1 homologue encoded
by
SEQ ID N0:1.
SEQ ID N0:3 - Full length cDNA sequence of a NIM1 homologue from Lycopersicon
esculentum.
-46-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
SEQ ID N0:4 - Protein sequence of the Lycopersicon esculentum NIM1 homologue
encoded by SEQ ID N0:3.
SEQ ID N0:5 - Partial cDNA sequence of a NIM1 homologue from Brassica napus.
SEQ ID N0:6 - Partial protein sequence of the Brassica napus NIM1 homologue
encoded
by SEQ ID N0:5.
SEQ ID N0:7 - Full length cDNA sequence of a NIM1 homologue (AtNMLcS~ from
Arabidopsis thaliana.
SEQ ID N0:8 - Full length protein sequence of the Arabidopsis thaliana NIM1
homologue
AtNMLc5 encoded by SEQ ID N0:7.
SEQ ID NOs:9-14 - Oligonucleotide primers used in Examples 1-4.
SEQ ID N0:15 - Genomic DNA sequence of a NIM1 homologue (AtNMLc2) from
Arabidopsis thaliana.
SEQ ID N0:16 - Protein sequence of the Arabidopsis thaliana NIM1 homologue
AtNMLc2
encoded by SEQ ID N0:15.
SEQ ID N0:17 - Genomic DNA sequence of a NIM1 homologue (AtNMLc4-1) from
Arabidopsis thaliana.
SEQ ID N0:18 - Protein sequence of the Arabidopsis thaliana NIM1 homologue
AtNMLc4-1
encoded by SEQ ID N0:17.
SEQ ID N0:19 - Genomic DNA sequence of a NIM1 homologue (AfNMLc4-2) from
Arabidopsis thaliana.
SEQ ID N0:20 - Protein sequence of the Arabidopsis thaliana NIM1 homologue
AtNMLc4-2
encoded by SEQ ID N0:19.
SEQ ID N0:21 - PCR primer NIM 1A.
SEQ ID N0:22 - PCR primer NIM 1 B.
SEQ ID N0:23 - PCR primer NIM 1C.
SEQ ID N0:24 - PCR primer NIM 1 D.
SEQ ID N0:25 - PCR primer NIM 2A.
SEQ ID N0:26 - PCR primer NIM 2B.
SEQ ID N0:27 - PCR primer NIM 2C.
SEQ ID N0:28 - PCR primer NIM 2D.
SEQ ID N0:29 - 659 by NIIV~Iike DNA fragment amplified from Nicotiana tabacum
(Tobacco
A), which is a consensus of 36 sequences and has 67% sequence identity
to the Arabidopsis thaliana NIM1 gene sequence.
-47-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
SEQ ID N0:30 - Protein sequence encoded by SEQ ID N0:29.
SEQ ID N0:31 - 498 by NIM like DNA fragment amplified from Nicotiana tabacum
(Tobacco
B), which is a consensus of 2 sequences and has 62% sequence identity to
the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:32 - Protein sequence encoded by SEQ ID N0:31.
SEQ ID N0:33 - 498 by Nlll~like DNA fragment amplified from Nicotiana tabacum
(Tobacco
C), which is a consensus of 3 sequences and has 63% sequence identity to
the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:34 - Protein sequence encoded by SEQ ID N0:33.
SEQ ID N0:35 - 399 by Nlll~like DNA fragment amplified from Nicotiana tabacum
(Tobacco
D), which has 59% sequence identity to the Arabidopsis thaliana NIM1 gene
sequence.
SEQ ID N0:36 - Protein sequence encoded by SEQ ID N0:35.
SEQ ID N0:37 - 498 by Nlll~like DNA fragment amplified from Lycopersicon
esculentum
(Tomato A), which is a consensus of 8 sequences and has 67% sequence
identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:38 - Protein sequence encoded by SEQ ID N0:37.
SEQ ID N0:39 - 498 by NIM like DNA fragment amplified from Beta vulgaris
(Sugarbeet),
which is a consensus of 24 sequences and has 66% sequence identity to
the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:40 - Protein sequence encoded by SEQ ID N0:39.
SEO ID N0:41 - 498 by NIM like DNA fragment amplified from Helianthus annuus
(Sunflower A), which is a consensus of 9 sequences and has 61 % sequence
identity to the Arabidopsis thaliana NIMi gene sequence.
SEQ ID N0:42 - Protein sequence encoded by SEQ ID N0:41.
SEQ ID N0:43 - 498 by NIM like DNA fragment amplified from Helianthus annuus
(Sunflower B), which is a consensus of 10 sequences and has 59%
sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:44 - Protein sequence encoded by SEQ ID N0:43.
SEQ ID N0:45 - 653 by NIM like DNA fragment amplified from Solanum tuberosum
(Potato
A), which is a consensus of 15 sequences and has 68% sequence identity
to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:46 - Protein sequence encoded by SEQ ID N0:45.
-48-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
SEQ ID N0:47 - 498 by Nlll~like DNA fragment amplified from Solanum tuberosum
(Potato
B), which is a consensus of 3 sequences and has 61 % sequence identity to
the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:48 - Protein sequence encoded by SEQ ID N0:47.
SEQ ID N0:49 - 477 by Nlll~like DNA fragment amplified from Solanum tuberosum
(Potato
C), which is a consensus of 2 sequences and has 62% sequence identity to
the Arabidopsis thaliana NIMi gene sequence.
SEQ ID N0:50 - Protein sequence encoded by SEQ ID N0:49.
SEQ ID N0:51 - 501 by Nlll~like DNA fragment amplified from Brassica napes
(Canola A),
which is a consensus of 5 sequences and has 59% sequence identity to the
Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:52 - Protein sequence encoded by SEQ ID N0:51.
SEQ ID N0:53 - 501 by Nlll~like DNA fragment amplified from Brassica napes
(Canola B),
which is a consensus of 5 sequences and has 58% sequence identity to the
Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:54 - Protein sequence encoded by SEQ ID N0:53.
SEQ ID N0:55 - 498 by NIM like DNA fragment amplified from Brassica napes
(Canola C),
which has 56% sequence identity to the Arabidopsis thaliana NIMi gene
sequence.
SEQ ID N0:56 - Protein sequence encoded by SEQ ID N0:55.
SEQ ID N0:57 - 498 by NIM like DNA fragment amplified from Brassica napes
(Canola D),
which has 73% sequence identity to the Arabidopsis thaliana NIM1 gene
sequence.
SEQ ID N0:58 - Protein sequence encoded by SEQ ID N0:57.
SEQ ID N0:59 - PCR primer NIM 3A.
SEQ ID N0:60 - PCR primer NIM 3B.
SEQ ID N0:61 - 148 by NlM like DNA fragment amplified from Lycopersicon
esculentum
(Tomato B), which is a consensus of 3 sequences and has 72% sequence
identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:62 - Protein sequence encoded by SEQ ID N0:61.
SEQ ID N0:63 - Full length cDNA sequence of a NlM1 homologue from Beta
vulgaris
(Sugarbeet), which corresponds to the PCR fragment of SEQ ID N0:39.
SEQ ID N0:64 - Protein sequence of the sugarbeet NIM1 homologue encoded by SEQ
ID
N0:62.
- 49 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
SEQ ID N0:65 - Full length cDNA sequence of a NIM1 homologue from Heliauthus
annuus
(Sunflower B), which corresponds to the PCR fragment of SEQ ID N0:43.
SEQ ID N0:66 - Protein sequence of the Heliauthus annuus NIM1 homologue
encoded by
SEQ ID N0:65.
SEQ ID N0:67 - cDNA sequence corresponding to the Arabidopsis thaliana
Nlll~like
genomic sequence AtNMLc2 (SEQ ID N0:15).
SEQ ID N0:68 - Protein sequence encoded by SEQ ID N0:67.
SEQ ID N0:69 - cDNA sequence corresponding to the Arabidopsis thaliana
Nlll~like
genomic sequence AfNMLc4-1 (SEQ ID N0:17).
SEQ ID N0:70 - Protein sequence encoded by SEQ ID N0:69.
SEQ ID N0:71 - cDNA sequence corresponding to the Arabidopsis thaliana
Nlll~like
genomic sequence AfNMLc4-2 (SEQ ID N0:19).
SEQ ID N0:72 - Protein sequence encoded by SEQ ID N0:71.
SEQ ID N0:73 - Full length cDNA sequence of a NIM1 homologue from Nicotiana
tabacum
(Tobacco B), which corresponds to the PCR fragment of SEQ ID N0:31.
SEQ ID N0:74 - Protein sequence of the Nicotiana tabacum NIM1 homologue
encoded by
SEQ ID N0:73.
DEPOSITS
The following material has been deposited with the Agricultural Research
Service,
Patent Culture Collection (NRRL), 1815 North University Street, Peoria,
Illinois 61604, USA,
under the terms of the Budapest Treaty on the International Recognition of the
Deposit of
Microorganisms for the Purposes of Patent Procedure. All restrictions on the
availability of
the deposited material will be irrevocably removed upon the granting of a
patent.
Clone Accession Number Date of Deposit
pNOV1203 NRRL B-30049 August 17,
1998
pNOV1204 NRRL B-30050 August 17,
1998
pNOV1206 NRRL B-30051 August 17,
1998
AtNMLc5 NRRL B-30139 May 25, 1999
REFERENCES
-50-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
The references cited herein are indicative of the current state of the art.
Each of the
following is incorporated by reference into the instant disclosure.
U.S. Patent No. 4,940,935
U.S. Patent No. 4,945,050
U.S. Patent No. 5,036,006
U.S. Patent No. 5,100,792
U.S. Patent No. 5,188,642
U.S. Patent No. 5,523,311
U.S. Patent No. 5,591,616
U.S. Patent No. 5,614,395
U.S. Patent No. 5,639,949
U.S. Patent No. 5,792,904
EP 0 292 435
EP 0 332 104
EP 0 332 581
EP 0 342 926
EP 0 392 225
EP 0 452 269
International PCT Application WO 93/07278
International PCT Application WO 93/21335
International PCT Application WO 94/00977
International PCT Application WO 94/13822
International PCT Application WO 94/16077
International PCT Application WO 97/49822
International PCT Application WO 98/06748
International PCT Application WO 98/26082
International PCT Application WO 98/29537
Alexander et al., Proc. Natl. Acad. Sci. USA 90: 7327-7331 (1993)
Aoyama and Chua, The Plant Journal 11: 605-612 (1997)
Ausubel, F.M. et al., Current Protocols in Molecular Biology, pub. by Greene
Publishing
Assoc. and Wiley-Interscience (1987)
Bartlett et aL, In: Edelmann et al. (Eds.) Methods in Chloroplast Molecular
Biology, Elsevier
pp 1081-1091 (1982)
-51 -
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Bevan et al., Nature 304:184-187 (1983)
Bevan, Nucl. Acids Res. (1984)
Bi et al., Plant J. 8: 235-245 (1995)
Binet et al. Plant Science 79: 87-94 (1991 )
Blochinger & Diggelmann, Mol Cell. Biol. 4: 2929-2931
Bourouis et al., EMBO J. 2(7): 1099-1104 (1983)
Boutry et al., Nature 328:340-342 (1987)
Caddick et aL, Nat. Biotechnol 16:177-180 (1998)
Callis et al., Genes Develop. 1: 1183-1200 (1987)
Cameron et al., Plant J. 5: 715-725 (1994)
Cao et al., Plant Cell 6, 1583-1592 (1994)
Cao et al., Cell 88: 57-63 (1997)
Casas et al., Proc. Natl. Acad. Sci. USA 90: 11212-11216 (1993)
Century et al., Proc. NatL Acad. Sci. USA 92: 6597-6601 (1995)
Chibbar et al., Plant Cell Rep. 12: 506-509 (1993)
Chrispeels, Ann. Rev. Plant Physiol. Plant Mol. Biol. 42: 21-53 (1991 )
Christou et al., Plant Physiol. 87:671-674 (1988)
Christou et aL, Biotechnology 9: 957-962 (1991 )
Christensen et al., Plant Molec. Biol. 12: 619-632 (1989)
Comai et al., J. Biol. Chem. 263: 15104-15109 (1988)
Crossway et al., BioTechniques 4:320-334 (1986)
Datta et al., Biotechnology 8: 736-740 (1990)
de Framond, FEBS 290: 103-106 (1991 )
Delaney et al., Science 266: 1247-1250 (1994)
Delaney et al., Proc. Natl. Acad. ScL USA 92: 6602-6606 (1995)
Dempsey and Klessig, Bulletin de L'Institut Pasteur 93: 167-186 (1995)
Dietrich et al., Cell77: 565-577 (1994)
Firek et al., Plant Molec. Biol. 22: 129-142 (1993)
Fromm et al., Biotechnology 8: 833-839 (1990)
Gaffney et al., Science 261: 754-756 (1993)
Gallie et al., Nucl. Acids Res. 15: 8693-8711 (1987)
Glazebrook et al., Genetics 143: 973-982 (1996)
Gordon-Kamm et al., Plant Cell 2: 603-618 (1990)
-52-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Gordon-Kamm et al, in 'Transgenic Plants", vol. 2., pp.21-33, pub. by Academic
Press
(1993)
Gorlach et aL, Plant Cel18:629-643 (1996)
Greenberg etal., Cell77: 551-563 (1994)
Gritz et al., Gene 25: 179-188 (1983)
Hayashimoto et al., Plant Physiol. 93: 857-863 (1990)
Hill et al., Euphytica 85:119-123 (1995)
Hinchee et al., Biotechnology 6:915-921 (1988)
Hofgen & Willmitzer, Nucl. Acids Res. 16: 9877 (1988)
Hudspeth & Grula, Plant Molec. Biol 12: 579-589 (1989)
Hunt and Ryals, Crit. Rev, in Plant Sci. 15: 583-606 (1996)
Innis et al., PCR Protocols, a Guide to Mefhods and Applications eds.,
Academic Press
(1990)
Ishida et al., Nature Biotechnology 14: 745-750 (1996)
Jahne et al., Theor. Appl. Genet. 89: 525-533 (1994)
Keegan et al., Science 231: 699-704 (1986)
Keogh et al., Trans. Br. Mycol. Soc. 74: 329-333 (1980)
Klein et al., Nature 327: 70-73 (1987)
Klein et al., Proc. Natl. Acad. Sci. USA 85:4305-4309 (1988)
Klein et al., BiolTechnology 6:559-563 (1988)
Klein et al., Plant Physiol. 91:440-444 (1988)
Koziel et al., Biotechnology 11: 194-200 (1993)
Koziel et aL, Annals of the New York Academy of Sciences 792:164-171 (1996)
Lawton et al., "The molecular biology of systemic aquired resistance" in
Mechanisms of
Defence Responses in Plants, B. Fritig and M. Legrand, eds (Dordrecht, The
Netherlands: Kluwer Academic Publishers), pp. 422-432 (1993)
Lawton et al., Plant J. 10: 71-82 (1996)
Logemann et al., Plant Cell 1: 151-158 (1989)
Maher et al., Proc. Natl. Acad. Sci. USA 91: 7802-7806 (1994)
Mauch-Mani and Slusarenko, Mol. Plant-Microbe Interact. 7: 378-383 (1994)
Mauch-Mani and Slusarenko, Plant CellB: 203-212 (1996)
Mayo O., The Theory of Plant Breeding, Second Edition, Clarendon Press, Oxford
(1987)
Mazur et al., Plant Physiol. 85: 1110 (1987)
-53-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
McBride et al., Plant Molecular Biology 14: 266-276 (1990)
McCabe et al., Biotechnology 6:923-926 (1988)
McElroy et aL, Plant Cell 2: 163-171 (1990)
McElroy et al., Mol. Gen. Genet. 231: 150-160 (1991 )
Messing & Vierra, Gene 19: 259-268 (1982)
Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962)
Nehra et aL, The Plant Journal5: 285-297 (1994)
Neuhaus et al., Proc. Natl. Acad Sci. USA 88: 10362-10366 (1991 )
Norris et al., Plant Mol. Biol. 21: 895-906 (1993)
Pallas et aL, Plant J. 10: 281-293 (1996)
Parker et aL, Plant Cell 8: 2033-2046 (1996)
Paszkowski et aL, EMBO J. 3: 2717-2722 (1984)
Payne et aL, Plant MoL Biol. 11:89-94 (1988)
Picard et al., Cell54: 1073-1080 (1988)
Potrykus et al., Mol. Gen. Genet. 199: 169-177 (1985)
Reich et al., Biotechnology 4: 1001-1004 (1986)
Riggs et al, Proc. Natl. Acad. Sci. USA 83:5602-5606 (1986)
Rogers et aL, Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985)
Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993)
Rothstein et al., Gene 53: 153-161 (1987)
Ryals et al., Plant CellB: 1809-1819 (1996)
Ryals et al., Plant Cell 9: 425-439 (1997)
Sambrook et al., Molecular Cloning, eds., Cold Spring Harbor Laboratory Press
(1989)
Sanford et al., Particulate Science and Technology 5:27-37 (1987)
Schmidhauser & Helinski, J. Bacteriol. 164: 446-455 (1985)
Schocher et al., Biotechnology 4: 1093-1096 (1986)
Shimamoto et al., Nature 338: 274-277 (1989)
Shinshi et aL, Plant Molec. Biol. 14: 357-368 (1990)
Shulaev ef al., Plant Cell7: 1691-1701 (1995)
Silhavy, et al., Experiments with Gene Fusions, eds., Cold Spring Harbor
Laboratory Press
(1984)
Singh, D.P., Breeding for Resistance to Diseases and Insect Pests, Springer-
Verlag, NY
(1986)
-54-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Skuzeski et aL, Plant Molec. Biol. 15: 65-79 (1990)
Somers et al., BiolTechnology 10: 1589-1594 (1992)
Spencer et al., Theor. Appl. Genet. 79: 625-631 (1990)
Stanford et al., Mol. Gen. Genet. 215: 200-208 (1989)
Svab et al., Proc. NatL Acad. Sci. USA 87:8526-8530 (1990)
Taylor et al., Plant Cell Rep. 12: 491-495 (1993)
Thompson et al. EMBO J. 6: 2519-2523 (1987)
Torbert et aL, Plant Cell Reports 14: 635-640 (1995)
Triezenberg et al., Genes Devel. 2: 718-729 (1988)
Uknes et al., Plant Cell4: 645-656 (1992)
Uknes et al. Plant Cell s: 159-169 (1993)
Uknes et aG, Molecular Plant Microbe Interactions 6: 680-685 (1993)
Uknes et al., Mol. Plant-Microbe Interact. 6: 692-698 (1993)
Umbeck et al., BiolTechnology 5: 263-266 (1987)
Unger et al., Plant Molec. BioL 13: 411-418 (1989)
van den Broeck, et al., Nature 313: 358-363 (1985)
Vasil et aL, Biotechnology 10: 667-674 (1992)
Vasil et al., Biotechnology 11: 1553-1558 (1993)
Vernooij et aL, Plant Cell 6: 959-965 (1994)
Vernooij et aL, Mol. Plant-Microbe Interact. 8: 228-234 (1995)
Von Heijne et al., Plant MoL Biol. Rep. 9:104-126 (1991 )
Vorst et al., Gene 65: 59 (1988)
Wan et aL, Plant Physiol. 104: 37-48 (1994)
Ward et al., Plant Cell 3: 1085-1094 (1991 )
Warner et al., Plant J. 3: 191-201 (1993)
Wasmann et al., Mol. Gen. Genet. 205: 446-453 (1986)
Weeks et al., Plant Physiol. 102: 1077-1084 (1993)
Weissinger et al., Annual Rev. Genet. 22:421-477 (1988)
Welsh J. R., Fundamentals of Plant Genetics and Breeding, John Wiley & Sons,
NY (1981 )
Weymann et al., Plant Cell7: 2013-2022 (1995)
White et al., Nucl. Acids Res. 18: 1062 (1990)
Wood D. R. (Ed.) Crop Breeding, American Society of Agronomy Madison,
Wisconsin
(1983)
-55-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Wricke and Weber, Quantitative Genetics and Selection Plant Breeding, Walter
de Gruyter
and Co., Berlin (1986)
Xu et al., Plant Molec. Biol. 22: 573-588 (1993)
Zhang et al., Plant Cell Rep. 7: 379-384 (1988)
- 56 -
CA 02365968 2001-09-06
WO 00/53762 - PCT/EP00/01978
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis)
A. The indications made below relate
to the deposited microorganism
or other biological material referred
to in the description
on page 50 , line 19-31
B. IDENTIFICATION OF DEPOSIT Further
deposits are identified on an additional
sheet Q
Name otdepositary institution
Agricultural Research Service Culture
Collection (NRRL)
Address of dcpositary institution
(including postal code and country)
1815 North University Street
Peoria, Illinois 61604
United States of America (USA)
Date of deposit Accession Number
17 August 1998 (17.08.98) NRRL B-30049
C. ADDITIONAL INDICATIONS (leave
blank if not applicable) This information
is continued on an additional sheet
We request the Expert Solution where
available.
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (ijthe indications are
not for al! designated Slates)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable)
The indications listed below will
be submitted to the International
Bureau later (specijythegenerd
nature ojthe iredicatiome.&, Ac~oession
Number ojDepasit'~
For receiving Office use only For Jntanational Bureau use only
This sheet was received with the international application Q This sheet was
received by the International Bureau on:
Authorized officer ~ ~ Authorized offx~
E. S~ ':~~r
Fon» PCT/R01134 (July 1998) - 57 -
CA 02365968 2001-09-06
WO 00/53762 PCT/EP00/01978
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis)
A. The indications made below relate
to the deposited microorganism
or other biological material rcferrcd
to in the description
on page 50 , line 19-31
B. IDENTIFICATION OF DEPOSIT Further
deposits arc identified on an
additional sheet D
Name of dcpositary institution
Agricultural Research Service Culture
Collection (NRRL)
Address of dcpositary institution
(including postal code and country)
1815 North University Street
Peoria, Illinois 61604
United States of America (USA)
Date of deposit , Accession Number
17 August 1998 (17.08.98) NRRL B-30050
G ADDT1'IONAL INDICATIONS (leave
blank if not applicoble) This
infomration is continued on an
additional sheet
We request the Expert Solution
where available.
D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (if the indications
are not jor oll designated SIOIeS)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable)
The indications listed bdow will
be submitted to the lntemational
Bureau later (speefythegeneral
nonoie oJthe indieatioru eg.,
"Ac~acssiorr
Number of Depasit~
For receiving Office use only For international Bureau use only ---
~ This sheet was received with the international application Q This shelf was
received by the lntanational Bureau on:
07
Authorized ofFtccr ~ ~ ~ Authorized officer
c....;
~. ~.~c,Sc~.
Form PCT/ROlI3~ (~aty199a)
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 136is)
A. The indications made below relate
to the deposited microorganism
or other biological material referred
to in the description
on page 50 , line 19-31
B. IDENTIFICATION OF DEPOSIT Further
deposits are idrntified on an additional
sheet
Name of depositary institution
Agricultural Research Service Culture
Collection (NRRL)
Address of depository itutitution
(including postal code and country)
1815 North University Street
Peoria, Illinois 61604
United States of America (USA)
Date of deposit Accession Number
17 August 1998 (17.08.98) NRRL B-30051
C. ADDITIONAL INDICATIONS (leave
blank ijnot applicable) This information
is continued on an additional sheet
We request the Expert Solution where
available.
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (if the indications are
not jor all designated States)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank ijnot applicable)
The indications listed below will
be submitted to the International
Bureau later (spec~thegeneral nature
oftlre indications eg. "Accurion
Number ofDep~it'~
For receiving Office use only For International Bureau ux only
~ This sheet was received with the international application D This sheet was
received by the International Bureau on:
0 7 MAR 2000
Authorized officer 1 1 Authorized offrccr
t. v~,lEiJ ~
Fornt PcrIROrI~~ ~mlylm> - 59 -
CA 02365968 2001-09-06
WO 00/53762 PCT/EP00/01978
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis)
A. The indications made below relate
to the deposited microorganism or
other biological material referred
to in the description
on page 50 , line 19-31
B. IDENTIFICATION OF DEPOSIT Further
deposits are idrntified on an additional
sheet
Name of depository institution
Agricultural Research Service Culture
Collection (NRRLj
Address of depository institution
(including postal code and country)
1815 North University Street
Peoria, Illinois 61604
United States of America (USA)
Date of deposit Accession Number
25 May 1999 (25.05.99) NRRL B-30139
C. ADDITIONAL INDICATIONS (leave
blank if not applicable) This information
is continued on an additional sheet
We request the Expert Solution where
available.
D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (ijtfre indications are
not jar all designated States)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable)
The indications listed below will
be submitted to the International
Bureau later (spec~thegereer~al
nature ojthe indicatiomeg., ~Ac~oessiat
Number 9ft~
For receiving Office use only For International Bureau use only
This sheet was received with the international application ~ This sheet was
received by the International Bureau on:
0 .7 MAR 2000
Authorized officer Authorized oflica
~. spear ~~
Form PCf/ROr134 (luty1993) - 60 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
SEQUENCE LISTING
<110> Novartis AG
<120> NOVEL PLANT GENES AND USES THEREOF
<130> S-30857A/RTP2095
<140>
<141>
<160> 74
<170> PatentIn Ver. 2.1
<210>
1
<211>
1767
<212>
DNA
<213> ianatabacum
Nicot
<220>
<221>
CDS
<222> (1764)
(1)..
