Note: Descriptions are shown in the official language in which they were submitted.
CA 02366488 2008-11-04
OPTIMIZATION OF LIGAND AFFINITY FOR RNA TARGETS USING MASS
SPECTROMETRY
FIELD OF THE INVENTION
The present invention is related to mass spectrometry methods for detecting
binding
interactions of ligands to substrates and in particular to methods for
determining the mode of
binding interaction of legends to substrates.
BACKGROUND OF THE INVENTION
Drug discovery has evolved from the random screening of natural products into
a
combinatorial approach of designing large numbers of synthetic molecules as
potential
bioactive agents (ligands, agonists, antagonists, and inhibitors).
Traditionally, drug discovery
and optimization have involved the expensive and time-consuming process of
synthesis and
evaluation of single compounds bearing incremental structural changes. For
natural products,
the individual components of extracts had to be painstakingly separated into
pure constituent
CA 02366488 2001-10-05
WO 01/58573 2 PCT/US01/40064
compounds prior to biological evaluation. Further, all compounds had to be
analyzed and
characterized prior to in vitro screening. These screens typically included
theevaluation of
candidate compounds for binding affinity to their target, competition for the
ligand binding
site, or efficacy at the target as determined via inhibition, cell
proliferation, activation or
antagonism end points. Considering all these facets of drug design and
screening that slow
the process of drug discovery, a number of approaches to alleviate or remedy
these matters,
have been implemented by those involved in discovery efforts.
The development and use of combinatorial chemistry has radically changed the
way
diverse chemical compounds are synthesized as potential drug candidates. The
high-
throughput screening of hundreds of thousands of small molecules against a
biological target
has become the norm in many pharmaceutical companies. The screening of a
combinatorial
library of compounds requires the subsequent identification of the active
component, which
can be difficult and time consuming. In addition, compounds are usually tested
as mixtures
to efficiently screen large numbers of molecules.
A shortcoming of existing assays relates to the problem of "false positives."
In a
typical functional assay, a false positive is a compound that triggers the
assay but which
compound is not effective in eliciting the desired physiological response. In
a typical
physical assay, a false positive is a compound that attaches itself to the
target but in a non-
specific manner (e.g. non-specific binding). False positives are particularly
prevalent and
problematic when screening higher concentrations of putative ligands because
many
compounds have non-specific affects at those concentrations. Methods for
directly
identifying compounds that bind to macromolecules in the presence of those
that do not bind
to the target could significantly reduce the number of "false positives" and
eliminate the need
for deconvoluting active mixtures.
In a similar fashion, existing assays are also plagued by the problem of
"false
negatives," which result when a compound gives a negative response in the
assay but the
compound is actually a ligand for the target. False negatives typically occur
in assays that
use concentrations of test compounds that are either too high (resulting in
toxicity) or too low
relative to the binding or dissociation constant of the compound to the taget.
When a drug discovery scientist screens combinatorial mixtures of compounds,
the
scientist will conventionally identify an active pool, deconvolute it into its
individual
CA 02366488 2001-10-05
WO 01/58573 3 PCT/USO1/40064
members, and identify the active members via re-synthesis and analysis of the
discrete
compounds. In addition to false positives and false negative, current
techniques and
protocols for the study of combinatorial libraries against a variety of
biologically relevant
targets have other shortcomings. These include the tedious nature, high cost,
multi-step
character, and low sensitivity of many screening technologies. These
techniques do not
always afford the most relevant structural and binding information, for
example, the structure
of a target in solution and the nature and the mode of the binding of the
ligand with the
receptor site. Further, they do not give relevant information as to whether a
ligand is a
competitive, noncompetitive, concurrent or a cooperative binder of the
biological target's
binding site.
The screening of diverse libraries of small molecules created by combinatorial
synthetic methods is a recent development that has the potential to accelerate
the
identification of lead compounds in drug discovery. Rapid and direct methods
have been
developed to identify lead compounds in drug discovery involving affinity
selection and mass
spectrometry. In this strategy, the receptor or target molecule of interest is
used to isolate the
active components from the library physically, followed by direct structural
identification of
the active compounds bound to the target molecule by mass spectrometry. In a
drug design
strategy, structurally diverse libraries can be used for the initial
identification of lead
compounds. Once lead compounds have been identified, libraries containing
compounds
chemically similar to the lead compound can be generated and used to develop a
structural
activity relationship (SAR) in order to optimize the binding characteristics
of the ligand with
the target receptor.
One step in the identification of bioactive compounds involves the
determination of
binding affinity and binding mode of test compounds for a desired biopolymeric
or other
receptor. For combinatorial chemistry, with its ability to synthesize, or
isolate from natural
sources, large numbers of compounds for in vitro biological screening, this
challenge is
greatly magnified. Since combinatorial chemistry generates large numbers of
compounds,
often isolated as mixtures, there is a need for methods which allow rapid
determination of
those members of the library or mixture that are most active, those which bind
with the
highest affinity, and the nature and the mode of the binding of a ligand to a
receptor target.
An analysis of the nature and strength of the interaction between a ligand
(agonist,
CA 02366488 2001-10-05
WO 01/58573 4 PCT/US01/40064
antagonist, or inhibitor) and its target can be performed by ELISA (Kemeny and
Challacombe, in ELISA and other Solid Phase Immunoassays: Theoretical and
Practical
Aspects; Wiley, New York, 1988), radioligand binding assays (Berson and Yalow,
Clin.
Chim. Acta, 1968, 22, 51-60; Chard, in "An Introduction to Radioimmunoassav
and Related
Techniques," Elsevier press, Amsterdam/New York, 1982), surface-plasmon
resonance
(Karlsson, Michaelsson and Mattson, J. Immunol. Methods, 1991, 145, 229;
Jonsson et al.,
Biotechniques, 1991, 11, 620), or scintillation proximity assays (Udenfriend,
Gerber and
Nelson, Anal. Biochem., 1987, 161, 494-500). Radio-ligand binding assays are
typically
useful only when assessing the competitive binding of the unknown at the
binding site for
that of the radio-ligand and also require the use of radioactivity. The
surface-plasmon
resonance technique is more straightforward to use, but is also quite costly.
Conventional
biochemical assays of binding kinetics, and dissociation and association
constants are also
helpful in elucidating the nature of the target-ligand interactions but are
limited to the
analysis of a few discrete compounds.
A nuclear magnetic resonance (NMR)-based method is described in which small
organic molecules that bind to proximal subsites of a protein are identified,
optimized, and
linked together to produce high-affinity ligands (Shuker, S. B.; Hajduk, P.
J.; Meadows, R.
P.; Fesik, S. W. Science, 1996, 274, 5252, 1531). The approach is called SAR
by NMR
because structure-activity relationships (SAR) are obtained from NMR. This
technique has
several drawbacks for routine screening of a library of compounds. For
example, the
biological target is required to incorporate a'5N label. Typically the
nitrogen atom of the
label is part of amide moiety within the molecule. Because this technique
requires
deshielding between nuclei of proximal atoms, the 15N label must also be in
close proximity
to a biological target's binding site to identify ligands that bind to that
site. The binding of a
ligand conveys only the approximate location of the ligands. It provides no
information
about the strength or mode of binding.
Therefore, methods for the screening and identification of complex
target/ligand
binding are greatly needed. In particular, new methods are needed for the
identification of
the strength and mode of binding of a ligand to its intended target.
SUMMARY OF THE INVENTION
CA 02366488 2001-10-05
WO 01/58573 5 PCT/USO1/40064
This invention provides for methods and processes for identifying weak binding
ligands for a target molecule. Ligands are selected that have an affinity for
the target
molecule that is equal to or greater than a baseline affinity. This can be
accomplished
according to one embodiment of the invention by utilizing a mass spectrometer
and sdecting
a standard ligand that forms a non-covalent binding complex with the target
molecule. An
amount of the standard ligand is mixed with an excess amount of the target
molecule such
that unbound target molecule is present in the mixture. This mixture is
introduced into the
mass spectrometer and the operating performance conditions of the mass
spectrometer are
adjusted such that the signal strength of the standard ligand bound to the
target molecule is
from about 1 % to about 30% of the signal strengthof unbound target molecule.
At least one
further ligand is introduced into a test mixture of the target molecule and
the standard ligand
and this test mixture is introduced into the mass spectrometer. Any complexes
of the further
ligand and the target wherein the ligand has greater than baseline affinity
for the target
molecule is identified by discerning the signals that have a signal strength
greater than the
background noise of the mass spectrometer.
The invention further provides for methods and processes for selecting those
members
of a group of compounds that can form a non-covalent complex with a target
molecule and
where the affinity of the members for the target molecule is greater than a
baseline affinity.
This can be accomplished by utilizing a mass spectrometer and selecting a
standard
compound that forms a non-covalent binding complex with the target molecule.
An amount
of the standard compound is mixed with an excess amount of the target molecule
such that
unbound target molecule is present in the mixture and the mixture is
introduced into the mass
spectrometer. The operating performance conditions of the mass spectrometer
are adjusted
such that the signal strength of the standard compound bound to the target
molecule is from
about 1 % to about 30% of signal strength of unbound target molecule. Next a
sub-set of the
group of compounds is introduced into a test mixture of the target molecule
and standard
compound and this test mixture is introduced into the mass spectrometer. Those
members of
the sub-set of compounds that form complexes with the target with an affinity
greater than
baseline are identified by discerning those signals that have a signal
strength greater than the
background noise of the mass spectrometer. The individual members are then
identified by
their respective molecular masses.
CA 02366488 2001-10-05
WO 01/58573 6 PCTIUS01/40064
The invention further includes methods and processes for determining the
relative
interaction between at least two ligands with respect to a target substrate.
This is
accomplished by mixing an amount of each of the ligands with an amount of the
target
substrate to form a mixture. The mixture is then analyzed using mass
spectrometry to
determine the presence or absence of a ternary complex corresponding to
simultaneous
binding of two of the ligands with the target substrate. The absence of a
ternary complex in
the mixture indicates that binding of the ligands to the target is competitive
while the
presence of a ternary complex indicates that binding of the ligands is other
than competitive.
The invention further includes methods and processes for determining the
binding
interaction of ligands to a target substrate. This is accomplished by mass
spectrometry
analysis of the mixture as described to determine if the binding is other than
competitive
followed by determination of the ion abundance of i) a ternary complex present
in the
mixture, ii) a first binary complex corresponding to the adduction of a first
ligand with the
target substrate; iii) a second binary complex corresponding to the adduction
of a second
ligand with the target substrate; and iv) target substrate unbound or not
complexed with either
of the first or second ligands. The absolute ion abundance of the ternary
complex is
compared to the sum of the relative ion abundance of the binary complexes
which contribute
to the formation of the ternary complex. The relative ion abundance of one of
the
contributing binary complexes is calculated by multiplying the absolute ion
abundance of the
first binary complex with the relative ion abundance of the second binary
complex with
respect to the unbound target substrate. The relative ion abundance of the
second binary
complex is calculated by dividing that binary complex' absolute ion abundance
by the
absolute ion abundance of the unbound target. Similarly, the relative ion
abundance of the
other contributing binary complex is calculated by multiplying the absolute
ion abundance of
the second binary complex with the relative ion abundance of the first binary
complex.
If the absolute ion abundance of the ternary complex is equal to the sum of
the
relative ion abundances of the contributing binary complexes this indicates
concurrent
binding interaction of the ligands to the target substrate. If the absolute
ternary complex ion
abundance is greater this indicates cooperative binding interaction, and if
lesser this indicates
competitive binding interaction.
The invention further includes methods and processes for determining the
relative
CA 02366488 2001-10-05
WO 01/58573 7 PCT/US01/40064
proximity of binding sites of a first and a second ligand on a target
substrate. This can be
accomplished by exposing the target substrate to a mixture of the second
ligand and a
plurality of derivative compounds of the first ligand. Each of the first
ligand derivatives has
the chemical structure of the first ligand and at least one substituent group
pending from it or
if the first ligand includes a ring within its structure, derivatives of the
ligand can include
expansion of contraction of that ring. This mixture is analyzed by mass
spectrometry to
identify a first ligand derivative that inhibits the binding of the second
ligand to the target
substrate or visa versa, i.e. binds competitively with the second ligand as
determined by the
absence of a ternary complex corresponding to the simultaneous complexation of
the first
ligand derivative and the second ligand with the target.
This invention further provides for methods and processes for determining the
relative
orientation of a first ligand to a second ligand when these ligands are bound
to a target
substrate. This is accomplished by exposing the target substrate to a mixture
of the second
ligand and a plurality of derivative compounds of the first ligand. Each of
the first ligand
derivatives has the chemical structure of the first ligand and a substituent
group pending
therefrom. The mixture is analyzed by mass spectrometry to identify a first
ligand derivative
that inhibits the binding of the second ligand to the target substrate or visa
versa, i.e. binds
competitively with the second ligand as determined by the absence of a ternary
complex
corresponding to the simultaneous complexation of the first ligand derivative
and the second
ligand with the target.
This invention further provides for a screening method for determining
compounds
that have binding affinity to a target substrate. This is accomplished using
mass spectrometry
to identifying two ligands that bind to a target non-competitively in a
mixture of the ligands
and target substrate. These two ligands are then concatenated to form another
ligand that has
greater binding affinity for the target substrate than either of the two
ligands.
The invention further includes methods and processes for modulating the
binding
affinity of ligands for a target molecule. This is accomplished by selecting a
first ligand
fragment and a second ligand fragment and then exposing a target molecule to
these ligand
fragments. The target molecule exposed to the ligand fragments is then
interrogated in a
mass spectrometer to identify binding of the ligand fragments to the target
molecules. The
ligand fragments are concatenated together in a structural configuration that
improves the
CA 02366488 2001-10-05
WO 01/58573 8 PCT/US01/40064
binding properties of the fragments for the target molecule.
The invention further includes methods and processes for refining the binding
of
ligands to target molecules. This is accomplished by selecting first and
second virtual
fragments of a ligand followed by virtually concatenating the selected ligand
fragments
together in silico to form a 3D model of the concatenated ligand fragments.
This 3D mocbl
of the concatenated ligand fragments is then positioned in silico on a 3D
model of the target
molecule. The various in silico positions of the 3D model of the concatenated
ligand
fragments on the in silico 3D model of the target molecule are scored. Eking
the results of
the scoring, the in silico position of the 3D model of the concatenated ligand
fragments on
the in silico 3D model of the target molecule is refined. In a preferred
embodiment of this
method, real ligand fragments corresponding to the virtual ligand fragments
are concatenated
together to covalently join these ligand fragments into a new molecule. The
new molecule is
mixed with a target molecule and the mixture interrogated in the mass
spectrometer for
binding of the new molecule to the target molecule.
