Note: Descriptions are shown in the official language in which they were submitted.
INT~RNATIDNAL
StAHC;h Intemdtlonal
Htrur~ Application
i No
CA 02367037
2001-08-31 PCT/US
00/05728
C.(Continuatlon)
DOCUMENTS
CONSIDERED
TO
BE
RELEVANT
CategoryCitation of document, with indication,where Relevant to
appropriate, of the relevant passages claim No.
X WO 96 41865 A (ARIAD GENE THERAPEUTICS 1,4,
INC
;CLACKSON TIMOTHY (US); HOLT DENNIS 11-13,
A)
27 December 1996 (1996-12-27) 16-18,
20-24,
31-33
page 2, line 10 -page 6, line 25
page 14, line 31 -page 21, line 21
page 29, line 11 -page 33, line 10
page 53, line 25 -page 55, line 25
examples 1-8
X WO 96 37609 A (ZENECA LTD ;JEPSON IAN 1,4,6, I
(GB); MARTINEZ ALBERTO (GB); GREENLAND 11,16,
ANDR) 28 November 1996 (1996-11-28) 18,20,
22,23,
31-33
page 9, line 10 -page 12, line 36
page 13, line 11 -page 14, line 7;
examples I-X
X WO 94 29442 A (BASF AG ;BUJARD HERMANN 1,2,4,6,
(DE); GOSSEN MANFRED (DE); MOSS JEFFREY 11,
W)
22 December 1994 (1994-12-22) 16-20,
31-33
page 2, line 1 -page 5, line 20
page 12, line 14 -page 16, line 28
page 23, line 21 -page 28, line 9
page 32, line 12 -page 35, line 5;
examples 1,2
X WO 93 23431 A (BAYLOR COLLEGE MEDICINE) 1,4,
25 November 1993 (1993-11-25) 11-13,
16-18,
20-24,
31-33
page 6, line 17-27
page 16, line 1 -page 18, line 27
A MARGOLIN JUDITH F ET AL: 25,26
"Krueppel-associated boxes are potent
transcriptional repression domains"
PROCEEDINGS OF THE NATIONAL ACADEMY
OF
SCIENCES OF USA,US,NATIONAL ACADEMY
OF
SCIENCE. WASHINGTON,
vol. 91, no. 10, May 1994 (1994-05),
pages
4509-4513, XP002136979
ISSN: 0027-8424
the whole document
-/__
Forth PCT/ISA/210 (continuation of second sheet) (July 1992)
page 2 of 3
INT~HNATIUNAL
StAliC:h Intesn~tional
r~trvrc Application
~ No
CA PCT/US
02367037 00/05728
2001-08-31
C.(Contlnuatlon)
DOCUMENTS
CONSIDERED
TO
BE
RELEVANT
CategoryCitation of document, with indication,where Relevant to
appropriate, of the relevant passages claim No.
A RUSSO M W ET AL: "IDENTIFICATION OF 25,26
NAB1
A REPRESSOR OF NGFI-A- AND KROX20-
MEDIATED TRANSCRIPTION"
PROCEEDINGS OF THE NATIONAL ACADEMY
OF
SCIENCES OF USA,US,NATIONAL ACADEMY
OF
SCIENCE. WASHINGTON,
vol. 92, 1 July 1995 (1995-07-O1), pages
6873-6877, XP002034500
ISSN: 0027-8424
the whole document
A HIDALGO A: "The roles of engrailed" 25,26
TRENDS IN GENETICS,NL,ELSEIIIER SCIENCE
PUBLISHERS B.11. AMSTERDAM,
vol. 12, no. 1, 1996, pages 1-4,
XP004037189
ISSN: 0168-9525
the whole document
P,X WO 00 09704 A (JEPSON IAN ;ZENECA LTD 1,4,6,8,
(GB); FRAY RUPERT GEORGE (GB); MARTINEZ 11,12,
ALB) 24 February 2000 (2000-02-24) 16-20,31
page 6, line 5-15
page 10, line 10-27
page 14, line 2-32
examples 1-7
P,X WO 99 25856 A (HEDDLE JOHN A ;SWIGER 1,2,4,
ROY R
(CA)) 27 May 1999 (1999-05-27) 6-8,11,
12,16,
18-22,
24,25,
31-33
page 2, line 16 -page 3, line 32
page 6, line 11 -page 9, line 25
page 12, line 19 -page 15, line 31
T CHEN 1 G ET AL: "Groucho/TLE family 25,26
proteins and transcriptional repression"
GENE,NL,ELSEIIIER BIOMEDICAL PRESS.
AMSTERDAM,
vol. 249, no. 1-2, May 2000 (2000-05),
pages 1-16, XP000946056
ISSN: 0378-1119
the whole document
Forth PCT/ISA/2t0 (continuation of second sheet) (July 1992)
page 3 of 3
INTERNATIONAL
SEARCH REPORT
ink-~&ional
Application
No
information PCT/US
on patent family 00/05728
members
Patent documentPublication Patent Publication
family
cited in searchdate members) date
report
WO 9710337 A AU 7103896 A O1-04-1997
20-03-1997
EP 0871729 A 21-10-1998
JP 11511328 T 05-10-1999
WO 9641865 A AU 714904 B 13-O1-2000
27-12-1996
AU 6270696 A 09-O1-1997
CA 2219080 A 27-12-1996
EP 0833894 A 08-04-1998
WO 9637609 A AU 711391 B 14-10-1999
28-11-1996
AU 5771696 A 11-12-1996
BG 102124 A 30-11-1998
BR 9608897 A 29-06-1999
CA 2219121 A 28-11-1996
CN 1191568 A 26-08-1998
CZ 9703722 A 18-03-1998
EP 0828829 A 18-03-1998
HU 9802225 A 28-O1-1999
JP 11506319 T 08-06-1999
NO 975419 A 22-O1-1998
PL 323587 A 14-04-1998
WO 9429442 A AU 684524 B 18-12-1997
22-12-1994
AU 7108194 A 03-O1-1995
CA 2165162 A 22-12-1994
DE 705334 T 30-12-1999
EP 0705334 A 10-04-1996
ES 2140359 T O1-03-2000
JP 9500526 T 21-O1-1997
US 5650298 A 22-07-1997
US 5789156 A 04-08-1998
US 5888981 A 30-03-1999
US 5859310 A 12-O1-1999
US 6004941 A 21-12-1999
US 5589362 A 31-12-1996
US 5814618 A 29-09-1998
US 5866755 A 02-02-1999
US 5912411 A 15-06-1999
US 5922927 A 13-07-1999
WO 9323431 A US 5364791 A 15-11-1994
25-11-1993
AU 685054 B 15-O1-1998
AU 4241793 A 13-12-1993
AU 6065198 A 02-07-1998
CA 2135644 A 25-11-1993
EP 0745121 A 04-12-1996
JP 7509694 T 26-10-1995
US 5935934 A 10-08-1999
US 5874534 A 23-02-1999
WO 0009704 A AU 5379699 A 06-03-2000
24-02-2000
WO 9925856 A US 5968773 A 19-10-1999
27-05-1999
AU 1138499 A 07-06-1999
EP 1034287 A 13-09-2000
Form PCT/ISAr210 (patent family annex) (July 1992)
CA 02367037 2001-08-31
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
DNA BINDING COMPOUND-MEDIATED MOLECULAR SWITCH SYSTEM
Field Of The Invention
s The present invention relates to methods for the regulated expression of a
gene using
cells which comprise a molecular switch, including a transcriptional
regulatory ~iotein, a
DNA response site for the transcriptional regulatory protein, and a compound
binding
sequence in the vicinity of the DNA response site, such that sequence-
dependent binding of a
compound to the compound binding sequence modulates expression of a gene
operably linked
1 o thereto.
References
Albanese et al., J Biol Chem 1995 Oct 6;270(40):23589-97.
Antona V et al., Cytogenet Cell Genet. 83(1-2):90-2 (1998).
15 Artier et al., Cancer Res. 1997 Apr 15;57(8):1569-74.
Ausubel, et al. , CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons,
New
York, N.Y., (1989).
Ayer, D.E., et al., Mol. Cell Biol 16(10):5772-5781, (1996).
A-Mohammadi, S., et al., Gene Ther 4:993-997, (1997).
2o Bagai, S., and Sarkar, D.P., FEBSLett 326:183-188, (1993).
Bailey PJ et al., J Steroid Biochem Mol Biol. 63(4-6):165-74, (1997).
Baim, S.B., et al., Proc Natl Acad Sci USA 88(12):5072-5076, (1991).
Baumann et al., Plant Cell. 11(3):323-34, 1999.
Beerli, R.R., et al., Proc Natl Acad Sci USA 95(25):14628-33, (1998).
25 Beier et al., Proc Natl Acad Sci U S A. 1999 Feb 16;96(4):1433-8.
Bilbao, G., et al., FASEB J 11(8):624-634, (1997).
Blaese, R.M., et al., Science 270:475-480, (1995).
Bohl, D., etal., NatMed (3):299-305; 278-9, (1997).
Bohl, D., and Heard, J.M., Hum Gene Ther 8(2):195-204, (1997).
3o Bourillot et al., J Gen Virol. 1998 Feb;79 ( Pt 2):363-70.
Brand NJ, Int J Biochem Cell Biol. 1997 Dec;29(12):1467-70.
Brar, D.S., et al., Biotechnol Genet Eng Rev 13:167-79, (1996).
Braselmann, S., et al., Proc Natl Acad Sci USA. 90(5):1657-1661, (1993).
Briata P, et al., FEBS Lett 402(2-3):131-5 (1997).
3 5 Busch et al. , Mol Endocrinol . 1997 Mar; l l (3) : 379-89.
Bremen R.E., et al., Chem Biol 5(3):119-33, (1998).
Burcin, M.M., et al., Proc Natl Acad Sci USA 96(2):355-60, (1999).
Bushman, F., Science 267:1443-1444, (1995).
Butler, M., MAMMALIAN CELL BIOTECHNOLOGY: A PRACTICAL APPROACH, IRL Press,
40 (1991).
Culig, Z., et al., Cancer Res 54(20):5474-5478, (1994).
Delgado MD et al., FEBS Lett 444(1):5-10 (1999).
Delort, J.P., and Capecchi, M.R., Hum Gene Ther 7(7):809-820, (1996).
Dzau, V., Keystone Symposium Molecular and Cellular Biology of Gene Therapy,
Keystone,
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
Co. January 19-25, (1998).
Egholm, M., et al., J. Am. Chem. Soc 114:1895-1897, (1992).
Egholm, et al., Science 254:1497, (1991).
Evans, et al., HANDBOOK OF PLANT CELL CULTURES, Vol. 1, MacMillan Publishing
Co.
s New York, (1983).
Fisher F et al., EMBO J 12(13):5075-82 (1993).
Fraley, et al., Proc Natl Acad Sci USA 79:1859-1863, (1982).
Fraley, et al., Proc Natl Acad Sci USA 80:4803, (1983).
From, et al., Proc. Nat Acad Sci USA 82:5824, (1985).
1 o Gatz, C . , et al. , R Mol Gen Genet 227(2) :229-37, ( 1991 ) .
Gelvin, S.B., et al., eds. PLANT MOLECULAR BIOLOGY MANUAL, (1990).
Gossen, M., and Bujard, H., Proc Natl Acad Sci 89(12):5547-5551, (1992).
Gossen, M., et al., Trends Biochem. Sci 18:471-475, (1993).
Gossen, M., et al., Science 268(5218):1766-1769, (1995).
15 Greisman, H.A., and Pabo, C.O., Science 275(5300):657-61, (1997).
Guo, H., and Kohlhaw, G.B., FEBSLett 390(2):191-195, (1996).
Hanvey, et al., Science 258:1481-1485, (1992).
Horsch, etal., Science 233:496-498, (1984).
Hsiao, et al. , Proc Natl Acad Sci USA 76:3829, (1979).
2o Ido, A., etal., CancerRes 55(14):3105-3109, (1995).
Ikeda et al., Mol. Cell. Biol. 18(1):10-18, (1998).
Isner, J., Keystone Symposium Molecular and Cellular Biology of Gene Therapy,
Keystone,
Co. January 19-25, (1998).
Jiang, et al. , Oncogene, 8:3447-3457, 1993.
2 s Johnstone RW et al. , Biochemistry 37(34):11924-31 ( 1998).
Jones FS, Proc Natl Acad Sci U S A 90(14):6557-61, 1993
Kasuga, M., et al., Nat Biotechnol 17(3):287-291, (1999).
Keown, et al., Methods in Enzymology 185:527-537 (1990).
Klein, et al., Nature 327:70-73, (1987).
3o Knudsen and Muller, Planta 185:330-336, (1991).
Koh, G.Y., et al., J Clin Invest 95(1):114-121, (1995).
Kolodziejczyk, P.P., Adv Exp Med Biol 464:5-20, (1999).
Krens, et al., Nature 296:72-74, (1982).
Larrick, J.W., Res Immunol 149:603-608, (1998).
35 Li S et al., J Biol Chem., 274(12):7803-15 (1999).
Lu, B., and Federoff, H.J., Hum Gene Ther 6(4):419-428, (1995).
Ma, J.K., and Vine, N.D., Curr Top Microbiol Immunol 236:275-92, (1999).
Mailly F et al., Mol Cell Biol 16(10):5346-57 (1996).
Maniatis, et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d Edition (1989).
4 o Mansour, et al. , Nature 336:348-352 ( 1988).
Margolin, J.F., et al., Proc Natl Acad Sci USA 91(10):4509-13, (1994).
McBryant, S.J., et al., J Mol Biol 286(4):973-81, (1999).
Miller, N., et al., Melanoma Res 5(2):75-81, (1995).
2
W~ X0/$2179 CA 02367037 2001-08-31 PCT/US00/0$728
Miller, N., and Whelan, J., Hum. Gene Ther 8:803-815, (1997).
Mizuno, M., et al., Cancer Res 50:7826-7829, (1990).
Montenay-Garestier, T., et al., CIBA Found Symp 158:147-157, (1991).
Moore, I., et al., PNAS 95:376-381, (1998).
s Moosmann P et al., Biol Chem 378(7):669-77 (1997).
ivlorishita, R., et al., Hyperterasian 21:894-899, (1993).
Nagel, R., et al., FEMS Microbiol. Lett 67:325, (1990).
Nan X et al., Nature 393(6683):386-389 (1998).
No, D., et al., Proc Natl Acad Sci USA. 93(8):3346-3351, (1996).
to Peffer, N.J., et al., Proc. Natl. Acad. Sci. USA 90(22):10648-10652,
(1993).
Perms, M., et al., J Virol 69(9):5506-5515, (1995).
Pomerantz, et al., Science 267(5194):93-96, (1995).
Redolfi, et al. , Neth J Plant Pathol 89:245-254, (1983).
Rehli M et al., J Immunol 162(3):1559-1565 (1999).
15 Ren B et al., Genes Dev. 13(1):125-37 (1999).
Rivera, V.M., et al., Nat Med 2(9):1028-1032, (1996).
Sadowski, L, et al., Nature 335(6190):563-564, (1988).
Salmons, B., and Gunzburg, W.H., Hum Gene Ther 4:129-141, (1993).
Sambrook, et al. , MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Edition, Cold
2 o Spring Harbor Laboratory press ( 1989).
Satijn DP et al., Mol. Cell. Biol. 17(7):4105-4113, (1997).
Schell, J., Science 237:1176-1183, (1987).
Shaw, et al., Gene 23:315 (1983).
Seipel, K., et al., EMBO J 13:4961-4968, (1992).
2s Smith, J.D., et al., Proc Natl Acad Sci USA 92(25):11926-11930, (1995).
Smolenska, L., et al., FEBS Lett 441:379-382, (1998).
Soucek L, et al., Oncogene 17(19):2463-72 (1998).
Stelnicki EJ et al., Differentiation 62(1):33-41 (1997).
Takahashi T et al., Jpn J Cancer Res 89(4):347-51 (1998).
3o Thiel G et al., J Biol Chem 273(41):26891-9 (1998).
Tian, X.C., and Yang, X.J., Mol Med Today 4(10):424-425, (1998).
Triezenberg, S.J., et al., Genes Dev 2:718-729, (1988).
Uknes, etal., Plant Cel14:645-656, (1982).
Valsesia-Wittman, S., et al., J. Virol 68:4609-4619, (1994).
3s Van Loon, PlantMol Viol 4:111-116, (1985).
Van Solingen, et al., J. Bact 130:946, (1977).
Vasil, LR., CELL CULTURE AND SOMATIC CELL GENETICS OF PLANTS, ed., Acad.
Press,
Orlando, Vol. I, (1984), and Vol. III, (1986).
Walther, W., and Stein, U., J. Mol Med 74:379-392, (1996).
4o Wang, J.C., and Van Dyke, M.W., Biochim Biophys Acta 1218(3):308-314,
(1994).
Warren, G.J., Curr Biol 8(15):R514-6, (1998).
White RJ et al. , Science 266(5184) 448-450 ( 1994).
White, S., et al., Chem Biol 4(8):569-78, (1997).
3
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
Wingo, P.A., et al., Cancer 82(6):1197-1207, 1998.
Wittung, P. , et al. , Nature 368:561-563, ( 1994).
Wolfgang CD et al., Mol Cell Biol 17(11):6700-6707 (1997).
Wu, G.Y., et al., J. Biol. Chem 269:11542-11546, 1994.
s Xu, Z., et al., Bioorg Med Chem 5(6):1137-47, (1997).
~Y'e, X., et al., Science 283(5398):88-91, (i999).
Yarranton, G.T., Curr. Opin. Biotechnol 3:506-511, 1992.
Zazopoulos E et al., Nature, 390(6657):311-5, (1997).
Zhang D et al. , J Biol Chem 273(29):18086-91 (1998).
to Zipfel PF et al., Biochim Biophys Acta 1354(2):134-144 (1997).
Cowell et al., Nucleic Acids Res. 1996 Sep 15;24(18):3607-1.
Deuschle et al., Mol Cell Biol. 1995 Apr;lS(4):1907-14.
Estrem et al., Proc Natl Acad Sci U S A. 1998 Aug 18;95(17):9761-6.
Gansauge et al., Cancer Res. 1997 May 1;57(9):1634-7.
15 Hall et al., Adv Cancer Res. 1996;68:67-108.
Herber et al., Oncogene, 9(7):2105-7, 1994a.
Herber et al., Oncogene, 9(4):1295-304, 1994b.
Hinz et al. Mol Cell Biol. 19(4):2690-8, 1999.
Hunter and Pines, Cell. 1994 Nov 18;79(4):573-82.
zo Jiang et al., Oncogene. 1993 Dec;B(12):3447-57.
Kornmann et al., J Clin Invest. 1998 Jan 15;101(2):344-52.
Lenzmeier et al., Mol Cell Biol. 1998 Feb;l8(2):721-31.
Licht et al. , Mol Cell Biol. 1994 Jun;14(6):4057-66.
Loser et al., Biol Chem Hoppe Seyler. 1996 Mar;377(3):187-93.
25 Matsumura et al., EMBO J. 1999 Mar 1;18(5):1367-77.
Matsumura et al., EMBO J. 1999 Mar 1;18(5):1367-77.
Motokura and Arnold, Genes Chromosomes Cancer. 1993 Jun;7(2):89-95.
Motokura et al., Nature. 1991 Apr 11;350(6318):512-5.
Philipp et al. , Mol Cell Biol. 1994 Jun;14(6):4032-43.
3o Quelle et al., Genes Dev. 1993 Aug;7(8):1559-71.
Resnitzky et al., Mol Cell Biol. 1994 Mar;l4(3):1669-79.
Saha et al., Nature. 1993 Jun 17;363(6430):648-52.
Sandig et al., Gene Ther. 1996 Nov;3(11):1002-9
Schnabell et al. , Mol Cell Biol. 1996 Jun;16(6):2678-88.
35 Schwechheimer et al., Plant Mol Biol. 1998 Jan;36(2):195-204.
Sherr et al., Science. 1996 Dec 6;274(5293):1672-7.
Shtutman et al., Proc Natl Acad Sci U S A. 1999 May 11;96(10):5522-7.
Swirnoff et al., Mol Cell Biol. 1998 Jan;l8(1):512-24.
Tetsu et al., Nature. 1999 Apr 1;398(6726):422-6.
4o Tzamarias et al., Nature. 1994 Jun 30;369(6483):758-61
Ulmasov et al., Plant Mol Biol. 1997 Nov;35(4):417-24.
Watanabe et al., J Biol Chem. 1996 Sep 13;271(37):22570-7.
Watanabe et al. , Mol Cell Biol. 1998 Jun;18(6):3212-22.
Welch et al., J Biol Chem. 1994 Dec 9;269(49):31051-8.
45 Whelan et al., J Steroid Biochem Mol Biol. 1996 Apr;58(1):3-12.
Wilde et al., EMBO J. 1992 Apr;ll(4):1251-9.
Withers et al., Mol Cell Biol. 1991 Oct;ll(10):4846-53.
4
WO 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
Xiong et al., Cell. 1991 May 17;65(4):691-9.
Yan, Nakagawa et al., J Biol Chem. 1997 Dec 26;272(52):33181-90.
Zhang et al., J Biol Chem. 1997 Nov 14;272(46):29272-80.
Zhou et al., Genes Chromosomes Cancer. 1995 Aug;l3(4):285-90.
Background Of The Invention
Regulated gene expression has utility in a variety of applications including
the
expression of recombinant proteins, modified production of various
metabolites, functional
studies in cell-based assays and in vivo in transgenic animals, in gene
therapy vectors, and in
1 o plant expression vectors for controlled transgene expression.
Gene therapy is a fast evolving area of medical and clinical research. Gene
therapy
encompasses gene correction therapy and transfer of therapeutic genes and is
being applied
for treatment of cancer, infectious diseases, monogenic diseases, multigenic
diseases, and
acquired diseases.
There are an increasing number of anecdotal cases of efficacy in the use of
gene
therapy for the treatment of monogenic diseases, early stage tumors, and
cardiovascular
disease (Blaese, et al., 1995; Wingo, et al., 1998; Dzau, et al., 1998; Isner,
et al., 1998).
However, all of the currently utilized methods of gene transfer typically
demonstrate low
transfer efficiency and expression rates. As the technology is improved and
high efficiency
2 0 gene transfer and expression is achieved, the ability to regulate such
expression on both a
temporal and spatial level becomes increasingly important.
In addition, the development of plants having desired traits such as improved
yield;
disease resistance to fungal, bacterial, viral and other pathogens; insect
resistance; improved
fruit ripening characteristics; cold temperature and dehydration tolerance;
increased salt and
2 s drought tolerance; improved food quality (i. e. , nutritional content) and
improved appearance
has been the focus of agribusiness for many years. At present, the regulated
expression of
transgenes in plants with optimal expression of target genes in manner that
does not result in
harm to the plant is the focus of extensive research.
Attempts to control gene activity have been made using various inducible
eukaryotic
3 o promoters, such as those responsive to heavy metal ions, heat shock or
hormones. In most
cases, the effect of exogenous inducers is pleiotropic, in that it induces the
expression of
endogenous cellular genes in addition to the target transgene. Second, many
promoter
systems exhibit high levels of basal activity in the non-induced state, i. e.
, endogenous
activators often interfere with regulation of transgene expression.
3 s Several systems for regulatable expression of genes ("gene switch"
systems) have been
reported in the literature. Such systems are based on modifying the activity
of synthetic
regulatory proteins, which bind to double stranded DNA and control the
activity of a promoter
for a given gene, by the use of exogenous inducers (compounds) that
specifically interact with a
particular synthetic regulatory protein.
4 o In systems where an inducer interacts with a regulatory protein, the
regulatory protein
dictates the selection of inducer. So, the ability to choose an inducer with
better
pharmacological properties are limited by the selection of regulatory protein.
Methods for screening and constructing molecules, which have properties of
sequence specific DNA binding and displacement of protein that is bound at
flanking or
5
WO X0/52179 CA 02367037 2001-08-31 pCT/US00/05728
adjacent sites on a DNA sequence, have been reported in co-owned U.S. Pat.
Nos.
5,306,619, 5,693,463, 5,716,780, 5,726,014, 5,744,131, 5,738,990, 5,578,444,
5,869,241.
Using such methods, several classes of small molecules that interact with
double-
stranded DNA have been identified, and shown to preferentially recognize
specific nucleotide
s sequences.
A need exists foi the development of systems for regulatable gene expression
which
are controlled, inducible by compounds targeted to polynucleotides, and
characterized by low
toxicity and favorable pharmacokinetic properties.
1 o Summary Of The Invention
The invention provides a molecular switch which employs a natural, engineered
or
synthetic DNA binding transcriptional regulatory protein and a compound
(inducer) that
interacts with double stranded DNA in the vicinity of the transcriptional
regulatory protein
binding site or DNA response element.
1 s The binding of the compound to DNA affects the binding of the
transcriptional
regulatory protein to its DNA response element, thereby modifying the
expression of a gene
operably linked to the DNA response element.
More particularly, the invention provides a molecular switch which includes a
first
nucleic acid construct that has a DNA response sequence for a transcriptional
regulatory
2 o protein operably linked to a first promoter; a compound binding sequence
in the vicinity of
the DNA response sequence for binding to a DNA binding compound; a transgene
under the
control of the first promoter; and a DNA binding compound.
In some cases, the molecular switch includes an engineered, non-native
exogenous or
synthetic transcriptional regulatory protein, by providing a second nucleic
acid sequence
25 having the coding sequence for a transcriptional regulatory protein
operably linked to a
second promoter.