<223> length
Full tobacco
cDNA
sequence
<400>
1
atg aatagt aggact gcgttttct gattcgaat gacatcagc gga 48
gat
Met AsnSer ArgThr AlaPheSer AspSerAsn AspIleSer Gly
Asp
1 5 10 15
agc agtata tgctgc atcggcggc ggcatgact gaatttttc tcg 96
agt
Ser SerIle CysCys IleGlyGly GlyMetThr GluPhePhe Ser
Ser
20 25 30
ccg acttcg ccggcg gagatcact tcactgaaa cgcctatcg gaa 144
gag
Pro ThrSer ProAla GluIleThr SerLeuLys ArgLeuSer Glu
Glu
35 40 45
aca gaatct atcttc gatgcgtct ttgccggag tttgactac ttc 192
ctg
Thr GluSer IlePhe AspAlaSer LeuProGlu PheAspTyr Phe
Leu
50 55 60
gcc getaag cttgtg gtttccggc ccgtgtaag gaaattccg gtg 240
gac
Ala AlaLys LeuVal ValSerGly ProCysLys GluIlePro Val
Asp
65 70 75 80
cac tgcatt ttgtcg gcgaggagt ccgttcttt aagaatttg ttc 288
cgg
His CysIle LeuSer AlaArgSer ProPhePhe LysAsnLeu Phe
Arg
85 90 95
tgc aaaaag gagaag aatagtagt aaggtggaa ttgaaggag gtg 336
ggt
Cys LysLys GluLys AsnSerSer LysValGlu LeuLysGlu Val
Gly
100 105 110
atg gagcat gaggtg agctatgat getgtaatg agtgtattg get 384
aaa
Met GluHis GluVal SerTyrAsp AlaValMet SerValLeu Ala
Lys
115 120 125
tat tatagt ggtaaa gttaggcct tcacctaaa gatgtgtgt gtt 432
ttg
Tyr TyrSer GlyLys ValArgPro SerProLys AspValCys Val
Leu
130 135 140
-1 -
W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
tgtgtggac aatgac tgctctcatgtg gettgtagg ccagetgtg gca 480
CysValAsp AsnAsp CysSerHisVal AlaCysArg ProAlaVal Ala
145 150 155 160
ttcctggtt gaggtt ttgtacacatca tttaccttt cagatctct gaa 528
PheLeuVal GluVal LeuTyrThrSer PheThrPhe GlnIleSer Glu
165 170 175
ttggttgac aagttt cagagacaccta ctggatatt cttgacaaa act 576
LeuValAsp LysPhe GlnArgHisLeu LeuAspIle LeuAspLys Thr
180 185 190
gcagcagac gatgta atgatggtttta tctgttgca aacatttgt ggt 624
AlaAlaAsp AspVal MetMetValLeu SerValAla AsnIleCys Gly
195 200 205
aaagca tgcgagaga ttgctttca agctgcatt gagattatt gtcaag 672
LysAla CysGluArg LeuLeuSer SerCysIle GluIleIle ValLys
210 215 220
tctaat gttgatatc ataaccctt gataaagcc ttgcctcat gacatt 720
SerAsn ValAspIle IleThrLeu AspLysAla LeuProHis AspIle
225 230 235 240
gtaaaa caaattact gattcacga gcggaactt ggtctacaa gggcct 768
ValLys GlnIleThr AspSerArg AlaGluLeu GlyLeuGln GlyPro
245 250 255
gaaagc aacggtttt cctgataaa catgttaag aggatacat agggca 816
GluSer AsnGlyPhe ProAspLys HisValLys ArgIleHis ArgAla
260 265 270
ttggat tctgatgat gttgaatta ctacaaatg ttgctaaga gagggg 864
LeuAsp SerAspAsp ValGluLeu LeuGlnMet LeuLeuArg GluGly
275 280 285
catact accctagat gatgcatat getctccat tatgetgta gcgtat 912
HisThr ThrLeuAsp AspAlaTyr AlaLeuHis TyrAlaVal AlaTyr
290 295 300
tgcgat gcaaagact acagcagaa cttctagat cttgcactt getgat 960
CysAsp AlaLysThr ThrAlaGlu LeuLeuAsp LeuAlaLeu AlaAsp
305 310 315 320
attaat catcaaaat tcaagggga tacacggtg ctgcatgtt gcagcc 1008
IleAsn HisGlnAsn SerArgGly TyrThrVal LeuHisVal AlaAla
325 330 335
atgagg aaagagcct aaaattgta gtgtccctt ttaaccaaa ggaget 1056
MetArg LysGluPro LysIleVal ValSerLeu LeuThrLys GlyAla
340 345 350
agacct tctgatctg acatccgat ggaagaaaa gcacttcaa atcgcc 1104
ArgPro SerAspLeu ThrSerAsp GlyArgLys AlaLeuGln IleAla
355 360 365
aagagg ctcactagg cttgtggat ttcagtaag tctccggag gaagga 1152
LysArg LeuThrArg LeuValAsp PheSerLys SerProGlu GluGly
370 375 380
-2-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
aaa tct get tcg aat gat cgg tta tgc att gag att ctg gag caa gca 1200
Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala
385 390 395 400
gaa aga aga gac cct ctg cta gga gaa get tct gta tct ctt get atg 1248
Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Val Ser Leu Ala Met
405 410 415
gca ggc gat gat ttg cgt atg aag ctg tta tac ctt gaa aat aga gtt 1296
Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val
420 425 430
ggc ctg get aaa ctc ctt ttt cca atg gaa get aaa gtt gca atg gac 1344
Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp
435 440 445
att get caa gtt gat ggc act tct gag ttc cca ctg get agc atc ggc 1392
Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Pro Leu Ala Ser Ile Gly
450 455 460
aaa aag atg get aat gca cag agg aca aca gta gat ttg aac gag get 1440
Lys Lys Met Ala Asn Ala Gln Arg Thr Thr Val Asp Leu Asn Glu Ala
465 470 475 480
cct ttc aag ata aaa gag gag cac ttg aat cgg ctt aga gca ctc tct 1488
Pro Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser
485 490 495
aga act gta gaa ctt gga aaa cgc ttc ttt cca cgt tgt tca gaa gtt 1536
Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Glu Val
500 505 510
cta aat aag atc atg gat get gat gac ttg tct gag ata get tac atg 1584
Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met
515 520 525
ggg aat gat acg gca gaa gag cgt caa ctg aag aag caa agg tac atg 1632
Gly Asn Asp Thr Ala Glu Glu Arg Gln Leu Lys Lys Gln Arg Tyr Met
530 535 540
gaa ctt caa gaa att ctg act aaa gca ttc act gag gat aaa gaa gaa 1680
Glu Leu Gln Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu
545 550 555 560
tat gat aag act aac aac atc tcc tca tct tgt tcc tct aca tct aag 1728
Tyr Asp Lys Thr Asn Asn Ile Ser Ser Ser Cys Ser Ser Thr Ser Lys
565 570 575
gga gta gat aag ccc aat aag ctc cct ttt agg aaa tag 1767
Gly Val Asp Lys Pro Asn Lys Leu Pro Phe Arg Lys
580 585
<210> 2
<211> 588
<212> PRT
<213> Nicotiana tabacum
<400> 2
Met Asp Asn Ser Arg Thr Ala Phe Ser Asp Ser Asn Asp Ile Ser Gly
1 5 10 15
-3-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Ser Ser Ser Ile Cys Cys Ile Gly Gly Gly Met Thr Glu Phe Phe Ser
20 25 30
Pro Glu Thr Ser Pro Ala Glu Ile Thr Ser Leu Lys Arg Leu Ser Glu
35 40 45
Thr Leu Glu Ser Ile Phe Asp Ala Ser Leu Pro Glu Phe Asp Tyr Phe
50 55 60
Ala Asp Ala Lys Leu Val Val Ser Gly Pro Cys Lys Glu Ile Pro Val
65 70 75 80
His Arg Cys Ile Leu Ser Ala Arg Ser Pro Phe Phe Lys Asn Leu Phe
85 90 95
Cys Gly Lys Lys Glu Lys Asn Ser Ser Lys Val Glu Leu Lys Glu Val
100 105 110
Met Lys Glu His Glu Val Ser Tyr Asp Ala Val Met Ser Val Leu Ala
115 120 125
Tyr Leu Tyr Ser Gly Lys Val Arg Pro Ser Pro Lys Asp Val Cys Val
130 135 140
Cys Val Asp Asn Asp Cys Ser His Val Ala Cys Arg Pro Ala Val Ala
145 150 155 160
Phe Leu Val Glu Val Leu Tyr Thr Ser Phe Thr Phe Gln Ile Ser Glu
165 170 175
Leu Val Asp Lys Phe Gln Arg His Leu Leu Asp Ile Leu Asp Lys Thr
180 185 190
Ala Ala Asp Asp Val Met Met Val Leu Ser Val Ala Asn Ile Cys Gly
195 200 205
Lys Ala Cys Glu Arg Leu Leu Ser Ser Cys Ile Glu Ile Ile Val Lys
210 215 220
Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ala Leu Pro His Asp Ile
225 230 235 240
Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gln Gly Pro
245 250 255
Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala
260 265 270
Leu Asp Ser Asp Asp Val Glu Leu Leu Gln Met Leu Leu Arg Glu Gly
275 280 285
His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr
290 295 300
Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ala Leu Ala Asp
305 310 315 320
Ile Asn His Gln Asn Ser Arg Gly Tyr Thr Val Leu His Val Ala Ala
325 330 335
-4-
WO 00/53762 CA 02365968 2001-09-06 pCT~, P00/01978
Met Arg Lys Glu Pro Lys Ile Val Val Ser Leu Leu Thr Lys Gly Ala
340 345 350
Arg Pro Ser Asp Leu Thr Ser Asp Gly Arg Lys Ala Leu Gln Ile Ala
355 360 365
Lys Arg Leu Thr Arg Leu Val Asp Phe Ser Lys Ser Pro Glu Glu Gly
370 375 380
Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala
385 390 395 400
Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Val Ser Leu Ala Met
405 410 415
Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val
420 425 430
Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp
435 440 445
Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Pro Leu Ala Ser Ile Gly
450 455 460
Lys Lys Met Ala Asn Ala Gln Arg Thr Thr Val Asp Leu Asn Glu Ala
465 . 470 475 480
Pro Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser
485 490 495
Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Glu Val
500 505 510
Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met
515 520 525
Gly Asn Asp Thr Ala Glu Glu Arg Gln Leu Lys Lys Gln Arg Tyr Met
530 535 540
Glu Leu Gln Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu
545 550 555 560
Tyr Asp Lys Thr Asn Asn Ile Ser Ser Ser Cys Ser Ser Thr Ser Lys
565 570 575
Gly Val Asp Lys Pro Asn Lys Leu Pro Phe Arg Lys
580 585
<210> 3
<211> 1731
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> CDS
<222> (1)..(1728)
<223> Full length tomato cDNA sequence
<400> 3
-5-
WO CA pCT~P00/01978
00/53762 02365968
2001-09-06
atggatagt agaactget ttttcg gattccaat gatattagt ggaagc 48
MetAspSer ArgThrAla PheSer AspSerAsn AspIleSer GlySer
1 5 10 15
agtagtata tgctgcatg aacgaa tcggaaact tcactggca gacgtc 96
SerSerIle CysCysMet AsnGlu SerGluThr SerLeuAla AspVal
20 25 30
aattccctc aaacgtcta tcagaa acactagag tctatcttc gatgcg 144
AsnSerLeu LysArgLeu SerGlu ThrLeuGlu SerIlePhe AspAla
35 40 45
tctgcgccg gatttcgac ttcttc getgatget aagcttctg getcca 192
SerAlaPro AspPheAsp PhePhe AlaAspAla LysLeuLeu AlaPro
50 55 60
ggcggtaag gaaattccg gtgcat cggtgcatt ttgtcggcg aggagt 240
GlyGlyLys GluIlePro ValHis ArgCysIle LeuSerAla ArgSer
65 70 75 80
ccttttttt aagaatgta ttctgt gggaaagat agcagcacg aagctg 288
ProPhePhe LysAsnVal PheCys GlyLysAsp SerSerThr LysLeu
85 90 95
gaactcaaa gagctgatg aaagag tatgaggtg agttttgat gccgtg 336
GluLeuLys GluLeuMet LysGlu TyrGluVal SerPheAsp AlaVal
100 105 110
gtcagtgtg ctcgcctat ttgtat agtggaaaa gttaggcct gcatct 384
ValSerVal LeuAlaTyr LeuTyr SerGlyLys ValArgPro AlaSer
115 120 125
aaagatgtg tgtgtttgt gtggac aatgagtgc ttgcatgta gettgt 432
LysAspVal CysValCys ValAsp AsnGluCys LeuHisVal AlaCys
130 135 140
aggccaget gtggccttc atggtt caggttttg tacgcatcc tttacc 480
ArgProAla ValAlaPhe MetVal GlnValLeu TyrAlaSer PheThr
145 150 155 160
tttcagatc tctcaattg gtcgac aagtttcag agacaccta ttggat 528
PheGlnIle SerGlnLeu ValAsp LysPheGln ArgHisLeu LeuAsp
165 170 175
attcttgac aaagetgta gcagat gatgtaatg atggtttta tccgtt 576
IleLeuAsp LysAlaVal AlaAsp AspValMet MetValLeu SerVal
180 185 190
gcaaacatt tgcggtaaa gcatgt gaaagatta ctttcaaga tgcatt 624
AlaAsnIle CysGlyLys AlaCys GluArgLeu LeuSerArg CysIle
195 200 205
gatattatt gtcaagtct aatgtt gatatcata acccttgat aagtcc 672
AspIleIle ValLysSer AsnVal AspIleIle ThrLeuAsp LysSer
210 215 220
ttgcctcat gacattgta aaacaa atcactgat tcacgtget gaactt 720
LeuProHis AspIleVal LysGln IleThrAsp SerArgAla GluLeu
225 230 235 240
ggtctgcaa gggcctgaa agcaat ggttttcct gataaacat gttaag 768
-6-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys
245 250 255
agg ata cat aga gca ttg gac tct gat gat gtt gaa tta cta agg atg 816
Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met
260 265 270
ttg ctt aaa gag ggg cat act act ctt gat gat gca tat get ctc cac 864
Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His
275 280 285
tat get gta gca tat tgc gat gca aag act aca gca gaa ctt tta gat 912
Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp
290 295 300
ctt tca ctt get gat gtt aat cat caa aat cct aga gga cac acg gta 960
Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val
305 310 315 320
ctt cat gtt get gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt 1008
Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu
325 330 335
tta acc aaa gga get aga cct tct gat ctg aca tcc gat ggc aaa aaa 1056
Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys
340 345 350
gca ctt caa att get aag agg ctc act agg ctt gta gat ttt acc aag 1104
Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys
355 360 365
tct aca gag gaa gga aaa tct get cca aag gat cgg tta tgc att gag 1152
Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu
370 375 380
att ctg gag caa gca gaa aga aga gat cca cta cta gga gaa get tca 1200
Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser
385 390 395 400
tta tct ctt get atg gca ggc gat gat ttg cgt atg aag ctg tta tac 1248
Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr
405 410 415
ctt gaa aat aga gtt ggt ctg get aaa ctc ctt ttt ccc atg gaa gca 1296
Leu Glu Asn Arg Val Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala
420 425 430
aaa gtt gca atg gac att gca caa gtt gat ggc acg tct gaa tta ccc 1344
Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Leu Pro
435 440 445
ctg get agc atg agg aag aag ata get gat gca cag agg aca aca gtg 1392
Leu Ala Ser Met Arg Lys Lys Ile Ala Asp Ala Gln Arg Thr Thr Val
450 455 460
gat ttg aac gag get cct ttc aag atg aaa gag gag cac ttg aat cgg 1440
Asp Leu Asn Glu Ala Pro Phe Lys Met Lys Glu Glu His Leu Asn Arg
465 470 475 480
ctt agg get ctc tct aga act gtg gaa ctt gga aaa cgg ttc ttt cca 1488
Leu Arg Ala Leu Ser Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro
_7_
WO UO/53762 CA 02365968 2001-09-06 pCT/EP~~/01978
485 490 495
cgttgt tcagaagtt ctaaataag atcatg gatgetgat gacttgtct 1536
ArgCys SerGluVal LeuAsnLys IleMet AspAlaAsp AspLeuSer
500 505 510
gagata gettacatg gggaatgat acagta gaagagcgt caactgaag 1584
GluIle AlaTyrMet GlyAsnAsp ThrVal GluGluArg GlnLeuLys
515 520 525
aagcaa aggtacatg gaacttcaa gaaatt ttgtctaaa gcattcacg 1632
LysGln ArgTyrMet GluLeuGln GluIle LeuSerLys AlaPheThr
530 535 540
gaggat aaagaagaa tttgetaag actaac atgtcctca tcttgttcc 1680
GluAsp LysGluGlu PheAlaLys ThrAsn MetSerSer SerCysSer
545 550 555 560
tctaca tctaaggga gtagataag cccaat aatctccca tttaggaaa 1728
SerThr SerLysGly ValAspLys ProAsn AsnLeuPro PheArgLys
565 570 575
tag 1731
<210> 4
<211> 576
<212> PRT
<213> Lycopersicon esculentum
<400> 4
Met Asp Ser Arg Thr Ala Phe Ser Asp Ser Asn Asp Ile Ser Gly Ser
1 5 10 15
Ser Ser Ile Cys Cys Met Asn Glu Ser Glu Thr Ser Leu Ala Asp Val
20 25 30
Asn Ser Leu Lys Arg Leu Ser Glu Thr Leu Glu Ser Ile Phe Asp Ala
35 40 45
Ser Ala Pro Asp Phe Asp Phe Phe Ala Asp Ala Lys Leu Leu Ala Pro
50 55 60
Gly Gly Lys Glu Ile Pro Val His Arg Cys Ile Leu Ser Ala Arg Ser
65 70 75 80
Pro Phe Phe Lys Asn Val Phe Cys Gly Lys Asp Ser Ser Thr Lys Leu
85 90 95
Glu Leu Lys Glu Leu Met Lys Glu Tyr Glu Val Ser Phe Asp Ala Val
100 105 110
Val Ser Val Leu Ala Tyr Leu Tyr Ser Gly Lys Val Arg Pro Ala Ser
115 120 125
Lys Asp Val Cys Val Cys Val Asp Asn Glu Cys Leu His Val Ala Cys
130 135 140
Arg Pro Ala Val Ala Phe Met Val Gln Val Leu Tyr Ala Ser Phe Thr
145 150 155 160
_g_
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Phe Gln Ile Ser Gln Leu Val Asp Lys Phe Gln Arg His Leu Leu Asp
165 170 175
Ile Leu Asp Lys Ala Val Ala Asp Asp Val Met Met Val Leu Ser Val
180 185 190
Ala Asn Ile Cys Gly Lys Ala Cys Glu Arg Leu Leu Ser Arg Cys Ile
195 200 205
Asp Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ser
210 215 220
Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu
225 230 235 240
Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys
245 250 255
Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met
260 265 270
Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His
275 280 285
Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp
290 295 300
Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val
305 310 315 320
Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu
325 330 335
Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys
340 345 350
Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys
355 360 365
Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu
370 375 380
Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser
385 390 395 400
Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr
405 410 415
Leu Glu Asn Arg Val Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala
420 425 430
Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Leu Pro
435 440 445
Leu Ala Ser Met Arg Lys Lys Ile Ala Asp Ala Gln Arg Thr Thr Val
450 455 460
Asp Leu Asn Glu Ala Pro Phe Lys Met Lys Glu Glu His Leu Asn Arg
465 470 475 480
Leu Arg Ala Leu Ser Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro
_g_
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
485 490 495
Arg Cys Ser Glu Val Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser
500 505 510
Glu Ile Ala Tyr Met Gly Asn Asp Thr Val Glu Glu Arg Gln Leu Lys
515 520 525
Lys Gln Arg Tyr Met Glu Leu Gln Glu Ile Leu Ser Lys Ala Phe Thr
530 535 540
Glu Asp Lys Glu Glu Phe Ala Lys Thr Asn Met Ser Ser Ser Cys Ser
545 550 555 560
Ser Thr Ser Lys Gly Val Asp Lys Pro Asn Asn Leu Pro Phe Arg Lys
565 570 575
<210>
<211>
1740
<212>
DNA
<213>
Brassica
napus
<220>
<221>
CDS
<222> (1737)
(1)..