In each of the above methods and processes, in a preferred embodiment, an
electrospray mass spectrometer is utilized. Preferred electrospray ionization
is accomplished
by Z-spray, microspray, off-axis spray or pneumatically assisted ele trospray
ionization.
Further countercurrent drying gas can be used. Preferred mass analyzers for
use in
identifying the complexes are quadrupole, quadrupole ion trap, time-of-flight,
FT-ICR and
hybrid mass detectors. The preferred method of measuring signal strength is by
the relative
ion abundance. The mass spectrometer can also include a gated ion storage
device for
effecting thermolysis of the test mixtures within the mass spectrometer.
Adjustment of the mass spectrometer operating performance conditions would
include
adjustment of the source voltage potential across the desolvation capillary
and a lens element
of the mass spectrometer. This is best monitored by ion abundance of free
target molecule.
Adjustment of the mass spectrometer operating conditions further can include
adjustment of
the temperature of the desolvation capillary and adjustment of the operating
gas pressure with
the mass spectrometer downstream of the desolvation capillary.
In a preferred embodiment, adjustment of the operating performance conditions
of the
mass spectrometer is effected by adjustment of the voltage potential across
the desolvation
capillary and a lens element to generate an ion abundance of the ion from a
complex of
CA 02366488 2001-10-05
WO 01/58573 9 PCTIUSO1/40064
standard ligand with the target of from about 1% to about 30% compared to the
abundance of
the ion from the target molecule. A more preferred range of abundance of the
complex of
standard ligand with target to the abundance of the ion from the target
molecule is from about
10% to about 20%.
Preferred for standard ligands are those ligands having a baseline affinity
for the
target of about 10 to about 100 millimolar. Particularly preferred are
standard ligands having
a baseline affinity for the target molecule of about 50 millimolar as
expressed as a
dissociation constant. Particularly preferred for standard ligands for nucleic
acid targets are
amines, primary, secondary or tertiary, amino acids, and nitrogen containing
heterocycles
with ammonium being the most preferred. Particularly preferred for standard
ligands for
peptides are esters, phosphates, borates, amino acid and nitrogen containing
heterocycles.
The target molecule can be one of various target molecules including RNA, DNA,
proteins, RNA-DNA duplexes, DNA duplexes, polysaccharides, phospholipids and
glycolipids. Preferred are nucleic acids and proteins with RNA being
particularly preferred
as a target molecule.
Various RNA molecules are useful as the target. Preferred RNA target molecules
are
those that are fragments of larger RNA molecules including those being from
about 10 to
about 200 nucleotides in length. A more preferred RNA target is RNA of from
about 15 to
about 100 nucleotides in length including those having secondary and ternary
structure.
Preferred ligand molecules include those having a molecular mass of less than
about
1000 Daltons and fewer that 15 rotatable bonds, i.e., covalent bonds linking
one atom to a
further atom in the molecule and subject to rotation of the respective atoms
about the axis of
the bond. More preferred ligands molecules include those having a molecular
mass of less
than about 600 Daltons and fewer than 8 rotatable bonds. Even more preferred
ligand
molecules include those have a molecular mass of less than about 200 Daltons
and fewer than
4 rotatable bonds. Further preferred ligands include those having no more than
one sulfur,
phosphorous or halogen atom.
The ligands can comprise members of collection libraries. Preferred collection
libraries include historical repositories of compounds, collections of natural
products,
collections of drug substances or intermediates for such drug substances,
collections of
dyestuffs, commercial collections of compounds or combinatorial libraries of
compounds. A
CA 02366488 2001-10-05
WO 01/58573 10 PCT/US01/40064
preferred collection for selecting ligands can contain various numbers of
members with
libraries of from 2 to about 100,000 being preferred.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation of a mass spectrometer employing an
electospray ion source.
Figure 2 is a mass spectrum showing binding of a small molecule ligand (2-
amino-4-
benzylthio-1,2,4-triazole) to a 27-mer fragment of bacterial 16S A-site
ribosomal RNA and
ammonium as standard ligand.
Figure 3 is a mass spectrum showing competitive displacement of glucosamine
from
the 16S RNA fragment by Ibis-326732.
Figure 4 is a mass spectrum showing the concurrent binding of 2-DOS and 3,5-
diamino-1,2,4-triazole to the 16S RNA fragment.
Figure 5 is a table of particular amines and carboxylic acids that were
conjugated at
the R group in all combinations to form a library of amide linked compounds.
The amide
linked compounds were analyzed by mass spectroscopy to determine their binding
affinity to
16S RNA fragment.
Figure 6 is a mass spectrum showing the binding of a piperazinyl small
molecule
IBIS-326611 from the amide library to 16S RNA fragment.
Figure 7 is a mass spectrum showing the binding to 16S RNA fragment of another
piperazinyl small molecule IBIS-326645 from the amide library.
Figure 8 is a mass spectrum showing the enhanced bindingto the 16S RNA
fragment
of concatenated compound IBIS-271583, derived from the structures of IBIS-
326611 and
IBIS-326645 and sharing the common piperazine moiety of the two parent
compounds. The
concatenated compound has greater affinity for 16S than either parent
compound.
Figure 9 is a schematic representation of the binding of triazole and 2-
deoxystreptamine ligands binding at their respective binding sites on the
target 16S RNA
fragment and a concatenated compound derived from the two ligands.
Figure 10 is a mass spectrum of ammonium ion adducts of 16S as a function of
desolvation conditions. (A) No ammonium adducted ions observed at a-180 V cap
exit-
skimmer potential. Two smaller higher mass signals from a methylated impurity
in the RNA
CA 02366488 2001-10-05
WO 01/58573 11 PCT/US01/40064
(x; M+14.016 Da) and sodium-adducted species (Na; M+21.982 Da) respectively.
(B) At a-
115 V cap exit-skimmer potential, a series of peaks from ammonia-adducted ions
are
observed at 17.030 Da intervals.
Figure 11 illustrates structures of ligands analyzed for binding to 16S
ribosomal
RNA.
Figure 12 is a graph showing polynomial fit of Q (the sum of the ion
intensities from
16S and all 2-DOS:16S complexes divided by the intensity of 16S) versus 2-DOS
concentration (M) in the presence of 100 mM ammonium acetate buffer. The
calculated KD
values for 2-DOS, (2-DOS)2, and (2-DOS)3 were 0.6, 1.4, and 4 mM respectively.
Figure 13 is a graph showing effective dissociation energy versus mole
fraction of
ions observed from undissociated (2-DOS):16S complex (A) and free 16S (=).
Figure 14 is a graph showing effective dissociation energy versus mole
fraction of
ions observed from undissociated bis-(2-DOS): 16S (A; solid), (2-DOS): 16S (^;
long dash)
and 16S (;short dash), respectively.
DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
The methods of the present invention are useful for the detection, evaluation
and
optimization of ligands to targets especially biological targets. The methods
and processes of
the invention utilize mass spectrometry as the primary tool to accomplish
this. The detection
and evaluation of the different binding modes of noncovalently bound ligands
to a target are
useful for advancing the structure activity relationship (SAR) and for
designing ligands with
higher binding affinities for their given target sites.
Mass spectrometry has been used to afford direct and rapid methods to identify
lead
compounds and to study the interactions between small molecules and biological
targets. An
advantage of mass spectrometry in identifying lead compounds is the
sensitivity of the
detection process. Small molecules (ligands) which bind to a target through
weak
noncovalent interactions, may be missed through conventional screening assays.
These
noncovalent ligand:target complexes, however, are readily detected by mass
spectral analysis
using the methods and processes of the invention.
These small molecules include both tight and weak binding ligands that bind to
a
particular target. In both collections of compounds and in biological samples,
tight binding
CA 02366488 2001-10-05
WO 01/58573 12 PCTIUS01/40064
ligands can be present in very low concentrations relative to the weaker
binding ligands. A
tight binding ligand may be part of a very large library of compounds (e.g. a
combinatorial
library) or may be present in trace amounts of a tissue extract. In both
cases, there is usually
a much higher concentration of weaker binding ligands relative to the tight
binding ligands.
A tight or a weak binding ligand can bind to a target by a noncovalent bond.
These
noncovalent interactions include hydrogen-bonding, electrostatic, and
hydrophobic contacts
that contribute to the binding affinity for the target. The difference between
a tight and weak
binding ligand is relative, a tight binding ligand has a stronger interaction
between a target
than does a weak binding ligand. Tight and weak binding noncovalent complexes
are in
equilibrium with the free ligand and free target. If a target is incubated
with a mixture of two
ligands, e.g., a tight binding and a weak binding ligand, an equilibrium will
be established
between the bound and unbound forms of each ligand with the binding site of
the biological
target. At equilibrium, an equilibrium constant (binding constant) can be
calculated and is
used as a measure of the binding affinities of the ligands. Binding affinity
is a measure of the
attraction between a ligand and its target.
A binding site is the specific region of a target where a substrate or a
ligand binds to
form a complex. For example, an enzyme's active site is where catalysis takes
place. In a
structured RNA molecule, binding of a ligand at a binding site can result in
the disruption of
the transcription or translation processes. A ligand is a small molecule that
binds to a
particular large molecule, a target molecule. Typically the target molecule is
a large
molecule, as for instance, a biological target such as a protein (enzyme) or a
structured RNA
or DNA.
A preferred target molecule is RNA particularly structured RNA. Structured RNA
is
a term that refers to definable, relatively local, secondary and tertiary
structures such as
hairpins, bulges, internal loops, junctions and pseudoknots. Structured RNA
can have both
base paired and single stranded regions. RNA can be divided into primary,
secondary, and
tertiary structures and is defined similarly to proteins. Thus the primary
structure is the linear
sequence. The secondary structure reflects local intramolecular base pairing
to form stems
and single stranded loops, bulges, and junctions. The tertiary structure
reflects the
interactions of secondary structural elements with each other and with single
stranded
regions.
CA 02366488 2001-10-05
WO 01/58573 13 PCT/US01/40064
Mass spectrometry (MS) is a powerful analytical tool for the study of
molecular
structure and interaction between small and large molecules. The current state
of the art in
MS is such that sub-femtomole quantities of material can be readily analyzed
to afford
information about the molecular contents of the sample. An accurate assessment
of the
molecular weight of the material may be quickly obtained, irrespective of
whether the
samples' molecular weight is several hundred, or in excess of a hundred
thousand, atomic
mass units or Daltons (Da). It has now been found that mass spectrometry can
elucidate
significant aspects of important biological molecules. One reason for the
utility of MS as an
analytical tool is the availability of a variety of different MS methods,
instruments, and
techniques that can provide different pieces of information about the samples.
A mass spectrometer analyzes charged molecular ions and fragment ions from
sample
molecules. These ions and fragment ions are then sorted based on their mass to
charge ratio
(m/z). A mass spectrum is produced from the abundance of these ions and
fragment ions that
is characteristic of every compound. In the field of biotechnology, mass
spectrometry has
been used to determine the structure of a biomolecule, as for instance
determining the
sequence of oligonucleotides, peptides, and oligosaccharides.
In principle, mass spectrometers consist of at least four parts: (1) an inlet
system; (2)
an ion source; (3) a mass analyzer; and (4) a mass detector/ion-collection
system (Skoog,
D.A. and West, D.M., Principles of Instrumental Analysis, Saunders College,
Philadelphia,
PA, 1980, 477-485). The inlet system pen-nits the sample tobe introduced into
the ion source.
Within the ion source, molecules of the sample are converted into gaseous
ions. The most
common methods for ionization are electron impact (EI), electrospray
ionization (ESI),
chemical ionization (CI) and matrix-assisted laser desorption ionization
(MALDI). A mass
analyzer resolves the ions based on mass-to-charge ratios. Mass analyzers can
be based on
magnetic means (sector), time-of-flight, quadrupole and Fourier transform mass
spectrometry
(FTMS). A mass detector collects the ions as they pass through the detector
and records the
signal. Each ion source can potentially be combined with each type of mass
analyzer to
generate a wide variety of mass spectrometers.
Mass spectrometry ion sources are well known in the art. Two commonly used
ionization methods are electrospray ionization (ESI) and matrix-assisted laser
desorption/ionization (MALDI) (Smith et al., Anal. Chem., 1990, 62, 882-899;
Snyder, in
CA 02366488 2001-10-05
WO 01/58573 14 PCT/USO1/40064
Biochemical and Biotechnological Applications of Electrospray Ionization Mass
Spectrometry, American Chemical Society, Washington, DC, 1996; and Cole, in
Electrospray Ionization Mass Spectrometry: Fundamentals, Instrumentation,
Wiley, New
York, 1997).
ESI is a gentle ionization method that results in no significant mole ular
fragmentation and preserves even weakly bound complexes between biopolymers
and other
molecules so that they are detected intact with mass spectrometry. ESI
produces highly
charged droplets of the sample being studied by gently nebulizing a solution
of the sample in
a neutral solvent in the presence of a very strong electrostatic field. This
results in the
generation of highly charged droplets that shrink due to evaporation of the
neutral solvent
and ultimately lead to a "coulombic explosion" that affords multiply charged
ions of the
sample material, typically via proton addition or abstraction, under mild
conditions.
Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for
very
high molecular weight biopolymers such as proteins and nucleic acids greater
than 10 kDa in
mass, for it affords a distribution of multiply-charged molecules of the
sample biopolymer
without causing any significant amount of fragmentation. The fact that several
peaks are
observed from one sample, due to the formation of ions with different charges,
contributes to
the accuracy of ESI-MS when determining the molecular weight of the biopolymer
because
each observed peak provides an independent means for calculation of the
molecular weight of
the sample. Averaging the multiple readings of molecular weight obtained from
a single ESI
mass spectrum affords an estimate of molecular weight that is much more
precise than would
be obtained if a single molecular ion peak were to be provided by the mass
spectrometer.
Further adding to the flexibility of ESI-MS is the capability of obtaining
measurements in
either the positive or negative ionization modes.
ESI-MS has been used to study biochemical interactions of biopolymers such as
enzymes, proteins and macromolecules such as oligonucleotides and nucleic
acids and
carbohydrates and their interactions with their ligands, receptors, substrates
or inhibitors
(Bowers et al., Journal ofPhysical Chemistry,1996,100, 12897-12910; Burlingame
et al., J.