The molecular switch may take the form of a single vector comprising one or
more
promoters, or may take the form of a two vector embodiment, wherein each
vector comprises
a promoter, which may be the same or different.
3 o Promoters for use in the molecular switch may be compound inducible or
constitutive
promoters.
The molecular switch may provide from 1 to 12 compound binding sequences,
wherein each compound binding sequence has from about 8 to 20 nucleotides.
The molecular switch may further provide from 1 to 12 tandem repeated
3 s transcriptional regulatory protein DNA response sequences.
The invention further includes a method of producing cells comprising a
molecular
switch for modulating gene expression, and cells produced by that method.
A method of screening DNA-binding compounds for the ability to regulate a
molecular
switch is also included in the invention and is based on: (i) identifying a
DNA sequence to
4 o which a DNA binding compound is to bind; (ii) providing a nucleic acid
construct having a
DNA response sequence for a transcriptional regulatory protein and a compound
binding
sequence in the vicinity of the DNA response sequence; (iii) screening a
plurality of
candidate DNA binding compounds, by exposing each of the candidate compounds
to the
6
CA 02367037 2001-08-31
WO 00/52179 PCT/LTS00/05728
nucleic acid construct and identifying DNA binding compounds having the
ability to bind to
the compound-binding sequence.
Brief Description Of The Figures
s Figure 1 is a schematic illustration of a transcriptional regulatory
protein/DNA
ri~iiilding compound-mediated molecular switch system, wherein a
transcriptional regulatory
factor (TF, consisting of a transcriptional activator or repressor domain and
a compound-
binding domain), which may be native to a cell or provided exogenously in a
plasmid (pTF),
interacts with a response element (RE) comprising a ligand binding site (LBS)
and a
to transcriptional regulatory factor binding site (TFBS). Components of the
system include a
transcription factor, a small molecule or ligand and a switchable promoter
construct.
Figure 2A shows the consensus sequence of the rrnB P1 promoter UP element
which
has been previously described (Estrem et al. , 1998).
Figure 2B shows the sequence of nucleotides -66 to +50 of the rrnB P1
promoter.
i5 Figure 3 depicts exemplary switchable promoter constructs engineered to
have a
compound, ligand or drug binding sequence near the cis element, with the
transcriptional
regulatory protein DNA response element indicated as bolded and uppercase, the
introduced
nucleic acid sequence for compound binding indicated in lowercase and
potential compound
binding sequences indicated as ( ) or [ ]. In such constructs, the compound
binding sequence
2 o may be introduced relative to the transcriptional regulatory protein DNA
response element,
in one or more locations including: (1) on either side, (2) on both sides, (3)
upstream, (4)
downstream, or (5) overlapping the DNA response element.
Figure 4A depicts various oligonucleotide constructs engineered to have a
compound-
binding sequence, indicated as ( ) or [ ], in the vicinity of rrnB P1 promoter
UP element.
2s Figure 4B depicts the effect of various concentrations of 21x on reporter
expression
in E. coli strains that carry rrnB P1 promoter constructs (the sequences for
which are
presented in Fig. 9A), fused to a lacZ reporter on the chromosome as a phage
mono-lysogen,
as indicated in the figure. Cells were incubated with or without 21x for 24
hrs and promoter
activities assayed following treatment. Promoter activities are expressed as a
percentage of
3o basal promoter activity. All samples were in triplicate, the error bars
represent standard
errors of the mean (SEM) for three separate experiments.
Figure 5 depicts the upper strand of various double-stranded oligonucleotides
engineered to have a compound-binding sequence in the vicinity of a UL9 DNA
response
element, wherein the transcriptional regulatory protein DNA response element
is indicated as
3 5 bolded and uppercase, introduced compound binding sites are indicated in
lowercase and
potential compound binding sites are indicated as ( ) or [ ].
Figure 6 depicts the results of DNA binding studies with the modified UL9 DNA
response sequences presented in Fig. 9A and 32P labeled oligos, incubated with
various
concentrations of 21x. The modified sequences include "YK 202LX" (shown as
diamonds,
4o SEQ ID N0:18), "YK 202RX-A" (shown as squares, SEQ ID N0:19), and "YK
202RX"
(shown as triangles, SEQ ID NO: 21).
Figure 7 depicts the upper strand of various double-stranded oligonucleotides
engineered to have a drug-binding sequence overlapping an p50 NF-KB DNA
response
7
CA 02367037 2001-08-31
WO 00/52179 PCT/US00/05728
element, with the transcriptional regulatory protein DNA response element
indicated as
bolded and uppercase, introduced drug binding sites indicated in lowercase and
potential drug
binding sites indicated as ( ) or [ ].
Figure 8A depicts the results of DNA binding studies with the modified p50 NF-
KB
s DNA response sequences of 21x. The modified sequences include "JF101" (shown
as
diamonds, SEQ ID N0:3I), "JF102" (shown as ~c~uares, SEQ 11O:N0:32), and
"JF103"
(shown as triangles, SEQ ID N0:33).
Figure SB depicts the results of DNA binding studies with the modified p50 NF-
KB
DNA response site, JF102 and 32P labeled oligonucleotides, incubated with
various
1 o concentrations of distamycin.
Figure 9 depicts the results of DNA binding studies with the modified LacR DNA
response sequences (lac0) and 32P labeled oligos, incubated with various
concentrations of
21x. The modified sequences include the sequence presented as SEQ ID N0:34
(shown as
squares) and the sequence presented as SEQ ID N0:35 (shown as diamonds).
15 Figure 10 depicts the results of DNA binding studies with a modified LacR
DNA
response sequence (SEQ ID N0:35) and 32P labeled oligos, incubated with
various
concentrations of 21x (shown as diamonds) or IPTG (shown as squares).
Figure 11 depicts the effect of 21x on the activity of the chimeric activator
ULVP on
various promoter constructs driving firefly luciferase, transfected into MCF7
cells.
2o Transfected cells were incubated with or without 21x for 48 hrs and
promoter activities assayed
at 48 hrs post-transfection. Promoter activities were normalized relative to
the co-transfected
internal control (pRL-NULL basal promoter) driving Renilla luciferase and
expressed as a
percentage of the untreated wild-type promoter construct.
Figure 12 depicts the effect of 21x on various cyclin Dl promoter derivatives
driving
2s firefly luciferase in pGL3 basic, transfected into MCF7 cells, as indicated
on the Figure.
Transfected cells were incubated with or without 21x for 48 hrs and promoter
activities assayed
at 48 hrs post-transfection. Promoter activities were normalized relative to
the co-transfected
internal control (pRL-NULL basal promoter) driving Renilla luciferase and
expressed as a
percentage of the untreated wild-type promoter construct. All samples were in
triplicate, the
3 o error bars represent standard errors of the mean (SEM) for three separate
experiments.
Figure 13 depicts the dosage-dependent effect of the DNA-binding compound
GL046732 on the activity of engineered HBV core promoter constructs driving
firefly
luciferase in pGL3 basic, in HepG2 cells, where CpWT is the core promoter wild
type
construct (SEQ ID NO:51), CpTATARdsI (SEQ ID NO:55) and CpHNF3Rds1 (SEQ ID
35 N0:58), have dsl sequences placed adjacent and overlapping the TATA and
proximal HNF3
site, respectively.
Figures 14 A and B depict the sequence of the PACT ULVP activator construct
construct (SEQ ID N0:61).
Figures 15 A and B depict the sequence of the pACT ULKRAB repressor construct
40 (SEQ ID N0:62).
DETAILED DESCRIPTION OF THE INVENTION
I. DEFINITIONS
As used herein, a nucleic acid may be double stranded, single stranded, or
contain
8
CA 02367037 2001-08-31
WO 00/52179 PCT/US00/05728
portions of both double stranded or single stranded sequence. The depiction of
a single strand
also defines the sequence of the other strand and thus also includes the
complement of the
sequence.
As used herein, the term "recombinant nucleic acid" refers to a nucleic acid,
originally
formed in vitro, in general, by the manipulation of nucleic acid.
A ''heteroiogous nucleic acid construct" has a sequence portion which is not
native to
the cell in which it is expressed. Heterologous, with respect to a control
sequence/coding
sequence combination refers to a control sequence (i. e. , promoter or
enhancer) together with
a coding sequence or gene, that is not found together in nature, in other
words, the promoter
1 o does not regulate the expression of the same gene in the heterologous
nucleic acid construct
and in nature. Generally, heterologous nucleic acid sequences are not
endogenous to the cell
or part of the genome in which they are present, and have been added to the
cell, by
transfection, microinjection, electroporation, or the like. Such a
heterologous nucleic acid
construct may also be referred to herein as an "expression cassette".
As used herein, the term "vector" refers to a nucleic acid construct useful
for transfer
of the vector between different host cells. An "expression vector" refers to a
vector that has
the ability to incorporate and express heterologous DNA fragments in a foreign
cell. Many
prokaryotic and eukaryotic expression vectors are commercially available.
Selection of
appropriate expression vectors is within the knowledge of those having skill
in the art.
2 o As used herein, the term "plasmid" refers to a circular double-stranded
(ds) DNA
construct used as a vector, and which forms an extrachromosomal self-
replicating genetic
element in many bacteria and some eukaryotes.
As used herein, the term "gene" means the segment of DNA involved in producing
a
polypeptide, which may or may not include regions preceding and following the
coding
2 5 region. For example, 5' untranslated (5' UTR) or "leader" sequences and 3'
UTR or
"trailer" sequences, as well as intervening sequences (introns) between
individual coding
segments (exons), may or may not be included in the DNA segment designated as
the gene.
As used herein the term "transgene" refers to the portion of a heterologous
nucleic
acid construct, expression cassette or vector which comprises the coding
sequence for a
3 o polypeptide, wherein the gene is associated with other components, i. e. ,
the promoter with
which it is not normally associated in nature.
As used herein, the term "regulatable expression system", or "molecular switch
system" includes the DNA response element (site or sequence) for a
transcriptional regulatory
protein, a promoter, a compound-binding sequence, and a DNA binding compound.
In some
35 cases, the "regulatable expression system", or "molecular switch system"
further includes an
exogenously provided transcriptional regulatory protein.
As used herein, the term "DNA response element" refers to the DNA binding site
or
sequence for a transcriptional regulatory protein, which may be the same as,
overlapping, or
adjacent to, a compound-binding sequence.
4o As used herein, the terms "compound binding sequence", "compound binding
site",
"ligand binding sequence", and "ligand binding site" are used interchangeably
and refer to
the portion of a DNA sequence with which a compound, ligand, or molecule
interacts
resulting in the modified binding of a transcriptional regulatory protein to
its DNA binding
9
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
site (or DNA response element). In some cases the compound, ligand, or
molecule may also
be designated a compound or inducer. The "compound-binding sequence" or
equivalent is in
the vicinity of the DNA response element for transcriptional regulatory
protein and may be
adjacent (i. e. , flanking), overlapping, or the same as the DNA binding site
for a
s transcriptional regulatory protein.
As used herein, the term "promoter" refers to a sequence of DNA that functions
to
direct transcription of a gene which is operably linked thereto. The promoter
will generally be
appropriate to the host cell in which the target gene is being expressed. The
promoter may
or may not include additional control sequences (also termed "transcriptional
and
to translational regulatory sequences"), involved in expression of a given
gene product. In
general, transcriptional and translational regulatory sequences include, but
are not limited to,
promoter sequences, ribosomal binding sites, transcriptional start and stop
sequences,
translational start and stop sequences, and enhancer or activator sequences.
The promoter
may be homologous or heterologous to the cell in which it is found.
is As used herein, the terms "regulatable promoter", "inducible promoter" and
"switchable promoter", are used interchangeably and refer to any promoter the
activity of
which is affected by a cis or traps acting factor.
As used herein, the terms "transcriptional regulatory protein" ,
"transcriptional
regulatory factor" and "transcription factor" may be used interchangeably with
the term
20 "DNA-binding protein" and refer to a cytoplasmic or nuclear protein that
binds a DNA
response element and thereby transcriptionally regulates the expression of an
associated gene
or genes. Transcriptional regulatory proteins generally bind directly to a DNA
response
element, however in some cases may bind indirectly to the another protein,
which in turn
binds to or is bound to the DNA response element.
2 s As used herein, the term "transcriptional regulatory fusion protein"
refers to a
recombinant fusion protein consisting essentially of a DNA binding domain and
a regulatory
domain. The terms "chimeric protein" and "fusion protein" are used
interchangeably herein,
and refer to the transcriptional regulatory fusion proteins of the invention.
It will be
understood that in some cases a DNA binding protein may lack a regulatory
domain and that
3 o the methods of the invention are also applicable to such transcriptional
regulatory proteins.
Such a transcriptional regulatory protein may be (I) natural (native), (2)
chimeric
(chimera of the DNA-binding domain of a natural protein and the regulatory
(activator or
repressor) domain of a natural protein, (3) synthetic, having a novel DNA-
binding domain
designed by structural modeling, phage display screen, or other methods, and
(4) may or
3 s may not take the form of a fusion protein.
As used herein, the terms "natural regulatory factor", "natural regulatory
protein",
"native regulatory factor", and "native regulatory protein" are used
interchangeably and refer
to transcriptional regulatory factors that are either broadly effective,
tissue-specific, disease-
specific or heterologous natural (native) factors. Such factors may be
provided exogenously
40 or may be endogenous to a particular tissue or cell type.
As used herein, the terms "synthetic regulatory factor", "synthetic regulatory
protein"
and "engineered regulatory factor", are used interchangeably and refer to
factors that are non-
native (not natural) to the host, and are provided exogenously to a cell.
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
As used herein, the term "operably linked" relative to a recombinant DNA
construct
or vector means a nucleotide component of the recombinant DNA construct or
vector is in a
functional relationship with another nucleotide component of the recombinant
DNA construct
or vector. For example, a promoter or enhancer is operably linked to a coding
sequence if it
s affects the transcription of the coding sequence; or a ribosome binding site
is operably linked
to a coding sequence if it is positioned so as to facilitate translation: -
E~enerally, "operably
linked" means that the DNA sequences being linked are contiguous, and, in the
case of a
secretory leader, contiguous and in reading phase. However, enhancers do not
have to be
contiguous.
to As used herein, the term "expression" refers to the process by which a
polypeptide is
produced based on the information contained in a given DNA sequence. The
process
includes both transcription and translation.
A host cell has been "transformed" by exogenous or heterologous DNA when the
DNA has been introduced into the cell. Transformation may or may not result in
integration
is (covalent incorporation) into the chromosomal DNA of the cell. For example,
in eukaryotic
cells such as yeast and mammalian cells, the transfected DNA may be maintained
on an
episomal element such as a plasmid.
As used herein, the terms "stably transformed", "stably transfected" and
"transgenic"
refer to cells that have a non-native (heterologous) nucleic acid sequence
integrated into the
2o genome. Stable transformation is demonstrated by the establishment of cell
lines or clones
comprised of a population of daughter cells containing the transfecting DNA.
In some cases "transformation" is not stable, i. e. , it is transient. In the
case of
transient transformation, the exogenous or heterologous DNA is expressed,
however, the
introduced sequence is not integrated into the genome.
2 s As used herein, the term "co-transformed" refers to a process by which two
or more
recombinant DNA constructs or vectors are introduced into the same cell. "Co-
transformed"
may also refer to a cell into which two or more recombinant DNA constructs or
vectors have
been introduced.
As used herein, the term "adjacent" refers to two sites on a given DNA
sequence
3 o which in general are separated by less than about 20 nucleotides.
As used herein, the term "flanking compound-binding sequence" means a sequence
of from about 8 to 20 nucleotides which is introduced in the vicinity of the
DNA response
element for a transcriptional regulatory protein. For example, a sequence of
from about 8 to
20 nucleotides may be introduced, 3' and 5' , respectively, of the
transcriptional regulatory
3 5 protein DNA response element.
As used herein, the term "sequence preferential binding" refers to the binding
of a
molecule to DNA in a manner which indicates a preference for binding to a
certain DNA
sequence relative to others.
As used herein, the term "sequence specific binding" refers to the binding of
a
4 o molecule to DNA in a manner which indicates a strong binding preference
for a particular
DNA sequence.
As used herein, the term "sequence-dependent binding" refers to the binding of
molecules to DNA in a manner that is dependent upon the target nucleotide
sequence. Such
11
WD X0/52179 CA 02367037 2001-08-31 PCT/[JS00/~5728
binding may be "sequence-preferential" or "sequence-specific.
As used herein, the term "inhibit binding" relative to the effect of a given
concentration of a particular compound on the binding of a transcriptional
regulatory protein
to its DNA response element refers to a decrease in the amount of binding of
the
s transcriptional regulatory protein to its DNA response element relative to
the amount of
binding in the absence of the same concentration of the particular compound,
and includes
both a decrease in binding as well as a complete inhibition of binding.
As used herein, the term "regulate a molecular switch" refers to the ability
of a DNA
binding compound to bind to a nucleic acid sequence in the vicinity of the DNA
response
1 o element for a transcriptional regulatory protein, thereby modifying the
expression of a gene
operably linked to the DNA response element.
As used herein, the terms "compound", "molecule", "ligand" and "inducer" are
used
interchangeably and refer to molecules or ligands characterized by sequence-
preferential or
sequence-specific binding to DNA at a sequence which is adjacent (i. e. ,
flanking),
15 overlapping, or the same as, the DNA binding site for a transcriptional
regulatory protein.
As used herein, the term "dimer" refers to a compound that has two subunits,
which
are linked to one another and each of which may or may not have the same
chemical
structure. "Dimers" are a preferred embodiment for compounds used in the
methods and
compositions of the invention.
2 o As used herein, the terms "modulate" and "modify" are used interchangeably
and refer
to a change in biological activity. Modulation may relate to an increase or a
decrease in
biological activity, binding characteristics, or any other biological,
functional, or
immunological property of the molecule.
The systems of the present invention described herein as systems for
"modifying the
2 s level of expression of an exogenous gene by a DNA-binding compound", or
"regulatable
expression systems", are also referred to as "molecular switch systems".
As used herein, the terms "native", "natural" and "wild-type" relative to a
particular
nucleic acid sequence, trait or phenotype refers to the form in which that
nucleic acid
sequence, trait or phenotype is found in nature.
3 o As used herein, the term "transgenic plants" refers to plants that have
incorporated
exogenous nucleic acid sequences, i. e. , nucleic acid sequences which are not
present in the
native ("untransformed") plant or plant cell.
As used herein, the term "T DNA sequence" refers to a sequence derived from
the T,
plasmid of Agrobacterium tumifaciens containing the nucleic acid sequence,
which is
3 s transferred to a plant cell host during infection by Agrobacterium.
As used herein, the term "border sequence" refers to the nucleic acid
sequence,
which corresponds to the left and right edges ("borders") of a T-DNA sequence.
As used herein, a "plant cell" refers to any cell derived from a plant,
including
undifferentiated tissue (e. g. , callus) as well as plant seeds, pollen,
progagules and embryos.
4o As used herein, the term "modified" regarding a plant trait, refers to a
change in the
phenotype of a transgenic plant relative to a non-transgenic plant, as it is
found in nature.
As used herein, the term "in vitro" relative to the molecular switch system
described
herein, refers to cell-based assays carried out in vitro, including, but not
limited to, binding
12
W~ ~~/52179 CA 02367037 2001-08-31 PCT/US00/05728
and displacement assays and expression assays using reporter genes.
As used herein, the term "in vivo" refers to the in vivo expression of a
transgene
using a regulatable molecular switch, as described herein.
II. Regnlatable Gene ExQression/Molecular Switch Systems
A. General Considerations
An effective regulatable gene expression system for use in the methods and
compositions of the invention has the following properties: (1) the ability to
increase or
decrease the expression of a gene of interest, (2) the ability to control the
level of expression,
to and (3) the ability to reduce the potential toxicity of the compound used
to induce expression.
B. Expression Systems Induced By Binding To Transcriptional Re~ulatory
Proteins
Many DNA binding transcription factors are comprised of separable DNA binding
and transcriptional activation domains. By interchanging DNA-binding and
transcriptional
15 activation domains from bacterial, yeast, mammalian, and viral proteins,
chimeric regulatory
proteins may be developed which have unique specificity and can be regulated
in various host
cell systems.
Several groups have successfully engineered chimeric regulatory proteins,
which are
generally composed of a non-mammalian DNA-binding domain and a regulatory
domain of
2 o either mammalian or non-mammalian origin. A chimeric transcriptional
activator with a non-
mammalian DNA-binding domain allows activation of a non-mammalian response
element in
a mammalian system. Depending upon the level of activation required, strong
viral or
cellular activation domains are used.
Synthetic inducible systems utilizing both prokaryotic and eukaryotic non-
mammalian
2 s DNA-binding domains have been described in the literature. The present
invention makes
use of various components of the synthetic inducible systems and chimeric
regulatory
proteins, as summarized below.
Prokaryotic inducible systems generally make use of prokaryotic
repressor/operator
systems such as the tet (tetR) or lac (lacI) repressor proteins. The repressor
proteins contain
3 o domains that bind operator sequences specifically and domains that bind
specific exogenous
inducers (e.g. tetracycline for tetR and IPTG for lacI), and bind their
operators in the
absence of exogenous inducers that block transcription. In the presence of an
exogenous
inducer, the repressor binds to the inducer, changing its conformation,
resulting in release of
the repressor from the operator, and activation of transcription. New
synthetic regulatable
3 s systems have been developed by fusing the DNA binding and inducer binding
domains of
these bacterial regulatory proteins to viral transactivation domains (Baim et
al. , 1991; Gossen
and Bujard, 1992).
The purine repressor protein, PurR, is a member of the lac repressor, LacI,
family of DNA-binding proteins and binding to the operator of the pur regulon
results
4 o in negative coregulation of expression. The exemplary native
transcriptional
regulators of PurR: purF, purFMUT, IHF, and Lef-1 provide potential binding
sites
for the purR protein, making them targets for regulation of the repressor
using DNA-
binding compounds.
13
WO UO/52179 cA 02367037 2001-08-31 PCT/US00/05728
Further exemplary systems include a synthetic expression system containing a
modified CMV promoter with tandem repeats of tet0 elements and a fusion
protein
consisting of a TetR DNA binding domain and a VP16 transactivator. Upon
binding of
tetracycline or doxycycline to the TetR protein, the chimeric TetR/VP16
protein is released
s from tet0 elements and gene expression is down regulated (tet OFF system).
Inducer
mediated up-regulation of transcription has been achieved by fnutating the
TetR such that the
mutant TetR (TetR*) binds to tet0 elements in the presence of inducers such as
tetracycline
or doxycycline and up-regulates transcription of the transgene (tet ON
system). (Gossen, et
al. , 1995). The TetR systems lack appropriate pharmacokinetics for rapid
temporal
1 o regulation in that to reach the maximal activation in the tet ON system,
the inducer needs to
be cleared from the cells. Following removal, the resumption of full promoter
activity takes
48 hours for tetracycline and 216 hours for doxycycline for (A-Mohammadi, et
al., 1997).
Also described in the literature are similar synthetic expression systems
which are
responsive to hormones such as estradiol or RU486. (See, e.g., Wang, et al.,
1994; Delort
15 and Capecchi, 1996.) However, the inducers used in these systems, estradiol
and RU486,
are toxic or abortive.
A further type of regulatable expression system includes a DNA binding unit
(ZFHD 1 /FKB 12), and transcriptional activation unit (NF-KB p65/FRAP, Rivers,
et al. ,
1996), expressed as separate polypeptides which come together in the presence
of an
2 o exogenous inducer (rapamycin), to function as a response element specific
transcriptional
activator. Although the synthetic components of the chimeric transactivator
are of human
origin, and accordingly may be less immunogenic in humans, the inducer,
rapamycin, is an
immunosuppressive agent.
Non-mammalian eukaryotic elements which have also been utilized to generate
2 s chimeric regulators include the yeast Saccharomyces cerevisiae Gal4 DNA
binding domain
(Braselmann et al., 1993; Wang et al., 1994) or Leu3 (Guo and Kohlhaw, 1996)
has been
fused with various regulatory domains. For example, a fusion protein
consisting of the Gal4
DNA binding domain, the estrogen receptor or the mutated progesterone receptor
ligand
binding domain and the VP16 transactivation domain may be regulated by
exogenous
3 o estradiol or RU486, respectively (Whelan and Miller, 1996; Wang et al. ,
1994). Several
variations of this basic system have been described (Whelan and Miller, 1996).
The insect hormone ecdysone inducible expression system (No et al., 1996), is
based
on a chimeric ecdysone receptor/VP16 fusion protein which dimerizes with the
retinoid X
receptor in the presence of ecdysone or its synthetic analogue, muristerone.
The dimerized
3 s receptor binds the ecdysone response element and acts as transcriptional
activator.
A further type of regulatable expression system includes a DNA binding domain
and
transcriptional activation domain expressed as separate polypeptides, and
which come
together in the presence of an exogenous inducer to function as a response
element specific
transcriptional activator. An exemplary construct includes, as a DNA binding
domain,
4o ZFHD1 (a synthetic fusion protein that contains zinc forgers 1 and 2 from
Zif268, a short
polypeptide linker, and the homodomain of Oct-1; Pomerantz et al., 1995),
fused to the
human protein FKB12, and the p65 activation domain of the human transcription
factor NF-
KB fused to another human protein FRAP (Rivers et al. , 1996). Although the
synthetic
14
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
components of the chimeric transactivator are derived from human origin, and
accordingly
may be less immunogenic in humans, the inducer, rapamycin, is an
immunosuppressive
agent.