<223>
Canola
cDNA
sequence
<400>
5
atg accattget rgatttgat gatttc tatgagatcagc agcact 48
gag
Met ThrIleAla XaaPheAsp AspPhe TyrGluIleSer SerThr
Glu
1 5 10 15
agc cycgccgca ccggcgcca accgat aactccggatca tccacc 96
ttc
Ser XaaAlaAla ProAlaPro ThrAsp AsnSerGlySer SerThr
Phe
20 25 30
gtc ccgacggag cttytcacc agaccc gaggtatccgcg tttcaa 144
twc
Val ProThrGlu LeuXaaThr ArgPro GluValSerAla PheGln
Xaa
35 40 45
ctc tccaacagc ctcgagtcc gtcttc gactcgccggaa gcgttc 192
ctc
Leu SerAsnSer LeuGluSer ValPhe AspSerProGlu AlaPhe
Leu
50 55 60
tac gacgccaag cttgttctc tccgac gacaaggaagta tccttc 240
agc
Tyr AspAlaLys LeuValLeu SerAsp AspLysGluVal SerPhe
Ser
65 70 75 80
cac tgcattctc tcggcgaga agcctc ttcttcaaggcc getttg 288
cgt
His CysIleLeu SerAlaArg SerLeu PhePheLysAla AlaLeu
Arg
85 90 95
rca gccgagaag gtgcagaag tccacc cccgtgaagctc gagctg 336
gcc
Xaa AlaGluLys ValGlnLys SerThr ProValLysLeu GluLeu
Ala
100 105 110
aag ctcgcggcg gaatacgac gtcggg ttcgattctgtg gtgget 384
aca
Lys LeuAlaAla GluTyrAsp ValGly PheAspSerVal ValAla
Thr
115 120 125
-10-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
gttctggcg tacgtttac agcggcaga gtgaggccg cctccgaag gga 432
ValLeuAla TyrValTyr SerGlyArg ValArgPro ProProLys Gly
130 135 140
gtttctgaa tgcgcagac gakagctgc tgccacgtg gcgtgccgt ccg 480
ValSerGlu CysAlaAsp XaaSerCys CysHisVal AlaCysArg Pro
145 150 155 160
getgtggat ttcatggtg gaggttctc tacttgget ttcgtcttc cag 528
AlaValAsp PheMetVal GluValLeu TyrLeuAla PheValPhe Gln
165 170 175
attcaggaa ctggttacc atgtatcag aggcattta ctggatgtt gta 576
IleGlnGlu LeuValThr MetTyrGln ArgHisLeu LeuAspVal Val
180 185 190
gacaaagtt awcatagaa gacactttg gtcgtcctc aagcttget aac 624
AspLysVal XaaIleGlu AspThrLeu ValValLeu LysLeuAla Asn
195 200 205
atctgcggt aaagcgtgc aagaagcta ttcgataag tgcagagag atc 672
IleCysGly LysAlaCys LysLysLeu PheAspLys CysArgGlu Ile
210 215 220
attgtcaag tctaacgtg gatgttgtt actctaaag aagtcattg cct 720
IleValLys SerAsnVal AspValVal ThrLeuLys LysSerLeu Pro
225 230 235 240
gagracatt gccaagcaa gtaatcgat atccgcaaa gagctcggc ttg 768
GluXaaIle AlaLysGln ValIleAsp IleArgLys GluLeuGly Leu
245 250 255
gaggtaget gaaccagag aaacatgtc tccaacata cacaaggcg ctt 816
GluValAla GluProGlu LysHisVal SerAsnIle HisLysAla Leu
260 265 270
gagtcagac gatcttgac cttgtcgtt atgcttttg aaagagggc cac 864
GluSerAsp AspLeuAsp LeuValVal MetLeuLeu LysGluGly His
275 280 285
acgaatcta gacgaagcg tatgetctc cattttget gttgcgtat tgc 912
ThrAsnLeu AspGluAla TyrAlaLeu HisPheAla ValAlaTyr Cys
290 295 300
gatgagaag acagcgagg aatctcctg gaactgggg tttgcggat gtc 960
AspGluLys ThrAlaArg AsnLeuLeu GluLeuGly PheAlaAsp Val
305 310 315 320
aaccggaga aacccgaga gggtacacg gtaattcac gtcgetgcg atg 1008
AsnArgArg AsnProArg GlyTyrThr ValIleHis ValAlaAla Met
325 330 335
aggaaagag ccgacactg atagcattg ttgttgacg aaagggget aat 1056
ArgLysGlu ProThrLeu IleAlaLeu LeuLeuThr LysGlyAla Asn
340 345 350
gcattagaa atgtctttg gacgggaga actgetctg ttgatcgcg aaa 1104
AlaLeuGlu MetSerLeu AspGlyArg ThrAlaLeu LeuIleAla Lys
355 360 365
-11 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
caagtc actaaggcg gccgagtgt tgtattctg gagaaaggg aagtta 1152
GlnVal ThrLysAla AlaGluCys CysIleLeu GluLysGly LysLeu
370 375 380
getgcc aaaggcgga gtatgtgta gagatactc aagcaacca gacaac 1200
AlaAla LysGlyGly ValCysVal GluIleLeu LysGlnPro AspAsn
385 390 395 400
acacga gaaccattt cctgaagat gtttctccc tcccttgca gtgget 1248
ThrArg GluProPhe ProGluAsp ValSerPro SerLeuAla ValAla
405 410 415
getgat caattcaag ataaggttg attgatctt gaaaacaga gttcaa 1296
AlaAsp GlnPheLys IleArgLeu IleAspLeu GluAsnArg ValGln
420 425 430
atgget cgatgtctc tatccaatg gaagcacaa gttgcaatg gatttc 1344
MetAla ArgCysLeu TyrProMet GluAlaGln ValAlaMet AspPhe
435 440 445
gcccga atgaaggga acacgcgag tttgtcgtg acgacagca actgac 1392
AlaArg MetLysGly ThrArgGlu PheValVal ThrThrAla ThrAsp
450 455 460
ctacac atggaacct ttcaagttc gtagaaatg catcagagt agacta 1440
LeuHis MetGluPro PheLysPhe ValGluMet HisGlnSer ArgLeu
465 470 475 480
acagcg ctttctaaa actgtggaa ttcgggaaa cgcttcttc ccacgc 1488
ThrAla LeuSerLys ThrValGlu PheGlyLys ArgPhePhe ProArg
485 490 495
tgttcg aaagtgctc gatgatatt gtggactct gaggacttg actata 1536
CysSer LysValLeu AspAspIle ValAspSer GluAspLeu ThrIle
500 505 510
ctgget ctcgtagaa gaagacact cctgagcaa cgacaacaa aagagg 1584
LeuAla LeuValGlu GluAspThr ProGluGln ArgGlnGln LysArg
515 520 525
cagagg ttcatggaa atacaggag attgttcaa atggcgttt agtaaa 1632
GlnArg PheMetGlu IleGlnGlu IleValGln MetAlaPhe SerLys
530 535 540
gacaag gaggatctt ggaaagtcg tctctctca gettcgtct tcttcc 1680
AspLys GluAspLeu GlyLysSer SerLeuSer AlaSerSer SerSer
545 550 555 560
acatcc aaattaact ggtaaaaag aggtctatt getaaaccc tctcac 1728
ThrSer LysLeuThr GlyLysLys ArgSerIle AlaLysPro SerHis
565 570 575
cggcgt cggtga 1740
ArgArg Arg
<210>
6
<211>
579
<212>
PRT
<213>
Brassica
napus
-12-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
<400> 6
Met Glu Thr Ile Ala Xaa Phe Asp Asp Phe Tyr Glu Ile Ser Ser Thr
1 5 10 15
Ser Phe Xaa Ala Ala Pro Ala Pro Thr Asp Asn Ser Gly Ser Ser Thr
20 25 30
Val Xaa Pro Thr Glu Leu Xaa Thr Arg Pro Glu Val Ser Ala Phe Gln
35 40 45
Leu Leu Ser Asn Ser Leu Glu Ser Val Phe Asp Ser Pro Glu Ala Phe
50 55 60
Tyr Ser Asp Ala Lys Leu Val Leu Ser Asp Asp Lys Glu Val Ser Phe
65 70 75 80
His Arg Cys Ile Leu Ser Ala Arg Ser Leu Phe Phe Lys Ala Ala Leu
85 90 95
Xaa Ala Ala Glu Lys Val Gln Lys Ser Thr Pro Val Lys Leu Glu Leu
100 105 110
Lys Thr Leu Ala Ala Glu Tyr Asp Val Gly Phe Asp Ser Val Val Ala
115 120 125
Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Pro Pro Pro Lys Gly
130 135 140
Val Ser Glu Cys Ala Asp Xaa Ser Cys Cys His Val Ala Cys Arg Pro
145 150 155 160
Ala Val Asp Phe Met Val Glu Val Leu Tyr Leu Ala Phe Val Phe Gln
165 170 175
Ile Gln Glu Leu Val Thr Met Tyr Gln Arg His Leu Leu Asp Val Val
180 185 190
Asp Lys Val Xaa Ile Glu Asp Thr Leu Val Val Leu Lys Leu Ala Asn
195 200 205
Ile Cys Gly Lys Ala Cys Lys Lys Leu Phe Asp Lys Cys Arg Glu Ile
210 215 220
Ile Val Lys Ser Asn Val Asp Val Val Thr Leu Lys Lys Ser Leu Pro
225 230 235 240
Glu Xaa Ile Ala Lys Gln Val Ile Asp Ile Arg Lys Glu Leu Gly Leu
245 250 255
Glu Val Ala Glu Pro Glu Lys His Val Ser Asn Ile His Lys Ala Leu
260 265 270
Glu Ser Asp Asp Leu Asp Leu Val Val Met Leu Leu Lys Glu Gly His
275 280 285
Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Val Ala Tyr Cys
290 295 300
Asp Glu Lys Thr Ala Arg Asn Leu Leu Glu Leu Gly Phe Ala Asp Val
305 310 315 320
-13-
WO 00/53762 CA 02365968 2001-09-06 pC'T/EP00/01978
Asn Arg Arg Asn Pro Arg Gly Tyr Thr Val Ile His Val Ala Ala Met
325 330 335
Arg Lys Glu Pro Thr Leu Ile Ala Leu Leu Leu Thr Lys Gly Ala Asn
340 345 350
Ala Leu Glu Met Ser Leu Asp Gly Arg Thr Ala Leu Leu Ile Ala Lys
355 360 365
Gln Val Thr Lys Ala Ala Glu Cys Cys Ile Leu Glu Lys Gly Lys Leu
370 375 380
Ala Ala Lys Gly Gly Val Cys Val Glu Ile Leu Lys Gln Pro Asp Asn
385 390 395 400
Thr Arg Glu Pro Phe Pro Glu Asp Val Ser Pro Ser Leu Ala Val Ala
405 410 415
Ala Asp Gln Phe Lys Ile Arg Leu Ile Asp Leu Glu Asn Arg Val Gln
420 425 430
Met Ala Arg Cys Leu Tyr Pro Met Glu Ala Gln Val Ala Met Asp Phe
435 440 445
Ala Arg Met Lys Gly Thr Arg Glu Phe Val Val Thr Thr Ala Thr Asp
450 455 460
Leu His Met Glu Pro Phe Lys Phe Val Glu Met His Gln Ser Arg Leu
465 470 475 480
Thr Ala Leu Ser Lys Thr Val Glu Phe Gly Lys Arg Phe Phe Pro Arg
485 490 495
Cys Ser Lys Val Leu Asp Asp Ile Val Asp Ser Glu Asp Leu Thr Ile
500 505 510
Leu Ala Leu Val Glu Glu Asp Thr Pro Glu Gln Arg Gln Gln Lys Arg
515 520 525
Gln Arg Phe Met Glu Ile Gln Glu Ile Val Gln Met Ala Phe Ser Lys
530 535 540
Asp Lys Glu Asp Leu Gly Lys Ser Ser Leu Ser Ala Ser Ser Ser Ser
545 550 555 560
Thr Ser Lys Leu Thr Gly Lys Lys Arg Ser Ile Ala Lys Pro Ser His
565 570 575
Arg Arg Arg
<210> 7
<211> 1761
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (1)..(1758)
-14-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
<223> AtNMLc5 cDNA sequence
<400>
7
atggetactttg actgagcca tcatcatct ttgagtttc acatcttct 48
MetAlaThrLeu ThrGluPro SerSerSer LeuSerPhe ThrSerSer
1 5 10 15
catttctcttat ggttctatt gggtccaat cacttctca tcaagctca 96
HisPheSerTyr GlySerIle GlySerAsn HisPheSer SerSerSer
20 25 30
gettctaatcct gaagttgtt agtctaacc aaactcagc tccaatctt 144
AlaSerAsnPro GluValVal SerLeuThr LysLeuSer SerAsnLeu
35 40 45
gagcagcttctt agtaattca gattgtgat tacagtgat gcagagatc 192
GluGlnLeuLeu SerAsnSer AspCysAsp TyrSerAsp AlaGluIle
50 55 60
attgttgatggt gttccagtt ggtgttcat agatgcatt ttagetgca 240
IleValAspGly ValProVal GlyValHis ArgCysIle LeuAlaAla
65 70 75 80
agaagtaagttt ttccaagat ttgtttaag aaagaaaag aaaatttcg 288
ArgSerLysPhe PheGlnAsp LeuPheLys LysGluLys LysIleSer
85 90 95
aaaactgagaaa ccaaagtat cagttgaga gagatgtta ccttatgga 336
LysThrGluLys ProLysTyr GlnLeuArg GluMetLeu ProTyrGly
100 105 110
getgttgetcat gaagetttc ttgtatttc ttgagttat atatatact 384
AlaValAlaHis GluAlaPhe LeuTyrPhe LeuSerTyr IleTyrThr
115 120 125
gggagattaaag ccttttcca ttggaggtt tcgacttgt gttgatcca 432
GlyArgLeuLys ProPhePro LeuGluVal SerThrCys ValAspPro
130 135 140
gtttgttctcat gattgttgt cgacctgcc attgatttt gttgttcaa 480
ValCysSerHis AspCysCys ArgProAla IleAspPhe ValValGln
145 150 155 160
ttgatgtatget tcctctgtt ctccaagtg cctgagcta gtttcatct 528
LeuMetTyrAla SerSerVal LeuGlnVal ProGluLeu ValSerSer
165 170 175
tttcagcggcgg ctttgtaac tttgtggag aagaccctt gttgagaat 576
PheGlnArgArg LeuCysAsn PheValGlu LysThrLeu ValGluAsn
180 185 190
gttcttcccatt cttatggtt getttcaat tgtaagttg actcagctt 624
ValLeuProIle LeuMetVal AlaPheAsn CysLysLeu ThrGlnLeu
195 200 205
cttgatcagtgt attgagaga gtggcgagg tcagatctt tacaggttc 672
LeuAspGlnCys IleGluArg ValAlaArg SerAspLeu TyrArgPhe
210 215 220
tgtattgaaaag gaagttcct cccgaagta gcagagaag attaaacag 720
CysIleGluLys GluValPro ProGluVal AlaGluLys IleLysGln
-15-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
225 230 235 240
cttcgacttata tccccgcaa gacgaagaa accagtccc aagatttcg 768
LeuArgLeuIle SerProGln AspGluGlu ThrSerPro LysIleSer
245 250 255
gagaaattgctt gaaagaatc ggtaaaatt ctcaaggcc ttggattca 816
GluLysLeuLeu GluArgIle GlyLysIle LeuLysAla LeuAspSer
260 265 270
gatgatgttgag cttgtgaag cttcttttg actgagtca gatatcact 864
AspAspValGlu LeuValLys LeuLeuLeu ThrGluSer AspIleThr
275 280 285
ctagatcaagcc aatggtctg cattattct gttgtgtat agtgatccg 912
LeuAspGlnAla AsnGlyLeu HisTyrSer ValValTyr SerAspPro
290 295 300
aaagttgttgcc gagattctt getctggat atgggtgat gtgaactac 960
LysValValAla GluIleLeu AlaLeuAsp MetGlyAsp ValAsnTyr
305 310 315 320
aggaattcccgg ggttacacg gttcttcat tttgetgcg atgcgtaga 1008
ArgAsnSerArg GlyTyrThr ValLeuHis PheAlaAla MetArgArg
325 330 335
gagccatcgatc attatatcg cttatcgat aaaggcgcc aatgcatct 1056
GluProSerIle IleIleSer LeuIleAsp LysGlyAla AsnAlaSer
340 345 350
gagtttacatct gacggacgc agcgcagtt aatatattg agaagactg 1104
GluPheThrSer AspGlyArg SerAlaVal AsnIleLeu ArgArgLeu
355 360 365
acaaatccaaag gattatcat accaaaaca gcaaaaggg cgtgaatct 1152
ThrAsnProLys AspTyrHis ThrLysThr AlaLysGly ArgGluSer
370 375 380
agtaaggccagg ctatgcatc gatatattg gaaagagaa atcaggaag 1200
SerLysAlaArg LeuCysIle AspIleLeu GluArgGlu IleArgLys
385 390 395 400
aaccccatggtt ctagataca ccaatgtgt tccatttct atgcctgaa 1248
AsnProMetVal LeuAspThr ProMetCys SerIleSer MetProGlu
405 410 415
gatctccagatg agactgttg tacctagaa aagagagtg ggtcttget 1296
AspLeuGlnMet ArgLeuLeu TyrLeuGlu LysArgVal GlyLeuAla
420 425 430
cagttgttcttt ccaacggaa getaaagtg getatggac attggtaac 1344
GlnLeuPhePhe ProThrGlu AlaLysVal AlaMetAsp IleGlyAsn
435 440 445
gtagaaggtaca agtgagttc acagggttg tcacctcct tcaagtggg 1392
ValGluGlyThr SerGluPhe ThrGlyLeu SerProPro SerSerGly
450 455 460
ttaaccggaaac ttgagtcag gttgattta aacgaaact cctcatatg 1440
LeuThrGlyAsn LeuSerGln ValAspLeu AsnGluThr ProHisMet
465 470 475 480
-16-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
caaacccaaaga cttcttact cgtatg gtggetcta atgaaaaca gtt 1488
GlnThrGlnArg LeuLeuThr ArgMet ValAlaLeu MetLysThr Val
485 490 495
gagactggtcga aggtttttt ccatat ggttcagag gttctagat aag 1536
GluThrGlyArg ArgPhePhe ProTyr GlySerGlu ValLeuAsp Lys
500 505 510
tacatggetgag tatatagac gacgac atcctcgac gatttccat ttt 1584
TyrMetAlaGlu TyrIleAsp AspAsp IleLeuAsp AspPheHis Phe
515 520 525
gagaagggatct acacatgaa agaaga ttgaaaaga atgagatat aga 1632
GluLysGlySer ThrHisGlu ArgArg LeuLysArg MetArgTyr Arg
530 535 540
gagcttaaggat gatgtccaa aaggca tatagcaaa gacaaagag tct 1680
GluLeuLysAsp AspValGln LysAla TyrSerLys AspLysGlu Ser
545 550 555 560
aagattgcgcgg tcttgtctt tctget tcatcttct ccttcttct tct 1728
LysIleAlaArg SerCysLeu SerAla SerSerSer ProSerSer Ser
565 570 575
tccataagagat gatctgcac aacaca acatga 1761
SerIleArgAsp AspLeuHis AsnThr Thr
580 585
<210> 8
<211> 586
<212> PRT
<213> Arabidopsis thaliana
<400> 8
Met Ala Thr Leu Thr Glu Pro Ser Ser Ser Leu Ser Phe Thr Ser Ser
1 5 10 15
His Phe Ser Tyr Gly Ser Ile Gly Ser Asn His Phe Ser Ser Ser Ser
20 25 30
Ala Ser Asn Pro Glu Val Val Ser Leu Thr Lys Leu Ser Ser Asn Leu
35 40 45
Glu Gln Leu Leu Ser Asn Ser Asp Cys Asp Tyr Ser Asp Ala Glu Ile
50 55 60
Ile Val Asp Gly Val Pro Val Gly Val His Arg Cys Ile Leu Ala Ala
65 70 75 80
Arg Ser Lys Phe Phe Gln Asp Leu Phe Lys Lys Glu Lys Lys Ile Ser
85 90 95
Lys Thr Glu Lys Pro Lys Tyr Gln Leu Arg Glu Met Leu Pro Tyr Gly
100 105 110
Ala Val Ala His Glu Ala Phe Leu Tyr Phe Leu Ser Tyr Ile Tyr Thr
115 120 125
Gly Arg Leu Lys Pro Phe Pro Leu Glu Val Ser Thr Cys Val Asp Pro
-17-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
130 135 140
Val Cys Ser His Asp Cys Cys Arg Pro Ala Ile Asp Phe Val Val Gln
145 150 155 160
Leu Met Tyr Ala Ser Ser Val Leu Gln Val Pro Glu Leu Val Ser Ser
165 170 175
Phe Gln Arg Arg Leu Cys Asn Phe Val Glu Lys Thr Leu Val Glu Asn
180 185 190
Val Leu Pro Ile Leu Met Val Ala Phe Asn Cys Lys Leu Thr Gln Leu
195 200 205
Leu Asp Gln Cys Ile Glu Arg Val Ala Arg Ser Asp Leu Tyr Arg Phe
210 215 220
Cys Ile Glu Lys Glu Val Pro Pro Glu Val Ala Glu Lys Ile Lys Gln
225 230 235 240
Leu Arg Leu Ile Ser Pro Gln Asp Glu Glu Thr Ser Pro Lys Ile Ser
245 250 255
Glu Lys Leu Leu Glu Arg Ile Gly Lys Ile Leu Lys Ala Leu Asp Ser
260 265 270
Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr
275 280 285
Leu Asp Gln Ala Asn Gly Leu His Tyr Ser Val Val Tyr Ser Asp Pro
290 295 300
Lys Val Val Ala Glu Ile Leu Ala Leu Asp Met Gly Asp Val Asn Tyr
305 310 315 320
Arg Asn Ser Arg Gly Tyr Thr Val Leu His Phe Ala Ala Met Arg Arg
325 330 335
Glu Pro Ser Ile Ile Ile Ser Leu Ile Asp Lys Gly Ala Asn Ala Ser
340 345 350
Glu Phe Thr Ser Asp Gly Arg Ser Ala Val Asn Ile Leu Arg Arg Leu
355 360 365
Thr Asn Pro Lys Asp Tyr His Thr Lys Thr Ala Lys Gly Arg Glu Ser
370 375 380
Ser Lys Ala Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Lys
385 390 395 400
Asn Pro Met Val Leu Asp Thr Pro Met Cys Ser Ile Ser Met Pro Glu
405 410 415
Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Lys Arg Val Gly Leu Ala
420 425 430
Gln Leu Phe Phe Pro Thr Glu Ala Lys Val Ala Met Asp Ile Gly Asn
435 440 445
Val Glu Gly Thr Ser Glu Phe Thr Gly Leu Ser Pro Pro Ser Ser Gly
450 455 460
_18_
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Leu Thr Gly Asn Leu Ser Gln Val Asp Leu Asn Glu Thr Pro His Met
465 470 475 480
Gln Thr Gln Arg Leu Leu Thr Arg Met Val Ala Leu Met Lys Thr Val
485 490 495
Glu Thr Gly Arg Arg Phe Phe Pro Tyr Gly Ser Glu Val Leu Asp Lys
500 505 510
Tyr Met Ala Glu Tyr Ile Asp Asp Asp Ile Leu Asp Asp Phe His Phe
515 520 525
Glu Lys Gly Ser Thr His Glu Arg Arg Leu Lys Arg Met Arg Tyr Arg
530 535 540
Glu Leu Lys Asp Asp Val Gln Lys Ala Tyr Ser Lys Asp Lys Glu Ser
545 550 555 560
Lys Ile Ala Arg Ser Cys Leu Ser Ala Ser Ser Ser Pro Ser Ser Ser
565 570 575
Ser Ile Arg Asp Asp Leu His Asn Thr Thr
580 585
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 9
agattattgt caagtctaat g 21
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 10
ttccatgtac ctttgcttc 19
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 11
gcggatccat ggataatagt agg 23
-19-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 12
gcggatccta tttcctaaaa ggg 23
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 13
tcaaggcctt ggattcagat g 21
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR Primer
<400> 14
attaactgcg ctacgtccgt c 21
<210> 15
<211> 1477
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (1)..(1476)
<223> AtNMLc2 genomic sequence
<400> 15
atg agc aat ctt gaa gaa tct ttg aga tct cta tcg ttg gat ttc ctg 48
Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu
1 5 10 15
aac cta cta atc aac ggt caa get ttc tcc gac gtg act ttc agc gtt 96
Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val
20 25 30
gaa ggt cgt tta gtc cac get cac cgt tgt atc ctc gcc gca cgg agt 144
Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser
35 40 45
- 20 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
cttttcttccgc aaattcttt tgtgggaca gactcacca caacctgtc 192
LeuPhePheArg LysPhePhe CysGlyThr AspSerPro GlnProVal
50 55 60
acaggtatagac ccgacccaa catgggtcc gtacccget agcccaaca 240
ThrGlyIleAsp ProThrGln HisGlySer ValProAla SerProThr
65 70 75 80
agaggctccacg gccccaget ggaattata ccagtgaac tcagtcggt 288
ArgGlySerThr AlaProAla GlyIleIle ProValAsn SerValGly
85 90 95
tatgaggttttt ctgttgcta cttcagttt ctttatagc ggacaagtc 336
TyrGluValPhe LeuLeuLeu LeuGlnPhe LeuTyrSer GlyGlnVal
100 105 110
tccatcgtgccg cagaaacac gagcctaga cctaattgt ggcgagaga 384
SerIleValPro GlnLysHis GluProArg ProAsnCys GlyGluArg
115 120 125
ggatgttggcac actcattgc tcagccgcc gttgatctt getcttgat 432
GlyCysTrpHis ThrHisCys SerAlaAla ValAspLeu AlaLeuAsp
130 135 140
actctcgccgcc tctcgttac ttcggcgtc gagcagctc gcattgctc 480
ThrLeuAlaAla SerArgTyr PheGlyVal GluGlnLeu AlaLeuLeu
145 150 155 160
acccagaaacaa ttggcaagc atggtggag aaagcctct atcgaagat 528
ThrGlnLysGln LeuAlaSer MetValGlu LysAlaSer IleGluAsp
165 170 175
gtgatgaaagtt ttaatagca tcaagaaag caagacatg catcaatta 576
ValMetLysVal LeuIleAla SerArgLys GlnAspMet HisGlnLeu
180 185 190
tggaccacctgc tctcactta gttatgagc aatcttgaa gaatctttg 624
TrpThrThrCys SerHisLeu ValMetSer AsnLeuGlu GluSerLeu
195 200 205
agatctctatcg ttggatttc ctgaaccta ctaatcaac ggtcaaget 672
ArgSerLeuSer LeuAspPhe LeuAsnLeu LeuIleAsn GlyGlnAla
210 215 220
ttctccgacgtg actttcagc gttgaaggt cgtttagtc cacgetcac 720
PheSerAspVal ThrPheSer ValGluGly ArgLeuVal HisAlaHis
225 230 235 240
cgttgtatcctc gccgcacgg agtcttttc ttccgcaaa ttcttttgt 768
ArgCysIleLeu AlaAlaArg SerLeuPhe PheArgLys PhePheCys
245 250 255
gggacagactca ccacaacct gtcacaggt atagacccg acccaacat 816
GlyThrAspSer ProGlnPro ValThrGly IleAspPro ThrGlnHis
260 265 270
gggtccgtaccc getagccca acaagaggc tccacggcc ccagetgga 864
GlySerValPro AlaSerPro ThrArgGly SerThrAla ProAlaGly
275 280 285
att ata cca gtg aac tca gtc ggt tat gag gtt ttt ctg ttg cta ctt 912
-21 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
IleIleProVal AsnSerVal GlyTyrGlu ValPhe LeuLeuLeu Leu
290 295 300
cagtttctttat agcggacaa gtctccatc gtgccg cagaaacac gag 960
GlnPheLeuTyr SerGlyGln ValSerIle ValPro GlnLysHis Glu
305 310 315 320
cctagacctaat tgtggcgag agaggatgt tggcac actcattgc tca 1008
ProArgProAsn CysGlyGlu ArgGlyCys TrpHis ThrHisCys Ser
325 330 335
gccgccgttgat cttgetctt gatactctc gccgcc tctcgttac ttc 1056
AlaAlaValAsp LeuAlaLeu AspThrLeu AlaAla SerArgTyr Phe
340 345 350
ggcgtcgagcag ctcgcattg ctcacccag aaacaa ttggcaagc atg 1104
GlyValGluGln LeuAlaLeu LeuThrGln LysGln LeuAlaSer Met
355 360 365
gtggagaaagcc tctatcgaa gatgtgatg aaagtt ttaatagca tca 1152
ValGluLysAla SerIleGlu AspValMet LysVal LeuIleAla Ser
370 375 380
agaaagcaagac atgcatcaa ttatggacc acctgc tctcactta gtt 1200
ArgLysGlnAsp MetHisGln LeuTrpThr ThrCys SerHisLeu Val
385 390 395 400
atgagcaatctt gaagaatct ttgagatct ctatcg ttggatttc ctg 1248
MetSerAsnLeu GluGluSer LeuArgSer LeuSer LeuAspPhe Leu
405 410 415
aacctactaatc aacggtcaa getttctcc gacgtg actttcagc gtt 1296
AsnLeuLeuIle AsnGlyGln AlaPheSer AspVal ThrPheSer Val
420 425 430
gaaggtcgttta gtccacget caccgttgt atcctc gccgcacgg agt 1344
GluGlyArgLeu ValHisAla HisArgCys IleLeu AlaAlaArg Ser
435 440 445
cttttcttccgc aaattcttt tgtgggaca gactca ccacaacct gtc 1392
LeuPhePheArg LysPhePhe CysGlyThr AspSer ProGlnPro Val
450 455 460
acaggtatagac ccgacccaa catgggtcc gtaccc getagccca aca 1440
ThrGlyIleAsp ProThrGln HisGlySer ValPro AlaSerPro Thr
465 470 475 480
agaggctccacg gccccaget ggaattata ccagtg a 1477
ArgGlySerThr AlaProAla GlyIleIle ProVal
485 490
<210>
16
<211> 2
49
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 16
Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu
1 5 10 15
-22-
WO 00/53762 CA 02365968 2001-09-06 pCT~, P00/01978
Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val
20 25 30
Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser
35 40 45
Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val
50 55 60
Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr
65 70 75 80
Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val Asn Ser Val Gly
85 90 95
Tyr Glu Val Phe Leu Leu Leu Leu Gln Phe Leu Tyr Ser Gly Gln Val
100 105 110
Ser Ile Val Pro Gln Lys His Glu Pro Arg Pro Asn Cys Gly Glu Arg
115 120 125
Gly Cys Trp His Thr His Cys Ser Ala Ala Val Asp Leu Ala Leu Asp
130 135 140
Thr Leu Ala Ala Ser Arg Tyr Phe Gly Val Glu Gln Leu Ala Leu Leu
145 150 155 160
Thr Gln Lys Gln Leu Ala Ser Met Val Glu Lys Ala Ser Ile Glu Asp
165 170 175
Val Met Lys Val Leu Ile Ala Ser Arg Lys Gln Asp Met His Gln Leu
180 185 190
Trp Thr Thr Cys Ser His Leu Val Met Ser Asn Leu Glu Glu Ser Leu
195 200 205
Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gln Ala
210 215 220
Phe Ser Asp Val Thr Phe Ser Val Glu Gly Arg Leu Val His Ala His
225 230 235 240
Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys
245 250 255
Gly Thr Asp Ser Pro Gln Pro Val Thr Gly Ile Asp Pro Thr Gln His
260 265 270
Gly Ser Val Pro Ala Ser Pro Thr Arg Gly Ser Thr Ala Pro Ala Gly
275 280 285
Ile Ile Pro Val Asn Ser Val Gly Tyr Glu Val Phe Leu Leu Leu Leu
290 295 300
Gln Phe Leu Tyr Ser Gly Gln Val Ser Ile Val Pro Gln Lys His Glu
305 310 315 320
Pro Arg Pro Asn Cys Gly Glu Arg Gly Cys Trp His Thr His Cys Ser
325 330 335
Ala Ala Val Asp Leu Ala Leu Asp Thr Leu Ala Ala Ser Arg Tyr Phe
-23-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
340 345 350
Gly Val Glu Gln Leu Ala Leu Leu Thr Gln Lys Gln Leu Ala Ser Met
355 360 365
Val Glu Lys Ala Ser Ile Glu Asp Val Met Lys Val Leu Ile Ala Ser
370 375 380
Arg Lys Gln Asp Met His Gln Leu Trp Thr Thr Cys Ser His Leu Val
385 390 395 400
Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu
405 410 415
Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val
420 425 430
Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser
435 440 445
Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val
450 455 460
Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr
465 470 475 480
Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val
485 490
<210>
17
<211>
1804
<212>
DNA
<213>
Arabidopsis
thaliana
<220>
<221>
CDS
<222> (1803)
(1)..