Anal. Chem., 1998, 70, 647R-716R; Biemann,Ann. Rev. Biochem.,1992, 61, 977-
1010; and
Crain et al., Curr. Opin. Biotechnol., 1998, 9, 25-34). While interactions
that lead to
covalent modification of biopolymers have been studied for some time, one of
the most
CA 02366488 2001-10-05
WO 01/58573 15 PCT/USO1/40064
significant developments in the field has been the observation, under
appropriate solution
conditions and analyte concentrations, of specific non-covalently associated
macromolecular
complexes that have been promoted into the gas-phase intact (Loo, Mass
Spectrometry
Reviews, 1997, 16, 1-23; Smith et al., Chemical Society Reviews, 1997, 26, 191-
202; Ens et
al., Standing and Chernushevich, Eds., New Methods for the Study of
Biomolecular
Complexes, Proceedings of the NA TO Advanced Research Workshop, held 16-20
June 1996,
in Alberta, Canada, in NATO ASI Ser., Ser. C, 1998, 510, Kluwer, Dordrecht,
Netherlands).
A variety of non-covalent complexes of biomolecules have been studied using
ESI-
MS and reported in the literature (Loo, Bioconjugate Chemistry, 1995, 6, 644-
665; Smith et
al., J. Biol. Mass Spectrom. 1993, 22, 493-501; Li et al., J. Am. Chem. Soc.,
1993, 115,
8409-8413). These include the peptide-protein complexes (Busman et al., Rapid
Commun.
Mass Spectrom., 1994, 8, 211-216; Loo et al., Biol.. Mass Spectrom., 1994, 23,
6-12;
Anderegg and Wagner, J. Am. Chem. Soc., 1995, 117, 1374-1377; Baczynskyj et
al., Rapid
Commun. Mass Spectrom., 1994, 8, 280-286), interactions of polypeptides and
metals (Loo
et al., J. Am. Soc. Mass Spectrom.,1994, 5, 959-965; Hu and Loo, J.
MassSpectrom., 1995,
30, 1076-1079; Witkowska et al., J. Am. Chem. Soc.,1995, 1995,117, 3319-3324;
Lane et al., J.
Cell Biol., 1994, 125, 929-943), and protein-small molecule complexes (Ganem
and Henion,
ChemTracts-Org. Chem., 1993, 6, 1-22; Henion et al., Ther. Drug Monit.,
1993,15, 563-569;
Ganguly et al., Tetrahedron, 1993, 49, 7985-7996, Baca and Kent, J. Am. Chem.
Soc.,1992,
114, 3992-3993). Further, the study of the quaternary structure of multimeric
proteins (Baca
and Kent, J. Am. Chem. Soc., 1992, 114, 3992-3993; Light-Wahl et al., J. Am.
Chem. Soc.,
1994, 116, 5271-5278; Loo, J. Mass Spectrom., 1995,30, 180-183, Fitzgerald et
al., Proc.
Natl. Acad. Sci. USA, 1996, 93, 6851-6856), and of nucleic acid complexes
(Light-Wahl et
al., J. Am. Chem. Soc.,1993,115, 803-804; Gale et al., J. Am. Chem.
Soc.,1994,116, 6027-
6028; Goodlett et al., Biol. Mass Spectrom., 1993, 22, 181-183; Ganem et al.,
Tet. Lett.,
1993, 34, 1445-1448; Doctycz et al., Anal. Chem., 1994, 66, 3416-3422; Bayer
et al., Anal.
Chem., 1994, 66, 3858-3863; Greig et al., J. Am. Chem. Soc., 1995, 117, 10765-
766),
protein-DNA complexes (Cheng et al., Proc. Natl. Acad. Sci. U.S.A.,1996, 93,
7022-7027),
multimeric DNA complexes (Griffey et al., Proc. SPIE-Int. Soc. Opt. Eng.,
1997, 2985, 82-
86), and DNA-drug complexes (Gale et al., JACS, 1994, 116, 6027-6028) are
known in the
literature.
CA 02366488 2001-10-05
WO 01/58573 16 PCTIUSO1/40064
ESI-MS has also been effectively used for the determination of binding
constants of
non-covalent macromolecular complexes such as those between proteins and
ligands,
enzymes and inhibitors, and proteins and nucleic acids. The use of ESI-MS to
determine the
dissociation constants (KD) for oligonucleotide-bovine serum albumin (BSA)
complexes have
been reported (Greig et at., J. Am. Chem. Soc., 1995, 117, 10765-10766). The
KD values
determined by ESI-MS were reported to match solutionKD values obtained using
capillary
electrophoresis.
ESI-MS measurements of enzyme-ligand mixtures under competitive binding
conditions in solution afforded gas-phase ion abundances that correlated with
measured
solution-phase dissociation constants (KD) (Cheng et al., JACS,1995,117, 8859-
8860). The
binding affinities of a 256-member library of modified benzenesulfonamide
inhibitors to
carbonic anhydrase were ranked. The levels of free and bound ligands and
substrates were
quantified directly from their relative abundances as measured by ESI-MS and
these
measurements were used to quantitatively determine molecular dissociation
constants that
agree with solution measurements. The relative ion abundance of non-covalent
complexes
formed between D- and L-tripeptides and vancomycin group antibiotics were also
used to
measure solution binding constants (Jorgensen et at., Anal. Chem., 1998, 70,
4427-4432).
ESI techniques have found application for the rapid and straightforward
determination
of the molecular weight of certain biomolecules (Feng and Konishi, Anal.
Chem.,1992, 64,
2090-2095; Nelson et at., Rapid Commun. Mass Spectrom., 1994, 8, 627-63 1).
These
techniques have been used to confirm the identity and integrity of certain
biomolecules such
as peptides, proteins, oligonucleotides, nucleic acids, glycoproteins,
oligosaccharides and
carbohydrates. Further, these MS techniques have found biochemical
applications in the
detection and identification of post-translational modifications on proteins.
Verification of
DNA and RNA sequences that are less than 100 bases in length has also been
accomplished
using ESI with FTMS to measure the molecular weight of the nucleic acids
(Littleet at, Proc.
Natl. Acad. Sci. USA, 1995, 92, 2318-2322).
While data generated and conclusions reached from ESI-MS studies for weak non-
covalent interactions generally reflect, to some extent, the nature of the
interaction found in
the solution-phase, it has been pointed out in the literature that control
experiments are
necessary to rule out the possibility of ubiquitous non-specific interactions
(Smith and Light-
CA 02366488 2001-10-05
WO 01/58573 17 PCT/US01/40064
Wahl, Biol. Mass Spectrom., 1993, 22, 493-501). The use of ESI-MS has been
applied to
study multimeric proteins because the gentleness of the
electrospray/desorption process
allows weakly-bound complexes, held together by hydrogen bonding, hydrophobic
and/or
ionic interactions, to remain intact upon transfer to the gas phase. The
literature shows that
not only do ESI-MS data from gas-phase studies reflect the non-covalent
interactions found
in solution, but that the strength of such interactions may also be
determined. The binding
constants for the interaction of various peptide inhibitors to src SH2 domain
protein, as
determined by ESI-MS, were found to be consistent with their measured solution
phase
binding constants (Loo et al., Proc. 43d ASMS Conf. on Mass Spectrom. and
Allied Topics,
1995). ESI-MS has also been used to generate Scatchard plots for measuring the
binding
constants of vancomycin antibiotics with tripeptide ligands (Lim et al, J.
Mass Spectrom.,
1995, 30, 708-714).
Similar experiments have been performed to study non-covalent interactions of
nucleic acids. ESI-MS has been applied to study the non-covalent interactions
of nucleic
acids and proteins. Stoichiometry of interaction and the sites of interaction
have been
ascertained for nucleic acid-protein interactions (Jensen et al., Rapid
Commun. Mass
Spectrom., 1993, 7, 496-501; Jensen et al., 42"d ASMS Conf. on Mass Spectrom.
and Allied
Topics, 1994, 923). The sites of interaction are typically determined by
proteolysis of either
the non-covalent or covalently crosslinked complex (Jensen et al., Rapid
Commun. Mass
Spectrom., 1993, 7, 496-50 1; Jensen et al., 42"d ASMS Conf. on Mass Spectrom.
and Allied
Topics, 1994, 923; Cohen et al., Protein Sci., 1995, 4, 1088-1099). Comparison
of the mass
spectra with those generated from proteolysis of the protein alone provides
information about
cleavage site accessibility or protection in the nucleic acid-protein complex
and, therefore,
information about the portions of these biopolymers that interact in the
complex.
Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) is an
especially useful analytical technique because of its ability to resolve very
small mass
differences to make mass measurements with a combination of accuracy and
resolution that is
superior to other MS detection techniques, in connection with ESI ionization
(Amster, J.
Mass Spectrom., 1996, 31, 1325-1337, Marshall et al., Mass Spectromi. Rev.,
1998, 17, 1-35).
FT-ICR MS may be used to obtain high resolution mass spectra of ions generated
by any of
the other ionization techniques. The basis for FT-ICR MS is ion cyclotron
motion, which is
CA 02366488 2001-10-05
WO 01/58573 18 PCT/USO1/40064
the result of the interaction of an ion with a unidirectional magnetic field.
The massto-charge
ratio of an ion (m/q or m/z) is determined by a FT-ICR MS instrument by
measuring the
cyclotron frequency of the ion.
The insensitivity of the cyclotron frequency to the kinetic energy of an ion
is one of
the fundamental reasons for the very high resolution achievable with FT-ICR
MS. Each
small molecule with a unique elemental composition carries an intrinsic mass
label
corresponding to its exact molecular mass, identifying closely related library
members bound
to a macromolecular target requires only a measurement of exact molecular
mass. The target
and potential ligands do not require radio labeling, fluorescent tagging, or
deconvolution via
single compound re-synthesis. Furthermore, adjustment of the concentration of
ligand and
target allows ESI-MS assays to be run in a parallel format under competitive
or non-
competitive binding conditions. Signals can be detected from complexes with
dissociation
constants ranging from < 10 nM to -100 mM. FT-ICR MS is an excellent detector
in
conventional or tandem mass spectrometry, for the analysis of ions generated
by a variety of
different ionization methods including ESI, or product ions resulting from
collisionally
activated dissociation.
FT-ICR MS, like ion trap and quadrupole mass analyzers, allows selection of an
ion
that may actually be a weak non-covalent complex of a large biomolecule with
another
molecule (Marshall and Grosshans, Anal. Chem., 1991, 63, A215-A229; Beu et
al., J. Am.
Soc. Mass Spectrom., 1993,4, 566-577; Winger et al., J. Am. Soc. Mass
Spectrom.,1993, 4,
566-577; Huang and Henion, Anal. Chem., 1991, 63, 732-739), or hyphenated
techniques
such as LC-MS (Bruins et al., Anal. Chem., 1987, 59, 2642-2646; Huang and
Henion, J. Am.
Soc. Mass Spectrom.,1990,1, 158-65; Huang and Henion, Anal. Chem., 1991, 63,
732-739)
and CE-MS experiments (Cai and Henion, J. Chromatogr.,1995, 703, 667-692).
FTICR-MS
has also been applied to the study of ion-molecule reaction pathways and
kinetics.
The use of ESI-FT-ICR mass spectrometry as a method to determine the structure
and
relative binding constants for a mixture of competitive inhibitors of the
enzyme carbonic
anhydrase has been reported (Cheng et al., J. Am. Chem. Soc., 1995, 117, 8859-
8860).
Using a single ESI-FT-ICR MS experiment these researchers were able to
ascertain the
relative binding constants for the noncovalent interactions between inhibitors
and the enzyme
by measuring the relative abundances of the ions of these noncovalent
complexes. Further,
CA 02366488 2001-10-05
WO 01/58573 19 PCTIUS01/40064
the Ks so determined for these compounds paralleled their known binding
constants in
solution. The method was also capable of identifying the structures of tight
binding ligands
from small mixtures of inhibitors based on the high-resolution capabilities
and multistep
dissociation mass spectrometry afforded by the FT-ICR technique. A related
study (Gao et
at., J. Med. Chem.,1996, 39, 1949-55) reports the use of ESI-FT-ICR MS
toscreen libraries
of soluble peptides in a search for tight binding inhibitors of carbonic
anhydrase II.
Simultaneous identification of the structure of a tight binding peptide
inhibitor and
determination of its binding constant was performed. The bindingaffinities
determined from
mass spectral ion abundance were found to correlate well with those determined
in solution
experiments. Heretofore, the applicability of this technique to drug discovery
efforts is
limited by the lack of information generated with regards to sites and mode of
such non-
covalent interactions between a protein and ligands.
Electrospray ionization (ESI) has found wide acceptance in the field of
analytical
mass spectrometry since it is a gentle ionization method which produces
multiply charged
ions from large molecules with little or no fragmentation and promotes them
into the gas
phase for direct analysis by mass spectrometry. ESI sources operate in a
continuous mode
with flow rates ranging from < 25 nL/min to 1000 L/min. The continuous nature
of the ion
source is well suited for mass spectrometers which employ the m/z scanning,
such as
quadrupole and sector instruments, as their coupling constitutes a continuous
ion source
feeding in a nearly continuous mass analyzer. As used in this invention the
electrospray
ionization source may have any of the standard configurations including but
not limited to Z-
spray, microspray, off-axis spray or pneumatically assisted electrospray. All
of these can be
used in conjunction with or without additional countercurrent drying gas.
Further the mass
spectrometer can include a gated ion storage device for effecting thermolysis
of test mixtures.
When the solvated ions generated from electrospray ionization conditions are
introduced into the mass spectrometer, the ions are subsequently desolvated in
an evaporation
chamber and are collected in a rf multi-pole ion reservoir (ion reservoir). A
gas pressure
around the ion reservoir is reduced to 10-'- 10-6 torr by vacuum pumping. The
ion reservoir
is preferably driven at a frequency that captures the ions of interest and the
ensemble of ions
are then transported into the mass analyzer by removing or reversing the
electric field
generated by gate electrodes on either side of the ion reservoir. Mass
analysis of the reacted
CA 02366488 2001-10-05
WO 01/58573 20 PCT/US01/40064
or dissociated ions are then performed. Any type of mass analyzers can be used
in effecting
the methods and process of the invention. These include, but are not limited
to, quadrupole,
quadrupole ion trap, linear quadrupole, time-of-flight, FT-ICR and hybrid mass
analyzers. A
preferred mass analyzer is a FT-ICR mass analyzer.