None of the aforementioned regulatable expression systems exhibit all the
features of
an effective regulatable gene expression system. The TetR system lacks
pharmacokinetics
necessary for a tightly controlled system. In addition, systems such as TetR
are not
applicable to agricultural applications, in that it is not practical for an
inducer (i. e.
tetracycline) to be spayed on an entire field of plants.
The hormone (estradiol or RU486) and rapamycin-inducible systems suffer from
1 o toxicity problems with the specific compounds used to induce expression.
Further, in the
ecdysone system and the rapamycin inducible system, two chimeric proteins need
to be
expressed in order to make the chimeric transcription factor.
C. Expression Systems Induced By BindingyTo DNA
1 s All of the aforementioned regulatable expression systems utilize compounds
(inducers) that act on protein transcriptional factors. The binding of a
compound or inducer
to a transcriptional regulatory protein appears to change the conformation of
the protein,
which leads to the changes in either the DNA binding property or the
dimerization property
of the factors, resulting in changes in the regulatory properties of the
chimeric regulator.
2 o The fact that prior art protein-inducible systems require a compound which
is specific to the
inducer domain of the transcriptional regulatory protein significantly limits
the choice of
compounds capable of functioning as inducers in a given system. Any DNA
binding
compound that modulates the binding of the transcriptional regulatory protein
can be utilized
as an inducer in the molecular switch systems of the present invention. In
both switch-on and
2 s switch-off systems, described herein, the incorporation of compound-
binding sequences in the
vicinity of the DNA response element for a transcriptional regulatory protein
permits a wide
selection of compounds effective to regulate the expression of genes operably
linked to such a
response element. However, it will be understood that in some cases the
compound-binding
sequence and the DNA response element for the transcriptional regulatory
compound have
3o the same sequence.
The present invention is directed to a molecular switch system utilizing a
transcriptional regulatory protein and an exogenously supplied compound, which
targets
nucleic acid, not protein. It has been well established through the MerlinT"'
technology that
DNA binding compounds, when bound to double stranded DNA at sites in the
vicinity of
35 regulatory protein binding sequences, can displace the bound protein. See,
e.g., U.S. Pat.
Nos. 5,306,619, 5,693,463, 5,716,780, 5,726,014, 5,744,131, 5,738,990,
5,578,444, and
5,869,241, expressly incorporated reference herein.
III. Methods And Compositions Of The Invention
4 o In the molecular switch methods and compositions of the invention, when a
transcriptional regulatory protein DNA binding site is in the vicinity of (the
same as,
overlapping or adjacent to), a compound-binding site, the binding of the
transcriptional
regulatory protein may be controlled by an exogenous DNA binding compound.
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
A. Embodiments Of The Molecular Switch System
A number of embodiments of the molecular switch systems of the invention may
be
used to regulate gene expression. In its basic form, the molecular switch
system includes a
s nucleic acid construct which has a compound-binding site in the vicinity of
(the same as,
overlapping or adjacent to), the DNA response site for a transcriptional
regulatory protein, a
DNA binding compound and a transcriptional regulatory factor (Figure 1).
Transcriptional
regulatory factors or proteins for use in the molecular switch systems of the
invention may be
one or more of (I) endogenous, (2) exogenously supplied, (3) native, (4)
synthetic
to (engineered), (5) chimeric, (6) effective in specific tissues or cell
types, and (7) effective in a
tissue or cell type independent manner.
The components of the molecular switch system of the invention may be provided
to
a cell by way of one or two vectors.
In one exemplary one vector embodiment of the invention, the transcriptional
1 s regulatory protein may be a native endogenous protein. In such cases, the
vector comprises a
synthetic DNA response element for the transcriptional regulatory protein
which has a
compound-binding sequence in the vicinity of the DNA response sequence and a
transgene
under the control of a first promoter.
In another one vector embodiment, an engineered transcriptional regulatory
protein is
2 o exogenously provided to a cell in the same vector construct as a synthetic
DNA response
element and associated compound-binding sequence. In this aspect, the vector
comprises a
synthetic DNA response element for the transcriptional regulatory protein
which has a
compound-binding sequence in the vicinity of the DNA response sequence and a
transgene
under the control of a first promoter and the coding sequence for an
engineered
2 s transcriptional regulatory protein under the control of a second promoter.
In still other cases, a single vector is effective to express both a
transcriptional
regulatory protein and a transgene under the control of a single compound-
inducible
promoter, utilizing IRES.
In one exemplary two vector embodiment of the invention, the first vector
comprises
s o the synthetic DNA response element for a transcriptional regulatory
protein which has a
compound-binding sequence in the vicinity of the DNA response element and a
transgene
under the control of a first promoter and the second vector comprises the
coding sequence for
an engineered transcriptional regulatory protein operably linked to a second
promoter.
In some cases, the expression of the engineered transcriptional regulatory
protein
3 s may also be regulated by a compound. In such cases, the construct has a
compound-binding
sequence in the vicinity of the DNA response element for a transcriptional
regulatory protein
and a second promoter operably linked to the coding sequence for the
engineered
transcriptional regulatory protein. In such cases, the first and second
vectors may or may not
have the same compound-binding sequence and DNA response element.
4 o In such two vector embodiments, when the transcriptional regulatory
protein is
engineered, it may be an exogenously supplied native protein, it may be
synthetic or
chimeric, and may be effective in specific tissues or cell types, or may be
effective in a tissue
or cell type independent manner.
16
WO 00/52179 CA 02367037 2001-08-31 pCT/US~~/05728
In both the one and two vector embodiments of the molecular switch system, the
invention includes a compound or inducer, which when bound to a compound-
binding
sequence is effective to modify expression of a gene under control of the
promoter.
In a chimeric activator DNA binding compound-mediated molecular switch system,
s the binding of a compound directly to, adjacent, or overlapping the DNA
binding site for a
transcriptional regulatory protein displaces the bound transcriptional
regulatory protein from
the DNA response element of a promoter. In such cases, the displacement of the
transcriptional regulatory protein leads to down-regulation of transcription
of an operably
linked transgene (switch-off system).
to A similar system which is switched-on by binding of a compound includes a
chimeric
transcriptional regulatory protein with a repressor domain instead of a
transactivator domain.
Incorporation of a strong activator or repressor domain into an engineered
transcriptional regulatory protein confers a wide range of activity to the
regulatory protein in
a regulatable gene expression construct. By incorporating promoters that
function in a
1 s variety of cell types into vector constructs which have an appropriate DNA
response element,
expression can be achieved in the particular cell types.
In the methods of the invention, cell lines which produce a given
transcriptional
regulatory protein may be generated and transformed with vector constructs
having a variety
of compound-binding sequences. A repertoire of different regulatable
expression systems
2 o may then be generated using the same basic transcriptional regulatory
protein construct and
DNA response element, by modifying the number of copies (repeats) of the DNA
response
element, and by the use of different compound-binding sequences.
In one embodiment, the system involves a natural transcriptional regulatory
factor
(protein) that is either tissue-specific, disease-specific or heterologous and
unique to the host.
2 s Such natural or native factors may be provided exogenously or may be
endogenous to a
particular tissue, cell or host. In either case, such a natural DNA-binding
regulatory factor
will bind to a synthetic DNA response element which has been introduced into
cells and has a
compound-binding sequence which is the same as, overlapping, or adjacent to
the DNA
response element. A synthetic DNA response element for one or more natural
factors may
3 o be provided to a cell.
As set forth above, in another embodiment, the system incorporates engineered
regulatory proteins (activators or repressors), which are provided to cells
together with a
corresponding synthetic DNA response element and associated compound-binding
sequence.
It will be understood that the DNA sequence encoding an engineered
transcriptional
3 s regulatory protein is exogenously supplied, it may be provided in the same
or in a different
vector construct as the synthetic DNA response element and associated compound-
binding
sequence. In addition, the expression of an engineered regulatory protein may
be under the
control of a constitutive promoter or a compound inducible promoter. When the
expression
of an engineered regulatory protein is under the control of a compound
inducible promoter,
4 o expression may be induced by a compound which is the same as, or differs
from, the
compound which binds a sequence in the vicinity of the DNA response element
for the
regulatory protein.
Regulatable gene expression systems may be designed wherein the compound-
binding
17
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
sequence and the regulatory protein binding site are the same. In such cases,
a native
endogenous regulatory protein is used or alternatively, an exogenous,
synthetic regulatory
protein may be "designed" which has a DNA-binding domain which specifically
binds the
compound-binding sequence/transcriptional regulatory protein binding site.
(See, e.g.,
Greisman and Pabo, 1997, which describes the selection of novel zinc three-
finger proteins
which bind to a specific 9 to 10 by sequence.)
It will be understood that in some cases the DNA response element for a given
transcriptional regulatory protein will include a site that also functions as
the preferential
binding sequence for a DNA-binding compound, i. e. , a small molecule. In such
cases, the
i o DNA response element may be incorporated into the regulatable expression
system of the
invention in a single copy or constructs may be engineered including one or
more tandem
repeats of the sequence.
In other cases, the promoter sequence in the vicinity of the DNA response
element
will be modified to include one or more preferred binding sequences for a DNA-
binding
i 5 compound resulting in a regulatable promoter construct.
In one preferred embodiment, a single vector molecular switch system is
employed
wherein the vector contains a transgene under the control of a promoter
operably linked to
the DNA response element for a native transcriptional regulatory protein which
has a
compound binding site in the vicinity of the DNA response element. A
luciferase reporter
2o gene may be used to evaluate regulatable gene expression in vitro in cell
culture. However,
any reporter gene known to those of skill in the art may also be used (as
further described
below).
Once the ability of a compound to displace a transcriptional regulatory
protein from
its DNA response element has been demonstrated in a cell-based assay using a
reporter
2 s construct, the genetic construct may be readily modified to include a gene
of interest, such as
a therapeutic gene, recombinant protein-encoding gene or drug resistance gene,
in place of
the reporter gene. Such modifications may be made using techniques routinely
used by those
of skill in the art.
In cases where the molecular switch system takes advantage of natural
regulatory
3 o proteins or factors, i. e. , those having tissue specificity or disease
specificity, the genetic
construct may deliver a therapeutic gene under control of an inducible
promoter with multiple
natural factor response elements flanked by compound-binding sequences without
a need for
an exogenous regulatory protein.
Alternatively, a natural promoter may be modified to include one or more
compound
3 s binding sequences near the natural factor binding sites in the promoter,
e.g. , NF-KB and
TFIID sites in a modified CMV promoter.
When the molecular switch system employs an exogenous transcriptional
regulatory
protein, the regulatory protein is supplied along with therapeutic gene,
either in a single
genetic construct or in separate genetic constructs.
4 o An exogenous regulatory protein gene and a therapeutic gene may be placed
under
the control of the same compound-inducible promoter, and delivered by a single
vector, e. g. ,
by placing an internal ribosomal entry site in front of the synthetic
activator gene. In such
cases, the compound not only displaces the exogenous regulatory protein, e. g.
, activator,
18
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
from the promoter, down-regulating the expression of the therapeutic gene, it
also reduces
the expression of the activator protein, providing a system with tighter
regulation.
In summary, the molecular switch system provides single vector embodiments
comprising one or more promoters and two vector embodiments, each comprising a
promoter
s which may be the same or different.
rOrice the one or more binding sites for such an essential transcriptional
regulatory
protein are determined, compound binding sequence(s), e.g. for a small
molecule, are
engineered into the promoter near the transcriptional regulatory protein DNA
response
elements) and thereby used to regulate the binding of the transcriptional
regulatory protein to
to the promoter, resulting in regulation of promoter activity.
For example, an engineered promoter that is regulated by a DNA binding
molecule
can be created. In one example, a sequence comprising from about 1 to 12 or
more tandem
repeats of the NF-kB site with a corresponding number of compound binding
sequences in
the vicinity of the NF-kB site is added to a CMV minimal promoter sequence
(Example 2).
i5 Alternatively, the DNA response element for more than one type of
transcriptional
regulatory factor may be incorporated into a single promoter, particularly
when the selected
transcriptional regulatory factors work cooperatively.
In a further embodiment, a natural tissue-specific promoter is modified to
include one
or more introduced compound binding sequences near one or more natural
transcriptional
2 o regulatory factor binding sites which are essential for transcriptional
regulation of the natural
tissue-specific promoter.
Temporal and spatial regulation of gene expression can be achieved by
combining the
tissue specificity of such a promoter with regulation of the interaction
between the tissue-
specific promoter and one or more essential transcriptional regulatory
proteins, by the
2 s exposure of the promoter to a DNA binding compound which exhibits sequence-
preferential
binding to the introduced compound binding sequence(s).
A synthetic promoter may be made by introducing one or more tissue-specific
transcription factor binding sites and one or more compound binding sequences
into the
sequence of a tissue-specific regulatable promoter such that the promoter may
be regulated by
3 o a compound which preferentially binds the compound binding sequence(s), e.
g. , a small
molecule. Such a small molecule may target an essential transcription factor
or tissue
specific transcription factor if it is essential to the activity of the
promoter.
For example, a CMV/HBV enhancer II hybrid promoter (Sandig, et al. , 1996;
Loser,
et al. , 1996), which displays liver specificity, may be modified to have
compound-binding
3 s sequences in the vicinity of (i. e. , adjacent to, or overlapping),
essential transcription factor
binding sites, such as C/EBP, HNF-l, HNF-3 and SP-1 and/or TATA box.
In another example, tandem repeats of the myocyte-specific enhancer factor 2
(MEF2, SEQ ID N0:22) binding sequence may be fused to the sequence of a CMV
minimal
promoter to give muscle specificity. MEF2 sites, which are present in many
muscle genes
40 (Brand NJ, 1997), may be preferentially targeted by a small molecule such
as 21x, given that
the MEF2 sequence is "AT-rich" .
19
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
B. Components of the Molecular Switch System
In all of the embodiments described above, the DNA response site for a
transcriptional regulatory protein may contain from 1 to 12 copies of a given
response
sequence, with multiple copies facilitating amplification of the response. In
addition, in each
s embodiment, natural factor and synthetic factor DNA response sites may be
the same as,
overlapping, or adjacent to compound-binding sequences. Accordingly; nucleic
acid
constructs for use in the molecular switch system of the invention may have a
compound-
binding sequence on one or both sides of each transcriptional regulatory
protein DNA
response element. Such compound-binding sequences are introduced into the DNA
response
1 o element of a regulatable expression construct, allowing induction by a DNA
binding
compound and modulation of the activity of a promoter operably linked thereto.
It will be understood that the various components of the molecular switch
systems of
the invention are interchangeable. For example, a given regulatory domain may
be
combined with any of a number of DNA binding domains in a synthetic
transcriptional
15 regulatory protein. Similarly, any of a number of DNA response elements
which bind a
given transcriptional regulatory protein may be used. Many such regulatory
domains, DNA
binding domains and corresponding DNA response elements are known to those of
skill in
the art, and are summarized below. DNA binding proteins which affect
transcription, but
lack a regulatory domain also find utility in the methods of the invention. In
general,
2 o multiple copies of a transcriptional regulatory protein may bind to its
corresponding DNA
response element.
Synthetic or engineered transcriptional regulatory proteins for use in the
methods and
compositions of the invention include a mammalian or a non-mammalian DNA
binding
domain and a regulatory domain of choice. Synthetic regulatory proteins can be
designed by
2 s consideration of the DNA response elements for the DNA binding domain and
the activity of
the transcriptional regulatory protein. Activators or repressors can be used
for switch-off or
switch-on system, respectively.
In some cases, one or more natural transcriptional regulatory proteins may be
employed in the methods and compositions of the invention to facilitate
regulated gene
3 o expression, such as, homologous, heterologous, host-, tissue- or disease-
specific expression.
In such cases, a compound-binding sequence is inserted into a nucleic acid
construct and is
the same as, overlapping , or adjacent to the DNA response elements) for the
one or more
natural transcriptional regulatory proteins. For example, a nucleic acid
construct which has
introduced compound-binding sequences in the vicinity of the TFIID and NF-xB
DNA
3 s response elements in a CMV promoter.
C. Transcri~tional Regulatory Proteins
In the molecular switch systems of the invention, the choice of DNA binding
domain
in a given transcriptional regulatory protein will determine the appropriate
response element.
4 o Different DNA response elements can be utilized together with a
corresponding DNA
binding transcriptional regulatory protein, and need not have sequence
homology to the
associated compound binding sequence. The sequences of a number of DNA binding
transcriptional regulatory proteins and corresponding response elements are
known in the art
WO 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
and examples are provided in Table 1.
Table 1. Non-mammalian DNA binding proteins and their response elements
DNA BINDING PROTEIN RESPONSE ELEMENT
TetR (prokaryotic) tet0 (SEQ ID NO:S)
LacR (prokaryotic) lac0 (SEQ ID N0:6)
GAL4 (yeast) GAL4 (SEQ ID N0:2)
Ecdysone receptor Ecdysone (SEQ ID N0:7)
ZFHD1 (mammalian) ZFHD1 (SEQ ID N0:3)
UL9 (viral) UL9 (SEQ ID NO:I)
Activator and repressor protein domains which may be incorporated into
engineered
transcriptional regulatory proteins for use in the methods and compositions of
the invention
may be of mammalian, plant, Drosophila, yeast, bacterial, or viral origin, if,
when linked to
a DNA binding domain, the domain functions as an activator or repressor,
respectively when
1 o an appropriate DNA response element is introduced into the host cells of
the regulatable
expression system.
In one embodiment of the regulatable expression system of the present
invention, an
engineered transcriptional regulatory protein is provided which includes a
strong sequence
specific activator, UL9-VP16, which has the C-terminal DNA binding domain of
UL9 fused
i5 to the N-terminus of the activation domain of VP16 utilizing pGEX-UL9
(Genelabs) and
pACT (Promega), expressed under the control of a CMV immediate early
enhancer/promoter.
In another embodiment, an engineered transcriptional regulatory protein is
provided
which includes the UL9 C-terminal DNA binding domain fused to the N-terminus
of
2o activation domain of NF-KB p65, prepared by replacing the VP16 domain in
the UL9-VP16
construct, with the activation domain of NF-KB p65 (SEQ ID N0:4).
In a further preferred embodiments, the UL9 C-terminal DNA binding domain is
fused to the N-terminus of the repressor domain of kruppel protein (KRAB which
is present
in about one third of the vertebrate Kruppel-type zinc finger factors
(Margolin JF, et al. ,
25 1994), or Mad protein (Ayer et al., 1996).
D. Activators
Polypeptides which can function to activate transcription in eukaryotic cells
are well
known in the art. In particular, transcriptional activation domains of many
DNA binding
3 o proteins have been described and have been shown to retain their
activation function when
the domain is transferred to a heterologous protein. Activator domains which
may be
incorporated into chimeric transcriptional regulatory proteins for use in the
methods and
compositions of the invention, include but are not limited to VP16, NF-KB,
TFE3, ITFI,
Oct-1, Spl, Oct-2, NFY-A, ITF2, c-myc, and CTF (Seipel, et al., 1992).
3 5 An exemplary polypeptide for use in a transcriptional regulatory protein
of the
21
WO 00/52179 CA 02367037 2001-08-31 pCT~S00/05728
invention is the herpes simplex virus virion protein 16, referred to herein as
VP16, the amino
acid sequence of which is disclosed in Triezenberg, et al. , 1988. In one
embodiment, amino
acids from about 413-489 of the C-terminus of VP16 (SEQ ID N0:8) are used as
the
transactivator domain (Sadowski, et al. 1988). In another embodiment, a
tetramer of amino
s acids 437-447 of VP16 (SEQ ID N0:9)is used as the transactivator domain
(Beerli, et al. ,
1998).
E. Repressors
Native repressors such as LacR or TetR may also be utilized in the molecular
switch
1 o system of the invention. Such repressors are provided exogenously as one
component of a
transcriptional regulatory protein, together with a regulatable promoter which
has been
modified to include one or more compound-binding sequences in the vicinity of
(the same as,
overlapping, or adjacent to), the DNA response element for a given
transcriptional regulatory
protein.
15 Exemplary repressor proteins and their corresponding DNA binding domains
for use
in the methods and compositions of the invention are summarized in Table 2.
The repressor
domains include Kruppel (KRAB; Margolin et al. , 1994), kox-1 (Deuschle et al.
, 1995),
even-skipped (Licht et al. , 1994), LacR, engrailed (Li et al, 1997), hairy
(HES; Fisher et al. ,
1996), Groucho (TLE; Fisher etal., 1996), RING1 (Satjin etal., 1997), SSB16
and SSB24
2 0 (Saha et al. , 1993), Tup 1 (Tzamarlas, Struhl, 1994), Nab 1 (Swirnoff et
al. , 1998), AREB
(Ikeda et al. , 1998), E4BP4 (Cowell & Hurst, 1996), HoxA7 (Schnabell et al,
1996),
EBNA3 (Bourillot et al. , 1998), and v-erbA (Busch et al. , 1997).
Further exemplary repressors for use in the methods and compositions of the
invention include the basic helix-loop-helix (bHLH) proteins (a family of
transcription
2 s factors, which act as dimers, with their selective dimerization affecting
cell proliferation,
differentiation or apoptosis), such as Mxi (which is involved in repressing
transcription of c-
myc-responsive genes, Fisher F et al. , 1993); Mnt (Soucek L, et al. , 1998),
Rox (Takahashi
T et al. , 1998), and TFEC (Rehli M et al. , 1999); the homeoproteins
(transcription factors
known to exist in all eukaryotes where they perform important functions during
development)
3 o such as Msx-1 (Stelnicki EJ et al. , 1997), Evxl (Briata P, et al. , 1997)
and HoxC6 (or Hox-
3.3-encoded homeoprotein, Jones FS, 1993); Zn finger proteins such as CTCF
(Delgado MD
et al., 1999), AREB, Ikeda et al., 1998, REST (zinc finger protein RE-1-
silencing
transcription factor, Thiel G et al. , 1998), EGR-4 (Zipfel PF et al. , 1997)
and KOX 1 (which
contains a KRAB domain, Moosmann P et al. , 1997); in addition to CDP/cut
(human
3 5 homeodomain CCAAT displacement protein/cut homolog, Li S et al. , 1999;
Mailly F et al. ,
1996); ATF-3 (Wolfgang CD et al. , 1997); MBP (Ghosh AK et al. , 1999); BP1
(Berg PE et
al., 1991); ERF (Day RN et al., 1998); Drl (White RJ et al., 1994), MeCP2
(methyl Cp-G-
binidng protein; Nan X et al. , 1998); ZFM 1 (human zinc finger motif 1, Zhang
D et al. ,
1998), BERF-1 (Antona V et al., 1998); PRDI-BFl/Blimp-1 protein (Ren B et al.,
1999), IFI
4 0 16 (interferon-inducible transcriptional repressor, Johnstone RW et al
1998), ICER
(inducible CAMP early repressor, Bodor J et al., 1998), COUP TF (Chicken
ovalbumin
upstream promoter-transcription factor, Bailey PJ et al. , 1997); DAX-1
(Zazopoulos E et al. ,
1997), ATF3 [in the activating transcription factor/cAMP responsive element
binding protein
22
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
(ATF/CREB) family of transcription factors, Wolfgang CD et al., 1997], and
polyhomeotic
protein (Ph, Satijn DP et al. , 1997).
Table 2. Repressors with tethering DNA binding domain
Repressor O~ DNA binding Reference
domain
kru el Droso hila Gal4 Mar olin et al.
, 1994
kox-1 Human TetR Deuschle et al.,
1995
even-ski ed Droso hila LacR Licht et al. ,
1994
en railed Droso hila Qin Li et al. , 1997
hai (hes) Droso hila (human)Gal4 ~ Fisher et al.
, 1996
Groucho(TLE) Droso hila (human)Gal4 Fisher et al.
, 1996
RING1 Droso hila LexA Gal4 Satin et al.,
1997
SSB 16 SSB24 E. coli Gal4 Saha et al. ,
1993
Tu 1 Yeast LexA - Tzamarlas Struhl,
1994
Nabl Human Gal4 ~ Swirnoff etal.,
1998
AREB Human Gal4 Ikeda et al. ,
1998
E4BP4 Human Gal4 Cowell & Hurst
,1996 I
HoxA7 Mouse Gal4 ! Schnabell et
al.. 1996 '~
EBNA3 EBV Gal4 Bourillot et al.
, 1998
v-erbA virus Gal4 Busch et al. ,
1997
Mad Mammalian Gal4 A er et al. ,
1996
F. DNA Response Elements
In the molecular switch system described herein, the DNA response element
which
binds the transcriptional regulatory protein may be of mammalian or non-
mammalian origin
to and is generally present in multiple (about 1 to 12) copies, as tandem
repeats.
For example, the transcriptional regulatory protein DNA response sequence may
be a
UL9 sequence, an NF-tcB sequence or a LacR sequence which is present as 1 to
12 tandem
repeats. (See Examples 1, 2 and 3.)
Preferred DNA response sequences for use in the methods and compositions of
the
invention are UL9, NF-tcB, GAL4, ZFHD1, LacR, TetR, LexA, the UP element of
rrnB P1,
and the ecdysone receptor binding sequence. However, it will be understood
that the DNA
response sequence for any known DNA-binding protein may be incorporated into
the
regulatable gene expression systems of the invention. Such a DNA-binding
protein, may or
may not contain an activator or repressor domain.
G. Promoters
The choice of promoter can significantly affect both temporal and spatial
aspects of
gene expression. Strong promoters with enhancers may result in a high level of
expression.