<223> genomic sequence
AtNMLc4-1
<400>
17
atg get act gcaatagag ccatct tcatctata agtttcaca tct 48
gca
Met Ala Thr AlaIleGlu ProSer SerSerIle SerPheThr Ser
Ala
1 5 10 15
tct cac tca aacccttct cctgtt gttactact tatcactca get 96
tta
Ser His Ser AsnProSer ProVal ValThrThr TyrHisSer Ala
Leu
20 25 30
get aat gaa gagctcagc tctaac ttggagcag cttctcact aat 144
ctt
Ala Asn Glu GluLeuSer SerAsn LeuGluGln LeuLeuThr Asn
Leu
35 40 45
cca gat gat tacactgac gcagag atcatcatt gaagaagaa get 192
tgc
Pro Asp Asp TyrThrAsp AlaGlu IleIleIle GluGluGlu Ala
Cys
50 55 60
aac cct agt gttcataga tgtgtt ttagetget aggagcaag ttt 240
gtg
Asn Pro Ser ValHisArg CysVal LeuAlaAla ArgSerLys Phe
Val
65 70 75 80
-24-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
tttcttgatctg tttaagaaa gataaagat agtagtgag aagaaacct 288
PheLeuAspLeu PheLysLys AspLysAsp SerSerGlu LysLysPro
85 90 95
aagtatcaaatg aaagattta ttaccatat ggaaatgtg ggacgtgag 336
LysTyrGlnMet LysAspLeu LeuProTyr GlyAsnVal GlyArgGlu
100 105 110
gcatttctgcat ttcttgagc tatatctac actgggagg ttaaagcct 384
AlaPheLeuHis PheLeuSer TyrIleTyr ThrGlyArg LeuLysPro
115 120 125
tttcctatcgag gtttcaact tgtgttgat tcagtttgt getcatgat 432
PheProIleGlu ValSerThr CysValAsp SerValCys AlaHisAsp
130 135 140
tcttgtaaaccg gccattgat tttgetgtt gagttgatg tatgettca 480
SerCysLysPro AlaIleAsp PheAlaVal GluLeuMet TyrAlaSer
145 150 155 160
tttgtgttccaa atcccggat cttgtttcg tcatttcag cggaagctt 528
PheValPheGln IleProAsp LeuValSer SerPheGln ArgLysLeu
165 170 175
cgtaactatgtt gagaagtca ctagtagag aatgttctt cctatcctc 576
ArgAsnTyrVal GluLysSer LeuValGlu AsnValLeu ProIleLeu
180 185 190
ttagttgcgttt cattgtgat ttgacacag cttcttgat caatgcatt 624
LeuValAlaPhe HisCysAsp LeuThrGln LeuLeuAsp GlnCysIle
195 200 205
gagagagtggcg agatcagac ttagacaga ttctgtatc gaaaaggag 672
GluArgValAla ArgSerAsp LeuAspArg PheCysIle GluLysGlu
210 215 220
cttcctttagaa gtattggaa aaaatcaaa cagcttcga gttaagtcg 720
LeuProLeuGlu ValLeuGlu LysIleLys GlnLeuArg ValLysSer
225 230 235 240
gtgaacataccc gaggtggag gataaatcg atagagaga acagggaaa 768
ValAsnIlePro GluValGlu AspLysSer IleGluArg ThrGlyLys
245 250 255
gtactcaaggca ttggattca gatgatgta gaactcgtg aagcttctt 816
ValLeuLysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu
260 265 270
ttgactgagtca gatataact ctagaccaa gccaatggt ctacattat 864
LeuThrGluSer AspIleThr LeuAspGln AlaAsnGly LeuHisTyr
275 280 285
gcagtggcatac agtgatccg aaagttgtg acacaggtt cttgatcta 912
AlaValAlaTyr SerAspPro LysValVal ThrGlnVal LeuAspLeu
290 295 300
gatatggetgat gttaatttc agaaattcc agggggtat acggttctt 960
AspMetAlaAsp ValAsnPhe ArgAsnSer ArgGlyTyr ThrValLeu
305 310 315 320
-25-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
catattgetgetatg cgtaga gagccaaca attatcatacca cttatt 1008
HisIleAlaAlaMet ArgArg GluProThr IleIleIlePro LeuIle
325 330 335
caaaaaggagetaat gettca gatttcacg tttgatggacgc agtgcg 1056
GlnLysGlyAlaAsn AlaSer AspPheThr PheAspGlyArg SerAla
340 345 350
gtaaatatatgtagg agactc actaggccg aaagattatcat accaaa 1104
ValAsnIleCysArg ArgLeu ThrArgPro LysAspTyrHis ThrLys
355 360 365
acctcaaggaaagaa cctagt aaataccgc ttatgcatcgat atcttg 1152
ThrSerArgLysGlu ProSer LysTyrArg LeuCysIleAsp IleLeu
370 375 380
gaaagggaaattaga aggaat ccattggtt agtggggataca cccact 1200
GluArgGluIleArg ArgAsn ProLeuVal SerGlyAspThr ProThr
385 390 395 400
tgttcccattcgatg cccgag gatctccaa atgaggttgtta tactta 1248
CysSerHisSerMet ProGlu AspLeuGln MetArgLeuLeu TyrLeu
405 410 415
gaaaagcgatgggac ttgcgt cagttgttc ttcccagcagaa gccaat 1296
GluLysArgTrpAsp LeuArg GlnLeuPhe PheProAlaGlu AlaAsn
420 425 430
gtggetatggacgtt getaat gttgaaggg acaagcgagtgc acaggt 1344
ValAlaMetAspVal AlaAsn ValGluGly ThrSerGluCys ThrGly
435 440 445
cttctaactccacct ccatca aatgataca actgaaaacttg ggtaaa 1392
LeuLeuThrProPro ProSer AsnAspThr ThrGluAsnLeu GlyLys
450 455 460
gtcgatttaaatgaa acgcct tatgtgcaa acgaaaagaatg cttaca 1440
ValAspLeuAsnGlu ThrPro TyrValGln ThrLysArgMet LeuThr
465 470 475 480
cgtatgaaagccctc atgaaa acaggtaaa agcttaaggaaa tgtact 1488
ArgMetLysAlaLeu MetLys ThrGlyLys SerLeuArgLys CysThr
485 490 495
ttcaagttttattct ctgacc acaagattg actgattcgaaa ccgttc 1536
PheLysPheTyrSer LeuThr ThrArgLeu ThrAspSerLys ProPhe
500 505 510
aacaacgcagttgag acaggt cggagatac ttcccatcttgt tatgag 1584
AsnAsnAlaValGlu ThrGly ArgArgTyr PheProSerCys TyrGlu
515 520 525
gttctggataagtac atggat cagtatatg gacgaagaaatc cctgat 1632
ValLeuAspLysTyr MetAsp GlnTyrMet AspGluGluIle ProAsp
530 535 540
atgtcgtatcccgag aaaggc actgtgaaa gagagaagacag aagagg 1680
MetSerTyrProGlu LysGly ThrValLys GluArgArgGln LysArg
545 550 555 560
atg aga tat aac gag ctg aag aac gac gtt aaa aaa gca tat agc aaa 1728
-26-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys Lys Ala Tyr Ser Lys
565 570 575
gac aaa gtc gcg cgg tct tgt ctt tct tct tca tca cca get tct tct 1776
Asp Lys Val Ala Arg Ser Cys Leu Ser Ser Ser Ser Pro Ala Ser Ser
580 585 590
ctt aga gaa gcc tta gag aat cca aca t 1804
Leu Arg Glu Ala Leu Glu Asn Pro Thr
595 600
<210> 18
<211> 601
<212> PRT
<213> Arabidopsis thaliana
<400> 18
Met Ala Ala Thr Ala Ile Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser
1 5 10 15
Ser His Leu Ser Asn Pro Ser Pro Val Val Thr Thr Tyr His Ser Ala
20 25 30
Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gln Leu Leu Thr Asn
35 40 45
Pro Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala
50 55 60
Asn Pro Val Ser Val His Arg Cys Val Leu Ala Ala Arg Ser Lys Phe
65 70 75 80
Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys Pro
85 90 95
Lys Tyr Gln Met Lys Asp Leu Leu Pro Tyr Gly Asn Val Gly Arg Glu
100 105 110
Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys Pro
115 120 125
Phe Pro Ile Glu Val Ser Thr Cys Val Asp Ser Val Cys Ala His Asp
130 135 140
Ser Cys Lys Pro Ala Ile Asp Phe Ala Val Glu Leu Met Tyr Ala Ser
145 150 155 160
Phe Val Phe Gln Ile Pro Asp Leu Val Ser Ser Phe Gln Arg Lys Leu
165 170 175
Arg Asn Tyr Val Glu Lys Ser Leu Val Glu Asn Val Leu Pro Ile Leu
180 185 190
Leu Val Ala Phe His Cys Asp Leu Thr Gln Leu Leu Asp Gln Cys Ile
195 200 205
Glu Arg Val Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu
210 215 220
Leu Pro Leu Glu Val Leu Glu Lys Ile Lys Gln Leu Arg Val Lys Ser
-27-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
225 230 235 240
Val Asn Ile Pro Glu Val Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys
245 250 255
Val Leu Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu
260 265 270
Leu Thr Glu Ser Asp Ile Thr Leu Asp Gln Ala Asn Gly Leu His Tyr
275 280 285
Ala Val Ala Tyr Ser Asp Pro Lys Val Val Thr Gln Val Leu Asp Leu
290 295 300
Asp Met Ala Asp Val Asn Phe Arg Asn Ser Arg Gly Tyr Thr Val Leu
305 310 315 320
His Ile Ala Ala Met Arg Arg Glu Pro Thr Ile Ile Ile Pro Leu Ile
325 330 335
Gln Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala
340 345 350
Val Asn Ile Cys Arg Arg Leu Thr Arg Pro Lys Asp Tyr His Thr Lys
355 360 365
Thr Ser Arg Lys Glu Pro Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu
370 375 380
Glu Arg Glu Ile Arg Arg Asn Pro Leu Val Ser Gly Asp Thr Pro Thr
385 390 395 400
Cys Ser His Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu
405 410 415
Glu Lys Arg Trp Asp Leu Arg Gln Leu Phe Phe Pro Ala Glu Ala Asn
420 425 430
Val Ala Met Asp Val Ala Asn Val Glu Gly Thr Ser Glu Cys Thr Gly
435 440 445
Leu Leu Thr Pro Pro Pro Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys
450 455 460
Val Asp Leu Asn Glu Thr Pro Tyr Val Gln Thr Lys Arg Met Leu Thr
465 470 475 480
Arg Met Lys Ala Leu Met Lys Thr Gly Lys Ser Leu Arg Lys Cys Thr
485 490 495
Phe Lys Phe Tyr Ser Leu Thr Thr Arg Leu Thr Asp Ser Lys Pro Phe
500 505 510
Asn Asn Ala Val Glu Thr Gly Arg Arg Tyr Phe Pro Ser Cys Tyr Glu
515 520 525
Val Leu Asp Lys Tyr Met Asp Gln Tyr Met Asp Glu Glu Ile Pro Asp
530 535 540
Met Ser Tyr Pro Glu Lys Gly Thr Val Lys Glu Arg Arg Gln Lys Arg
545 550 555 560
-28-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys Lys Ala Tyr Ser Lys
565 570 575
AspLysValAla ArgSerCys LeuSerSer SerSer ProAlaSer Ser
580 585 590
LeuArgGluAla LeuGluAsn ProThr
595 600
<210>
19
<211> 03
18
<212>
DNA
<213>
Arabidopsis
thaliana
<220>
<221>
CDS
<222> )..(1803)
(1
<223> NMLc4-2 genomic sequence
At
<400>
19
atggccaccacc accaccacc accaccget agattc tctgattca tac 48
MetAlaThrThr ThrThrThr ThrThrAla ArgPhe SerAspSer Tyr
1 5 10 15
gagttcagcaac acaagcggc aatagcttc ttcgcc gccgagtca tct 96
GluPheSerAsn ThrSerGly AsnSerPhe PheAla AlaGluSer Ser
20 25 30
cttgattatccg acggaattt ctcacgcca ccggag gtatcaget ctt 144
LeuAspTyrPro ThrGluPhe LeuThrPro ProGlu ValSerAla Leu
35 40 45
aaacttctgtct aactgcctc gagtctgtt ttcgac tcgccggag acg 192
LysLeuLeuSer AsnCysLeu GluSerVal PheAsp SerProGlu Thr
50 55 60
ttctacagcgat getaagcta gttctcgcc ggcggc cgggaagtt tct 240
PheTyrSerAsp AlaLysLeu ValLeuAla GlyGly ArgGluVal Ser
65 70 75 80
tttcaccgttgt attctttcc gcgagaatt cctgtc ttcaaaagc get 288
PheHisArgCys IleLeuSer AlaArgIle ProVal PheLysSer Ala
85 90 95
ttagccaccgtg aaggaacaa aaatcctcc accacc gtgaagctc cag 336
LeuAlaThrVal LysGluGln LysSerSer ThrThr ValLysLeu Gln
100 105 110
ctgaaagagatc gccagagat tacgaagtc ggcttt gactcggtt gtg 384
LeuLysGluIle AlaArgAsp TyrGluVal GlyPhe AspSerVal Val
115 120 125
gcggttttggcg tatgtttac agcggcaga gtgagg tccccgccg aag 432
AlaValLeuAla TyrValTyr SerGlyArg ValArg SerProPro Lys
130 135 140
ggagettctget tgcgtagac gacgattgt tgccac gtggettgc cgg 480
GlyAlaSerAla CysValAsp AspAspCys CysHis ValAlaCys Arg
- 29 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
145 150 155 160
tcaaaggtggat ttcatggtg gaggtt ctttatctg tctttcgtt ttc 528
SerLysValAsp PheMetVal GluVal LeuTyrLeu SerPheVal Phe
165 170 175
cagattcaagaa ttagttact ctgtat gagaggcag ttcttggaa att 576
GlnIleGlnGlu LeuValThr LeuTyr GluArgGln PheLeuGlu Ile
180 185 190
gtagacaaagtt gtagtcgaa gacatc ttggttata ttcaagctt gat 624
ValAspLysVal ValValGlu AspIle LeuValIle PheLysLeu Asp
195 200 205
actctatgtggt acaacatac aagaag cttttggat agatgcata gaa 672
ThrLeuCysGly ThrThrTyr LysLys LeuLeuAsp ArgCysIle Glu
210 215 220
attatcgtgaag tctgatata gaacta gttagtctt gagaagtct tta 720
IleIleValLys SerAspIle GluLeu ValSerLeu GluLysSer Leu
225 230 235 240
cctcaacacatt ttcaagcaa atcata gacatccgc gaagcgctc tgt 768
ProGlnHisIle PheLysGln IleIle AspIleArg GluAlaLeu Cys
245 250 255
ctagagccacct aaactagaa aggcat gtcaagaac atatacaag gcg 816
LeuGluProPro LysLeuGlu ArgHis ValLysAsn IleTyrLys Ala
260 265 270
ctagactcagat gatgttgag cttgtc aagatgctt ttgctagaa gga 864
LeuAspSerAsp AspValGlu LeuVal LysMetLeu LeuLeuGlu Gly
275 280 285
cacaccaatctc gatgaggcg tatget cttcatttt getatcget cac 912
HisThrAsnLeu AspGluAla TyrAla LeuHisPhe AlaIleAla His
290 295 300
tgcgetgtgaag accgcgtat gatctc ctcgagctt gagcttgcg gat 960
CysAlaValLys ThrAlaTyr AspLeu LeuGluLeu GluLeuAla Asp
305 310 315 320
gttaaccttaga aatccgagg ggatac actgtgctt catgttget gcg 1008
ValAsnLeuArg AsnProArg GlyTyr ThrValLeu HisValAla Ala
325 330 335
atgcggaaggag ccgaagttg ataata tctttgtta atgaaaggg gca 1056
MetArgLysGlu ProLysLeu IleIle SerLeuLeu MetLysGly Ala
340 345 350
aatattttagac acaacattg gatggt agaaccget ttagtgatt gta 1104
AsnIleLeuAsp ThrThrLeu AspGly ArgThrAla LeuValIle Val
355 360 365
aaacgactcact aaagcggat gactac aaaactagt acggaggac ggt 1152
LysArgLeuThr LysAlaAsp AspTyr LysThrSer ThrGluAsp Gly
370 375 380
acgccttctctg aaaggcgga ttatgc atagaggta cttgagcat gaa 1200
ThrProSerLeu LysGlyGly LeuCys IleGluVal LeuGluHis Glu
385 390 395 400
-30-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
caaaaa ctagaatat ttgtcgcct atagagget tcactttct cttcca 1248
GlnLys LeuGluTyr LeuSerPro IleGluAla SerLeuSer LeuPro
405 410 415
gtaact ccagaggag ttgaggatg aggttgctc tattatgaa aaccga 1296
ValThr ProGluGlu LeuArgMet ArgLeuLeu TyrTyrGlu AsnArg
420 425 430
gttgca cttgetcga cttctcttt ccagtggaa actgaaact gtacag 1344
ValAla LeuAlaArg LeuLeuPhe ProValGlu ThrGluThr ValGln
435 440 445
ggtatt gccaaattg gaggaaaca tgcgagttt acagettct agtctc 1392
GlyIle AlaLysLeu GluGluThr CysGluPhe ThrAlaSer SerLeu
450 455 460
gagcct gatcatcac attggtgaa aagcggaca tcactagac ctaaat 1440
GluPro AspHisHis IleGlyGlu LysArgThr SerLeuAsp LeuAsn
465 470 475 480
atggcg ccgttccaa atccatgag aagcatttg agtagacta agagca 1488
MetAla ProPheGln IleHisGlu LysHisLeu SerArgLeu ArgAla
485 490 495
ctttgt aaaaccgtg gaactgggg aaacgctac ttcaaacga tgttcg 1536
LeuCys LysThrVal GluLeuGly LysArgTyr PheLysArg CysSer
500 505 510
cttgat cactttatg gatactgag gacttgaat catcttget agcgta 1584
LeuAsp HisPheMet AspThrGlu AspLeuAsn HisLeuAla SerVal
515 520 525
gaagaa gatactcct gagaaacgg ctacaaaag aagcaaagg tacatg 1632
GluGlu AspThrPro GluLysArg LeuGlnLys LysGlnArg TyrMet
530 535 540
gaacta caagagact ctgatgaag acctttagt gaggacaag gaggaa 1680
GluLeu GlnGluThr LeuMetLys ThrPheSer GluAspLys GluGlu
545 550 555 560
tgtgga aagtcttcc acaccgaaa ccaacctct gcggtgagg tctaat 1728
CysGly LysSerSer ThrProLys ProThrSer AlaValArg SerAsn
565 570 575
agaaaa ctctctcac cggcgccta aaagtggac aaacgggat tttttg 1776
ArgLys LeuSerHis ArgArgLeu LysValAsp LysArgAsp PheLeu
580 585 590
aaacga ccttacggg aacggggat taa
1803
LysArg ProTyrGly AsnGlyAsp
595 600
<210>
20
<211> 0
60
<212>
PRT
<213> abidopsis
Ar thaliana
<400> 20
Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe Ser Asp Ser Tyr
-31 -
WO 00/53762 CA 02365968 2001-09-06 pC'T/EP00/01978
1 5 10 15
Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser Ser
20 25 30
Leu Asp Tyr Pro Thr Glu Phe Leu Thr Pro Pro Glu Val Ser Ala Leu
35 40 45
Lys Leu Leu Ser Asn Cys Leu Glu Ser Val Phe Asp Ser Pro Glu Thr
50 55 60
Phe Tyr Ser Asp Ala Lys Leu Val Leu Ala Gly Gly Arg Glu Val Ser
65 70 75 80
Phe His Arg Cys Ile Leu Ser Ala Arg Ile Pro Val Phe Lys Ser Ala
85 90 95
Leu Ala Thr Val Lys Glu Gln Lys Ser Ser Thr Thr Val Lys Leu Gln
100 105 110
Leu Lys Glu Ile Ala Arg Asp Tyr Glu Val Gly Phe Asp Ser Val Val
115 120 125
Ala Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Ser Pro Pro Lys
130 135 140
Gly Ala Ser Ala Cys Val Asp Asp Asp Cys Cys His Val Ala Cys Arg
145 150 155 160
Ser Lys Val Asp Phe Met Val Glu Val Leu Tyr Leu Ser Phe Val Phe
165 170 175
Gln Ile Gln Glu Leu Val Thr Leu Tyr Glu Arg Gln Phe Leu Glu Ile
180 185 190
Val Asp Lys Val Val Val Glu Asp Ile Leu Val Ile Phe Lys Leu Asp
195 200 205
Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile Glu
210 215 220
Ile Ile Val Lys Ser Asp Ile Glu Leu Val Ser Leu Glu Lys Ser Leu
225 230 235 240
Pro Gln His Ile Phe Lys Gln Ile Ile Asp Ile Arg Glu Ala Leu Cys
245 250 255
Leu Glu Pro Pro Lys Leu Glu Arg His Val Lys Asn Ile Tyr Lys Ala
260 265 270
Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Leu Glu Gly
275 280 285
His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala His
290 295 300
Cys Ala Val Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala Asp
305 310 315 320
Val Asn Leu Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala Ala
325 330 335
Met Arg Lys Glu Pro Lys Leu Ile Ile Ser Leu Leu Met Lys Gly Ala
340 345 350
Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Val Ile Val
355 360 365
Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp Gly
370 375 380
Thr Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His Glu
385 390 395 400
Gln Lys Leu Glu Tyr Leu Ser Pro Ile Glu Ala Ser Leu Ser Leu Pro
405 410 415
Val Thr Pro Glu Glu Leu Arg Met Arg Leu Leu Tyr Tyr Glu Asn Arg
420 425 430
Val Ala Leu Ala Arg Leu Leu Phe Pro Val Glu Thr Glu Thr Val Gln
435 440 445
Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser Leu
450 455 460
Glu Pro Asp His His Ile Gly Glu Lys Arg Thr Ser Leu Asp Leu Asn
465 470 475 480
Met Ala Pro Phe Gln Ile His Glu Lys His Leu Ser Arg Leu Arg Ala
485 490 495
-32-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Leu Cys Lys Thr Val Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys Ser
500 505 510
Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser Val
515 520 525
Glu Glu Asp Thr Pro Glu Lys Arg Leu Gln Lys Lys Gln Arg Tyr Met
530 535 540
Glu Leu Gln Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu Glu
545 550 555 560
Cys Gly Lys Ser Ser Thr Pro Lys Pro Thr Ser Ala Val Arg Ser Asn
565 570 575
Arg Lys Leu Ser His Arg Arg Leu Lys Val Asp Lys Arg Asp Phe Leu
580 585 590
Lys Arg Pro Tyr Gly Asn Gly Asp
595 600
<210> 21
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
1A
<400> 21
gakattattg tcaagtctaa tgtwgata 28
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
1B
<400> 22
aytkgaytck gatgatrttg artta 25
<210> 23
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
1C
<400> 23
taaytcaaya tcatcmgart cmartgc 27
<210> 24
<211> 28
<212> DNA
<213> Artificial Sequence
-33-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
<220>
<223> Description of Artificial Sequence: PCR primer NIM
1D
<220>
<221> misc_feature
<222> (1). (28)
<223> n = a, t, c or g
<400> 24
gttkagcmag nscaactcta ttttcaag 28
<210> 25
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
2A
<400> 25
tgcatwgara twrttgtsaa gtctratgtw ga 32
<210> 26
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
2B
<400> 26
ggcaytggay tcwgatgatg ttgaryt 27
<210> 27
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
2C
<400> 27
arytcaacat catcwgartc cartgcc 27
<210> 28
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
2D
-34-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<400> 28
agttkagcma gdccaactck attttcaarr t 31
<210>
29
<211> 9
65
<212>
DNA
<213> cotiana tabacum
Ni
<220>
<221> S
CD
<222> )..(657)
(1
<223> bacco
To A
<400>
29
tgc atggagatt attgtcaag tctaat gttgatatcata acccttgat 48
Cys MetGluIle IleValLys SerAsn ValAspIleIle ThrLeuAsp
1 5 10 15
aag gccttgcct catgacatt gtaaaa caaattaccgat tcacgagca 96
Lys AlaLeuPro HisAspIle ValLys GlnIleThrAsp SerArgAla
20 25 30
gaa cttggtcta caagggcct gaaagc aatggttttcct gataaacat 144
Glu LeuGlyLeu GlnGlyPro GluSer AsnGlyPhePro AspLysHis
35 40 45
gtt aagaggata catagggca ttagat tctgatgatgtt gaattactg 192
Val LysArgIle HisArgAla LeuAsp SerAspAspVal GluLeuLeu
50 55 60
cag atgttgcta agagagggg catact actctagatgat gcatatget 240
Gln MetLeuLeu ArgGluGly HisThr ThrLeuAspAsp AlaTyrAla
65 70 75 80
ctc cactatget gtagcatat tgcgat gcaaagactaca gcagaactt 288
Leu HisTyrAla ValAlaTyr CysAsp AlaLysThrThr AlaGluLeu
85 90 95
cta gatcttgca cttgetgat gttaat catcaaaattca agaggatac 336
Leu AspLeuAla LeuAlaAsp ValAsn HisGlnAsnSer ArgGlyTyr
100 105 110
aca gtgctgcat gttgcagcc atgagg aaagagcctaaa attatagtg 384
Thr ValLeuHis ValAlaAla MetArg LysGluProLys IleIleVal
115 120 125
tcc cttttaacc aaaggaget agacct tctgatctgaca tccgatggc 432
Ser LeuLeuThr LysGlyAla ArgPro SerAspLeuThr SerAspGly
130 135 140
aga aaagcactt caaattgcc aagagg ctcactaggctt gtggatttc 480
Arg LysAlaLeu GlnIleAla LysArg LeuThrArgLeu ValAspPhe
145 150 155 160
agt aagtctcca gaggaagga aaatct gettcgaaggat cggttatgc 528
Ser LysSerPro GluGluGly LysSer AlaSerLysAsp ArgLeuCys
165 170 175
att gagattctg gagcaagca gaaaga agagatccactg ctaggagaa 576
Ile GluIleLeu GluGlnAla GluArg ArgAspProLeu LeuGlyGlu
-35-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
180 185 190
get tct gta tct ctt get atg gcg ggc gat gat ttg cgt atg aag ctg 624
Ala Ser Val Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu
195 200 205
tta tac ctt gaa aat aga gtt ggc ctt get caa ct 659
Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln
210 215
<210> 30
<211> 219
<212> PRT
<213> Nicotiana tabacum
<400> 30
Cys Met Glu Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp
1 5 10 15
Lys Ala Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala
20 25 30
Glu Leu Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His
35 40 45
Val Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu
50 55 60
Gln Met Leu Leu Arg Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala
65 70 75 80
Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu
85 90 95
Leu Asp Leu Ala Leu Ala Asp Val Asn His Gln Asn Ser Arg Gly Tyr
100 105 110
Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val
115 120 125
Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly
130 135 140
Arg Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe
145 150 155 160
Ser Lys Ser Pro Glu Glu Gly Lys Ser Ala Ser Lys Asp Arg Leu Cys
165 170 175
Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu
180 185 190
Ala Ser Val Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu
195 200 205
Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln
210 215
-36-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<210> 31
<211> 498
<212> DNA
<213> Nicotiana tabacum
<220>
<221> CDS
<222> (2)..(496)
<223> Tobacco B
<400> 31
g gca ctg gat tct gat gat gtt gag ctg gtc aag ctt cta ctc aac gag 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Asn Glu
1 5 10 15
tct gag ata agc tta gat gaa gcc tac get ctt cat tat get gtt gca 97
Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
tat tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt get 145
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
gat gtc aat cta cgt aat act cgc ggt tac act gtg ctt cac att get 193
Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
gcc atg cgt aag gag cca gca ata att gta tcg ctt ttg act aag gga 241
Ala Met Arg Lys Glu Pro Ala Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
get cat gtg tca gag att aca ttg gat ggg caa agt get gtt agt atc 289
Ala His Val Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
tgt agg agg cta act agg cct aag gag tac cat gca aaa aca gaa caa 337
Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
gag atg cgt cgc aac cca atg get gga gat gca ttg ctt tct tcc caa 433
Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Leu Ser Ser Gln
130 135 140
atg ttg gcc gat gat ctg cac atg aaa ctg cac tat ttt gaa aat cga 481
Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Phe Glu Asn Arg
145 150 155 160
gtt gga ctt get caa ct
498
Val Gly Leu Ala Gln
165
<210> 32
<211> 165
<212> PRT
<213> Nicotiana tabacum
-37-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
<400> 32
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Asn Glu
1 5 10 15
Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
Ala Met Arg Lys Glu Pro Ala Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala His Val Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Leu Ser Ser Gln
130 135 140
Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Phe Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 33
<211> 498
<212> DNA
<213> Nicotiana tabacum
<220>
<221> CDS
<222> (2)..(496)
<223> Tobacco C
<400> 33
g gca ctg gac tcw gat gat gtt gag ttt gtc aag ctt cta ctg agt gag 49
Ala Leu Asp Xaa Asp Asp Val Glu Phe Val Lys Leu Leu Leu Ser Glu
1 5 10 15
tct aac ata agc tta gat gaa gcc tac get ctt cat tat get gtg gca 97
Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
tat tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt gcg 145
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
gat gtc aac cta cgt aat act cgt ggt tac act gtg ctt cac att get 193
Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
-38-
WO CA 02365968 2001-09-06 PCT/EP00/01978
00/53762
50 55 60
tcc atgcgtaag gagccagca gtaattgta tcgcttttg actaag gga 241
Ser MetArgLys GluProAla ValIleVal SerLeuLeu ThrLys Gly
65 70 75 80
get cgtgcatca gagactaca ttggatggg cagagtget gttagt atc 289
Ala ArgAlaSer GluThrThr LeuAspGly GlnSerAla ValSer Ile
85 90 95
tgt aggaggctg actaggcct aaggagtac catgcaaaa acagaa caa 337
Cys ArgArgLeu ThrArgPro LysGluTyr HisAlaLys ThrGlu Gln
100 105 110
ggc caggaagca aacaaagat cgggtatgt attgatgtt ttggag aga 385
Gly GlnGluAla AsnLysAsp ArgValCys IleAspVal LeuGlu Arg
115 120 125
gag atgcgtcgc aacccaatg getggagat gcattgttt tcttcc cca 433
Glu MetArgArg AsnProMet AlaGlyAsp AlaLeuPhe SerSer Pro
130 135 140
atg ttggccgat gatctgcac atgaaactg cactacctt gaaaat aga 481
Met LeuAlaAsp AspLeuHis MetLysLeu HisTyrLeu GluAsn Arg
145 150 155 160
gtt ggcctgget caact 498
Val GlyLeuAla Gln
165
<210> 34
<211> 165
<212> PRT
<213> Nicotiana tabacum
<400> 34
Ala Leu Asp Xaa Asp Asp Val Glu Phe Val Lys Leu Leu Leu Ser Glu
1 5 10 15
Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
Ser Met Arg Lys Glu Pro Ala Val Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
- 39 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Phe Ser Ser Pro
130 135 140
Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 35
<211> 399
<212> DNA
<213> Nicotiana tabacum
<220>
<221> CDS
<222> (1)..(399)
<223> Tobacco
D
<400> 35
act gat gatgat gttgagtta cttaagtta cttcttgaa gagtct 48
tcg
Thr Asp AspAsp ValGluLeu LeuLysLeu LeuLeuGlu GluSer
Ser
1 5 10 15
aat gtc ttagac gatgettgt getcttcat tatgcaget gettat 96
act
Asn Val LeuAsp AspAlaCys AlaLeuHis TyrAlaAla AlaTyr
Thr
20 25 30
tgt aac aaggtt gtgaatgag gtcctcgag ctggattta getgat 144
tcc
Cys Asn LysVal ValAsnGlu ValLeuGlu LeuAspLeu AlaAsp
Ser
35 40 45
gtc aat cagaac tcccgagga tataacgtc cttcacgtt getget 192
ctt
Val Asn GlnAsn SerArgGly TyrAsnVal LeuHisVal AlaAla
Leu
50 55 60
aga aga gagcca tcaataata atgggacta cttgaaaaa ggagca 240
aag
Arg Arg GluPro SerIleIle MetGlyLeu LeuGluLys GlyAla
Lys
65 70 75 80
tct ttc aatact acacgggat ggaaacaca gcactatct atctgt 288
ttg
Ser Phe AsnThr ThrArgAsp GlyAsnThr AlaLeuSer IleCys
Leu
85 90 95
cgg aga actcgg ccaaaggat tataatgag ccaacaaag caaggg 336
ttg
Arg Arg ThrArg ProLysAsp TyrAsnGlu ProThrLys GlnGly
Leu
100 105 110
aaa gaa aataag gaccgcata tgcattgat attttggag agagag 384
act
Lys Glu AsnLys AspArgIle CysIleAsp IleLeuGlu ArgGlu
Thr
115 120 125
acg aat aatcct 399
agg
Thr Asn AsnPro
Arg
130
<210> 36
<211> 133
-40-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<212> PRT
<213> Nicotiana tabacum
<400> 36
Thr Asp Ser Asp Asp Val Glu Leu Leu Lys Leu Leu Leu Glu Glu Ser
1 5 10 15
Asn Val Thr Leu Asp Asp Ala Cys Ala Leu His Tyr Ala Ala Ala Tyr
20 25 30
Cys Asn Ser Lys Val Val Asn Glu Val Leu Glu Leu Asp Leu Ala Asp
35 40 45
Val Asn Leu Gln Asn Ser Arg Gly Tyr Asn Val Leu His Val Ala Ala
50 55 60
Arg Arg Lys Glu Pro Ser Ile Ile Met Gly Leu Leu Glu Lys Gly Ala
65 70 75 80
Ser Phe Leu Asn Thr Thr Arg Asp Gly Asn Thr Ala Leu Ser Ile Cys
85 90 95
Arg Arg Leu Thr Arg Pro Lys Asp Tyr Asn Glu Pro Thr Lys Gln Gly
100 105 110
Lys Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Ile Leu Glu Arg Glu
115 120 125
Thr Asn Arg Asn Pro
130
<210> 37
<211> 498
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> CDS
<222> (2)..(496)
<223> Tomato A
<400> 37
g gca ttg gat tct gat gat gtt gag tta cta agg atg ttg ctt aaa gag 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu
1 5 10 15
ggg cat act act ctt gat gat gca tat get ctc cac tat get gta gca 97
Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
tat tgc gat gca aag act aca gca gaa ctt tta gat ctt tca ctt get 145
Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala
35 40 45
gat gtt aat cat caa aat cct aga gga cac acg gta ctt cat gtt get 193
Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val Leu His Val Ala
50 55 60
gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt tta acc aaa gga 241
-41 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
AlaMetArgLys GluProLys IleIleVal SerLeuLeuThr LysGly
65 70 75 80
getagaccttct gatctgaca tccgatggc aaaaaagcactt caaatt 289
AlaArgProSer AspLeuThr SerAspGly LysLysAlaLeu GlnIle
85 90 95
getaagaggctc actaggctt gtagatttt accaagtctaca gaggaa 337
AlaLysArgLeu ThrArgLeu ValAspPhe ThrLysSerThr GluGlu
100 105 110
ggaaaatctget ccaaaggat cggttatgc attgagattctg gagcaa 385
GlyLysSerAla ProLysAsp ArgLeuCys IleGluIleLeu GluGln
115 120 125
gcagaaagaaga gatccacta ctaggagaa gettcattatct cttget 433
AlaGluArgArg AspProLeu LeuGlyGlu AlaSerLeuSer LeuAla
130 135 140
atggcaggcgat gatttgcgt atgaagctg ttataccttgaa aataga 481
MetAlaGlyAsp AspLeuArg MetLysLeu LeuTyrLeuGlu AsnArg
145 150 155 160
gttggccttget aaact 4gg
ValGlyLeuAla Lys
165
<210> 38
<211> 165
<212> PRT
<213> Lycopersicon esculentum
<400> 38
Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu
1 5 10 15
Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala
35 40 45
Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val Leu His Val Ala
50 55 60
Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gln Ile
85 90 95
Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys Ser Thr Glu Glu
100 105 110
Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln
115 120 125
Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala
130 135 140
- 42 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Lys
165
<210> 39
<211> 498
<212> DNA
<213> Beta vulgaris
<220>
<221> CDS
<222> (2)..(496)
<223> Sugarbeet
<400> 39
g gca ttg gat tct gat gat gtt gag tta gtc aga atg ctt tta aaa gag 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Arg Met Leu Leu Lys Glu
1 5 10 15
cgc cat aca act cta gat gat gca tat gcc ctt cac tat get gtg gca 97
Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
cat tgt gat gcc aag acc acc acg gag ctt ctt gag ctt ggg ctt gca 145
His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala
35 40 45
gat gtt aat ctt aga aat cta agg ggt cac act gtg cta cat gtg gca 193
Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val Leu His Val Ala
50 55 60
gcc atg aga aaa gag cct aag ata att gta tcc ttg tta acc aag gga 241
Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
gcc cat ccg tct gat ata aca tca gat gat aaa aaa gca ctg cag ata 289
Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gln Ile
85 90 95
gca aag aga cta aca aaa get gtg gac ttc tat aaa act aca gaa caa 337
Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys Thr Thr Glu Gln
100 105 110
gga aaa gat gca cca aag gat cgg ttg tgc att gaa ata ctg gag caa 385
Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln
115 120 125
get gaa aga aga gaa cca ttg cta gga gaa ggt tct gtt tct ctt gca 433
Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser Val Ser Leu Ala
130 135 140
aag gca gga gat gat ctg cgt atg aag cta tta tac ctt gaa aat cga 481
Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
gtt ggc ctt get caa ct
498
Val Gly Leu Ala Gln
-43-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
165
<210> 40
<211> 165
<212> PRT
<213> Beta vulgaris
<400> 40
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Arg Met Leu Leu Lys Glu
1 5 10 15
Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala
35 40 45
Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val Leu His Val Ala
50 55 60
Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gln Ile
85 90 95
Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys Thr Thr Glu Gln
100 105 110
Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln
115 120 125
Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser Val Ser Leu Ala
130 135 140
Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 41
<211> 498
<212> DNA
<213> Helianthus annuus
<220>
<221> CDS
<222> (2)..(496)
<223> Sunflower A
<400> 41
g gca ttg gat tct gat gat gtt gag yta gtc aca atg tta tta cga gaa 49
Ala Leu Asp Ser Asp Asp Val Glu Xaa Val Thr Met Leu Leu Arg Glu
1 5 10 15
ggt cat act tca tta gac ggt tct tgc get ctt cat tac get gtt gcg 97
Gly His Thr Ser Leu Asp Gly Ser Cys Ala Leu His Tyr Ala Val Ala
-44-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
20 25 30
tacgca gatget aaaacgaca accgaatta ctggattta gcacttget 145
TyrAla AspAla LysThrThr ThrGluLeu LeuAspLeu AlaLeuAla
35 40 45
gacgta aatcat aaaaactcg aggggtttt accgtactt catgttgcc 193
AspVal AsnHis LysAsnSer ArgGlyPhe ThrValLeu HisValAla
50 55 60
getatg agaaaa gagccgagt attatcgtt tcgcttctt acgaaaggg 241
AlaMet ArgLys GluProSer IleIleVal SerLeuLeu ThrLysGly
65 70 75 80
gcccga ccctcg gatctcacc cctgatggg agaaaagca ctacagatt 289
AlaArg ProSer AspLeuThr ProAspGly ArgLysAla LeuGlnIle
85 90 95
tcgaag aggttg accagagcg gttgactat tacaagtca aacgaggat 337
SerLys ArgLeu ThrArgAla ValAspTyr TyrLysSer AsnGluAsp
100 105 110
gataaa gagtca acgaaaggt cgtttgtgt attgagata ttggaacaa 385
AspLys GluSer ThrLysGly ArgLeuCys IleGluIle LeuGluGln
115 120 125
gccgaa agaaga aatccattg ttaggtgaa gettcgget tctcttgca 433
AlaGlu ArgArg AsnProLeu LeuGlyGlu AlaSerAla SerLeuAla
130 135 140
atggcc ggagat gatttgcgt ggaaagttg ttgtacctt gaaaatcga 481
MetAla GlyAsp AspLeuArg GlyLysLeu LeuTyrLeu GluAsnArg
145 150 155 160
gttggc ctgget caact 498
ValGly LeuAla Gln
165
<210>
42
<211>
165
<212>
PRT
<213> annuus
Helianthus
<400>
42
Ala Leu Ser AspAspVal GluXaaVal ThrMetLeu LeuArgGlu
Asp
1 5 10 15
Gly His Ser LeuAspGly SerCysAla LeuHisTyr AlaValAla
Thr
20 25 30
Tyr Ala Ala LysThrThr ThrGluLeu LeuAspLeu AlaLeuAla
Asp
35 40 45
Asp Val His LysAsnSer ArgGlyPhe ThrValLeu HisValAla
Asn
50 55 60
Ala Met Lys GluProSer IleIleVal SerLeuLeu ThrLysGly
Arg
65 70 75 80
Ala Arg Pro Ser Asp Leu Thr Pro Asp Gly Arg Lys Ala Leu Gln Ile
-45-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
85 90 95
Ser Lys Arg Leu Thr Arg Ala Val Asp Tyr Tyr Lys Ser Asn Glu Asp
100 105 110
Asp Lys Glu Ser Thr Lys Gly Arg Leu Cys Ile Glu Ile Leu Glu Gln
115 120 125
Ala Glu Arg Arg Asn Pro Leu Leu Gly Glu Ala Ser Ala Ser Leu Ala
130 135 140
Met Ala Gly Asp Asp Leu Arg Gly Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 43
<211> 498
<212> DNA
<213> Helianthus annuus
<220>
<221> CDS
<222> (2)..(496)
<223> Sunflower B
<400> 43
g gca ttg gac tct gat gat gtt gag ctt gtg aaa atg att tta gac gaa 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Ile Leu Asp Glu
1 5 10 15
tcc aaa atc acg tta gat gaa gcc tgc get ctt cat tat gcg gtc atg 97
Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Val Met
20 25 30
tat tgt aat caa gaa gtt get aag gag att ctt aac tta aac cgt gcg 145
Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala
35 40 45
gat gtt aat ctt aga aac tca cga gat tac acc gtg ctt cat gtt get 193
Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr Thr Val Leu His Val Ala
50 55 60
gcc atg cgt aaa gaa cca tca ctt att gtt tcg att cta agc aaa ggc 241
Ala Met Arg Lys Glu Pro Ser Leu Ile Val Ser Ile Leu Ser Lys Gly
65 70 75 80
gcg tgt gca tcg gat act act ttt gat gga caa agt gcg gtt agt att 289
Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
tgc agg aga cga aca agg ccc aag gat tat tat gtg aaa acc gaa cac 337
Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr Tyr Val Lys Thr Glu His
100 105 110
ggg caa gaa aca aat aaa gat cgt ata tgc atc gat gtt ttg gag cgg 385
Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Val Leu Glu Arg
115 120 125
- 46 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
gaa ata aag agg aat ccg atg ata ggc gat gtt tcc gtg tgt tct tca 433
Glu Ile Lys Arg Asn Pro Met Ile Gly Asp Val Ser Val Cys Ser Ser
130 135 140
gca gtg get gat gat ttg cat atg aat tta ctc tac ttt gaa aat cga 481
Ala Val Ala Asp Asp Leu His Met Asn Leu Leu Tyr Phe Glu Asn Arg
145 150 155 160
gtt ggc ctt get caa ct 498
Val Gly Leu Ala Gln
165
<210> 44
<211> 165
<212> PRT
<213> Helianthus annuus
<400> 44
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Ile Leu Asp Glu
1 5 10 15
Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Val Met
20 25 30
Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala
35 40 45
Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr Thr Val Leu His Val Ala
50 55 60
Ala Met Arg Lys Glu Pro Ser Leu Ile Val Ser Ile Leu Ser Lys Gly
65 70 75 80
Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr Tyr Val Lys Thr Glu His
100 105 110
Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Val Leu Glu Arg
115 120 125
Glu Ile Lys Arg Asn Pro Met Ile Gly Asp Val Ser Val Cys Ser Ser
130 135 140
Ala Val Ala Asp Asp Leu His Met Asn Leu Leu Tyr Phe Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 45
<211> 653
<212> DNA
<213> Solanum tuberosum
<220>
-47-
WO CA 02365968 2001-09-06 pCT/EP00/01978
00/53762
<221> S
CD
<222> )..(651)
(1
<223> tatoA
Po
<400>
45
gakatt attgtcaagtct aatgttgat atcataacc cttgataag tcc 48
XaaIle IleValLysSer AsnValAsp IleIleThr LeuAspLys Ser
1 5 10 15
ttgcct catgacatcgta aaacaaatc actgattca cgtgetgaa ctt 96
LeuPro HisAspIleVal LysGlnIle ThrAspSer ArgAlaGlu Leu
20 25 30
ggtcta caagggcctgaa agcaatggt tttcctgat aaacatgtt aag 144
GlyLeu GlnGlyProGlu SerAsnGly PheProAsp LysHisVal Lys
35 40 45
aggata catagggcattg gactctgat gatgttgag ttactaagg atg 192
ArgIle HisArgAlaLeu AspSerAsp AspValGlu LeuLeuArg Met
50 55 60
ttgctt aaagaagggcat actactctc gatgatgca tatgetctc cac 240
LeuLeu LysGluGlyHis ThrThrLeu AspAspAla TyrAlaLeu His
65 70 75 80
tatget gtagcatattgc gatgcaaag actacagca gaactttta gat 288
TyrAla ValAlaTyrCys AspAlaLys ThrThrAla GluLeuLeu Asp
85 90 95
ctttca cttgetgatgtt aatcatcaa aatcctaga ggatacacg gta 336
LeuSer LeuAlaAspVal AsnHisGln AsnProArg GlyTyrThr Val
100 105 110
cttcat gttgetgccatg aggaaagag cctaaaatt atagtgtcc ctt 384
LeuHis ValAlaAlaMet ArgLysGlu ProLysIle IleValSer Leu
115 120 125
ttaacc aaaggagetaga ccttctgat ctgacatct gatggcaaa aaa 432
LeuThr LysGlyAlaArg ProSerAsp LeuThrSer AspGlyLys Lys
130 135 140
gcactt caaattgetaag aggctcact aggcttgtg gattttact aag 480
AlaLeu GlnIleAlaLys ArgLeuThr ArgLeuVal AspPheThr Lys
145 150 155 160
tctaca gaggaaggaaaa tctgetcca aaagatcgg ttatgcatt gag 528
SerThr GluGluGlyLys SerAlaPro LysAspArg LeuCysIle Glu
165 170 175
attctg gagcaagcagaa agaagagat ccactacta ggagaaget tca 576
IleLeu GluGlnAlaGlu ArgArgAsp ProLeuLeu GlyGluAla Ser
180 185 190
ttatct cttgetatggca ggcgatgat ttgcgtatg aagctgtta tac 624
LeuSer LeuAlaMetAla GlyAspAsp LeuArgMet LysLeuLeu Tyr
195 200 205
cttgaa aatcgagttggc ctkgetcaa ct 653
LeuGlu AsnArgValGly XaaAlaGln
210 215
-48-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
<210> 46
<211> 217
<212> PRT
<213> Solanum tuberosum
<400> 46
Xaa Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ser
1 5 10 15
Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu
20 25 30
Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys
35 40 45
Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met
50 55 60
Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His
65 70 75 80
Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp
85 90 95
Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly Tyr Thr Val
100 105 110
Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu
115 120 125
Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys
130 135 140
Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys
145 150 155 160
Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu
165 170 175
Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser
180 185 190
Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr
195 200 205
Leu Glu Asn Arg Val Gly Xaa Ala Gln
210 215
<210> 47
<211> 498
<212> DNA
<213> Solanum tuberosum
<220>
<221> CDS
<222> (2)..(496)
<223> Potato B
-49-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<400> 47
g gca ttg gat tca gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 49
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu
1 5 10 15
tct gac ata agt tta gat gga gcc tac get ctt cat tac get gtt gca 97
Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
tat tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt get 145
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
aat gtc aac ctt cgg aat aca cgt ggt tac act gtg ctt cac att get 193
Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
gcc atg cgt aag gaa ccc tca atc att gta tca ctt ttg act aag gga 241
Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
get cat gca tca gaa att aca ttg gat ggg cag agt get gtt ggc atc 289
Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Gly Ile
85 90 95
tgt agg agg ctg agt agg cct aag gag tac cat gca aaa aca gaa caa 337
Cys Arg Arg Leu Ser Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
gag atg cgt cac aac cca atg acc gga gat gca tta ttt tct tcc ccc 433
Glu Met Arg His Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro
130 135 140
atg ttg gcc gat gat ctg ccc atg aaa ctg ctc tac ctt gaa aat cga 481
Met Leu Ala Asp Asp Leu Pro Met Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
gtt ggc ctt get aaa ct
498
Val Gly Leu Ala Lys
165
<210> 48
<211> 165