Seen in Figure 1 is a schematic representation of a mass spectrometer. A
review of
the mass spectrometer will facilitate understanding of the invention as it
includes various
component parts that may be included in one or more of the various types of
different mass
spectrometers. The spectrometer 10 includes a vacuum chamber 12 that is
segmented into a
first chamber 14 and a second chamber 16. The mass spectrometer 10 is shown as
an
electrospray mass spectrometer. A metallic micro-electrospray emitter
capillary 18 having an
electrode 20 is positioned adjacent to the vacuum chamber 12. The
electrode/metallic
capillary serves as an ion emitter. The capillary 18 is positioned on an X-Y
manipulator for
movement in two planes.
Adjacent to the capillary 18 and extending from the vacuum chamber 16 is an
evaporative chamber 22 having a further capillary 24 extending axially along
its length. The
X-Y manipulator allows for precise positioning of the capillary 18 with
respect to the
capillary 24. A plume of ions carried in a solvent is emitted from the emitter
capillary18
towards the evaporator capillary 24. The evaporator capillary 24 serves as an
inlet to the
interior of vacuum chamber 12 for that portion of the plume directly in line
with the
evaporator capillary 24.
Within the first chamber 14 is a skimmer cone 26. This skimmer cone 26 serves
as a
lens element. In line with the skimmer cone 26 is an ion reservoir 28. A port
30 having a
valve is connected to a conventional first vacuum source (not shown) for
reducing the
atmospheric pressure in the first chamber 14 to create a vacuum in that
chamber. Separating
chambers 14 and 16 is a gate electrode 32.
The ion reservoir 28 can be one of various reservoirs such as a hexapole
reservoir.
Ions, carried in a solvent, are introduced into chamber 14 via the evaporator
capillary 24.
Solvent is evaporated from the ions within the interior of capillary 24 of the
evaporator
chamber 22. Ions travel through skimmer cone 26 towards the electrode 32. By
virtue of
their charge and a charge placed on the electrode 32 the ions can be held in
the reservoir.
The electrode 32 includes an opening. Ions are released from the ion reservoir
28 by
CA 02366488 2001-10-05
WO 01/58573 21 PCTIUS01/40064
modifying the potential on the electrode 32. They then can pass through the
opening into the
second vacuum chamber 16 towards a mass analyzer 34. For use in FT-ICR,
positioned with
respect to the analyzer 34 is a magnet (not shown). The second vacuum
chamberl6 includes
port 36 having a valve. As with valve 30 in chamber 14, this valve 36 is
attached to an
appropriate vacuum pump for creating a vacuum in chamber 16. Chamber 16 may
further
include a window or lens that is positioned in line with a laser. The laser
can be used to
excite ions in either the mass analyzer 34 or the ion reservoir.
In effecting the methods and processes of the invention, a set of compounds
are
probed against a target molecule, using the mass spectrometer, to identify
those compounds,
i.e., ligands, from the set of compounds that are "weak" binders with respect
to the target
molecule. For the purposes of this invention "weak" binding is defined as
binding in the
millimolar (mM) range. Typically ligands will have a binding affinity in the
range of 0.2 to
10 nM. As opposed to other techniques, the mass spectrometer will not fail to
detect these
weak mM interactions. Ligands having preferred binding characteristics with
respect to a
target molecule are selected. After selection, the binding mode of the ligands
is determined
by re-screening mixtures of ligands against the target molecule. Re.screening
is effected by
simultaneously exposing the target molecule against a small set of two more
ligands. As a
result of this screening, ligands that can not bind at overlapping sites,
competitive binding,
are differentiated from those that can bind at remote sites simultaneously,
concurrent binding,
and those that can bind in a way that traps one compound, cooperative binding
as well as
those having "mixed" binding modes.
Ligands having selected binding characteristics are identified and their
structure
activity relationship (SAR) with respect to target binding is probed using the
mass
spectrometer. Two or more ligands can be joined by concatenation into new
structural
configurations to create a new ligand that will have improved binding
characteristics or
properties. Thus starting from small, rigid ligands that bind with weak
affinity, more
complex molecules that bind to specific target molecules with high affinity
can be identified
using mass spectrometry. This is effected using the mass spectrometer as the
primary tool and
does not involve extensive chemical synthesis or extensive molecular modeling.
Concatenation can be effected based on empirical or computational predictions.
Thus
concatenation will yield either new synthetic chemical ligands having new
properties or in
CA 02366488 2001-10-05
WO 01/58573 22 PCTIUSO1/40064
silico virtual ligands. In conjunction with molecular modeling tools, the
virtual ligands can
be used to identify probable binding locations on the target molecule.
In concatenating ligands together using the methods and processes of the
invention,
two ligands that have mM (millimolar) affinities might be joined and yield a
concatented
ligand that might have nM affinity (nanomolar). While we do not wish to be
bound by
theory, we presently believe this result has multiple contributing factors.
There can be a gain
in intrinsic binding energy, i.e., loss of translational entropy, when both
fragments always
bind at the same time. Proper geometry for both fragments can result in a
favorable enthalpy
of interaction, i.e., no loss of binding enthalpy. Fewer degrees of freedom
resulting from two
fragments being linked through bonds with limited rotation will result in a
loss of rotational
entropy that equals a gain in binding energy. And there can be some energy
gain (enthalpy
and entropy) from desolvation of the target and the ligand fragments. The net
result can be a
103 to a 106 improvement in binding affinity, i.e., a 4-6 kcal/mol gain in
binding energy.
Newly synthesized concatenated ligand molecules, which retain the best
conformations and locations of the ligand fragments with respect to the
target, can be re-
probed using the mass spectrometer to ascertain the binding characteristics of
the new
molecule. Repeated iteration of the process and methods of the invention can
improve the
binding affinity of these new molecules. The newly synthesized concatenated
ligand
molecules can also be screened using a functional assay that involves the
target.
The target molecule can be any target of interest. Preferred as targets are
molecules
of biological interest especially RNA, proteins, RNA-DNA duplexes, DNA
duplexes,
polysaccharides, phospholipids and glycolipids. A particularly preferred
target molecule is
RNA. As practiced herein, the target molecule can, itself, be a fragment of a
larger molecule,
as for instance, RNA that is a fragment of a larger RNA. Particularly
preferred as a target
molecule is RNA especially RNA that is a fragment of a larger RNA. A further
preferred
target molecule is double stranded DNA targeted with ligands that are
transcription factors.
The initial weak binding ligands can be selected from various sources
including, but
not limited to, collection libraries of diverse compounds. These include, but
are not limited
to, historical repositories of compounds, collections of natural products,
collections of drug
substances, collections of intermediates produced in forming drug substances,
collections of
dye stuffs, commercial collections of chemical substances or combinatorial
libraries of
CA 02366488 2001-10-05
WO 01/58573 23 PCTIUSO1/40064
related compounds. Many universities and pharmaceutical companies maintain
historical
repositories of all compounds synthesized. These can include drugs substances
that have or
have not been screened for biological activity, intermediates used in the
preparation of such
drug substances and derivatives of such drug substances. A typical
pharmaceutical company
might have millions of such repository samples. Other collections of compounds
include
collections of natural occurring compounds or derivatives of such natural
occurring
compounds. Irrespective of the origin of the compounds, the compound
collections can be
categorized by size, structure, function or other various parameters.
Commercial chemical supply houses also have collections of compounds that are
suitable for screening against target molecules. Again these might be
categorized by various
parameter that can be useful in selecting sets of compounds for screening
against a target
molecule to identify weak binding ligands for that target molecule. Other
ligand molecule
candidates might be specifically synthesized to include one or more features.
One preferred
method to assemble a group of compounds useful for selecting binding ligands
is by effecting
a combinatorial synthesis of a group of related compounds using various
methods that are
available in the art of combinatorial chemistry. Irrespective of the source of
the ligands, i.e.,
from a collection or specifically synthesized according to define criteria,
the ligands will
contain various motifs, i.e., stacking, electrostatic and I-bonding, that
contribute to the weak
binding of the ligands with the target.
The collections of compound for consideration as ligands for target molecules,
typically categorized by size, structure or function, can be assembled as a
library or set of
compounds having from 2 to about 100,000 or less members. In a first preferred
group of
compounds selected for consideration as ligands for a target molecule each
member of the
group would be selected to independently have a molecular mass less than about
1000
Daltons and fewer than 15 rotatable bonds. In a more preferred group of
compounds, each
member of the group will be selected to independently have a molecular mass
less than about
600 Daltons and fewer than 8 rotatable bonds. In a more preferred group of
compounds each
of member of the group will be selected to independently have a molecular mass
less than
about 200 Daltons, have fewer than 4 rotatable bonds or no more than one
sulfur,
phosphorous or halogen atom. A particularly useful solvent for use in
screening potential
ligands for an RNA target is dimethylsulfoxide. In a particularly preferred
method of the
CA 02366488 2001-10-05
WO 01/58573 24 PCT/US01/40064
invention, the potential ligands are selected as compounds having at least 20
mM solubility in
dimethylsulfoxide.
In screening a compound set for potential binding ligands, sample preparation
and
certain basic operations of the mass spectrometer are optimized to preserve
the weak non-
covalent complexes formed between ligands and the target molecule. These
include extra
care in desalting the target molecule as well as a general reduction of the
temperature of the
desolvation capillary compared to the temperature that would be used if the
only interest was
in analyzing the target molecule itself. Also the voltage potential across the
capillary exit and
the first skimmer cone, i.e., lens element, is optimized to ensure good
des)lvation. A further
consideration is selection of the buffer concentration and solvent to insure
good solvation.
Detection of weak non-covalent complexes using ESI-MS is a function of both
instrument parameters and solution conditions. In solution, highconcentrations
of buffer can
be used to reduce formation of non-specific electrostatic or hydrogen-bonded
aggregates.
The observation of weak complexes depends on the level of collisional
activation that occurs
along the path from the atmospheric region to the high vacuum region.
Variables that impact
the degree of collisional activation include the flow rate and temperature of
countercurrent
drying gas, desolvation capillary temperature, ESI needle position, capillary-
skimmer
potential difference, droplet size, and pressure in the region of the
supersonic expansion
beyond the desolvation capillary. Preferably, these variables are iteratively
adjusted on any
ESI-MS instrument to optimize the detection of weak non-covalent complexes.
A number of parameters influence the "harshness" of the ESI source,
including the rate of drying produced by countercurrent gas and the
temperature of the
desolvation capillary, the gas pressure in the region of supersonic expansion
beyond the
desolvation capillary, and the effective electric field generated by the
potential difference
between the desolvation capillary and the first skimmer cone. For example, it
has been
observed that desolvated ions can be formed from partially desolvated droplets
that traverse a
low temperature desolvation capillary when the voltage difference between the
capillary and
the skimmer cone is increased on the LCQ mass spectrometer. Although the
improved
performance with increased energy would seem to be counterintuitive, the
viscous drag of
ions following supersonic expansion from the capillary provides a mild method
for removal
of residual waters of hydration without disruption of complexes (such as
ammonium)
CA 02366488 2001-10-05
WO 01/58573 25 PCT/US01/40064
stabilized by a single hydrogen bond.
It is possible to measure the relative gas-phase binding energies of ligands
through
CAD of the ternary complexes, individually or in parallel. This information
can be used to
establish the order and proximity of binding when a ligand with higher binding
energy is
preferentially dissociated from the complex. For example, the hydroxyl groups
of
glucosamine (GA) may not compete effectively with waters of hydration for
binding to target
16S ribosomal RNA in solution. However, in the gas phase, these hydroxyls can
bind to the
desolvated RNA and enhance the apparent stability of the complex.
In selecting potential weak binding ligands for a target molecule a standard
ligand is
used as a reference ligand for that target. Various standard ligands will be
used for different
targets. In one sense, these standard ligands can be thought of as ion
thermometers. With any
target molecule, the standard compounds will typically be selected such that
its has a binding
affinity, as measured as a dissociation constant, i.e., Kd, of the order of
nanomolar to about
100 millimolar for its target molecule. A more preferred range would be from
10 to 50 mM
with 50 mM binding affinity for the target molecule being the most preferred.
For use with RNA or DNA targets we have found ammonium (from acetate,
chloride,
borate or other salts), primary amines (including by not limited to alkyl
amines such as
methylamine and ethylamine), secondary amines (including but not limited to
dialkylamines
such as dimethylamine and diethylamine), tertiary amines (including by not
limited to trialkyl
amines such as triethylamine, trimethylamine and dimethylethyl amine), amino
acids
(including but not limited to glycine, alanine, tryptophan and serine) and
nitrogen containing
heterocycles (including but not limited to imidazole, triazole, triazine,
pyrimidine and
pyridine) are particularly useful. These standard ligands will typically have
a binding
affinity, as measured as a dissociation constant, i.e., Kd, of the order of
nanomolar to about
100 millimolar for the RNA or DNA target. Ammonium isparticularly useful for
RNA since
it has a binding affinity for RNA, as measure by its dissociation constant,
i.e., Kd, of about
50mM.
Other standard ligands will be used for other target molecules. For use with
protein
target molecules, esters such as formate, acetate and propionate, phosphates,
borates, amino
acids and nitrogen containing heterocycles (including but not limited to
imidazole, triazole,
triazine, pyrimidine and pyridine) are particularly useful. As with the above
described RNA
CA 02366488 2001-10-05
WO 01/58573 26 PCT/US01/40064
and DNA target molecules, for protein target molecules as well as for other
target molecules,
the standard ligands will typically have a binding affinity, as measured as a
dissociation
constant, i.e., Kd, of the order of nanomolar to about 100 millimolar for the
target.
By selecting the binding affinity for the standard ligand as described, the
operating
performance conditions of the mass spectrometer are adjusted such that the
signal strength of
the standard ligand to that of the target molecule of from 1% to about 30% of
the signal
strength of unbound target. One or more of the candidate ligands from a set of
compounds is
next screened with a mixture of the target molecule and the standard ligand.
Those candidate
ligands having weak affinities can be identified by the presence of a signal
that is greater than
the background noise of the mass spectrometer. By adjustment of the operating
conditions of
the mass spectrometer using the standard ligands, non-binding ligands are not
detected by the
mass spectrometer.
The candidate ligands can be screened one at a time or in sets. A typical set
would
have from 2 to 10 members. A more preferred set has from 4 to 8 members. The
compound set is screened for members that form non-covalent complexes with the
target
molecule using the mass spectrometer. The relative abundances and
stoichiometries of the
non-covalent complexes with the target molecule are measured from the
integrated ion
intensities. These results can be stored in a relational database that is
cross-indeced to the
structure of the compounds.
For a typical RNA target, the RNA is selected as an RNA molecule have from
about
10 to about 200 nucleotides. This RNA can be an isolated or purified fragment
of a larger
RNA or it can be a synthetic RNA. Such synthetic RNA can be a mimic of a
natural RNA.