However, when a low level of basal activity is desired, a weak promoter may be
a better
2s choice. Expression of transgenes of interest may also be controlled at the
level of
transcription, by the use of cell type specific promoters or promoter elements
in gene transfer
vectors. Exemplary cell type specific promoters/elements and their target
cell/tissue
specificity are provided in Table 3. (See also, Walther and Stein, 1996;
Miller and Whelan,
1997).
23
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
Table ~. Promoters with tissue stieciftcitv
Gene Promoter Target cell/tissue
Hematopoietic cells
CD l la Leukocytes
CD llb Leukocytes
CD 18 Leukocytes
(3-Globin promoter/LCR Erythroid cells
Immunoglobulin promoters B-lymphoma
Human parvovirus B19 Erythroid cells
Scavenger receptor A Macrophages, foam cells
Glycoprotein IIb Megakaryocytes, platelets
yc chain Mature myeloid cells
Brain
Liver, intestine and kidney
PEPCK Hepatocytes
Albumin Hepatocytes
hAAT Hepatocvtes
HBV Hepatocvtes
Fatty acid synthetase Liver, adipose tissue
Factor VII Liver
Carbamoyl phosphate Portal vein hepatocytes
Synthetase I Small intestine
Na-K-CI transporter Kidney
Mammary gland
MMTV-LTR Mammary carcinoma
WAp Mammary carcinoma
(3-casein Mammary carcinoma
Epithelium and endothelium
SPC Broncheolar and alveolar epithelium
SP-A Broncheolar and alveolar epithelium
SP-B Broncheolar and alveolar epithelium
E-cadherin Epithelium
Flt-1 Endothelial cell
Preproendothelin Endothelium, epithelium, muscle
Keratinocytes and others
Cytokeratins Keratinocytes
Transglutaminase 3 Keratinocytes
Bullous pemphigoid antigenBasal keratinocytes
24
WU 00/52179 CA 02367037 2001-08-31 PCT/[JS00/05728
' Keratin 6 Proliferating epidermis
Collagen a 1 Hepatic stellate cells skin/tendon
fibroblast
Type X collagen Hypertrophic chondrocytes
Muscle
MCK Undifferentiated myogenic cells
" V:~i~:l Myoblasts
GLUT4 Skeletal muscle
Slow/fast troponins Slow/fast twitching myofibers
a-actin Smooth muscle
myosin heavy chain Smooth muscle
Virus infected cells
HIV-LTR HIV infected Lymphocytes
Tat/Rev-responsive elementsHIV infected CD4+ T-cells
Tat-inducible element HIV infected CD4+ T-cells
EBNA-1 EBV infected cells
Cancer
PSA Prostate
Aromatase Cancer
CEA Colon and lung carcinomas
AFP Hepatocellular carcinomas
SLPI Carcinomas
Tyrosinase Melanomas
Varicella Zoster virus Melanocytes
c-erbB2 Breast, pancreatic, gastric
carcinomas
Lung cancer
Myc-Max responsive elementRas-transformed cells
Murine parvovirus MVMp
Pathological milieu
Egr-1 Irradiated tumors
Grp78 Anoxic, acidic tumors
MDRI Tumors treated with chemotherapy
HSP70 Tumors treated with hyperthermy
VEGF Hypoxic angiogenesis
Nitric oxide synthase Hypoxic angiogenesis
Murine CF3 Liver, lung inflammation
Serum amyloid 3 Liver inflammation
Bovine keratin 6 Hyperproliferating epithelial
cells
The promoter component of the heterologous nucleic acid constructs for use in
the
molecular switch systems of the invention may be a minimal or full length
promoter
sequence. An exemplary engineered or synthetic promoter may comprise a minimal
promoter sequence fused to a cis element, such as an endogenous DNA response
element for:
NF-tcB, myocyte-specific enhancer factor (MEF), or hepatic nuclear factor
(HNF); or
alternatively a bacterial sequence such as LacO, or a viral sequence such as
UL9.
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
Preferred constitutive promoters for use in the methods and compositions of
the
invention include any of a number of promoters known to those of skill in the
art, examples
of which are a minimal CMV promoter, a CMV immediate/early enhancer promoter,
an
SV40 promoter, the HSV TK promoter, the MuLV LTR promoter and the HIV LTR
promoter. Such promoters may be used in the native form in conjunction with
natural
transcriptional regulatory proteins or may be modified to include the DIVA
response elements
for a natural or synthetic transcriptional regulatory protein.
In molecular switch systems which utilize either synthetic or natural
transcriptional
regulatory proteins, promoter activity may be amplified by incorporating
tandem repeats of
1 o the appropriate DNA response element into the regulatable gene expression
system.
Promoter activity may be further amplified by the use of an enhancer sequence,
e.g.,
SV40, HIV or CMV enhancer sequences.
H. Compound binding sites
Compound-binding sequences are generally 8-20 by in length and may be the same
as, overlapping, or adjacent to the DNA response element for a transcriptional
regulatory
protein.
In one embodiment, the sequences are inserted next to either one or both ends
of a
transcriptional regulatory protein DNA response element.
2 o In another embodiment, the compound binding sequences overlap a
transcriptional
regulatory protein DNA response element.
In the case of transcriptional regulatory protein response sites which consist
of
repeated sequence portions, the compound-binding sequence may flank each
repeated
sequence portion, or may flank the entire transcriptional regulatory protein
response site.
In both repressor- and activator-mediated systems, incorporating compound-
binding
sequences in the vicinity of the DNA response element for a given
transcriptional regulatory
protein permits a wide selection of inducers.
Typically, binding of a DNA-binding compound to a compound-binding sequence
interferes with the binding of a transcriptional regulatory protein to its
corresponding DNA
3 o response element. However, the binding of some DNA-binding compounds to
such DNA
response elements may have the opposite effect, causing increased binding of
the
transcriptional regulator, i. e. , activator, under conditions effective to
result in expression of a
transgene operably linked thereto.
In addition, each embodiment set forth above further includes one or more
compound
3 5 binding sequences in the vicinity of the DNA response element, as
exemplified by an 8 to 20
or more by "AT-rich" sequence which is the preferred binding preferred binding
sequence
for the netropsin dimer, designated 21x.
I. Transgenes
4 o When evaluating the affect of the molecular switch system on transcription
in cell
based an vitro screening assays, selection of the reporter gene, determines
the assay format.
For example, luciferase activity can be measured by biochemical reaction with
lysates from
transfected cells followed by using a luminometer. If the green fluorescence
protein is used
26
WO 00/52179 CA 02367037 2001-08-31 pC'T/[JS00/05728
as reporter, cells can be directly monitored for their fluorescence without
biochemical assay,
and transformed cells can be separated easily by FACS, which facilitates
faster selection and
enrichment of transformed cells compared to conventional methods which involve
antibiotic
selection.
s Preferred reporter genes for use in the methods and compositions of the
invention
include, luciferase, green fluorescent protein~(GFP), blue fluorescent protein
(BFP), CAT, (3-
galactosidase, human growth hormone, alkaline phosphatase, etc., under the
control of an
appropriate promoter.
In nucleic acid constructs for use in cell-based reporter assays using the
molecular
to switch system set forth above, the DNA response element for the
transcriptional regulatory
protein has from 1 to 12 copies of the DNA response element for the
transcriptional
regulatory protein, together with a promoter and a reporter gene, e.g.,
luciferase.
In one exemplary embodiment, a luciferase reporter construct with a series of
tandem
repeated UL9 binding sites and flanking compound-binding sequences is made by
15 modification of the pG5luc vector (Promega). In this construct, the firefly
luciferase is under
the control of a synthetic promoter that is composed of five tandem repeats of
the GAL4
binding site followed by the site for the major late minimal promoter of
adenovirus. For use
in the methods of the present invention, the Gal4 binding sites in the vector
are replaced with
1 to 12 copies of the UL9 binding site, flanked by 21x binding sequences.
IV. Introduction Of Nucleic Acid Constructs Into Cells
A nucleic acid construct for use in the molecular switch system of the
invention is
introduced into either eukaryotic or prokaryotic cells. In the case of
engineered, synthetic
and heterologous native transcriptional regulatory proteins, a vector encoding
the protein is
2 s introduced into a host cell, wherein the nucleic acid is in a form
suitable for expression of the
protein in that host cell. For example, a recombinant expression vector of the
invention,
encoding the protein, is introduced into a host cell.
A "host cell" includes any cell or cell line which is not incompatible with
the protein
to be expressed, the selection system chosen or the fermentation system
employed. Host
3 o cells for use in the molecular switch systems of the invention include
human cells, other non
human mammalian cells, yeast, bacteria, insect cells, plant cells, archea,
fungi, etc.
In addition to cell lines, the invention is applicable to normal cells in
vitro, ex vivo
and in vivo, such as cells to be modified for gene therapy purposes, embryonic
cells modified
to create a transgenic or homologous recombinant animal, and plant cells.
3 5 Methods known in the art for delivery of nucleic acid constructs into
mammalian
cells include viral methods using adenoviral vectors, retroviral vectors, or
adeno-associated
viral vectors; non-viral methods using plasmids, liposomes, or other vehicles;
and physical or
chemical methods using calcium phosphate transfection or gene gun techniques.
Similarly, methods known in the art for delivery of a nucleic acid construct
into plant
4 o cells include bacterial vectors such as the Agrobacterium Ti vector, and
viral vectors such as
the tomato mosaic virus and potato X virus.
In addition, baculovirus vectors may be used to deliver a nucleic acid
construct into
insect cells, and bacteria may be transformed with plasmids, and phage such as
lambda
27
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
phage.
For example, vectors encoding transcriptional regulatory proteins can be
introduced
into a host cell by standard techniques for transfecting cells. The term
"transfecting" or
"transfection" is intended to encompass all conventional techniques for
introducing a nucleic
acid construct into a host cell, including calcium phosphate co-precipitation,
DEAE-dextran-
mediated tran'sfsrction, lipofection, electroporation and microinjection.
Suitable methods for
transfecting cells can be found e. g. , in Sambrook, et al. ,1989, expressly
incorporated by
reference herein.
The number of host cells transformed with a nucleic acid construct of the
invention
1 o will depend, at least in part, upon the type of recombinant expression
vector used and the
type of transfection technique used. Nucleic acid can be introduced into a
host cell
transiently, or more typically, for long term regulation of gene expression,
the nucleic acid is
stably integrated into the genome of the host cell or remains as a stable
episome in the host
cell. Plasmid vectors introduced into mammalian cells are typically integrated
into host cell
15 DNA at only a low frequency. In order to identify these integrants, a gene
that contains a
selectable marker (e. g. , drug resistance) is introduced into the host cells
along with the
nucleic acid of interest, and the transfected cells are cultured in medium
containing the
appropriate drug. Preferred selectable markers include neomycin, zeomycin and
hygromycin.
2 o In some cases, two separate plasmids may be used to deliver a
transcription factor
and a transgene into a cell; one or both of which are under the control of
regulatable or
constitutive promoters. In such cases, the same compound may be used to
regulate the
expression of both the transcriptional regulatory protein and the transgene,
which may result
in feedback regulation.
2 s In an exemplary embodiment of the method of the invention, HeLa, COS, MCF7
or
HepG2 cells are transfected with an expression vector encoding a synthetic
transcriptional
activator protein under conditions effective to generate transformants which
express the
transcriptional activator. Expression of the activator is monitored by Western
blot or
Northern.
3 o Once transformants expressing the transcriptional regulatory protein have
been
generated, they are transfected with vector constructs having different
numbers of UL9 DNA
binding sites, and co-transfected with a copy control, e.g., a Renilla
luciferase plasmid.
In some cases, cells are co-transfected with plasmids containing: (1) nucleic
acid
sequences for expression of an engineered transcriptional regulatory protein,
(2) nucleic acid
3 s sequences which have various different numbers of transcriptional
regulatory protein DNA
binding sites, and (3) nucleic acid sequences which serve as a copy number
control at the
same time.
The luciferase activity of transformants is measured and constructs selected
which
have an operable number of UL9 binding sites selected, i. e. , constructs
which give detectable
40 luciferase activity are selected. Molecular switch constructs for use in
the methods and
compositions of the invention are generated by adding compound-binding
sequences in the
vicinity of the DNA response element for the transcriptional regulatory
protein to constructs
having an operable number of DNA response elements for the transcriptional
regulatory
28
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
protein.
Transformants that express a transcriptional regulatory protein are
transfected with
promoter constructs which have a response site and a copy control reporter
plasmid, followed
by treatment with different amounts of appropriate compounds. The effect of
the compound
on reporter (e.g., luciferase) activity is then determined. In most cases, the
initial assay is
done with transiently transfected cells. In such cases, double stable
transfonnants are made
later and the activity is verified.
Reporter constructs are used to identify and optimize operable nucleic acid
constructs
for use in the molecular switch systems of the invention. Once the components
of the system
1 o have been engineered and tested in the context of reporter constructs, the
reporter is
generally replace by a transgene which encodes a protein or polypeptide of
interest.
It will be understood that following engineering, optimization and testing,
the
components of the molecular switch system are then transferred to vectors
appropriate to the
application, e.g. gene therapy vectors or vectors for expression in plant
cells.
V. Compounds (Inducers)
Small molecules are desirable as therapeutics for several reasons related to
compound
delivery: (i) they are commonly less than lOK molecular weight; (ii) they are
more likely to
be permeable to cells; (iii) they may be less susceptible to degradation by
cellular
2 o mechanisms; and, (iv) they are not as apt to elicit an immune response.
Many
pharmaceutical companies have extensive libraries of chemical and/or
biological mixtures,
often fungal, bacterial, or algal extracts, that would be desirable to screen
with the assay of
the present invention.
Compounds for use in the regulatable gene expression systems of the invention
may
be small molecules; biological or synthetic organic compounds; peptides,
oligonucleotides
(and derivatives thereofj; or even inorganic compounds (i. e. , cisplatin).
Several classes of small molecules that interact with double-stranded DNA have
been
identified. Although the sequence binding preferences of most known DNA
binding
molecules have not, to date, been identified, several small DNA-binding
molecules have been
3 o shown to preferentially recognize specific nucleotide sequences. In most
cases, the DNA
binding activity of a candidate compound is first evaluated in a pre-screening
assay. In other
cases, a compound with a known or predicted sequence binding preference is
directly
incorporated in the molecular switch system of the invention.
Preferred compounds for use in the molecular switch system of the invention
include,
3 5 but are not limited to dimers or multimers of known DNA-binding compounds,
peptide
nucleic acids (PNAs), polyamides, various triplex forming DNA-binding
compounds, and
derivatives thereof.
PNAs are compounds that are analogous to oligonucleotides, but differ in
composition. In PNAs, the deoxyribose backbone of oligonucleotide is replaced
by a peptide
4 o backbone. (See, e.g. , Hanvey et al. , 1992; Egholm, M. et al. , 1992;
Peffer, N.J. et al. , ,
1993; Wittung, P. et al., 1994).
Exemplary polyamides include N-methylpyrrole and N-methylimidazole amino acids
which act as synthetic DNA ligands that bind to predetermined sequences in the
minor
29
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
groove of DNA. (See, e. g. , McBryant SJ et al. , 1999; Bremer RE et al. ,
1998; and White S
et al. , 1997. )
Exemplary triplex forming DNA-binding compounds include the aromatic
diamidine,
DAPI (4',6-diamidino-2-phenylindole), which can induce the formation of an RNA-
DNA
s hybrid triplex (Xu Z et al: ; 1997); homopyrimidine PNAs which have been
shown to bind
complementary DNA or RNA forming (;'NA)2/DNA(RNA) triplexes (Egholm et al.,
1991);
nucleic acid analogs such as methylphosphonates and phosphorothioates (Miller,
et al., U.S.
Patent No. 4,757,055, issued July 19, 1988); and other small intercalating
agents coupled to
oligonucleotides have been described (Montenay-Garestier T., et al., 1991).
1 o Although exemplary classes of compounds are described herein, it will be
understood
that any compound effective to bind to a sequence in the vicinity of the DNA
response
sequence for a transcriptional regulatory protein and thereby modify the
binding of a
transcriptional regulatory protein to its corresponding DNA response sequence
finds utility in
the molecular switch system of the invention.
1 s Pre-selected compounds may be initially identified as monomers, however,
such
monomers may be modified or dimerized for use in the regulatable gene
expression systems
of the invention.
Once identified, a DNA binding compound may be modified to improve any of a
number of properties, including binding affinity, transcriptional regulatory
protein
2 o displacement activity, solubility, pharmacokinetics, side effects or
toxicity and production
cost.
Compounds for use in the molecular switch system of the invention are
characterized
by sequence-specific or sequence-preferential binding, binding affinity, and
the ability to
modify the binding of a transcriptional regulatory protein to its
corresponding response
25 element.
By way of example, a compound designated "21x" has been identified which binds
to
an 8 to 10 base pair stretch of AT rich double stranded DNA. 21x is a dimer of
Netropsin,
which is known to bind to the minor groove of DNA, and accordingly was
predicted to
interact with double stranded DNA through minor groove contacts.
3 o An additional exemplary compound, GL046732, has been identified which has
two
linked netropsin moieties and similar binding properties to 21x.
DNA footprinting results indicate that 21x binds to the TATA box region of the
IL-1
promoter region, confirming the preferential binding of 21x to AT rich
sequences of DNA.
Protein displacement data indicate that when preferred 21x sequences are
introduced
3 s into the DNA response sequence for UL9, NF-kB and LacR, displacement of
the
transcriptional regulatory protein results. (See Figs. 6, 8A-B and 10.)
In some cases, compounds which preferentially bind to "GC-rich" sequences will
be
used in the molecular switch systems of the invention together with any of a
number of
appropriate transcriptional regulatory proteins and their DNA response
sequences, e.g.,
4 o chromomycin (Lenzmeier et al, 1998; Welch et al, 1994).
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
VI. Exemplary Systems For Regulated Gene Expression
UL9-Based Systems For Regulated Gene Expression
Chimeric transcriptional regulatory constructs containing the UL9 DNA response
element were constructed. In one example, the strong sequence specific
chimeric activator,
s UL9-VP16, was constructed with the C-terminal DNA binding domain of UL9
fused to the
N-terminus ofvtl~e activation domain of VP16 and expressed under the control
of a CMV
immediate early enhancer/promoter. Luciferase reporter constructs with a
series of tandem
repeated UL9 binding sites and flanking compound-binding sites were made by
modifying a
commercially available vector (Example 1).
1 o When exemplary modified promoters are operably linked to the UL9 DNA
response
element and a reporter gene, such as firefly luciferase in a promoter test
vector, e. g. , pGL3-
basic (Promega), expression of the reporter gene may be measured in the
presence or
absence of a DNA binding molecule. An introduced "AT-rich" sequence results in
preferential binding of a DNA binding molecule, such as 21x to the modified
promoter,
i5 affecting the binding of UL9-VP16 to the UL9 DNA response element,
resulting in down-
regulation of transcription.
The effect of the exogenously provided chimeric activator UL9-VP16 ("ULVP") on
expression of four different engineered reporter constructs in HeLa cells was
evaluated. Low
concentrations of pULVP encoding the UL9-VP16 activator significantly
increased the
2 o expression of specific reporter constructs that have UL9 response elements
while non-specific
reporter constructs were not activated significantly (Example l, Table 4). The
results
showed specific activation of expression by the ULVP activator promoter
construct together
with UL9 response elements.
The effect of an exemplary compound, 21x, on different engineered reporter
2 s constructs in MCF7 cells was also evaluated. The results suggest that
reporter expression in
the presence of chimeric activator ULVP was down-regulated with 21x treatment
(7 fold at
20 uM 21x) and that the observed down-regulation was concentration dependent.
Regulated Gene Expression Using A Native Transcri~tional Re ug latory Protein
And
3 o Modifications Thereof
In one example, NF-kB and TFIID sites of the CMV immediate early promoter are
targeted with 21x or another DNA-binding compound (Example 2).
The enhancer/promoter region of the CMV immediate early promoter contains
multiple cellular transcription factor binding sites, including 6x SP 1, 4x
CRE/ATF, 4x NF-
35 kB, and 2x AP1. Targeting a transcriptional regulatory protein to such DNA
response
elements which are modified to include compound-binding sequences may provide
a means
to modulate the activity of the promoter. Given that NF-kB is implicated as an
important
transcription activator for the CMV promoter which is widely used in gene
therapy field,
oligonucleotides were constructed based on the NF-kB DNA response sequence of
the CMV
4 o promoter in order to determine if the molecular switch system described
herein could be used
to regulate CMV promoter the expression of genes under the control of the CMV
promoter.
As detailed in Example 2, gel mobility shift assays used to detect protein
displacement indicated that (1) 21x can efficiently displace p50 NF-xB at
concentrations as
31
WO 00/52179 CA 02367037 2001-08-31 pCT/jJS00/05728
low as 1 pM, (2) the displacement is more efficient when the NF-KB binding
sequence is an
IL-6 sequence (SEQ ID NO: 30) relative to an IgK sequence (SEQ ID N0:29), and
(3) 21x
displaces NF-xB more efficiently than distamycin. These results suggest that
the exemplary
molecular switch system which utilizes 21x and NF-xB has broad applicability
to gene
therapy.
The expression of exemplary modified CMV promoters operably linked to a
reporter
gene, such as firefly luciferase in a promoter test vector, e.g., pGL3-basic
(Promega) was
measured in the presence and absence of the DNA binding molecule, 21x. The
results show
that an introduced "AT-rich" sequence resulted in preferential binding of a
DNA binding
to molecule, such as 21x to the modified promoter, affecting the binding of NF-
kB and TFIID
to the transcriptional regulatory protein DNA response element, resulting in
down-regulation
of transcription.
A series of purely engineered NF-kB/ TATA binding protein (TBP) based 21x
ligand
switchable constructs were created having 0, 2 and 4 tandem repeats of a
response element
i5 consisting of the NF-kB response sequence flanked by 21x sites fused to a
CMV minimal
promoter with the TBP site modified to include a 9 A/T stretch to optimize 21x
binding.
These promoters were cloned into pGL3-Basic to create firefly luciferase
reporter constructs,
and reporter activity evaluated as detailed in Example 2.
2 o LacR
The feasibility of using LacR as an exogenous factor for a switch-on molecular
switch system was evaluated using LacR, which is a repressor that represses
transcription of
the lac operon by binding to IacO operator sequences. Binding and displacement
of LacR
was tested using oligonucleotides with introduced drug binding sites that
overlap the
2s transcriptional regulatory protein binding site (Fig. 9).
A gel mobility shift assay was carried out as described above for UL9, and the
results
of the assay indicate that: (1) 21x can efficiently displace LacR, and that
(2) 21x appears to
displace LacR more efficiently when the oligo JF107 was used, as further
described in
Example 3.
Regulation Of Prokaryotic Gene Expression
The E. coli promoter rrnB P 1 (SEQ ID N0:12), was selected as a prokaryotic
model
promoter for evaluating the use of 21X in the molecular switch systems of the
invention, and
confirming its utility in engineered switchable promoter systems.
3 s In Escherichia coli, ribosome synthesis is limited by the rate of
synthesis of ribosomal
RNA (rRNA), which increases with growth rate. Multiple mechanisms contribute
to the
transcription and regulation of the rrnB P1 promoter. These include
interactions with the
alpha and sigma subunits of RNA polymerise. Transcriptional control involves
the UP
element, and core promoter.
4o The (-38) to (-59) region of the promoter functions as the binding site for
the a
subunit of RNA polymerise (RNAP, Ross et al., 1993). This AT-rich recognition
element or
"UP element" is responsible for the strong activity of rrnB P1 promoter, which
is 30 fold
greater than activity of the promoter without the UP element. The consensus
sequence of the
32
W~ 0/52179 CA 02367037 2001-08-31 pCT/US00/~5728
UP element has been previously described (Estrem et al. , 1998) and is shown
in Fig. 2A
(SEQ ID N0:13).
The rrnB P1 promoter UP element is composed of two sub sites, (proximal and
distal), both of which are implicated in binding of the promoter to the a
subunit of RNAP.
s The wild type UP element of rrnB P1, which contains a 17 base pair stretch
of AT-rich
sequences, was used to test the affect of variou~''c~mpounds which preferably
bind to AT-rich
sequences.
The affect of 21x on the interaction of the a subunit of RNAP with the rrnB P1
UP
element was evaluated based on the transcriptional activity of the promoter.
The sequence of
to nucleotides -66 to +50 of the rrnB Pl promoter is shown in Fig. 2B (SEQ ID
N0:12).
Several E.coli strains carrying various rrnB Pl promoters fused to a lacZ
reporter on
its chromosome, were tested as a phage mono-lysogen, as detailed in Example 4.
Each of the promoters described above has intact RNAP a binding consensus
sequences in the -35 and -10 regions of the promoter.
15 Components of bacterial cell-based assay systems for evaluation of
regulated
expression using the molecular switch include:
(1) a recombinant promoter construct including a reporter gene, such as
Renilla
luciferase or (3-galactosidase;
(2) a recombinant DNA response sequence which has transcription factor binding
2 o sites, such as RNA polymerase sigma and RNA polymerase alpha with drug
binding
sequences in the vicinity thereof; and
(3) a small molecule (compound) designed to bind in the vicinity of the DNA
response element.
In such an assay system, gene expression is measured as a function of compound
2 5 concentration using wild type and engineered promoters and may include
both plasmid and
chromosomal DNA.
An exemplary assay is described in Example 4, below. The results indicate that
the
21x effect is concentration dependent up to 10 p.M. The observed effect was
not altered by
targeting both sites of the UP element, relative to targeting the distal site
of the UP element
3o alone. The differences in the magnitude of the down-regulating effect of
21x suggest that the
21x binding sequence can be optimized in engineered promoters.