<212> PRT
<213> Solanum tuberosum
<400> 48
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu
1 5 10 15
Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
- 50 -
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Gly Ile
85 90 95
Cys Arg Arg Leu Ser Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
Glu Met Arg His Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro
130 135 140
Met Leu Ala Asp Asp Leu Pro Met Lys Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Lys
165
<210> 49
<211> 477
<212> DNA
<213> Solanum tuberosum
<220>
<221> CDS
<222> (2)..(475)
<223> Potato C
<400> 49
g gca ctg gac tct gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 49
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu
1 5 10 15
tct gac ata agt tta gat gga gcc tac get ctt cat tac get gtt gca 97
Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
tat tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt get 145
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
aat gtc aac ctt cgg aat aca cgt ggt tac act gtg ctt cac att get 193
Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
gcc atg cgt aag gaa ccc tca atc att gta tca ctt ttg act aag gga 241
Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
get cat gca tca gaa att aca ttg gat ggg cag agt get gtt agc atc 289
Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
-51 -
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
tgtagg aggctgact aggcct aaggagtac catgcaaaa acagaacaa 337
CysArg ArgLeuThr ArgPro LysGluTyr HisAlaLys ThrGluGln
100 105 110
ggccag gaagcaaac aaagat cgggtatgt attgatgtt ttggagaga 385
GlyGln GluAlaAsn LysAsp ArgValCys IleAspVal LeuGluArg
115 120 125
gagatg cgtcgcaac ccaatg accggagat gcattattt tcttccccc 433
GluMet ArgArgAsn ProMet ThrGlyAsp AlaLeuPhe SerSerPro
130 135 140
atgaaa cagctctac cttgaa aatagagtt ggccttget aaact 477
MetLys GlnLeuTyr LeuGlu AsnArgVal GlyLeuAla Lys
145 150 155
<210> 50
<211> 158
<212> PRT
<213> Solanum tuberosum
<400> 50
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu
1 5 10 15
Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala
35 40 45
Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala
50 55 60
Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly
65 70 75 80
Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile
85 90 95
Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln
100 105 110
Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg
115 120 125
Glu Met Arg Arg Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro
130 135 140
Met Lys Gln Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys
145 150 155
<210> 51
<211> 501
<212> DNA
<213> Brassica napes
<220>
-52-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
<221> CDS
<222> (2)..(499)
<223> Canola A
<400> 51
g gca ttg gat tct gat gat gtt gag ttt gtg aag ttg ctt ttg act gag 49
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu
1 5 10 15
tca gat atc act cta gat gaa gcc aat ggt ctt cat tac tca gtg gtg 97
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
tat agt gat ccc aaa gtt gtt gcc gag att ctt act ctt gat atg ggt 145
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly
35 40 45
gat gtc aac cac aga aac tca cgt ggc tac acg gtt ctt cat ctc gca 193
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala
50 55 60
gcc atg cgc aaa gag ccg tcc atc atc ata tct ctt ctc aag aga ggt 241
Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly
65 70 75 80
gcc aat gcg tct ggc ttc acg tgt gat gga cgc agt gcg gtt aat ata 289
Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile
85 90 95
tgt aga aga ttg aca act cca aag gat tat cat acg aaa aca get gcg 337
Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala
100 105 110
aaa ggg agg gaa get agt aaa gca cgg tta tgt ata gat ctc ttg gaa 385
Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu
115 120 125
aga gaa gta agg agg aac cct atg gtt gtt gat tca cca atg tgt tcc 433
Arg Glu Val Arg Arg Asn Pro Met Val Val Asp Ser Pro Met Cys Ser
130 135 140
ctt tct atg cct gaa gat ctc caa atg aga ctg tta tac ctt gaa aat 481
Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn
145 150 155 160
cga gtt ggc ctt get caa ct
501
Arg Val Gly Leu Ala Gln
165
<210> 52
<211> 166
<212> PRT
<213> Brassica napus
<400> 52
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu
1 5 10 15
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
-53-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly
35 40 45
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala
50 55 60
Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly
65 70 75 80
Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile
85 90 95
Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala
100 105 110
Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu
115 120 125
Arg Glu Val Arg Arg Asn Pro Met Val Val Asp Ser Pro Met Cys Ser
130 135 140
Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn
145 150 155 160
Arg Val Gly Leu Ala Gln
165
<210> 53
<211> 501
<212> DNA
<213> Brassica napus
<220>
<221> CDS
<222> (2)..(499)
<223> Canola B
<400> 53
g gca ttg gat tct gat gat gtt gag ttt gtg aag ctt ctt ttg acc gag 49
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu
1 5 10 15
tca gat atc act cta gat gaa gcc aat ggt ctt cat tac tca gtg gtg 97
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
tat agt gat ccc aaa gtt gtt gcc gag att ctt act ctt gat atg ggt 145
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly
35 40 45
gat gtt aac cac aga aac tca cgt ggc tac acg gtt ctg cat ctc gca 193
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala
50 55 60
gcc atg cgc aaa gag ccg tcc atc atc ata tct ctt ctc aag aaa ggt 241
Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Lys Gly
65 70 75 80
-54~
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
gccaat gcgtctggc ttcacctgt gatgga cgcagtgcggtt aatata 289
AlaAsn AlaSerGly PheThrCys AspGly ArgSerAlaVal AsnIle
85 90 95
tgtaga agattgaca actccaaag gattat catactaaaaca getgcg 337
CysArg ArgLeuThr ThrProLys AspTyr HisThrLysThr AlaAla
100 105 110
aaaggg agggaaget agtaaagca cggtta tgtatagatctc ttggaa 385
LysGly ArgGluAla SerLysAla ArgLeu CysIleAspLeu LeuGlu
115 120 125
agagaa gtaaggagg aaccctatg gttgtt gagtcaccaatg tgttct 433
ArgGlu ValArgArg AsnProMet ValVal GluSerProMet CysSer
130 135 140
ctttct atgcctgaa gatctccaa atgaga ctgttatacctt gaaaat 481
LeuSer MetProGlu AspLeuGln MetArg LeuLeuTyrLeu GluAsn
145 150 155 160
cgagtt ggcctgget caact 501
ArgVal GlyLeuAla Gln
165
<210> 54
<211> 166
<212> PRT
<213> Brassica napus
<400> 54
Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu
1 5 10 15
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly
35 40 45
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala
50 55 60
Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Lys Gly
65 70 75 80
Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile
85 90 95
Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala
100 105 110
Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu
115 120 125
Arg Glu Val Arg Arg Asn Pro Met Val Val Glu Ser Pro Met Cys Ser
130 135 140
Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn
145 150 155 160
-55-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Arg Val Gly Leu Ala Gln
165
<210> 55
<211> 498
<212> DNA
<213> Brassica napus
<220>
<221> CDS
<222> (2)..(496)
<223> Canola C
<400> 55
g gca ctg gat tct gat gat gtt gag ctt gtg aag ctt ctt ttg acc gag 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu
1 5 10 15
tca gat atc act cta gat gaa gcc aat ggt ctg cat tac tca gtg gtg 97
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
tat agt gat ccc aaa gtt gtt gca gag ata ctt gcc ctt ggt tta ggt 145
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Ala Leu Gly Leu Gly
35 40 45
gat gtc aat cac aga aac tca cgt ggc tac tcg gtt ctt cat ttc get 193
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Ser Val Leu His Phe Ala
50 55 60
gcc atg cgt aga gag cct tcc atc atc ata tct ctt ctc aag gaa ggc 241
Ala Met Arg Arg Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly
65 70 75 80
gcc aat gcg tct agc ttc act ttt gat gga cgc agt gcg gtt aat ata 289
Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile
85 90 95
tgt agg aga ctg aca act cca aag gat tat cat aca aag aca tcc aaa 337
Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ser Lys
100 105 110
aag agg gaa get agt aaa gca agg ctg tgc ata gat ctc ttg gaa aga 385
Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg
115 120 125
gag gtt agg agg aac cct atg ctt get gat acg cca atg tgt tca ctt 433
Glu Val Arg Arg Asn Pro Met Leu Ala Asp Thr Pro Met Cys Ser Leu
130 135 140
act atg cct gaa gat ctc caa atg aga ctg tta tac ctt gaa aat cga 481
Thr Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
gtt ggt ctt get aaa ct
498
Val Gly Leu Ala Lys
165
-56-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<210> 56
<211> 165
<212> PRT
<213> Brassica napus
<400> 56
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu
1 5 10 15
Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val
20 25 30
Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Ala Leu Gly Leu Gly
35 40 45
Asp Val Asn His Arg Asn Ser Arg Gly Tyr Ser Val Leu His Phe Ala
50 55 60
Ala Met Arg Arg Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly
65 70 75 80
Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile
85 90 95
Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ser Lys
100 105 110
Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg
115 120 125
Glu Val Arg Arg Asn Pro Met Leu Ala Asp Thr Pro Met Cys Ser Leu
130 135 140
Thr Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Lys
165
<210> 57
<211> 498
<212> DNA
<213> Brassica napus
<220>
<221> CDS
<222> (2)..(496)
<223> Canola D
<400> 57
g gca ctg gac tct gat gat gtt gag ctt gtc aag atg ctt ttg aca gaa 49
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Thr Glu
1 5 10 15
gga cac acg agt cta gac gac gcc tac get ctt cac tac get gtt gca 97
Gly His Thr Ser Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala
20 25 30
cat tcc gat gtg aag acg gcc tct gat ctc ata gac ctt gag ctt gcg 145
-57-
WO CA 02365968 pCT/EP00/01978
00/53762 2001-09-06
HisSer AspValLys ThrAlaSer AspLeu IleAspLeu GluLeuAla
35 40 45
gatgtt gaccataga aacctgagg gggtac acggcgctt cacgttget 193
AspVal AspHisArg AsnLeuArg GlyTyr ThrAlaLeu HisValAla
50 55 60
gcgatg aggaacgag ccgaagctg atggtt tatttattg actaaaggt 241
AlaMet ArgAsnGlu ProLysLeu MetVal TyrLeuLeu ThrLysGly
65 70 75 80
gcgaat gcgtcggag acaacgttt gacggt agaacgget cttgtgatt 289
AlaAsn AlaSerGlu ThrThrPhe AspGly ArgThrAla LeuValIle
85 90 95
gcaaaa agactcact aaagettct gagtat aatgetagt acggagcaa 337
AlaLys ArgLeuThr LysAlaSer GluTyr AsnAlaSer ThrGluGln
100 105 110
gggaag ccttctctg aaaggaggg ctatgc atagaggta ctagagcat 385
GlyLys ProSerLeu LysGlyGly LeuCys IleGluVal LeuGluHis
115 120 125
gcgcgg aaactaggt aggttgcct agagat ggtttacct tctcttcca 433
AlaArg LysLeuGly ArgLeuPro ArgAsp GlyLeuPro SerLeuPro
130 135 140
getact cctgatgaa ctgaggatg aggttg ctctacctt gaaaatcga 481
AlaThr ProAspGlu LeuArgMet ArgLeu LeuTyrLeu GluAsnArg
145 150 155 160
gttggc ctggetcaa ct 498
ValGly LeuAlaGln
165
<210>
58
<211>
165
<212>
PRT
<213>
Brassica
napus
<400>
58
Ala Leu SerAsp AspVal GluLeuVal LysMetLeu LeuThrGlu
Asp
1 5 10 15
Gly His SerLeu AspAsp AlaTyrAla LeuHisTyr AlaValAla
Thr
20 25 30
His Ser ValLys ThrAla SerAspLeu IleAspLeu GluLeuAla
Asp
35 40 45
Asp Val HisArg AsnLeu ArgGlyTyr ThrAlaLeu HisValAla
Asp
50 55 60
Ala Met AsnGlu ProLys LeuMetVal TyrLeuLeu ThrLysGly
Arg
65 70 75 80
Ala Asn SerGlu ThrThr PheAspGly ArgThrAla LeuValIle
Ala
85 90 95
Ala Lys LeuThr LysAla SerGluTyr AsnAlaSer ThrGluGln
Arg
-58-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
100 105 110
Gly Lys Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His
115 120 125
Ala Arg Lys Leu Gly Arg Leu Pro Arg Asp Gly Leu Pro Ser Leu Pro
130 135 140
Ala Thr Pro Asp Glu Leu Arg Met Arg Leu Leu Tyr Leu Glu Asn Arg
145 150 155 160
Val Gly Leu Ala Gln
165
<210> 59
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
3A
<400> 59
tagatgawgc mtaygctcty caytatgctg t 31
<210> 60
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer NIM
3B
<400> 60
ggctcyttmc kcatggcagc aayrtgaags ac 32
<210> 61
<211> 148
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> CDS
<222> (4)..(147)
<223> Tomato B
<400> 61
tag atg atg cat atg ctc ttc att atg ctg ttg cat att gtg acc cca 48
Met Met His Met Leu Phe Ile Met Leu Leu His Ile Val Thr Pro
1 5 10 15
agg ttg ttg ctg agg ttc ttg gac tgg gtg ttg cta atg tca acc ttc 96
Arg Leu Leu Leu Arg Phe Leu Asp Trp Val Leu Leu Met Ser Thr Phe
20 25 30
-59-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
gga atg cac gtg gtt aca ctg tcc ttc acg ttg ctg cca tgc gga aag 144
Gly Met His Val Val Thr Leu Ser Phe Thr Leu Leu Pro Cys Gly Lys
35 40 45
agc c 148
Ser
<210>
62
<211>
48
<212>
PRT
<213>
Lycopersicon
esculentum
<400>
62
Met Met Met Leu Phe Ile LeuLeu His Ile ThrPro Arg
His Met Val
1 5 10 15
Leu Leu Arg Phe Leu Asp ValLeu Leu Met ThrPhe Gly
Leu Trp Ser
20 25 30
Met His Val Thr Leu Ser ThrLeu Leu Pro GlyLys Ser
Val Phe Cys
35 40 45
<210> 63
<211> 2296
<212> DNA
<213> Beta vulgaris
<220>
<221> CDS
<222> (113)..(1927)
<223> full-length Sugarbeet cDNA sequence
<400> 63
cacacacaca cccgacgccg tatgcgtatc cattctctct cctcaacctc cctttgactt 60
cctcttactc caccatcttc aatgtcgtcg atttccaatc tctaacattc ac atg aca 118
Met Thr
1
acc acc tcc aca aca atg gtg atc gat tct cgc acc get ttc tcc gat 166
Thr Thr Ser Thr Thr Met Val Ile Asp Ser Arg Thr Ala Phe Ser Asp
10 15
tcc aac gac atc agc aat ggc agt agc atc tgc tgc gtc gcc gca aca 214
Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Val Ala Ala Thr
20 25 30
aca act aca aca aca acc gcc gca gaa aac tct ctc tcc ttt act ccc 262
Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe Thr Pro
35 40 45 50
gac gcc gcc get ctt ctc cgc ctc tct gaa aac ctc gac tcg ctt ttc 310
Asp Ala Ala Ala Leu Leu Arg Leu Ser Glu Asn Leu Asp Ser Leu Phe
55 60 65
caa ccc tcg ctt tct ctc tcc gac tcc gac tct ttc gcc gac get aaa 358
Gln Pro Ser Leu Ser Leu Ser Asp Ser Asp Ser Phe Ala Asp Ala Lys
70 75 80
-60-
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
atc gtc gtt tcc ggt gat tcg cgt gaa gtc gcc gtt cat cgg tgt gtt 406
Ile Val Val Ser Gly Asp Ser Arg Glu Val Ala Val His Arg Cys Val
85 90 95
ctc tcg tct cgg agc tcg ttc ttt cgg tcc get ttt get tcg aaa cga 454
Leu Ser Ser Arg Ser Ser Phe Phe Arg Ser Ala Phe Ala Ser Lys Arg
100 105 110
gag aag gag aag gag agg gat aaa gag aga gtg gtg aag ctt gag ctt 502
Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Val Val Lys Leu Glu Leu
115 120 125 130
aaggatttaget ggtgat tttgaggtt ggatttgat tcggttgtt gcg 550
LysAspLeuAla GlyAsp PheGluVal GlyPheAsp SerValVal Ala
135 140 145
gttttaggttat ttgtat agtggcaaa gttaggaat ttgcctaga gga 598
ValLeuGlyTyr LeuTyr SerGlyLys ValArgAsn LeuProArg Gly
150 155 160
atttgtgtttgt gttgat gaggattgc tctcatgaa gettgtcgt cct 646
IleCysValCys ValAsp GluAspCys SerHisGlu AlaCysArg Pro
165 170 175
getgttgatttt gttgtt gaggttctc tatttgtct cacaaattc gag 694
AlaValAspPhe ValVal GluValLeu TyrLeuSer HisLysPhe Glu
180 185 190
attgtcgaattg gtttcg ctttatcag aggcaccta ctggatatt ctt 742
IleValGluLeu ValSer LeuTyrGln ArgHisLeu LeuAspIle Leu
195 200 205 210
gacaagattgca ccagat gacgttcta gtagtgtta tctgtcget gag 790
AspLysIleAla ProAsp AspValLeu ValValLeu SerValAla Glu
215 220 225
atgtgtggaaat gcgtgt gacggattg ctggcaagg tgtattgac aag 838
MetCysGlyAsn AlaCys AspGlyLeu LeuAlaArg CysIleAsp Lys
230 235 240
attgtgaggtcc gatatt gacgtaacc accattgat aaatccttg ccg 886
IleValArgSer AspIle AspValThr ThrIleAsp LysSerLeu Pro
245 250 255
cagaatgttgtg aaacag ataatcgac acgcgaaag gaacttggg ttt 934
GlnAsnValVal LysGln IleIleAsp ThrArgLys GluLeuGly Phe
260 265 270
actgaacctggg cgtgtt gagtttcct gataagcat gtgaagaga ata 982
ThrGluProGly ArgVal GluPhePro AspLysHis ValLysArg Ile
275 280 285 290
cacagagetttg gaatcc gatgatgta gagttagtc agaatgctt tta 1030
HisArgAlaLeu GluSer AspAspVal GluLeuVal ArgMetLeu Leu
295 300 305
aaagagcgccat acaact ctagatgat gcatatgcc cttcactat get 1078
LysGluArgHis ThrThr LeuAspAsp AlaTyrAla LeuHisTyr Ala
310 315 320
-61 -
WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978
gtggca cattgtgat gccaagacc accacg gagcttctt gagcttggg 1126
ValAla HisCysAsp AlaLysThr ThrThr GluLeuLeu GluLeuGly
325 330 335
cttgca gatgttaat cttagaaat ctaagg ggtcacact gtgctacat 1174
LeuAla AspValAsn LeuArgAsn LeuArg GlyHisThr ValLeuHis
340 345 350
gtggca gccatgaga aaagagcct aagata attgtatcc ttgttaacc 1222
ValAla AlaMetArg LysGluPro LysIle IleValSer LeuLeuThr
355 360 365 370
aaggga gcccatccg tctgatata acatca gatgataaa aaagcactg 1270
LysGly AlaHisPro SerAspIle ThrSer AspAspLys LysAlaLeu
375 380 385
cagata gcaaagaga ctaacaaaa getgtg gacttctat aaaactaca 1318
GlnIle AlaLysArg LeuThrLys AlaVal AspPheTyr LysThrThr
390 395 400
gaacaa ggaaaagat gcaccaaag gatcgg ttgtgcatt gaaatactg 1366
GluGln GlyLysAsp AlaProLys AspArg LeuCysIle GluIleLeu
405 410 415
gagcaa getgaaaga agagaacca ttgcta ggagaaggt tctgtttct 1414
GluGln AlaGluArg ArgGluPro LeuLeu GlyGluGly SerValSer
420 425 430
cttgca aaggcagga gatgatctg cgtatg aagctatta tatcttgaa 1462
LeuAla LysAlaGly AspAspLeu ArgMet LysLeuLeu TyrLeuGlu
435 440 445 450
aataga gttgcactt getcggttg ctcttt ccaatggaa gcgaaagtg 1510
AsnArg ValAlaLeu AlaArgLeu LeuPhe ProMetGlu AlaLysVal
455 460 465
getatg gatattget caagtggac ggaact tctgaattc acattgtca 1558
AlaMet AspIleAla GlnVa1Asp GlyThr SerGluPhe ThrLeuSer
470 475 480
aagaat atagetgat gcacgaaga aatgcg gtggacttg aatgagget 1606
LysAsn IleAlaAsp AlaArgArg AsnAla ValAspLeu AsnGluAla
485 490 495
cccttt atattgaaa gaggagcat ttgcag aggatgaaa gcactgtct 1654
ProPhe IleLeuLys GluGluHis LeuGln ArgMetLys AlaLeuSer
500 505 510
aaaact gttgagctt ggcaagcgt ttcttt ccacgctgc tccgatgtt 1702
LysThr ValGluLeu GlyLysArg PhePhe ProArgCys SerAspVal
515 520 525 530
cttaat aagattatg gacgccgaa gatcta tcacagctt gcattttta 1750
LeuAsn LysIleMet AspAlaGlu AspLeu SerGlnLeu AlaPheLeu
535 540 545
ggaaaa gatactcca gaggaacgg caaagg aagagaaaa cgatacctt 1798
GlyLys AspThrPro GluGluArg GlnArg LysArgLys ArgTyrLeu
550 555 560
gaa ctg caa gac get tta act aag get ttt aca gag gac aaa gaa gag 1846
-62-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
Glu Leu Gln Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu
565 570 575
ttt gac cgt tct aca tta tca tca tcg tcg tcg tcg act cca atg ggg 1894
Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr Pro Met Gly
580 585 590
agg cca tat ggt aag acc aat ttc aag agg taa ctccttagca gctcaaagtt 1947
Arg Pro Tyr Gly Lys Thr Asn Phe Lys Arg
595 600 605
gcatacgacg tcacttgtat aatattcatg tatatgtatg aaaatttctt tttgttctcc 2007
ccttctattg atggccacgg tttcgatctt tttggtctgt attataattt ttgaccgatt 2067
acttgataga attgtattct atacatcttt ataagctcat agtaacacca gatttaggta 2127
ctatccgttg gagacacata ctcttgtgtg cgatgatgaa tcaatcatca gattacatta 2187
cacgagccat ttcctgccat attgtaattc atgtatcaag gtacaaataa atagcgtcgt 2247
ggggttgcac ctcttgcatt atcgaaaaaa aaaaaaaaaa aaaaaaaaa 2296
<210> 64
<211> 604
<212> PRT
<213> Beta wlgaris
<400> 64
Met Thr Thr Thr Ser Thr Thr Met Val Ile Asp Ser Arg Thr Ala Phe
1 5 10 15
Ser Asp Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Val Ala
20 25 30
Ala Thr Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe
35 40 45
Thr Pro Asp Ala Ala Ala Leu Leu Arg Leu Ser Glu Asn Leu Asp Ser
50 55 60
Leu Phe Gln Pro Ser Leu Ser Leu Ser Asp Ser Asp Ser Phe Ala Asp
65 70 75 80
Ala Lys Ile Val Val Ser Gly Asp Ser Arg Glu Val Ala Val His Arg
85 90 95
Cys Val Leu Ser Ser Arg Ser Ser Phe Phe Arg Ser Ala Phe Ala Ser
100 105 110
Lys Arg Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Val Val Lys Leu
115 120 125
Glu Leu Lys Asp Leu Ala Gly Asp Phe Glu Val Gly Phe Asp Ser Val
130 135 140
Val Ala Val Leu Gly Tyr Leu Tyr Ser Gly Lys Val Arg Asn Leu Pro