A more preferred RNA target molecule would have from about 15 to about 100
nucleotides.
The RNA can have both secondary and ternary structure.
Having derived a set of ligands that bind to the target molecule, in one
embodiment of
the invention, simple derivative of these ligands are made by modifying the
ligand. These
modifications include modification by addition of methyl, amino, nitro,
hydroxyl, bromo,
thio groups or other small substituent group or derivatives where the
composition and size of
rings and side chains have been varied. These derivatives can then be screened
as above to
obtain SAR information and to optimize the binding affinity with the target.
Depending on the size of the compound collection used above, from 2 to 10,000
CA 02366488 2001-10-05
WO 01/58573 27 PCTIUSO1/40064
compounds may form complexes with the target. These compounds are pooled into
groups
of 4-10 and screened again as a mixture against the target as before. Since
all of the
compounds have been shown previously to bind to the target, three possible
changes in the
relative ion abundances are observed in the mass spectrometry assay. If two
compounds bind
at the same site, the ion abundance of the target complex for the weaker
binder will be
decreased through competition for target binding with the higher affinity
binder (competitive
binding). If two compounds can bind at distinct sites, signals will be
observed from the
respective binary complexes with the target and from a ternary complex where
both
compounds bind to the target simultaneously (concurrent binders). If the
binding of one
compound enhances the binding of a second compound, the ion abundance from the
ternary
complex will be enhanced relative to the ion abundances from the respective
binary
complexes (cooperative binding). If the ratio of the relative ion abundances
is greater than 1,
the binding is considered to be cooperative. These ratios of relative ion
abundances are
calculated and can be stored in a database for all compounds that bind to the
target.
Compounds that bind concurrently are further analyzed. Derivatives of
concurrent
binders can be prepared with addition of an added moiety, including but not
limited to
methyl, ethyl, isopropyl, amino, methylamino, dimethylamino, trifluoromethyl,
methoxy,
thiomethyl or phenyl at different positions around the original compound that
binds. These
derivatives can be re-screened as a mixture with compounds that bound
concurrently to the
starting compound. If the additional methyl, ethyl, isopropyl, or phenyl
moiety occupies
space that the concurrent binder occupied, the two compounds will bind
competitively.
Observation of this change in the mode of binding using the mass spectrometer
indicates the
two molecules are spatially proximate as a result of the chemical
modification. Correlation
of the change in binding mode with the size and position of the chemical
modification can be
used as a "molecular ruler" to measure the distance between two compounds on
the surface of
the RNA. Compounds that bind in a cooperative or competitive mode do so by
binding in
close proximity on the target surface. Locations where addition of a moiety
has no effect on
the binding mode are potential sites of covalent attachment between the two
molecules. This
information can be used in conjunction with molecular modeling of the target-
ligand complex
to generate a pharmacophore map of the chemical groups that bind to the target
surface.
In some cases, a 3-dimensional working model of the target structure may be
CA 02366488 2001-10-05
WO 01/58573 28 PCT/US01/40064
available based on NMR or chemical and enzymatic probing data. These 3-D
models of the
target can be used with computational programs such as MCSS (MSI, San Diego)
or QXP
(Thistlesolft, Groton, CT) to locate the possible sites of binding with the
ligand. MCSS,
QCP and similar programs perform a Monte Carlo-based search for sites where
the ligand can
bind, and rank order the sites based on a scoring scheme. The scoring scheme
calculates
hydrophobic, hydrogen-bonding, and electrostatic interactions between the
ligand and target.
The small molecules may bind at many locations along the surface of the
target. However,
there are some locations that are preferred. These calculations can be
performed for
molecules that bind competitively or cooperatively, and favorable binding
conformations
whose proximity is based on the "molecular ruler" as described above can be
identified.
In one embodiment of the invention, the QXP program is used to search all
interaction space around a RNA target molecule and to cluster the results.
From the clustered
results the highest probability, low-energy binding sites for binding ligands
is identified. All
the interaction space around the RNA target is searched for proximate binding
sites between
ligands. The distances between the ligands are measured to obtain the lengths
of linkers
required to connect functional group sites on the ligands for best scaffold
binding. The search
also is used to insure that the lowest energy conformation retains the best
binding contacts.
In conjunction with the developers of QXP, the UNIX version of the QXP program
designed to run on a SGI computer having 128 processors was ported to a LINUX
version
that runs on a PC platform having 56 processors. This resulted in an advantage
in maximizing
the price to performance ratio of the hardware. The computationally intensive
nature of
identifying global energy minimum for a combinatorial library of small
molecule, typically
with 8 - 12 rotatable bonds, bound to the receptor is particularly well suited
to the
"distributed computing" method. The compound library is divided into the
number of
available computational resources and thus the docking calculations are run in
"parallel".
This method exploits the available CPU cycles over a cluster of extremely fast
PC boxes
networked together in a system commonly referred to as a Beowulf-class
cluster. Beowulf-
class clusters are described by E. Wilson in Chemical & Engineering News
(2000, 78(2):27-
31) The PC platform used included 16 PCs, dual Intel pentium 11450 MHz
processors, 256
MB RAM and 6.4 GB disk and 12 PCs, dual Intel pentium 11400 MHz processors,
256 MB
RAM and 6.4 GB disk totaling 56 processors. A benchmark calculation using
350MHz
CA 02366488 2001-10-05
WO 01/58573 29 PCT/USO1/40064
Pentium II processors indicated, in terms of speed, that PC boxes clustered
together as
described would outperform a R5000 SGI 02 machine.
The same result is reported to be accomplished using the MCSS software, i.e.,
MCSS/HOOK. As reported by its manufacture, MSI, San Diego, CA, for proteins,
MCSS/HOOK characterizes an active site's ability to bind ligands using
energetics calculated
via CHARMm. Strongly bound ligands are linked together automatically to
provide de novo
suggestions for drug candidates. The software is reported to provide a
systematic,
comprehensive approach to ligand development and de novo ligand design that
result in
synthetically feasible molecules. Using libraries of functional groups and
molecules, MCSS
is reported to systematically searches for energetically feasible binding
sites in a protein.
HOOK is reported to then systematically searches a database for skeletons
which logically
might connect these binding sites in the presence of the protein. HOOK
attempts to link
multiple functional groups with molecular templates taken from the its
database. The results
are potential compounds that are consistent with the geometry and chemistry of
the binding
site.
An embodiment of the invention relates to methods of determining the relative
interaction of ligands that bind to a target substrate. The exposure of a
target substrate to a
mixture of two or more ligands allows for the formation of noncovalent
complexes. Analysis
of the mixture by mass spectrometry enables the identification of the
complexes formed, the
relative affinities of the ligands and ultimately the type of interaction
between the ligands for
the target. In the simplest situation, two ligands known to bind to a target
are mixed together
and screened by mass spectrometry leading to three conditional relationships;
competitive,
concurrent and cooperative binding.
Competitive binding
Ligands bind competitively for a target when the binding of one ligand
prevents the
binding of the other ligand is the result of the ligands binding to the target
at the same
location. In this situation, the mixture contains an equilibriumof two binary
complexes, one
of which being one ligand bound to the target and the other being the other
ligand bound to
the target. The ligand having the greater affinity for the target will
predominate and thus
have higher signal intensity for its binary complex with the target compared
to the other
CA 02366488 2001-10-05
WO 01/58573 30 ' PCT/US01/40064
ligand. Competitive binding interaction between two ligands is determined
according to
methods of the invention by analyzing the mixture by mass-spectrometry to
detect the
presence or lack of signal corresponding to a ternary complex where both
ligands are bound
to the target at the same time. The lack of signal for a ternary complex
indicates a
competitive binding interaction between the two ligands while the presence of
the signal
indicates a non-competitive interaction.
Accordingly, in an aspect of the present invention, there is provided a method
for
determining the relative interaction between at least two ligands with respect
to a target
substrate. In practicing this method an amount of each of the ligands is mixed
with an
amount of the target substrate to form a mixture. This mixture is analyzed by
mass
spectrometry to determine the presence or absence of a ternary complex
corresponding to the
simultaneous adduction of two of the ligands with the target substrate. The
absence of the
ternary complex indicates that binding of the ligands to the target substrate
is competitive and
the presence of the ternary complex indicates that binding of the ligands to
the target
substrate is other than competitive.
The above method for determining a competitive binding interaction of two
ligands is
exemplified in figure 3 wherein 70 M of a small molecule Ibis-326732 (4-amino-
2-
piperidin-4-ylbenzimidazole) was added to a solution of 100 M glucosamine and
5 M of a
27 nucleotide fragment of bacterial 16S ribosomal RNA incorporating the A -
site. The mass-
spectrum trace for the mixture lacks an intensity signal for a ternary complex
of the two
ligands Ibis-326732 and glucosamine simultaneously bound to the target 16S
RNA. This
indicates that the two ligands are competitive binders for this target i.e.
bind to the same site.
Further, a comparison of the ion abundance of the two binary complexes at
approximately
1762 and 1770 m/z indicates that Ibis-326732 binds to the target RNA with
greater affinity
than glucosamine.
Concurrent binding
Ligands bind concurrently when the binding of one ligand to the target is
unaffected
by the binding of the other and is a consequence of the ligands binding to the
target at distinct
sites. In this situation, a mixture containing two concurrent binding ligands
will have an
equilibrium of two binary complexes, one being first ligand bound to the
target and the other
CA 02366488 2001-10-05
WO 01/58573 31 PCT/US01/40064
being the second ligand bound to the target as well as a ternary complex of
both ligands
bound to the target and unbound target substrate. The ligand having the
greater affinity for
the target will have higher signal intensity for its binary complex with the
target compared to
the other ligand. Concurrent binding interaction between two ligands is
determined
according to methods of the invention by analyzing the mixture by mass-
spectrometry and
comparing the ratios of the ion abundance of the complexes. Particularly, the
absolute ion
abundance of the ternary complex (TL 1 L2) is compared to the relative ion
abundance of the
binary complexes (TL1 and TL2) which contribute to the formation of the
ternary complex
with respect to the unbound target (TL1 X TL2 / T). Since there are two binary
complexes
contributing the formation of the ternary complex, the comparison is with the
sum of the two
contributing binary complexes i.e. TL1 X TL2/T + TL2 X TL1/T. If the absolute
ion
abundance of the ternary complex is equal to the sum of the relative ion
abundance of the
contributing binary complexes, then the two ligands concurrently bind to the
target substrate.
Expressed another way, a pair of ligands are concurrent binders for a target
if in either of the
following equivalent formulae the value of y is equal to zero:
y = TL 1 L2 - TL 1 x TL2 - TL2 x TL 1
T T
or
y= TL1L2 -2x TL1 x TL2
T
The above method for determining a concurrent binding interaction of two
ligands is
exemplified in figure 4 wherein 3,5-diamino-1,2,4-triazole (DT) and 2-
deoxystreptamine (2-
DOS) are both ligands for target RNA (a 27-mer fragment of ribosomal RNA
comprising the
16S A-site). The mass-spectrum trace shows intensity signals for a ternary
complex at
approximately 1778 m/z for both ligands bound to the target 16S RNA, a binary
complex at
about 1758 m/z for 2-DOS bound to 16S RNA, a binary complex at 1746 m/z for DT
bound
to 16S RNA and another signal at about 1727 m/z for 16S RNA unbound by either
ligand.
The relative ion abundance of the ternary complex (16S+2-DOS+DT) with respect
to the
unbound 16S target RNA (16S) is equal, within limits of error, to the sum of
the relative ion
CA 02366488 2001-10-05
WO 01/58573 32 PCTIUSO1/40064
abundance of the contributing binary complex ((16S+DT) X (16S+2-DOS)) with
respect to
the unbound target (16S) and the contributing binary complex ((16S+2-DOS) +
(16S+DT))
with respect to the unbound target (16S). Expressed in a simplified form of
the formula:
y (16S+2-DOS+DT) - 2 X (16S+2-DOS)X(16S+DT) / 16S
This indicates a concurrent binding interaction between the two ligands, 2-DOS
and DT, for
the target 16S RNA. Further, a comparison of the ion abundance of the two
binary
complexes indicates that 2-DOS has greater binding affinity for the target RNA
than DT.
Cooperative binding
Ligands bind cooperatively when the binding of one ligand to the target
enhances the
binding of the other, i.e. more of the first ligand will bind to the target in
the presence of the
second ligand than in its absence. Cooperatively binding ligands may bind to
their target at
distinct locations. In a mixture containing two cooperatively binding ligands
there will be an
equilibrium of two binary complexes, a ternary complex and unbound target. The
ternary
complex is a simultaneous adduction of both ligands to the target. One of the
binary
complexes is complex of the first ligand bound to the target and the other
binary complex is
that of the second ligand bound to the target. The ligand having the greater
affinity for the
target will demonstrate a higher signal intensity for its binary complex with
the target
compared to the other ligand. Cooperative binding interaction between two
ligands is
determined according to methods of the invention by analyzing the mixture by
mass-
spectrometry and comparing the absolute ion abundance of the ternary complex
to the sum of
the relative ion abundance of the binary complexes contributing to the
formation of the
ternary complex in the same manner as for concurrent binders. However, in the
instance of
cooperative binding ligands, the relative ion abundance of the ternary complex
(TL 1 L2/T) is
greater than the sum of the relative ion abundances of the contributing binary
complexes.
Expressed another way, a pair of ligands are concurrent binders for a target
if in either of the
following equivalent formulae the value of y is greater than zero:
y = TL 1 L2 - TL 1 x TL2 - TL2 x TL 1
T T
CA 02366488 2001-10-05
WO 01/58573 33 PCT/US01/40064
or
y = TL 1 L2 - 2 x TL I x TL2
T
Mixed binding
Another scenario can arise when comparing the ion abundances, that is, when
the
ternary ion abundance is less than the sum of the relative abundances of the
contributing
binary complexes (i.e. y of the above formulae is less than zero). This
indicates a more
complex binding situation where there is a combination of interactions
resulting from a
competitive interaction between the ligands while at the same time another non-
competitive
interaction (cooperative or concurrent) is also occurring. Stated another way,
this indicates a
mixed binding mode arising when either or both ligands have more than one
binding site on
the target that may be detected by a mass-spectrum signal for the multiply
bound target.
Complex binding interaction of two ligands includes competitive/cooperative,
competitive/concurrent, cooperative/concurrent, competitive/cooperative/
concurrent or further combinations thereof.