Such targeting studies suggest that a strong promoter like rrnB Pl, and
engineered
variants thereof, can be down-regulated with a sequence preferential DNA-
binding compound
when the engineered promoter contains a compound binding sequence in the
vicinity of the
3 s transcriptional regulatory protein DNA response element.
Regulated Gene Expression Usin The Cyclin D 1 Promoter
Mammalian cyclin D1 (CCND1, also named PRADI or BCLI) has applications to a
number of cancers including but not limited to breast cancers, colon cancers
and pancreatic
4 o cancers, and functions as a major positive regulator of the G, restriction
checkpoint of the cell
cycle of normal mature animal cells. (See Hunter and Pines, 1994; Sherr,
1996.)
Cyclin D1 (CCND1) is a regulatory protein overexpressed in many carcinomas.
Cyclin Dl acts by binding to and regulating the cyclin dependent kinases CDK4
and CDK6.
33
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
CCND1 gene expression is low in quiescent cells (in Go) but is induced as
cells respond to
growth factors and enter the cell cycle leading to an increase in active
cyclin Dl-CDK4/CDK6
complexes.
Rapid cell cycling irrespective of appropriate growth signals and failure to
respond to
s growth-inhibition signals such as contact inhibition are characteristics of
cancer cells.
Inappropriate exp~P~sion of cyclin Dl during chromosomal inversion,
translocation or
amplification has been characterized in a variety of tumor cells (Hall and
Peters, 1996; Sherr,
1996 for reviews). Cyclin D 1 gene overexpression is also seen in many tumors
without gross
chromosomal rearrangements or amplification of the cyclin Dl gene. In fact,
overexpression
l o of cyclin D 1 is seen in 50 % of primary breast carcinomas, in 30 % of
adenocarcinomas of the
colon (Hall and Peters, 1996), in familial adenomatous polyposis (Zhang et al.
, 1997) as well
as in many cases of pancreatic cancer (Gansauge et al. , 1997).
In addition, transgenic mice that overexpress the cyclin D 1 gene in mammary
epithelium show mammary hyperplasia and develop mammary adenocarcinomas (Wang
et al. ,
1 s 1994). Overexpression of cyclin D 1 in cultured cells has been shown to
result in early
phosphorylation of pRB (Jung, et al., Oncogene, 8:3447-3457, 1993), shortening
of the G1
phase and makes the cells growth factor independent (Jiang et al. , 1993;
Quelle et al. , 1993;
Resnitzky et al. , 1994). When injected into nude mice these cells produce
tumors (Jiang et al. ,
1993).
2 o The link between inappropriate expression of cyclin D 1 and tumorigenesis
indicates
that cyclin D 1 is a good target for therapeutic intervention. Cyclin D 1
antisense molecules
have been shown to reduce the neoplastic phenotype of human esophageal, colon
and
pancreatic cancer cells overexpressing cyclin Dl in culture as well as the
ability of these cells
to produce tumors in mice (Zhou et al. , 1995; Artier et al. , 1997; Kornmann
et al. , 1998). In
2 s these studies antisense technology was used to specifically inhibit cyclin
D 1 mRNAs.
Accordingly, regulated expression of cyclin D 1 fords utility in cancer and
other
therapies. The present invention provides identification of DNA response
elements within the
cyclin D 1 promoter that are involved in regulation of gene expression and a
demonstration of
the utility of DNA-binding compounds that bind to a sequence in the vicinity
of a DNA
3 o response element of the cyclin D 1 promoter as a means to modulate
expression of a gene
operably linked to the cyclin Dl promoter.
The human CCND 1 gene has been previously cloned and sequenced (Motokura et
al. ,
1991; Withers et al. , 1991; Xiong et al. , 1991 ). An upstream promoter
sequence of the
CCND 1 gene has also been cloned and sequenced (Herber et al. , 1994a,1994b;
Philipp et al.
3 5 1994). The CCND 1 promoter sequence may be found in GenBank at Accession
HUMPRDAlA (Motokura and Arnold, 1993).
Potential Spl, E2F, CRE, Octl, Myc/Max, AP-1, Egr, NFKB, STATS, Ets, PRAD
and TCF/LEF sites have been previously identified in the cyclin D1 promoter
(Motokura &
Arnold 1993; Herber, Truss, et al. 1994; Philipp, Schneider, et al. 1994;
Hinz, Krappmann, et
4 o al. 1999; Matsumura, Kitamura, et al. 1999; Shtutman, Zhurinsky, et al.
1999; and Tetsu &
McCormick 1999). Several of these sites have been demonstrated to play a role
in cyclin D1
regulation in various cell lines (Philipp, Schneider, et al. 1994; Albanese,
Johnson, et al. 1995;
Watanabe, Lee, et al. 1996; Yan, Nakagawa, et al. 1997; Watanabe, Albanese, et
al. 1998;
34
WO 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
Beier, Lee, et al. 1999; Hinz, Krappmann, et al. 1999; Matsumura, Kitamura, et
al. 1999;
Shtutman, Zhurinsky, et al. 1999; and Tetsu & McCormick 1999).
The prior art includes some analysis of the cyclin D 1 promoter, but does not
indicate
appropriate targets for regulated gene expression using the cyclin D 1
promoter. Analysis of
s transcription factor binding sites in the cyclin D 1 promoter was carried
out to identify portions
of the cyclin Dl promoter that can be used to regulate the expression of a
gene operabiy linked
to the cyclin D1 promoter and important transcription factor binding sites
were identified, and
modified as detailed in Example 5.
A 1900-by fragment of the human cyclin D 1 promoter was PCR amplified from
1 o genomic DNA and subcloned into the vector pGL3-basic (Promega) to form a
reporter
construct. A series of modified promoters were made and promoter activities
compared to that
of the full-length (-1745) cyclin D1 promoter following transfection into
asynchronous MCF7
human breast carcinoma cells, which overexpress cyclin D1, and important
regulatory regions
of the promoter were identified.
15 The -30 to -21 region of the CCND 1 promoter was identified as an important
regulatory region for promoter activity. The -30 to -21 sequence was modified
to contain
binding sites for the netropsin dimer 21x, which were introduced overlapping
the -30 to -21
sequence. In one case, the site was introduced into the 3' end of the A/T-rich
-30 to -21 site
(SEQ ID N0:36), by changing only 2bp (10 by 21x, SEQ ID N0:37, Example 5). A
second
20 21x binding site was constructed by mutating 5 by of the wild-type promoter
sequence to
produce an uninterrupted 8 A/T stretch (8 by 21x, SEQ ID N0:38, Example 5).
These
constructs were cloned in the context of the -1745 cyclin D 1 promoter in pGL3
basic,
transfected into MCF7 cells and demonstrated to retain high levels of promoter
activity in
MCF7 cells in the absence of 21x.
2s Binding of 21x to these sites was confirmed using a hybridization
stabilization assay, as
detailed herein and described in co-owned application USSN 09/151,890 and USSN
09/393,783, incorporated herein by reference.
In summary, the binding preference of compounds to various the cyclin D 1
promoter
sequences was examined in a competitive hybridization-stabilization binding
assay (HSA). In
3 o the HSA a nucleotide sequence of interest is represented in an
oligonucleotide duplex, and the
duplex was tested for its ability to compete with an indicator oligonucleotide
duplex which is
known to bind the test molecule with a certain degree of affinity. The
indicators are rich in AT
bases and labeled with either a fluorescent probe or a quencher moiety on each
of the two
strands. The binding of the compound to the indicator stabilizes the duplex
formation allowing
3 s the fluorescence to be quenched. If the compound prefers the test sequence
(competitor) more
than the indicator, it is less available to stabilize the indicator duplex and
thus quenching is
reduced. Therefore, a higher fluorescence signal implies a higher degree of
binding preference
to the test sequence relative to the indicator.
In one example, the hybridization stabilization assay employs a DNA duplex as
an
4 o indicator for binding, wherein one strand of the duplex is 5' labeled with
fluorescein, and the
complementary strand was 5' labeled with a dabsyl quenching molecule. When the
two strands
are mixed together with a DNA-binding molecule, which can stabilize the duplex
form, the
signal from the fluorescein is quenched by the dabsyl on the complementary
strand. Various
WO 00/52179 CA 02367037 2001-08-31 PCT/LTS00/05728
cold competitor duplexes are then added to see whether they provide preferred
binding sites for
a DNA-binding compound, e.g., 21x. If the competitor DNA, for example, an
oligonucleotide
containing a 21x binding site, or the wild-type cyclin D1 control sequence
bind 21x, 21x is
titrated away from the indicator duplex. This results in destabilization of
the indicator duplex
and as the strands separate, quenching is diminished and fluorescence
increases.
In the experiments described in Exmple 59 treatment of MCF7 cells containing
these
constructs with 21x resulted in down regulation of cyclin D1 promoter activity
while promoter
constructs lacking the 21x sites were unaffected. The results show that 21x
treatment of MCF7
cells was able to specifically lower cyclin D1 promoter activity 4-fold when a
21x binding site
to was present overlapping a transcriptional activator site.
One application of the present invention is the use of the molecular switch to
modulate
cyclin D 1 expression in cancer cells that overexpress the gene.
Regulated Gene Expression Using the HBV core Promoter
Viral induced Hepatitis B (HBV) in humans is estimated to have infected 300
million
people worldwide, with a small but significant number of infected individuals
developing
severe pathologic consequences, including chronic hepatic insufficiency,
cirrhosis, and
hepatocellular carcinoma. HBV-specific promoters involved in viral replication
are therefore
relevant to both therapy of HBV disease and regulated gene expression which is
specific to
2 0 liver cells.
Characterization of the HBV core promoter, which directs the transcription of
two
greater than genome size messenger transcripts, has been described (for
reviews, see Ganem
D, in Field Virology 3'd Ed. 1996 and Kann M and Gerlich, W, in Viral
Hepatitis, 2nd Ed).
The results of studies on the promoter activity of linker scanner mutants of
the native
2 s sequences HBV core promoter indicated that the TATA box and proximal HNF3
sites are
control elements critical for promoter activity (data not shown).
Small DNA-binding compounds were utilized to test their ability to alter the
transcription level from wild type and engineered HBV core promoters, either
by interference
and/or displacement of protein factor binding to its cognate nucleotide
binding sequences. The
3 o nucleotide composition at the core TATA box contains a run of seven A and
T (adenine and
thymine) bases that could serve as a preferred binding site for the compounds
21x and
GL046732, which exhibit a binding preference of A/T-rich sequences. In
addition, various
engineered promoter constructs were prepared containing introduced A/T-rich
sequences.
Treatment with 21x and/or GL046732 was effective to down-regulate the core
wild type
3 s promoter activity in constructs with A/T-rich sequences in a regulatory
region (Example 6),
indicating that DNA-binding compounds, are capable of altering levels of gene
transcription
through interaction with a basal transcription factor.
IX. Selection Of DNA-Bindin_g~pounds
4 o Exemplary pre-screening assays for candidate compounds include, but are
not limited
to, DNA binding assays and protein displacement assays, such as gel mobility
shift assays,
competitive binding assays, DNA footprinting, etc. Such assays may be carried
out using
various techniques which are known in the art. Briefly, an exemplary assay
provides
36
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
information about the sequence-specific or sequence-preferential binding to
DNA sequences,
for example, binding to A/T rich sequences. Gel mobility shift assays may be
used to
determine the effect of a compound on the binding of a transcriptional
regulatory protein to
its DNA response element, based on the change in size (and corresponding
mobility on a gel)
s of the DNA/protein complex relative to the DNA alone.
DNA footprriting may then be used to characterize the binding region based on
the
stability of drug binding sequence/drug complex to nuclease degradation.
In one embodiment, compounds for use in the regulatable gene expression system
of
the invention are pre-selected for DNA-binding and transcriptional regulatory
protein
1 o displacement in a form of the Merlin '~ assay. Exemplary pre-screening
assays include
various forms of the Merlin' assay. See, e.g., co-owned U.S. Pat. Nos.
5,306,619,
5,693,463, 5,716,780, 5,726,014, 5,744,131, 5,738,990, 5,578,444, 5,869,241,
expressly
incorporated reference herein.
In other embodiments, compounds are pre-selected in a nucleic acid ligand
15 interaction assay, such as that described in co-owned, co-pending, USSN
09/151,890
(expressly incorporated by reference, herein), or another nucleic acid binding
assay known to
those of skill in the art.
Candidate compounds may be modified or dimerized, screened in a DNA binding
and displacement assay, as further described for NF-KB, UL9, LacR, cyclin D1
and HBV
2 o HNF3. Further evaluation of interesting compounds may then be carried out
in a cell-based
aspect of the molecular switch system, as further described below for
UL9/VP16, rrnB P1 in
E. coli, cyclin Dl and HBV HNF3 and TATA sites. The potential efficacy,
toxicity and
pharmacokinetic properties of a compound may be evaluated in a cellular
environment in
such assay systems.
2 s In order to develop an effective regulatable in vivo gene expression
systems,
additional studies are carried out in vivo.
Animal models such as mice, rat, rabbit, dog, chimpanzee, zebra, fish, etc.,
can be
employed for such in vivo tests.
3 o X . In vivo Gene Thera
A. Re~ulatable In vivo Expression Systems
An effective regulatable in vivo expression system for use in the methods and
compositions of the invention must have the following properties: (1) the
ability to both
increase and decrease the expression of a selected therapeutic transgene, (2)
the ability to
3 s tightly control the expression level of a given transgene, (3) the
potential for cell type-,
tissue-specific or broadly-based expression, (4) a stable vector which may be
efficiently
transduced into cells in vivo and maintain promoter activity for an extended
time following
transduction, (5) the ability to be regulated by a compound with minimal
toxicity, (6) the
ability to operate with either engineered (exogenous) or natural (native),
exogenous or
4 o endogenous transcriptional regulatory elements, and (7) application to (a)
treatment of genetic
and non-genetic diseases (i. e. , cancer and infectious diseases), (b) toxic
recombinant protein
or secondary metabolite production, as well as (c) agricultural uses.
37
WO 00/$2179 CA 02367037 2001-08-31 pCT/US00/05728
B. Vectors for In vivo Delivery of Therapeutic Genes
Successful gene therapy depends on the controlled expression of transgenes.
Factors
which affect the expression of such transgenes include the efficiency of
transduction, the
stability of the vector, and efficient activation of the promoter that
regulates expression of the
s transgene.
The regulatable molecular switch constructs of the invention may be delivered
in vivo
by gene delivery vehicles known to those of skill in the art, including, but
not limited to viral
vectors (retroviral, adenoviral or adeno-associated viral vectors; Bohl, et
al. , 1997; Bohl and
Heard, 1997; Burcin, et al, 1999; Ye, et al., 1999) herpes virus vectors, pox
virus vectors;
1 o non-viral vectors, including non-liposomal vectors (i. e. , FuGeneT"6,
Roche Molecular
Biochemicals), liposomal vectors (i. e. , DOSPER and DOTAP, Roche Molecular
Biochemicals) and other non-viral means including receptor-mediated delivery,
calcium
phosphate transfection, electroporation, particle bombardment (gene gun), and
pressure-
mediated gene delivery.
1 s In general, the efficiency of gene transfer by viral vectors, e. g. ,
retroviral vectors
and adenoviral vectors, is higher than that of non-viral vectors. Retroviral
vectors, including
the most widely used amphotrophic murine leukemia virus (MuLV) vector, can
infect only
replicating cells, and typically, their transduction rate is lower than that
of adenoviral
vectors. However, since retroviral vectors integrate into the host genome the
expression of
2 o the transgene is persistent. Recently retroviral vectors have been
developed in which the
therapeutic gene carrying vector construct is introduced into a packaging cell
line that carries
two independent constructs, which express structural proteins for packaging,
thereby
addressing safety issues surrounding the generation of replication competent
retroviruses
(Salmons and Gunzburg, 1997).
2s Adenoviral vectors can infect many cell types, resting and replicating,
with high
efficiency. However, the expression of the transgene is transient, and in
addition, these
vectors induce a strong host immune response. An improved adenoviral vector
has the
majority of the viral genome removed and increased the capacity of the vector
for transgenes.
Recently, a hybrid adeno/retroviral vector has been designed (Bilbao, et al.,
1997).
3 o Adeno-associated virus vectors also facilitate integration of transgenes
into host
chromosomes, and constitutive expression of a transgene, without evoking a
strong host
immune response. However, limited cloning capacity, and the requirement of a
helper
adenovirus virus for its replication have hampered use of these types of
vectors in gene
therapy.
3 5 Once a transgene has been transferred into cells either via a viral or non-
viral vector,
expression of the transgene is governed by the strength and nature of the
promoter (i. e. ,
constituitively active vs. tightly regulated). In most cases high levels of
expression are
preferred in the methods and compositions of the invention, and strong viral
promoters are
incorporated into vectors for in vivo expression of transgenes. However, in
some cases
40 lower levels of expression are desired, and cellular promoters are used.
Factors to be considered in order to achieve non-toxic, selective and
controlled
expression of transgenes include, targeted delivery of therapeutic genes to a
particular tissue,
cell type specific expression, and expression which may be modified by an
exogenous
38
WO 00/52179 CA 02367037 2001-08-31 pCT~S00/05728
inducer.
For example, replicating cells may be targeted by retroviral vectors and
neuronal
tissue may be targeted by Herpes simplex virus (HSV) vectors. In the case of
retroviral and
adenoviral vectors, which lack tissue specificity, targeting may be improved,
for example, by
s the use of recombinant pseudo-typed viruses which are produced in a
packaging cell line that
provides a different envelope protein (Salmons and Guz~zberg, 1993), by
engineering the
envelope protein to redirect the interaction between the envelope protein and
a cell surface
receptor (Valsessia-Wittman et al., 1994), or to improve internalization of
the vector upon
receptor binding (Bushman, 1995). For adenoviral vectors, cell type
specificity can be
Zo augmented by modification of the fiber protein (Wu, et al., 1994).
Similarly, non-viral
vectors may be modified by coupling of antibodies to liposomes (Mizuno, et
al., 1990). In
addition, incorporation of viral surface glycoproteins or fusogenic proteins
into liposomes
confers the tropism of the coupled molecules onto the liposomes (Morishida, et
al. , 1993;
Bagai, et al., 1993).
i s Expression of transgenes of interest may also be controlled at the level
of
transcription, by the use of cell type- or developmental stage- specific
promoters or promoter
elements in gene transfer vectors, as further described in co-owned USSN
60/122,513,
expressly incorporated by reference herein.
Although many promoters and elements confer a degree of cell type specificity,
2 o transgene expression is typically constitutive in target tissues. Temporal
regulation of
therapeutic transgenes is highly desirable, to avoid toxicity which may occur
with constitutive
expression. Promoters which are inducible by exogenous factors such as
hormones, growth
factors, metabolites and stress factors are useful in the methods and
compositions of the
invention. (See, e.g. , Yarranton, 1992; Gossen, et al. , 1993). Exemplary
inducible cellular
2 s and viral promoters which exhibit restricted tissue specificity find
utility in the methods and
compositions of the invention, e. g. , the tyrosinase (Miller, et al. , 1995),
prostate specific
antigen (Culig et al. , 1994), a-feto protein (Ido, et al. , 1995) and MVMp P4
(Perms, et al. ,
1995) promoters. Exemplary cellular promoters which are generally not tissue-
specific, may
also be used in the methods and compositions of the invention, e.g., a
glucocorticoid
3 o responsive promoter (Lu and Federoff, 1995), a heavy metal responsive
promoter (Koh, et
al., 1995) and the cytochrome P450 lAl promoter (Smith, et al., 1995).
The feasibility of tissue-specific regulatable gene expression in vivo has
been
demonstrated by liver-specific expression using a liver-specific promoter
(Burcin, et al. ,
1999).
3 5 Gene therapy is applicable to many medical indications including monogenic
diseases, multigenic diseases, oncology, infectious diseases, and acquired
diseases.
Temporal and spatial regulation of therapeutic transgenes is of value in many
of these fields.
In many of these fields molecular switch technology will be needed for optimal
gene therapy
protocols.
4 o Disease targets include, but are not limited to, cancer such as prostate
cancer, breast
cancer, lung cancer, colorectal cancer, melanoma and leukemia; infectious
diseases, such as
HIV, monogenic diseases such as CF, hemophilia, phenylketonuria, ADA, familial
hypercholesterolemia, and multigenic diseases, such as restenosis, ischemia,
and diabetes.
39
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
In one embodiment, a natural tissue-specific promoter is modified to include
one or
more introduced compound binding sequences near one or more natural
transcriptional
regulatory factor binding sites which are essential for transcriptional
regulation of the natural
tissue-specific promoter.
s Temporal and spatial regulation of gene expression can be achieved by
combining the
tissue specificity of such a promoter with regulation of the interaction
between the tissue-
specific promoter and one or more essential transcriptional regulatory
proteins, by the
exposure of the promoter to a DNA binding compound which exhibits sequence-
preferential
binding to the introduced compound binding sequence(s).
1 o Once the one or more binding sites for such an essential transcriptional
regulatory
protein are determined, compound binding sequence(s), e.g. for a small
molecule, are
engineered into the promoter near the transcriptional regulatory protein DNA
response
elements) and thereby be used to regulate the binding of the transcriptional
regulatory
protein to the promoter, resulting in regulation of promoter activity.
1 s In a related aspect of the invention, a synthetic promoter is made by
introducing one
or more tissue-specific transcription factor binding sites and one or more
compound binding
sequences into the sequence of a tissue-specific regulatable promoter such
that the promoter
may be regulated by a compound which preferentially binds the compound binding
sequence(s), e.g., a small molecule. Such a small molecule may target an
essential
2 o transcription factor or tissue specific transcription factor if it is
essential to the activity of the
promoter.
XI. EXPRESSION OF RECOMBINANT PROTEINS
In vitro
25 Suitable host cells for cloning or expressing recombinant proteins include
prokaryotic, yeast, and higher eukaryotic cells. Suitable prokaryotes include,
but are not
limited to, gram-negative and gram-positive bacteria, for example, E. coli,
various strains of
which are publicly available.
Host cells are transfected or transformed with expression or cloning vectors
for
3 o recombinant protein production and cultured in conventional nutrient media
modified as
appropriate for inducing promoters, selecting transformants, and/or amplifying
the expression
of genes encoding the desired sequences. The culture conditions, such as
media,
temperature, pH and the like, may be optimized according to knowledge
generally available
to those of skill in the art. In general, principles, protocols, and practical
techniques for
3 s maximizing the productivity of cell cultures can be found in Butler, 1991,
and Sambrook, et
al. 1989.
Methods of transfection are known to those of skill in the art, for example,
CaP04
transfection, bacterial protoplast fusion with intact cells, nuclear
microinjection,
electroporation, or in methods that employ polycations, such as, polybrene or
polyornithine.
4 o Transfection is carried using standard techniques, as appropriate to the
particular type of cells
being transformed.
Infection with Agrobacterium tumefaciens is generally used for transformation
of
plant cells, as described by Shaw, et al. , 1983 and WO 89/05859 published 29
June 1989.
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
Mammalian cell transformations may be carried out as generally described in
U.S. Patent
No. 4,399,216: Keown, et al. , 1990 and Mansour, et al. , 1988.
In addition to prokaryotes, eukaryotes such as filamentous fungi or yeast are
useful
for expression of recombinant proteins. Saccharomyces cerevisiae is a commonly
used lower
s eukaryotic host microorganism.
Expression of recombinant proteins in yeast are typically carried out
following
transfection according to the methods described in Van Solingen, et al. , 1977
and Hsiao, et
al., 1979.
Suitable host cells for the expression of glycosylated recombinant proteins
are
Zo derived from multicellular organisms. Examples of invertebrate cells
include insect cells
such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of
useful
mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells.
More
specific examples include monkey kidney CV 1 line transformed by SV40 (COS-7,
ATCC
CRL 1651); human embryonic kidney line, 293, Graham, et al., (1977); Chinese
hamster
15 ovary cells (Cho, et al. , ( 1980); human lung cells (W 138, ATCC CCL 75);
and human liver
cells (Hep G2, HB 8065). Large numbers of cell lines are publicly available,
e.g., from the
American Type Culture Collection (ATCC, Manassas, VA). The selection of the
appropriate
host cell is deemed to be within the skill in the art.
In general, in methods for production of recombinant proteins, the nucleic
acid (e.g.,
2 o cDNA or genomic DNA) encoding a recombinant protein or polypeptide of
interest is
inserted into a replicable vector for cloning, or for expression. Various
vectors are publicly
available, and may take the form of a plasmid, cosmid, viral particle, or
phage. The
appropriate nucleic acid coding sequence may be inserted into the vector by a
variety of
procedures known to those skilled in the art of recombinant DNA technology.
2 s In general, DNA is inserted into an appropriate restriction endonuclease
sites) using
techniques known in the art. Vector components generally include, but are not
limited to,
one or more of a signal sequence, an origin of replication, one or more marker
genes, an
enhancer element, a promoter, and a transcription termination sequence.
Construction of
suitable vectors containing one or more of these components employs standard
ligation
3 o techniques which are known to the skilled artisan.
The desired recombinant protein or polypeptide may be produced recombinantly
directly, or as a fusion polypeptide with a heterologous polypeptide, which
may be a signal
sequence or other polypeptide having a specific cleavage site at the N-
terminus of the mature
protein or polypeptide. Included in heterologous nucleic acid constructs for
use in the
3 s methods of the invention are signal sequences that allow processing and
translocation of the
protein, as appropriate. The heterologous nucleic acid construct typically
lacks any sequence
that might result in the binding of the desired protein to a membrane.