145 150 155 160
Arg Gly Ile Cys Val Cys Val Asp Glu Asp Cys Ser His Glu Ala Cys
165 170 175
Arg Pro Ala Val Asp Phe Val Val Glu Val Leu Tyr Leu Ser His Lys
180 185 190
Phe Glu Ile Val Glu Leu Val Ser Leu Tyr Gln Arg His Leu Leu Asp
195 200 205
Ile Leu Asp Lys Ile Ala Pro Asp Asp Val Leu Val Val Leu Ser Val
210 215 220
Ala Glu Met Cys Gly Asn Ala Cys Asp Gly Leu Leu Ala Arg Cys Ile
225 230 235 240
Asp Lys Ile Val Arg Ser Asp Ile Asp Val Thr Thr Ile Asp Lys Ser
-63-
WO 00/53762 CA 02365968 2001-09-06 PCT/EP00/01978
245 250 255
Leu Pro Gln Asn Val Val Lys Gln Ile Ile Asp Thr Arg Lys Glu Leu
260 265 270
Gly Phe Thr Glu Pro Gly Arg Val Glu Phe Pro Asp Lys His Val Lys
275 280 285
Arg Ile His Arg Ala Leu Glu Ser Asp Asp Val Glu Leu Val Arg Met
290 295 300
Leu Leu Lys Glu Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His
305 310 315 320
Tyr Ala Val Ala His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu
325 330 335
Leu Gly Leu Ala Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val
340 345 350
Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu
355 360 365
Leu Thr Lys Gly Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys
370 375 380
Ala Leu Gln Ile Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys
385 390 395 400
Thr Thr Glu Gln Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu
405 410 415
Ile Leu Glu Gln Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser
420 425 430
Val Ser Leu Ala Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr
435 440 445
Leu Glu Asn Arg Val Ala Leu Ala Arg Leu Leu Phe Pro Met Glu Ala
450 455 460
Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Thr
465 470 475 480
Leu Ser Lys Asn Ile Ala Asp Ala Arg Arg Asn Ala Val Asp Leu Asn
485 490 495
Glu Ala Pro Phe Ile Leu Lys Glu Glu His Leu Gln Arg Met Lys Ala
500 505 510
Leu Ser Lys Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser
515 520 525
Asp Val Leu Asn Lys Ile Met Asp Ala Glu Asp Leu Ser Gln Leu Ala
530 535 540
Phe Leu Gly Lys Asp Thr Pro Glu Glu Arg Gln Arg Lys Arg Lys Arg
545 550 555 560
Tyr Leu Glu Leu Gln Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys
565 570 575
Glu Glu Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr Pro
580 585 590
Met Gly Arg Pro Tyr Gly Lys Thr Asn Phe Lys Arg
595 600
<210> 65
<211> 2844
<212> DNA
<213> Helianthus annuus
<220>
<221> CDS
<222> (737)..(2512)
<223> full-length Sunflower B cDNA sequence
<400> 65
gacgataaaa cccctctctc tttttgctac caagaacctt cctactttct tgcaccaaag 60
-64-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
tttctttgca ggttctttga agcttcttta tcatcatacg ttggtttgat attgtttttg 120
atgcatcttt tcacatgggt tttgcttatt gagtgattat ctgttgtggg tatttgatac 180
aaattgaaaa aaagatgatt agatttggta tttagggttt tggttattga agattttatt 240
aattagggtt tgattagggt ttgattaaga ttcttgtatt ggatgggttg atttagatcc 300
agctgtttgt gggtttcaaa tttttgtttt ggtatttgca tatctcattc taatctattc 360
agaggttgag gttctttagg tttgactttg actttgactt ttgggtactt tcttgtacat 420
gtataatgtt tgatttgatc cattatatgt gttttgtaat tgaatcatag caaattttct 480
tgcctgtata tatatgtttt attgaggatt tggttcaagt tttgaccttt ttgggaaaaa 540
aagtcaaaca catattcttg ttcatgtagt tttgcaaatc aatcatttca caaatctttc 600
tttatgttgg gaatccatct caatcataaa aaagtttctt tctttctttg agttcttgtt 660
agctatgaaa gtttatgatt tgtccttttt gtgataaagt caaaccccta atcatcctgg 720
gactttgact aaatcg atg gcg aat tca tcc gaa ccg tca tca tcc ata agc 772
Met Ala Asn Ser Ser Glu Pro Ser Ser Ser Ile Ser
1 5 10
ttc acc tca tct tca cac ata tct aac ggc gca act agc tac aac ata 820
Phe Thr Ser Ser Ser His Ile Ser Asn Gly Ala Thr Ser Tyr Asn Ile
15 20 25
ccc cca cca tca atc ccc gag cca cgg tcg aat att gaa atc att ggc 868
Pro Pro Pro Ser Ile Pro Glu Pro Arg Ser Asn Ile Glu Ile Ile Gly
30 35 40
tta aat aga ctc agc aca aac cta gag aag ctc gta ttc gat tca ggt 916
Leu Asn Arg Leu Ser Thr Asn Leu Glu Lys Leu Val Phe Asp Ser Gly
45 50 55 60
tct gaa tct gat tgc aat tac agc gat get gaa gtt gtt gtt gag ggt 964
Ser Glu Ser Asp Cys Asn Tyr Ser Asp Ala Glu Val Val Val Glu Gly
65 70 75
att tct gta ggc att cat cgg tgt att tta gcc act aga agt acg ttt 1012
Ile Ser Val Gly Ile His Arg Cys Ile Leu Ala Thr Arg Ser Thr Phe
80 85 90
ttt agc gat ttg ttt aag aag aac aaa ggt tgt gta gag aag gac agt 1060
Phe Ser Asp Leu Phe Lys Lys Asn Lys Gly Cys Val Glu Lys Asp Ser
95 100 105
aag ccg aaa tat aac atg agt gat ttg ttg ccg tat ggg agc gtt ggg 1108
Lys Pro Lys Tyr Asn Met Ser Asp Leu Leu Pro Tyr Gly Ser Val Gly
110 115 120
tat gat gcg ttt ctc gtg ttt tta agc tat gtt tat act ggg aaa ctg 1156
Tyr Asp Ala Phe Leu Val Phe Leu Ser Tyr Val Tyr Thr Gly Lys Leu
125 130 135 140
aaa gcg tct cct ccg gag gtt tca acc tgc gtt gat gat ggg tgt ctt 1204
Lys Ala Ser Pro Pro Glu Val Ser Thr Cys Val Asp Asp Gly Cys Leu
145 150 155
-65-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
catgat gettgt tggcctget attaacttt getgttgag ttgacttat 1252
HisAsp AlaCys TrpProAla IleAsnPhe AlaValGlu LeuThrTyr
160 165 170
gcgtct tcggtt tttcaagtt ccggaatta gtttcgctt tttcagcgt 1300
AlaSer SerVal PheGlnVal ProGluLeu ValSerLeu PheGlnArg
175 180 185
cgtctt ctcaac tttgtggac aaggetctt gttgaagac gtgatcccg 1348
ArgLeu LeuAsn PheValAsp LysAlaLeu ValGluAsp ValIlePro
190 195 200
atcctt gttgtg gcctttcac tgtcagttg caaaacgtc ttatctcgt 1396
IleLeu ValVal AlaPheHis CysGlnLeu GlnAsnVal LeuSerArg
205 210 215 220
tgcatt gaccga gtagttagg tcaaagctc gatactatt tccattgaa 1444
CysIle AspArg ValValArg SerLysLeu AspThrIle SerIleGlu
225 230 235
aaagag cttcca tttgaagtc acccaaatg atcaaatcc attgataac 1492
LysGlu LeuPro PheGluVal ThrGlnMet IleLysSer IleAspAsn
240 245 250
atcatc caagaa gatgacgaa catacagtc gaatcagaa gtcgtgtta 1540
IleIle GlnGlu AspAspGlu HisThrVal GluSerGlu ValValLeu
255 260 265
cgtgaa aagaga attaaaagc atacacaaa gcattagac tgtgacgat 1588
ArgGlu LysArg IleLysSer IleHisLys AlaLeuAsp CysAspAsp
270 275 280
gttgag cttgtg aaaatgatt ttagacgaa tccaaaatc acgttagat 1636
ValGlu LeuVal LysMetIle LeuAspGlu SerLysIle ThrLeuAsp
285 290 295 300
gaagcc tgcget cttcattat gcggtcatg tattgtaat caagaagtt 1684
GluAla CysAla LeuHisTyr AlaValMet TyrCysAsn GlnGluVal
305 310 315
getaag gagatt cttaactta aaccgtgcg gatgttaat cttagaaac 1732
AlaLys GluIle LeuAsnLeu AsnArgAla AspValAsn LeuArgAsn
320 325 330
tcacga gattac accgtgctt catgttget gccatgcgt aaagaacca 1780
SerArg AspTyr ThrValLeu HisValAla AlaMetArg LysGluPro
335 340 345
tcactt attgtt tcgattcta agcaaaggc gcgtgtgca tcggatact 1828
SerLeu IleVal SerIleLeu SerLysGly AlaCysAla SerAspThr
350 355 360
actttt gatgga caaagtgcg gttagtatt tgcaggaga cgaacaagg 1876
ThrPhe AspGly GlnSerAla ValSerIle CysArgArg ArgThrArg
365 370 375 380
cccaag gattat tatgtgaaa accgaacac gggcaagaa acaaataaa 1924
ProLys AspTyr TyrValLys ThrGluHis GlyGlnGlu ThrAsnLys
385 390 395
- 66 -
WO CA 02365968 2001-09-06 pCT~P00/01978
00/53762
gatcgtatatgc atcgat gttttggag cgggaaata aagaggaat ccg 1972
AspArgIleCys IleAsp ValLeuGlu ArgGluIle LysArgAsn Pro
400 405 410
atgataggcgat gtttcc gtgtgttct tcagcagtg getgatgat ttg 2020
MetIleGlyAsp ValSer ValCysSer SerAlaVal AlaAspAsp Leu
415 420 425
catatgaattta ctctac ttagaaaac cgagtggca tttgetcga ctg 2068
HisMetAsnLeu LeuTyr LeuGluAsn ArgValAla PheAlaArg Leu
430 435 440
ttatttccgtca gaagcg aaactagca atggaaatt gcgcatgcc caa 2116
LeuPheProSer GluAla LysLeuAla MetGluIle AlaHisAla Gln
445 450 455 460
acgactgcacag tatccg ggtctattg gcatcgaaa gggtcaaat ggt 2164
ThrThrAlaGln TyrPro GlyLeuLeu AlaSerLys GlySerAsn Gly
465 470 475
aacttaagggag atggat ttgaacgag acaccgttg gtgcagaac aaa 2212
AsnLeuArgGlu MetAsp LeuAsnGlu ThrProLeu ValGlnAsn Lys
480 485 490
agattgctttca agaatg gaagccctt tcccggaca gtggaaatg ggt 2260
ArgLeuLeuSer ArgMet GluAlaLeu SerArgThr ValGluMet Gly
495 500 505
aggcgatatttc cctcat tgttcagag gttctggat aagttcatg gag 2308
ArgArgTyrPhe ProHis CysSerGlu ValLeuAsp LysPheMet Glu
510 515 520
gacgatctacag gatctt tttatcctc gagaagggt accgaagaa gaa 2356
AspAspLeuGln AspLeu PheIleLeu GluLysGly ThrGluGlu Glu
525 530 535 540
caagaaatcaaa aggacg cgatttatg gagcttaaa gaagatgtc caa 2404
GlnGluIleLys ArgThr ArgPheMet GluLeuLys GluAspVal Gln
545 550 555
agagcctttacc aaggac aaggccgag cttcatcgc ggtttgtcc tca 2452
ArgAlaPheThr LysAsp LysAlaGlu LeuHisArg GlyLeuSer Ser
560 565 570
tcaatgtacacc cccaca gtgagaaac gggtcaaag agtaaagcc cgc 2500
SerMetTyrThr ProThr ValArgAsn GlySerLys SerLysAla Arg
575 580 585
aaatactcatga aacccccgtg tttctttgat ttta 2552
gatcttttaa
cacgct
LysTyrSer
590
cgtgcctaat attagaggca aaacatatgt atgaagaaat aatggtggtg catgatgatg 2612
tttagggctc aggtttaggg tttatatgta ctaaattttg tgatttgacg ctaaaaatgc 2672
tatgttgttt tttttttttt ttggataata tggtgtgaaa gctaacgcct tttactagta 2732
gcatgttaat gtttgtgttt gaatcatagt tttttatgca tgtttgtttt acttgcacaa 2792
caactaataa atataatttt tcataataaa aaaaaaaaaa aaaaaaaaaa as 2844
-67-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<210> 66
<211> 591
<212> PRT
<213> Helianthus annuus
<400> 66
Met Ala Asn Ser Ser Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser
1 5 10 15
Ser His Ile Ser Asn Gly Ala Thr Ser Tyr Asn Ile Pro Pro Pro Ser
20 25 30
Ile Pro Glu Pro Arg Ser Asn Ile Glu Ile Ile Gly Leu Asn Arg Leu
35 40 45
Ser Thr Asn Leu Glu Lys Leu Val Phe Asp Ser Gly Ser Glu Ser Asp
50 55 60
Cys Asn Tyr Ser Asp Ala Glu Val Val Val Glu Gly Ile Ser Val Gly
65 70 75 80
Ile His Arg Cys Ile Leu Ala Thr Arg Ser Thr Phe Phe Ser Asp Leu
85 90 95
Phe Lys Lys Asn Lys Gly Cys Val Glu Lys Asp Ser Lys Pro Lys Tyr
100 105 110
Asn Met Ser Asp Leu Leu Pro Tyr Gly Ser Val Gly Tyr Asp Ala Phe
115 120 125
Leu Val Phe Leu Ser Tyr Val Tyr Thr Gly Lys Leu Lys Ala Ser Pro
130 135 140
Pro Glu Val Ser Thr Cys Val Asp Asp Gly Cys Leu His Asp Ala Cys
145 150 155 160
Trp Pro Ala Ile Asn Phe Ala Val Glu Leu Thr Tyr Ala Ser Ser Val
165 170 175
Phe Gln Val Pro Glu Leu Val Ser Leu Phe Gln Arg Arg Leu Leu Asn
180 185 190
Phe Val Asp Lys Ala Leu Val Glu Asp Val Ile Pro Ile Leu Val Val
195 200 205
Ala Phe His Cys Gln Leu Gln Asn Val Leu Ser Arg Cys Ile Asp Arg
210 215 220
Val Val Arg Ser Lys Leu Asp Thr Ile Ser Ile Glu Lys Glu Leu Pro
225 230 235 240
Phe Glu Val Thr Gln Met Ile Lys Ser Ile Asp Asn Ile Ile Gln Glu
245 250 255
Asp Asp Glu His Thr Val Glu Ser Glu Val Val Leu Arg Glu Lys Arg
260 265 270
Ile Lys Ser Ile His Lys Ala Leu Asp Cys Asp Asp Val Glu Leu Val
275 280 285
Lys Met Ile Leu Asp Glu Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala
290 295 300
Leu His Tyr Ala Val Met Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile
305 310 315 320
Leu Asn Leu Asn Arg Ala Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr
325 330 335
Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Ser Leu Ile Val
340 345 350
Ser Ile Leu Ser Lys Gly Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly
355 360 365
Gln Ser Ala Val Ser Ile Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr
370 375 380
Tyr Val Lys Thr Glu His Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys
385 390 395 400
Ile Asp Val Leu Glu Arg Glu Ile Lys Arg Asn Pro Met Ile Gly Asp
405 410 415
Val Ser Val Cys Ser Ser Ala Val Ala Asp Asp Leu His Met Asn Leu
-68-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
420 425 430
Leu Tyr Leu Glu Asn Arg Val Ala Phe Ala Arg Leu Leu Phe Pro Ser
435 440 445
Glu Ala Lys Leu Ala Met Glu Ile Ala His Ala Gln Thr Thr Ala Gln
450 455 460
Tyr Pro Gly Leu Leu Ala Ser Lys Gly Ser Asn Gly Asn Leu Arg Glu
465 470 475 480
Met Asp Leu Asn Glu Thr Pro Leu Val Gln Asn Lys Arg Leu Leu Ser
485 490 495
Arg Met Glu Ala Leu Ser Arg Thr Val Glu Met Gly Arg Arg Tyr Phe
500 505 510
Pro His Cys Ser Glu Val Leu Asp Lys Phe Met Glu Asp Asp Leu Gln
515 520 525
Asp Leu Phe Ile Leu Glu Lys Gly Thr Glu Glu Glu Gln Glu Ile Lys
530 535 540
Arg Thr Arg Phe Met Glu Leu Lys Glu Asp Val Gln Arg Ala Phe Thr
545 550 555 560
Lys Asp Lys Ala Glu Leu His Arg Gly Leu Ser Ser Ser Met Tyr Thr
565 570 575
Pro Thr Val Arg Asn Gly Ser Lys Ser Lys Ala Arg Lys Tyr Ser
580 585 590
<210> 67
<211> 1477
<212> DNA
<213> Arabidopsis haliana
t
<220>
<221> CDS
<222> (1)..(804)
<223> AtNMLc2 sequence
cDNA
<220>
<221> misc_feature
<222> (1)..(1477)
<223> n = c r
a, t, o g
<400> 67
atg agc aat gaagaa tctttgaga tctctatcg ttggat ttcctg 48
ctt
Met Ser Asn GluGlu SerLeuArg SerLeuSer LeuAsp PheLeu
Leu
5 10 15
aac cta cta aacggt caagetttc tccgacgtg actttc agcgtt 96
atc
Asn Leu Leu AsnGly GlnAlaPhe SerAspVal ThrPhe SerVal
Ile
20 25 30
gaa ggt cgt gtccac getcaccgt tgtatcctc gccgca cggagg 144
tta
Glu Gly Arg ValHis AlaHisArg CysIleLeu AlaAla ArgArg
Leu
35 40 45
ctt ttc ttc aaattc ttttgtggg acagactca ccacaa cctgtc 192
cgc
Leu Phe Phe LysPhe PheCysGly ThrAspSer ProGln ProVal
Arg
50 55 60
aca ggt ata ccgacc caacatggg tccgtaccc getagc ccaaca 240
gac
Thr Gly Ile ProThr GlnHisGly SerValPro AlaSer ProThr
Asp
65 70 75 80
aga ggc tcc acg gcc cca get gga att ata cca gtg aac tca gtc ggt 288
-69-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
ArgGly SerThrAla ProAlaGly IleIlePro ValAsn SerValGly
85 90 95
tatgag gtttttctg ttgctactt cagtttctt tatagc ggacaagtc 336
TyrGlu ValPheLeu LeuLeuLeu GlnPheLeu TyrSer GlyGlnVal
100 105 110
tccatc gtgccgcag aaacacgag cctagacct aattgt ggcgagaga 384
SerIle ValProGln LysHisGlu ProArgPro AsnCys GlyGluArg
115 120 125
ggatgt tggcacact cattgctca gccgccgtt gatctt getcttgat 432
GlyCys TrpHisThr HisCysSer AlaAlaVal AspLeu AlaLeuAsp
130 135 140
actctc gccgcctct cgttacttc ggcgtcgag cagctc gcattgctc 480
ThrLeu AlaAlaSer ArgTyrPhe GlyValGlu GlnLeu AlaLeuLeu
145 150 155 160
acccag aaacaattg gcaagcatg gtggagaaa gcctct atcgaagat 528
ThrGln LysGlnLeu AlaSerMet ValGluLys AlaSer IleGluAsp
165 170 175
gtgatg aaagtttta atagcatca agaaagcaa gacatg catcaatta 576
ValMet LysValLeu IleAlaSer ArgLysGln AspMet HisGlnLeu
180 185 190
tggacc acctgctct cacttagtt getaaatca ggtctc ccaccagag 624
TrpThr ThrCysSer HisLeuVal AlaLysSer GlyLeu ProProGlu
195 200 205
attctt gccaagcat ctccctatt gacgtcgtc accaaa atagaagag 672
IleLeu AlaLysHis LeuProIle AspValVal ThrLys IleGluGlu
210 215 220
cttcgt cttaaatct tctataget cgccgttct ctaatg cctcacaac 720
LeuArg LeuLysSer SerIleAla ArgArgSer LeuMet ProHisAsn
225 230 235 240
caccac catgatctc agcggngnt caanaccta aagntc aaagttaga 768
HisHis HisAspLeu SerXaaXaa GlnXaaLeu LysXaa LysValArg
245 250 255
aggttg agccgactt ggattcttc aacgngaac tagtaaagctgat 814
ArgLeu SerArgLeu GlyPhePhe AsnXaaAsn
260 265
ggtaatggan aaggactcca ttcttgatga agtcgtaagc attgcattac cgcttgttaa 874
aagctgtaga agagaagttg tgaagncttt ngcttgaagc ttggaagctg ccgatgtgaa 934
ttatccggcg ggtccggcaa ggnaaancac ctttgcactt cgcgggntga gatggtctct 994
ccagacatgg tggctgttct gttagcccnc catgcttgat cctaatgtga ggacagttgg 1054
tggaatcacg cctcttgata tccttagaac attaacttcg gatttcttgt tcaaggggca 1114
gttcctggat tgactcacat tgaaccgaat aaacttaggc tttgcctcga gcttgttcaa 1174
tccgctgcaa tggtgatatc tcgagaagaa ggaaacaata gcaacaacca aaacaatgat 1234
-70-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
aacaataccg ggatttaccc tcatatgaat gaggagcaca atagtggaag cagtggaggg 1294
agcaataaca atttggattc aagattggtt tatctcaatc ttggagcagg tacgggtcag 1354
atgggtccag gtcgagatca aggggatgac cataacagtc agagggaagg tatgagtcgg 1414
catcatcatc atcatcaaga cccatctaca atgtatcatc accatcatca acatcacttc 1474
tag 1477
<210> 68
<211> 267
<212> PRT
<213> Arabidopsis thaliana
<400> 68
Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu
1 5 10 15
Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val
20 25 30
Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Arg
35 40 45
Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val
50 55 60
Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr
65 70 75 80
Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val Asn Ser Val Gly
85 90 95
Tyr Glu Val Phe Leu Leu Leu Leu Gln Phe Leu Tyr Ser Gly Gln Val
100 105 110
Ser Ile Val Pro Gln Lys His Glu Pro Arg Pro Asn Cys Gly Glu Arg
115 120 125
Gly Cys Trp His Thr His Cys Ser Ala Ala Val Asp Leu Ala Leu Asp
130 135 140
Thr Leu Ala Ala Ser Arg Tyr Phe Gly Val Glu Gln Leu Ala Leu Leu
145 150 155 160
Thr Gln Lys Gln Leu Ala Ser Met Val Glu Lys Ala Ser Ile Glu Asp
165 170 175
Val Met Lys Val Leu Ile Ala Ser Arg Lys Gln Asp Met His Gln Leu
180 185 190
Trp Thr Thr Cys Ser His Leu Val Ala Lys Ser Gly Leu Pro Pro Glu
195 200 205
Ile Leu Ala Lys His Leu Pro Ile Asp Val Val Thr Lys Ile Glu Glu
210 215 220
Leu Arg Leu Lys Ser Ser Ile Ala Arg Arg Ser Leu Met Pro His Asn
225 230 235 240
His His His Asp Leu Ser Xaa Xaa Gln Xaa Leu Lys Xaa Lys Val Arg
245 250 255
Arg Leu Ser Arg Leu Gly Phe Phe Asn Xaa Asn
260 265
<210> 69
<211> 1725
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
-71 -
WOOU/53762 CA 02365968 2001-09-06 pCT~,P00/01978
<222>
(1)..(1725)
<223> cDNA
AtNMLc4-1 sequence
<400>
69
atgget gcaactgca atagagcca tcttcatct ataagtttc acatct 48
MetAla AlaThrAla IleGluPro SerSerSer IleSerPhe ThrSer
1 5 10 15
tctcac ttatcaaac ccttctcct gttgttact acttatcac tcaget 96
SerHis LeuSerAsn ProSerPro ValValThr ThrTyrHis SerAla
20 25 30
gccaat cttgaagag ctcagctct aacttggag cagcttctc actaat 144
AlaAsn LeuGluGlu LeuSerSer AsnLeuGlu GlnLeuLeu ThrAsn
35 40 45
ccagat tgcgattac actgacgca gagatcatc attgaagaa gaaget 192
ProAsp CysAspTyr ThrAspAla GluIleIle IleGluGlu GluAla
50 55 60
aaccct gtgagtgtt catagatgt gttttaget getaggagc aagttt 240
AsnPro ValSerVal HisArgCys ValLeuAla AlaArgSer LysPhe
65 70 75 80
tttctt gatctgttt aagaaagat aaagatagt agtgagaag aaacct 288
PheLeu AspLeuPhe LysLysAsp LysAspSer SerGluLys LysPro
85 90 95
aagtat caaatgaaa gatttatta ccatatgga aatgtggga cgtgag 336
LysTyr GlnMetLys AspLeuLeu ProTyrGly AsnValGly ArgGlu
100 105 110
gcattt ctgcatttc ttgagctat atctacact gggaggtta aagcct 384
AlaPhe LeuHisPhe LeuSerTyr IleTyrThr GlyArgLeu LysPro
115 120 125
tttcct atcgaggtt tcaacttgt gttgattca gtttgtget catgat 432
PhePro IleGluVal SerThrCys ValAspSer ValCysAla HisAsp
130 135 140
tcttgt aaaccggcc attgatttt getgttgag ttgatgtat gettca 480
SerCys LysProAla IleAspPhe AlaValGlu LeuMetTyr AlaSer
145 150 155 160
tttgtg ttccaaatc ccggatctt gtttcgtca tttcagcgg aagctt 528
PheVal PheGlnIle ProAspLeu ValSerSer PheGlnArg LysLeu
165 170 175
cgtaac tatgttgag aagtcacta gtagagaat gttcttcct atcctc 576
ArgAsn TyrValGlu LysSerLeu ValGluAsn ValLeuPro IleLeu
180 185 190
ttagtt gcgtttcat tgtgatttg acacagctt cttgatcaa tgcatt 624
LeuVal AlaPheHis CysAspLeu ThrGlnLeu LeuAspGln CysIle
195 200 205
gagaga gtggcgaga tcagactta gacagattc tgtatcgaa aaggag 672
GluArg ValAlaArg SerAspLeu AspArgPhe CysIleGlu LysGlu
210 215 220
ctt cct tta gaa gta ttg gaa aaa atc aaa cag ctt cga gtt aag tcg 720
-72-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
LeuPro LeuGlu ValLeuGlu LysIleLys GlnLeuArg ValLysSer
225 230 235 240
gtgaac ataccc gaggtggag gataaatcg atagagaga acagggaaa 768
ValAsn IlePro GluValGlu AspLysSer IleGluArg ThrGlyLys
245 250 255
gtactc aaggca ttggattca gatgatgta gaactcgtg aagcttctt 816
ValLeu LysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu
260 265 270
ttgact gagtca gatataact ctagaccaa gccaatggt ctacattat 864
LeuThr GluSer AspIleThr LeuAspGln AlaAsnGly LeuHisTyr
275 280 285
gcagtg gcatac agtgatccg aaagttgtg acacaggtt cttgatcta 912
AlaVal AlaTyr SerAspPro LysValVal ThrGlnVal LeuAspLeu
290 295 300
gatatg getgat gttaatttc agaaattcc agggggtat acggttctt 960
AspMet AlaAsp ValAsnPhe ArgAsnSer ArgGlyTyr ThrValLeu
305 310 315 320
catatt getget atgcgtaga gagccaaca attatcata ccacttatt 1008
HisIle AlaAla MetArgArg GluProThr IleIleIle ProLeuIle
325 330 335
caaaaa ggaget aatgettca gatttcacg tttgatgga cgcagtgcg 1056
GlnLys GlyAla AsnAlaSer AspPheThr PheAspGly ArgSerAla
340 345 350
gtaaat atatgt aggagactc actaggccg aaagattat cataccaaa 1104
ValAsn IleCys ArgArgLeu ThrArgPro LysAspTyr HisThrLys
355 360 365
acctca aggaaa gaacctagt aaataccgc ttatgcatc gatatcttg 1152
ThrSer ArgLys GluProSer LysTyrArg LeuCysIle AspIleLeu
370 375 380
gaaagg gaaatt agaaggaat ccattggtt agtggggat acacccact 1200
GluArg GluIle ArgArgAsn ProLeuVal SerGlyAsp ThrProThr
385 390 395 400