A mixture in which two ligands have both competitive and concurrent binding
interactions will exhibit a mass-spec signal for a ternary complex whereas a
mixture having
only a competitive interaction will exhibit no such signal. A mixture in which
two ligands
exhibit both a competitive and cooperative interaction will exhibit a mass-
spec signal for the
ternary complex and the absolute ion abundance for the ternary complex (TL1L2)
will be
greater than the sum of the relative ion abundance for the contributing binary
complexes
when the cooperative interaction is predominant. Conversely, the absolute
ternary abundance
will be less when the competitive interaction is stronger than the cooperative
interaction.
When there is both competitive and concurrent binding interaction, the
absolute ternary ion
abundance will be less than the sum of the relative ion abundances for the
contributing binary
complexes and greater when there is both cooperative and concurrent binding
interaction.
A further embodiment of the invention includes methods for determining the
relative
proximity and orientation of binding sites for a first ligand and a second
ligand on a target
substrate. The target substrate is exposed to a mixture of the second ligand
and at least one
CA 02366488 2001-10-05
WO 01/58573 34 PCT/US01/40064
derivative compound of the first ligand. Derivative compounds of the first
ligand are
derivative structures that include the first ligand and have at least one
substituent group
pendent from the first ligand. The mixture is analyzed by mass spectrometry to
identify those
first ligand derivatives that inhibits the binding of the second ligand to the
target substrate. In
this embodiment, the method of determining the mode of binding interaction
previously
discussed may be used to determine the spatial proximity of ligand binding
sites on a target.
For example, the knowledge that two ligands are concurrent binders indicates
that they have
separate and distinct binding sites. In order to determine the distance
between these two
binding sites, derivatives of one of the ligands are prepared and mixed with
the other ligand
and the target. The derivatives of the first ligand will have the core
chemical structure of the
ligand but will also have substituents pending from the structure, the
substituents having a
diversity of lengths and attachment points to the structure.
A ligand derivative that inhibits the binding of the second ligand to the
target, i.e. a
derivative that is competitive with the second ligand, provides insight into
the proximity and
orientation of the binding sites relative to each other. A competitive
derivative is identified
by mass-spec analysis of the mixture and its particular substituent and
attachment point on
the parent ligand structure is determined. The point of attachment of the
substituent indicates
the relative orientation while the length of the substituent indicates the
relative proximity of
the binding sites. In this way the substituent group serves as a molecular
ruler and compass.
An efficient manner of performing the method is by employing combinatorial
chemistry techniques to create a library of ligand derivatives having great
diversity in
substituents. Suitable substituent groups include but are not limited to alkyl
(e.g. methyl,
ethyl, propyl), alkenyl (e.g. allyl), alkynyl (e.g. propynyl), alkoxy (e.g.
methoxy, ethoxy),
alkoxycarbonyl, acyl, acyloxy, aryl (e.g. phenyl), aralkyl, hydroxyl,
hydroxylamino, keto
(=O) amino, alkylamino (e.g. methylamino), mercapto, thioalkyl (e.g.
thiomethyl, thioethyl),
halogen (e.g. chloro, bromo), nitro, haloalkyl (e.g. trifluoromethyl),
phosphorous, phosphat,
sulfur and sulfate.
In further embodiment of the invention, the invention includes a screening
method for
determining compounds having binding affinity to a target substrate. A mixture
of the ligands
and the target substrate are analyzed by mass spectrometry. First and second
ligand that bind
to the target substrate are identified. These first and second ligands are
concatenated to form
CA 02366488 2001-10-05
WO 01/58573 35 PCT/US01/40064
a third ligand having greater binding affinity for the target substrate than
either first or second
ligand. In this embodiment of the invention, ligands are identified using mass
spectrometry
methods described herein and are concatenated or linked together to form a new
ligand
incorporating the chemical structure responsible for binding of the two parent
ligands to the
target. The new concatenated ligand will have greater binding affinity for the
target than
either of the two parent ligands. An example of this is illustrated in
examples 4 and 5 and
figures 6-8 where mass-spec analysis of a library of amide compounds revealed
two having
binding affinity for a fragment of bacterial 16S ribosomal RNA. The two
ligands (IBIS-
271583 and IBIS-32661 1) both incorporated a piperazine moiety and a
concatenated
compound of the two ligands was prepared having a common piperazinemoiety from
which
the remainder of the ligand structures depend. The concatenated compound (IBIS
326645) is
shown in figure 8 to bind the target 16S RNA fragment with greater affinity
(52.4% of the
target) than either of the two parent ligands in figures 6 and 7 (27.8% and
14.7%
respectively). In a preferred embodiment, the new concatenated ligand
comprises the
chemical structure of the first and second ligands linked together by a
linking group. Suitable
linking groups are well known in the art and depend upon the chemical
structure of the
ligands and are preferably linked to atoms of the ligand molecule not directly
involved in
binding to the target.
Linking groups are selected that generally are of a length that results in a
reduction in
entropy of the ligand target system. Typically a linker will have a length of
about 15
Angstroms, preferably less than about 10 Angstroms and more preferably less
than 5
Angstroms. Preferred linking groups include but are not limited to a direct
covalent bond,
alkylene (e.g. methylene, ethylene), alkenylene, alkynylene, arylene, ether
(e.g. alkylethers),
alkylene-esters, thioether, alkylene-thioesters, aminoalkylene (e.g.
aminomethylene),
amine, thioalkylene and heterocycles (e.g. pyrimidines, piperizine and
aralkylene).
An example of the above method is shown in figures 5 through 7. In separate
mixtures, 200gM of three ligands IBIS-326611 ((2S)-2-amino-3-hydroxy-l-
piperazinylpropan-l-one), IBIS-326645 (5-methyl-l-(2-oxo-2-piperazinylethyl)-
1,3-
dihydropyrimidine-2,4-dione) and a concatenated compound thereof, IBIS-271583
(1-{2-
[(3 R)-4-((2S)-2-amino-3-hydroxypropanoyl)-3-methylpiperazinyl]-2-oxoethyl}-5-
methyl-
1,3-dihydropyrimidine-2,4-dione) are each mixed with 5 M of target 16S RNA
fragment and
CA 02366488 2001-10-05
WO 01/58573 36 PCTIUS01/40064
analyzed by mass spectrometry. IBIS-326611 is shown in figure 5 to form a
binary complex
having an ion abundance 27.8% that of the unbound 16S RNA while IBIS-326645 in
figure 6
forms a binary complex having an ion abundance 14.7% that of the unbound 16S
RNA.The
concatenated compound IBIS-271483 on the other hand forms a binary complex
having
52.4% ion abundance relative to unbound 16S RNA, and therefor has greater
affinity for the
target 16S RNA than either of the parent compounds.
New concatenated ligands may be screened in the same manner as were the parent
ligands, and the affinities of those that bind may be measured through
titration of the ligand
concentration. The binding location of the new molecule on the target may be
determined
using a mass spectrometry-based protection assay, infrared multiphoton
dissociation, NMR,
X-ray crystallography, AFM force microcopy and other known techniques.
Suitable
concatenated ligands having improved affinity may then be screened in
functional assays to
demonstrate a biological effect appropriate for a drug molecule. If the
biological activity is
insufficient, the molecules may be iterated through the process additional
times.
In a preferred embodiment the linking group is chosen based on the relative
orientation and proximity of the ligand binding sites by exposing the target
substrate to a
mixture of the second ligand and a plurality of derivative compounds of the
first ligand
wherein the first ligand derivatives comprising the chemical structure of the
first ligand and
at least one substituent group pending therefrom. The mixture is analyzed by
mass
spectrometry to identify a first ligand derivative that inhibits the binding
of said second
ligand to the target substrate. In this method, mass spectrometry is used to
infer the locd
environments of ligands. The footprint of one or more of the binding ligands
may be
increased through addition of substituents such as methyl, ethyl, amino,
methylamino,
methoxy, ethoxy, thiomethyl, thioethyl, bromo, nitro, chloro, trifluoromethyl
and phenyl
groups at different positions. This allows a SAR series to be constructed
(either virtually or
in vitro) for each individual ligand. For example, a methyl group may be added
to the first
ligand and it is found by the mass-spec screening that the methyl group does
not affect the
binding of the second ligand. This suggests that a methyl group may be an
appropriate point
to use for ligation with the second ligand. For example, it was found that
first and second
ligands bind cooperatively to a target and that a methyl derivative of the
first ligand retains
the cooperative binding with the second ligand. This indicates that point of
attachment of the
CA 02366488 2001-10-05
WO 01/58573 37 PCT/US01/40064
methyl group on the first ligand may be a suitable point on that ligand for
linking to the
second ligand. In the instance where the binding sites of the first and second
ligand overlap,
a concatenated compound comprising a fusion of the two chemical structures
that are
responsible for binding to the target will have greater affinity to the target
than either first or
second ligand.
Alternatively, the orientation and proximity of the binding sites may be
determined by
molecular modeling techniques, i.e., in silico, using programs such as MCSS
(LeClerk, 1999)
and others that virtually reproduce stacking, hydrogen bonding and
electrostatic contacts with
the target. Preferably, orientation and proximity of the binding sites is
determined by a
combination of molecular modeling and the methods employing derivatized
ligands in an
iterative process wherein each technique provides information useful in
performing the other.
For example, molecular modeling may predict the orientation of a ligand at its
binding site
and give insight into the position at which a substituent or linking group may
be attached to
the ligand. Other techniques may also be used separately or in combination
with those
mentioned such as X-ray crystallography which provides 3-dimensional
orientation and
location when bound to its target. Another technique available for determining
orientation
and proximity of ligands at their binding site for designing linking groups is
by NMR. A
particular NMR method for determining orientation and proximity is described
in patent
application WO97/18469 which claims priority from USSN 08/558,644 (filed 14
November
1995) and 08/678,903 (filed 12 July 1996) each incorporated herein by
reference. In this
NMR method a target molecule is labeled with 15N and analyzed by 15N/'H NMR
correlation
spectroscopy when bound by the ligands. This method is particularly useful for
targets that
are easily labeled with 15N such as proteins and peptide.
EXAMPLES
General
All MS experiments were performed by using an Apex II 70e ESI-FT-ICR MS
(Bruker Daltonics, Billerica, MA) with an actively shielded 7 tesla
superconductingmagnet.
RNA solutions were prepared in 50 mM NH4OAc (pH 7), mixed with 10% isopropanol
to aid
desolvation, and infused at a rate of 1.5 L/min by using a syringe pump. Ions
were formed
in a modified electrospray source (Analytica, Branford, CT) by using an off-
axis grounded
CA 02366488 2001-10-05
WO 01/58573 38 PCT/US01/40064
electrospray probe positioned ca. 1.5 cm from the metallized terminus of the
glass
desolvation capillary biased at 5,000 V. A countercurrent flow of dry oxygen
gas heated to
150 C was used to assist in the desolvation process. Ions wereaccumulated in
an external ion
reservoir comprised of a radio frequency-only hexapole, a skimmer cone, and an
auxiliary
electrode for 1,000 ms before transfer into the trapped ion cell for mass
analysis. Each
spectrum was the result of the co-addition of 64 transients comprised of
524,288 data points
acquired over a 217,391 -kHz bandwidth, resulting in a 1.2-sec detection
interval. All aspects
of pulse sequence control, data acquisition, and postacquisition processing
were performed
by using a Bruker Daltonics data station running XMASS Version 4.0 on a
Silicon Graphics
(Mountain View, CA) R5000
computer.
Example 1
Mass spectrometry-based selection of compounds with affinity for RNA
RNA binding ligands are selected from a set of compounds using mass
spectrometry.
The RNA use for the target molecule is an RNA whose electrospray ionization
properties
have been optimized in conjunction with optimization of the electrospray
ionization and
desolvation conditions. A set of compounds that contains members withmolecular
mass less
than 200, 3 or fewer rotatable bonds, no more than one sulfur, phosphorous, or
halogen atom,
and at least 20 mM solubility in dimethylsulfoxide is used. A 50 M stock
solution of the
RNA is purified, and dialyzed to remove sodium and potassium ions.
The compound set is pooled into mixtures of 8 members, each present at 1-10 mM
in
DMSO. A collection of these mixtures is diluted 1:50 into an aqueous solution
containing 50,
150 mM ammonium acetate buffer at pH 7.0, 1-5 M RNA target, and 10-50%
isopropanol,
ethanol, or methanol to create the screening sample. The aqueous solution
contains 100 M
each of 8 compounds, 50 mM ammonium acetate, 5 pM RNA target, and 25%
isopropanol.
These screening samples are arrayed in a 96-well microtiterplate, or added to
individual vials
for queuing into an automated robotic liquid hander under computer control by
the mass
spectrometer.
The source voltage potentials are adjusted to give stable electrospray
ionization by
monitoring the ion abundance of the free RNA. The temperature of the
desolvation capillary
CA 02366488 2001-10-05
WO 01/58573 39 PCTIUS01/40064
is next reduced incrementally and the voltage potential between the capillary
and the first
skimmer lens element of the mass spectrometer is adjusted until adducts of
ammonia with the
RNA can be observed. If available on the mass spectrometers, the partial gas
pressure
beyond the desolvation capillary is adjusted by throttling the pumping speed.
This gas
pressure may also be altered to optimize the ion abundance and observation of
the
ammonium ion adducts. After instrument performance has been optimized, the
voltage
potential between the capillary and skimmer lens is increase to reduce the
abundance of the
ion from the monoammonium-RNA complex to -10% of the abundance of the ion from
the
RNA. These instrument parameters are used for detection of complexes between
the RNA
and compound set.
The compound set is screened for members that form non-covalent complexes with
the RNA. The relative abundances and stoichiometries of the non-covalent
complexes with
the RNA are measured from the integrated ion intensities, and the results are
stored in a
relational database cross-indexed to the structure of the compounds.
Figure 2 shows the resulting spectrum obtained after adjustment of operating
performance conditions of the mass spectrometer for detection of weak affinity
complexes.
Free target RNA is seen at 1726.7 m/z in the spectrum. Ions associated with
adducts of
ammonium with the RNA target can be observed and are easily differentiated
from sodium
ion adducts based on the combined molecular mass of the ammonium/RNA adducts.
Ions
associated with an adduct of a triazole ligand (2-amino-4-benzylthio-1,2,4-
triazole) are also
seen. The RNA target is present at a concentration 5 micromolar and the
triazole ligand at a
concentration of 100 micromolar and the relative abundances of the ion peaks
are normalized
to that of the target RNA.
Example 2
Chemical optimization of compounds that form complexes with the RNA target.