In some cases, the recombinant protein may be produced as a precursor protein,
which may be further processed in cell culture or following extraction from
the culture
4 o medium.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the
vector to replicate in one or more selected host cells. Such sequences are
well known for a
variety of bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is
41
WO 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
suitable for most gram-negative bacteria, and various viral origins of
replication (SV40,
polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian
cells.
In cases where two separate plasmids are transformed into bacteria, compatible
replicons are used employing techniques generally known to those of skill in
the art.
In most cases, expression and cloning vectors also contain. a selectable
marker gene.
Typical selectable marker genes encode proteins that (aJ ~oiifer resistance to
antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b)
complement
auxotrophic deficiencies, or (c) supply critical nutrients not available from
complex media,
e.g., the gene encoding D-alanine racemase for Bacilli.
1 o Expression and cloning vectors generally contain a promoter operably
linked to the
recombinant protein- or polypeptide-encoding nucleic acid sequence to direct
mRNA
synthesis. Promoters recognized by a variety of potential host cells are well
known. Such
promoters my be inducible or constitutive, and may be of prokaryotic,
eukaryotic or viral
origin.
15 In the methods and compositions of the invention, the molecular switch
systems
described herein are used for expression of recombinant proteins and
polypeptides.
When an endogenous transcriptional regulatory protein is utilized in the
molecular
switch system of the invention, a vector is provided which includes a DNA
binding site for
the transcriptional regulatory protein, a compound-binding sequence, a
promoter, and a
2 o transgene which encodes a recombinant protein or polypeptide of interest,
under the control
of the aforementioned promoter.
In some cases, the molecular switch systems of the invention for expression of
recombinant proteins include two vectors, wherein one vector comprises the DNA
binding
site for a transcriptional regulatory protein, a compound-binding sequence, a
first promoter,
2 s and a transgene which encodes a recombinant protein or polypeptide of
interest, under the
control of the aforementioned promoter. A second vector is effective to
express an
engineered transcriptional regulatory protein or natural regulatory protein
having a regulatory
domain and a DNA binding domain under the control of a first promoter
(inducible or
constitutive). The regulatable expression system also includes compounds or
inducers which
3 o bind to the compound-binding sequence.
In other cases, a single vector system is used for expression of recombinant
proteins
in vitro. In such cases, the vector includes the DNA binding site for a
transcriptional
regulatory protein, a compound-binding sequence, a first promoter, and a
transgene which
encodes a recombinant protein or polypeptide of interest, under the control of
the first
3 5 promoter and is effective to express an engineered transcriptional
regulatory protein or
natural regulatory protein under the control of a second promoter. The
expression of one or
both of the transgene and transcriptional regulatory protein may be under the
control of a
constitutive or compound-inducible promoter.
In still other cases, a single vector is effective to express both a
transcriptional
4 o regulatory protein and a transgene under the control of a single compound-
inducible
promoter, utilizing internal ribosomal entry sites (IRES).
Alternatively, the molecular switch comprises a single vector which has a
transcriptional regulatory protein under the control of a single compound-
inducible and a
42
WU 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
transgene under the control of a constitutive promoter.
Transcription of a DNA encoding a recombinant protein or polypeptide by higher
eukaryotes may be increased by inserting an enhancer sequence into the vector.
Enhancers
are cis-acting elements of DNA, usually from about 10 to 300 bp, that act on a
promoter to
increase its transcription. Many enhancer sequences are now known from
mammalian genes,
however, frequently ettkaryotic viral enhancers are used. The enhancer may be
incorporated
into the vector at a position S' or 3' to the recombinant protein or
polypeptide coding
sequence, but is preferably located at a site 5' to the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal,
or human) will also contain sequences necessary for the termination of
transcription and for
stabilizing the mRNA. Such sequences are commonly available from the 3' and,
occasionally
5' , untranslated regions of eukaryotic or viral DNAs or cDNAs.
Molecular biological procedures routinely employed by those of skill in the
art for
production of recombinant proteins are provided in Sambrook, et al., 1989 and
Ausubel, et
1 s al. , 1989, both of which are expressly incorporated by reference herein.
Heterologous nucleic acid constructs for use in the methods of the invention
may
encode any protein or polypeptide of interest, or an intermediate in a
biosynthetic pathway
leading to a product or secondary metabolite of interest.
Exemplary recombinant proteins or polypeptides which may be expressed using
the
2 o molecular switch systems of the invention, include, but are not limited
to, enzymes;
immunoglobulins; recombinant proteins such as those used in therapeutics;
including, but not
limited to; serum albumin; Factor VIII, tissue plasminogen factor,
erythropoietin, colony
stimulating factors, such as G-CSF and GM-CSF, cytokines such as interleukins,
integrins;
surface membrane protein receptors; T cell receptors; structural proteins,
such as, collagen,
2s fibrin, elastin, tubulin, actin, and myosin; growth factors and growth
hormones. The protein
may also be an industrial protein or enzyme as exemplified by peroxidase,
glucanase, alpha-
amylase, and glucose oxidase).
Such exemplary recombinant proteins or polypeptides may be expressed using the
molecular switch systems of the invention in the context of in vitro
expression in bacteria,
3 o yeast, insect cells, mammalian cells and plant cells as well as in vivo in
transgenic animals
and plants.
In one further embodiment the molecular switch system may be used to express
more
than one recombinant protein at the same time. For example, a "switch on"
system using a
transcriptional regulatory protein with a repressor as the regulator component
could be used
3 5 to increase expression of one recombinant protein at the same time a
"switch off" system
using a transcriptional regulatory protein with an activator component is used
to decrease
expression of a second protein, e.g., a proteolytic enzyme.
In vivo in Trans~enic Animals
4 o Nucleic acids which encode recombinant proteins, polypeptides, and
modified forms
thereof, may be used to generate transgenic animals which, in turn, are useful
in the
production of therapeutically useful reagents. A transgenic animal (e.g., a
mouse, rat or
goat) is an animal having cells that contain a transgene, which transgene was
introduced into
43
WO 00/52179 CA 02367037 2001-08-31 pCT~S00/05728
the animal or an ancestor of the animal at a prenatal, e.g., an embryonic
stage. A transgene
is a DNA which is integrated into the genome of a cell from which a transgenic
animal
develops. In one embodiment, cDNA encoding a polypeptide or protein of
interest can be
used to clone genomic DNA encoding that polypeptide or protein in accordance
with
s established techniques. Methods for generating transgenic animals,
particularly animals such
as mice, rats and goats, have become conventional in the art and are
described, for example,
in U.S. Patent Nos. 4,736,866, 4,870,009 and 5,907,080.
Typically, transgenic animals that include a copy of a transgene encoding a
polypeptide or protein of interest introduced into the germ line of the animal
at an embryonic
1 o stage can be used to examine the effect of increased expression of DNA
encoding the
polypeptide or protein of interest.
Recently, transgenic animals are being used to produce various types of
recombinant
proteins. Transgenic goats which produce therapeutic proteins in their milk
have been
developed and recently a commercial kit, the pBCI Milk Expression Vector Kit
(Genzyme
15 Transgenics Corporation and Invitrogen Corp.), became available for the
production of
recombinant proteins in the milk of transgenic mice. In such methods, the DNA
sequences
for a milk protein promoter is operably linked to the coding sequence for a
recombinant
protein or polypeptide of interest. Similarly, the molecular switch system
described herein
find utility in regulated, e. g. , switch-on, expression of recombinant
proteins or polypeptides
20 of interest in transgenic animals.
XII. Agricultural Applications
A. Regulation of Gene Expression
Regulatable gene expression is applicable to many agricultural uses as well.
This
z s aspect of the invention includes methods directed to the production of
transgenic plants using
the regulatable expression (molecular switch) systems of the invention,
resulting in the
production of; (1) non-native recombinant proteins and polypeptides, (2)
modified native
proteins and polypeptides, and (3) secondary metabolites in such transgenic
plants.
Regulation of transcription using exogenous bacterial transcriptional
repressors such
3 o as LacR and TetR together with plant promoters modified to contain an
appropriate bacterial
operator sequence, have been successfully employed in various plant systems
such as
Arabidopsis, carrot and tobacco cells (Gatz, et al., 1991; Wilde, et al, 1992;
Ulmasov, et al,
1997).
The use of chimeric transcriptional activators such as LacR/Gal4 (Moore et al,
1998)
3 s and Gal4/VP16 or Gal4/THM 18 (Schwechheimer, et al. , 1998) for the
regulation of
transgene expression from engineered promoters has also been demonstrated in
plant
systems .
The molecular switch system of the invention finds utility in the regulation
of plant
gene expression by providing either an exogenous or endogenous transcriptional
regulatory
4 o factor (repressor or activator), which is active in plants, together with
a corresponding DNA
response element for the transcriptional regulatory factor, a compound binding
site and a
DNA-binding compound which preferentially binds to the compound binding site.
In most cases, gene expression is achieved by introducing a single vector or
nucleic
44
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
acid construct into plant cells, wherein the vector includes either: (1) a DNA
response
element for a transcriptional regulatory protein, a compound-binding sequence,
a promoter,
and a transgene which encodes a recombinant protein or polypeptide of
interest, under the
control of the promoter, which functions together with a native
transcriptional regulatory
s protein and an exogenously supplied DNA binding compound or (2) a DNA
response element
for a transcriptional regulatory protein, a compound-bindingwsequence, a
promoter, and a
transgene which encodes a recombinant protein or polypeptide of interest,
under the control
of the promoter, together with an engineered transcriptional regulatory
protein or natural
regulatory protein also under the control of a promoter, which functions
together with an
1 o exogenously supplied DNA binding compound.
In some cases, gene expression is achieved by introducing two vectors or
nucleic acid
constructs into plant cells, wherein a first vector is effective to express an
engineered
transcriptional regulatory protein or natural regulatory protein, and a second
vector includes
a DNA binding sequence for the transcriptional regulatory protein, a compound-
binding
i5 sequence, a promoter, and a transgene which encodes a protein or
polypeptide of interest,
under the control of the aforementioned promoter, which function together with
an
exogenously supplied DNA binding compound.
Both the one and two vector aspects, and the one and two promoter aspects of
the
molecular switch system of the invention include compounds or inducers which
bind the
2 o compound-binding sequence. Exemplary compounds for use in the molecular
switch system
of the invention are further described above.
B. Exemplary Plant Transcription Factors and Associated Binding Proteins
Exemplary transcriptional regulatory factors for use in plants include the
UL9/VP16
2 s activator or UL9/KRAB repressor, together with a regulatable transgene
operably linked to a
promoter having one or more UL9 DNA response elements in the vicinity of one
or more
binding sequences for 21x.
It will be understood that the various components of the molecular switch
system are
interchangeable. For example, transcriptional regulatory factors for use in
the methods of
3o the invention may include any of a number of DNA binding domains, such as
DAT1 from
Saccharomyces cerevisiae. DAT1 specifically recognizes the minor groove of non-
alternating oligo(A).oligo(T) sequences (Reardon, et al., 1995), and
accordingly provides a
sequence for the effective binding of 21x and compounds which act by a similar
mechanism.
In one example, a heterologous nucleic acid construct is described which has
the
3 s coding sequence for a reporter or gene of interest, linked to a minimal
promoter (i. e. CaMV
35S) with two upstream lac operator sequences fused to the promoter sequence,
which serve
as the binding site for a transcription factor, "LhG4" . LhG4 has a
transcriptional activator
domain from Gal4 fused to a mutant lac-repressor, which has enhanced binding
affinity, and
functions to regulate transcription of coding sequences downstream of the CaMV
35S
4 o promoter. (See, e. g. , Moore, et al. , 1998).
The tet repressor-operator system has been used to regulate the gene
expression in
transgenic tobacco plants. A transgenic plant constitutively synthesizing a
large number of
Tet repressor monomers per cell was made, followed by introduction of a
heterologous
WO 00/52179 CA 02367037 2001-08-31 PCT/[JS00/05728
nucleic acid construct containing the beta-glucuronidase (Gus) gene under the
control of a
CaMV 35S promoter, modified to contain two tet operators. Expression of the
GUS gene
was repressed 50- to 80-fold when both operators were positioned downstream of
the TATA
box. (See, e.g., Gatz, etal., 1991).
In some cases, the molecular switch system may make use of endogenous
transcription factors found in plants. For example, the endogenous plant
transcriptional
activator 780BP (780 binding protein) of cauliflower inflorescence which binds
to the 780
gene of T-DNA may be used. The DNA response element was determined (Adams and
Gurley, 1994; TTGAAAAATCAACGCT, SEQ ID N0:23) and includes the preferred
to sequence for binding of 21x and other compounds which target "AT-rich"
sequences.
In one exemplary embodiment, tandem repeats of the 780BP DNA response element
are fused to the minimal CaMV 35S promoter sequence operably linked to a
transgene, and
21x is used to regulate the binding of 780BP at the tandem repeated sites.
In a further exemplary embodiment, a plant tissue-specific transcription
factor,
15 NtBBFl, identified by its ability to bind to a regulatory domain of the
rolB oncogene
promoter (found in the Agrobacterium rhizogenes Ti plasmid in tobacco), is
used to regulate
transcription. The DNA response (cis) element for NtBBF 1 has been identified
in the rolB
gene (ACTTTA, SEQ ID N0:27). Mutational studies have indicated that this
sequence is
essential for the expression of rolB in apical meristems (Baumann, et al. ,
1999). A tissue
2o specific regulatable promoter may be designed using the DNA response
element for NtBBFl
in the rolB promoter or an engineered promoter having the DNA response element
for
NtBBFl fused to a minimal promoter sequence wherein the sequence in the
vicinity of the
DNA response (cis) element for NtBBFl is modified to include small molecule
binding
sequences (i.e., 21x). For example, the NtBBFl cis element (bold, uppercase),
may be
2s modified to include one or more introduced compound binding sequences
(lowercase) for 21x
or another compound that preferentially binds to "AT-rich" sequences.
Potential compound
binding sequences are indicated as "Q".
AC(TTTAtttt)
3 0 (aaaACTTTA)
The DNA response element for NtBBF 1 may be fused to a minimal promoter in
tandem to increase the activity of the promoter.
Overexpression of the natural plant transcription factor, "CBFI", which binds
to a
3s DNA response element, "CRT/DRE", found in the promoter of cold-inducible
genes may
fmd utility in regulating cold tolerance by incorporating CBF1 and CRT/DRE
into the
molecular switch systems of the invention. (See, e.g., Warren, 1998).
A cis-acting element identified in the promoter region of the rd29A gene is
associated
with dehydration and cold-induced gene expression. The sequence designated the
4o dehydration response element ("DRE", TACCGACAT, SEQ ID N0:28), has been
found in
the promoter regions of other dehydration and cold-stress inducible genes.
When the stress
inducible promoter rd29A was used to drive expression of a DRE-binding
protein,
"DREB1A" in Arabidopsis, transgenic plants were produced that were drought-,
salt- and
46
WO 00/52179 CA 02367037 2001-08-31 PCT/[JS00/05728
freezing-tolerant. (Kasuga, et al., 1999). The DREB1A transcriptional
regulatory protein
and the DRE response element, may fmd utility in regulating drought-, salt-
and cold-
tolerance by incorporating them into the molecular switch systems of the
invention.
Plant output traits of interest may be modified using the methods of the
invention by
s introducing heterologous nucleic acid constructs which encode recombinant
proteins,
polypeptides, or intermediates in the biosynthetic pathway leading to the
production of
metabolites associated with such output traits.
Such heterologous nucleic acid constructs may encode native or non-native,
e.g.,
mammalian or viral proteins or polypeptides.
1 o In another aspect of the invention, recombinant proteins or polypeptides
are produced
in plants using the molecular switch methods of the invention.
C. Improved Output Traits
The development of plants having desired traits such as improved yield;
disease
15 resistance to fungal, bacterial, viral and other pathogens; insect
resistance; herbicide
resistance; improved fruit ripening characteristics; cold temperature and
dehydration
tolerance; increased salt and drought tolerance; improved food quality (i. e.
nutritional
content) and improved appearance has been the focus of agribusiness for many
years.
Numerous genes involved in regulating such plant characteristics have been
identified
2 o and characterized
One example is the development of herbicide resistance in rice plants.
Transformed
rice has been shown to be resistant to at least imazethapyr, imazaquin,
nicosulfuron, and
primisulfuron, with suggested resistance to additional herbicides. (See, e.g.,
U. S. Pat. No.
5,773,703.)
z s Another example is genetically altered higher plants having a modified
starch and
sucrose biosynthesis phenotype, e.g., edible plants, such as peas with altered
sucrose and
starch content. (See, e.g., U. S. Pat. No. 5,773,693.)
Coding sequences for expression in plants using the regulatable expression
vectors
described herein include, but are not limited to, sequences which encode
enzymes and other
3 o proteins or polypeptides that confer: disease resistance to fungal,
bacterial, viral and other
pathogens; insect resistance; herbicide resistance; fungicide resistance; and
insecticide
resistance.
Coding sequences associated with output traits of interest further include,
those
associated with: regulation of plant development; regulation of fruit
ripening; increased salt
3 s and drought tolerance; and regulation of plant nutritional content, e. g.
, by altered oil
composition in seeds, increased grain oil content, altered seed protein
composition, altered
carbohydrate composition in seeds, altered carbohydrate composition in fruits,
and the like.
(See, e.g., Brar, et al., 1996).
By way of example, numerous plant proteins associated with pathogenesis or
4 o pathogenesis-related proteins (PR proteins) which are induced in large
amounts in response to
infection by various pathogens, including viruses, bacteria and fungi have
been identified.
In one aspect of the invention, the use of heterologous nucleic acid construct
comprising the coding sequence for such pathogenesis-associated proteins can
be used in the
47
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
molecular switch systems of the invention to develop plants which have
enhanced resistance
to disease. (See, e.g., Redolfi, et al., 1983; Van Loon, 1985; and Uknes, et
al., 1982; and
U. S. Pat. No 5,880,328, issued Mar. 9, 1999.)
D. Production of Recombinant Proteins and Polypeptides in Plants
Transgenic plants as the source of recombinant proteins and polypeptides offer
the advantage
of production at low cost, based on ease of plant transformation and scale up,
correct
assembly of the subunit components of multimeric proteins, and the lack of
pathogens
associated with recombinant protein or polypeptide production in cell culture.
(See, e.g.,
to Larrick, 1998).
Heterologous nucleic acid constructs for use in the methods of the invention
may
include coding sequences for recombinant proteins or polypeptides for
pharmaceutical
applications and nutraceutical production.
Exemplary recombinant proteins which have been produced in plants include
vaccines, enzymes, hormones, plasma proteins, and antibodies. More recently
technology
has been developed for the production of polymers, such as microbial
polyesters in plants.
(See, e.g., Kolodziejczyk, 1999).
More specific examples of recombinant proteins which have been produced in
plants
include, SpaA of S. mutans, HBV surface antigen, M protein of HBV, LT of E.
coli, CT of
2o V. cholerae, capsid protein of Norwalk virus, rabies glycoprotein, VPl of
foot and mouth
disease virus, secretory IgA and IgG. (See, e.g., Ma and Vine, 1999; Tian and
Yang, 1998;
Larrick, 1998).
E. Plant Transformation
2 s Genetic transformation of plants is generally accomplished by introducing
heterologous nucleic acid constructs into plants using Agrobacterium T-DNA
vectors,
microprojectile bombardment or by use of plant viral vectors, including, but
not limited to,
tobacco mosaic virus (TMV), cowpea mosaic virus (CPMV), tomato bushy stunt
virus and
alfalfa mosaic virus (A1MV), potato virus X (PVX) (Ma and Vine, 1999;
Smolenska, et al. ,
30 1998).
Targeting recombinant proteins for secretion in plants may be accomplished
using
either native or plant-derived leader sequences, such that N-glycoslylation
takes place. The
expression of recombinant proteins or polypeptides may be targeted to
extracellular spaces or
to particular tissues, e.g., storage organs such as seeds, by use of tissue-
specific promoters.
3 5 Once expressed, such recombinant proteins or polypeptides may be extracted
and
purified using techniques generally available to those of skill in the art.
Optimal methods of
plant transformation vary dependent upon the type of plant. It is preferred
that the vector
sequences be stably integrated into the plant genome.
Preferred methods for transformation of plant cells in molecular switch
methods of
4 o the invention are Agrobacterium-mediated transformation, electroporation,
microinjection,
and microprojectile bombardment.
In another aspect of the invention, transgenic plants are produced following
infection
with a plant virus which has been genetically modified to encode one or more
foreign genes,
48
WU 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
which are expressed following infection, as a soluble protein or polypeptide
in the plant
cytoplasm, targeted to cellular compartments, or alternatively fused to a
viral coat protein
which is displayed on the surface of the viral particle.
Expression vectors for use in the molecular switch methods of the invention
comprise
s heterologous nucleic acid constructs, designed for operation in plants, with
companion
sequences upstream and do~urstream from the expression cassette. The companion
sequences
are of plasmid or viral origin and provide necessary characteristics to the
vector to permit the
vector to move DNA from bacteria to the plant host, such as, sequences
containing an origin
of replication and a selectable marker. Typical secondary hosts include
bacteria and yeast.
to In one embodiment, the secondary host is E. coli, the origin of replication
is a colEl-
type, and the selectable marker is a gene encoding ampicillin resistance. Such
sequences are
well known in the art and are commercially available as well (e.g., Clontech,
Palo Alto,
Calif.; Stratagene, La Jolla, CA).
Vectors useful in the practice of the present invention may be microinjected
directly
15 into plant cells by use of micropipettes to mechanically transfer the
nucleic acid construct or
cassette (Crossway, Mol. Gen. Genet, 202:179-185, 1985). Such nucleic acid
constructs or
cassettes may also be transferred into the plant cell using polyethylene
glycol (Krens, et al. ,
1982.
High velocity ballistic penetration by small particles with the nucleic acid
either
2 o within the matrix of small beads or particles, or on the surface may also
be used for
introduction of nucleic acid sequences into plant cells. (See, e.g., Klein, et
al., 1987 and
Knudsen and Muller, 1991).
Yet another method for introduction of nucleic acid sequences into plant cells
is
fusion of protoplasts with other entities, either minicells, cells, lysosomes
or other fusible for
2 s introduction of nucleic acid segments into plant cells with lipid surfaces
(Fraley, et al. ,
1982).
A preferred method for introduction of nucleic acid constructs or cassettes
into the
plant cells is electroporation (From, et al., 1985). In this technique,
electrical impulses of
high field strength reversibly permeabilize biomembranes allowing the
introduction of
3 o plasmids into plant cells or protoplasts. Electroporated plant protoplasts
reform the cell wall,
divide, and form plant callus.
Another preferred method of introducing a nucleic acid construct comprising a
sequence of interest into plant cells is to infect a plant cell, explant,
meristem or seed with
Agrobacterium, in particular Agrobacterium tumefaciens. A nucleic acid
construct
3 s comprising such a sequence of interest can be introduced into appropriate
plant cells, for
example, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti
plasmid is
transmitted to plant cells upon infection by Agrobacterium tumefaciens, and is
stably
integrated into the plant genome (Horsch, et al., 1984; Fraley, et al., 1983;
Schell, 1987).
Standard Agrobacterium binary vectors are known to those of skill in the art
and
4 o many are commercially available. Expression vectors typically include
polyadenylation sites,
translation regulatory sequences (e.g., translation start sites), introns and
splice sites,
enhancer sequences (which can be inducible, tissue specific or constitutive),
and may further
include 5' and 3' regulatory and flanking sequences.
49
WO 00/52179 CA 02367037 2001-08-31 PCT/jJS00/05728
An exemplary binary vector suitable for use in the molecular switch methods of
the
invention include at least one T-DNA border sequence (left, right or both);
restriction
endonuclease sites for the addition of one or more heterologous nucleic acid
coding
sequences [adjacent flanking T-DNA border sequences)]; a heterologous nucleic
acid coding
s sequence (i.e., the sequence encoding a protein or polypeptide of interest),
operably linked to
appropriate regulatory sequences and to the directional T-DNA border
sequences; a
selectable marker-encoding nucleotide sequence which is functional in plant
cells, operably
linked to a promoter effective to express the selectable marker encoding
sequence; a
termination element for the selectable marker-encoding nucleotide sequence; a
heterologous
1 o Ti-plasmid promoter; a nucleic acid sequence which facilitates replication
in a secondary host
(e.g., an E. coli origin of replication) and a nucleic acid sequence for
selection in the
secondary host, i.e., E. coli.
In general, a selected nucleic acid sequence is inserted into an appropriate
restriction
endonuclease site or sites in the vector. Standard methods for cutting,
ligating and E. coli
1 s transformation, known to those of skill in the art, are used in
constructing vectors for use in
the present invention. See, for example, Sambrook, et al. (1989) and Ausubei,
et al.,
(1989).
In choosing a promoter it may be desirable to use a tissue-specific or
developmentally
regulated promoter for regulated expression in certain tissues without
affecting expression in
20 other tissues. Numerous examples of such promoters are known in the art or
differential
screening techniques may be used to isolate promoters expressed at specific
(developmental)
times, such as during seed development.
Generally, the construction of vectors for use in practicing the present
invention are
known by those of skill in the art. (See generally, Maniatis, et al., (1989),
and Ausubel, et
2s al., (c) 1987, 1988, 1989, 1990, 1993 by Current Protocols; Gelvin, etal.,
(1990), all three
of which are expressly incorporated by reference, herein.