tgttcc cattcg atgcccgag gatctccaa atgaggttg ttatactta 1248
CysSer HisSer MetProGlu AspLeuGln MetArgLeu LeuTyrLeu
405 410 415
gaaaag cgagtg ggacttget cagttgttc ttcccagca gaagccaat 1296
GluLys ArgVal GlyLeuAla GlnLeuPhe PheProAla GluAlaAsn
420 425 430
gtgget atggac gttgetaat gttgaaggg acaagcgag tgcacaggt 1344
ValAla MetAsp ValAlaAsn ValGluGly ThrSerGlu CysThrGly
435 440 445
cttcta actcca cctccatca aatgataca actgaaaac ttgggtaaa 1392
LeuLeu ThrPro ProProSer AsnAspThr ThrGluAsn LeuGlyLys
450 455 460
gtcgat ttaaat gaaacgcct tatgtgcaa acgaaaaga atgcttaca 1440
ValAsp LeuAsn GluThrPro TyrValGln ThrLysArg MetLeuThr
-73-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
465 470 475 480
cgt atg aaa gcc ctc atg aaa aca gtt gag aca ggt cgg aga tac ttc 1488
Arg Met Lys Ala Leu Met Lys Thr Val Glu Thr Gly Arg Arg Tyr Phe
485 490 495
ccatcttgttat gaggttctg gataagtac atggat cagtatatggac 1536
ProSerCysTyr GluValLeu AspLysTyr MetAsp GlnTyrMetAsp
500 505 510
gaagaaatccct gatatgtcg tatcccgag aaaggc actgtgaaagag 1584
G1uGluIlePro AspMetSer TyrProGlu LysGly ThrValLysGlu
515 520 525
agaagacagaag aggatgaga tataacgag ctgaag aacgacgttaaa 1632
ArgArgGlnLys ArgMetArg TyrAsnGlu LeuLys AsnAspValLys
530 535 540
aaagcatatagc aaagacaaa gtcgcgcgg tcttgt ctttcttcttca 1680
LysAlaTyrSer LysAspLys ValAlaArg SerCys LeuSerSerSer
545 550 555 560
tcaccagettct tctcttaga gaagcctta gagaat ccaacatga 1725
SerProAlaSer SerLeuArg GluAlaLeu GluAsn ProThr
565 570 575
<210>
70
<211> 4
57
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 70
Met Ala Ala Thr Ala Ile Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser
1 5 10 15
Ser His Leu Ser Asn Pro Ser Pro Val Val Thr Thr Tyr His Ser Ala
20 25 30
Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gln Leu Leu Thr Asn
35 40 45
Pro Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala
50 55 60
Asn Pro Val Ser Val His Arg Cys Val Leu Ala Ala Arg Ser Lys Phe
65 70 75 80
Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys Pro
85 90 95
Lys Tyr Gln Met Lys Asp Leu Leu Pro Tyr Gly Asn Val Gly Arg Glu
100 105 110
Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys Pro
115 120 125
Phe Pro Ile Glu Val Ser Thr Cys Val Asp Ser Val Cys Ala His Asp
130 135 140
Ser Cys Lys Pro Ala Ile Asp Phe Ala Val Glu Leu Met Tyr Ala Ser
145 150 155 160
Phe Val Phe Gln Ile Pro Asp Leu Val Ser Ser Phe Gln Arg Lys Leu
165 170 175
Arg Asn Tyr Val Glu Lys Ser Leu Val Glu Asn Val Leu Pro Ile Leu
180 185 190
Leu Val Ala Phe His Cys Asp Leu Thr Gln Leu Leu Asp Gln Cys Ile
195 200 205
Glu Arg Val Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu
210 215 220
-74-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
Leu Pro Leu Glu Val Leu Glu Lys Ile Lys Gln Leu Arg Val Lys Ser
225 230 235 240
Val Asn Ile Pro Glu Val Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys
245 250 255
Val Leu Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu
260 265 270
Leu Thr Glu Ser Asp Ile Thr Leu Asp Gln Ala Asn Gly Leu His Tyr
275 280 285
Ala Val Ala Tyr Ser Asp Pro Lys Val Val Thr Gln Val Leu Asp Leu
290 295 300
Asp Met Ala Asp Val Asn Phe Arg Asn Ser Arg Gly Tyr Thr Val Leu
305 310 315 320
His Ile Ala Ala Met Arg Arg Glu Pro Thr Ile Ile Ile Pro Leu Ile
325 330 335
Gln Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala
340 345 350
Val Asn Ile Cys Arg Arg Leu Thr Arg Pro Lys Asp Tyr His Thr Lys
355 360 365
Thr Ser Arg Lys Glu Pro Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu
370 375 380
Glu Arg Glu Ile Arg Arg Asn Pro Leu Val Ser Gly Asp Thr Pro Thr
385 390 395 400
Cys Ser His Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu
405 410 415
Glu Lys Arg Val Gly Leu Ala Gln Leu Phe Phe Pro Ala Glu Ala Asn
420 425 430
Val Ala Met Asp Val Ala Asn Val Glu Gly Thr Ser Glu Cys Thr Gly
435 440 445
Leu Leu Thr Pro Pro Pro Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys
450 455 460
Val Asp Leu Asn Glu Thr Pro Tyr Val Gln Thr Lys Arg Met Leu Thr
465 470 475 480
Arg Met Lys Ala Leu Met Lys Thr Val Glu Thr Gly Arg Arg Tyr Phe
485 490 495
Pro Ser Cys Tyr Glu Val Leu Asp Lys Tyr Met Asp Gln Tyr Met Asp
500 505 510
Glu Glu Ile Pro Asp Met Ser Tyr Pro Glu Lys Gly Thr Val Lys Glu
515 520 525
Arg Arg Gln Lys Arg Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys
530 535 540
Lys Ala Tyr Ser Lys Asp Lys Val Ala Arg Ser Cys Leu Ser Ser Ser
545 550 555 560
Ser Pro Ala Ser Ser Leu Arg Glu Ala Leu Glu Asn Pro Thr
565 570
<210> 71
<211> 1818
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (13)..(1818)
<223> AtNMLc4-2 cDNA sequence
<400> 71
gccgatctcg tg atg atg gcc acc acc acc acc acc acc acc get aga ttc 51
Met Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe
1 5 10
-75-
W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
tctgattcatac gagttc agcaacaca agcggcaatagc ttcttc gcc 99
SerAspSerTyr GluPhe SerAsnThr SerGlyAsnSer PhePhe Ala
15 20 25
gccgagtcatct cttgat tatccgacg gaatttctcacg ccaccg gag 147
AlaGluSerSer LeuAsp TyrProThr GluPheLeuThr ProPro Glu
30 35 40 45
gtatcagetctt aaactt ctgtctaac tgcctcgagtct gttttc gac 195
ValSerAlaLeu LysLeu LeuSerAsn CysLeuGluSer ValPhe Asp
50 55 60
tcgccggagacg ttctac agcgatget aagctagttctc gccggc ggc 243
SerProGluThr PheTyr SerAspAla LysLeuValLeu AlaGly Gly
65 70 75
cgggaagtttct tttcac cgttgtatt ctttccgcgaga attcct gtc 291
ArgGluValSer PheHis ArgCysIle LeuSerAlaArg IlePro Val
80 85 90
ttcaaaagcget ttagcc accgtgaag gaacaaaaatcc tccacc acc 339
PheLysSerAla LeuAla ThrValLys GluGlnLysSer SerThr Thr
95 100 105
gtgaagctccag ctgaaa gagatcgcc agagattacgaa gtcggc ttt 387
ValLysLeuGln LeuLys GluIleAla ArgAspTyrGlu ValGly Phe
110 115 120 125
gactcggttgtg gcggtt ttggcgtat gtttacagcggc agagtg agg 435
AspSerValVal AlaVal LeuAlaTyr ValTyrSerGly ArgVal Arg
130 135 140
tccccgccgaag ggaget tctgettgc gtagacgacgat tgttgc cac 483
SerProProLys GlyAla SerAlaCys ValAspAspAsp CysCys His
145 150 155
gtggettgccgg tcaaag gtggatttc atggtggaggtt ctttat ctg 531
ValAlaCysArg SerLys ValAspPhe MetValGluVal LeuTyr Leu
160 165 170
tctttcgttttc cagatt caagaatta gttactctgtat gagagg cag 579
SerPheValPhe GlnIle GlnGluLeu ValThrLeuTyr GluArg Gln
175 180 185
ttcttggaaatt gtagac aaagttgta gtcgaagacatc ttggtt ata 627
PheLeuGluIle ValAsp LysValVal ValGluAspIle LeuVal Ile
190 195 200 205
ttcaagcttgat actcta tgtggtaca acatacaagaag cttttg gat 675
PheLysLeuAsp ThrLeu CysGlyThr ThrTyrLysLys LeuLeu Asp
210 215 220
agatgcatagaa attatc gtgaagtct gatatagaacta gttagt ctt 723
ArgCysIleGlu IleIle ValLysSer AspIleGluLeu ValSer Leu
225 230 235
gagaagtcttta cctcaa cacattttc aagcaaatcata gacatc cgc 771
GluLysSerLeu ProGln HisIlePhe LysGlnIleIle AspIle Arg
240 245 250
-76-
WO CA 02365968 2001-09-06 pCT/EP00/01978
00/53762
gaa gcg ctctgtcta gagccacct aaactagaa aggcatgtc aagaac 819
Glu Ala LeuCysLeu GluProPro LysLeuGlu ArgHisVal LysAsn
255 260 265
ata tac aaggcgcta gactcagat gatgttgag cttgtcaag atgctt 867
Ile Tyr LysAlaLeu AspSerAsp AspValGlu LeuValLys MetLeu
270 275 280 285
ttg cta gaaggacac accaatctc gatgaggcg tatgetctt catttt 915
Leu Leu GluGlyHis ThrAsnLeu AspGluAla TyrAlaLeu HisPhe
290 295 300
get atc getcactgc getgtgaag accgcgtat gatctcctc gagctt 963
Ala Ile AlaHisCys AlaValLys ThrAlaTyr AspLeuLeu GluLeu
305 310 315
gag ctt gcggatgtt aaccttaga aatccgagg ggatacact gtgctt 1011
Glu Leu AlaAspVal AsnLeuArg AsnProArg GlyTyrThr ValLeu
320 325 330
cat gtt getgcgatg cggaaggag ccgaagttg ataatatct ttgtta 1059
His Val AlaAlaMet ArgLysGlu ProLysLeu IleIleSer LeuLeu
335 340 345
atg aaa ggggcaaat attttagac acaacattg gatggtaga accget 1107
Met Lys GlyAlaAsn IleLeuAsp ThrThrLeu AspGlyArg ThrAla
350 355 360 365
tta gtg attgtaaaa cgactcact aaagcggat gactacaaa actagt 1155
Leu Val IleValLys ArgLeuThr LysAlaAsp AspTyrLys ThrSer
370 375 380
acg gag gacggtacg ccttctctg aaaggcgga ttatgcata gaggta 1203
Thr Glu AspGlyThr ProSerLeu LysGlyGly LeuCysIle GluVal
385 390 395
ctt gag catgaacaa aaactagaa tatttgtcg cctatagag gettca 1251
Leu Glu HisGluGln LysLeuGlu TyrLeuSer ProIleGlu AlaSer
400 405 410
ctt tct cttccagta actccagag gagttgagg atgaggttg ctctat 1299
Leu Ser LeuProVal ThrProGlu GluLeuArg MetArgLeu LeuTyr
415 420 425
tat gaa aaccgagtt gcacttget cgacttctc tttccagtg gaaact 1347
Tyr Glu AsnArgVal AlaLeuAla ArgLeuLeu PheProVal GluThr
430 435 440 445
gaa act gtacagggt attgccaaa ttggaggaa acatgcgag tttaca 1395
Glu Thr ValGlnGly IleAlaLys LeuGluGlu ThrCysGlu PheThr
450 455 460
get tct agtctcgag cctgatcat cacattggt gaaaagcgg acatca 1443
Ala Ser SerLeuGlu ProAspHis HisIleGly GluLysArg ThrSer
465 470 475
cta gac ctaaatatg gcgccgttc caaatccat gagaagcat ttgagt 1491
Leu Asp LeuAsnMet AlaProPhe GlnIleHis GluLysHis LeuSer
480 485 490
aga cta agagcactt tgtaaaacc gtggaactg gggaaacgc tacttc 1539
_77_
WO CA 02365968 pCT/EP00/01978
00/53762 2001-09-06
Arg Leu Ala LeuCysLysThr ValGlu LeuGlyLys ArgTyrPhe
Arg
495 500 505
aaa cga tcg cttgatcacttt atggat actgaggac ttgaatcat 1587
tgt
Lys Arg Ser LeuAspHisPhe MetAsp ThrGluAsp LeuAsnHis
Cys
510 515 520 525
ctt get gta gaagaagatact cctgag aaacggcta caaaagaag 1635
agc
Leu Ala Val GluGluAspThr ProGlu LysArgLeu GlnLysLys
Ser
530 535 540
caa agg atg gaactacaagag actctg atgaagacc tttagtgag 1683
tac
Gln Arg Met GluLeuGlnGlu ThrLeu MetLysThr PheSerGlu
Tyr
545 550 555
gac aag gaa tgtggaaagtct tccaca ccgaaacca acctctgcg 1731
gag
Asp Lys Glu CysGlyLysSer SerThr ProLysPro ThrSerAla
Glu
560 565 570
gtg agg aat agaaaactctct caccgg cgcctaaaa gtggacaaa 1779
tct
Val Arg Asn ArgLysLeuSer HisArg ArgLeuLys ValAspLys
Ser
575 580 585
cgg gat ttg aaacgaccttac gggaac ggggattaa 1818
ttt
Arg Asp Leu LysArgProTyr GlyAsn GlyAsp
Phe
590 595 600
<210>
72
<211>
601
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 72
Met Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe Ser Asp Ser
1 5 10 15
Tyr Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser
20 25 30
Ser Leu Asp Tyr Pro Thr Glu Phe Leu Thr Pro Pro Glu Val Ser Ala
35 40 45
Leu Lys Leu Leu Ser Asn Cys Leu Glu Ser Val Phe Asp Ser Pro Glu
50 55 60
Thr Phe Tyr Ser Asp Ala Lys Leu Val Leu Ala Gly Gly Arg Glu Val
65 70 75 80
Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ile Pro Val Phe Lys Ser
85 90 95
Ala Leu Ala Thr Val Lys Glu Gln Lys Ser Ser Thr Thr Val Lys Leu
100 105 110
Gln Leu Lys Glu Ile Ala Arg Asp Tyr Glu Val Gly Phe Asp Ser Val
115 120 125
Val Ala Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Ser Pro Pro
130 135 140
Lys Gly Ala Ser Ala Cys Val Asp Asp Asp Cys Cys His Val Ala Cys
145 150 155 160
Arg Ser Lys Val Asp Phe Met Val Glu Val Leu Tyr Leu Ser Phe Val
165 170 175
Phe Gln Ile Gln Glu Leu Val Thr Leu Tyr Glu Arg Gln Phe Leu Glu
180 185 190
Ile Val Asp Lys Val Val Val Glu Asp Ile Leu Val Ile Phe Lys Leu
195 200 205
Asp Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile
_78_
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
210 215 220
Glu Ile Ile Val Lys Ser Asp Ile Glu Leu Val Ser Leu Glu Lys Ser
225 230 235 240
Leu Pro Gln His Ile Phe Lys Gln Ile Ile Asp Ile Arg Glu Ala Leu
245 250 255
Cys Leu Glu Pro Pro Lys Leu Glu Arg His Val Lys Asn Ile Tyr Lys
260 265 270
Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Leu Glu
275 280 285
Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala
290 295 300
His Cys Ala Val Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala
305 310 315 320
Asp Val Asn Leu Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala
325 330 335
Ala Met Arg Lys Glu Pro Lys Leu Ile Ile Ser Leu Leu Met Lys Gly
340 345 350
Ala Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Val Ile
355 360 365
Val Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp
370 375 380
Gly Thr Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His
385 390 395 400
Glu Gln Lys Leu Glu Tyr Leu Ser Pro Ile Glu Ala Ser Leu Ser Leu
405 410 415
Pro Val Thr Pro Glu Glu Leu Arg Met Arg Leu Leu Tyr Tyr Glu Asn
420 425 430
Arg Val Ala Leu Ala Arg Leu Leu Phe Pro Val Glu Thr Glu Thr Val
435 440 445
Gln Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser
450 455 460
Leu Glu Pro Asp His His Ile Gly Glu Lys Arg Thr Ser Leu Asp Leu
465 470 475 480
Asn Met Ala Pro Phe Gln Ile His Glu Lys His Leu Ser Arg Leu Arg
485 490 495
Ala Leu Cys Lys Thr Val Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys
500 505 510
Ser Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser
515 520 525
Val Glu Glu Asp Thr Pro Glu Lys Arg Leu Gln Lys Lys Gln Arg Tyr
530 535 540
Met Glu Leu Gln Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu
545 550 555 560
Glu Cys Gly Lys Ser Ser Thr Pro Lys Pro Thr Ser Ala Val Arg Ser
565 570 575
Asn Arg Lys Leu Ser His Arg Arg Leu Lys Val Asp Lys Arg Asp Phe
580 585 590
Leu Lys Arg Pro Tyr Gly Asn Gly Asp
595 600
<210> 73
<211> 2673
<212> DNA
<213> Nicotiana tabacum
<220>
<221> CDS
<222> (661)..(1767)
<223> full-length Tobacco B cDNA sequence
_79_
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
<220>
<221> misc_feature
<222> (1). (2673)
<223> n = a, t, c or g
<400> 73
tcgagcggcc gcccgggcag gtaaactcta acccttttaa tctttttttg gttgcatttc 60
ggatctaacc tcaggaaaaa aaacagtatt tttagcctct gcaattgcaa attttctcgt 120
ttttttagcc gaagtgaatg ttattccaat tgggtaagct gtgatcaagc agttgaagtt 180
ttttgttgca aaatttgcca gttatcttga ctttttgtga agttggtaaa tttttcattt 240
gggtaagttg tgatcaagca gttgaagatt tgcactttgt attcttactg tgaaattgca 300
gttttgttga ttatagatgg ggtggaattg ttaatttctt ctaaagtttt aaagggttga 360
tttggtttta cctgaaatag ggagaatatg acttgtagtt ttggaatttg cttcttttct 420
tggtctgcat agttgaatgt tattagaaaa cttatggaaa gttttggtca aacttttgtc 480
ctttgagaag aatttcttgt attggtgatt ggttatggtc ttggagaggt tctttttttt 540
tttgcataga gcctgtgcgg agaatattat acatggttaa aaacattaga ttttctggac 600
tttgactatc ttagatgtag ataaattttg tatatgtttt tagaccatta gaattgggaa 660
atg get tgt tct get gaa cca tca tca tct ata agc ttt act tca tct 708
Met Ala Cys Ser Ala Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser
1 5 10 15
tcc att aca tcg aat ggg tcg att ggc gtt ggc caa aac act cat get 756
Ser Ile Thr Ser Asn Gly Ser Ile Gly Val Gly Gln Asn Thr His Ala
20 25 30
tat ggc ggc tct gag aca ggg agt agt tat gaa atc atc agc ttg agt 804
Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser
35 40 45
aaa ctc agt aac aat tta gag caa ctc ttg tca gat tcc agc tct gat 852
Lys Leu Ser Asn Asn Leu Glu Gln Leu Leu Ser Asp Ser Ser Ser Asp
50 55 60
ttt act gat get gag att gtt gtt gag ggt gtt tca ctt ggt gtt cac 900
Phe Thr Asp Ala Glu Ile Val Val Glu Gly Val Ser Leu Gly Val His
65 70 75 80
cgt tgt ata tta get gcc agg agt aaa ttt ttt cag gat ctt ttt agg 948
Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gln Asp Leu Phe Arg
85 90 95
aaa gag aag gga agt tgt gga aag gaa ggt aaa cca aga tat tct atg 996
Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys Pro Arg Tyr Ser Met
100 105 110
acc gat att ttg cct tat ggt aag gtt gga tat gag get ttc gtt acc 1044
Thr Asp Ile Leu Pro Tyr Gly Lys Val Gly Tyr Glu Ala Phe Val Thr
115 120 125
-80-
WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978
ttcctaagctat ttgtactca ggaaaattg aagcatttc cctccggag 1092
PheLeuSerTyr LeuTyrSer GlyLysLeu LysHisPhe ProProGlu
130 135 140
gtatcaacatgt atggacact atatgtget catgactct tgcagacca 1140
ValSerThrCys MetAspThr IleCysAla HisAspSer CysArgPro
145 150 155 160
gcaattaatttt agtgtggag ttgatgtat gcctcttcc atgtttcag 1188
AlaIleAsnPhe SerValGlu LeuMetTyr AlaSerSer MetPheGln
165 170 175
gttccagagcta gtatcactt ttcctgaga cgccttatc aattttgtt 1236
ValProGluLeu ValSerLeu PheLeuArg ArgLeuIle AsnPheVal
180 185 190
gggaaggetctt gtggaagat gttatccca atacttaga gttgetttt 1284
GlyLysAlaLeu ValGluAsp ValIlePro IleLeuArg ValAlaPhe
195 200 205
cattgccaattg agcgagctt ctcactcat tccgttgat agagtagca 1332
HisCysGlnLeu SerGluLeu LeuThrHis SerValAsp ArgValAla
210 215 220
cgatcagatctt gaaatcaca tgcattgag aaagaggtt ccctttgaa 1380
ArgSerAspLeu GluIleThr CysIleGlu LysGluVal ProPheGlu
225 230 235 240
gttgcagagaat attaaatta ttgtggccg aaatgtcag gttgatgaa 1428
ValAlaGluAsn IleLysLeu LeuTrpPro LysCysGln ValAspGlu
245 250 255
agtaaggttcta cctgtggat cccttgcat gaaaagaga aaaaatagg 1476
SerLysValLeu ProValAsp ProLeuHis GluLysArg LysAsnArg
260 265 270
atatacaaggca ttggattcg gatgatgtt gaacttgtc aagcttcta 1524
IleTyrLysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu
275 280 285
ctgagtgagtct aacataagc ttagatgaa gcctacget cttcattat 1572
LeuSerGluSer AsnIleSer LeuAspGlu AlaTyrAla LeuHisTyr
290 295 300
getgtggcatat tgtgatccc aaggttgtg actgaggtt cttggactg 1620
AlaValAlaTyr CysAspPro LysValVal ThrGluVal LeuGlyLeu
305 310 315 320
ggtgttgcggat gtcaaccta cgtaatact cgtggttac actgtgctt 1668
GlyValAlaAsp ValAsnLeu ArgAsnThr ArgGlyTyr ThrValLeu
325 330 335
cacattgettcc atgcgtaag gagccagca gtaattgta tcgcttttg 1716
HisIleAlaSer MetArgLys GluProAla ValIleVal SerLeuLeu
340 345 350
actaagggaget cgtgcatca gagactaca ttggatggg cagagtget 1764
ThrLysGlyAla ArgAlaSer GluThrThr LeuAspGly GlnSerAla
355 360 365
gtt agtatctgta ggaggctgac taggcctaag gagtaccatg caaaaacaga 1817
_81 _
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
Val
acaaggccag gaagcaaaca aagatcgggt atgtattgat gttttggaga gagagatgcg 1877
tcgcaaccca atggctggag atgcattgtt ttcttcccca atgttggccg atgatctgca 1937
catgaaactg cactacctgg aaaatagagt ggcatttgca cggttactgt tccctcttga 1997
agccagacta gccatgcaaa ttgcaaatgc tgagactgca gctgaagtag cagtccgttt 2057
ggcatctaaa agtacatctg ggaacttgag ggaggttgat ttgaatgaga cacccataaa 2117
gcagaaagaa agacttcttt caaggatgca agccctctcg aagacagttg aacttggcaa 2177
gcgctatttt ccacattgct ctcaagttct ggacaagttt atggaggatg acttacccga 2237
cttaattttc cttgagatgg gccctccaga ggagcaaaag atcaagagga agcgatttaa 2297
ggagctcaaa gatgacgttc ancgggcatt taacaaagac aaagctgaac ttcattgctc 2357
ccgcttgtcc tcatcatcat gttcctcttc ttttaaagat ggngcaagtg tcaaacttag 2417
gaaactatga gtaaataggg ttttgtccta tagtttctct nccatctcag ttttgaatgt 2477
aagattaata gtttttataa agacttgtct tgtacancct tcattagagc gcctgctttg 2537
tcgctatcca tttccctatt cagcttgtta aacttccatg tttncagtag aaagaaattt 2597
gcttaggaac aagcttttgg aatagcttat atggaaaatt gattgtaaaa aaaaaaaaaa 2657
aaaaaaaaaa aaaaaa 2673
<210> 74
<211> 369
<212> PRT
<213> Nicotiana tabacum
<400> 74
Met Ala Cys Ser Ala Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser
1 5 10 15
Ser Ile Thr Ser Asn Gly Ser Ile Gly Val Gly Gln Asn Thr His Ala
20 25 30
Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser
35 40 45
Lys Leu Ser Asn Asn Leu Glu Gln Leu Leu Ser Asp Ser Ser Ser Asp
50 55 60
Phe Thr Asp Ala Glu Ile Val Val Glu Gly Val Ser Leu Gly Val His
65 70 75 80
Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gln Asp Leu Phe Arg
85 90 95
Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys Pro Arg Tyr Ser Met
100 105 110
Thr Asp Ile Leu Pro Tyr Gly Lys Val Gly Tyr Glu Ala Phe Val Thr
-82-
WO 00/53762 CA 02365968 2001-09-06
PCT/EP00/01978
115 120 125
Phe Leu Ser Tyr Leu Tyr Ser Gly Lys Leu Lys His Phe Pro Pro Glu
130 135 140
Val Ser Thr Cys Met Asp Thr Ile Cys Ala His Asp Ser Cys Arg Pro
145 150 155 160
Ala Ile Asn Phe Ser Val Glu Leu Met Tyr Ala Ser Ser Met Phe Gln
165 170 175
Val Pro Glu Leu Val Ser Leu Phe Leu Arg Arg Leu Ile Asn Phe Val
180 185 190
Gly Lys Ala Leu Val Glu Asp Val Ile Pro Ile Leu Arg Val Ala Phe
195 200 205
His Cys Gln Leu Ser Glu Leu Leu Thr His Ser Val Asp Arg Val Ala
210 215 220
Arg Ser Asp Leu Glu Ile Thr Cys Ile Glu Lys Glu Val Pro Phe Glu
225 230 235 240
Val Ala Glu Asn Ile Lys Leu Leu Trp Pro Lys Cys Gln Val Asp Glu
245 250 255.
Ser Lys Val Leu Pro Val Asp Pro Leu His Glu Lys Arg Lys Asn Arg
260 265 270
Ile Tyr Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu
275 280 285
Leu Ser Glu Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr
290 295 300
Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu
305 310 315 320
Gly Val Ala Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu
325 330 335
His Ile Ala Ser Met Arg Lys Glu Pro Ala Val Ile Val Ser Leu Leu
340 345 350
Thr Lys Gly Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gln Ser Ala
355 360 365
Val
-83-