In a second step, compounds are obtained with structures derived from those
selected in
Example 1. These compounds may be simple derivatives with additional methyl,
amino, or
hydroxyl groups, or derivatives where the composition and size of rings and
side chains have
been varied. These derivatives are screened as in Example 1 to obtain SAR
information and
to optimize the binding affinity with the RNA target.
CA 02366488 2001-10-05
WO 01/58573 40 PCTIUSO1/40064
Example 3
Determination of the mode of binding for compounds forming complexes with the
RNA
target.
In the compound collection used in Example 1, those compounds that formed
complexes with the RNA target are pooled into groups of 4-10 and screened
again as a
mixture against the RNA target as outlined in Example 1. Since all of the
compounds have
been shown previously to bind to the RNA, three possible changes in the
relative ion
abundance are observed in the mass spectrometry assay. If two compounds bind
at the same
site, the ion abundance of the RNA complex for the weaker binder will be
decreased through
competition for RNA binding with the higher affinity binder (competitive
binding). An
example is presented in Figure 3, where the ion abundance from a glucosamine-
RNA
complex is reduced as glucosamine is displaced from the RNA by addition of a
benzimidazole compound. If two compounds can bind at distinct sites, signals
will be
observed from the respective binary complexes with the RNA and from the
ternary complex
where both compounds bind to the RNA simultaneously (concurrent binders). If
the binding
of one compound enhances the binding of a second compound, the ion abundance
from the
ternary complex will be enhanced relative to the ion abundance from the
respective binary
complexes (cooperative binding). An example of cooperative binding between 2-
deoxystreptamine (2-DOS) and 3,5-diaminotriazole (3,5-DT) is presented in
Figure 4. The
relative ion abundance from the secondary complex for 3,5-DT to the free RNA
is measured,
as is the relative ion abundance from the ternary complex between 3,5-DT, 2-
DOS, and RNA
and the binary complex. If the ratio of the relative ion abundance is greater
than 1, the
binding is considered to be cooperative. The ratios of relative ion abundance
are calculated
and stored in a database for all compounds that bind to this RNA.
Example 4
Amide Library Synthesis - General Procedures
Operations involving resin were carried out in a Quest 210 automated
synthesizer
(Argonaut Technologies, San Carlos, CA). HPLC/MS spectra were obtained on a HP
1100
MSD system (Hewlett-Packard, Palo Alto, CA) equipped with a SEDEX (Sedere)
CA 02366488 2001-10-05
WO 01/58573 41 PCT/US01/40064
evaporative light scattering detector (ELSD). A 4.6 x 50 mm Zorbax XDB-C 18
reversed
phase column (Hewlett-Packard, Palo Alto, CA) was operated using a linear
gradient of 5%
A to 100% B over 4 min at 2 mL/min flow rate (A = 10 mM aqueous ammonium
acetate +
1% v/v acetic acid, B = 10 mM ammonium acetate in 95:5 v/v acetonitrile/water
+ 1% v/v
acetic acid. The flow was split 3:1 after the column, with 0.5 mL/min flowing
to the MSD
mass detector, and 1.5 mL/min flowing to the ELSD detector. Quantitation was
based on
integration of the ELSD peak corresponding to product, which was identified by
the
corresponding mass spectrum of the eluting peak.l H NMR spectra for all
compounds were
recorded either at 399.94 MHz on a Varian Unity 400 NMR spectrometer or at
199.975 MHz
on a Varian Gemini 200 NMR spectrometer.
General Procedure for Synthesis of Secondary Amine Resins: Preparation of AG-
MB-
benzylamine resin
2-methoxy-4-alkoxy-benzaldehyde PEG-PS resin (ArgoGel-MB-CHO, Argonaut
Technologies, San Carlos, CA, 10 g, 0.4 mmole/g) was slurried in 30 ml dry
trimethylorthoformate (TMOF). Benzylamine (0.52 ml, 4.8 mmole) was added and
the slurry
swirled gently on a shaker table under dry nitrogen overnight. A solution of
40 ml dry
methanol, acetic acid (0.46 ml, 8.0 mmole) and borane-pyridine complex (1.0
ml, 8.0 mmole)
was added, and the slurry swirled overnight. The resin was filtered, and
washed several times
with methanol, DMF, CH7CIõ and finally methanol. Gel-phase NMR showed complete
conversion from the aldehyde to secondary benzylamine derivative. Gel-phase
13C NMR
(C6D6) 6 40.9, 48.1, 53.0, 54.8, 67.7, 70.9 (PEG linker), 99.5, 104.7, 121.3,
127.0, 127.8
(poly-styrene beads), 128.5, 130.5, 141.2, 159.0, 159.8.
The supports AG-MB-cyclohexylamine and AG-MB-methylamine, were similarly
prepared
using cyclohexyl and methylamine (used as a methanol solution available from
Aldrich),
respectively. The following are the resins employed and the resulting amine
functionality of
the library compounds.
resin amine functionality
1,2-diaminoethane-PS 1,2-diaminoethane
2-OH-1,3-diaminopropane-PS 2-OH-1,3-diaminopropane
CA 02366488 2001-10-05
WO 01/58573 42 PCT/US01/40064
AG-MB-benzylamine benzylamine
AG-MB-cyclohexylamine cyclohexylamine
AG-MB-methylamine methylamine
AG-Rink-NH-Fmoc amino
PS-trityl-piperazine piperazine
General Procedure for Synthesis of Amide Motifs
The desired carboxylic acid (1 eq.) was suspended in dry DMF (5 mL/mmole), and
HATU (Perseptive Biosystems, 1 eq.) and collidine (3 eq.) was added. The
suspension was
stirred for 15 min, and if a suspension still existed, diisopropylethylamine
(1 eq.) was added,
and stirring continued. At this point all acids were in solution. ThisØ2 M
(5 eq. per eq. of
amine on the resin) solution of activated acid was added to the appropriate
rcsin containing a
primary or secondary amine, and the mixture was agitated overnight at 65 C.
The resins
were either purchased from Novabiochem, Argonaut Technologies, or prepared via
the
general procedure. The mixture was filtered, and the resin washed with DMF
(3x), MeOH
(3x), CH,CI2 (3x), DMF (3x) and CH2Cl2 (3x) and dried with a flow of inert
gas. To the
resulting resin, trifluoroacetic acid (7 mL/g dry resin) containing 5% v/v
triisopropylsilane
was added, and the suspension agitated for 4 h. The Mixture was filtered, and
the resin
washed with trifluoroacetic acid (3x). The combined filtrates were
concentrated to afford the
desired products. The products were characterized by HPLC/MS and were
generally
sufficiently pure for testing.
The following are the carboxylic acids each of which were coupled with each of
the
resin bound amines listed above. The corresponding amide functionality of the
resulting
library compounds are listed thereafter.
carboxylic acid
(R)-(-)-2,2-dimethyl-5-oxo-1,3-dioxolane-4-acetic acid
(S)-(+)-2,2-dimethyl-5-oxo-1,3-dioxolane-4-acetic acid
2,3-dihydroxyquinoxaline-6-carboxylic acid
2-N-Bhoc-guanine-l-acetic acid
4-N-Bhoc-cytosine-l -acetic acid
CA 02366488 2001-10-05
WO 01/58573 43 PCT/US01/40064
6-N-Bhoc-adenine-l-acetic acid
bis(BOC-3, 5-diaminobenzoic acid)
BOC-3-ABZ-OH
BOC-benzimidazole-5-carboxylic acid
BOC-glycine
BOC-imidazole-4-carboxylic acid
BOC-isonipecotic acid
BOC-SER(tBu)-OH
FMOC-3 -amino- 1,2,4-triazole-5-carboxylic acid
nalidixic acid
N-BOC-L-homoserine
orotic acid
t-butoxyacetic acid
thymine-l-acetic acid
amide functionality
(R)-3 -hydroxy-3 -c arboxypropi onyl
(S)-3 -hydroxy-3 -c arboxypropionyl
2,3 -dihydroxyquinoxaline-6-carboxyl
guanine- I -acetyl
cytosine-l-acetyl
adenine- 1 -acetyl
3,5-diaminobenzoyl
3-aminobenzoyl
5-carboxy-benzimidazole
1-aminoacetyl
imidazole-4-carboxyl
isonipecotyl
(2S)-2-amino-3 -hydroxypropi onyl
3-amino-1,2,4-triazole-5-carboxyl
nalidixoyl
CA 02366488 2001-10-05
WO 01/58573 44 PCT/USO1/40064
(2S)-2-amino-4-hydroxybutyryl
orotyl
hydroxyacetyl
thymine- l -acetyl
Example 5
(2S)-2-Amino-3-hydroxy-1 piperazinyipropan-l-one
According to the general procedure, the title compound was prepared using PS-
tityl-
piperazine resin (Novabiochem) and BOC-(tBu)-Serine (Bachem): HPLC/MS M+H 174
fnd., (0.25 min, 100%)
Thymine-1-acetylpiperazine
According to the general procedure, the title compound was prepared using PS-
trityl-
piperazine resin (Novabiochem) and thymine- l -acetic acid (Aldrich): HPLC/MS
M+H = 253
fnd., (0.29 min, 100%).
0
NH
HO N'ZO
H2N O O\\J
(N) CN)
N N
H H
(2S)-2-amino-3-hydroxy-1-piperazinylpropan-1-one thymi ne- 1 -acetyl
piperazine
1-{2-[(3R)-4-((2S)-2-Arnino-3-hydroxypropanoyl)-3-nzethylpiperazinylJ-2-
oxoethyl)-5-
methyl-1, 3 -dihydropyrim idin e-2,4-dione.
HATU (1.1 g, 2.7 mmol) and DIEA (4.7 mL, 27 mmol) were added sequentially to a
solution of Boc-Ser(tBu)-OH (0.71 g, 2.7 mmol) in DMF (10 mL). The mixture was
stirred
at room temperature for about 30 min then was added to a solution of (R)-(-)-2-
methylpiperazine (0.3 g, 3 mmol) in DMF (5 mL). The mixture was stirred for 12
h and was
diluted with a mixture of sat. NaHCO3/EtOAc (200 mL, v/v, 50:50). The aqueous
layer was
extracted with more EtOAc (2 X 30 mL). The combined organic layer was dried
(Na,SO4),
CA 02366488 2001-10-05
WO 01/58573 45 PCT/US01/40064
filtered, and concentrated in vacuo to give a colorless oily residue, which
was used in the
next step without purification.
HATU (0.38 g, 1.0 mmol) and 2,4,6-collidine (0.73 mL, 5.5 mmol) were added
sequentially to a solution of thymine-l-acetic acid (0.19 g, I nimol) in DMF
(5 mL). The
mixture was stirred at room temperature for about 30 min then was added to a
solution of the
residue prepared above in DMF (5 mL). The mixture was stirred for 12 h and was
diluted
with a mixture of sat. NaHCO3/EtOAc (100 mL, v/v, 50:50). The aqueous layer
was
extracted with more EtOAc (2 X 10 mL). The combined organic layer was dried
(Na,SO4),
filtered, and concentrated in vacuo to give a colorless oily residue.
Purification of the residue
by flash column chromatography (gradient elution 3-5% MeOH/CH,CL,) provided N-
BOC-
O-t-butyl protected derivative (38 mg, 8% yield in two step): TLC (Rf = 0.4;
10%
MeOH/CH,Cl,); 13CNMR (DMSO-d6) 6169.8, 165.4, 164.4, 155.2, 151.0, 142.2,
107.9, 78.2,
72.7, 61.5, 50.3, 48.2, 45.1, 28.1, 27.1, 11.8; HRMS (MALDI) m/z 532.2736
(M+Na)+
(C24H39N507 requires 532.2747).
A solution of the protected derivative (23.4 mg, 0.046 mmol) in concentrated
aqueous
HCl (2 mL) was stirred at room temperature for 12 h. The reaction mixture was
evaporated
to give the title compound (20 mg, quantitative yield). 13C NMR (CD3OD) 6
167.3, 167.0,
153.2, 143.9, 111.0, 73.6, 72.4, 62.2, 60.8, 54.4, 47.1, 46.5, 43.8, 12.3.
HOO
H-NH N
ON
O
N
NH
O
Example 6
2-Deoxy-1, 3-diazido-4-[(5-bronio-3-nitro-1, 2, 4-triazolyl)methylJ-5, 6-di-O-
acetylstreptamine
Dry hydrogen chloride is passed through a solution of 2-deoxy-1,3-diazido-5,6-
di-O-
acetylstreptamine (296 mg, 1 mmole, prepared according to the method of Wong
et. al., J.
CA 02366488 2001-10-05
WO 01/58573 46 PCT/US01/40064
Am. Chem. Soc. 1999, 121, 6527-6541) and paraformaldehyde (45 mg, 1.5 mmole)
in
dichlorethane at 0 C for 6 h. Solid CaC12 is added, the mixture filtered,
then concentratedin
vacuo. The syrup is azeotroped three times with dry acetonitrile to provide
the chloromethyl
derivative. Separately, a suspension of 5-bromo-3-nitro-1,2,4-triazole (386
mg, 2 mmole) is
stirred with sodium hydride (60% w/w, 80 mg, 2 mmole) for 0.5 h in
acetonitrile (20 mL).
This suspension is then added directly to the chloromethyl derivative, and the
mixture stirred
overnight at room temperature. Water and ethyl acetate were added, the organic
layer
collected, dried over magnesium sulfate, concentrated, and chromatographed
(20% ethyl
acetate/hexanes) to provide the title compound.
2-Deoxy-l,3-diazido-4-[(5-amino-3-nitro-1,2,4-triazolyl)methylJstreptamine
2-Deoxy-1,3-diazido-4-[(5-bromo-3-nitro-1,2,4-triazolyl)methyl]-5,6-di-O-
acetylstreptamine is dissolved in 3:1 dioxane/28% aqueous ammonia, and the
solution stirred
at 60 C in a sealed vessel overnight. The solvent is removed, and the residue
chromatographed (10% methanol/chloroform) to provide the title compound.
2-Deoxy-4-[(3,5-diamino-1,2,4-triazolyl)methyl]streptamine
2-Deoxy- 1,3 -diazido-4-[(5-amino-3 -nitro- 1,2,4-triazolyl)methyl]streptamine
is
dissolved in ethanol, and hydrogenated over 10% palladium oncarbon catalyst at
50 psi with
shaking for 72 h. The mixture was filtered through celite, and the solvent
removed to afford
the title compound.