In one aspect of the invention, an Agrobacterium binary plant transformation
vector
is introduced into a disarmed strain of A. tumefaciens by electroporation
(Nagel, et al.,
1990), followed by co-cultivation with plant cells, to transfer the
heterologous nucleic acid
3 o constructs) into plant cells. Upon infection by Agrobacterium tumefaciens,
the heterologous
DNA sequence is stably integrated into the plant genome in one or more
locations.
In a further aspect of the invention, transgenic plants are produced using
Agrobacterium T-DNA vectors or microprojectile bombardment, where a
heterologous
nucleic acid coding sequence is integrated into the plant genome and
traditional breeding is
3 s used to generate transgenic seed stock and transgenic plants.
In a further aspect, plant cells are transformed by infection with
Agrobacterium
tumifaciens. However, as will be appreciated, the optimal transformation
method and tissue
for transformation will vary depending upon the type of plant being
transformed.
Suitable selectable markers for selection in plant cells include, but are not
limited to,
4 o antibiotic resistance genes, such as, kanamycin (nptII), 6418, bleomycin,
hygromycin,
chloramphenicol, ampicillin, tetracycline, and the like. Additional selectable
markers include
a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene
which encodes
glyphosate resistance; a nitrilase gene which confers resistance to
bromoxynil; a mutant
WO 00/52179 cA 02367037 2001-08-31 PCT/US00/05728
acetolactate synthase gene (ALS) which confers imidazolinone or sulphonylurea
resistance;
and a methotrexate resistant DHFR gene.
The particular marker gene employed is one which allows for selection of
transformed cells as compared to cells lacking the DNA which has been
introduced.
s Preferably, the selectable marker gene is one which facilitates selection at
the tissue culture
stage of the molecular switch methods of the invention, e.g. , a: kanamyacin,
hygromycin or
ampicillin resistance gene.
Transformed explant cells are screened for the ability to be cultured in
selective
media having a threshold concentration of selective agent. Explants that can
grow on the
1 o selective media are typically transferred to a fresh supply of the same
media and cultured
again. The explants are then cultured under regeneration conditions to produce
regenerated
plant shoots. After shoots form, the shoots are transferred to a selective
rooting medium to
provide a complete plantlet. The plantlet may then be grown to provide seed,
cuttings, or the
like for propagating the transformed plants. The method provides for high
efficiency
15 transformation of plant cells with expression of modified native or non-
native plant genes and
regeneration of transgenic plants, which can produce a protein, polypeptide or
secondary
metabolite of interest.
Once the expression of a protein, polypeptide or secondary metabolite of
interest is
confirmed using standard analytical techniques such as Western blot, ELISA,
PCR, HPLC,
2 o NMR, or mass spectroscopy, whole plants are regenerated. Plant
regeneration is described
for example in Evans, et al., 1983 and in Vasil, 1984, and 1986).
XIII. Utilit~~ Of The Invention
The present invention can be used for (1) screening and optimizir.~ as well as
validation
2 s of the sequence specificity of a DNA binding molecule in cell based
assays, (2) in vectors for
controlled therapeutic gene expression in vivo, (3) in toxic protein
production in eukaryotic
expression systems, (4) for recombinant protein and secondary metabolite
production, (5) in
various agricultural uses, examples of which are described above, (6) as a
research tool, and
(7) in developmental and functional studies with transgenic animals, where
molecular switches
3 o allow the temporal expression of the genes that are lethal if expressed at
an early stage of
development. Expression of disease or therapeutic genes in adult animals may
aid the study
of the function of these genes.
IX. Advantageses
3 s All of the prior art systems for regulated gene expression rely on the
binding of a
compound to a regulatory protein and each lacks some features of an effective
regulatable
expression system.
The molecular switch compositions and methods described herein provide the
advantage of regulated gene expression using native transcriptional regulatory
proteins which
4 o are present endogenously and which may also be exogenously provided.
In contrast to the prior art, in the molecular switch methods and compositions
of the
invention, the compound binds with double-stranded DNA and the binding of the
compound to
double-stranded DNA has an effect on the binding of a transcriptional
regulatory protein to its
51
WO 00/52179 CA 02367037 2001-08-31 pCT/[JS00/05728
DNA response element. In the methods of the invention, any compound which
modulates the
binding of a transcriptional regulatory protein to its DNA binding site can be
used to regulate
the expression of a gene operably linked to the promoter. The choice of
inducer is not
restricted by the transcriptional regulatory protein as long as it modifies
the binding of the
s transcriptional regulatory protein to its DNA response element and thereby
regulates the
expression of a gene o~erably linked thereto.
By engineering one or more compound binding sequences in the vicinity of the
DNA
response element for an endogenous transcriptional regulatory protein, a
compound can
specifically target transcription factor binding to the engineered site or
sites, resulting in greater
1 o specificity of regulation.
In addition, the invention provides a system that is tightly regulated by an
exogenous
factor which can regulate expression of the transgene without non-specifically
affecting
expression of endogenous cellular genes.
1 s All patent and literature references cited in the present specification
are hereby
incorporated by reference in their entirety.
While the invention has been described with reference to specific methods and
embodiments, it will be appreciated that various modifications and changes may
be made
without departing from the invention.
EXAMPLE 1
UL9 Chimeric Transcriptional Regulatory Constructs
Oligonucleotides comprising the UL9 DNA response element and one or two
binding
sequences for the A/T-rich binder, 21x were constructed. In each
oligonucleotide the
2s putative 21x-binding sequences) overlap the modified UL9 binding site (SEQ
ID N0:18).
The modified sequences include YK 202LX (Fig. 6, SEQ ID N0:19), YK 202RX-A
(Fig. 6,
SEQ ID N0:20), and YK 202RX (Fig. 6, SEQ ID N0:21), wherein the
transcriptional
regulatory protein DNA response site is indicated as bolded and uppercase,
introduced
compound binding sequences are indicated in lowercase and potential compound
binding
3 o sequences are indicated as ( ) or [ ] . A gel mobility shift assay for
protein displacement was
used to measure compound induced protein displacement. A 3zP labeled
oligonucleotide was
incubated with 10 nM GST-UL9 at room temperature in the binding buffer (20 mM
HEPES,
pH 7.5, 50 mM KCI, 0.1 mM EDTA, 5 % glycerol and 1mM DTT) for 20 minutes,
followed
by the addition of 21X. The incubation was continued for 2 hours and the
samples analyzed
3 5 by polyacrylamide gel electrophoresis, with the amount of protein bound
oligonucleotide
quantitated. UL9 was displaced most efficiently when there was an overlap
between protein
and 21x binding sequences at 3'end of UL9 binding site, as shown in Fig. 7.
UL9 Activator Constructs
4 o The strong sequence specific chimeric activator, UL9-VP 16, was
constructed the C-
terminal DNA binding domain of UL9 fused to the N-terminus of the activation
domain of
VP16 utilizing pGEX-UL9 (Genelabs) and pACT (Promega), expressed under the
control of
a CMV immediate early enhancer/promoter. Luciferase reporter constructs with a
series of
52
WO X0/52179 cA 02367037 2001-08-31 PCT/US00/05728
tandem repeated UL9 binding sites and flanking compound-binding sites were
made by
modifying the pG5luc vector (Promega). In this vector the fire fly luciferase
is under the
control of synthetic promoter that is composed of five tandem repeats of GAL4
binding sites
followed by the major late minimal promoter of adenovirus. Gal4 binding sites
in the vector
were replaced with 1 to 7 copies of the UL9 binding site.
The effect of the exogenously provided chimeric activator UL9-VP16 ("U1,VP")
on
expression of four different engineered reporter constructs was evaluated.
pSUL and pSULE
were engineered with the adeno major late minimal promoter fused to 5 tandem
repeats of the
UL9-21x response element and a firefly luciferase reporter in the pGL3-Basic
or the pGL3-
to Enhancer vector which has an SV40 enhancer, respectively. pULVP has a
chimeric UL9/VP
activator fused to a firefly luciferase reporter. pSGal and pSGaIE contain 5
tandem repeats
of the Gal4 response element in place of the UL9-21x response element of pSUL
and pSULE,
respectively. The promoterless pRL-Null plasmid containing the Renilla
luciferase reporter
was used as a copy number control.
HeLa cells (5 x 105 cells) were co-transfected with 3 plasmids: 2 ~g of
reporter, 0.2
~g of pRL-Null co-reporter and varying amounts of pULVP (0 to 100 ng). Low
concentrations of pULVP encoding the UL9-VP16 activator significantly
increased the
expression of specific reporter constructs that have UL9 response elements
while non-specific
reporter constructs were not activated significantly (Table 4). PSUL and pSULE
expression
2 o was increased 24 fold and 8 fold, respectively above basal expression,
with 25 ng of pULVP.
In contrast, 25ng of pULVP activated pSGal only 2 fold and did not activate
pSGaIE
expression at all. SV40 enhancer in pSULE and pSGaIE augmented the promoter
activities
18 fold and 15-fold compared to the activities of comparable constructs with
no enhancer
(pSUL and p5Ga1), respectively.
Table 4 Effect Of UL9-VP16 Activator On Reporter Expression
Construct no nULVP pULVP (25n~) pULVP
pSUL 1 x 24 x 31 x (1 ng), 77
x (20 ng)
pSULE 18 x 138 x ND'
p5Ga1 1 x 2 x ND
pSGalE 15 x 17 x ND
pRL-Null 1 x 1.5-2.5 x 3 x (10 ng)
The results indicate that exogenously provided ULVP acts as a transcriptional
3 o activator for promoters which have UL9 response elements. Further
titration (0 to 40 ng) of
pULVP was carried out to determine the optimal level of ULVP for the specific
activation of
pSUL and pSULE. Based on firefly luciferase expression normalized by Renilla
luciferase
expression from pRL-Null, 1 ng of pULVP showed an activation level relative to
pSULE of
over 30 fold. Expression of ULVP also increased expression of pRL-Null up to 3
fold
increase was observed with 10 ng of pULVP. The non-normalized reporter
activity indicated
1 ND=not done
53
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
up to 77-fold activation of pSULE with 20 ng of pULVP (Table 4).
The results show specific activation of expression by the ULVP activator
promoter
construct together with UL9 response elements.
5x104 MCF7 cells were co-transfected with 3 ~g of reporter, 0.5 pg of pRL-Null
co-
y reporter and 20ng of pULVP using 16 p.g of LipofectAmineTM and 2 p.l of Plus
agent in a
total volume of 0.4 ml in each well of a 24-well plate ( 1 % fetal 'calf serum
OPTI-DMEM
medium). After 4 hours medium was changed to OPTI-DMEM containing 1 % fetal
calf
serum plus varying amount of 21x. 20 ng of pULVP activator was shown to
significantly
increase the expression of pSUL which has UL9 response elements while the
control reporter
to construct pSGal was not activated significantly (Figure 11). pSUL reporter
expression in the
presence of chimeric activator ULVP was down-regulated significantly with 21x
treatment (7
fold at 20 p.M 21x). The down-regulation was concentration dependent,
suggesting that 21x
displaced the ULVP chimeric activator from the promoter and that the 21x
ligand response
element was UL9 specific.
UL9 Repressor Construct
The sequence specific chimeric repressor, UL9-KRAB, was constructed the C-
terminal DNA binding domain of UL9 fused to the N-terminus of the repressor
domain of
kruppel protein (KRAB, SEQ ID NO:10, Margolin JF, et al. , 1994), expressed
under the
2 o control of a CMV immediate early enhancer/promoter. Luciferase reporter
constructs with a
series of tandem repeated UL9 binding sites and flanking compound-binding
sites were made
by modifying the pG5luc vector (Promega). In this vector the firefly
luciferase is under the
control of synthetic promoter that is composed of five tandem repeated GAL4
binding sites
followed by the major late minimal promoter of adenovirus. Gal4 binding sites
in the vector
were replaced with 1 to 7 copies of the UL9 binding site.
The effect of the exogenously provided chimeric repressor UL9-KRAB ("ULKRAB")
on expression of three different engineered reporter constructs was evaluated.
pSULE was
engineered with the major late minimal promoter of adenovirus fused to 5
tandem repeats of
the UL9-21x response element and a firefly luciferase reporter in the pGL3-
Enhancer vector
3 o which has an SV40 enhancer. pSGaIE has five tandem repeats of the GAL4
binding site
followed by the major late minimal promoter of adenovirus and a firefly
luciferase reporter in
the pGL3-Enhancer vector which has an SV40 enhancer. The promoterless pRL-Null
plasmid
containing the Renilla luciferase reporter was used as a copy number control.
Previously expression of the chimeric ULKRAB repressor in HeLa cells exhibited
specific repression of the pSULE reporter activity by 6 fold (to 16% of basal
level) in a triple
plasmid co-transfection of plasmids pRL-SV40 copy control, co-reporter (15
ng), pSWSUL
reporter (2 p.g) and pULKRAB repressor (1 pg). The ULKRAB repressor plasmid
was
further titrated in a similar transfection assay to optimize the level of
ULKRAB expression
needed for specific repression of the pSWSULE reporter. In this experiment 2
pg pSWSULE
4 o reporter plasmid was co-transfected with varying amounts (0 to 2 p.g) of
pULKRAB plasmid
and 0.2 pg of co-reporter pRL-Null. The basal activities of pSULE and pSGaIE
were
consistent with previous observations in the absence of pULKRAB (Table
ULKRAB).
Specific repression mediated by ULKRAB was observed: with 0.8 p.g or more of
pULKRAB
54
WO 00/$2179 CA 02367037 2001-08-31 PCT/LTS00/05728
pSWSUL was down regulated 20 fold (down to 5 % of basal level). PSGaIE was
down
regulated 1.7 fold (down to 62 % of basal level) in the same experiment.
Expression of up to
0.8 ~g of pULKRAB did not affect the expression of pRL-Null significantly in
triple plasmid
co-transfection (data not shown).
Table 5. Effect Of ULS-KRAB Repressor On Reporter Expression
Constructsno~ULKRAB with pULKRAB (0.8 to about
1 u~)
pSULE 1 x 1 /20 x (5 % )
pSGaIE 1 x 1 / 1. 7 x (62 % )
pRL-Null 1 x 1 / 1. 3 x
FX A MPT F 7
1 o Protein Displacement Studies With NF-KB
A purified Thioredoxin-p50 NF-kB fusion protein (p50C) (Genelabs Technologies,
Inc.) was used to generate five oligonucleotides comprising an NF-kB DNA
response element
and one or two overlapping binding sites for the AT-rich binder, 21x.
The exemplified NF-kB binding sites, GGGACTTTCC (SEQ ID N0:29) and
GGGATTTTCC (SEQ ID N0:30) are present in the Igk and IL-6 promoters,
respectively.
The exemplary oligonucleotides are presented in Fig. 7, with the
transcriptional regulatory
protein DNA response site indicated as bolded and uppercase, introduced
compound binding
sequences indicated in lowercase and potential compound binding sequences
indicated as ( )
or [ ].
2o Oligonucleotides JF101 (SEQ ID N0:31) and 102 (SEQ ID N0:32), have compound
binding sequences overlapping the right side of the NF-kB DNA response
element, while in
the case of JF103 (SEQ ID N0:33), the overlaps are from both sides (Fig. 7).
A gel mobility shift assay was carried out as described above for UL9, and the
results
presented in Figs. 8A and B, indicated that: (1) 21x can efficiently displace
NF-kB at
concentrations as low as 1 pM, (2) the displacement is more efficient when the
NF-kB
binding site is an IL-6 sequence (SEQ ID N0:30) relative to an IgK sequence
(SEQ ID
N0:29), and (3) 21x displaces NF-kB more efficiently than distamycin.
The native CMV promoter has 3 NFKB response sites and 1 TATA binding protein
(TBP) site. Purely engineered NF-kB/TBP based 21x ligand switchable constructs
were
3 o created. In each of pMC, p2MC and p4MC, 0, 2 and 4 tandem repeats of a
response
element consisting of the NF-kB response sequence flanked by 21x sites were
fused to a
CMV minimal promoter with the TBP site modified to include a 9 A/T stretch to
optimize
21x binding. These promoters were cloned into pGL3-Basic to create firefly
luciferase
reporter constructs, as set forth below.
Firefly luciferase reporter promoter constructs containing a minimal CMV
system
were constructed as follows:
pMC3 (SEQ ID N0:40), which includes a minimal CMV promoter with an
introduced 21x site and a luciferase reporter; p2MC5 (SEQ ID N0:41), which
includes a
minimal CMV promoter with an introduced 21x site and a luciferase reporter and
two NFKB
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
sites; p4MC1 (SEQ ID N0:42), which includes a minimal CMV promoter with an
introduced
21x site and a luciferase reporter plus four NFKB sites; pBKMCl (SEQ ID
N0:43), a wild
type control vector which includes a minimal CMV promoter and a luciferase
reporter and
has a sequence of 8 to 9 A/T's near the TBP site; pBK2MC5 (SEQ ID N0:44), a
control
vector which includes a minimal CMV promoter, a luciferase reporter plus two
tandem
repeats of the NF-kB response element flanked by a poor 21x binding sequence
and the
flanking sequence of the TBP site was also modified to contain a 7 A/T
stretch, which is less
desirable for 21x binding; and pBK2MC12 (SEQ ID N0:45), a control vector which
includes
a minimal CMV promoter plus a luciferase reporter and two tandem repeats of
the NF-kB
1 o response element.
Firefly luciferase reporter promoter constructs containing a complex CMV
system
were constructed as follows:
SWCMV (SEQ ID N0:46), which includes a native full CMV promoter with all 3
NFKB sites modified to contain introduced preferred binding sites for 21x and
a luciferase
15 reporter; MTCMV (SEQ ID N0:47), which includes a native full CMV promoter
with all 3
NFKB sites and the TBP site modified to contain introduced preferred binding
sites for 21x
and a luciferase reporter; and BKCMV (SEQ ID N0:48), which includes a native
full CMV
promoter with 3 unmodified NFKB sites and an unmodified TBP site and a
luciferase
reporter.
2 o The sequences of exemplary promoter constructs are provided below:
pSWCMV (SEQ ID N0:46), as cloned in pGL3-Basic with KpnI and HindIII sites
indicated
as lowercase,
2s ~TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATTAAT
ATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATT
GGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATA
GTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACAT
AACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGAC
3o GTCAATAATGACGTATGTTCCCATAGTAACGCAAATAGGGATTTTCCATTAACGTC
AATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT
ATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATT
ATGCCCAGTACATGACTTTATGGGATTTTCCTATTTGGCAGTACATCTACGTATTA
GTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATA
3s GCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT
TGTTTTGGCACCAAGGTAAAAGGGATTTTCCAAAATGTCGTAACAACTGCGATCG
CCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTATATAA
GCAGAGCTCGTTTAGTGAACCGTCAGATC
4 o MTCMV (SEQ ID N0:47), as cloned in pGL3-Basic with KpnI and HindIII sites
indicated as
lowercase,
TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATTAAT
ATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATT
45 GGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATA
GTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACAT
AACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGAC
56
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
to
GTCAATAATGACGTATGTTCCCATAGTAACGCAAATATTCCCGGGAAATTAACGT
CAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATC
ATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCA
TTATGCCCAGTACATGACTTTATTCTCGAGGAATATTTGGCAGTACATCTACGTAT
TAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGA
TAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGA
GTTTGTTTTGGCACCAAGGTAAAATTACGCGTAAAA~~ATi~TCirTAACAACTGCGA
TCGCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTGCTA
GCCGCAGAGCTCGTTTAGTGAACCGTCAGAT ;
BKCMV, (SEQ ID N0:48), as cloned in pGL3-Basic with KpnI and HindIII sites
indicated as
lowercase,
TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAAT
i5 ATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATT
GGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATA
GTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACAT
AACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGAC
GTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTC
2o AATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT
ATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATT
ATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTA
GTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATA
GCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT
2s TGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTGCGATCG
CCCGCCCCGTTGACGCAAATGGGCGGTAGCCGTGTACGGTGGGAGGTCTATATAA
GCAGAGGTCGTTTAGTGAACCGTCAGATC
Expression of the firefly reporter using various engineered minimal CMV
promoter
3 o constructs was analyzed in the presence or absence of various amount of
exogenous NF-KB
plasmid (pS50 and pS65 for the p50 and p65 NF-xB subunit, respectively). As
shown in
Table 6, the presence of NF-xB response elements in p2MC, p4MC, pBK2MC
augmented
the activity of the promoters approximately 4 to 17 fold relative to the
activity of promoters
lacking the NF-KB response element (pMC and pBKMC). This effect was
incrementally
3 s increased based on the number of NF-KB response elements. These results
suggest that NF-
xB acted as the major activator for the promoters with NF-KB response element.
Results are
reported as normalized firefly luciferase activity relative to Renilla
luciferase activity and as
absolute firefly luciferase activity ( )
4 o Table 6 Reporter Expression Regulated By NF-KB In A Minimal CMV Svstem.
Construct endogenous NF plus additional exo~gnous
kB NF kB 0.1 u~
each of pS50 and pS65)
MC3 1 x (1 x) 2.2 x (1.3 x)
2MC5 6 x (12 x) 44 x (32 x)
4MC 1 17 x (22 x) 85 x (65 x)
BKMC 1 1 x ( 1.4 x) 1.4 x (0.7 x)
BK2MC5 3.5 x (3.8 x) 12 x (5 x)
pBK2MC 12 4 x (4.4 x) ~ 18 x (9 x)
57
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
As shown in Tables 6 and 7, the effect of additional exogenous NF-KB p50 and
p65,
expression following co-transfection, further increased the activity of all
the promoter
constructs which have NF-KB elements by approximately 4 to 7 fold. These
results indicate
that the endogenous intracellular NF-xB level is sub-optimal for the full
activation of these
engineered promoters. Additional expression of exogenous NF-KB did not
significantly affect
promoters without NF-xli element:
Table 7 Reporter Expression Regulated B~NF-KB In A Complex CMV S stem.
Construct plus endogenous NF-kB
pBKCMV 1 x
pSWCMV 1.2' 1.6 x
pMTCMV 0.4'0.5 x
to
Firefly luciferase reporter expression results normalized relative to co-
reporter
Renilla luciferase to accommodate the differential transfection efficiency in
each transfection.
We have analyzed the effect of expression of exogenous NF-kB on Renilla
luciferase co-
reporter of pRL-Null. It was observed that with increasing amounts of NF-kB
plasmid in all
i5 co-transfections, the level of Renilla luciferase expression was decreased
3 to 7 fold. The
ideal copy and transfection control co-reporter is the one that is not
affected either by the
transcription factors or by the ligands. However, independent of the effect of
NF-kB
expression on the level of pRL-Null expression, absolute (un-normalized)
expression of the
firefly reporter showed a similar trend to normalized expression: that is
addition of NF-kB
2 o response elements augmented the promoter activities of the reporter
constructs and additional
expression of exogenously provided NF-kB p50 and p65 increased the activity of
the
promoter in reporter constructs which had NF-kB response elements, indicating
the
endogenous level of NF-kB in HeLa cells is limiting for the full expression of
the reporter
constructs with NF-kB response element.
EXAMPLE 3
Protein Displacement Studies With LacR
The feasibility of using LacR as an exogenous factor for a switch-on molecular
switch system was evaluated using LacR, which is a repressor that represses
transcription of
3 o the lac operon by binding to lac0 operator sequences. Binding and
displacement of LacR
was tested using oligonucleotides with introduced drug binding sites that
overlap the
transcriptional regulatory protein binding site (Fig. 9).
In Figure 9, the transcriptional regulatory protein DNA response site is
indicated as
bolded and uppercase, introduced drug binding sites are indicated in lowercase
and potential
3 5 drug binding sites are indicated as ( ) or [ ] . Both of oligonucleotides
tested, SEQ ID N0:34
and SEQ ID N0:35, have introduced drug binding sites which overlap the LacR
binding site
on both sides of the IacO sequence.
A gel mobility shift assay was carried out as described above for UL9, and the
results
are presented in Figs. l0A and B.
58
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
The results of the assay indicate that: (1) 21x can efficiently displace LacR,
and that
(2) 21x appears to displace LacR more efficiently than IPTG.
Preliminary experiments were carried out using reporter constructs. PBKLac has
3
wild type lac0 response elements in an intron region of the RSV-LTR promoter
fused to the
s firefly luciferase reporter gene. PSWLac has 3 modified lac0/21x response
elements in
pl~~e cif wild type lac0 sites. Basal activities of two clones each of pBKLac
and pSW l.ac
were determined. Two clones of pBKLac showed somewhat different activity. When
compared to the expression of pBKLac34 ( 100 % ) pBKLac25 expression was 150 %
. Two
pSWLac clones 27 and 30 each exhibited 71 % and 83 % , respectively. Two to
four fold
to repression by exogenously supplied LacI was observed with as low as 0.1 p.g
of pLacI
together with 2 pg of reporter construct.
EXAMPLE 4
Regulated Gene Expression In Prokaryotic Cells
i5 The E.coli promoter rrnB P1 (SEQ ID N0:12), was selected as a prokaryotic
model
promoter for evaluating 21X in a cell-based aspect of the molecular switch
system. The wild
type UP element contains a 17 base pair stretch of AT-rich sequences, was used
to test the
effect of a DNA binding compound 21x, which preferably bind to AT-rich
sequences (Fig
2B, SEQ ID N0:13).
2o The effect of 21x on the interaction of the a subunit of RNAP with the rrnB
P1 UP
element was determined by evaluating the transcriptional activity of the
promoter in several
E.coli strains carrying a wild type or mutant rrnB Pl promoter fused to a lacZ
reporter on its
chromosome, as a phage monolysogen.