HO ' N~3\ CH2O/HCI CIAO N3
AcON3 Ac 00 N3
OAc OAc
N O2
N"~INH NaH/MeCN Br
N NH /dioxane
Br N N ~0~ N3 s
N AcO,N3
02N OAc
CA 02366488 2001-10-05
WO 01/58573 47 PCTIUS01/40064
NH2
H2/Pd/C/EtOH
N i N --,,O H2N
N HO~NH2
H2N OH
Example 7
ESI and CAD Mass Spec Analysis of Binding of 2-Deoxystreptamine (2-DOS) to 16S
Ribosomal RNA Fragment.
2'-O-ACE protected 27mer RNA (GGCGUCACACCUUCGGGUGAAGUCGCC;
SEQ ID NO: 1) was purchased from Dharmacon Research (Boulder, CO). Aqueous
solutions
were deprotected for 30 min at 60 C in a 0.1M tetramethylenediamine acetate
buffer at pH
3.5. The resulting solution was evaporated to dryness under reduced pressure
and a stock
RNA solution (80 M) was prepared in 50 mM ammonium acetate buffer, pH 7Ø
All
chemicals were purchased from Aldrich Chemicals (Milwaukee), except for 2-
deoxystreptamine and 3,5-diamino-l-N-methyl-triazole, which were prepared
according to
Georgiadis et al (J. Carbohydr. Chem. 1991, 10, 739-748) and Kaiser et al (US
Patent
2,648,670). Ligands were added to the indicated final concentrations from 20
mM aqueous
solutions. Final RNA concentrations of 5 M were prepared by dilution with 50
mM
ammonium acetate buffer, pH 7.0, and 30% isopropyl alcohol added to assist the
desolvation
process.
Mass spectrometry experiments were performed with an LCQ quadrupole ion trap
mass spectrometer (ThermoQuest; San Jose, CA) operating in the negative
ionization mode
and with a 7.0 Tesla Apex Ile Fourier Transform Ion Cyclotron Resonance
(FTICR) mass
spectrometer (Bruker, Billerica, MA). For the LCQ mass spectrometer, the
electrospray
needle voltage was adjusted to -3.5 kV and the spray was stabilized with a
sheath gas
pressure of 50 psi and an auxiliary gas pressure of 20 psi (60:40 N,:O,). The
sample was
introduced at 2.5 gL/min and the capillary interface heated to a temperature
of 180 C. The
He gas pressure in the ion trap was held at 1 mTorr (uncorrected). MS/MS
experiments on
the LCQ employed a 1.5 Da isolation window having the desiredni/z. Ions were
selected via
resonance ejection and stored with q=0.2. The excitation RF voltage was
applied to the end
caps for 30 msec and increased stepwise over the specified range (0.2-1.6 Vp).
A total of 64
scans comprised of 8 microscans were summed overm/z 1600-2000 following ion
trapping
CA 02366488 2001-10-05
WO 01/58573 48 PCT/US01/40064
for -200 msec.
Identical sample preparations were used for experiments with FTICR mass
spectrometer. The electrospray needle voltage was adjusted to-4.0 kV and the
spray was
stabilized with a gas pressure of45 psi (50:50 N:O2). Sample was introduced at
1ØtL/min
and the capillary interface unheated. Ions were stored for 1.25 sec in a
hexapole ion guide
prior to transfer to the trapped ion cell. The indicated gas pressure over the
vacuum pump
situated below the hexapole ion guide was - 8x10-6 mbar. The parallel
measurements of
relative activation energy were performed with the FTICR mass spectrometer by
varying the
potential difference between the capillary exit and the first skimmer lens
element. Typically,
32 1.2 sec transients of 512k data points were summed prior to Fourier
transformation and
display.
QXP software was used to determine the optimal geometry of ligand-target RNA
complex wherein the RNA was held fixed and the ligand treated as completely
flexible. The
QXP method employed a Monte Carlo perturbation method in conjunction with
energy
minimization to explore the conformational space in a robust manner. QXP used
a modified
version of the AMBER force field with a distance-dependent dielectric of 4.0*r
(Weiner et
al., J. Ain. Cheri. Soc. 1984, 106, 765).
The formal charges on the phosphate oxygen atoms were scaled down by 80% to
account for the absence of explicit solvent molecules or counterions in the
calculations.
During the search process, a random translational movement between 0.5 and 15
A was given
to the ligand.
The solution structure of gentamycin-16S RNA, as determined by using NMR
technique, was used in docking calculations (PDB entry 1BYJ). At the start of
the
calculation, gentamycin was pulled outside the pocket and all the torsions
were randomized.
Docking searches using QXP resulted in rms difference between the lowest
energy docked
structure and the energy-minimized NMR structure of less than 0.5 A. Good
correlation
between the rms deviation and QXP scores was observed.
We used the intensity of 16S:ammonium ion complexes as a measure of the
"harshness" of the ESI and desolvation processes for RNA targets and their
complexes. As
shown in Figure 10 (A), the FTICR source with an unheated desolvation
capillary and a-165
V capillary-skimmer potential lead to complete desolvation of 16S with
concomitant
CA 02366488 2001-10-05
WO 01/58573 49 PCT/US01/40064
dissociation of bound ammonium ions. Ions with adducted sodium and potassium
cations
that were not released during desolvation appeared at higher m/z values.
Decreasing the
capillary-skimmer potential to -115 V generated the spectrum shown in Figure
10 (B). The
identity of the ammonium ion adducts could be established unambiguously from
accurate
measurement of the mass difference (A m/z = 3.406+0.001) relative to the [M-
5H+]5- ions of
16S. Residual waters had been removed, but a series of anmonium-adducted
species were
observed at 3.4 m/z intervals. Under these conditions, non-covalent complexes
stabilized by a
single hydrogen bond were observed. Ina similar manner, lowering the
desolvation capillary
temperature from 180 C to 125 C and increasing the capillary-skimmer potential
difference
from -25 to -45 V generated ammonium-adducted ions of 16S on the quadrupole
ion trap
mass spectrometer (with lower resolution).
2-deoxystreptamine (2-DOS) bound to 16S at multiple locations as a function of
increasing concentration. At 0.33 mM, one 2-DOS bound 16S, generating an [M-
5H+]5-
complex observed at m/z 1758.9. Complexes corresponding to three and four 2-
DOS
molecules bound concurrently to 16S appeared at concentrations above 3.3 mM.
Knowledge
of the binding stoichiometry lead to the use of a fourth-order polynomial for
calculation of
the respective dissociation constants (Ku) (Greig et al., J. Am. Chem. Soc.
1995, 117, 10765-
10766). As shown in Figure 12, the 2-DOS binding data fit to the 4th order
polynomial
(R2=0.99), with estimated Kp values of 0.61+0.08 mM, 1.4+0.1 mM, and 4+1 mM.
The nature of the binding of 2-DOS at two different sites on 16S was
investigated
using collisionally activated dissociation (CAD) and MS/MS. CAD of ions from
the 2-
DOS:RNA complex at m/z 1758.9 yielded ions from unbound 16S. As the relative
dissociation energy was increased (Figure 13) the complex was dissociated into
free 16S ions
and 2-DOS, with 1.13 V yielding 50% dissociation (FO). Next, we studied the
CAD of the
bis-(2-DOS):16S complex at m/z 1791.4. As shown in Figure 14, the E50 of the
bis.(2-
DOS):16S complex was also 1.13 V, but the product ions were composed of both
free 16S
and the (2-DOS):RNA complex. The abundance of the resulting (2-DOS):16S
complex
increased as the power was increased to 1.21 V, and then started to decrease
at higher
activation energies, with free 16S ions as the major product. We investigated
the stability of
the (2-DOS):16S complex generated from the bis-(2-DO S):16S complex in an
MS/MS/MS
experiment. First, the (2-DOS): 16S complex product was isolated following CAD
of the bis-
CA 02366488 2001-10-05
WO 01/58573 50 PCTIUS01/40064
(2-DOS):16S complex. These ions were then subjected to additional CAD at
different
activation energies. The conversion of the (2-DOS): 16S complex to free 16S
ions was abrupt
relative to Figure 13, with an E50 of 1.17 V. In contrast to the ions which
started as a (2-
DOS): 16S complex, complete dissociation of the (2-DOS): 16S ions generated
from the bis-
(2-DOS):16S complex occurred at 1.3 V.
Potential binding sites for 2-DOS on 16S have been investigated using
molecular
modeling. Leclerc et al., (Theor. Chem. Acc. 1999, 101, 131-137) suggested the
preferred
binding site for 2-DOS on 16S was near the site where the 2-DOS ring binds as
part of
neomycin-class aminoglycosides. We used QXP, a Monte Carlo-based
conformational
search algorithm to locate the binding sties for 2-DOS on the RNA using random
initial
coordinates. We observed two high-probability binding sites corresponding to
the location of
the 2-DOS ring in neomycin-class aminoglycosides and at the location of the L-
idose ring in
paromomycin that has been determined by NMR spectroscopy (Fourmy et al.,
Science
(Washington, D. C.) 1996, 274, 1367-1371). Additional higher energy binding
sites were
observed along the wall of the major groove generated by the bulged A1492 and
A1493
residues.
Example 8
Determination ofBindingInteraction ofDeoxvstreptamine (2-DOS) and 3,5-
Diaminotriazole
(3,5-DT) with target 16S Ribosomal RNA Fragment.
Mass spectrometry assay was used to identify other ligands that bind to 16S
with low
affinity. The compounds 3,5-diaminotriazole (3,5-DT) and 2,4-diaminopyrimidine
(DAP,
Figure 11) bind 16S with -mM affinities. In a subsequent step, pairs of
ligands were mixed
with 16S and ESI-MS was used to study the stoichiometry of the resulting
complexes. A
solution containing 5 tM 16S and 100 M 2DOS was mixed with 0.5 mM 3,5-DT. ESI-
MS
produced signals from free 16S, (3,5-DT):16S, and (2-DOS):16S (Figure 4). An
additional
signal was observed from the ternary complex formed between 16S and the two
low affinity
ligands (2-DOS and 3,5-DT) at m/z 1778.5. The formation of this ternary
complex is
consistent with simultaneous, concurrent binding of both ligands at different
locations on the
RNA surface. In addition, a ternary complex was observed at m/z 1791 produced
by
concurrent binding of two 2-DOS ligands. Binding of 3,5-diamino-l-N-
methyltriazole to
CA 02366488 2001-10-05
WO 01/58573 51 PCT/US01/40064
16S was not observed by ESI-MS at the ligand concentrations employed. That the
addition
of a methyl group at Ni is sufficient to preclude binding of the 3,5-DT to 16S
suggests a
hydrogen bond from Ni is required for binding of the 3,5-DT, or binding occurs
at a
sterically limited site on 16S. In contrast, aminoalkyl 3,5-DT derivatives
complexed to 16S
with affinities similar to 3,5-DT. In contrast to the concurrent binding
observed with 2-DOS
and 3,5-DT, only signals from 2 DOS:16S complexes were observed when 2,4-
diaminopyrimidine and 2-DOS were mixed with 16S. The lack of asignal from the
ternary
complex suggests that their preferred sites overlap and 2-DOS displaces DAP
for binding.
Example 9
Determination of relative gas phase activation energies (E,g) for dissociation
of a series
ligand-16S complexes.
The relative gas-phase activation energies (EA) for dissociation of a series
of ligand-
16S complexes was determined using the FTICR mass spectrometer. The relative
ion
abundances for a series of complexes between 16S and ammonia, glucosamine
(GA), 4-
aminoimidazole-5-carboxamide (AICA), DAP, 4-aminobenzamidine (ABA), 2-
guanidylbenzimidazole (GBI) (figure 11), as well as a series of their ternary
complexes was
measured as a function of the voltage difference between the capillary exit
and the skimmer
cone. In each case, a plot of the natural logarithm of the ion abundance
versus the
dissociation potential was linear with R2=0.99+0.02. The slopes were
normalized to the E
for ammonia, and are listed in Table 1 below. The relative gas-phase EA for
AICA, DAP, and
GBI were 2.04, 2.16, and 2.12, respectively. The EAfor GA and ABA were 2.86
and 4.00.
The order of these values correlated with the solution affinities except for
GA, whose
solution affinity for 16S was lower than GBI. The increase in gas phase
stability for the GA
16S complex may result from additional H-bond contacts between hydroxyl groups
and 16S.
The relative EA for several ternary complexes were also measured using the
FTICR
mass spectrometer. The GBI:ABA:16S complex dissociated with the EAof the
weaker GBI
ligand. However, the EA for the GA:AICA: 16S and GA:DAP: 16S complexes were
equal to
the higher EA of the GA: 16S complex, rather than the lower EA of the AICA or
DAP
complexes. The products from gas-phase dissociation of the GA:AICA:I6S and
GA:GA: 16S
ternary complexes were measured using the LCQ mass spectrometer. Isolation and
CAD of
CA 02366488 2001-10-05
WO 01/58573 52 PCTIUSO1/40064
the GA:GA:16S complex yielded GA:16S and 16S in a 3:1 ratio at 50%
dissociation.
Isolation and CAD of the GA:AICA: 16S complex yielded AICA: 16S and 16S in a
1:1 ratio
at 50% dissociation. Hence, the higher EA for he GA:AICA:16S complex was
consistent
with the observed product ions where GA or GA and AICA were displaced from
16S. This
result suggests that the AICA may lie deeper in the binding pocket than GA,
and dissociation
from the ternary complex may be blocked. Alternatively, binding of GA may
induce a
change in the conformation of the RNA that traps the lower affinity ligand.
Table 1. Relative activation energies and solution affinities for a series of
ligand: 16S
complexes.
Compound Relative EA Relative Soln. Affinity
NH3 1.00a
2,4-Diaminopyrimdine 2.16+0.11 .17+0.04
4-Aminoimidazolecarboxamide 2.04+0.16 .26+0.04
Glucosamine 2.86+0.21 .86+0.03
2-Guanylbenzimidazole 2.12+0.09 .99+0.02
4-aminobenzamidine 4.00+0.28 1.001
a. All activation energies have been normalized to the activation energy for
loss of
ammonia
b. All solution affinities have been normalized to the solution affinity of 4-
aminobenzamidine
CA 02366488 2002-04-04
SEQUENCE LISTING
<110> Isis Pharmaceuticals, Inc.
<120> Optimization of Ligand Affinity for RNA Targets Using Mass Spectrometry
<130> P58-PCA101
<150> 09/499,875
<151> 2000-02-08
<150> 09/573,479
<151> 2000-05-16
<150> 2,366,488
<151> 2001-02-08
<160> 1
<170> Patentln version 3.1
<210> 1
<211> 27
<212> RNA
<213> Artificial Sequence
<220>
<223> Ribosomal RNA Fragment
<400> 1
ggcgucacac cuucggguga agucgcc 27