The promoters which were evaluated include a wild type rrnB P1 promoter
2s (RLG3074, SEQ ID NO:15), which has a consensus UP sequence at a distal
site, two mutant
rrnB P1 promoters which have a consensus UP sequence at both proximal and
distal sites
(RLG4192, SEQ ID N0:16 and RLG4174, SEQ ID N0:17), and the "core" rrnB P1
promoter (RLG3097, SEQ ID N0:14), which functions as a negative control and
lacks an UP
sequence and a 21X binding site [Table 8 and Fig. 4A, wherein 21x binding
sites are
3 o indicated as ( )] .
Table 8
UP region Relative
sequence Basal Activity
RLG3097 GACTGCAGTGGTACCTAGGAGG (SEQ ID N0:14)1 X
RLG3074 AG(AAAATTATTTTAAATTT)CCT (SEQ ID NO:15)30 X
RLG4192 GG(AAAATTTTTTTTCAAAA)GTA (SEQ ID N0:16)110
X
RLG4174 TG(AAATTTATTTT)GCGAAAGGG (SEQ ID N0:17)75 X
3 s Figure 4B shows the results of testing the activity of E. coli strains
that carry the
various rrnB P1 promoters fused to a lacZ reporter with 21X.
The promoter activity of RLG3097 (SEQ ID N0:14), which has the "core" sequence
was not affected by 21x.
59
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
E.coli strains that carry rrnB Pl promoters which have a distal UP element
(RLG4174, SEQ ID N0:17) or both proximal and distal UP elements (RLG 3074, SEQ
ID
NO:15 and RLG4192, SEQ ID N0:16), exhibited similarly significant down-
regulation of
reporter gene expression, when treated with 21x.
s The results indicate that targeting RNA polymerase a sites in the E.coli
rrnB P1
promoter with a small DNA-binding molecule, exemplified by 21x, may tie used
to
effectively regulate prokaryotic gene expression in the chromosomal context.
Such targeting studies also suggest that a strong promoter like rrnB Pl, and
engineered variants thereof, can be down-regulated with a sequence
preferential DNA-
1 o binding small molecule when the engineered promoter contains a small
molecule binding
sequence near the protein binding site.
EXAMPLE 5
Regulated Gene Expression Using The Cyclin D1 Promoter
1 s A full-length 1900-by fragment of the human cyclin D 1 promoter
representing
nucleotides -1745 to +155 relative to the transcription start site and a
series of cyclin D1 5'
promoter deletions were constructed and PCR amplified. The -1745 wild-type and
various
site-directed mutants of the cyclin D1 promoter were inserted into the
promoter-less firefly
luciferase plasmid (pGL3-basic) and co-transfected into MCF7 cells human
breast carcinoma
2 o cells, which overexpress cyclin D 1, together with an SV40 promoter driven
Renilla luciferase
control plasmid. Firefly luciferase activity for each construct was normalized
to Renilla
luciferase activity and compared to that of the full-length wild-type promoter
(-1745). The data
are presented as the mean +/- SEM for a minimum of two independent
transfections done in
triplicate. The promoter constructs were assayed in MCF7 cells, a second
cyclin Dl
2 s overexpressing breast carcinoma cell line, ZR75 ; a breast cell line that
expresses cyclin D 1
normally, HMEC; a cyclin D1 overexpressing colon cancer cell line, HCT116; and
a cyclin
D1 overexpressing pancreatic cancer cell line, PANC-1.
The human breast carcinoma cell lines MCF7 and ZR75 were maintained in
DMEM/F12 medium with 10% fetal bovine serum, 10 pg/ml bovine insulin and
antibiotics
30 (penicillin/ streptomycin). The human colon carcinoma cell line HCT116 was
maintained in
McCoy's medium with 10% fetal bovine serum and pen/strep. The human pancreatic
cell line
PANC-1 was maintained in DMEM/F12 with 10% fetal bovine serum and pen/strep.
Human
mammary epithelial cells (HMEC) were maintained in Epithelial Growth Media
supplemented
with bovine pituitary extract (50 pg/ml), hydrocortisone (SOOng/ml), hEGF
(lOng/ml), and
35 insulin (5 pg/ml). All lines were maintained at 37°C, 5% CO2. MCF7,
ZR75, HCT116 and
PANC-1 cells were purchased from the American Type Culture Collection. HMEC
cells were
purchased from Clonetics Corp.
Cells were transiently transfected with LipofectAMINE (GIBCO Life Sciences) in
triplicate in 6-well tissue culture plates (Corning, NY). Equal numbers of
cells (3 x 105/well)
4 o were seeded in each well, 24 hours prior to transfection. Prior to
transfection, cells were
equilibrated in 800 ~l fresh medium (OptiMEM with 5 % FBS and pen/strep).
Cells were
transfected with 5 ~g of reporter plasmid containing a cyclin D 1 promoter
constructs in 200 ~1
transfection buffer. After 4 hours incubation with the transfection solution,
cells were fed with
WO X0/52179 CA 02367037 2001-08-31 PCT/US00/05728
4 ml OptiMEM with 5 % FBS and pen/strep. Cells were harvested 48 hours after
transfection.
Following co-transfection into various cell lines, the cyclin D1 promoter
constructs
containing a mutation of the CRE and/or a mutation of the -30 to -21 region
resulted in a
reduction in luciferase activity, suggesting that both the CRE and the -30 to -
21 sites are
s involved in transcriptional regulation of cyclin Dl basal expression in all
of the overexpressing
cancer cell lines tested, as well as in HMEC cells which express normal levels
of cyclin D 1.
Site-directed mutagenesis of the -30 to -21 promoter region was carried out
and
constructs assayed in MCF7 cells. The assay results indicate that bases
between -30 and -24
(GAGTTTT) are the most important for transcriptional activation from this site
(Table 9).
lU
Table 9 Reporter Activit~yclin D 1 Promoter Constructs
Construct Mutations in -30-21 % Wild Type Activity
region
WT -1745 GAGTTTTGTT 100
-30 -21 -1745 TCTGGGATCC 33 +/- 2.2
-30 -26 -1745 TCTGGTTGTT 43 +/- 3.5
-25 -21 -1745 GAGTTGGCGG 34 +l- 4.7
-30 -28 -1745 TCTTTTTGTT 33 +/- 6.3
-28 -23 -1745 GATGGGATTT 46 +/- 5.1
-23 -21 -1745 GAGTTTTTCC 138 +/- 16.4
by 21x -1745GAGTTTTTTTTAAG 87 +/- 11.4
8 by 21x -1745 GAGTTTTAAAAGAG 85 +/- 7.8
A dimer of netropsin, designated 21x, which has a high affinity for A/T-rich
DNA
sequences and has been shown to footprint a DNA site of about lObp was used to
regulate
cyclin D1 promoter activity. A detailed biochemical characterization of 21x is
provided in co-
owned USSN 06/154,415, expressly incorporated by reference herein.
Oligonucleotide binding sites for the netropsin dimer 21x, were introduced
overlapping
the -30 to -21 region of the CCND1 promoter. In one case, the site was
introduced into the 3'
2o end of the A/T-rich -30 to -21 site, by changing only 2bp (10 by 21x, SEQ
ID N0:37). A
second 21x binding site was constructed by mutating 5 by of the wild-type
promoter sequence
to produce an uninterrupted 8 A/T stretch (8 by 21x, SEQ ID N0:38). Binding of
21x to these
sites was confirmed using a hybridization stabilization assay, as detailed
herein and described in
co-owned application USSN 09/151,890 and USSN 09/393,783, incorporated herein
by
2s reference. Both 21x site-containing constructs were cloned in the context
of the -1745 cyclin
Dl promoter in pGL3 basic, transfected into MCF7 cells and demonstrated to
retain high levels
of promoter activity in MCF7 cells in the absence of 21x (85 % and 87 % of
wild-type promoter
activity respectively).
When transiently transfected MCF7 cells were treated with 0, 1 or 10 pM 21x
and
3 o assayed after 48 hr, activity of the wild-type cyclin D 1 promoter
constructs was unaffected by
21x, activity of the -30 to -21 mutant construct was approximately 25% of wild
type and
unaffected by 21x treatment, while both the 8 by 21x (SEQ ID N0:38) and 10 by
21x (SEQ ID
N0:37) constructs showed reduced promoter activity at 1 ~M 21x and levels as
low as those of
61
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
the -30 to -21 mutant construct at 10 ~M 21x (Fig. 12).
The results of luciferase expression assays in mammalian MCF7 cells indicate
that 21x
treatment is effective to specifically lower cyclin D1 promoter activity 4-
fold when a 21x-
binding site is present overlapping the -30 to -21 transcriptional activator
DNA response site,
s while promoter constructs lacking the 21x sites were unaffected (Fig. 12)..
The results show that it is possible to specifically down-regulate
overexpressed
endogenous cyclin D1 in tumor cells by developing a DNA-binding compound with
specificity
for a regulatory sequence of the promoter.
1 o EXAMPLE 6
Regulated Gene Expression Using the HBV core Promoter
A luciferase reporter construct was constructed with a linearized full-length
copy of the
HBV genome, with the core promoter positioned immediately upstream and driving
the
expression of the reporter. Mutagenic primers containing blocks of 15
nucleotides of targeted
is sequence mutation were designed to generate a series of linker scanner
mutant promoter
reporter clones using either a MorphTM (5'Prime to 3'Prime, Boulder, CO) or a
QuikChangeT"'
(Stratagene, La Jolla, CA) mutagenesis protocol.
Targeted segments of the promoter found to be resistant to mutagenesis were
further
sub-divided into smaller blocks of mutations consisting of 7-8 nucleotides.
This series of linker
2 o scanner clones span the entire length of the core promoter segment.
Mutagenic primers were
also used to construct site-directed mutant constructs of known transcription
factor binding sites
including the hepatocyte nuclear factor sites, HNF3 and HNF4.
To determine potential critical regulatory elements in the core promoter,
linker scanner
analysis was performed using the series of systemic mutation clones
constructed. Each linker
2 s scanner mutant construct was evaluated for promoter activity in transient
transfection
experiments based on luciferase reporter activity in the hepatoma-derived cell
lines HepG2 and
HuH7. The HBV stably-transfected cell lines, 22.1.5 and HepAD38, were also
used in the
linker scanner analysis. An increase or decrease in relative luciferase
reporter activity relative
to the wild type indicates potential presence of control elements critical to
regulation of gene
3 o transcription.
Three regions of interest were identified by linker scanning analysis. All 3
regions
align with cis-elements previously reported in the literature. One region
contains sequences
corresponding to a HNF4 transcription factor binding site (SEQ ID NO:50). A
second region
contains sequences corresponding to a proximal HNF3 transcription factor
binding site (SEQ
35 ID N0:48). Both of these protein factor sites have been described as
important activation
elements for the HBV core promoter. Mutation of a third region abolished the
wild type
TATA box sequence (SEQ ID NO:51) of the promoter. A second HNF3 site (Distal
HNF3-1)
has been reported, however, mutation of the distal HNF3 site did not show any
adverse effects
in promoter activity (Table 10).
62
WO X0/52179 CA 02367037 2001-08-31 pCT/US00/05728
Table 10. Reporter Analysis of Site-Directed Mutants of HNF3
and HNF4 Sites of the HBV Core Promoter.
Nucleotide CoordinatesSite-Directed Percent Wild
(HBV ayw Strain) Mutant Type
Sequence HepAD38
Distal HNF3 1680 - 1691 CCAGGGCi:CCGA 102
~
Proximal HNF31715 - 1726 GCCGCGGTCTGT 33
HNF4 ~ 1661 - 1672 CGTCCGCGGTGA 29
~ ~
Following identification of the TATA box and the HNF4 and proximal HNF3 sites
as
the control elements most critical for core promoter activity, transcriptional
activation as a
result of the binding of the TATA binding protein (TBP) and the HNF
transcription factors was
further studied. It will be appreciated that failure of these protein factors
to bind would result
in down-regulation of the promoter.
1 o Small DNA-binding compounds were utilized to test their ability to alter
the
transcription level from wild type and engineered HBV core promoters, either
by interference
and/or displacement of protein factor binding to its cognate nucleotide
binding sequences. The
nucleotide composition at the core TATA box contains a run of seven (7) A and
T bases that
could serve as a binding site for the compound 21x, which exhibits a binding
preference of
A/T-rich sequences. As shown in Table 11, 21x down-regulated the core wild
type promoter
by approximately 50% in transient transfection assays at concentrations of 0.5-
1 ~M. An
engineered promoter construct, TATA2IxR (SEQ ID N0:52) was prepared containing
an
introduced 21x binding site located adjacent to and overlapping the TATA box
sequence. The
down-regulating effects were pronounced for cells transfected with the
engineered TATA2IxR
2 o construct, for which the reporter gene activity decreased by 4-5 fold,
consistent with the
premise that 21x may bind with higher affinity to the A/T-rich binding
sequence present in
TATA2IxR than to the core TATA box native sequence, leading to enhanced
interference
and/or displacement of TBP binding to the DNA.
A promoter construct, TATAmut (SEQ ID N0:53), with the TATA box sequence
2 5 mutated in a manner to abolish TBP binding exhibited a low level of
transcription and was not
responsive to 21x treatment. Another mutant construct, 3'TATAmut (SEQ ID
N0:54), with a
sequence alteration resulting in a shorter run of A/T nucleotides downstream
of the TATA box
also showed no effects upon 21x treatment. The DNA-binding compound (21x) is
shown to be
capable of altering levels of gene transcription through its interaction with
a basal transcription
3 o factor.
63
WO ~~/52179 CA 02367037 2001-08-31 pCT/US00/05728
Table 11. 21x Down-regulates ExQression of the HBV Core Promoter Through the
TATA Box
ReporterSequence Percent
Wild
Type
Construct Promoter
Activit
No Treatment
Treatmentwith
1 ~M
21x
Wild TACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACC100 60
type2
AGCACCATG
TATAm~~3TACTAGGATTAGTGCITAAGCCCTTGGTCTGCGCACCA15 13
GCACCATG
3'TATAm~,4TACTAGGAGGCTGTAGGCATAAAGCTCGAGTATACAA31 36
GCACCATG
TATAZ~XRSTACTAGGAGGCTGTAGGCATAAATTAGTCTGCGCACC98 21
AGCACCATG
Another DNA-binding compound, GL046732, was demonstrated to be effective in
the regulation of promoter activity of HBV core promoter constructs with
engineered
compound binding sequences. Three types of potential compound binding
sequences were
designed and position-cloned to be adjacent and overlapping transcription
factor recognition
sites. The general designs of the three different types of potential compound
binding
sequences are (dsl) two core sequences of 5 A/T nucleotides on either end with
a center
to block of 3 G/C nucleotides, (ds2) a run of 12 to 13 A/T nucleotides, and
(ds3) a run of 8 to 9
A/T nucleotides. Exemplary promoter constructs include the following:
TATARdsI (SEQ ID NO:55)
TACTAGGAGGCTGTAGGCATAAATGCGTAAAAGCACCAGCACCATGCAAC
TATARds2 (SEQ ID N0:56)
TACTAGGAGGCTGTAGGCATAAATTAAAAAACGCACCAGCACCATGCAAC
TATARds3 (SEQ ID N0:57)
2o TACTAGGAGGCTGTAGGCATAAATTAATCCGCGCACCAGCACCATGCAAC
As shown in Table 12 and Figure 13, the DNA-binding compound GL046732 used
to treat HepG2 cells transfected with wild type and engineered core promoter
constructs,
preferentially down-regulated the promoter activity of the TATARdsl clone (SEQ
ID NO:55)
2 5 in a dosage-dependent manner resulting in a 4 fold reduction in promoter
activity at the 40
~M concentration. The promoter activity of clone TATARds3 (SEQ ID N0:57) was
also
affected, but the level of down-regulation observed was less of that seen for
the "ds 1 "
2 Wild type=wild type core promoter (SEQ ID N0:51)
' TATAmuc=mutant construct with TATA (SEQ ID N0:53)
4 3'TATAm"t=mutant construct with 15 nucleotides downstream from TATA
box mutated (SEQ ID N0:54)
5 TATAzIXR=construct with engineered 21x site on right side of TATA (SEQ
ID N0:52)
64
WO UO/52179 cA 02367037 2001-08-31 PCT/US~O/05728
sequence. The core promoter activity of the wild type construct remained
relatively
unaffected.
Table 12. Effects of GL046732 on Promoter ActivitX of Core Promoter Constructs
s Containing Engineered Drub-Bindin~ySites
Reporter ConstructPercent of
no Drug Control
Wild type 1 pM GL046732 10 p.M GL046732 40 pM GL046732
TATARds 1 114 67 93
TATARds2 56 39 25
TATARds3 71 62 65
102 73 39
Similarly, dsl, ds2, and ds3 sequences were designed and placed adjacent and
overlapping the proximal HNF3 site. Exemplary engineered sequences include the
to following:
HNF3Rds1 (SEQ ID N0:58)
ACCTTGAGGCATACTTCAAAGACTGTTGATTTAGCGAATAAGAGGAGTTGG
15 HNF3Rds2 (SEQ ID N0:59)
ACCTTGAGGCATACTTCAAAGACTGTTTATTTTAATAACGGGAGGAGTTGG
HNF3Rds3 (SEQ ID N0:60)
ACCTTGAGGCATACTTCAAAGACTGTTTATTTAAGGACTGGGAGGAGTTGG
Oligonucleotides containing these HNF3 engineered sequences were used along
with
a wild type oligomer in an in vitro gel mobility shift assay, and found to
bind the HNF3
transcription factor specifically. GL046732 was then tested for its ability to
bind to the
engineered sequences and either cause displacement of HNF3 or prevent the
transcription
2s factor from binding. GL046732 was found to be most effective in
displacement of protein
bound band in the gel shift assay with the same drug sequence (dsl). The ECSO
value for
protein displacement was determined to be in the concentration range of 300-
800 nM.
Similar to the transfection results obtained from the TATAds constructs,
GL046732 was also
slightly effective in displacement of HNF3 with the ds3 type sequence, while
having no
3 o effects on the wild type sequence.
These results, taken together, indicate that a compound binding site may be
engineered into a promoter and thereby serves as a means for regulated gene
expression of a
coding sequence operably linked to it.
WO 00/52179 CA 02367037 2001-08-31 PCT/US00/05728
SEQUENCE LISTING TABLE
(all oligonucleotides shown as single stranded in 5' to 3' direction)
Description SEQ
ID
NO
UL9 DNA res onse element CGTTCGCACTT (11 b ) 1
GAL4 DNA res once element CGGAGTACTGTCCTCCG (i 7 b ) 2
ZFHD1 DNA res nse element TAATTANGGGNG (12 b ) 3
NF-KB p65 Genbank Accession Number HUMP65NFKB 4
tet0 DNA res nse element TCCCTATCAGTGATAGAGA (19 b )
lac0 DNA res once element CTTAACACTCG:CGAGTGTTAAG (22 b 6
)
Ecd sone rece for RG(GT)TCANTGA(CA)CY (15 b ) 7
VP16: as 413-489 reference or se uence 8
VP64: tetramer of as 437-447 of VP16
KRAB: as 1-97 reference or se uence 10
Mad: as 1-36 reference or se uence 11
Sequence of rrnB P1 promoter: from -66 to +50 12
CGCGGTCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGAATAACTCCCTATAATG
CGCCACCACTGACACGGAACAACGGCAAACACGCCGCCGGGTCAGCGGGGTTCTCCT
rrnB P1 romoter UP element AGAAAATTATTTTAAATTTCCT 13
RLG3097 (core) GACTGCAGTGGTACCTAGGAGG 14
RLG3074 (WILD TYPE) AG(AAAATTATTTTAAATTT)CCT 15
RLG4192 GG(AAAATTTTTTTTCAAAA)GTA 16
RLG4174 TG(AAATTTATTTT)GCGAAAGGG 17
modified UL-9DNA res onse se uence TGTTCGCACTT 18
modified UL-9 DNA response sequence (YK 202LX, 52-mer) 19
CATGGACG CCACTG AGCCGtttt TGTTCGCACTT GAGGCGAGTCGATGCACC
modified UL-9 DNA response sequence (YK 202RX-A, 54-mer) 20
CATGGACG CCACTG AGCCG TGTTCGCACTT ttttttGAGGCGAGTCGATGCACC
modified UL-9 DNA response sequence (YK 202RX, 58-mer) 21
CATGGACG CCACTG
AGCCGTTTT TGTTCGCACTT ttttttGAGGCGAGTCGATGCACC
MEF C(TTAAAAATAA)C 22
780BP (TTGAAAAATCAA)CGCT 23
UL9 (modified) (ttttTGTT)CGCAC(TTtttttt) 24
NFkB (modified) (tttttGGG[AtTTT)CCttttt] 25
LacO (modified) (aaaaAATT)GTGAGCGCTCAC(AATTtttt) 26
NtBBFl ( lant tissue-s ecific transcri tion factor) ACTTTA27
DRE (plant element identified in the promoter region of 28
the rd29A gene associated with
deh dration and cold-induced ene ex ression) TACCGACAT
NF-kB DNA res nse se uence from I k romoter: GGGACTTTCC 29
NF-kB DNA res onse se uence from IL-6 romoter: GGGATTTTCC 30
JF 101 (NFKB 1 ) (SOmer) (right side) 31
c ac c t ctc a TTAACGGGACTTTCCAAaaa c atc act actc
JF 102 (NFKB2)(60mer)(right side) 32
c ac c t ctc a TTAACGGGAtTTTCCAAaaa ceatc act Qactc
JF 103 (NFKB3)(60mer) (both sides) 33
c ac c t ctc a aaattGGGAtTTTCCAAaaa c atc act actc
LacI aaaaAATTGTGAGCGCTCACAATTmt 34
LacI ttttttTTGTGAGCGGATAACAAaa 35
Cyclin D1 -30-21 TCTGGGATCC 36
C clin D1 lOb 21x GAGTTTTTTTTAAG 37
C clin D1 8b 21x GAGTTTTAAAAGAG 38 ~~
NFKB p50 Genbank Accession Number HUMNFKB34 3g
66
WO 00/52179 CA 02367037 2001-08-31 pCT/US00/05728
Description SEQ
ID
NO
NFKB pMC3 (NheI to BgII) 40
GCTAGCCCCGCCCCGTTGACGCAAATGGGCGGTAC~GCGTGTACGGTGGGAGGTTTATATAAGCAGAG
CTCGTTTAGTGAACCGTCAGATCAGATCT
NFKB 2MC5 (NheI to BgII) 41
TCCAAAAAGCCGP ~~1TTGGGATTTTCCAAAAACCGCCGATCGCCC
GCTAGCGCCCAAATTGGGATTT
_
GCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTATATAAGCAGAGCTCGTTTAG
TGAACCGTCAGATCAGATCT
NFKB 4MC 1 (MIuII to BgII) 42
ACGCGTGCCCAAATTGGGATTTTCCAAAAAGCCGAAATTGGGATTTTCCAAAAACCGCGCTAGCGCC
CAAATTGGGATTTTCCAAAAAGCCGAAATTGGGA':'TTTCCAAAAACCGCCGATCGCCCGCCCCGTTG
ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGG':'TTATATAAGCAGAGCTCGTTTAGTGAACCGTC
AGATCAGATCT
NFKB BKMC1 (NheI to BgII) 43
GCTAGCCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAG
CTCGTTTAGTGAACCGTCAGATCAGATCT
NFKB BK2MC5 (NheI to BgII) 44
GCTAGCGCCCAGGTCGGGATTTTCCGAGGAGCCGAGGTCGGGATTTTCCGAGGACCGCCGATCGCCC
GCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAG
TGAACCGTCAGATCAGATCT
BK2MC12 (NheI to BgII) 45
GCTAGCGCCCAGGTCGGGATTTTCCGAGGAGCCGAGGTCGGGATTTTCCGAGGACCGCCGATCGCCC
GCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAG
TGAACCGTCAGATCAGATCT
NFKB SWCMV 46
NFKB MTCMV 47
NFKB BKCMV 48
HBV core roximal, HNF3-2 bindin site (GACTGTTTGTTT) 49
HBV core HNF4 bindin site (AGGACTCTTGGA) 50
HBV core WT 51
TACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGCACCATG
HBV core TATA2IxR 52
TACTAGGAGGCTGTAGGCATAAATTAGTCTGCGCACCAGCACCATG
HBV core TATAmut 53
(TACTAGGATTAGTGCITAAGCCCTTGGTCTGCGCACCAGCACCATG)
HBV core 3'TATAmut 54
(TACTAGGAGGCTGTAGGCATAAAGCTCGAGTATA CAA CGCACCATG)
HBV core TATARdsl 55
TACTAGGAGGCTGTAGGCATAAATGCGTAAAAGCACCAGCACCATGCAAC
HBV core TATARds2 56
TACTAGGAGGCTGTAGGCATAAATTAAAAAACGCACCAGCACCATGCAAC
HBV core TATARds3
TACTAGGAGGCTGTAGGCATAAATTAATCCGCGCACCAGCACCATGCAAC
HNF3RdsIACCTTGAGGCATACTTCAAAGACTGTTGATTTAGCGAATAAGAGGAGTTGG58
HNF3Rds2ACCTTGAGGCATACTTCAAAGACTGTTTATTTTAATAACGGGAGGAGTTGG59
HNF3Rds3ACCTTGAGGCATACTTCAAAGACTGTTTATTTAAGGACTGGGAGGAGTTGG60
ACTULVP activator construct-Fi s 14A/B 61
ACT ULKRAB re ressor construct-Fi s 15A/B 62
67
